Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf ·...
Transcript of Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf ·...
![Page 1: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/1.jpg)
Molecular Tools for Nucleic Acid Analysis
Deirdre O’ Meara
Doctoral Thesis
Department of BiotechnologyRoyal Institute of Technology
Stockholm 2001
![Page 2: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/2.jpg)
© Deirdre O’ Meara
Department of BiotechnologyRoyal Institute of Technology, KTHSCFAB106 91 StockholmSweden
Printed at Universitetsservice US ABBox 700 14100 44 Stockholm, Sweden
ISBN 91-7283-161-8
![Page 3: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/3.jpg)
Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis.Department of Biotechnology, Royal Institute of Technology, KTH, SCFAB, Stockholm, Sweden.
ISBN 91-7283-161-8
Abstract
Nucleic acid technology has assumed an essential role in various areas of in vitro diagnosticsranging from infectious disease diagnosis to human genetics. An important requirement of suchmolecular methods is that they achieve high sensitivity and specificity with a fast turnaround timein a cost-effective manner. To this end, in this thesis we have focused on the development ofsensitive nucleic acid strategies that facilitate automation and high-throughput analysis.
The success of nucleic acid diagnostics in the clinical setting depends heavily on the method usedfor purification of the nucleic acid target from biological samples. Here we have focused ondeveloping strategies for hybridisation capture of such templates. Using biosensor technology weobserved that the hybridisation efficiency could be improved using contiguous oligonucleotideprobes which acted co-operatively. By immobilising one of the probes and annealing the secondprobe in solution, we achieved a marked increase in target capture due to a base stacking effectbetween nicked oligonucleotides and/or due to the opening up of secondary structure. Such co-operatively interacting modular probes were then combined with bio-magnetic bead technology todevelop a capture system for the extraction of hepatitis C RNA from serum. Viral capture withsuch co-operatively interacting probes extracted 2-fold more target as capture with only a singleprobe achieving a similar sensitivity to the conventional extraction protocol. An analogousstrategy was designed to enrich for sequencing products prior to gel electrophoresis removingsequencing reagents and template DNA which interfere with the separation and detection ofsequencing ladders, especially in the case of capillary gel electrophoresis. This protocol facilitateshigh throughput clean-up of cycle sequencing reactions resulting in accurate sequence data at alow cost, which is a pre-requisite for large-scale genome sequencing products.
Currently, a large effort is directed towards differential sequencing to identify mutations orpolymorphisms both in the clinical laboratory and in medical genetics. Inexpensive, highthroughput methods are therefore required to rapidly screen a target nucleic acid for sequencebased changes. In the clinical setting, sequence analysis of human immunodeficiency virus (HIV-1) is used to determine the presence of drug resistance mutations. Here we describe abioluminometric pyrosequencing approach to rapidly screen for the presence of drug resistancemutations in the protease gene of HIV-1. This sequencing strategy can analyse the protease geneof HIV-1 from eight patients in less than an hour and such non-gel based approaches should beuseful in the future in a clinical setting for rapid, robust mutation detection.
Microarray technology facilitates large-scale mutation/polymorphism detection and here wedeveloped a microarray based single nucleotide polymorphism (SNP) genotyping strategy basedon apyrase mediated allele specific extension (AMASE). AMASE exploits the fact thatmismatched primers exhibit slower reaction kinetics than perfectly matched primers by includinga nucleotide degrading enzyme (apyrase) which results in degradation of the nucleotides beforethe mismatched primer can be extended. We have successfully typed 200 genotypes (14% wereincorrect without apyrase) by AMASE which cluster into three distinct groups representing thethree possible genotypes. In the future, AMASE on DNA microarrays should facilitate associationstudies where an accuracy >99% is required.
Keywords: nucleic acid capture, modular probes, biosensor, bio-magnetic separation, hepatitis C,sequencing, pyrosequencing, mutation detection, HIV-1, drug resistance, SNP, allele-specificextension, apyrase, genotyping.
© Deirdre O’ Meara, 2001
![Page 4: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/4.jpg)
LIST OF PUBLICATIONS
This thesis is based on the following papers, which in the text will be referred to bytheir Roman numerals:
I. O’ Meara D., Nilsson P., Nygren P.Å., Uhlén M. and Lundeberg J. 1998.Capture of single-stranded DNA assisted by oligonucleotide modules.Analytical Biochemistry 255, 195-203.
II. Nilsson P., O’ Meara D., Edebratt F., Persson B., Uhlén M., Lundeberg, J.and Nygren P.Å. 1999. Quantitative investigation of the modular primer effectfor DNA and peptide nucleic acid hexamers. Analytical Biochemistry 269,155-161
III. O’ Meara D., Yun Z., Sönnerborg A. and Lundeberg J. 1998. Cooperativeoligonucleotides mediating direct capture of hepatitis C virus RNA fromserum. Journal of Clinical Microbiology 36, 2454-2459.
IV. Blomstergren A., O’ Meara D., Lukacs M., Uhlén M. and Lundeberg J. 2000.Cooperative oligonucleotides in purification of cycle sequencing projects.Biotechniques 29, 352-363.
V. O’ Meara D., Wilbe K, Letiner T, Hejdeman B., Albert J and Lundeberg J.2001. Monitoring resistance to human immunodeficiency virus type 1protease inhibitors by pyrosequencing. Journal of Clinical Microbiology 39,464-473.
VI. O’ Meara D., Ahmadian A., Odeberg J and Lundeberg J. SNP typing bydiscriminatory allele extension on DNA microarrays. Submitted.
![Page 5: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/5.jpg)
Table of contents
Introduction
1 In vitro amplification of nucleic acids..............................................................1
1.1 Sample preparation.....................................................................................2
1.2 Amplification .............................................................................................31.2.1 Target amplification............................................................................41.2.2 Probe amplification.............................................................................51.2.3 Signal amplification............................................................................6
1.3 Analysis and detection................................................................................71.3.1 Heterogeneous formats .......................................................................81.3.2 Homogeneous formats ...................................................................... 12
2 Nucleic acid sequencing .................................................................................13
2.1 Chain terminating techniques ................................................................... 142.1.1 Sanger sequencing ............................................................................ 14
2.2 Separation and detection........................................................................... 162.2.1 Automated slab-based sequencers ..................................................... 162.2.2 Capillary electrophoresis................................................................... 162.2.3 Ultrathin gel electrophoresis ............................................................. 162.2.4 Microfabricated DNA sequencers ..................................................... 17
2.3 Alternative sequencing strategies.............................................................. 172.3.1 Sequencing by hybridisation ............................................................. 172.3.2 Allele-specific extension................................................................... 182.3.3 Mini-sequencing ............................................................................... 192.3.4 Mass spectrometry ............................................................................ 21
3 Chip-based analysis........................................................................................22
3.1 DNA Biosensors....................................................................................... 233.1.1 Ligand immobilisation ...................................................................... 233.1.2 Signal detection ................................................................................ 24
3.2 DNA microarrays ..................................................................................... 253.2.1 Array platforms ................................................................................ 263.2.2 Hybridisation and detection .............................................................. 29
![Page 6: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/6.jpg)
Present Investigation
4 Nucleic acid hybridisation using modular primers.......................................31
4.1 Investigation of the modular primer effect using biosensor
technology (I, II) ...................................................................................... 32
4.2 Development of capture protocols using modular primers (III, IV) ........... 35
5 Analysis of mutations and polymorphisms ...................................................41
5.1 Monitoring drug resistance mutations in HIV-1 by pyrosequencing (V).... 42
5.2 SNP typing on DNA microarrays (VI) ...................................................... 45
6 Concluding remarks.......................................................................................50
Abbreviations.........................................................................................................51
Acknowledgements ................................................................................................52
References ..............................................................................................................54
Original papers (I-VI)
![Page 7: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/7.jpg)
Molecular Tools for Nucleic Acid Analysis
1
Introduction
Historical perspective
One of the most important advances in the field of biology in the twentieth century
has been the understanding that DNA is the carrier of genetic information. However
until the 1940’s, most biologists believed that proteins were the chief carriers of
hereditary material until the primary experiments by Avery and co-workers in 1944
showed that DNA was the “transforming factor” that conferred virulence upon
nonvirulent pneumococci (Avery et al., 1944). The landmark paper in 1953 by
Watson and Crick which correctly proposed the double-stranded structure of DNA
lead to an understanding of gene function in molecular terms and marked the
beginning of the molecular revolution (Watson and Crick, 1953). Since then
important milestones in nucleic acid based technology such as nucleic acid
hybridisation, DNA sequencing reactions, the polymerase chain reaction and
automated fluorescent DNA sequencers have made it possible to streamline and
automate most of the processes required for nucleic acid analysis. These technologies
have led to the late twentieth/early twenty-first century being called the “Genomic
Era” which has been characterised by developments occurring at a tremendous pace
allowing whole genomes to be sequenced effectively (Lee and Lee, 2000). Indeed
these technologies have led to the release of the human genome in February 2001,
four years ahead of schedule. Advances in nucleic acid analysis together with
publication of whole genome sequence data for a number of organisms have had
widespread applications and in this thesis I will outline three nucleic acid/molecular
tools (in vitro amplification, sequencing and DNA chip hybridisation) that have had a
major impact in the field of diagnostics and genome sequencing (Figure 1).
1 In vitro amplification of nucleic acids
The ability to specifically amplify very small amounts of nucleic acid has made
amplification techniques invaluable tools in areas such as diagnostics, genetic
analysis, forensics and environmental testing. The amplification process itself
constitutes only part of the complete analysis, as a sample preparation step must
usually be performed prior to amplification, which is followed by a detection step.
![Page 8: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/8.jpg)
D. O’ Meara
2
Nucleic acid
Amplification
Detection
(Qualitative, Quantitative) Sequencing
(Whole genomes, Expression profiling, Diagnostics)
Chip-based analysis
(Hybridisation kinetics, Expression analysis, Large scale diagnostics)
Figure 1. Nucleic acid molecular tools and their applications.
1.1 Sample preparation
The success of nucleic acid amplification depends greatly on the method used for
purification of nucleic acids. The fundamental goals of sample preparation include,
release of target, stabilisation from degradation, removal of amplification inhibitors
and concentration and re-suspension of target in an amplification compatible buffer.
The two main methods of sample preparation involve lysis or target capture or a
combination thereof. Simple lysis methods typically use detergents such as sodium
dodecyl sulphate or Triton X-100 and chaotropes such as guanidinium isothiocyanate
and proteases (Greenfield and White, 1993). If the number of infectious organisms is
low, it is frequently necessary to remove amplification inhibitors by additional
phenol-chloroform extraction steps and to concentrate target by alcohol precipitation.
Target capture involves the binding of nucleic acids in chaotropic solutions to
magnetic particles (coated with oligonucleotide dT or a specific probe), silica or glass
matrixes (Greenfield and White, 1993). Impurities and amplification inhibitors are
removed by magnetic separation, centrifugation or filtration and the nucleic acids are
eluted in an aqueous environment compatible with amplification. Target capture
offers the advantage of automation, universality for all specimens, concentration of
target and removal of inhibitors without the use of hazardous reagents. There are a
number of commercially available sample-extraction kits, many of which now exist in
![Page 9: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/9.jpg)
Molecular Tools for Nucleic Acid Analysis
3
an automated version capable of processing up to 96 extractions in a few hours from a
variety of samples such as serum, plasma, blood, cells, sputum, tissue or cerebrospinal
fluid (Heal, 2000). Whole organisms can also be captured by immunomagnetic
separation (IMS) (Olsvik et al., 1994) and following this enrichment step, the cell is
lysed and nucleic acid released. Sample preparation can also be integrated with
amplification and detection on a microfluidic platform in the so-called “lab-on-a-
chip” configuration (Waters et al., 1998; Anderson et al., 2000). Such miniaturisation
of the analytical instrument will allow transport of the laboratory to the sample
source, enabling point-of-care medical diagnostics and environmental testing.
1.2 Amplification
Amplification at the molecular level can be used to increase the concentration of a
specific target or probe or it can be used to increase the number of detection signals
that will arise from each target (Table 1).
Table 1. Properties of various nucleic acid amplification technologies (modified from Schweitzer andKingsmore, 2001).
Property PCR LCR NASBA bDNA Invader RCA
DNA target amplification √ x x x x Limited
RNA target amplification √ x √ x x Limited
Probe amplification x √ x √ x √
Signal amplification x x x √ √ x
Multiplexing Little Little Little x x √
Isothermal x x √ √ √ √
Amplification on microarrays x x x x √ √
Sensitivity (copies) <10 100 100 500 600 1
Range (logs) 5 3 5 3 4 7
Specificity (allele
discrimination factor)
50 5000 50 10 3000 1x105
(PCR;polymerase chain reaction, LCR;ligase chain reaction, NASBA;nucleic acid sequence basedamplification, RCA;rolling-circle amplification).
![Page 10: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/10.jpg)
D. O’ Meara
4
1.2.1 Target amplification
The most sensitive molecular techniques use an enzymatic step to amplify the target
nucleic acid before analysis of the specific sequence. A variety of target amplification
techniques have been developed but the polymerase chain reaction (PCR), developed
by Kary Mullis in 1983, is the most widely used. The PCR is based on the ability of
DNA polymerase to copy a strand of DNA by elongation of complementary strands
initiated from a pair of oligonucleotide primers (Saiki et al., 1985; Mullis and
Faloona, 1987). During PCR, the amplification goes through an exponential phase
allowing target amplification of one billion-fold or more. The PCR has been
systemically improved in many ways since its discovery and a number of these
modifications are listed in Table 2.
Table 2. Modifications of PCR
Modification References
Hot-start (Chou et al., 1992)
Nested-PCR (Haqqi et al., 1988) (Mullis and Faloona, 1987)
Touchdown PCR (Don et al., 1991)
RT-PCR (Erlich et al., 1991)
Multiplex PCR (Chamberlain et al., 1988)
Asymmetric PCR (Innis et al., 1988; Shyamala and Ames, 1989)
Real-time PCR (Holland et al., 1991; Tyagi and Kramer, 1996; Nazarenko et
al., 1997; Wittwer et al., 1997a; Whitcombe et al., 1999)
Miniaturisation (Wittwer et al., 1997a; Kopp et al., 1998)
Two important determinants of PCR performance are primer design and annealing
temperature and a number of computer applications are available to assist with primer
construction. Guidelines for the development of new PCR assays and information on
primer design software have recently been reviewed (Johnson, 2000).
The extreme sensitivity of PCR also results in a potential risk for false-positive
signals due to contamination. A number of suggestions exist to minimise this risk
(Kwok and Higuchi, 1989; Fredricks and Relman, 1999) and inclusion of various
controls will help identify any potential false-positive results. If PCR is being used for
diagnostic purposes, then a number of process controls must be incorporated to ensure
that negative results are indeed due to absence of detectable target. Commercial
![Page 11: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/11.jpg)
Molecular Tools for Nucleic Acid Analysis
5
systems for PCR based detection of bacterial (e.g. Chylamidia trachomatis and
Mycobacterium tuberculosis) and viral targets (e.g. hepatitis C virus [HCV] and
human immunodeficiency virus [HIV-1]) are manufactured by Roche Molecular
Systems. Another DNA target amplification assay that has been commercialised is the
strand displacement assay (SDA) (Walker et al., 1992).
A typical PCR involves 25-35 cycles usually taking two-three hours and is often the
rate-limiting step in nucleic acid analysis. The advent of miniaturisation has
facilitated improvements in PCR instrumentation allowing a reduction in sample
volume, reduced reagent cost, shorter cycling times and higher-throughput, with
automation offering the possibility of “hands-free” analysis. Reaction times have been
reduced to 90 seconds by adapting PCR to run in a continuous flow system on a chip
(Kopp et al., 1998), while real-time PCR has been performed in a rapid air thermal
cycler in 10-20 minutes (Wittwer et al., 1997a). Affymetrix have also developed a
miniature device that integrates sample extraction, nested PCR and mutation detection
of HIV-1 by array hybridisation (Anderson et al., 2000).
Transcription based amplification systems such as self sustained replication (3SR)
(Guatelli et al., 1990) and nucleic acid sequence based analysis (NASBA) (Compton,
1991) are alternative target amplification strategies, which use RNA polymerase,
reverse transcriptase (RT) and RNase H to amplify RNA. These are isothermal
techniques that are technically less robust than PCR but are useful when selective
amplification of RNA is desired. A kit for HIV-1 and cytomegalovirus (CMV)
detection based on NASBA is commercially available (Organon Teknika).
1.2.2 Probe amplification
The ligase chain reaction (LCR) (Barany, 1991) which is based on the
oligonucleotide-ligation assay (OLA) (Landegren et al., 1988) is a probe
amplification technique that uses DNA ligase to join two probe ends that are
juxtaposed on the target DNA. Repeating the process results in a exponential
accumulation of ligation products, which can be detected using the functional groups
attached to the probes. A modified technique called Gapped LCR, which uses a DNA
polymerase and a ligase reduces the risk of false-positive results from blunt-end
ligation (Ayyadevara et al., 2000). Since only the probe is amplified, LCR is limited
to applications where identification of a signature nucleotide sequence in the sample
is sufficient for target identification. However, the method is quite sensitive to
![Page 12: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/12.jpg)
D. O’ Meara
6
mismatches and has been useful in detection of point mutations at the ligation site
(Landegren et al., 1988). Padlock probes are a variant of the ligation principle, where
if there is complete homology to the target, the outer ends of a linear probe are ligated
to form a circularised probe intertwined with the target DNA (Nilsson et al., 1994).
This technology is compatible with rolling-circle amplification (RCA) systems,
allowing selective detection of the ligated circles (Baner et al., 1998) (Figure 2). This
new amplification strategy allows multiplex amplification of circular probes and
facilitates genotyping through allele-specific ligation of open circular probes (Lizardi
et al., 1998; Faruqi et al., 2001). Immobilised linear allele-specific ligated probes can
also be used to prime RCA allowing the allelic status of the target to be determined
(Lizardi et al., 1998). A number of other probe amplification techniques also exist and
include QB replicase (Kramer and Lizardi, 1989) and cycling probe technology (CPT)
(Duck et al., 1990).
s/s DNA target
Open circle probe Ligated padlock
DNA polymerase
Ligated padlock
s/s DNA generated by rolling circle
RCAprimer
s/s targets/s DNA target
Figure 2. Probe circularisation by ligation and amplification by RCA. A padlock probe is hybridised totarget DNA and if perfectly matched is ligated by DNA ligase. A primer complementary to the padlockprobe then initiates replication of the probe via a rolling-circle mechanism using a strand displacingDNA polymerase. This generates a single-strand product containing many copies in tandem of thesequence complementary to the circular probe. To achieve further amplification, highly branched RCA(HRCA) can be carried out by adding a second primer which initiates copying of the RCA product.
1.2.3 Signal amplification
An alternative approach to target and probe amplification is to amplify the signal
generated by detection of the target sequence. Branched DNA signal amplification
(bDNA) was developed by Chiron Corporation and uses multiple DNA probes, first
for capture and subsequently for increasing the number of potential binding sites from
which the reporter signal is eventually generated (Urdea et al., 1991). The signal
generated is in proportion to the amount of target and thus DNA quantification can be
![Page 13: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/13.jpg)
Molecular Tools for Nucleic Acid Analysis
7
determined from a calibration curve. This approach is less sensitive than target
amplification but has several advantages; the risk of contamination is minimal and
bDNA assays are capable of detecting a broader range of viral genotypes than PCR
based assays, which have restricted specificity due to their limited number of target
sequences. This is potentially a problem when detecting viral RNA genomes which
can show high sequence heterogeneity (Hawkins et al., 1997).
Another signal amplification technology is the Invader assay, which involves multiple
cleavage cycles of an overlapping probe complex (Figure 3). This cleavage results in
the release of a signal probe that is either detected directly (Lyamichev et al., 1999) or
triggers cleavage of a labelled probe releasing 107 fluourescent events for each target
molecule (Hall et al., 2000). The endonuclease that performs cleavage is sensitive to
the presence of a mismatch at the overlapping site which is utilised for single
nucleotide polymorphism (SNP) typing and mutation detection (Hessner et al., 2000).
