Molecular evidence of insecticide resistance in ...

Molecular evidence of insecticide

resistance in Helicoverpa armigera

and expression profiles of genes

involved in metabolic resistance

Akhtar Rasool

Submitted in partial fulfilment of

requirement for the degree

Doctor of Philosophy

2015

Department of Biotechnology (NIBGE)

Pakistan Institute of Engineering and Applied Sciences

Nilore-45650 Islamabad, Pakistan

National Institute for Biotechnology and Genetic Engineering

P. O. BOX 577, JHANG ROAD, FAISALABAD.

(Affiliated with PIEAS, Islamabad)

Declaration of Originality

I hereby declare that the work accomplished in this thesis is the result of my own

research carried out in Agriculture Biotechnology Division, National Institute for

Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan and

Department of Entomology, Max Planck Institute for Chemical Ecology, Jena

Germany. This thesis has not been published previously nor does it contain any

material from the published resources that can be considered as the violation of

international copyright law.

Furthermore I also declare that I am aware of the terms “copyright and plagiarism”,

and if any copyright violation is found out in this work I will be held responsible of

the consequences of any such violation.

Signature: _______________

Name of the Student: AKHTAR RASOOL

Registration No. 10-7-1-001-2008

Date:__24.03.2015__

Place: NIBGE, Faisalabad

Dedicated

to

My Beloved Parents

I

ACKNOWLEDGEMENTS

A major research project like this is never the work of anyone alone. The

contributions of many different people in their different ways, have made this

possible. I would like to extend my appreciation especially to the following.

Foremost, I would like to express my sincere gratitude to my advisor Dr.

Muhammad Ashfaq for the continuous support during my Ph.D study and research,

for his patience, motivation, enthusiasm, and providing me with immense knowledge.

I could not have imagined having a better advisor and mentor for my Ph.D study.

I wish to express my deep sense of gratitude for my foreign supervisor and co-

supervisor professor Dr. David G Heckel who made a great contribution for the

successful completion of my research during my stay at Department of Entomology,

Max Planck Institute for Chemical Ecology (MPI-ICE), Jena Germany . His skilful

advice and learned guidance enabled me to complete this work. I learned a lot from

him as he proved a very expert and capable teacher for me. My special and heartily

thanks to Dr Nicole Joussen (MPI-ICE) for providing her valuable guidance, ideas

and her expertise to make this research possible. Her support, guidance, advices

throughout the research project as well as her pain-staking effort in proof reading the

manuscripts is greatly appreciated.

I offer my special thanks to Dr. Shahid Mansoor, Director NIBGE, and Ex-directors

Dr. Zafar Mehmood Khalid and Dr. Sohail Hameed for providing the best possible

working environment at NIBGE. I also gratefully acknowledge Dr. Zahid Mukhtar,

Head Agricultural Biotechnology Division, NIBGE and Dr. Qaisar M Khan, Head

Soil and Environmental Biotechnology Division, NIBGE for their moral support

throughout my research work. I am profoundly indebted to Dr. Muhammad Asif

Qadri (PS), Agricultural Biotechnology Division, NIBGE, for his positive, sincere

and valuable guidelines and support. I am also thankful to Dr. M Sajjad Mirza

(DCS), Soil and Environmental Biotechnology Division, NIBGE, for his support

when I moved to his group.

I would like to pay my sincere gratitude to MPI-ICE entomology department

colleagues Dr. Yannick Pauchet, Dr. Heiko Vogel, Dr. Dr. Melanie Unbehend,

Anne Karpinski, and Susanne Donnerhacke, Domenica Schnabelrauch and all

other lab fellows who made my stay comfortable and successful at Jena. My special

thanks go to Mr. Sher Afzal Khan (MPI-ICE) for his help and suggestions during

my short stay at Jena. His hospitality and affection is memorable.

I am highly obliged to my lab colleagues at NIBGE; Dr. Arif M Khan, Imran Rauf,

Ali Raza Noor, Mr. Tayyab Naseem, Mrs. Mariam Masood, Dr. Innam Ullah,

Ms. Romana Iftikhar, Mr. Qamar Abbas, Miss Shamim Akhtar, Mrs. Saidia

Awais, Mr. Imran Ali, Mr. Shah Sawar for their cooperation and help in

experimental work.

I have no words that can suffice the role of my friends and colleagues especially, Dr.

Muhammd Tariq, Mr. Iftikhar Ali, Mr. Kashif Aslam, Dr. Muhammad Ikram

II

Anwar, Rahim Ullah, Dr. Ishtiaq Hassan, in the accomplishment of this task. Also,

I can not forget to mention the names of my friends in the Hujra for their ever

available help and sincere cooperation.

Special gratitude is due to Higher Education Commission of Pakistan for providing

financial support under Indigenous Scholarship program and International Research

Support Initiative program and Max Planck Society, Germany for granting me

“Award of doctoral students” for my studies and making my dreams come true. I offer

my special appreciation to National Institute for Biotechnology and Genetic

Engineering (NIBGE) and Pakistan Institute of Engineering and Applied Sciences

(PIEAS) for good academic procedures and research facilities.

Last but not the least special thanks from core of my heart to my brothers, sisters and

my finance Dr. Hina Jabeen for their undying love, support, precious affections,

prayers and their valuable encouragement enabled me to complete this task

successfully.

Akhtar Rasool

Table of contents

III

TABLE OF CONTENTS

Contents Page No.

ACKNOWLEDGEMENTS............................................................................................... I

TABLE OF CONTENTS ......................................................................................... III

LIST OF TABLES .................................................................................................... IX

LIST OF FIGURES .................................................................................................... X

LIST OF ABBREVIATIONS .................................................................................XII

Abstract ................................................................................................................... XVI

Chapter 1 ......................................................................................................................1

General introduction and review of literature ..........................................................1

1.1. Helicoverpa armigera.................................................................................. 1

1.1.1. Occurrence and biology ...........................................................................2

1.2. Global economic importance ....................................................................... 3

1.3. Control methods .......................................................................................... 6

1.3.1. Chemical control ......................................................................................6

1.3.2. Biological control.....................................................................................8

1.4. Insecticide resistance ................................................................................... 9

1.5. Mechanisms of insecticide resistance ........................................................ 10

1.5.1. Behavioural resistance ...........................................................................10

1.5.2. Cuticular penetration resistance .............................................................10

1.5.3. Target site insensitivity ..........................................................................11

1.5.4. Metabolic resistance...............................................................................11

1.6. Genomics of insecticide resistance ............................................................ 15

1.7. Genome mapping ....................................................................................... 15

1.7.1. Genetic mapping ....................................................................................16

1.8. DNA markers to evaluate genetic diversity ............................................... 17

Table of contents

IV

1.8.1. Microsatellites ........................................................................................17

1.8.2. Single nucleotide polymorphisms (SNPs) .............................................17

1.8.3. Restriction fragment length polymorphisms (RFLPs) ...........................18

1.8.4. Randomly amplified polymorphic DNA (RAPD) .................................19

1.8.5. Amplified fragment length polymorphism (AFLP) ...............................20

1.8.6. Mitochondrial DNA (mtDNA) markers.................................................21

1.9. Research objective ..................................................................................... 22

Chapter 2 ....................................................................................................................23