5'
5' 3'
Flap
Cleavage site
Primary probeInvader probe
Target3' 5'
F
Cleavage site
Q
Cleaved flapFRET probe
Flap/FRET bridging probe
Figure 3. Schematic representation of the Invader assay. The upstream invasive probe and thedownsteam primary probe hybridise to the target forming an overlapping hybridisation complex that isa substrate for the cleavage enzyme. The primary probe contains two regions; an analyte specificregion and a non-complementary arm which is cleaved from the probe when the overlapping probecomplex is formed. This cleaved flap is then used to drive a secondary invasive reaction resulting in theseparation of the fluorescence resonance energy transfer (FRET) pair which gives rise to a fluourescentsignal.
1.3 Analysis and detection
Nucleic acid based analysis can be carried out in either a heterogeneous or
homogenous manner. Heterogeneous assays require further manipulation once the
amplification reaction is complete which may involve aliquoting a sample for a
number of analytical procedures or adding some component of a signal detection
system. Homogenous assays require no further manipulation once the reaction is set
![Page 14: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/14.jpg)
D. O’ Meara
8
up as signal generation and detection are carried out in a single closed tube when the
reaction is complete or continuously during the amplification (real-time detection).
The quantity of samples and the number of analyses required from one sample usually
dictate the choice between homogeneous and heterogeneous systems. When a large
number of samples are to be analysed, heterogeneous chip-based assays become more
attractive.
1.3.1 Heterogeneous formats
PCR products may be analysed qualitatively or quantitatively depending on the
objective of the experiment. Detection is usually linked to gel electrophoresis,
hybridisation/capture to a solid support (microtitre plate, magnetic beads or DNA
chip) or enzymatic extensions such as single base extension (SBE) or pyrosequencing.
(i) Qualitative analysis
Qualitative analysis can be defined as specific product detection (e.g. detection of a
pathogen) or determination of sequence variation (e.g. detection of a viral subtype).
Many of the methods used to perform product detection and sequence verification
overlap and are listed in Table 3.
Table 3. Methods for qualitative analysis of amplification products
Detection ofCategory Techniques specific
productsequencevariation
Basis for distinction
Electrophoretic Agarose gelelectrophoresisSanger sequencingSSCP*DGGEHA
√√
n/a†n/an/a
x/√√√√√
SizeNucleotide sequenceMobility shiftMobility shiftMobility shift
Chromatographic DHPLC n/a √ Mobility shift
Hybridisation Southern blottingReverse dot blotASO
√√√
√x/√√
Probe & restriction sitesProbe sitesProbe sites
Enzymatic RFLPCFLPPyrosequencingMini-sequencing
n/an/a√√
√√√√
Restriction sitesCleavage sitesNucleotide sequenceNucleotide sequence
Mass Spec MALDI-TOF √ √ Nucleotide sequence
*See page 51 for abbreviations.†n/a (not applicable)
![Page 15: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/15.jpg)
Molecular Tools for Nucleic Acid Analysis
9
Specific product detection: Gel electrophoresis allows for convenient product analysis
allowing a yes/no answer with an estimate of product quality, quantity and size. PCR
product detection can also be performed via hybridisation assays which specifically
detect the amplified product e.g. hybridisation in a reverse dot-blot format where a
capture probe is immobilised followed by hybridisation of the denatured amplicon
(Saiki et al., 1989). Detection is performed either directly by detection of labels
incorporated in the amplicon e.g. fluorophores, or indirectly in a sandwich format
through immunoenzymatic methods or streptavidin conjugated enzymes. This format
has largely superseded the original dot-blot format where amplified products labelled
with biotin/digoxigenin were immobilised via biotin/digoxigenin antibodies coupled
to a solid support, which was followed by detection (directly or indirectly) with an
oligonucleotide probe. Amplified products can also be immobilised by performing
PCR with a PCR primer covalently coupled to a solid support (Oroskar et al., 1996).
Determination of sequence variation: Identification of sequence variation is
used in molecular typing of bacterial or viral nucleic acids and for epidemiological
pathogenesis and monitoring disease progression. Here a brief outline is given of
some of the methods used for the analysis of sequence variation (Table 3). DNA
sequencing is recognised as the “golden standard” for establishing the identity of
known and unknown sequence variants. However, alternate electrophoretic based
mutation detection techniques such as single-strand conformation polymorphism
(SSCP), denaturing gradient gel electrophoresis (DGGE) and heteroduplex analysis
(HA) can be used to scan a sequence for alterations based on the fact that sequence
differences cause mobility shifts. Denaturing high performance liquid
chromatography (DHPLC) can be used instead of electrophoresis to determine
mobility shifts, facilitating analysis in an automated rapid fashion. Restriction
fragment length polymorphism (RFLP) and cleavage fragment polymorphism (CFLP)
are based on variations in the size and number of fragments generated after digestion
with restriction and cleavage (endonuclease or ribonuclease) enzymes respectively
and can be used for comparative purposes in epidemiological and forensic studies and
to characterise bacterial and viral subtypes.
Enzymatic reactions such as OLA, pyrosequencing and SBE can also be carried out to
screen for point mutations and SNPs, with the later now being performed in an array
format (Pastinen et al., 1997; Hirschhorn et al., 2000). The recent publication by
![Page 16: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/16.jpg)
D. O’ Meara
10
Kristensen et al. should be consulted for a comprehensive review of these techniques
(Kristensen et al., 2001).
Hybridisation with allele-specific oligonucleotides (ASO) is a widely applied method
for detecting point mutations and SNPs and is based on determining differences in
hybridisation between a perfect match and a mismatch. A line probe assay applying
this technology for HCV typing (Stuyver et al., 1993; Le Pogam et al., 1998) and for
detection of drug resistance mutations in HIV (Stuyver et al., 1997) is commercially
available. With the advent of hybridisation based DNA chip technology, ASO
hybridisation can be performed in a high-throughput manner and these
oligonucleotide arrays have been used to screen for mutations in BRCA1 (Hacia et
al., 1996), the cystic fibrosis gene (Cronin et al., 1996) and HIV-1 (Vahey et al.,
1999) and for SNP identification and typing (Wang et al., 1998). An emerging new
technology is the use of the mass spectrometer for the analysis of small DNA
molecules. Its primary advantages are the speed and accuracy of sequence
determination and the fact that no labels are needed for detection (Graber et al.,
1999).
(ii) Quantitative analysis
The polymerase chain reaction can also be used to estimate the quantity of a particular
target DNA or RNA and is used to determine the load of an infecting pathogen, to
monitor therapeutic response and for RNA expression analysis. However, since PCR
is an exponential reaction, this means that small variations in amplification efficiency
can yield large changes in the amount of PCR product generated. This characteristic
together with the fact that later cycles of PCR exhibit a plateau effect makes it
difficult to use PCR to obtain quantitative data. However there are several methods of
quantitative PCR/RT-PCR that have been described in the literature and the strategy
chosen often depends on whether an absolute or relative quantitation is required. The
most widely used approach for determining absolute target amounts is quantitative
competitive PCR (QC-PCR). In QC-PCR, standards are co-amplified with target
nucleic acid to correct for tube-to-tube variations in amplification efficiency and to
determine absolute amounts of initial target. These standards are usually external
references that are amplified with the same primers as the native target to ensure that
the reference and target sequences are amplified with equal efficiency. Generally,
these standards are constructed by modifying a clone of the target sequence so that it
![Page 17: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/17.jpg)
Molecular Tools for Nucleic Acid Analysis
11
can be distinguished either by size difference or by insertion/removal of a restriction
enzyme site. Quantitative competitive PCR relies on the co-amplification of a dilution
series of these standards with a constant amount of native target, facilitating analysis
in the exponential or plateau phase (Becker-Andre and Hahlbrock, 1989; Gilliland et
al., 1990; Lundeberg et al., 1991) . Since the standard and target compete for primers
and enzymes there will be equivalent amplification when both molecules are present
in equimolar concentrations at the start of the reaction. By plotting the results (log
standard signal/target signal versus log amount of standard added) the equivalence
point can be calculated allowing determination of the initial amount of target.
Limiting dilution experiments using nested PCR combined with Poisson statistics can
also be used for an estimation of the initial number of target molecules present,
without quantitation of the actual amount of PCR product formed (Brinchmann et al.,
1991; Lundeberg et al., 1991; Sykes et al., 1992). This is based on the theory that one
target molecule should give rise to a PCR product and to achieve this, multiple
replicates of serial dilutions are assayed. This involves handling many PCR tubes and
since nested PCR is used, this approach is susceptible to contamination resulting in
false-positive end point results. However an advantage of this method is that target
concentration can be roughly estimated without the need for standards or expensive
equipment. Some of these drawbacks may be overcome in the future by performing
the PCR in a nanolitre scale with real-time detection thereby avoiding nested PCR
(Kalinina et al., 1997). This approach may also have an advantage when quantifying
viral targets as small mismatches in the primer sequences are unlikely to affect
quantitation to the same extent as mismatches in QC-PCR assays (Hawkins et al.,
1997).
Homogeneous quantitation methods based on amplification kinetics, which allow
simultaneous amplification and quantitation in real-time have been developed and are
discussed below and further in a recent review (Bustin, 2000). These strategies allow
both relative and absolute quantitation, eliminating the tedious preparation of dilution
series and have resulted in a robust, reproducible, quantitative PCR assay. In addition
a number of commercial quantitation assays based on PCR, NASBA and bDNA are
available for microbial and viral pathogens. These kits are widely used in clinical
laboratories for HCV and HIV-1 quantitation and even though they use different
![Page 18: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/18.jpg)
D. O’ Meara
12
extraction and amplification protocols, they show similar performance characteristics
(Lin et al., 1998).
1.3.2 Homogeneous formats
Homogenous assay formats simplify detection of amplification products and minimise
problems of cross contamination and are useful for gene quantitation, RNA
expression analysis and detection of small numbers of mutations in nucleic acid
targets. These homogeneous assays can be characterised as non-specific or specific.
Non-specific methods detect the presence or absence of amplicons but provide no
information about the nature of the amplified product. Intercalating agents such as
ethidium bromide, SBYR green or labelled hairpin primers (Sunrise primers)
(Nazarenko et al., 1997) are examples of non-specific methods that are used to
determine the amount of PCR product generated. Since these methods are prone to
“false-positives”, in that undesirable product such as primer-dimer and non-specific
products can increase fluorescence, it is desirable to use specific methods that probe
the amplification product. Such systems are based on the phenomenon of FRET and
have exploited various probe designs to allow the amplification to be monitored at the
endpoint (post-amplification) or in real-time. Fluorescence resonance energy transfer
requires a donor and an acceptor fluorophore and involves excitation of the donor,
which results in energy transfer to the acceptor. In response, the acceptor can either
emit light of a longer wavelength or dissipate the energy in the form of heat
(quenching). Examples of such techniques are exonuclease probes (TaqMan) (Holland
et al., 1991), hairpin probes (Molecular Beacons) (Tyagi and Kramer, 1996), hairpin
primers (Scorpion primers)(Whitcombe et al., 1999) and binary hybridisation probes
(Wittwer et al., 1997b). The hairpin primers and probes are more applicable to
multiplexing than the TaqMan format as they can used a wider variety of FRET pairs,
as the donor and quencher do not need to have overlapping spectra probably because
they are brought into close proximity in the hairpin loop conformation (Tyagi et al.,
1998).
At least four new instruments combining a thermal cycler, laser and a
detection/software system to automate detection and quantitation of nucleic acids are
available commercially and perform one or all of these assays (ABI Prism 7700 [PE
Biosystems], Light Cycler [Roche], SmartCycler [Cepheid] and I-Cycler [BioRad]).
These real-time PCR systems facilitate quantitative analysis because the number of
![Page 19: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/19.jpg)
Molecular Tools for Nucleic Acid Analysis
13
cycles needed to reach a threshold amount of PCR product is directly proportional to
the target copy number (Heid et al., 1996). They have been used for RNA expression
studies, gene copy number determination, detection of pathogens and for the analysis
of polymorphisms/mutations (Bustin, 2000).
Sequence variation among viral targets such as HCV and HIV can present problems
for these probe based real-time detection methods (Takeuchi et al., 1999) and
consequently non-specific detection formats may simplify the reaction if a conserved
probe sequence is difficult to find. Indeed, DNA specific dyes have been used with
these instruments (Light Cycler) for quantitation using re-annealing kinetics and
melting curve analysis for discrimination of sequence variants (de Silva and Wittwer,
2000).
2 Nucleic acid sequencing
The past two decades have seen nucleic acid sequencing (DNA and RNA) evolve
from complicated laboratory procedures performed by skilled researchers, to
automated familiar techniques available to biologists and nonbiologists alike, with the
Human Genome Project (HGP) having being the main driving force behind this
technological advance. Among the most significant applications of this technology is
the sequencing of whole genomes e.g. baker’s yeast (Saccharomyces cervisiae) (15
Mb) (Goffeau et al., 1996); the nematode worm (Caenorhabditis elegans) (97 Mb)
(The C. elegans Sequencing Consortium, 1998); Drosophila melanogaster (120 Mb)
(Adams et al., 2000); Arabidopsis thaliana (125 Mb) (The Arabidopsis Genome
Initative, 2000); and the human genome (3000 Mb) (McPherson et al., 2001; Venter
et al., 2001). These whole genome sequences facilitate investigation of gene
expression patterns and help understand evolution and the causation of disease. In
addition to the sequencing of whole genomes, DNA sequencing is also used for gene
expression profiling which involves the sequencing of Expressed Sequencing Tags
(EST) or short tags generated by Serial Analysis of Gene Expression (SAGE). DNA
sequencing is also used for discovery and typing of mutations (Berg et al., 1995) and
polymorphisms [e.g. SNP, insertions and deletions] within a genome (Mullikin et al.,
2000). Indeed, The SNP Consortium (TSC) have to date (August 2001) mapped over
one million SNPs by conventional DNA sequencing. This information has been
![Page 20: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/20.jpg)
D. O’ Meara
14
complied in a SNP database facilitating the use of resequencing techniques such as
mini-sequencing reactions etc. to rapidly screen for particular SNPs. Currently there is
a huge focus on SNPs as it is believed that they will provide the genetic markers for
the next era in human genetics due to their abundance throughout the genome and the
relative ease of developing automated large-scale SNP typing assays.
DNA sequencing can obviously also be used in many other areas such as sub-typing
of bacteria (Spratt, 1999) and viruses (Arens, 2001) by sequencing variable regions of
their genome e.g. sequencing of the 5′ non-translated region (NTR) PCR products
from the Amplicor quantitation kit has been used for subtype classification of HCV
(Germer et al., 1999). Sequencing can also facilitate identification of previously
identified or unknown pathogens and consequently it can be used for molecular
epidemiological studies and for investigations into pathogenesis, drug resistance
mutations and disease progression.
2.1 Chain terminating techniques
Despite the increased demand for high-throughput genome sequencing efforts, the
basic technique for DNA sequencing developed more than twenty years ago is still in
use today. This method (Sanger sequencing) developed by Sanger in 1977 performs
DNA sequencing by polymerase mediated dideoxy chain termination (Sanger et al.,
1977). A second sequencing strategy (Maxam-Gilbert sequencing) also described in
1977, uses chemical degradation but is in limited use due to the necessity of using
toxic chemicals (Maxam and Gilbert, 1977). These methods are similar in that they
generate a set of fragments with a common 5′ origin and a base specific 3′ terminus
which are separated by electrophoresis allowing the sequence of the target to be
determined.
2.1.1 Sanger sequencing
Sanger sequencing for slab gel electrophoresis is performed in either a four lane-one
dye format (Ansorge et al., 1986) or a one-lane four dye format (Smith et al., 1986).
The former generates raw data that is more easily interpreted as a single dye is used
and consequently the four lanes have equal mobility. Such formats are useful in
diagnostics and forensics when relative peak heights need to be compared to interpret
polymorphic nucleotide positions. However the throughput is slow and therefore the
![Page 21: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/21.jpg)
Molecular Tools for Nucleic Acid Analysis
15
most common sequencing approach has been the four dye-one lane format.
Commercial instruments are available in both formats; the automated laser
fluorescence sequencer (ALF) from Amersham Pharmacia uses four lanes per sample,
while the slab based sequencers from Applied Biosystems uses a one lane detection
system involving base calling algorithms of the raw data which can slightly hamper
the analysis of polymorphic positions.
Fluorescent labels are incorporated into the sequencing fragments via the
dideoxynucleotide (dye-terminator sequencing) (Prober et al., 1987) or the
sequencing primer (dye-primer sequencing) (Ansorge et al., 1986; Smith et al., 1986).
Dye-terminator sequencing is more versatile as any unlabelled primer can be used for
sequencing and since each of the four dideoxynucleotide triphosphates (ddNTPs) are
labelled with a different dye, four extension reactions can be carried out in one tube
reducing reagent cost and labour.
Significant improvements have been made to the DNA polymerase used in the Sanger
sequencing protocol. Initially, isothermal enzymes (T4 or T7 DNA polymerases) were
used that showed even incorporation of all four terminators but were sensitive to
temperature and degraded easily (Tabor and Richardson, 1987). With the discovery of
a thermostable DNA polymerase, PCR style sequencing reactions (cycle sequencing)
became possible and have grown in popularity due to a lower template requirement,
effective denaturation of double-stranded DNA (avoiding time consuming single-
strand preparation) and ease of automation (Murray, 1989). Genetic engineering of
the DNA polymerase solved problems with discrimination of the enzyme for
deoxynucleotide triphosphates (dNTPs) over ddNTPs (Tabor and Richardson, 1995).
In general, the sequencing strategy selected to generate Sanger sequencing data
depends on the template sequenced (e.g. genomic DNA, cDNA or viral template), the
purpose of sequencing, the throughput required and the importance of sequence read-
length and quality. The sequencing strategy employed is of particular importance
when sequencing mutations/polymorphisms in cancer cells and viruses as differential
incorporation of terminators, presence of prematurely terminated fragments, mobility
shifts and poor signal-to-noise ratios in sequencing ladders can all complicate the
interpretation of heterozygous nucleotide positions (Kronick, 1997).
![Page 22: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/22.jpg)
D. O’ Meara
16
2.2 Separation and detection
2.2.1 Automated slab-based sequencers
The most commonly used format for DNA sequencing has been with automated
fluorescence DNA sequencers which combine electrophoresis in a vertical slab gel
with on-line detection of the fluorescently labelled fragments after excitation by a
laser beam. Most commercial instruments (ABI prism and ALFexpress are the most
widely used) have a capacity of 10-96 samples per run, with a run taking from 2 hours
to 10 hours due to strict limitations in electric field strength.
2.2.2 Capillary electrophoresis
These slab gels are gradually being replaced by capillary gel electrophoresis (CGE)
which offers advantages such as automation, higher-throughput and reduced reagent
and labour costs. The high surface to volume ratio of a capillary can effectively
dissipate the heat produced during electrophoresis, allowing higher voltage and
thereby facilitating faster sequencing runs. The small sample requirement of CGE,
typically five nanolitres, provides an opportunity to reduce the amount of template
DNA and reagents leading to a reduction in cost. Due to the smaller sample volumes,
the development of dyes with stronger fluorescence signals was a significant advance
to CGE (Ju et al., 1995). These energy transfer (ET) dyes contain a common donor
dye paired with one of four acceptor dyes. A single excitation wavelength excites the
common donor fluorophore, which then excites the acceptor fluorophore. Commercial
capillary array instruments are now available and two of the most widely used are
from Molecular Dynamics (MegaBACE 1000) and Perkin Elmer Biosystems (ABI
3700). Both instruments can automatically process up to 96 samples per run (~2-4
hours) and are capable of read-lengths of up to 800 bases.
2.2.3 Ultrathin gel electrophoresis
Ultrathin sequencing gels can also withstand a higher level of voltage than traditional
slab gels thereby allowing faster separation of the DNA fragments. Visible Genetics
supply a disposable vertical gel cassette that allows rapid low-throughput dye-primer
sequencing (400 bases in 30 minutes). It is used mostly for molecular diagnostic
applications such as HIV, HCV and human papilloma virus (HPV) genotyping, p53
mutation detection and fragment analysis. A higher through-put system from MJ
![Page 23: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/23.jpg)
Molecular Tools for Nucleic Acid Analysis
17
Research uses horizontal electrophoresis and can sequence 600 bases in ninety
minutes in a 96 well format (Kostichka et al., 1992).
2.2.4 Microfabricated DNA sequencers
A totally different platform to perform capillary electrophoresis is to use microchips
or microfabricated devices. Recently four-colour separation of sequencing fragments
in microfabricated capillary electrophoresis channels was performed with 600 bases
sequenced in 20 minutes (Liu et al., 1999). In principle, these platforms offer higher-
throughput and should be compatible with on-line systems that automate and integrate
thermal cycling, purification, loading and capillary electrophoresis steps (Swerdlow et
al., 1997; Tan and Yeung, 1998).
2.3 Alternative sequencing strategies
In light of the near completion of the HGP, attention has shifted slightly from de novo
sequencing towards resequencing. Resequencing can be defined as the sequencing of
a region whose “normal” sequence is already known, to search for mutations and
polymorphisms. Resequencing techniques have the potential to offer high-throughput
analysis, facilitating SNP typing for use in association studies. This technology can
also be applied in the field of diagnostics for mutation detection and viral genotyping.
Most of the alternative sequencing strategies described here can be used both for de
novo sequencing and resequencing with the exception of allele-specific extension and
SBE.
2.3.1 Sequencing by hybridisation
Two alternate strategies using oligonucleotide arrays to perform sequencing by
hybridisation (SBH) were described by a number of group in the late 1980’s (Bains
and Smith, 1988; Drmanac et al., 1989; Khrapko et al., 1989; Southern et al., 1992).
In format I, oligonucleotides are hybridised to immobilised targets and formation of
strong duplexes between the perfectly matched probe and target DNA allows the
target sequence to be reconstructed from the hybridisation pattern (Drmanac et al.,
1989). This technology has been successfully applied to sequence 1.1 Kb of the p53
gene (Drmanac et al., 1998) but since thousands of separate hybridisation reactions
were needed for this approach, its utility will depend on the level of automation
![Page 24: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/24.jpg)
D. O’ Meara
18
achieved. An alternate format (format II) is based on the hybridisation of the target
DNA to a large array of short overlapping probes of known sequence (Khrapko et al.,
1989). This SBH approach (format II) offers the most potential and should be useful
in the future for sequence verification and mutation analysis.
2.3.2 Allele-specific extension
Allele-specific extension is based on the technique of amplification refractory
mutation system (ARMS), which uses allele-specific primers in the PCR to take
advantage of the lowered intrinsic efficiency of DNA polymerases to extend
mismatched primers compared to matched primers (Newton et al., 1989). In ARMS,
two PCR reactions are performed with a different allele-specific primer, with
extension and amplification only occurring if the primer is matched to the template
DNA at its 3′ end. While ARMS must detect a specific sequence prior to
amplification, allele-specific extension detects the variant after PCR. Allele-specific
extension is performed on the PCR product using primers that differ at the 3′ end,
defining the nucleotide variant of the polymorphic position. Labelled nucleotide(s) are
incorporated into the extension product followed detection of the incorporated
fluorophore after a brief washing step (Figure 4).
G
G
CG
C T
Extension with flourescent dNTPs
C * *
Measure signal Measure signal
Extension 1 Extension 2
PCR product
Denature PCR product and anneal allele-specific primers
T
G
G
Genotype=ratio of signal 1signal 2
Figure 4. Schematic representation of allele-specific extension. The single-strand template is split intwo and annealed to allele-specific primers (i.e. 3′ end of the primers defines the variant nucleotide).These primers are enzymatically extended in the presence of labelled dNTPs and the signal for eachextension reaction (after a washing step) determines which primer was extended, thereby allowing thenature of the nucleotide at the polymorphic site to be ascertained.
![Page 25: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/25.jpg)
Molecular Tools for Nucleic Acid Analysis
19
These extension assays have recently been adapted to microarray formats, which offer
the potential for high-throughput genotyping (Pastinen et al., 2000; Erdogan et al.,
2001). However despite the potential of allele-specific extension, this technique is not
widely used as there have been many reports on mismatches are not refractory to
extension (Newton et al., 1989; Kwok et al., 1990; Fry et al., 1992; Huang et al.,
1992; Ayyadevara et al., 2000).
2.3.3 Mini-sequencing
(i) Single base extension
These mini-sequencing reactions were first described by Syvänen in 1990 and employ
template-directed primer extension to screen for SNPs and point mutations (Syvänen
et al., 1990). They are based on extension of a primer by DNA polymerase in the
presence of a labelled dideoxynucleotide, which allows determination of the nature of
the base immediately 3′ of the sequencing primer (Figure 5). To facilitate signal
detection, a number of fluorophores are used (Head et al., 1997) or separate detection
reactions of one label are performed (Syvänen, 1994).
Extension 2 with labelled ddTTP
G
CG
Measure signal Measure signal
Extension 1 with labelled ddCTP
PCR product
Denature PCR product and anneal SBE primer
C *
C *
T *
G
G
Genotype=ratio of signal 1signal 2
Figure 5. Schematic representation of SBE. Single-strand template is annealed to a SBE primer whose3′ end is adjacent to the polymorphic site. The template and primer mix is then divided in two and theprimers are enzmatically extended using a specified labelled ddNTP. The nature of the polymorphicsite is determined from the signals generated from each extension mix.
![Page 26: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/26.jpg)
D. O’ Meara
20
Extension is carried out in solution or on a solid-phase such as magnetic beads,
manifold supports or on DNA microarrays (Syvänen, 1999). Extension reactions
carried out on oligonucleotide microarrays have discriminatory power that is one
order of magnitude higher than that of ASO hybridisation on DNA chips (Pastinen et
al., 1997). Single base extension on microarrays is also easier to set up as only one
mini-sequencing primer is needed per variable position as opposed to high-density
arrays, where a series of overlapping probes for each position to be analysed is
required. Modifications of this SBE method are TAG arrays where the array is
independent of the specific markers typed (Hirschhorn et al., 2000) which has
facilitated minisequencing on high-density oligonucleotide arrays (Fan et al., 2000).
(ii) Pyrosequencing
Pyrosequencing, a sequencing by synthesis method was first described in 1993 and
relies on the sequential addition and incorporation of nucleotides in a primer-directed
polymerase extension (Nyren et al., 1993). During DNA synthesis, pyrophosphate
(PPi) is released which is coupled with the enzymes sulfurylase and luciferase to
generate detectable light. This light is proportional to the number of nucleotides
incorporated allowing the sequence to be determined in real-time (Figure 6).
A significant advance for this sequencing by synthesis approach was the introduction
of apyrase, a nucleotide degrading enzyme which eliminated the need for washing
steps after each nucleotide addition (Ronaghi et al., 1998). A recently described
pyrosequencing approach performed on double-stranded DNA, which enzymatically
removed amplification primers and nucleotides from the preceding PCR (which
would otherwise interfere with the primer extension reaction), has potential for
increasing the capacity of pyrosequencing (Nordström et al., 2000).
An important factor in pyrosequencing, is the balance between the polymerase and
apyrase as nucleotide degradation competes with nucleotide incorporation. Thus to
obtain accurate pyrosequencing data, nucleotide degradation by apyrase has to be
slower than nucleotide incorporation by the DNA polymerase. However, several
factors such as insufficient exposure of polymerase to nucleotides, insufficient
nucleotide degradation by apyrase and contamination by kinases, limit the read-length
as discussed in a recently published review on pyrosequencing (Ronaghi, 2001).
A fully automated instrument capable of sequencing 96 reactions simultaneously is
now commercially available (Pyrosequencing AB) allowing the sequencing of short
![Page 27: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/27.jpg)
Molecular Tools for Nucleic Acid Analysis
21
stretches of DNA (20-30 bases) in less than one hour. This instrument has been used
for a wide range of applications ranging from SNP typing (Ahmadian et al., 2000;
Gustafsson et al., 2001) and mutation screening (Garcia et al., 2000) to bacterial
(Monstein et al., 2001) and viral (Gharizadeh et al., 2001) typing. Pyrosequencing has
also been used for de novo sequencing of cDNA tag libraries facilitating gene
identification (Agaton et al., 2001; Nordström et al., 2001).
Figure 6. Schematic diagram of pyrosequencing. The reaction mixture consists of a single-strand DNAwith a short annealed primer, DNA polymerase, adenosine triphosphate (ATP) sulfurylase, luciferaseand apyrase. The four nucleotide bases are added to the mixture in a defined order e.g. A, C, G and T.If the added nucleotide forms a base pair (in this case, two “T”s base-pair to the template), the DNApolymerase incorporates the nucleotide and consequently PPi is released. The released pyrophosphateis converted to ATP by ATP sulfurylase which is used by luciferase to generate detectable light. Thislight is proportional to the number of nucleotides incorporated and is detected in “real-time”. Thepyrosequencing raw data is displayed simultaneously and in this example the sequence generated reads“ATCTT”. If the nucleotide does not form a base pair with the DNA template, it is not incorporated bythe polymerase but is degraded by apyrase.
2.3.4 Mass spectrometry
Important advances in the ionisation of biopolymers in the gas phase during the last
decade has allowed mass spectrometry (MS) to be considered a fast and accurate
method for DNA sequence analysis. One mode of MS sequencing that seems to be the
TAGAAGGACCGTTTAAGTATCTT
3
Polymerase
PPi
ATP
dTTP
Sulfurylase
Luciferase
Real-timemonitoring
A T C TTDNA sequence:
5'
Nucleotides added:
Primer
dTMP + 2Pi
Apyrase
5'
Light
![Page 28: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/28.jpg)
D. O’ Meara
22
most promising is matrix-assisted laser desorption ionisation time of flight
spectrometry (MALDI-TOF). In MALDI-TOF MS the nucleic acid is desorbed,
ionised and subjected to an intense electric field which accelerates the fragments
proportional to their mass-charge ratio with detection based on the time required for
each particle to reach the detector. Although MS has been used for DNA sequencing
(Fu et al., 1998), it offers most potential for typing single point mutations or SNPs. A
number of MALDI-TOF MS genotyping approaches have been described and include
the PROBE (Braun et al., 1997) and the PinPoint assay (Haff and Smirnov, 1997;
Ross et al., 1998). These protocols subject the target to primer extension with a
specific mix of dNTPs and ddNTPs or with a single ddNTP respectively. The DNA
template and the extended primer are then separated and the primer product is
subjected to MALDI-TOF MS, which allows characterisation of the base(s)
downstream of the 3′ end of the primer. A drawback of MALDI-TOF MS is that it
relies heavily on stringent purification. However, a recently described protocol called
the GOOD assay has overcome some of these problems by chemically modifying the
extension product thus eliminating the need for purification prior to MS detection
(Sauer et al., 2000). An approach that offers potential for large-scale genotyping is to
combine MS with DNA chip technology where the probe is released from the chip
allowing interpretation of the extension product (Tang et al., 1999).
3 Chip-based analysis
Recently DNA biosensors and DNA chips have stimulated considerable interest due
to their ability to obtain sequence-specific information in a fast, simple and
inexpensive manner in comparison to traditional hybridisation/sequencing assays. The
fundamental difference between DNA biosensors and DNA chips is that biosensors
incorporate a biologically active layer at the surface of a recognition element which
translates a biorecognition event (e.g. hybridisation) into a signal whereas the DNA
chip surface must be scanned or imaged after hybridisation and washing to obtain the
complete hybridisation pattern (Figure 7).
![Page 29: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/29.jpg)
Molecular Tools for Nucleic Acid Analysis
23
Biosensor Microarray
Biorecognition layer
TransducerMicroarray
Hybridise and wash
Target
ScanSignalOpticalElectrochemicalPizoelectrical
Excite with lasers
Targetanalyte
Probe/target duplex
Figure 7. Biosensors couple the biorecognition event and signal generation while with microarraytechnology the slide is scanned after hybridisation.
3.1 DNA Biosensors
As described above, a biosensor is a device that combines the specificity of a
biological sensing element with a transducer to produce a signal proportional to the
target analyte concentration. Although biosensors have been most widely used to
study protein-protein interactions this technology also offers the possibility to perform
real-time binding measurements of DNA-protein interactions (Cheskis and Freedman,
1996) and to monitor DNA hybridisation kinetics and detect specific mutations
(Nilsson et al., 1995; Persson et al., 1997). The design of a DNA biosensor generally
involves modification of a sensor surface for attachment of DNA followed by
immobilisation of the probe and detection of the target via hybridisation at the sensor
surface.
3.1.1 Ligand immobilisation
Since DNA biosensors are usually in the form of electrodes, crystals or chips,
hybridisation is a solid-phase reaction, which is believed to proceed at one-tenth the
rate of solution hybridisation (Bunemann, 1982). Therefore the immobilisation step
should lead to a probe (ligand) with controlled orientation and packing density which
minimises steric hindrance allowing the probe to be accessible for hybridisation,
which is of course applicable to all solid-phase hybridisation formats. Depending on
the transducer, DNA can be immobilised by thiolylated or covalent linkage to gold
transducers, via biotin-streptavidin chemistry, by covalent coupling to functional
![Page 30: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/30.jpg)
D. O’ Meara
24
groups or by simple adsorption to carbon surfaces. As in solution-based hybridisation,
ionic strength and temperature need to be optimised for each probe-target interaction.
3.1.2 Signal detection
Transducers form the basis of a biosensor and serve to translate the biological event
into a measurable analytical signal. Common transducing elements in DNA
biosensors are optical, electrochemical or pizoelectrical devices which measure
changes in light absorption, current or mass respectively. Here the focus is on optical
DNA biosensors but for more information on electrochemical and pizoelectrical
biosensors please see a recent review (Wang, 2000).
Optical biosensors make up most of the DNA biosensor market with several types of
transducers such as surface plasmon resonance (SPR), wave guiding and fluorescence
forming the basis of these biosensors. These sensors measure properties such as the
intensity, phase or angle of the reflected light which allows determination in real-time
of the amount and rate of ligate binding. There are a number of commercially
available optical biosensors but over 90% of the commercial biosensor publications
cite the use of BIACORE instruments (Biacore AB). The BIACORE is a flow based
system which uses the principle of SPR to detect changes at the sensor surface
(Jönsson et al., 1991). Surface plasmon resonance is an optical phenomena in which
light is focused through a prism on a thin gold film and due to energy transfer in the
form of an evanescent wave from the light beam to the surface electrons on the metal
film the intensity of the reflected light is decreased (Garland, 1996). The angle of the
reflected light (resonance angle) is dependent on the refractive index near the surface
of the thin gold film. A biomolecular interaction taking place on the sensor chip (a
thin gold film coated with a dextran matrix) will lead to a change in the refractive
index and cause an increase in the resonance angle. This change in resonance angle is
proportional to the surface concentration of biomolecules (Stenberg et al., 1991) and
results are presented as resonance units (RU) against time in a sensorgram thus
providing a complete record of the process of association and dissociation (Figure 8).
In a typical binding analysis, the ligand is immobilised on a chip which forms one
wall of a flow cell while a sample is injected across the surface at a fixed flow rate.
DNA hybridisation is followed in real-time without the need for labelled targets,
making biomolecular interaction analysis (BIA) an ideal technique to determine
binding specificity and interaction kinetics.
![Page 31: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/31.jpg)
Molecular Tools for Nucleic Acid Analysis
25
Figure 8. Configuration of SPR detector, sensor chip and integrated fluidic cartridge in the BIACOREsystem. The resonance angle is sensitive to the mass concentration of molecules close to the sensorchip surface. As this concentration changes, the resonance angle shifts producing a response which isdisplayed in a sensorgram.
Biosensors such as the IAsys (Affinity Sensors) and ASI (Artificial Sensing
Instruments) also use the resonance angle to probe surface changes but instead of SPR
they utilise a wave guiding technique (Lowe et al., 1998; Wiki et al., 1998).
An alternate biosensor based on optical fibre technology uses the evanescent wave to
stimulate fluorescent labels in DNA attached at the end or along the length of the
fibre. Most of these fibre optic biosensors use ethidium bromide but some have
recently been described that use fluorescently labelled single-strand DNA to detect
multiple DNA targets simultaneously (Ferguson et al., 2000).
3.2 DNA microarrays
DNA microarrays originate from the method of Southern blotting (Southern, 1975)
and indeed its inventor, Edwin Southern, was the first to make oligonucleotide
microarrays (Southern et al., 1992) for the purpose of high-throughput sequencing i.e.
SBH. Although SBH was not sufficiently developed to have any impact on the
sequencing of the human genome, it led to the creation of DNA microarrays, a
powerful approach for the analysis of complex biological systems.
Sensorchip
Lightsource
Prism
Detectionunit
Flowcell
I
IIResonance
angle
II
ITime
ReflectedIntensity
AngleI II
Sensorgram
Resonancesignal
![Page 32: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/32.jpg)
D. O’ Meara
26
These DNA chip arrays have a wide range of applications and have the advantage of
speed of measurement and the ease with which the analysis lends itself to automation.
The most powerful application of DNA chips is the comparison of hybridisation
patterns to identify physiologically important variations e.g. expression profiling of
normal and diseased states to highlight induced and suppressed pathways in the
diseased tissue (DeRisi et al., 1996). Similar experiments in the pharmaceutical
industry may help in the identification of drug candidates and any secondary changes
suggestive of potential side-effects (Gerhold et al., 2001). DNA chips can also be
used in the field of DNA diagnostics for genotyping of bacteria and viruses and for
mutation/polymorphism screening i.e. resequencing. Affymetrixs have designed a
HIV GeneChip which has been used to screen for drug resistance mutations in HIV-1
(Kozal et al., 1996) which shows similar capacity to identify mutations as other HIV-
1 genotyping assays currently available (Wilson et al., 2000). Tailor made
oligonucleotide arrays have been used to test for mutations signifying susceptibility to
disease in genes as diverse as the breast cancer gene BRCA1 (Hacia et al., 1996), the
cystic fibrosis gene (Cronin et al., 1996) and the human mitochondrial genome (Chee
et al., 1996). Such high-density oligonucleotide arrays have also been used for high-
throughput discovery of SNPs as described by Wang et al. who examined 2.3 Mb of
human genomic DNA identifying over 3000 candidate SNPs (Wang et al., 1998).
However these approaches have not been so successful for large-scale SNP typing
with one report assigning the correct genotype in only 57% of sites analysed (Cho et
al., 1999). To enhance the discriminatory power of these chips, enzymatic extension
has been performed on the oligonucleotide arrays as described by a number of groups
(Pastinen et al., 1997; Fan et al., 2000; Hirschhorn et al., 2000; Pastinen et al., 2000).
3.2.1 Array platforms
Among the many different technical solutions available, methods for making an array
generally fall into one of two categories; in situ (on-chip) synthesis of
oligonucleotides or peptide nucleic acid (PNA) or arraying/spotting of prefabricated
oligonucleotides, PNA or DNA fragments (Figure 9). Design of an array is largely
dependant on the research question that has to be answered with smaller arrays with
well defined target sequences (e.g. HIV chip) being commonly used for diagnostic
purposes, while elucidation of metabolic pathways or identifying novel genes
necessitates the use of large arrays often with undefined sequences.
![Page 33: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/33.jpg)
Molecular Tools for Nucleic Acid Analysis
27
Gene X
DNA
Gene X
Public database
High-density oligonucleotide array
PMMM
PurificationRobotic printing
PCR amplification
Spotted DNA microarray
Glass wafer
Sequence selectionOligomer synthesis
Figure 9. Array fabrication and gene representation for spotted DNA arrays and high-densityoligonucleotide arrays. Spotted DNA arrays are made by printing amplified DNA onto glass slides.Each spot on the slide corresponds to a gene fragment of several hundred bases. Pre-synthesisedoligonucleotides can also be spotted (not shown). The high-density arrays are manufactured using lightdirected chemical synthesis to produce thousands of different oligonucleotide probes in a highlyordered fashion on the glass chip. Each gene is represented by 15-20 different oligomer pairs (pm;perfect match, mm; mismatch) on the array.