General materials and methods ................................................................................23

2.1. Insect collection ......................................................................................... 23

2.2. Helicoverpa armigera diets and rearing .................................................... 23

2.3. Chemical insecticide and toxicity test ....................................................... 23

2.4. Genomic DNA extraction .......................................................................... 24

2.5. RNA extraction .......................................................................................... 25

2.6. RNA purification ....................................................................................... 25

a. DNase treatment ................................................................................................... 25

b. Purification ........................................................................................................... 25

2.7. Quantitation of DNA/RNA ........................................................................ 26

2.8. cDNA synthesis ......................................................................................... 26

2.9. PCR amplification ..................................................................................... 26

2.10. Gel extraction and purification of PCR product ........................................ 27

2.11. Ligation ...................................................................................................... 27

2.12. Cloning and transformation ....................................................................... 27

2.13. Plasmid isolation........................................................................................ 28

2.14. Digestion of plasmid DNA ........................................................................ 29

2.15. Agarose gel electrophoresis ....................................................................... 29

Table of contents

V

2.16. Stocks preparation of cell cultures ............................................................. 29

2.17. Sequencing................................................................................................. 29

Chapter 3 ....................................................................................................................31

Identification, characterisation and metabolic capabilities of

cypermethrin resistance gene in Helicoverpa armigera ..........................................31

3.1. Introduction ............................................................................................... 31

3.2. Materials and Methods .............................................................................. 35

3.2.1. H. armigera strains and genetic crosses ................................................35

3.2.2. Toxicological tests .................................................................................35

3.2.3. Nucleic acid isolation .............................................................................36

3.2.4. AFLP linkage mapping ..........................................................................37

3.2.4.1. Restriction digestion .......................................................................37

3.2.4.2. Adaptor ligation ..............................................................................37

3.2.4.3. Pre-amplification ............................................................................38

3.2.4.4. Selective amplification ...................................................................38

3.2.4.5. Gel separation .................................................................................38

3.2.4.6. AFLP markers scoring on gel .........................................................39

3.2.4.7. Inference of resistant genotypes through PCR ...............................39

3.2.4.8. Exon primed intron crossing PCR (EPIC-PCR) .............................39

3.2.4.9. Data analysis ...................................................................................40

3.2.5. Isolation, cloning, overexpression and characterization of

CYP337B3 gene .....................................................................................42

3.2.5.1. DNA and RNA extraction ..............................................................42

3.2.5.2. PCR amplification, cloning and sequencing CYP337B3

gene fragment .................................................................................42

3.2.5.3. Rapid amplification of cDNA ends (RACE) PCR .........................42

3.2.5.4. Cloning and sequencing of RACE PCR products ..........................43

3.2.5.5. CYP337B3 cloning and characterisation of the intron ....................43

Table of contents

VI

3.2.5.6. Insect cell culture (Ha2302)............................................................44

3.2.5.7. Heterologous expression of CYP337B3 gene in Ha2302

Cells ................................................................................................44

3.2.5.8. Microsomal and cytosolic fractions isolation from

Ha2302 Cells ..................................................................................47

3.2.5.9. Determination of protein content ....................................................47

3.2.5.10. DNA extraction from Ha2302 cells and screening by

PCR .................................................................................................48

3.2.5.11. Stocks preparation of Ha2302 cells containing

CYP337B3 gene ..............................................................................48

3.2.5.12. SDS-PAGE and western-blot .........................................................48

3.2.5.13. Activity assays with P450 model substrates ...................................49

3.2.5.14. In vitro metabolism assays with cypermethrin and

analysis through HPLC ...................................................................50

3.3. Results ....................................................................................................... 52

3.3.1. Cypermethrin resistance in the FSD strain is metabolic and

semidominant .........................................................................................52

3.3.2. AFLP marker-discovery characteristics .................................................55

3.3.3. Mapping of resistant gene (CYP337B3) within linkage group

13............................................................................................................58

3.3.4. Full length gene isolation of CYP337B3 gene from FSD

strain .......................................................................................................61

3.3.5. Metabolic capabilities of CYP337B3 enzyme .......................................64

3.4. Discussion .................................................................................................. 67

Chapter 4 ....................................................................................................................71

Expression profiling of Helicoverpa armigera cytochrome p450

monooxygenases genes and their role in insecticides resistance ............................71

4.1. Introduction ............................................................................................... 71

4.2. Material and Methods ................................................................................ 74

4.2.1. H. armigera strains used in quantitative real-time PCR

(qRT-PCR) .............................................................................................74

Table of contents

VII

4.2.2. RNA extraction and cDNA synthesis ....................................................74

4.2.3. Primer designing ....................................................................................74

4.2.4. Quantitative real time PCR (qRT-PCR) ................................................74

4.2.5. Genomic DNA and RNA extraction from untreated

backcross larvae for CYP337B3 gene screening ....................................75

4.3. Results ....................................................................................................... 78

4.3.1. P450 genes in H. armigera ....................................................................78

4.3.2. Expression analysis of P450 Genes .......................................................78

4.3.2.1. Expression analysis of P450 genes in H. armigera

resistant strains................................................................................78

4.3.3. Expression pattern of FSD strain up-regulated genes

(CYP340G1, CYP340H1 and CYP341B2) in F1 backcross

progeny ..................................................................................................79

4.4. Discussion .................................................................................................. 84

Chapter 5 ....................................................................................................................87

Population structure and frequency of pyrethroid resistance gene

CYP337B3 in Helicoverpa armigera in pakistan ......................................................87

5.1. Introduction ............................................................................................... 87

5.2. Materials and Methods .............................................................................. 90

5.2.1. Specimen sampling ................................................................................90

5.2.2. DNA barcoding ......................................................................................90

5.2.3. Data analysis ..........................................................................................90

5.2.4. Screening of CYP337B1, CYP337B2 and CYP337B3 genes .................91

5.3. Results ....................................................................................................... 92

5.3.1. Genetic diversity of H. armigera ...........................................................93

5.3.1.1. DNA barcoding ...............................................................................93

5.3.2. Population structure ...............................................................................97

5.3.3. Geographical distribution of H. armigera pyrethroids

resistant (CYP337B3) and susceptible genes (CYP337B1 and

CYP337B2) in Pakistan ..........................................................................99

Table of contents

VIII

5.4. Discussion ................................................................................................ 102

Chapter 6 ..................................................................................................................105

General Discussion ...................................................................................................105

Recommendations/ Future Work ........................................................................... 111

Chapter 7 ..................................................................................................................112

References .................................................................................................................112

Publications ..............................................................................................................137

List of Tables

IX

LIST OF TABLES

Table Page No.