(i) In situ synthesis.
Three approaches have been used to direct oligonucleotide synthesis to defined areas
of a support for in situ fabrication: synthesis via combinatorial chemistry (Southern et
al., 1994); ink-jet delivery of nucleotide precursors to the surface (Blanchard, 1998);
and photolithography (Pease et al., 1994). Photolithography is pioneered by
Affymetrix to generate high-density oligonucleotide arrays. This technique involves
exposing light onto the surface of the chip through a photolithographic mask, which
selectively removes photo-labile deprotecting groups from the growing
oligonucleotide chain in a stepwise fashion to create oligonucleotides. Currently over
400,000 different features (an area containing millions of identical probes) are packed
into a region of about 1 cm2. However since the step-wise synthesis yield is only 95%,
oligonucleotides no longer than 25 bases can be synthesised which can dramatically
reduce specificity and sensitivity. In gene expression analysis, specificity is addressed
by comparing perfectly matched sequences with single base mismatched sequences
![Page 34: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/34.jpg)
D. O’ Meara
28
and by synthesising many oligonucleotides for each gene to be analysed (typically
twenty pairs of oligonucleotides are arrayed to represent each gene) (Figure 9)
(Wodicka et al., 1997). When these high-density chips are used for polymorphism
analysis, every nucleotide position that has to be interrogated has a set of four
oligonucleotides designed that differ only in the central nucleotide. The relative
intensities of hybridisation to each series of probes at a particular location identifies
the nucleotide. However, due to the poor step-wise yield, it is estimated that less than
36% of all probes in a feature are likely to be error free (Graves, 1999). Nevertheless,
this error prone synthesis may have beneficial side effects as it has been shown that a
probe to which a second mismatch has been added is more sensitive in detecting
mutations than one containing only the mismatched base (Guo et al., 1997). A further
disadvantage is that these high-density arrays are very expensive and the complexity
of photolithography means that the chip manufacture must be carried out “in house”.
However, in situ synthesis has a number of advantages over deposition of pre-
synthesised oligonucleotides in that yields are higher and consistent over the surface
from one cell of the array to another and chips can be manufactured directly from
sequence databases removing the uncertainty and burden of sample handling and
tracking.
(ii) Spotted arrays
The technology for printing prefabricated oligonucleotides and cDNAs is more
accessible and less expensive than that for in situ fabrication and simply involves the
robotic spotting of oligonucleotides or cDNA onto glass slides. This technology was
developed by researchers at Stanford University (Schena et al., 1995; Shalon et al.,
1996) but today there are numerous commercially available robotic spotters that use
direct touch or fine micropipetting (Gerhold et al., 1999). Generally PCR amplified
inserts from cDNA clones are spotted onto glass slides (overlaid with a positively
charged coating such as amino silane or polylysine) (Figure 9) but DNA (PCR
products or oligonucleotides) can also be covalently coupled to slides through various
coupling chemistries (Lindroos et al., 2001). An advantage of cDNA arrays is that
they can be produced from both known and unknown cDNA while oligonucleotide
arrays require gene sequence information for synthesis of the oligomers.
![Page 35: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/35.jpg)
Molecular Tools for Nucleic Acid Analysis
29
3.2.2 Hybridisation and detection
Hybridisation conditions depend greatly on the purpose of the experiment. Expression
analysis requires overnight hybridisation with low stringency (high salt and low
temperature) which enhances annealing of low copy number sequences while
identification of mismatches requires greater stringency over a shorter time period
(hours). Hybridisation of the labelled target ideally should be linear (i.e. proportional
to the amount of probe), sensitive so that low abundance genes are detected and
specific so that probes hybridise only to the desired gene in the complex target
mixture. Since the hybridisation efficiency is susceptible to sequence specific features
such as melting temperature and secondary or tertiary structure effects, the use of
PNA in place of DNA oligonucleotides may overcome some of these problems as
PNA can form hybrids in low salt conditions where secondary and tertiary structures
are prevented from forming. The hybridisation signal can also be improved by
insertion of spacers in short oligonucleotide sequences reducing steric hindrance and
improving probe accessibility (Guo et al., 1994; Southern et al., 1999). Electric fields
can be also used to enhance the hybridisation rate and precisely regulate the
stringency of hybridisation (Edman et al., 1997; Cheng et al., 1998).
The most common method of signal detection is laser-induced fluorescence which is
detected using confocal optical scanners. The method of labelling depends on the
template that is used, on whether mutation detection or gene expression analysis will
be performed and whether high-density or spotted arrays are used. Various means
have been proposed to introduce the fluorescent dyes into the target cDNA or RNA
(Wodicka et al., 1997; de Saizieu et al., 1998; Eisen and Brown, 1999) with a single
dye required for Affymetrix high-density arrays and two dyes for differential
expression analysis on cDNA microarrays.
While spotted cDNA arrays intrinsically normalise for noise and background in a
pair-wise comparison they are at a disadvantage when different samples in an
experimental set are to be compared. With cDNA arrays each test sample must first be
compared to the same reference sample and then the relative ratios compared after a
normalisation procedure. The high-density oligonucleotide arrays however allow
flexibility in sample comparisons and provides an estimate of the levels of gene
transcripts in individual samples. Both these microarray formats have a similar
detection limit of approximately 3 copies per cell (Lockhart et al., 1996; Schena et al.,
![Page 36: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/36.jpg)
D. O’ Meara
30
1996) which is lower than that of classical northern blots and thus misses rare
transcripts but still provides sensitive and accurate information regarding the majority
of differentially expressed genes (Taniguchi et al., 2001).
DNA microarrrays produce huge quantities of data which pose a major bottleneck
especially in gene expression analysis. This problem is now being tackled and
software tools such as the cluster system described by Eisen to identify co-regulated
genes in expression analysis (Eisen et al., 1998) are being developed to analyse,
interpret, visualise and manage this huge volume of data.
Finally, the future of microarray technology probably lies in its transfer from the
research laboratory into industrial, clinical and other routine applications. This will
require new technological developments such as label free detection and flow-through
systems which is further discussed in a recent review (Blohm and Guiseppi-Elie,
2001).
![Page 37: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/37.jpg)
Molecular Tools for Nucleic Acid Analysis
31
Present Investigation
This thesis describes the development of nucleic acid methods for sample preparation,
diagnostics and sequence analysis. Initially biosensor technology was used to
optimise conditions for nucleic acid hybridisation (papers I and II). These results
demonstrated that modular probes significantly improved target capture and a
protocol based on such co-operative oligonucleotides for the capture of HCV RNA
from serum and for the clean-up of sequencing products was developed (papers III
and IV). Papers V and VII are concerned with techniques to screen for mutations and
polymorphisms. Here we investigated the feasibility of using pyrosequencing to
monitor the development of drug resistance mutations in HIV-1 (paper V) as well as
describing the development of an apyrase mediated allele-specific extension
technique (AMASE) for SNP typing on DNA microarrays (paper VI).
4 Nucleic acid hybridisation using modular primers
The properties of nucleic acid complementarity are utilised in many standard
molecular biology techniques including sample preparation, PCR, DNA sequencing,
genotyping, nucleic acid detection and analysis using DNA microarrays. Important
factors in such applications are the stability of the duplex formed and the presence of
secondary or tertiary structure in the target or probe. In this thesis the use of a
modular probe to enhance the capture of single-strand DNA, viral targets and
sequencing products was investigated.
Modular probes are short oligonucleotide modules that hybridise contiguously on a
template resulting in their mutual stabilisation (Kotler et al., 1993). This stabilisation
effect has been attributed to base stacking interactions between adjacent bases of the
oligonucleotides as nicked DNA complexes are more difficult to dissociate than
oligonucleotide arrangements with gaps. Indeed, structural conformation analysis has
revealed large similarities between nicked and continuous double-stranded DNA,
while a gapped double-stranded DNA was kinked and more flexible (Roll et al.,
1998). In addition, the melting temperature of the duplex is increased several degrees
in the presence of an adjacent oligonucleotide (Lin et al., 1989; Kandimalla et al.,
1995) while thermodynamic analysis shows that a nick is energetically favoured over
a gap by at least 1.4 kcal/mol (Lane et al., 1997). Various groups have also shown
![Page 38: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/38.jpg)
D. O’ Meara
32
that insertion of ≥ 1 nucleotide gaps results in less stable duplexes or can even prevent
duplex formation (Kharpko et al., 1991; Parinov et al., 1996). Although purine-purine
interactions have the highest energy of interaction (Norberg and Nilsson, 1995),
pyrimidine-pyrimidine and purine-pyrimidine interactions have also been show to
participate in base stacking with even one of the weakest combinations, T:A being
sufficient for stabilisation of hexamers stacked with immobilised 8 mer probes
(Parinov et al., 1996). Such modular probes have been found to prime polymerase
directed DNA sequencing reactions uniquely unlike either of the modules alone,
facilitating the manufacture of longer more specific primers from libraries of shorter
less specific primers (Kieleczawa et al., 1992; Kotler et al., 1994). These modules
have also been used in SBH strategies where a set of short oligonucleotide probes
with known sequence is used to identify the complementary sequence in an unknown
DNA target (Kharpko et al., 1991; Parinov et al., 1996).
Although these sequencing strategies have largely been replaced by shotgun
sequencing, the principle of stacking hybridisation can be utilised in many other areas
such as array technology, nucleic acid capture and antisense applications to stabilise
DNA-probe duplexes and to open up secondary structure. Indeed stacked
oligonucleotides have been investigated as potential antisense oligonucleotides and
have been shown to bind with more sequence specificity than longer oligonucleotides
(Kandimalla et al., 1995). Recently it has been shown that the rate of target capture by
immobilised hairpin probes with dangling ends (i.e. facilitates base stacking) is twice
that of immobilised linear probes forming a thermodynamically more stable duplex,
which may offer advantages in solid-phase hybridisation systems (Riccelli et al.,
2001). A modification of this approach is to insert a linker between two
oligonucleotides which also serves to increases their binding affinity and thermal
stability (Taylor et al., 2001). Here this co-operative effect between contiguous
oligonucleotides was exploited to enhance the capture of various nucleic acid targets
ranging from viral RNA templates to cycle sequencing products.
4.1 Investigation of the modular primer effect using biosensor technology (I,
II)
In paper I, various modular primer combinations were investigated using SPR-based
biosensor technology to enhance the capture of single-strand PCR products. Initially,
![Page 39: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/39.jpg)
Molecular Tools for Nucleic Acid Analysis
33
immobilised probes of 9-36 nucleotides in length were used for capture but
surprisingly they resulted in very low hybridisation signals. These poor hybridisation
responses are probably due to restricted reaction kinetics at the semi-solid-phase
surface and to secondary structure in the target sequence that prevents efficient
hybridisation. Indeed the target DNA used in this study is derived from the NTR of
HCV, which is predicted to have a high degree of secondary structure (Brown et al.,
1992). To overcome such limitations, the use of a modular probe that anneals adjacent
to the immobilised probe was investigated. This pre-hybridisation step takes place in
solution taking advantage of the more efficient hybridisation kinetics in solution
(Figure 10).
Figure 10. Schematic illustration of the opening up of secondary structure using a modular probe.
Using this strategy, a significant improvement in single-stranded capture was
achieved when a single pre-hybridising module of 11 nucleotides or longer was
employed. Interestingly, no dramatic difference was observed when the capture probe
was reduced in length from 18 nucleotides to 9 nucleotides. Actually the nonamer
capture probe together with two adjacently positioned nonamers (pre-hybridised)
could capture single-stranded DNA more efficiently than an 18 mer capture probe
combined with a nonamer modular that spans the same twenty-seven nucleotides in
the target sequence. This suggests that the length of the capturing probe is not the
most important parameter but rather it depends on the number and length of the
modular probes. However, even-though the nonamer (with two modular probes) could
capture DNA as effectively as the 18 mer probe (with a modular ≥11 nucleotides), it
displayed apparent faster dissociation kinetics. Insertion of a gap between the capture
and modular probes reduced the capture efficiency by 30-90%, with the introduction
of a gap being more detrimental in situations where multiple modules were employed.
![Page 40: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/40.jpg)
D. O’ Meara
34
This suggests that the base stacking interactions have been disrupted but that the
modules can still partly suppress secondary structure.
To further explore the mechanism behind the modular primer effect, biosensor
technology was used to quantitatively investigate this stabilisation phenomenon using
combinations of shorter hexamer modules (paper II). Two different target
oligonucleotides were immobilised on separate flow cells generating nicked, gapped
and overlapping modular hybridisation complexes. In the third flow cell, a mixture of
two targets was immobilised each separately comprising of either of the two
annealing sites. Initially the affinities of each of the individual hexamers was
determined by plotting the equilibrium response as a function of the amount of
analyte injected. The hexamers showed different affinities for the two targets despite
the fact that each contained the identical hexamer annealing site, which shows that the
surrounding sequence also influences the hybridisation. To investigate the modular
primer effect, pair-wise combinations of four DNA hexamers, at a fixed total
concentration but at varying concentration ratios were hybridised to the template
oligonucleotides. To observe co-operative effects, the arithmetic sum of the individual
responses of the corresponding hexamers was then subtracted from the responses
obtained from co-injections. A stabilisation effect was observed for the three adjacent
hybridisation formats while two out of three one-base gap formats and a one-base
overlap resulted in a small modular stabilisation effect.
The apparent combined affinities for DNA-DNA hexamers were also determined by
varying the total hexamer concentration. Individual affinities for two hexamers were
compared to the apparent affinities when increasing amounts of a stabilising hexamer
were added. Up to an 80-fold increase in apparent combined affinity was observed
when a low affinity hexamer was supplemented with a high-affinity modules while up
to a 20-fold increase was seen for the opposite combination. When the modules were
hybridised on separate templates there was no increase in apparent affinity showing
that the modules were unable to stabilise each other. Taken together, these results
show that stabilisation is dependant on the positioning and inherent affinities of the
adjacently annealing hexamer modules.
To investigate if the modular primer effect could also be observed for PNA, which
has a peptide rather than a sugar backbone, PNA/DNA and PNA/PNA combinations
were analysed. The results show that PNA hexamers stabilise each other and that
PNA-DNA hexamers can also interact co-operatively. However, in one example there
![Page 41: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/41.jpg)
Molecular Tools for Nucleic Acid Analysis
35
was no apparent co-operative effect between a PNA and a DNA hexamer, which was
probably due to the high inherent affinity displayed by this PNA hexamer. In
conclusion, this work shows that flexible systems for capture can be designed from
libraries of short oligonucleotides that co-operatively interact stabilising duplex
formation. Such adjacently hybridising probes could also be used to resolve
secondary structure, a common obstacle encountered in many different molecular
biology techniques (van Doorn et al., 1994; Brooks et al., 1995). This work also
illustrates that the biosensor is a useful analytical tool to optimise different
hybridisation formats prior to the development of hybridisation protocols for
preparative purposes as described in the following papers (papers III and IV).
4.2 Development of capture protocols using modular primers (III, IV)
Based on this data it was investigated whether a sensitive extraction protocol for HCV
RNA could be developed using such stabilising probes and bio-magnetic bead
technology. Hepatitis C is a positive-sense RNA virus with a genome of
approximately 9.5 Kb. Previously routine diagnosis of HCV infection was based on
detection of antibodies against viral antigens (Kuo et al., 1989) but this has largely
been replaced by amplification of HCV RNA by RT-PCR. Amplification of HCV
RNA also serves to monitor viremia levels in patients receiving antiviral therapy (Lee
et al., 1998) and to generate template for genotyping/subtyping (Zein 2000).
An important first step in HCV RT-PCR is the extraction of RNA from serum, which
concentrates the target and removes PCR inhibitors present in the sample. However,
standard protocols generally involve phenol chloroform extraction and precipitation
steps or silica absorption on spin columns, which are impractical in the development
of automated systems for the processing of large sample numbers in a clinical setting.
In this protocol magnetic beads were used for target capture, which allows for a rapid
change of reaction buffers and reagents simply by applying a magnetic field, thereby
circumventing centrifugation or precipitation steps. Such magnetic bead based
protocols have been described previously but have displayed less sensitivity than
conventional protocols (Heermann et al., 1994; van Doorn et al., 1994; Regan and
Margolin, 1997; Miyachi et al., 2000). In one of these reports, a rapid hybridisation
capture assay for HCV based on magnetic beads was described which showed a 10-
fold lower sensitivity than the conventional extraction procedure with the capture
![Page 42: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/42.jpg)
D. O’ Meara
36
efficiency varying considerably depending on the particular probe used (van Doorn et
al., 1994). Similar results which have been attributed to the loss of template DNA
during capture have been observed for other viral targets such as hepatitis B virus
(HBV) (Heermann et al., 1994) and poliovirus (Regan and Margolin, 1997). Indeed a
loss of 60% of the HCV RNA template after capture with magnetic beads has
previously been reported (Hsuih et al., 1996). This loss in sensitivity applies not only
to magnetic bead assays but commercial silica extraction methods have also been
shown to be less sensitive than conventional extraction protocols (Fanson et al.,
2000). This loss in sensitivity could be a critical factor when nucleic acid technology
(NAT) is used by manufacturers of blood products and blood banks to screen plasma
pools (for economical and technical reasons) instead of testing individual donations.
Here it was investigated whether nucleic acid capture strategies could be improved by
using the co-operatively interacting modular probes described in paper I which
hybridise to the 5′ NTR, a conserved region in HCV. In this protocol, a modular probe
was prehybridised to the viral RNA (following viral lysis) and the duplex was then
captured by a second probe that was covalently coupled to magnetic beads (Figure
11). The captured RNA was then subjected to an in-house RT-PCR amplification. The
capture probe used here was covalently coupled to the magnetic beads as non-specific
binding of template to streptavidin beads was observed when a biotinylated probe was
used (data not shown).
Serum +
RT-PCR bDNA assay
modular probe
Magnetic bead and capture probe
Figure 11. Biomagnetic capture of HCV RNA from serum samples. Following capture the RNA isanalysed by RT-PCR or quantified by bDNA.
![Page 43: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/43.jpg)
Molecular Tools for Nucleic Acid Analysis
37
Initially the protocol was applied to HCV recombinant DNA and recombinant RNA.
The sensitivity of the protocol was investigated by performing capture on a dilution
series of recombinant template followed by semi-nested PCR. This allows comparison
at the PCR plateau level where all dilutions have reached saturation irrespective of the
initial copy number. The results showed a 5-fold improvement in overall detection
sensitivity when a modular probe was employed in comparison to extraction with
only the capture probe. When the approach was evaluated on HCV positive serum
samples, capturing the entire viral target of 9.6 Kb, an increase in assay sensitivity of
5 to 25-fold was observed when a modular probe was employed. However, this end
point analysis which facilitated comparison of capture with and without a modular
probe allowed only for the determination of the sensitivity of the capture procedure
combined with an amplification step.
To address the sensitivity of the capture protocol in comparison to a conventional
extraction method [guanidinum thiocyanate extraction, phenol chloroform extraction
and ethanol precipitation (Chomczynski and Sacchi, 1987)], the amount of viral target
extracted by both methods was quantified by the bDNA assay (Table 4). Since the
bDNA assay undergoes a linear amplification, the capture efficiency with and without
the modular probe can also be quantified. These results show that capture with the
modular probe extracts on average twice as much RNA as capture without the
modular probe (Table 4) and that it captured RNA of different genotypes with
comparable sensitivity to the conventional extraction procedure.
Table 4. Comparison of the conventional extraction method with the oligonucleotide assisted capture
assay.
Quantity of HCV RNA extracted (MEq/ml)
Conventional
extraction
Capture with pre-
hybridising probe
Capture without pre-
hybridising probe
Genotype
1a 1.115 0.934 0.3651b 5.287 5.984 2.410
2b 5.735 4.147 1.9293a 0.944 0.913 0.852
![Page 44: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/44.jpg)
D. O’ Meara
38
The capture protocol followed by RT-PCR was also successfully applied to 21
clinical samples (previously quantified by the Amplicor HCV Monitor test) with a
sample that yielded a false-negative result in the Amplicor test successfully detected.
These results show that the protocol captured all the different HCV subtypes and
genotypes tested with viral capture failing in one of seven samples captured without a
modular probe.
In this study, probes complementary to the NTR of HCV, a conserved region that is
predicted to have a high degree of secondary structure (Kato et al., 1990; Choo et al.,
1991; Brown et al., 1992) were used. Suppression of such secondary structure by the
modular probes might be an explanation for the marked improvement in capture
observed. Indeed it has been previously reported that the method selected for RNA
extraction can have a profound effect on the sensitivity of the HCV assay (Nolte et
al., 1994). Unlike silica based isolation methods, non-specific RNA and DNA is
removed by this selective extraction method which should improve the sensitivity of
detection especially in samples with low copy number. This magnetic bead capture of
whole genomes should also minimise shearing of the RNA template, a critical factor
in the success of long range RT-PCR (Thiel et al., 1997). Therefore it can be
concluded that this capture protocol is a sensitive extraction method for HCV which is
amenable to automation using robotic workstations.
A similar strategy using magnetic beads and stacking hybridisation was then used for
the purification of cycle sequencing products prior to DNA sequencing (paper IV).
This clean-up step is critical to obtain good quality sequencing data as excess
unincorporated dyes (dye-terminators or dye-primers) and other contaminants such as
salt, proteins and template DNA can interfere with the separation and detection of
sequencing products, especially in capillary gel electrophoresis (CGE) (Tong and
Smith, 1993; Salas-Solano et al., 1998). Traditional purification methods use ethanol
precipitation or spin columns but such protocols that include extraction, centrifugation
or vacuum drying steps are cumbersome and thus difficult to automate. To circumvent
such procedures, a magnetic bead based method for the purification of cycle
sequencing products suitable for large-scale genome sequencing projects was
developed. A similar capture protocol which uses streptavidin magnetic beads to
purify biotin labelled sequencing products has also been described (Fangan et al.,
![Page 45: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/45.jpg)
Molecular Tools for Nucleic Acid Analysis
39
1999). While this approach is generic, it requires biotin labelling of the sequencing
primer and is compatible only with dye-terminator chemistry.
In the approach described here, capture probes complementary to the vector sequence
were coupled to magnetic beads and were used together with an adjacently annealing
modular probe. These probes were complementary to vector sequences and therefore
represent a universal system to capture sequencing products generated from all inserts
(Figure 12).
Addition of probes and magnetic beads to sequencing products.
Magnetic separation of beads and sequencing fragments
DiscardElute and load on gel
Re-use beads
*
*
*
*
Sequencing products
*
** sequencing
primer
template DNA
dNTPs/ddNTPs/salt
modular probe
capture probeand bead
polymerase
* sequencing fragments
*
*
*
*
*
*
Figure 12. Biomagnetic purification of dye-primer cycle sequencing products (also applicable to dye-terminator sequencing chemistry). Magnetic beads facilitate facile separation of unincorporatedlabelled sequencing primer, nucleotides, salts, proteins and template DNA from the Sanger fragments,all of which can interfere with injection, separation and detection of sequencing products.
In these experiments, an in-house bacterial genome project using pUC18 and
pBluescript SKII shotgun libraries, with insert sizes in the range of 800-2000 base
pair (bp) was used as a model system. Sanger fragments were generated using either
forward or reverse sequencing primers and for each vector and sequencing primer
combination, a specific capture and modular probe was used. These sequencing
fragments were then captured on the beads in a one-step hybridisation reaction.
![Page 46: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/46.jpg)
D. O’ Meara
40
Initially we investigated whether a stacking module resulted in improved capture of
cycle sequencing products. Comparison of capture with and without the modular
probe using the random pUC clones shows a higher signal intensity for capture with
the modular probe. Generally capture with the modular probe resulted in a higher
accuracy especially in the 400-500 bp region (Table 5) with more even peak heights
compared to capture without the modular probe.
Table 5. Comparison of the sequencing results of 15 different inserts in terms of accuracy over the first500 bases.
Purification method Accuracy
Capture without modular 97.7%
Ethanol precipitation 98.3%Capture with modular 99.6%
Optimal conditions for capture were determined to be incubation at 54°C for at least
15 minutes with ≥150 µg beads and 30 pmoles of modular probe. The temperature
appears to be critical with a sharp decrease in capture efficiency at temperatures
above and below the melting temperature of the capture probe. The quality of
sequencing data (after capture with the modular probe) also compared favourably to
traditional ethanol precipitation with a higher accuracy observed for the capture
protocol (Table 5). This is probably due to mis-annealed and extended sequencing
primers which co-precipitate with the sequencing product during ethanol
precipitation. An advantage of the capture protocol is that only the correctly extended
sequencing products will be purified, reducing background and improving accuracy.
In addition, double-stranded templates are removed which can otherwise interfere
with the separation efficiency and the electrokinetic injection step of CGE (Salas-
Solano et al., 1998). To test the compatibility of this capture protocol with CGE, 15
random pBluescript clones were subjected to cycle sequencing, capture and elution
and were then directly electroinjected. The capture protocol achieved a higher
accuracy over the first 100 bases in comparison to ethanol precipitation while the
remaining 500 bases had comparable accuracy. The purification method used prior to
CGE is of critical importance, as residual salt and ddNTPs decrease the amount of
DNA injected into the capillary column while injected DNA template decreases read-
length (Salas-Solano et al., 1998). This protocol also allows relatively facile
![Page 47: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/47.jpg)
Molecular Tools for Nucleic Acid Analysis
41
separation of sequencing reaction products unlike previously described purification
methods for CGE which have involved gel filtration steps (Ruiz-Martinez et al.,
1998).
A crucial factor in adapting this capture protocol to large-scale sample purification is
the cost and throughput of the system. To make this procedure more cost-efficient it
was investigated whether the magnetic beads could be re-used. Following elution of
the captured sequencing product, the beads were briefly washed and re-used up to 12
times. There was no apparent loss in signal intensity and chromatograms showed low
background, high accuracy and a high signal-to-noise ratio. We have also shown that
this capture protocol is highly specific, as only the complementary sequencing
fragments are extracted from a mix of sequencing products. This specificity has
facilitated multiplex sequencing reactions (bi-directional sequencing of one or more
vectors) where the individual products are iteratively captured by the different
probe/bead sets reducing reagent costs considerably (Blomstergren, 2001). This
protocol has now been adapted to an automated robotic workstation which allows a
throughput of 384 reactions (obtained from 96 quatroplex or 192 duplex reactions) in
two hours (Holmberg, 2001). In conclusion we have described a method which allows
a high-throughput clean-up of cycle sequencing reactions resulting in highly accurate
sequence data at a low cost that is suitable for capillary sequencers.
5 Analysis of mutations and polymorphisms
Conventional Sanger sequencing has been the workhorse of DNA sequencing
laboratories for the past twenty years but faces limitations such as cost and throughput
in light of the increasing reliance on genotypic data in the diagnostic and medical
fields. Consequently numerous groups have focused on the development of alternate
sequencing technologies such as SBH, pyrosequencing and enzymatic reactions on
DNA microarrays. Here we have investigated the feasibility of using pyrosequencing
to monitor the development of drug resistance mutations in HIV-1 (paper V) as well
as developing an apyrase mediated allele-specific extension technique for SNP typing
on DNA microarrays (paper VI).
![Page 48: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/48.jpg)
D. O’ Meara
42
5.1 Monitoring drug resistance mutations in HIV-1 by pyrosequencing (V)
Human immunodeficiency virus has caused approximately 20 million deaths world
wide and today an estimated 36 million people are infected with HIV-1 (CDC, 2001).
Human immunodeficiency virus infection is characterised by high rates of viral
replication and destruction of CD4+ T-lymphocytes which ultimately leads to immune
deficiency, acquired immunodeficiency syndrome (AIDS)-defining illnesses and
death. Consequently, inhibition of viral replication has assumed primary importance
in the control of AIDS. However, resistance to the currently available antiretroviral
therapy directed against the reverse transcriptase (RT) and protease gene is a
widespread problem affecting 30-50% of individuals receiving highly active
antiretroviral therapy (HAART) (Wit et al., 1999). Due to the high replication rate of
HIV-1 and the low fidelity of RT, various mutations are introduced into the HIV-1
gene pool leading to the evolution of genetically distinct viral variants termed
quasispecies. If antiviral therapy is sub-optimal, variants with reduced sensitivity to
the antiviral agents will be selected for (Condra, 1998). The presence of these drug
resistance mutations can be tested phenotypically by measuring the degree of
sensitivity to a drug in a cell culture (Hertogs et al., 1998). However, these tests are
costly and time consuming and hence are not suitable for use in the routine
management of HIV-1 patients. Due to advances in nucleic acid diagnostics and an
increased understanding of the effects of resistance mutations on viral drug
susceptibility, genotypic drug resistance is now more frequently used in clinical
laboratories. Currently the three most widely used genotypic strategies to identity the
mutant virus population are (i) by conventional Sanger sequencing which provides
complete sequence information of a defined region, (ii) by hybridisation to specific
probes that interrogate certain codons e.g. line probe assay (LiPA) and (iii) by
hybridisation analysis to DNA chips. Sanger sequencing is seen as the gold standard
for drug resistance testing but is labour-intensive and expensive for use in a routine
setting with large inter-laboratory differences in the quality of the results (Schuurman
et al., 1999). However, the introduction of dedicated kits (Visible Genetics and ABI)
may improve overall sequencing results and increase throughput. A line probe assay
for RT has been found to be accurate and reliable and more sensitive than sequencing
for detection of mixed viruses (Stuyver et al., 1997). However it interrogates only
nine codons and suffers from a high rate of hybridisation failures (Koch et al., 1999;
![Page 49: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/49.jpg)
Molecular Tools for Nucleic Acid Analysis
43
Servais et al., 2001). A prototype assay for protease (interrogates eight codons) has
found to be similar in performance to the RT line probe assay but without the high
hybridisation failure rate (Servais et al., 2001). The GeneChip from Affymetrix
consists of over 16,000 oligonucleotide probes complementary to protease and part of
the RT region (Vahey et al., 1999). On the basis of the hybridisation pattern, the HIV-
1 genomic sequence and mutations are simultaneously identified. However the
GeneChip is expensive and currently is not designed to identify insertions and
deletions implicated in resistance to specific drugs.
In paper V, the feasibility of using pyrosequencing as a genotyping tool to determine
the presence of drug resistance mutations in the protease gene of HIV-1 was
investigated. Twelve pyrosequencing primers were designed to sequence the 33
codons implicated in the 52 drug resistance mutations in the 297 bp of the protease
gene (Kuiken et al., 2000). While the main focus was on the seven primary mutations
(at codons 30, 46, 48, 50, 82, 84 and 90-represented by the black bars in Figure 13) as
well as the eleven secondary mutations (represented by shaded bars in Figure 13), a
further fifteen codons implicated in drug resistance were also sequenced.
Figure 13. The resistance patterns of HIV-1 protease inhibitors (PIs). The black bars represent primarymutations while the shaded bars represent secondar y mutations that are common to many PIs. Anadditional fifteen secondary mutations specific to individual PIs are not represented here.
Initially these twelve primers were evaluated on the HIV-1 Mn strain and on eight
proviral DNA samples (previously sequenced by Sanger sequencing) with all codons
implicated in drug resistance successfully sequenced and with an average read-length
of 26 bases obtained for each primer. Some ambiguities were observed in the
pyrograms due to positive or negative frameshifts. These frameshifts generally
Amprenavir
Saquinavir
Nelfinavir
Indinavir
Ritonavir
48 90
30
50 84
10 46 8220 7154
![Page 50: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/50.jpg)
D. O’ Meara
44
appeared late in the extension reaction probably due to inefficient nucleotide
degradation or enzyme contamination (Ronaghi, 2001). Nevertheless, these
ambiguities did not affect the interpretation of nucleotide sequence as they appeared
consistently which allowed for pattern discrimination between wild type and mutant
sequences. Some discordances were observed between the pyrosequencing data and
the Sanger sequencing data which can be explained by low viral DNA copy numbers
where the input viral DNA for the individual PCRs may not be representative of the
entire population.
This pyrosequencing approach was then evaluated on clinical samples where four
patients were monitored retrospectively for the development of drug resistance
mutations over a two and a half-year period. Resistance to indinavir (IDV) was
observed in patient 2 after two months of therapy and concurred with the appearance
of primary and secondary drug resistance mutations to IDV at codon 46 and 10
respectively. Therapy was then switched to two other PIs but viral load remained high
and several additional PI resistance mutations developed including the primary drug
resistant mutations to ritonavir (RTV) and saquinavir (SQV). In patient 3, a secondary
mutation was present as a minor variant in the PI-naïve sample but during suboptimal
PI treatment it had a selective advantage over the other variants and thus became the
dominant population. Resistance to IDV, RTV and SQV was observed in patient 4 but
only one primary drug resistance mutation (to SQV) was observed. This could
indicate problems with treatment adherence or drug absorption.
A limitation of almost all resistance testing assays is their relative insensitivity to
detect minority variants in the virus population. Here the limit of detection of
pyrosequencing was determined to be 25%, which is comparable to conventional
sequencing strategies (Leitner et al., 1993; Schuurman et al., 1999). Indeed a
quasispecies present at 25% of the total population that was missed by conventional
Sanger sequencing was detected by pyrosequencing and confirmed by clonal analysis.
In conclusion, pyrosequencing is a rapid robust technique for monitoring the
development of drug resistance mutations in the protease gene allowing the
sequencing of eight patients in one hour. However, for pyrosequencing to be useful in
drug resistance testing in a clinical setting the assay would need to be extended to
include the sequencing of the drug resistance mutations in RT. This would require the
design of at least another 30 sequencing primers, which is not a trivial task given the
polymorphic nature of HIV-1. However, primer mismatches were generally well
![Page 51: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/51.jpg)
Molecular Tools for Nucleic Acid Analysis
45
tolerated in this study, as there were only three cases where mismatches lead to poor
sequencing results with these 12 pimers. While base calling and pattern recognition
was performed manually here, software to perform automatic base calling has now
been developed but interpretation of mixed variants must still be performed manually
and would not be practical in a routine clinical laboratory. However, the appearance
of an unexpected pattern could indicate that a polymorphism exists at a particular
codon and pyrosequencing could then be used for clonal analysis of this sample to
determine whether mixed variants are present in the population.
5.2 SNP typing on DNA microarrays (VI)
As well as monitoring the development of mutations in the HIV-1 viral nucleic acid
we have also typed (by allele-specific extension) a polymorphism in the chemokine
receptor CCR5, which is believed to confer resistance to HIV-1 infection or at least
delay the development of AIDS (Dean et al., 1996). This 32 bp deletion lies on the
short arm of chromosome 3 (3p21) with individuals homozygous for the deletion
being largely resistant to HIV-1 infection despite multiple sexual contacts with HIV-1
infected individuals, while heterozygotes are partially protected against disease
progression. The deletion results in a severely truncated CCR5 protein, which is not
presented at the cell surface and therefore cannot act as a co-receptor for HIV-1 (Liu
et al., 1996). It is believed that a number of other SNPs could also confer resistance
(Paxton and Kang, 1998) but association studies need to be carried out before they
can be associated with delayed disease progression or increased resistance to HIV-1.
To facilitate such large-scale association studies, high-throughput, accurate and robust
techniques are required to screen candidate SNPs. Here we have developed a
microarray based allele-specific extension method for the accurate typing of SNPs
which has the potential to analyse up to 12,500 SNPs per microarray.
Allele-specific extension methodology was first described by Newton in 1989 who
used allele-specific primers (with their 3′ terminus annealing at the variant position)
for amplification (Newton et al., 1989). The specificity of this ARMS technique
depends on the ability of polymerases to bind and extend perfectly matched primers in
comparison to a primer that is mismatched at the 3′ terminus (Newton et al., 1989).
However a problem which has greatly hampered the development of these allele
based discrimination methods is that some mismatches are not refractory to extension
![Page 52: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/52.jpg)
D. O’ Meara
46
(Newton et al., 1989; Wu et al., 1989; Kwok et al., 1990; Ayyadevara et al., 2000),
which can result in incorrect genotyping and almost certainly reduces the
discriminatory power of the method. Mismatches such as GT or CA are clearly not
refractory to extension (Newton et al., 1989) and in two independent studies it was
observed that generally all T mismatches were well extended in addition to CA
mismatches (Kwok et al., 1990; Huang et al., 1992).
The addition of apyrase, a nucleotide degrading enzyme, to allele-specific extension
reactions to minimise the extension of such mismatches has previously been described
(Ahmadian et al., 2001). This AMASE assay exploits the fact that DNA polymerases
exhibit slower reaction kinetics when extending a mismatched primer compared to a
perfectly matched primer allowing incorporation of nucleotides when the reaction
kinetics are fast but degrading the nucleotides before extension when the reaction
kinetics are slow. The principle has previously been illustrated in a real-time
bioluminometric detection format where inclusion of apyrase resulted in the correct
typing of eight variants which were incorrectly or ambiguously typed when apyrase
was omitted (Ahmadian et al., 2001). Here using microarray technology, the
genotyping of twelve polymorphisms in seventeen individuals based on this principle
is described. These twelve polymorphisms consist of ten single nucleotide
substitutions in genes that are implicated as risk factors for myocardial infarction
(Odeberg et al., 2001) and in the p53 tumour suppresser gene (Ahmadian et al.,
2000). An insertion/deletion in a candidate gene for coronary heart disease (Odeberg
et al., 2001) and in CCR5 were also typed (Dean et al., 1996). A pair of allele-specific
extension primers (with differing 3′ termini) were used for each SNP which generated
six A(primer):C(template)/G:T mismatches, two C:A/T:G, two C:T/A:G and one of
each of the mismatches G:A/T:C and G:G/C:C as well as generating the perfectly
matched primer:template duplexes. These extension primers were covalently coupled
to the slide surface thereby facilitating hybridisation and in situ extension of target
DNA.
Initially the conditions for hybridisation of target DNA to the microarray were
optimised and factors such as a spacer sequence and stabilising probes were
investigated. Synthesis of the extension primers with a 15 T spacer at the 5′ end
improved the hybridisation signal presumably because of the reduced steric hindrance
between target and probe as suggested by previous studies (Southern et al., 1999). It
![Page 53: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/53.jpg)
Molecular Tools for Nucleic Acid Analysis
47
was also investigated whether the modular probe effect could be extended to
microarrays to improve the amount of target hybridised to the printed
oligonucleotides. A 1.5 to a 5-fold improvement in the absolute amount of
methylenetetrahydrofolate reductase (MTHFR) and p53 DNA captured was observed
when a modular probe was prehybridised to the target DNA (Figure 14).
Although the role of base stacking is unclear here due to the presence of the 15 T
spacer, opening up of secondary structure is probably involved. Modular probes were
thus employed for all 12 polymorphisms typed and it is envisioned that they will be
particularly beneficial when AMASE is scaled up to type thousands of SNPs using
multiplex PCR products. In previous allele-specific extension assays performed on
microarrays, a reduction in absolute signal was observed when multiplex PCR
products were used (Pastinen et al., 2000). Thus the modular probes may help achieve
higher overall signals if employed in such scaled up assay formats.
Modular probe
+ -
s/s p53 s/s p53
Modular probe
0
4000
8000
12000
16000
+ -
Figure 14. Improvement of hybridisation efficiency using modular primer on oligonucleotidemicroarrays. Fluorescently labelled single-strand p53 DNA (with and without a modular primer) washybridised to the immobilised capture probe. The slides were scanned and the raw data analysed, whichshows a 5-fold improvement in the amount of DNA captured when a modular probe was included.
The presence/absence of apyrase and its effect on genotyping using oligonucleotide
microarrays was then investigated. When allele-specific extension was performed
without apyrase, five of the thirty-six (14%) different variants typed were incorrectly
scored. These were all homozygous variants that were scored as heterozygous when
![Page 54: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/54.jpg)
D. O’ Meara
48
apyrase was omitted, due to equal extension of the matched and mismatched primer.