Table 1.1 Geographical distribution of Helicoverpa armigera 4

Table 2.1 Helicoverpa armigera collected from different geographical regions

of the world. 30

Table 3.1

Primers for screening of CYP337B1, CYP337B2, CYP337B3, for

detection of CYP337B3 in the AFLP analysis, for cloning of

CYP337B3 and the intron region and for the ribosomal protein

genes

41

Table 3.2

Determination of cypermethrin toxicity (LD50, resistance factor

(RF), and synergistic factor (SF) with and without PBO) in 3rd

instar

larvae of Helicoverpa armigera strains through topical application

methods

54

Table 3.3 Primers combination used for MIBC and FIBC and number of

informative AFLP fragments scored per primer combination. 56

Table 3.4

Sequence identity of CYP337B3 gene of Helicoverpa armigera FSD

strain with already reported CYP337B through basic local alignment

search tool (BLAST) search.

62

Table 3.5

Activity of CYP337B3 containing microsomes toward different

model substrates of P450 enzymes. Corrected metabolic activities

were expressed as pmol product per mg of microsomal protein per

min.

65

Table 4.1 List of primer pairs used for RT-qPCR and the expression analysis 76

Table 4.2 P450 mRNA expression levels in three strains of Helicoverpa

armigera as determined by RT-qPCR. 82

Table 5.1

Comparisons between geographic regions (Northern Pakistan,

Central Pakistan and East Southern Pakistan) by AMOVA using

COI gene sequences of Helicoverpa armigera.

95

Table 5.2 Distribution of CYP337B1, CYP337B2 and CYP337B3 genes across

Pakistan 100

List of Figures

X

LIST OF FIGURES

Figure Page No.

Figure 1.1 Helicoverpa armigera 5

Figure 3.1

pIB/V5-His-TOPO® expression vector, used for cloning of

CYP337B3 gene isolated from Helicoverpa armigera strain FSD

and transformation into insect cell line Ha2302.

46

Figure 3.2

Dose-response curves of the resistant FSD strain of Pakistani

Helicoverpa armigera compared to the resistant TWBR line and

the susceptible TWBS line from Australia towards cypermethrin.

53

Figure 3.3 AFLP banding pattern and presence of CYP337B3 associated with

resistance. 57

Figure 3.4 Map of resistance-associated linkage group of Helicoverpa

armigera. 60

Figure 3.5 Alignment amino acid sequences of CYP337B3 isolated from of

Helicoverpa armigera FSD strain and TWB strain (Australian). 62

Figure 3.6 Confirmation of cloning and heterologous expression of

CYP337B3 in insect cell line Ha2302. 63

Figure 3.7 In vitro metabolism of cypermethrin by heterologously expressed

CYP337B3. 66

Figure 4.1 Maximum-likelihood tree of 63 P450 proteins from Helicoverpa

armigera. 80

Figure 4.2

mRNA abundance of 3 P450 genes in backcross larvae (BC)

possessing the resistance gene CYP337B3 or lacking CYP337B3

compared to the resistant FSD strain and TWBS line.

81

Figure 5.1 Map of Pakistan showing collection localities of Helicoverpa

armigera. 92

Figure 5.2 Distance analysis; Pairwise distance divergence (%) of

Helicoverpa armigera from Pakistan as generated by ABGD 96

List of Figures

XI

Figure 5.3 HapStar profile of COI gene haplotypes tree of Helicoverpa

armigera from Pakistan. 96

Figure 5.4 STRUCTURE analysis results of Helicoverpa armigera

populations collected from Pakistan based on SNPs. 98

Figure 5.5 PCR screening for the presence or absence of CYP337B1,

CYP337B2 and CYP337B3 in collected samples. 101

Figure 6.1

Alignment of CYP337B3v1 from Australian and CYP337B3 from

Pakistani Helicoverpa armigera with the CYP337B1 alleles and

CYP337B2.

110

Abbreviations

XII

LIST OF ABBREVIATIONS

A Adenine

AFLP Amplified fragment length polymorphism

Amp Ampicillin

AChE Acetylcholinesterase

AMOVA Analysis of molecular variance

ANOVA Analysis of variance

°C Degree celsius

% Percent

µg Micrograms

µL Microlitre

µM Micromolar

ng Nanogram

Bt Bacillus thuringiensis

BIO Biodiversity institute of Ontario

BLAST Basic local alignment search tool

bp Base pair

BOLD Barcode of life data system

BSA Bovine serum albumin

C Cytosine

CABI Centre for agricultural bioscience international

CCDB Canadian centre for DNA barcoding

cDNA Complementary DNA sequence

cm Centimeter

CNS Central nervous system

COI Cytochrome oxidase subunit I

COII Cytochrome oxidase subunit II

CYP Cytochrome P450 monooxygenases

CytB Cytochrome B

dATP Deoxyadenosine triphosphate

dCTP Deoxycytidine triphosphate

dGTP Deoxyguanosine triphosphate

DEPC Diethylpyrocarbonate

Abbreviations

XIII

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

dNTP Deoxyribonucleotide triphosphate

dUTP Deoxyuridine triphosphate

DDT Dichlorodiphenyl trichloroethane

DTT Dithiothreitol

dTTP Deoxythymidine triphosphate

EB Elution buffer

EDTA Ethylenediaminetetraacetic acid

EMBL European molecular biology laboratory

EPIC-PCR Exon primed intron crossing-polymerase chain reaction

EPPO European and mediterranean plant protection organization

EST Expressed sequence tag

EtBr Ethidium bromide

FIBC Female informative backcross

g Gram

G Guanine

GABA Gamma-aminobutyric acid

GMO Genetically modified organism

GST Glutathione S-transferase

HCl Hydrochloric acid

IPTG Isopropyl β-D-1-thiogalactopyranoside

IRs Inverted repeats

IRAC Insecticide resistance action committee

kDa Kilo dalton

Kdr Knockdown resistance

Kg Kilogarm

LB Lura bertani

LD50 Lethal dose, 50%

LSD Least significant difference

M Molar

MCMC Markov chain monte carlo

MIBC Male informative backcross

Mg Milligrams

Abbreviations

XIV

MgCl2 Magnesium chloride

min Minutes

ml Millilitres

mM Millimolar

mm Millimeter

mRNA Messenger RNA

mtDNA Mitochondrial DNA

NaCl Sodium chloride

NADH Nicotinamide adenine dinucleotide

NADPH Nicotinamide adenine dinucleotide phosphate

NCBI National center for biotechnology information

NPV Nuclear polyhedrosis virus

nt Nucleotide

PBO Piperonyl butoxide

PAGE Polyacrylamide gel electrophoresis

PCR Polymerase chain reaction

pM Picomole

QTL Quantitative trait loci

qRT-PCR Quantitative reverse transcription PCR

RACE-PCR Rapid amplification of cDNA ends PCR

RAPD Randomly amplified polymorphic DNA

RFLP Restriction fragment length polymorphism

RH Relative humidity

RNA Ribonucleic acid

rpm Resolution per minute

rRNA Ribosomal RNA

RT Reverse transcription

SD` Standard deviation

SDS Sodium dodecyl sulfate

Sec Second

SNPs Single nucleotide polymorphisms

SSR Simple sequence repeats

STR Short tandem repeats

T Thymine

Abbreviations

XV

TAE Tris acetate ethylenediaminetetraacetic acid

TE Tris ethylenediaminetetraacetic acid

Tm Melting temperature

U Units

US$ United states dollar

UV Ultra violet

V Volts

VNTR Variable number tandem repeats

Abstract

XVI

Abstract

Cotton bollworm, Helicoverpa armigera (Hübner) is a polyphagous pest which

has been reported from a wide array of plants and has cosmopolitan distribution across