These five variants comprised of three nucleotide substitutions, a 4G/5G insertion and
the 32 bp deletion. Not surprisingly, four of the five mismatches that were extended in
the absence of apyrase were mismatches that are difficult to discriminate i.e. G:T, T:G
and A:C.
AMASE was then applied to the typing of the ten SNPs and two insertion/deletion
polymorphisms in seventeen individuals generating approximately 200 genotypes.
Cluster analysis was performed on this data by plotting allelic fraction (estimates the
relative amount of the major allele in the sample) versus the total fluorescence which
showed a clear clustering of the allelic fractions for all twelve polymorphisms
corresponding to the three possible genotypes (Figure 15).
Figure 15. Cluster diagram showing the genotype assignment for the 17 individuals at each of thetwelve polymorphic positions. The relative allelic fraction versus the log of the total fluorescencesignal is plotted for each polymorphism. The dashed lines represents the boundaries for scoring asample homozygous (≤ 0.2 and ≥ 0.8) or heterozygous (0.29-0.71).
Boundaries were then calculated allowing a deviation of 3-fold the standard deviation
from the expected allelic fractions of 0.5 or 0.001/0.999 for heterozygous and
homozygous samples respectively. These boundaries determined the range of allelic
frequencies a sample had to fall between to be scored as heterozygous or homozygous
(for the major or minor allele). This means that for a sample to be called heterozygous
it must have an allele fraction between 0.29-0.71. The allelic fraction for the 58
heterozygous samples scored here ranged from 0.35 to 0.65 which corresponds to
0
1
2
3
4
5
6
0 0.2 0.4 0.6 0.8 1
Log
tota
l flu
ores
cenc
e
Allelic fraction
![Page 55: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/55.jpg)
Molecular Tools for Nucleic Acid Analysis
49
extension ratios <2 (i.e. the extension signal of one primer is no more than 2-fold
greater than the extension signal of the other primer). If a sample is to be scored as
homozygous for the minor or wild type allele it must have an allele fraction ≤0.2 or
≥0.8 respectively. In this study, allele fractions ranging from 0.01-0.18 for the minor
allele and from 0.86-0.99 for the major allele were observed. These boundaries mean
that for a sample to be called homozygous, one primer most be extended at least 4-
fold more than the other primer. The ratios obtained here after extension with apyrase
ranged from 4.6 to 314 with an average ratio of 23.
This microarray based allele-specific extension assay is a rapid, robust and accurate
method for large-scale genotyping. The assay can be completed in less than an hour
(excluding printing of the array, sample preparation and data analysis) with current
technology having the capacity to interpret up to 12,500 SNPs. The key parameters
for consideration for large-scale genotyping were recently outlined by Lai and
included the cost (<$0.2 per genotype), no-call rate (should be <10%), error rate
(should be <1%), throughput (≥ 50,000 genotypes per day) and potential for
multiplexing (≥ 10 x) (Lai, 2001). Here we have addressed at least two of these
parameters i.e. the no call rate and error rate. Other microarray based allele specific
extension formats have a high error/no call rate with samples scored as homozygous
even though extension ratios of only 1.4 were obtained (Erdogan et al., 2001).
Despite the setting of boundaries for SNP scoring, there were no samples here that
failed to be typed when apyrase was included. Indeed all 198 genotypes (which
included at least one sample of each variant) were scored correctly. However the
degree of multiplexing still needs to be addressed which is a problem for most of the
available SNP technologies with techniques such as rolling-circle perhaps offering a
solution to this problem (Lizardi et al., 1998).
Apyrase could also be included in SBE minisequencing formats where the accuracy
of typing depends on how reliably the DNA polymerase discriminates between
incorporation of a matched or mismatched dideoxynucleotide (Syvänen et al., 1993).
Like allele-specific extension, these SBE assays are also prone to polymerase errors
due to mispriming of the minisequencing extension primer (Fan et al., 2000; Prince et
al., 2001). However allele-specific extension methods requiring only a single
detection reaction of one fluorophore are more compatible with large-scale
genotyping than SBE formats where a number of separate extension or detection
![Page 56: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/56.jpg)
D. O’ Meara
50
reactions have to be carried out (Fan et al., 2000). Another advantage of this AMASE
method is that extension is performed in situ on the microarray rather than in solution
as described for many of the SBE techniques (Fan et al., 2000; Hirschhorn et al.,
2000).
6 Concluding remarks
In conclusion, a variety of molecular tools such as biosensor technology, magnetic
beads, pyrosequencing, apyrase mediated allele-specific extension and
oligonucleotide microarrays have been used for nucleic acid analysis. Biosensor
technology was used to investigate the kinetic properties of hybridisation, which led
to the development of stabilising modular probes to improve the capture of nucleic
acids. Such stabilising probes were used to extract viral RNA and to clean-up
sequencing products resulting in sensitive extraction protocols that are amenable to
automation. A pilot study of pyrosequencing illustrated that it could be employed to
rapidly screen HIV-1 patients for drug resistance mutations in the protease gene.
Finally, DNA microarray technology was used in the development of a high-
throughput genotyping method based on AMASE which has the potential to type up
to 12,500 SNPs in one hour.
![Page 57: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/57.jpg)
Molecular Tools for Nucleic Acid Analysis
51
Abbreviations
AMASE apyrase mediated allele-specific extensionARMS amplification refractory mutation systemASO allele-specific oligonucleotideATP adenosine triphosphatebDNA branched DNAbp basepairsCCR5 cysteine-cystein chemokine recepetorcDNA complementary DNACFLP cleavage fragment length polymorphismCGE capillary gel electrophoresisDGGE denaturing gradient gel electrophoresisDHPLC denaturing high performance liquid chromatographyDNA deoxyribonucleic aciddNTP deoxynucleotide triphosphateddNTP dideoxynucleotide triphosphateHA hetroduplex analysisHAART highly active antiretroviral therapyHBV hepatitis B virusHCV hepatitis C virusHGP Human Genome ProjectHIV human immunodeficiency virusHPV human papilloma virusFRET fluorescence resonance energy transferIDV indinavirKb kilo baseLCR ligase chain reactionMALDI matrix-assisted laser desorption ionisationMb mega basesmRNA messenger RNAMS mass spectroscopyNASBA nucleic acid based sequence amplificationNAT nucleic acid technology NTR non-translated regionOLA oligonucleotide ligation assayPCR polymerase chain reactionQC-PCR quantitative competitive PCRPI protease inhibitorPNA peptide nucleic acidPPi pyrophosphateRCA rolling-circle amplificationRFLP restriction fragment length polymorphismRNA ribonucleic acidRT reverse transcriptaseRTV ritonavirRU resonance unitsSBE single base extensionSBH sequencing by hybridisationSNP single nucleotide polymorphismSPR surface plasmon resonanceSSCP single-strand conformation polymorphismSQV saquinavirTOF time of flightTSC The SNP Consortium
![Page 58: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/58.jpg)
D. O’ Meara
52
Acknowledgements
I am grateful to the entire staff at the Department of Biotechnology for creating anexcellent working environment and for your friendship and help over the past fewyears. I am especially grateful to;
My supervisor, Prof. Joakim Lundeberg for all your help when I first arrived inStockholm, for your support and encouragement, for giving me so manyopportunities, for helping me reach this point and for your unending enthusiasm.
Prof. Mathias Uhlén, for accepting me as a PhD. student and for the creativeatmosphere you bring to the DNA corner.
Shea Fanning of Cork Institute of Technology, for introducing me to the world ofmolecular biology and for giving me the inspiration and encouragement to come hereto do a PhD.
Per-Åke for your thoughtful reflections on modular probes and hybridisation andStefan for helping things go smoothly at the beginning.
Jacob Odeberg for “showing me the ropes” in the lab and for good collaborations.Peter Nilsson for answering all my trivial questions about biacore and microarraysand for the work with the Mut S project that never came to be. Afshin Ahmadian forall your help in the last few months and for interesting discussions on AMASE andAnna Blomstergren for successfully using the modular probes with sequencingproducts.
My collaborators, Jan Albert, Thomas Leitner and Karin Wilbe for teaching me someof your knowledge about HIV, Zhibing Yun and Anders Sönnerberg for good workon the HCV project and to Dynal AS, Oslo for fruitful projects and for supplying mewith beads.
Påls group, Baback and Carlos for friendship and help with pyrosequencing andTommy and Jonas for the use of your enzymes.
Everybody in the department, but especially Eric and Anders for keeping thecomputers and network running smoothly, Bahram and Co. for all the sequencingruns, Kicki for keeping everything in order in relation to PCR, all in ex “Blå-kulla”(and Anna G, Åsa, Cissi and Malin N) for help with various things, Monica and Piafor taking care of administrative matters, Afshin, Torbjörn and Christin for answeringmy various questions about printing this thesis, everybody in the ex “storra labbet” forpleasant company and Tanya, Joke, Bertha, Naowarat and Mostafa for friendship andhelp.
![Page 59: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/59.jpg)
Molecular Tools for Nucleic Acid Analysis
53
My Irish friends here, with a special thanks to Mary and Barbara for all your help andcompanionship, for the shared experiences of being a PhD. student in Stockholm andnot least for the laughs we had. To Susan and Hans (and Ellen) for friendship, dinnersand memorable parties. To Alison for her friendship and John Kennedy forintroducing me to a large circle of friends in my first few months here.
Anders, Tuan and Christina, Vinay and Clara, Helena and Caj, Chris and Anna for thegood times we have had in Stockholm.
My friends in Ireland; Sheila and James, Karen, Caroline and Jim, Dorothy, Louiseand Gaye.
A heartfelt thanks to my family, Carmel and Laura, Catriona, Joseph, Paul and myparents for all your support during the years.
To Allen, for your love, support and understanding. I would never have made itwithout you.
![Page 60: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/60.jpg)
D. O’ Meara
54
References
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides,P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., and Galle, R. F. 2000. The genomesequence of Drosophila melanogaster. Science 287:2185-95.
Agaton, C., Sievertzon, M., Unneberg, P., Holmberg, A., Larsson, M., Odeberg, J.,Uhlén, M., and J, L. 2001. Gene Expression Analysis by Signature Pyrosequencing.Submitted.
Ahmadian, A., Gharizadeh, B., Gustafsson, A. C., Sterky, F., Nyrén, P., Uhlén, M.,and Lundeberg, J. 2000. Single-nucleotide polymorphism analysis bypyrosequencing. Anal Biochem 280:103-10.
Ahmadian, A., Gharizadeh, B., O' Meara, D., Odeberg, J., and Lundeberg, J. 2001.Genotyping by apyrase mediated allele-specific extension. Submitted.
Anderson, R. C., Su, X., Bogdan, G. J., and Fenton, J. 2000. A miniature integrateddevice for automated multistep genetic assays. Nucleic Acids Res 28:E60.
Ansorge, W., Sproat, B. S., Stegemann, J., and Schwager, C. 1986. A non-radioactiveautomated method for DNA sequence determination. J Biochem Biophys Methods13:315-23.
Arens, M. 2001. Clinically relevant sequence-based genotyping of HBV, HCV, CMV,and HIV. J Clin Virol 22:11-29.
Avery, O. T., MacLeod, C. M., and MacCarthy, M. 1944. Studies on the chemicalnature of the substance inducing transformationof pneumoccal types. J. Exp. Med.79:137-158.
Ayyadevara, S., Thaden, J. J., and Shmookler Reis, R. J. 2000. Discrimination ofprimer 3'-nucleotide mismatch by taq DNA polymerase during polymerase chainreaction. Anal Biochem 284:11-8.
Bains, W., and Smith, G. C. 1988. A novel method for nucleic acid sequencedetermination. J Theor Biol 135:303-7.
Baner, J., Nilsson, M., Mendel-Hartvig, M., and Landegren, U. 1998. Signalamplification of padlock probes by rolling circle replication. Nucleic Acids Res26:5073-8.
Barany, F. 1991. Genetic disease detection and DNA amplification using clonedthermostable ligase. Proc Natl Acad Sci U S A 88:189-93.
Becker-Andre, M., and Hahlbrock, K. 1989. Absolute mRNA quantification using thepolymerase chain reaction (PCR). A novel approach by a PCR aided transcripttitration assay (PATTY). Nucleic Acids Res 17:9437-46.
![Page 61: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/61.jpg)
Molecular Tools for Nucleic Acid Analysis
55
Berg, C., Hedrum, A., Holmberg, A., Pontén, F., Uhlén, M., and Lundeberg, J. 1995.Direct solid-phase sequence analysis of the human p53 gene by use if multiplexpolymerase chain reaction and α-thiotriphosphate nucleotides. Clin. Chem. 41:1461-1466.
Blanchard, A. 1998. Synthetic DNA arrays. Genet Eng 20:111-23.
Blohm, D. H., and Guiseppi-Elie, A. 2001. New developments in microarraytechnology. Curr Opin Biotechnol 12:41-7.
Blomstergren, A. 2001. Automated solid phase capture of multiplex cycle sequencingproducts. Unpublished.
Braun, A., Little, D. P., and Koster, H. 1997. Detecting CFTR gene mutations byusing primer oligo base extension and mass spectrometry. Clin Chem 43:1151-8.
Brinchmann, J. E., Albert, J., and Vartdal, F. 1991. Few infected CD4+ T cells but ahigh proportion of replication- competent provirus copies in asymptomatic humanimmunodeficiency virus type 1 infection. J Virol 65:2019-23.
Brooks, E. M., Sheflin, L. G., and Spaulding, S. W. 1995. Secondary structure in the3' UTR of EGF and the choice of reverse transcriptases affect the detection ofmessage diversity by RT-PCR. Biotechniques 19:806-815.
Brown, E. A., Zhang, H., Ping, L. H., and Lemon, S. M. 1992. Secondary structure ofthe 5´ nontranslated regions of hepatitis C virus and pestivirus genomic RNAs.Nucleic Acids Res. 20:5041-5045.
Bunemann, H. 1982. Immobilization of denatured DNA to macroporous supports: II.Steric and kinetic parameters of heterogeneous hybridization reactions. Nucleic AcidsRes 10:7181-96.
Bustin, S. A. 2000. Absolute quantification of mRNA using real-time reversetranscription polymerase chain reaction assays. J Mol Endocrinol 25:169-93.
CDC. The Center for Disease Control and Prevention:The global HIV and AIDSepidemic, 2001. Jama 285:3081-3.
Chamberlain, J., Gibbs, R., Ranier, J., Nguyen, P., and Caskey, C. 1988. Deletionscreening of the Duchenne muscular dystrophy locus via multiplex DNAamplification. Nucleic Acid Res 16:11141-11156.
Chee, M., Yang, R., Hubbell, E., Berno, A., Huang, X. C., Stern, D., Winkler, J.,Lockhart, D. J., Morris, S. F., and Fodor, S. P. 1996. Accessing genetic informationwith high-density DNA arrays. Science 274:610-614.
Cheng, J., Sheldon, E. L., Wu, L., Uribe, A., Gerrue, L. O., Carrino, J., Heller, M. J.,and O'Connell, J. P. 1998. Preparation and hybridization analysis of DNA/RNA fromE. coli on microfabricated bioelectronic chips. Nat Biotechnol 16:541-6.
![Page 62: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/62.jpg)
D. O’ Meara
56
Cheskis, B., and Freedman, L. P. 1996. Modulation of nuclear receptor interactions byligands: kinetic analysis using surface plasmon resonance. Biochemistry 35:3309-18.
Cho, R. J., Mindrinos, M., Richards, D. R., Sapolsky, R. J., Anderson, M., Drenkard,E., Dewdney, J., Reuber, T. L., Stammers, M., and Federspiel, N. 1999. Genome-widemapping with biallelic markers in Arabidopsis thaliana. Nat Genet 23:203-7.
Chomczynski, P., and Sacchi, N. 1987. Single-step method of RNA isolation by acidguanidinium thiocyante-phenol-chloroform extraction. Anal. Biochem. 162:156-159.
Choo, Q. L., Richman, K. H., Han, J. H., Berger, K., Lee, C., Dong, C., Gallegos, C.,Coit, D., Medina-Selby, A., Barr, P. J., Weiner, A. J., Bradley, D. W., Kuo, G., andHoughton, M. 1991. Genetic organization and diversity of the hepatitis C virus. Proc.Natl. Acad. Sci. USA 88:2451-2455.
Chou, Q., Russell, M., Birch, D. E., Raymond, J., and Bloch, W. 1992. Prevention ofpre-PCR mis-priming and primer dimerization improves low-copy-numberamplifications. Nucleic Acids Res 20:1717-23.
Compton, J. 1991. Nucleic acid sequence-based amplification. Nature 350:91-2.
Condra, J. H. 1998. Resistance to HIV protease inhibitors. Haemophilia 4:610-5.
Cronin, M. T., Fucini, R. V., Kim, S. M., Masino, R. S., Wespi, R. M., and Miyada,C. G. 1996. Cystic fibrosis mutation detection by hybridization to light-generatedDNA probe arrays. Hum Mutat 7:244-55.
de Saizieu, A., Certa, U., Warrington, J., Gray, C., Keck, W., and Mous, J. 1998.Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays.Nat Biotechnol 16:45-8.
de Silva, D., and Wittwer, C. T. 2000. Monitoring hybridization during polymerasechain reaction. J Chromatogr B Biomed Sci Appl 741:3-13.
Dean, M., Carrington, M., Winkler, C., Huttley, G. A., Smith, M. W., Allikmets, R.,Goedert, J. J., Buchbinder, S. P., Vittinghoff, E., and Gomperts, E. 1996. Geneticrestriction of HIV-1 infection and progression to AIDS by a deletion allele of theCKR5 structural gene. Hemophilia Growth and Development Study, MulticenterAIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco CityCohort, ALIVE Study. Science 273:1856-62.
DeRisi, J., Penland, L., Brown, P. O., Bittner, M. L., Meltzer, P. S., Ray, M., Chen,Y., Su, Y. A., and Trent, J. M. 1996. Use of a cDNA microarray to analyse geneexpression patterns in human cancer. Nat Genet 14:457-60.
Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., and Mattick, J. S. 1991.'Touchdown' PCR to circumvent spurious priming during gene amplification. NucleicAcids Res 19:4008.
![Page 63: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/63.jpg)
Molecular Tools for Nucleic Acid Analysis
57
Drmanac, R., Labat, I., Brukner, I., and Crkvenjakov, R. 1989. Sequencing ofmegabase plus DNA by hybridization: theory of the method. Genomics 4:114-28.
Drmanac, S., Kita, D., Labat, I., Hauser, B., Schmidt, C., Burczak, J. D., andDrmanac, R. 1998. Accurate sequencing by hybridization for DNA diagnostics andindividual genomics. Nat Biotechnol 16:54-8.
Duck, P., Alvarado-Urbina, G., Burdick, B., and Collier, B. 1990. Probe amplifiersystem based on chimeric cycling oligonucleotides. Biotechniques 9:142-8.
Edman, C. F., Raymond, D. E., Wu, D. J., Tu, E., Sosnowski, R. G., Butler, W. F.,Nerenberg, M., and Heller, M. J. 1997. Electric field directed nucleic acidhybridization on microchips. Nucleic Acids Res 25:4907-14.
Eisen, M., and Brown, P. 1999. DNA arrays for analysis of gene expression. In:Methods in Enzymology:cDNA preparation and characterisation. (S. Weissman, ed.),Academic Press, pp. 179-205.
Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. 1998. Cluster analysisand display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95:14863-8.
Erdogan, F., Kirchner, R., Mann, W., Ropers, H. H., and Nuber, U. A. 2001.Detection of mitochondrial single nucleotide polymorphisms using a primerelongation reaction on oligonucleotide microarrays. Nucleic Acids Res 29:E36.
Erlich, H. A., Gelfand, D., and Sninsky, J. J. 1991. Recent advances in the polymerasechain reaction. Science 252:1643-51.
Fan, J. B., Chen, X., Halushka, M. K., Berno, A., Huang, X., Ryder, T., Lipshutz, R.J., Lockhart, D. J., and Chakravarti, A. 2000. Parallel genotyping of human SNPsusing generic high-density oligonucleotide tag arrays. Genome Res 10:853-60.
Fangan, B. M., Dahlberg, O. J., Deggerdal, A. H., Bosnes, M., and Larsen, F. 1999.Automated system for purification of dye-terminator sequencing products eliminatesup-stream purification of templates. Biotechniques 26:980-3.
Fanson, B. G., Osmack, P., and Di Bisceglie, A. M. 2000. A comparison between thephenol-chloroform method of RNA extraction and the QIAamp viral RNA kit in theextraction of hepatitis C and GB virus- C/hepatitis G viral RNA from serum. J VirolMethods 89:23-7.
Faruqi, A. F., Hosono, S., Driscoll, M. D., Dean, F. B., Alsmadi, O., Bandaru, R.,Kumar, G., Grimwade, B., Zong, Q., Sun, Z., Du, Y., Kingsmore, S., Knott, T., andLasken, R. S. 2001. High-throughput genotyping of single nucleotide polymorphismswith rolling circle amplification. BMC Genomics 2:4.
Ferguson, J. A., Steemers, F. J., and Walt, D. R. 2000. High-density fiber-optic DNArandom microsphere array. Anal Chem 72:5618-24.
![Page 64: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/64.jpg)
D. O’ Meara
58
Fredricks, D. N., and Relman, D. A. 1999. Application of polymerase chain reactionto the diagnosis of infectious diseases. Clin Infect Dis 29:475-86; quiz 487-8.
Fry, G., Lachenmeier, E., Mayrand, E., Giusti, B., Fisher, J., Johnston-Dow, L.,Cathcart, R., Finne, E., and Kilaas, L. 1992. A new approach to template purificationfor sequencing applications using paramagnetic particles. Biotechniques 13:124-131.
Fu, D. J., Tang, K., Braun, A., Reuter, D., Darnhofer-Demar, B., Little, D. P.,O'Donnell, M. J., Cantor, C. R., and Koster, H. 1998. Sequencing exons 5 to 8 of thep53 gene by MALDI-TOF mass spectrometry. Nat Biotechnol 16:381-4.
Garcia, C. A., Ahmadian, A., Gharizadeh, B., Lundeberg, J., Ronaghi, M., and Nyrén,P. 2000. Mutation detection by pyrosequencing: sequencing of exons 5-8 of the p53tumor suppressor gene. Gene 253:249-57.
Garland, P. B. 1996. Optical evanescent wave methods for the study of biomolecularinteractions. Q Rev Biophys 29:91-117.
Gerhold, D., Lu, M., Xu, J., Austin, C., Caskey, C. T., and Rushmore, T. 2001.Monitoring expression of genes involved in drug metabolism and toxicology usingDNA microarrays. Physiol Genomics 5:161-70.
Gerhold, D., Rushmore, T., and Caskey, C. T. 1999. DNA chips: promising toys havebecome powerful tools. Trends Biochem Sci 24:168-73.
Germer, J. J., Rys, P. N., Thorvilson, J. N., and Persing, D. H. 1999. Determination ofhepatitis C virus genotype by direct sequence analysis of products generated with theAmplicor HCV test. J Clin Microbiol 37:2625-30.
Gharizadeh, B., Kalantari, M., Garcia, C. A., Johansson, B., and Nyrén, P. 2001.Typing of human papillomavirus by pyrosequencing. Lab Invest 81:673-9.
Gilliland, G., Perrin, S., Blanchard, K., and Bunn, H. F. 1990. Analysis of cytokinemRNA and DNA: detection and quantitation by competitive polymerase chainreaction. Proc Natl Acad Sci U S A 87:2725-9.
Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W., Dujon, B., Feldmann, H.,Galibert, F., Hoheisel, J. D., Jacq, C., and Johnston, M. 1996. Life with 6000 genes.Science 274:546, 563-7.
Graber, J. H., Smith, C. L., and Cantor, C. R. 1999. Differential sequencing with massspectrometry. Genet Anal 14:215-9.
Graves, D. J. 1999. Powerful tools for genetic analysis come of age. TrendsBiotechnol 17:127-34.
Greenfield, L., and White, T. J. 1993. Sample preparation methods. In: DiagnosticMolecular Microbiology:Principles and Applications (D. H. Persing, T. F. Smith, F.C. Tenover, and T. J. White, eds.), ASM Press, Washington, D.C., pp. p122-137.
![Page 65: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/65.jpg)
Molecular Tools for Nucleic Acid Analysis
59
Guatelli, J. C., Whitfield, K. M., Kwoh, D. Y., Barringer, K. J., Richman, D. D., andGingeras, T. R. 1990. Isothermal, in vitro amplification of nucleic acids by amultienzyme reaction modeled after retroviral replication. Proc Natl Acad Sci U S A87:7797.
Guo, Z., Guilfoyle, R. A., Thiel, A. J., Wang, R., and Smith, L. M. 1994. Directfluorescence analysis of genetic polymorphisms by hybridization with oligonucleotidearrays on glass supports. Nucleic Acids Res 22:5456-65.
Guo, Z., Liu, Q., and Smith, L. M. 1997. Enhanced discrimination of singlenucleotide polymorphisms by artificial mismatch hybridization. Nat Biotechnol15:331-5.
Gustafsson, A. C., Guo, Z., Hu, X., Ahmadian, A., Brodin, B., Nilsson, A., Ponten, J.,Ponten, F., and Lundeberg, J. 2001. HPV-related cancer susceptibility and p53 codon72 polymorphism. Acta Derm Venereol 81:125-9.
Hacia, J. G., Brody, L. C., Chee, M. S., Fodor, S. P., and Collins, F. S. 1996.Detection of heterozygous mutations in BRCA1 using high density oligonucleotidearrays and two-colour fluorescence analysis. Nat. Genet. 14:441-447.
Haff, L. A., and Smirnov, I. P. 1997. Single-nucleotide polymorphism identificationassays using a thermostable DNA polymerase and delayed extraction MALDI-TOFmass spectrometry. Genome Res 7:378-88.
Hall, J. G., Eis, P. S., Law, S. M., Reynaldo, L. P., Prudent, J. R., Marshall, D. J.,Allawi, H. T., Mast, A. L., Dahlberg, J. E., Kwiatkowski, R. W., de Arruda, M., Neri,B. P., and Lyamichev, V. I. 2000. Sensitive detection of DNA polymorphisms by theserial invasive signal amplification reaction. Proc Natl Acad Sci U S A 97:8272-7.
Haqqi, T. M., Sarkar, G., David, C. S., and Sommer, S. S. 1988. Specificamplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res16:11844.
Hawkins, A., Davidson, F., and Simmonds, P. 1997. Comparison of plasma virusloads among individuals infected with hepatitis C virus (HCV) genotypes 1, 2, and 3by quantiplex HCV RNA assay versions 1 and 2, Roche Monitor assay, and an in-house limiting dilution method. J Clin Microbiol 35:187-92.
Head, S. R., Rogers, Y. H., Parikh, K., Lan, G., Anderson, S., Goelet, P., and Boyce-Jacino, M. T. 1997. Nested genetic bit analysis (N-GBA) for mutation detection in thep53 tumor suppressor gene. Nucleic Acids Res 25:5065-71.
Heal, A. 2000. Molecular biology automation in the clinical laboratory. J ClinicalLigand Assay 23:57-65.
Heermann, K. H., Hagos, Y., and Thomssen, R. 1994. Liquid-phase hybridization andcapture of hepatitis B virus DNA with magnetic beads and fluorescence detection ofPCR product. J Virol Methods 50:43-57.
![Page 66: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/66.jpg)
D. O’ Meara
60
Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. 1996. Real timequantitative PCR. Genome Res 6:986-94.
Hertogs, K., de Bethune, M. P., Miller, V., Ivens, T., Schel, P., Van Cauwenberge, A.,Van Den Eynde, C., Van Gerwen, V., Azijn, H., and Van Houtte, M. 1998. A rapidmethod for simultaneous detection of phenotypic resistance to inhibitors of proteaseand reverse transcriptase in recombinant human immunodeficiency virus type 1isolates from patients treated with antiretroviral drugs. Antimicrob Agents Chemother42:269-76.
Hessner, M. J., Budish, M. A., and Friedman, K. D. 2000. Genotyping of factor VG1691A (Leiden) without the use of PCR by invasive cleavage of oligonucleotideprobes. Clin Chem 46:1051-6.
Hirschhorn, J. N., Sklar, P., Lindblad-Toh, K., Lim, Y. M., Ruiz-Gutierrez, M., Bolk,S., Langhorst, B., Schaffner, S., Winchester, E., and Lander, E. S. 2000. SBE-TAGS:an array-based method for efficient single-nucleotide polymorphism genotyping. ProcNatl Acad Sci U S A 97:12164-9.
Holland, P. M., Abramson, R. D., Watson, R., and Gelfand, D. H. 1991. Detection ofspecific polymerase chain reaction product by utilizing the 5'--3' exonuclease activityof Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 88:7276-80.
Holmberg, A. 2001. Novel automated workstations for large-scale sequence reactioncleanup. Unpublished.
Hsuih, T. C. H., Park, Y. N., Zaretsky, C., Wu, F., Tyagi, S., Kramer, F. R., Sperling,R., and Zhang, D. Y. 1996. Novel, ligation-dependent PCR assay for detection ofhepatitis C virus in serum. J. Clin. Microbiol. 34:501-507.
Huang, M. M., Arnheim, N., and Goodman, M. F. 1992. Extension of base mispairsby Taq DNA polymerase: implications for single nucleotide discrimination in PCR.Nucleic Acids Res 20:4567-73.
Innis, M. A., Myambo, K. B., Gelfand, D. H., and Brow, M. A. 1988. DNAsequencing with Thermus aquaticus DNA polymerase and direct sequencing ofpolymerase chain reaction-amplified DNA. Proc Natl Acad Sci U S A 85:9436-40.
Johnson, J. R. 2000. Development of polymerase chain reaction-based assays forbacterial gene detection. J Microbiol Methods 41:201-9.
Jönsson, U., Fägerstam, L., Ivarsson, B., Johnsson, B., Karlsson, R., Lundh, K.,Löfås, S., Persson, B., Roos, H., and Rönnberg, I. 1991. Real-time biospecificinteraction analysis using surface plasmon resonance and sensor chip technology.Biotechniques 11:620-627.
Ju, J., Ruan, C., Fuller, C. W., Glazer, A. N., and Mathies, R. A. 1995. Fluorescenceenergy transfer dye-labeled primers for DNA sequencing and analysis. Proc NatlAcad Sci U S A 92:4347-51.
![Page 67: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/67.jpg)
Molecular Tools for Nucleic Acid Analysis
61
Kalinina, O., Lebedeva, I., Brown, J., and Silver, J. 1997. Nanoliter scale PCR withTaqMan detection. Nucleic Acids Res 25:1999-2004.
Kandimalla, E. R., Manning, A., Lathan, C., Byrn, R. A., and Agrawal, S. 1995.Design, biochemical, biophysical and biological properties of cooperative antisenseoligonucleotides. Nucleic Acids Research 23:3578-3584.
Kato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugiymura, S.,and Shimotohno, K. 1990. Molecular cloning of the human hepatitis C virus genomefrom Japanese patients with non-A, non-B hepatitis. Proc. Natl. Acad. Sci. USA87:9524-9528.
Kharpko, K. R., Lysov, A. A., Ivanov, I. B., Yershov, G. M., S.K., V., V.L., F., andMirzabekov, A. D. 1991. A method for DNA sequencing by hybridization witholigonucelotide matrix. J. DNA Seq. Mapp. 1:375-388.
Khrapko, K. R., Lysov , Y. P., Khorlyn , A. A., Shick, V. V., Florentiev, V. L., andMirzabekov, A. D. 1989. An oligonucleotide hybridization approach to DNAsequencing. FEBS Lett. 256:118-122.
Kieleczawa, J., Dunn, J. J., and Studier, F. W. 1992. DNA sequencing by primerwalking with strings of contiguous hexamers. Science 258:1787-1791.
Koch, N., Yahi, N., Colson, P., Fantini, J., and Tamalet, C. 1999. Geneticpolymorphism near HIV-1 reverse transcriptase resistance- associated codons is amajor obstacle for the line probe assay as an alternative method to sequence analysis.J Virol Methods 80:25-31.
Kopp, M. U., Mello, A. J., and Manz, A. 1998. Chemical amplification: continuous-flow PCR on a chip. Science 280:1046-8.
Kostichka, A. J., Marchbanks, M. L., Brumley, R. L., Jr., Drossman, H., and Smith, L.M. 1992. High speed automated DNA sequencing in ultrathin slab gels.Biotechnology 10:78-81.
Kotler, L., Sobolev, I., and Ulanovsky, L. 1994. DNA sequencing: modular primersfor automated walking. Biotechniques 17:554-558.
Kotler, L. E., Zevin-Sonkin, D., Sobolev, I. A., and Beskin, A. D. 1993. DNAsequencing: modular primers assembled from a library of hexamers or pentamers.Proc. Natl. Acad. Sci. USA 90:4241-4245.
Kozal, M. J., Shah, N., Shen, N., Yang, R., Fucini, R., Merigan, T. C., Richman, D.D., Morris, D., Hubbell, E., Chee, M., and Gingeras, T. R. 1996. Extensivepolymorphisms observed in HIV-1 clade B protease gene using high-densityoligonucleotide arrays. Nat. Med. 2:753-9.
Kramer, F. R., and Lizardi, P. M. 1989. Replicatable RNA reporters. Nature 339:401-2.
![Page 68: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/68.jpg)
D. O’ Meara
62
Kristensen, V. N., Kelefiotis, D., Kristensen, T., and Borresen-Dale, A. L. 2001.High-throughput methods for detection of genetic variation. Biotechniques 30:318-22,324, 326 passim.
Kronick, M. 1997. Heterozygote determination using automated DNA sequencingtechnology. In: Laboratory methods for the detection of mutations and polymorphismsin DNA (G. R. Taylor, ed.), CRC Press, pp. 175-189.
Kuiken, C., Foley, B., Hahn, B., Marx, P., Mccutchan, F., Mellors, J., Mullins, J.,Wolinsky, S., and B., K. 2000. HIV Sequence Compendium 2000, TheoreticalBiology and Biophysics Group, Los Alamos National Laboratory.
Kuo, G., Choo, Q. L., Alter, H. J., Gitnick, G. L., Redeker, A. G., Purcell, R. H.,Miyamura, T., Dienstag, J. L., Alter, M. J., Stevens, C. E., and et al. 1989. An assayfor circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis.Science 244:362-4.
Kwok, S., and Higuchi, R. 1989. Avoiding false positives with PCR. Nature 339:237-8.
Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D., Goda, L., Levenson, C., andSninsky, J. J. 1990. Effects of primer-template mismatches on the polymerase chainreaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res18:999-1005.
Lai, E. 2001. Application of SNP technologies in medicine: lessons learned and futurechallenges. Genome Res 11:927-9.
Landegren, U., Kaiser, R., Sanders, J., and Hood, L. 1988. A ligase-mediated genedetection technique. Science 241:1077-80.
Lane, M. J., Paner, T., Kashin, I., Faldasz, B. D., Li, B., Gallo, F. J., and Benight, A.S. 1997. The thermodynamic advantage of DNA oligonucleotide ‘stackinghybridization’ reactions: energetics of a DNA nick. Nucleic Acids Res. 25:611-616.
Le Pogam, S., Dubois, F., Christen, R., Raby, C., Cavicchini, A., and Goudeau, A.1998. Comparison of DNA enzyme immunoassay and line probe assays (Inno-LiPAHCV I and II) for hepatitis C virus genotyping. J Clin Microbiol 36:1461-3.
Lee, P. S., and Lee, K. H. 2000. Genomic analysis. Curr Opin Biotechnol 11:171-5.
Lee, W. M., Reddy, K. R., Tong, M. J., Black, M., van Leeuwen, D. J., Hollinger, F.B., Mullen, K. D., Pimstone, N., Albert, D., and Gardner, S. 1998. Early hepatitis Cvirus-RNA responses predict interferon treatment outcomes in chronic hepatitis C.The Consensus Interferon Study Group. Hepatology 28:1411-5.
Leitner, T., Halapi, E., Scarlatti, G., Rossi, P., Albert, J., Fenyo, E. M., and Uhlén, M.1993. Analysis of heterogeneous viral populations by direct DNA sequencing.Biotechniques 15:120-7.
![Page 69: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/69.jpg)
Molecular Tools for Nucleic Acid Analysis
63
Lin, H. J., Pedneault, L., and Hollinger, F. B. 1998. Intra-assay performancecharacteristics of five assays for quantification of human immunodeficiency virustype 1 RNA in plasma. J Clin Microbiol 36:835-9.
Lin, S. B., Blake, K. R., Miller, P. S., and Ts'o, P. O. P. 1989. Use of EDTA tocharacterise interactions between oligodeoxyribonucleoside methylphosphonates andnucleic acids. Biochemistry 26:1054-1061.
Lindroos, K., Liljedahl, U., Raitio, M., and Syvänen, A. C. 2001. Minisequencing onoligonucleotide microarrays: comparison of immobilisation chemistries. NucleicAcids Res 29:E69-9.
Liu, R., Paxton, W. A., Choe, S., Ceradini, D., Martin, S. R., Horuk, R., MacDonald,M. E., Stuhlmann, H., Koup, R. A., and Landau, N. R. 1996. Homozygous defect inHIV-1 coreceptor accounts for resistance of some multiply-exposed individuals toHIV-1 infection. Cell 86:367-77.
Liu, S., Shi, Y., Ja, W. W., and Mathies, R. A. 1999. Optimization of high-speedDNA sequencing on microfabricated capillary electrophoresis channels. Anal Chem71:566-73.
Lizardi, P. M., Huang, X., Zhu, Z., Bray-Ward, P., Thomas, D. C., and Ward, D. C.1998. Mutation detection and single-molecule counting using isothermal rolling-circleamplification. Nat Genet 19:225-32.
Lockhart, D. J., Dong, H., Byrne, M. C., Follettie, M. T., Gallo, M. V., Chee, M. S.,Mittmann, M., Wang, C., Kobayashi, M., Horton, H., and Brown, E. L. 1996.Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat.Biotech. 14:1675-1680.
Lowe, P. A., Clark, T. J., Davies, R. J., Edwards, P. R., Kinning, T., and Yeung, D.1998. New approaches for the analysis of molecular recognition using the IAsysevanescent wave biosensor. J Mol Recognit 11:194-9.
Lundeberg, J., Wahlberg, J., and Uhlén, M. 1991. Rapid colorimetric quantification ofPCR amlified DNA. Biotechniques 10:68-75.
Lyamichev, V., Mast, A. L., Hall, J. G., Prudent, J. R., Kaiser, M. W., Takova, T.,Kwiatkowski, R. W., Sander, T. J., de Arruda, M., Arco, D. A., Neri, B. P., and Brow,M. A. 1999. Polymorphism identification and quantitative detection of genomic DNAby invasive cleavage of oligonucleotide probes. Nat Biotechnol 17:292-6.
Maxam, A. M., and Gilbert, W. 1977. A new method for sequencing DNA. Proc NatlAcad Sci U S A 74:560-4.
McPherson, J. D., Marra, M., Hillier, L., Waterston, R. H., Chinwalla, A., Wallis, J.,Sekhon, M., Wylie, K., Mardis, E. R., and Wilson, R. K. 2001. A physical map of thehuman genome. Nature 409:934-41.
![Page 70: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/70.jpg)
D. O’ Meara
64
Miyachi, H., Masukawa, A., Ohshima, T., Hirose, T., Impraim, C., and Ando, Y.2000. Automated specific capture of hepatitis C virus RNA with probes andparamagnetic particle separation. J Clin Microbiol 38:18-21.
Monstein, H., Nikpour-Badr, S., and Jonasson, J. 2001. Rapid molecular identificationand subtyping of Helicobacter pylori by pyrosequencing of the 16S rDNA variableV1 and V3 regions. FEMS Microbiol Lett 199:103-7.
Mullikin, J. C., Hunt, S. E., Cole, C. G., Mortimore, B. J., Rice, C. M., Burton, J.,Matthews, L. H., Pavitt, R., Plumb, R. W., and Sims, S. K. 2000. An SNP map ofhuman chromosome 22. Nature 407:516-20.