Asia, Australia, Africa, Europe and South America. It is one of the most widespread

pest species of economically important crops. To prevent the damage caused by H.

armigera, a variety of methods are being used, including the use of chemical and

biological pesticides. Chemical pesticides are the first choice for H. armigera control

and 30% of all the pesticides worldwide are used against this pest. The insecticides

used for its control include organophosphates, carbamates and pyrethroids but

extensive and unattended use of chemical pesticides has resulted in high levels of

resistance in H. armigera. In Pakistan, H. armigera has developed high level of

resistance against pyrethroid insecticides mainly cypermethrin but the resistance

mechanism and the underlying genes have remained unidentified. The current study

was designed to identify and investigate the novel genes and mechanisms involved in

metabolic insecticide resistance in H. armigera with particular focus on a pyrethroid

(cypermethrin) and to find the genes regulating the over-expression of cytochrome

P450 in the resistant insects.

Helicoverpa armigera were collected from cotton/chickpea fields in Faisalabad

(FSD), Pakistan and tested for resistance against cypermethrin. It was revealed that

FSD has evolved 6.9-fold resistance compared to Australian cypermethrin susceptible

strain TWBS (Toowoomba). To determine the resistance mechanism of the FSD

strain, larvae were treated with piperonyl butoxide (PBO), a known P450 and

carboxylesterase inhibitor, prior to cypermethrin treatment and the observed

cypermethrin resistance was a metabolic resistance. To find out the genes involved in

metabolic resistance, amplified fragment length polymorphism (AFLP) was used. The

AFLP based linkage map of FSD strain revealed that a single linkage group consisting

of 13 AFLPs showed a strong correlation with resistance, indicating the involvement

of a single gene. Thus a previously reported metabolic resistance gene CYP337B3 was

considered as a possible candidate gene for cypermethrin resistance in FSD strain and

it was further confirmed by PCR analysis which showed the presence of CYP337B3

gene in toxicity bioassays survived larvae and absence in killed larvae. Survivorship of

Abstract

XVII

the cypermethrin toxicity bioassay was most strongly correlated with the CYP337B3

genotype. To evaluate the metabolic capability of CYP337B3 gene to catabolise

cypermethrin, CYP337B3 was isolated from FSD strain, ligated in heterologous

expression vector and transformed into insect cell line (HA2302). It was found that

heterologous CYP337B3 enzyme is able to degrade cypermethrin in in vitro assays

using high performance liquid chromatography (HPLC).

To evaluate the possible role of other P450 genes in the cypermethrin

resistance of the FSD strain, the expression patterns of 59 P450 genes were analysed

in FSD strain, Australian fenvalerate resistant TWBR strain and susceptible strain

(TWBS) using quantitative PCR (qPCR). There was a higher expression (>5-fold) of

three genes (CYP340G1, CYP340H1 and CYP341B2) in FSD. Expression levels all

P450 genes in TWBR were similar to TWBS only with the exception of CYP321B1

significant down-regulation. Moreover, expression profile of these genes was also

examined in backcross progeny possessing CYP337B3 to study whether the

upregulated P450 genes (CYP340G1, CYP340H1 and CYP341B2) in FSD were

genetically linked to the cypermethrin resistance. However, it was revealed that these

genes were not overexpressed in backcross progeny.

Genetic diversity and presence or absence of resistance, in different

populations of H. armigera from Pakistan, were determined by using DNA barcoding

(COI gene) and CYP337B genes family, respectively. It was found that pyrethroid

resistance gene, CYP337B3 was present in all the populations (Northern, Central, East-

Southern) from Pakistan. Moreover, no significant population structure of H. armigera

was observed in Pakistan, indicating that this migratory pest is not restricted to

specific geographic region.

The study concludes that H. armigera in Pakistan has evolved CYP337B3 mediated

metabolic resistance against pyrethroids and CYP337B3 evolved twice independently

by unequal crossing-over between CYP337B2 and two different CYP337B1 alleles.

Introduction and Review of Literature Chapter 1

1

Chapter 1

General introduction and review of literature

The planet Earth is home to an astonishing diversity of animal and plant

species. The currently known 1.2 million (M) species are likely to be a small fraction

of the true total (3 to 100 M) estimated by the biologists (Mora et al., 2011). Class

Insecta, which represents the most dominant form of life on earth; contains of 75% of

all the recorded animal species in almost all ecosystems (ocean, deserts and Antarctic)

(Ikawa et al., 2002). This extraordinary ability of ecological adaptation gives insects

better chance of living in diverse environments. The vast diversity in their population,

body structure and size, adaptive abilities in feeding behaviour and mating approaches

are responsible for their survival and fitness in the environment (Behura, 2006).

Diversity of insects contributes to make them beneficial for environment (pollinate

crops, act as natural enemies of damaging pests and produce useful products such as

honey, wax and silk) (Hill, 1997a). However, insects also act as major pests and

vectors of different diseases of economically important crops (Hill, 1997b). One of the

inborn ability of insects is to develop resistance against insecticides, which is an

alarming situation for agriculture, human health and economy (Behura, 2006).

Subfamily Heliothinae (family Noctuidae), includes most of the world's major

crop pests, such as Helicoverpa zea, Helicoverpa assulta (Guenée), Helicoverpa

punctigera (Wallengren), Heliothis virescens and H. armigera. In order to understand

their ecology and develop management strategies it is important to understand the

demography of these pests (Fitt, 1989; Mitter et al., 1993). Thus, it is very important to

understand the morphological, behavioural and physiological traits of insect‟s

populations even within the species (Speight et al., 1999).

1.1. Helicoverpa armigera

Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae), commonly known

as old world (African) bollworm, corn earworm, American bollworm, cotton

bollworm (English), is an economically important and a highly polyphagous pest

(Cunningham et al., 1998; Fitt, 1989; Gujar et al., 2000; Zalucki et al., 1986). H.

armigera was previously known as Heliothis armigera and was indistinguishable from


2

its nearest relative Helicoverpa zea (the new world bollworm). In fact both the species

were considered synonyms. The two pest species belong to two different geographical

regions of the world. However, H. armigera has widest global range across four

continents Asia, Australia, Africa and Europe whereas H. zea is present only in South

America and North America (Hardwick, 1970).

1.1.1. Occurrence and biology

H. armigera has been reported from about 200 plant species (68 plants

families) including maize, sorghum, chick pea, pigeon pea, cotton, soybean,

groundnut, sunflower and a range of vegetables. H. armigera has tropical and

subtropical origin and its adults have the ability to migrate over long distances

(Cunningham et al., 1998; Cunningham and Zalucki, 2014; Fitt, 1989; Zalucki et al.,

1986). This ability accounts for the cosmopolitan distribution of this pest across four

continents (Table 1.1) i.e. Australia, Asia, Africa and Europe.

H. armigera larvae (caterpillars) feed and sustain themselves on a wide range

of economically important crops (King, 1994). Larvae feed on the nitrogenous rich

parts of the plant, mainly reproductive structures (Fitt, 1989). Most of the time these

plant parts are harvested in the form of seed or fruiting body (King, 1994), thus

playing an important role in its transfer from one location to another. Due to its

successful adaptation to different agroecosystems, H. armigera can exhibit up to 11

generations a year under favourable conditions. During its life cycle H. armigera

female lays up to 3000 eggs on various plant parts. Depending on temperature,

incubation period ranges from approximately 3-14 days (Shanower et al., 1999).

Newly hatched larvae feed on flowers, buds, bolls and leaves of the crop (King, 1994).

Larval body colouration varies from greenish to light yellowish, reddish brown or

black (Figure 1.1). Larvae passes through 5-7 developmental stages (instars) in 12 - 32

days to reach pupation. Fluctuation in the number of larval instars and metamorphosis

depends on the host plant and the temperature. Pupal period lasts for 10-14 days

before adult emergence in the absence of diapause (dormancy) condition. Diapause

occurs under unfavourable conditions and can last for several months, thus allowing

H. armigera to survive adverse environmental conditions (King, 1994; Reed, 1965;

Shanower et al., 1999). Adult female is yellowish to orange-brown in colour and male


3

greenish-gray in colour (Figure 1.1) and both male and female adults feed on flower

nectar. Females release sex pheromones to attract male for mating, which occurs 3-4

days after emergence. Adults have the ability to migrate over long distances up to

1,000 kilometres. (Fitt, 1989; Shanower et al., 1999).

1.2. Global economic importance

H. armigera causes significant economic losses in the form of reduced crop

yield, poor quality of crop product, pesticide cost, increased number of pesticide

applications, time and cost of scouting required for its control. Severe economic losses

have been reported in agriculture cash crops (cotton and tobacco), maize, sweet corn

pigeon pea, chick pea, vegetables and many horticultural crops (Fitt, 1989).

Worldwide 30 percent of all the chemical pesticides are directed against this pest

(Ghulam, 2007). The exact figure of global economic losses is not possible to

determine while they cause an estimated annual loss of 5 billion US dollars with

additional over 1 billion US dollar cost of chemical pesticides (Sharma, 2005). In

Australia, economic losses during 1990-1991 were estimated to be approximately 150

million Australian dollars; mainly due to the reduction in yield and cost of pest

management. In Queensland, Australia, despite the expenditure of 4.2 million US

dollar, 7.7% reduction in cotton yield was reported (Fitt, 1994). In New Zealand,

during 1969 and 1970 the outbreak of this noctuid species damaged more than 50%

leaves of about 60% of young Pinus radiata trees. The situation in Africa is not so

different. In Ethiopia, Kenya and Tanzania the estimated yield losses due to H.

armigera and cowpea pod borer in beans were 12% to 53% (Abate and Ampofo,

1996). Moreover, in southern Africa the estimated annual yield losses in pigeon pea

reach up to US$ 317 million. In Cote d'Ivoire, between 1978 and 1983, about 60%

reduction in cotton crop yield was recorded due to H. armigera (Abate et al., 2000).

In China, high usage of chemical insecticides to control H. armigera resulted in

significant yield losses due to the reduction in predation by natural enemies and

because of high insecticide resistance. In China, before commercialization of Bt-cotton

in 1994, the estimated losses in cotton due to H. armigera were 6.6% of the total crop

loss (Wu and Guo, 2005). H. armigera has been reported to wipe out over half of the

yield of pulse crops in India (King, 1994). Ahmad (2007), reported that in Pakistan

insecticide resistance in H armigera is a widespread problem, and annually


4

Table 1.1 Geographical distribution of Helicoverpa armigera

European

Union

Widespread in Albania, Armenia, Azerbaijan, Bulgaria, Georgia,

Croatia, Greece, Macedonia, Portugal (including Madeira), Romania,

Spain (including Canary Islands), France, Hungary, Italy, Russia

(European, Siberia), Switzerland, Yugoslavia; found but not

established in Germany, Netherlands; found but eradicated in UK;

intercepted only in the Czech Republic and Denmark.

Asia

Afghanistan, Bangladesh, Bhutan, Cambodia, China (widespread),

Cyprus (locally established), Hong Kong, India (widespread),

Indonesia (widespread), Iran, Iraq, Israel, Japan, Jordan, Kazakhstan,

Korea Democratic People's Republic, Korea Republic, Kuwait,

Kyrgyzstan, Lao, Lebanon, Malaysia, Myanmar, Nepal, Pakistan,

Philippines, Saudi Arabia, Singapore, Sri Lanka, Syria, Taiwan,

Tajikistan, Thailand, Turkey, United Arab Emirates, Uzbekistan,

Viet Nam, Yemen.

Africa

Algeria, Angola, Benin, Botswana, Burkina Faso, Burundi,

Cameroon, Cape Verde, Central African Republic, Chad, Congo,

Côte d'Ivoire, Egypt, Ethiopia, Gabon, Gambia, Ghana, Guinea,

Kenya, Lesotho, Libya, Madagascar, Malawi, Mali, Malta,

Mauritania, Mauritius, Morocco, Mozambique, Namibia, Niger,

Nigeria, Réunion, Rwanda, Senegal, Seychelles, Sierra Leone,

Somalia, South Africa, St. Helena, Sudan, Tanzania, Togo, Tunisia,

Uganda, Zaire, Zambia, Zimbabwe.

Oceania

American Samoa, Australia (north of 17°S and along the east coast),

Cocos Islands, Fiji, Guam, Kiribati, Marshall Islands, Micronesia,

New Caledonia, New Zealand, Norfolk Island, Northern Mariana

Islands, Palau, Papua New Guinea, Samoa, Solomon Islands, Tonga,

Tuvalu, Vanuatu.

Data source: Helicoverpa armigera. Data Sheets on Quarantine Pests, prepared by Centre for

Agricultural Bioscience International (CABI) and European and Mediterranean Plant Protection

Organization (EPPO) for the European Union


5

Figure 1.1 Helicoverpa armigera a. adult female, b. Adult male, c. Pupa and d. larva


6

over Rs. 10 billion are being spent on the import of pesticides through registered firms

alone.

1.3. Control methods

To prevent the H. armigera damage, a variety of methods including use of

chemical pesticides and biological pesticides are being adopted (Schnepf et al., 1998).