Mullis, K. B., and Faloona, F. A. 1987. Specific synthesis of DNA in vitro via apolymerase-catalyzed chain reaction. Methods Enzymol 155:335-50.
Murray, V. 1989. Improved double-stranded DNA sequencing using the linearpolymerase chain reaction. Nucleic Acids Res 17:8889.
Nazarenko, I. A., Bhatnagar, S. K., and Hohman, R. J. 1997. A closed tube format foramplification and detection of DNA based on energy transfer. Nucleic Acids Res25:2516-21.
Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J., Summers, C., Kalsheker,N., Smith, J. C., and Markham, A. F. 1989. Analysis of any point mutation in DNA.The amplification refractory mutation system (ARMS). Nucleic Acids Res 17:2503-16.
Nilsson, M., Malmgren, H., Samiotaki, M., Kwiatkowski, M., Chowdhary, B. P., andLandegren, U. 1994. Padlock probes: circularizing oligonucleotides for localizedDNA detection. Science 265:2085-8.
Nilsson, P., Persson, B., Uhlén, M., and Nygren, P.-Å. 1995. Real-time monitoring ofDNA manipulations using biosensor technology. Anal. Biochem. 224:400-408.
Nolte, F. S., Thurmond, C., and Mitchell, P. S. 1994. Isolation of hepatitis C virusRNA from serum for reverse transcription-PCR. J. Clin. Microbiol. 32:519-520.
Norberg, J., and Nilsson, L. 1995. Potential of mean force calculations of thestacking-unstacking process in single-stranded deoxyribodinucleosidemonophosphates. Biophys J 69:2277-85.
Nordström, T., Gharizadeh, B., Pourmand, N., Nyrén, P., and Ronaghi, M. 2001.Method enabling fast partial sequencing of cDNA clones. Anal Biochem 292:266-71.
Nordström, T., Ronaghi, M., Forsberg, L., de Faire, U., Morgenstern, R., and Nyrén,P. 2000. Direct analysis of single-nucleotide polymorphism on double-stranded DNAby pyrosequencing. Biotechnol Appl Biochem 31:107-12.
![Page 71: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/71.jpg)
Molecular Tools for Nucleic Acid Analysis
65
Nyren, P., Pettersson, B., and Uhlen, M. 1993. Solid phase DNA minisequencing byan enzymatic luminometric inorganic pyrophosphate detection assay. Anal Biochem208:171-5.
Odeberg, J., Holmberg, K., Persson, M. L., and Uhlén, M. 2001. Pyrosequencing ofgenetic risk factors for thrombosis. In preparation.
Olsvik, O., Popovic, T., Skjerve, E., Cudjoe, K. S., Hornes, E., Ugelstad, J., andUhlén, M. 1994. Magnetic separation techniques in diagnostic microbiology. ClinMicrobiol Rev 7:43-54.
Oroskar, A. A., Rasmussen, S. E., Rasmussen, H. N., Rasmussen, S. R., Sullivan, B.M., and Johansson, A. 1996. Detection of immobilized amplicons by ELISA-liketechniques. Clin Chem 42:1547-55.
Parinov, S., Barsky, V., Yershov, G., Kirillov, E., Timofeev, E., Belgovskiy, A., andMirzabekov, A. 1996. DNA sequencing by hybridization to microchip octa-anddecanucleotides extended by stacked pentanucleotides. Nucleic Acids Res 24:2998-3004.
Pastinen, T., Kurg, A., Metspalu, A., Peltonen, L., and Syvänen, A. C. 1997.Minisequencing: a specific tool for DNA analysis and diagnostics on oligonucleotidearrays. Genome Res 7:606-14.
Pastinen, T., Raitio, M., Lindroos, K., Tainola, P., Peltonen, L., and Syvänen, A. C.2000. A system for specific, high-throughput genotyping by allele-specific primerextension on microarrays. Genome Res 10:1031-42.
Paxton, W. A., and Kang, S. 1998. Chemokine receptor allelic polymorphisms:relationships to HIV resistance and disease progression. Semin Immunol 10:187-94.
Pease, A. C., Solas, D., Sullivan, E. J., Cronin, M. T., Holmes, C. P., and Fodor, S. P.1994. Light-generated oligonucleotide arrays for rapid DNA sequence analysis. ProcNatl Acad Sci U S A 91:5022-6.
Persson, B., Stenhag, K., Nilsson, P., Larsson, A., Uhlén, M., and Nygren, P. Å. 1997.Analysis of oligonucleotide probe affinities using surface plasmon resonance: ameans for mutational scanning. Anal. Biochem. 246:33-44.
Prince, J. A., Feuk, L., Howell, W. M., Jobs, M., Emahazion, T., Blennow, K., andBrookes, A. J. 2001. Robust and accurate single nucleotide polymorphism genotypingby dynamic allele-specific hybridization (DASH): design criteria and assayvalidation. Genome Res 11:152-62.
Prober, J. M., Trainor, G. L., Dam, R. J., Hobbs, F. W., Robertson, C. W., Zagursky,R. J., Cocuzza, A. J., Jensen, M. A., and Baumeister, K. 1987. A system for rapidDNA sequencing with fluorescent chain-terminating dideoxynucleotides. Science238:336-41.
![Page 72: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/72.jpg)
D. O’ Meara
66
Regan, P. M., and Margolin, A. B. 1997. Development of a nucleic acid capture probewith reverse transcriptase-polymerase chain reaction to detect poliovirus ingroundwater. J. Virol. Methods 64:65-72.
Riccelli, P. V., Merante, F., Leung, K. T., Bortolin, S., Zastawny, R. L., Janeczko, R.,and Benight, A. S. 2001. Hybridization of single-stranded DNA targets toimmobilized complementary DNA probes: comparison of hairpin versus linearcapture probes. Nucleic Acids Res 29:996-1004.
Roll, C., Ketterle, C., Faibis, V., Fazakerley, G. V., and Boulard, Y. 1998.Conformations of nicked and gapped DNA structures by NMR and moleculardynamic simulations in water. Biochemistry 37:4059-70.
Ronaghi, M. 2001. Pyrosequencing sheds light on DNA sequencing. Genome Res11:3-11.
Ronaghi, M., Uhlén, M., and Nyrén, P. 1998. A sequencing method based on real-time pyrophosphate. Science 281:363, 365.
Ross, P., Hall, L., Smirnov, I., and Haff, L. 1998. High level multiplex genotyping byMALDI-TOF mass spectrometry. Nat Biotechnol 16:1347-51.
Ruiz-Martinez, M. C., Salas-Solano, O., Carrilho, E., Kotler, L., and Karger, B. L.1998. A sample purification method for rugged and high-performance DNAsequencing by capillary electrophoresis using replaceable polymer solutions. A.Development of the cleanup protocol. Anal Chem 70:1516-27.
Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., andArnheim, N. 1985. Enzymatic amplification of beta-globin genomic sequences andrestriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-4.
Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. 1989. Genetic analysisof amplified DNA with immobilized sequence-specific oligonucleotide probes. ProcNatl Acad Sci U S A 86:6230-4.
Salas-Solano, O., Ruiz-Martinez, M. C., Carrilho, E., Kotler, L., and Karger, B. L.1998. A sample purification method for rugged and high-performance DNAsequencing by capillary electrophoresis using replaceable polymer solutions. B.Quantitative determination of the role of sample matrix components on sequencinganalysis. Anal Chem 70:1528-35.
Sanger, F., Nicklen, S., and Coulson, A. R. 1977. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 74:5463-7.
Sauer, S., Lechner, D., Berlin, K., Lehrach, H., Escary, J. L., Fox, N., and Gut, I. G.2000. A novel procedure for efficient genotyping of single nucleotide polymorphisms.Nucleic Acids Res 28:E13.
![Page 73: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/73.jpg)
Molecular Tools for Nucleic Acid Analysis
67
Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. 1995. Quantitativemonitoring of gene expression patterns with a complementary DNA microarray.Science 270:467-70.
Schena, M., Shalon, D., Heller, R., Chai, A., Brown, P. O., and Davis, R. W. 1996.Parallel human genome analysis: microarray-based expression monitoring of 1000genes. Proc Natl Acad Sci U S A 93:10614-9.
Schuurman, R., Demeter, L., Reichelderfer, P., Tijnagel, J., de Groot, T., andBoucher, C. 1999. Worldwide evaluation of DNA sequencing approaches foridentification of drug resistance mutations in the human immunodeficiency virus type1 reverse transcriptase. J. Clin. Microbiol. 37:2291-6.
Schweitzer, B., and Kingsmore, S. 2001. Combining nucleic acid amplification anddetection. Curr Opin Biotechnol 12:21-7.
Servais, J., Lambert, C., Fontaine, E., Plesseria, J. M., Robert, I., Arendt, V., Staub,T., Schneider, F., Hemmer, R., Burtonboy, G., and Schmit, J. C. 2001. Comparison ofDNA sequencing and a line probe assay for detection of human immunodeficiencyvirus type 1 drug resistance mutations in patients failing highly active antiretroviraltherapy. J Clin Microbiol 39:454-9.
Shalon, D., Smith, S. J., and Brown, P. O. 1996. A DNA microarray system foranalyzing complex DNA samples using two- color fluorescent probe hybridization.Genome Res 6:639-45.
Shyamala, V., and Ames, G. F. 1989. Amplification of bacterial genomic DNA by thepolymerase chain reaction and direct sequencing after asymmetric amplification:application to the study of periplasmic permeases. J Bacteriol 171:1602-8.
Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P., Dodd, C., Connell, C. R.,Heiner, C., Kent, S. B., and Hood, L. E. 1986. Fluorescence detection in automatedDNA sequence analysis. Nature 321:674-9.
Southern, E., Mir, K., and Shchepinov, M. 1999. Molecular interactions onmicroarrays. Nat Genet 21:5-9.
Southern, E. M. 1975. Detection of specific sequences among DNA fragmentsseparated by gel electrophoresis. J Mol Biol 98:503-17.
Southern, E. M., Case-Green, S. C., Elder, J. K., Johnson, M., Mir, K. U., Wang, L.,and Williams, J. C. 1994. Arrays of complementary oligonucleotides for analysing thehybridisation behaviour of nucleic acids. Nucleic Acids Res 22:1368-73.
Southern, E. M., Maskos, U., and Elder, J. K. 1992. Analyzing and comparing nucleicacid sequences by hybridization to arrays of oligonucleotides: evaluation usingexperimental models. Genomics 13:1008-17.
![Page 74: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/74.jpg)
D. O’ Meara
68
Spratt, B. G. 1999. Multilocus sequence typing: molecular typing of bacterialpathogens in an era of rapid DNA sequencing and the internet. Curr Opin Microbiol2:312-6.
Stenberg, E., Persson, B., Roos, H., and Urbaniczky, C. 1991. Quantitativedetermination of surface concentration of protein with surface plasmon resonanceusing radiolabeled proteins. J. Colloid Interface Sci. 143:513-526.
Stuyver, L., Rossau, R., Wyseur, A., Duhamel, M., Vanderborght, B., VanHeuverswyn, H., and Maertens, G. 1993. Typing of hepatitis C virus isolates andcharacterization of new subtypes using a line probe assay. J Gen Virol 74:1093-102.
Stuyver, L., Wyseur, A., Rombout, A., Louwagie, J., Scarcez, T., Verhofstede, C.,Rimland, D., Schinazi, R. F., and Rossau, R. 1997. Line probe assay for rapiddetection of drug-selected mutations in the human immunodeficiency virus type 1reverse transcriptase gene. Antimicrob Agents Chemother 41:284-91.
Swerdlow, H., Jones, B. J., and Wittwer, C. T. 1997. Fully automated DNA reactionand analysis in a fluidic capillary instrument. Anal Chem 69:848-55.
Sykes, P. J., Neoh, S. H., Brisco, M. J., Hughes, E., Condon, J., and Morley, A. A.1992. Quantitation of targets for PCR by use of limiting dilution. Biotechniques13:444-9.
Syvänen, A. C. 1994. Detection of point mutations in human genes by the solid-phaseminisequencing method. Clin Chim Acta 226:225-36.
Syvänen, A. C. 1999. From gels to chips: "minisequencing" primer extension foranalysis of point mutations and single nucleotide polymorphisms. Hum Mutat 13:1-10.
Syvänen, A. C., Aalto-Setala, K., Harju, L., Kontula, K., and Soderlund, H. 1990. Aprimer-guided nucleotide incorporation assay in the genotyping of apolipoprotein E.Genomics 8:684-92.
Syvänen, A. C., Sajantila, A., and Lukka, M. 1993. Identification of individuals byanalysis of biallelic DNA markers, using PCR and solid-phase minisequencing. Am JHum Genet 52:46-59.
Tabor, S., and Richardson, C. C. 1987. DNA sequence analysis with a modifiedbacteriophage T7 DNA polymerase. Proc Natl Acad Sci U S A 84:4767-71.
Tabor, S., and Richardson, C. C. 1995. A single residue in DNA polymerases of theEscherichia coli DNA polymerase I family is critical for distinguishing betweendeoxy- and dideoxyribonucleotides. Proc Natl Acad Sci U S A 92:6339-43.
Takeuchi, T., Katsume, A., Tanaka, T., Abe, A., Inoue, K., Tsukiyama-Kohara, K.,Kawaguchi, R., Tanaka, S., and Kohara, M. 1999. Real-time detection system forquantification of hepatitis C virus genome. Gastroenterology 116:636-42.
![Page 75: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/75.jpg)
Molecular Tools for Nucleic Acid Analysis
69
Tan, H., and Yeung, E. S. 1998. Automation and integration of multiplexed on-linesample preparation with capillary electrophoresis for high-throughput DNAsequencing. Anal Chem 70:4044-53.
Tang, K., Fu, D. J., Julien, D., Braun, A., Cantor, C. R., and Koster, H. 1999. Chip-based genotyping by mass spectrometry. Proc Natl Acad Sci U S A 96:10016-20.
Taniguchi, M., Miura, K., Iwao, H., and Yamanaka, S. 2001. Quantitative assessmentof DNA microarrays-comparison with Northern blot analyses. Genomics 71:34-9.
Taylor, R. W., Wardell, T. M., Connolly, B. A., Turnbull, D. M., and Lightowlers, R.N. 2001. Linked oligodeoxynucleotides show binding cooperativity and canselectively impair replication of deleted mitochondrial DNA templates. Nucleic AcidsRes 29:3404-12.
The Arabidopsis Genome Initative. 2000. Analysis of the genome sequence of theflowering plant Arabidopsis thaliana. Nature 408:796-815.
The C. elegans Sequencing Consortium. 1998. Genome sequence of the nematode C.elegans: a platform for investigating biology. The C. elegans Sequencing Consortium.Science 282:2012-8.
Thiel, V., Rashtchian, A., Herold, J., Schuster, D. M., Guan, N., and Siddell, S. G.1997. Effective amplification of 20-kb DNA by reverse transcription PCR. Anal.Biochem. 252:62-70.
Tong, X., and Smith, L. M. 1993. Solid phase purification in automated DNAsequencing. DNA Seq 4:151-62.
Tyagi, S., Bratu, D. P., and Kramer, F. R. 1998. Multicolor molecular beacons forallele discrimination. Nat Biotechnol 16:49-53.
Tyagi, S., and Kramer, F. R. 1996. Molecular beacons: probes that fluoresce uponhybridization. Nat Biotechnol 14:303-8.
Urdea, M. S., Horn, T., Fultz, T. J., Anderson, M., Running, J. A., Hamren, S., Ahle,D., and Chang, C. A. 1991. Branched DNA amplification multimers for the sensitive,direct detection of human hepatitis viruses. Nucleic Acids Symp Ser 24:197-200.
Vahey, M., Nau, M. E., Barrick, S., Cooley, J. D., Sawyer, R., Sleeker, A. A.,Vickerman, P., Bloor, S., Larder, B., Michael, N. L., and Wegner, S. A. 1999.Performance of the Affymetrix GeneChip HIV PRT 440 platform for antiretroviraldrug resistance genotyping of human immunodeficiency virus type 1 clades and viralisolates with length polymorphisms. J Clin Microbiol 37:2533-7.
van Doorn, L. J., Kleter, B., Voermans, J., Maertens, G., Brouwer, H., Heijtink, R.,and Quint, W. 1994. Rapid detection of hepatitis C virus RNA by direct capture fromblood. J. Med. Virol. 42:22-28.
![Page 76: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/76.jpg)
D. O’ Meara
70
Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G.,Smith, H. O., Yandell, M., Evans, C. A., and Holt, R. A. 2001. The sequence of thehuman genome. Science 291:1304-51.
Walker, G. T., Fraiser, M. S., Schram, J. L., Little, M. C., Nadeau, J. G., andMalinowski, D. P. 1992. Strand displacement amplification-an isothermal, in vitroDNA amplification technique. Nucleic Acids Res 20:1691-6.
Wang, D. G., Fan, J. B., Siao, C. J., Berno, A., Young, P., Sapolsky, R., Ghandour,G., Perkins, N., Winchester, E., and Spencer, J. 1998. Large-scale identification,mapping, and genotyping of single- nucleotide polymorphisms in the human genome.Science 280:1077-82.
Wang, J. 2000. From DNA biosensors to gene chips. Nucleic Acids Res 28:3011-6.
Waters, L. C., Jacobson, S. C., Kroutchinina, N., Khandurina, J., Foote, R. S., andRamsey, J. M. 1998. Microchip device for cell lysis, multiplex PCR amplification,and electrophoretic sizing. Anal Chem 70:158-62.
Watson, J. D., and Crick, F. H. 1953. Molecular structure of nucleic acids. A structurefor deoxyribose nucleic acid. Nature 171:737-738.
Whitcombe, D., Theaker, J., Guy, S. P., Brown, T., and Little, S. 1999. Detection ofPCR products using self-probing amplicons and fluorescence. Nat Biotechnol 17:804-7.
Wiki, M., Kunz, R. E., Voirin, G., Tiefenthaler, K., and Bernard, A. 1998. Novelintegrated optical sensor based on a grating coupler triplet. Biosens Bioelectron13:1181-5.
Wilson, J. W., Bean, P., Robins, T., Graziano, F., and Persing, D. H. 2000.Comparative evaluation of three human immunodeficiency virus genotyping systems:the HIV-GenotypR method, the HIV PRT GeneChip assay, and the HIV-1 RT lineprobe assay. J Clin Microbiol 38:3022-8.
Wit, F. W., van Leeuwen, R., Weverling, G. J., Jurriaans, S., Nauta, K., Steingrover,R., Schuijtemaker, J., Eyssen, X., Fortuin, D., and Weeda, M. 1999. Outcome andpredictors of failure of highly active antiretroviral therapy: one-year follow-up of acohort of human immunodeficiency virus type 1-infected persons. J Infect Dis179:790-8.
Wittwer, C. T., Herrmann, M. G., Moss, A. A., and Rasmussen, R. P. 1997a.Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques22:130-1, 134-8.
Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, R. A., and Balis,U. J. 1997b. The LightCycler: a microvolume multisample fluorimeter with rapidtemperature control. Biotechniques 22:176-81.
![Page 77: Molecular Tools for Nucleic Acid Analysis › smash › get › diva2:8999 › FULLTEXT01.pdf · Deirdre O’ Meara (2001): Molecular Tools for Nucleic Acid Analysis. Department of](https://reader031.fdocuments.net/reader031/viewer/2022011903/5f0f70cc7e708231d4442c99/html5/thumbnails/77.jpg)
Molecular Tools for Nucleic Acid Analysis
71
Wodicka, L., Dong, H., Mittmann, M., Ho, M. H., and Lockhart, D. J. 1997. Genome-wide expression monitoring in Saccharomyces cerevisiae. Nat Biotechnol 15:1359-67.
Wu, D. Y., Ugozzoli, L., Pal, B. K., and Wallace, R. B. 1989. Allele-specificenzymatic amplification of ß-globin genomic DNA for diagnosis of sickle cellanemia. Proc Natl Acad Sci U S A 86:2757-60.