In case of H. armigera the chemical pesticides are the first choice for its control

(Ffrench-Constant et al., 2004).

1.3.1. Chemical control

The era of modern chemical pesticides began with the discovery of

organochlorine pesticide, dichlorodiphenyltrichloroethane (DDT) for insect control, by

a Swiss chemist, Paul Hermann Müller (1938). Organochlorines were commercialized

in 1942 as a pest control agent after the successful application of DDT during Second

World War for protection against disease vectors. Organochlorines are acute

neurotoxins and can be divided into three groups namely DDT group,

hexachlorohexane group, and cyclodiene group (Thacker, 2002). The DDT acts on

voltage-dependent sodium channels by disrupting sodium ions flow within the axonal

membranes while hexachlorohexane and cyclodiene are gamma-aminobutyric acid

(GABA) antagonists and inhibit calcium ion influx resulting in hyperexcitation of

nerve cells (Roberts et al., 2004; Thacker, 2002). Many different types of

organochlorine pesticides including DDT, heptachlor, dicofol, chlordane,

endosulfan, aldrin, dieldrin, mirex, endrin and pentachlorophenol have been in use for

pest control since long time. Most of these agents (e.g. DDT and chlordane ) have

been banned in various countries due to the their non target toxicity, accumulation in

the environment, bioconcentration, biomagnification in food chain and harmful effects

on wild life (Metcalf, 2000).

Organophosphates derived from phosphoric acid are another class of modern

synthetic insecticides. Organophosphates act as nerve toxicants which interferes with

nervous coordination by irreversibly inhibiting the acetylcholinesterase (AChE); an

enzyme responsible for hydrolysing excess of acetylcholine (neurotransmitter) (Gupta

and Milatovic, 2012). This inhibition leads to the accumulation of acetylcholine at all


7

ganglia and many synapses resulting in hyperexcitation of the Central Nervous System

(CNS). This mechanism has been studied in H. virescens and H. armigera (Brown and

Bryson, 1992; Gunning et al., 1998). Organophosphates are generally classified into

three groups: I. Aliphatic compounds which are carbon chain-like in structure and

include malathion, dichlorvos, acephate, dimethoate, disulfoton, phorate,

methamidophos and mevinphos. II. Phenyl compounds which contain a phenyl ring

and are more stable than aliphatics compounds include parathion, fenitrothion and

fenthion. III. Heterocyclic compounds which possess a ring structure containing

different atoms include diazinon, azinphosmethyl and chlorpyrifos (Thacker, 2002;

Ware and Whitacre, 2004).

Carbamate insecticides are carbamic acid derivatives and are the third class of

chemical insecticides. They were discovered in 1951 when researchers were searching

for compounds other than organophosphates. Carbamates are toxic to mammals and

insects, particularly to beneficial hymenoptera e.g. honeybees. The mode of action,

site of action in CNS and the signs of intoxications of carbamates are similar to those

of the organophosphates while the catalysed reaction is relatively less stable (Gupta

and Milatovic, 2012). Since the commercialization of carbamates in 1956, more than

thirty different types of active ingredients have been developed. These active groups

can be divided into three groups, carbocyclic carbamates; is contact and feeding

poison with non-systemic effects, other chemistries belong to this group are carbaryl,

propoxure and methiocarb. Heterocyclic carbamates is the second class of carbamates

having systemic effects e.g. carbofuran and pirimicarb. The third class is aliphatic

carbamates (aldicarb, aldoxycarb, methomyl and oxamyl), are systemic in action but

extremely toxic (Thacker, 2002; Ware and Whitacre, 2004).

Identification of problems associated with the usage of DDT led to the

introduction and development of new groups of modern chemical pesticides i.e.

pyrethroids. Pyrethroids are synthetic pesticides, derived from chrysanthemic acid and

are similar to the natural pesticide (pyrethrum) extracted from the flowers of

Chrysanthemum cinerariaefolium and Cynomorium coccineum. They are contact and

stomach poisons and their mechanism of action is similar to that of DDT – disrupting

the flow of sodium channel. On the basis of sodium current modification and alcohol


8

moiety, pyrethroids can be classified as type 1 or type 2. The type 1 group compounds

are pyrethrins, allethrin, tetramethrin while type 2 pyrethroids are fenvalerate and

fluvalinate. Pyrethroid insecticides are effective against a range of insect pests.

Susceptibility to pyrethroids toxicoses is higher in insects than mammals primarily

because of slower metabolic clearance, low body temperature and higher affinity for

the pyrethroids in insects (Ensley, 2007).

1.3.2. Biological control

Microbial pathogens such as nuclear polyhedrosis virus (NPV),

entomopathogenic fungi, Bacillus thuringiensis (Bt) and natural plant products are

used for the control of H. armigera (Thacker, 2002).

The NPV (family: Baculoviridae) is used as a microbial insecticide against

insects predominantly the Lepidopteran pests of forests and crops. For the first time, in

1892, NPV was introduced to control Lymantria monacha populations in pine forests

in Germany (Huber, 1986). Larvae are normally infected by ingestion of occlusion

bodies of virions or through vertical transmission and injection by parasitoids. After

ingestion the virions replicate in the larval midgut and the infection spreads to other

tissues through hemolymph causing secondary infections. Infection results in reduced

development, increased exposure to predation and feeding and mobility. The larva dies

in 5–8 days. Further effects may include lowered weights of pupae and adults as well

as reduced reproductive capabilities if larvae survived. Despite a great potential of

NPV for controlling Lepidopteran pests, viral insecticides are used much less than

they could be (Moscardi, 1999).

Entomopathogenic fungus, Beauvaria bassiana is the first microorganism

known to be a disease causing agent in silkworm Bombyx mori. Hundreds of

entomopathogenic fungal species have been isolated and a few of them are being used

commercially. They belong to class Entomophthorales in the Zygomycota or class

Hyphomycetes in the Deuteromycota (Eilenberg, 2002; Thacker, 2002). The fungal

infections occur in arthropods including both crop pests and those insects which are

not the pests of cultivated crops. For example Nomuraea rileyi has been used for

Lepidoptera control (Faria and Wraight, 2007; Shah and Pell, 2003).


9

In recent years one approach to pest management which has received

significant attention is the development of genetically engineered crops by

introgression of genes from distantly related organisms, such as bacterium Bacillus

thuringiensis (Bt). B. thuringiensis, a gram-positive bacterium possesses genes which

encode insecticidal toxins known as Cry proteins. The mechanism of action of the Cry

proteins involves the ingestion of Cry protein crystal followed by solubilisation of

crystal under the alkaline environments of the insect midgut. After solubilisation the

midgut proteolytic enzymes (proteases) convert the protoxin into active toxin. The

active toxin binds to receptor sites in the epithelial cell lining of the midgut which

results in the development of pores or ion channels in apical membrane leading to

eventual death of the insect (Gill et al., 1992; Schnepf et al., 1998). Bt insecticidal

toxins have been widely used against Dipteran, Lepidopteran and Coleopteran insect

pests (Gill et al., 1992; Höfte and Whiteley, 1989; Schnepf et al., 1998). Since the year

2004, the commercial transgenic crops were planted on approximately 170 million ha

in the world (James, 2012). These transgenic crops have decreased the use of chemical

insecticides thus benefitting the growers and also environment (Ferré and Van Rie,

2002). Growing Bt cotton has become a key source of effectively controlling the

damage caused by the pink bollworm (Pectinophora gossypiella) and cotton bollworm

(H. armigera) (Li et al., 2006; Wan et al., 2005; Wu et al., 2003).

1.4. Insecticide resistance

The first case of insecticides resistance was documented by Melander (1914) in

scale insects against an inorganic insecticide. After that a number of cases of

resistance to inorganic insecticides were reported which result in the development of

organic insecticides. But unfortunately organic insecticides face the same situation. By

the year 1947, housefly (Musca domestica) had developed resistance to DDT

(Busvine, 1971). With the introduction of every new insecticide chemistry for pest

control, such as organochlorine, organophosphates, carbamates, and pyrethroids, cases

of insecticide resistance were documented within two to 20 years (IRAC, 2013).

Development of a high level of insecticide resistance in insects is due to the high level

usage of chemical insecticides which have further led to the spread of resistance-

associated mutations (Ffrench-Constant et al., 2004; Ghulam, 2007).


10

1.5. Mechanisms of insecticide resistance

Insecticide resistance occurs either through mutation in the targets site of

insecticides or through changes in the activity of metabolic enzymes that degrade

insecticides before they reach the target site. Insecticide resistance mechanisms in

insects can be divided into four groups; behavioural resistance (a shift in behaviour to

avoid exposure to insecticides), penetration resistance (changes in the insect‟s gut

lining or cuticle), target site resistance (characterized by mutations in the

acetylcholinesterase, sodium channel and GABA receptor genes) and metabolic

resistance (alterations in the levels or activities of detoxification proteins including

Glutathione S-transferase, Carboxylesterase; Cytochrome P450 monooxygenase). In

insects resistance is evolved against insecticides through single method or in

combination of these mechanisms (Ffrench-Constant, 2007; Hemingway et al., 2004;

Li et al., 2007).

1.5.1. Behavioural resistance

An insect shows a shift in behaviour to avoid exposure to insecticides or plants

that possess non-host chemicals (Pittendrigh et al., 2007). Although behavioral

resistance remains controversial, there are strong arguments in the published literature

which support the role of behavioral resistance in insects. This mechanism has been

reported in pyrethroid resistant strain of horn fly (Haematobia irritans) and the

tobacco budworm (Heliothis virescens) along with target-site insensitivity and

enhanced detoxification mechanisms (Sparks et al., 1989). No literature is available

explaining behavioural resistance mechanism in H. armigera.

1.5.2. Cuticular penetration resistance

Penetration resistance involves the slower absorption of insecticide through the

barriers of outer cuticle layers which prevent the entry or penetration of insecticide

into the insect body. Thus reduced penetration provides more time for detoxification

enzyme to metabolise the insecticides. This mechanism frequently works in

combination with other resistance mechanisms (Pittendrigh et al., 2007). Reduced

cuticular penetration insecticide resistance has been reported in housefly (Musca

domestica) and mosquito (Culex pipiens) (Raymond et al., 2002; Seifert and Scott,


11

2002). Metabolism studies of different insecticides using in vivo and in vitro methods

in H. armigera indicate that lowered cuticular penetration appears to be an important

resistance mechanism (Ahmad and McCaffery, 1999; Gunning et al., 1995).

1.5.3. Target site insensitivity

Target site insensitivity is one of the most important mechanisms of

resistance occurs due to alteration at the target site (insecticide receptor site). The

alteration prevents the binding of insecticide to its site of action, thus allowing the

insect to survive under stress condition (Mullin and Scott, 1992). In insects

knockdown resistance (Kdr) is the well-known resistance mechanism against

dichlorodiphenyltrichloroethane (DDT) and pyrethroids. Kdr resistance is associated

with mutations in the sodium-channel gene, the main target of pyrethroids.

Furthermore, in vitro studies have demonstrated that sodium-channel insensitivity

confer resistance to DDT and pyrethroids (Davies et al., 2007). Target site alteration

have been found in several species, including tobacco budworm (H. virescens) and

Colorado potato beetle (Clarke and Ottea, 1997; Sharif et al., 2007). Increased target

site insensitivity with Super-Kdr was reported in H. armigera from Australia (Gunning

et al., 1991). Furthermore, acetylcholinesterase (AChE) target site resistance has been

shown in carbamate resistant strain of H. armigera and was considered an intractable

resistance mechanism in pests (Gunning, 2006). But the level of target site

insensitivity varies in H. armigera collected from India, China, Thailand and Australia

(Russell and Kranthi, 2006). Reports indicate that reduction in pyrethroids selection

pressure is responsible for the replacement of pyrethroid resistance mechanisms from

nerve insensitivity to metabolic form of resistance (Forrester et al., 1993).

1.5.4. Metabolic resistance

Metabolic resistance involves biochemical transformation of a toxic compound

or insecticide, thus decreasing its capability to interact with a target site. Biochemical

transformation in insects comprises three integrated distinct phases (I, II and III).

Phase I involves the oxidation of insecticide by cytochrome P450 monooxygenases

(P450s). In phase II, the activated insecticide is converted into water-soluble substrate

by Glutathione S-transferases (GSTs). In phase III, the less toxic metabolite is

eliminated from the cell. An increase in the levels or activities of these detoxificative


12

enzymes (P450s, GSTs and carboxylesterase) due to gene duplication, transcriptional

enhancements and mutations in coding sequences of genes are responsible for

increased detoxification (Li et al., 2007; Sheehan et al., 2001).

Cytochrome P450-dependent monooxygenase enzymes the members of a

superfamily of heme-containing proteins and are very important in the oxidative

metabolism of endogenous compounds such as fatty acids, hormones and steroids, and

exogenous compounds including pesticides, drugs and toxins from plants (Feyereisen,

2005; Scott, 2008). More than 660 genes encoding P450 of insects, disseminated in

different insect families and subfamilies have been characterized (Li et al., 2007).

P450s genes are designated by prefix CYP; insect P450s have been categorized into

six CYP families; CYP6, CYP9, CYP12, CYP18 and CYP28 are insect specific, and

CYP4 is shared with sequences from other organisms (Nelson et al., 1996).

Monooxygenases are found in all aerobic organisms. They are mostly found in the

endoplasmic reticulum or mitochondria of eukaryotes and in soluble form in bacteria

(Scott, 1999). In P450 catalysed reactions hemoproteins activate dioxygen producing

two atomic oxygens, which catalyses the regio- and stereospecic oxidations of

unactivated hydrocarbons (C-H). The first atom of oxygen is introduced into the

organic substrate e.g. insecticide, whereas the second oxygen atom is reduced to water.

Catalytic activity of P450s is dependent on a protein redox partner to deliver one or

more electrons from NADH or NADPH to the P450 heme center. Redox reaction

proteins are cytochrome P450 reductase, cytochrome b5 (mirosomal), adrenodoxin

reductase and adrenodoxin (mitochondrial), ferredoxin reductase and a ferredoxin

(bacterial) (Feyereisen, 2005; Urlacher and Girhard, 2012). The P450 catalysed

reactions play an important role in metabolic insecticide resistance in insects. P450

monooxygenases show large variation in substrate specificity. In insects, a wide range

of tissues produces monooxygenases; highest activities are usually associated with the

midgut, fat bodies and malpighian tubules. The expression patterns of individual

P450s vary at different life stages of insects (Scott, 1999). Constitutive over-

expression of P450 monooxygenase genes is associated with resistance to insecticides

in many insects and elevated metabolism is confirmed at the biochemical level as an

important resistance mechanism to pyrethroids in H. armigera from Asia (Yang et al.,

2006; Yang et al., 2004). The specific gene responsible for insecticide resistance in H.


13

armigera has not yet been identified in the field population but the quest for

cytochrome P450 genes involved in metabolic resistance continues. One of the earlier

studies from Australia involves the isolation and sequencing of CYP6B2 gene, with the

assumption that CYP6B2 is important in metabolic resistance to pyrethroids while

there could likely be other P450 genes which may also be important in resistance

(Xiao-Ping and Hobbs, 1995). Although it has shown that CYP6B7 has no role in

resistance (Grubor and Heckel, 2007) but there are some reports claiming its role in

pyrethroids resistance. Additionally isolation and characterization of CYP6B2,

CYP6B6, and CYP6B7 genes was done in a pyrethroid resistant strain from Australia.

The mRNA for CYP6B7 was found to be over-expressed in pyrethroid resistant

population of H. armigera thus responsible for pyrethroid metabolism (Ranasinghe

and Hobbs, 1998). Yang et al., (2006) from China isolated P450 genes, CYP9A12,

CYP9A14, CYP6B7 and CYP4G8 from H. armigera YGF (a laboratory selected strain)

by reverse transcriptase polymerase reaction (RT-PCR) and rapid amplification of

cDNA ends (RACE). Constitutive over expression of multiple cytochrome P450 genes

(CYP9A12, CYP9A14, and CYP6B7) was assumed to be linked with pyrethroid

resistance. cDNA-amplified fragment length polymorphism (AFLP) analysis in ANO2

strain of H. armigera revealed two P450 genes CYP337B1, CYP4S1, a

carboxylesterase-like gene and a glutathione S-transferase gene were found to be

constitutively overexpressed. CYP337B1 was found to be tightly linked to the resistant

locus RFen1, suggesting that this P450 may be responsible in a fenvalerate

(pyrethroid) resistant strain (Wee et al., 2008). Expression profiling of multiple P450s

in H. armigera deltamethrin resistant strain (lab and field collected strain) from Africa

and Spain showed significant overexpression of multiple genes (CYP4M6, CYP4M7,

CYP6AE11, CYP9A12, CYP332A1 and CYP337B1) (Brun-Barale et al., 2010).

Recently, in order to explore the role of CYP337B1 in fenvalerate resistant strain

TWB, a new chimeric gene CYP337B3 was found. CYP337B3 gene which resulted

from an unequal crossing over between two parental genes, CYP337B1 and

CYP337B2, has been reported from a susceptible TWB strain of H. armigera, in

Australia (Joussen et al., 2012).

Glutathione S-transferase (GSTs) is another important large gene family of

metabolic enzymes. Phase II metabolic enzymes are responsible for the detoxification


14

of an extensive variety of synthetic and toxic chemicals including insecticides. GSTs

are located in microsomes, cytosol, mitochondria and peroxisomes within the cell

(Udomsinprasert et al., 2005). In insects GSTs are classified into three major classes

(class I, class II, and class III). Class I and III are designated delta and epsilon classes,

respectively while class II is designated as sigma class which includes GSTs from

several mammalian classes. These enzymes are involved in metabolic resistance by

detoxification of various endogenous and synthetic compounds through glutathione

conjugation, dehydrochlorination and glutathione peroxidase activity (Li et al., 2007).

In GSTs catalysed reactions, electrophilic compounds are conjugated with the thiol

group (SH) of reduced glutathione (GSH) thus making the end products more water

soluble that can be easily excreted (Enayati et al., 2005). In insects, organophosphate,

organochlorine and pyrethroid resistance is GST-mediated (Li et al., 2007).

Dehydrochlorination of DDT is an important GST mediated resistance mechanism

reported in houseflies and mosquitoes. Higher levels of GSTs activity have been

reported to be linked to insecticide resistance in many insects. It is not evident that

either increase in the expression of GST enzymes or gene amplification are involved in

insecticide resistance (Enayati et al., 2005). In H. virescens GSTs are involved in

resistance to profenofos. GST activity was found to be significantly higher in phoxim-

resistant H. armigera which shows correlation between increased GSTs activity and

insecticide resistance (Ahmad, 2007; Li et al., 2007).

Esterase is known to be the 3rd key group of metabolic enzymes involved in

detoxification of insecticides. In insects, elevated level of esterases is frequently

implicated in resistance against organophosphates, carbamates and pyrethroids. In

addition to overexpression of esterase genes, single point mutations are known to play

role in insecticide resistance. Esterases detoxify the insecticides by sequestration

(rapid-binding and slow turnover of insecticide) and hydrolysis reactions (Achaleke et

al., 2009; Hemingway et al., 2004; Li et al., 2007). Increase in the sequestration is due

to gene amplification, as has been reported in an aphid (Myzus persicae), mosquitoes

(Culex quinquefasciatus, C. pipiens, C. tarsalis and C. tritaeniorhynchus) and the

brown planthopper (Nilaparvata lugens) (Hemingway et al., 2004). Elevated level of

esterases has been reported in Bt (Cry1Ac toxin) resistant H. armigera (Gunning et al.,

2005).


15

1.6. Genomics of insecticide resistance

Currently molecular techniques are being extensively used to study the ecology

and molecular biology of insects (Symondson, 2002). In this regard significant work

has been done to understand the diversification and ecology of insects. In early days of

classical genetics phenotypic markers were used to understand different traits of

insects e.g. eye colours, body shape and hairs etc. In 1910, Thomas Hunt Morgan

constructed genetic map of fruit fly (D. melanogaster) based on one phenotypic

character, eye colour (Benson, 2001). The advantage of phenotypic markers is that

they are present through the lifespan. Further these markers can be used in field

conditions. But there are limitations of using these markers; such as they are

comparatively rare, hard to score, time consuming, interfere with overall fitness of

organism and require inheritance pattern as additional information. To overcome the

limitation of phenotypic markers, scientists chose alternative markers known as

biochemical markers or protein markers (blood antigens or isozymes). These markers

have made a significant contribution in understanding insect diversity and ecology.

These markers were used to study inter- and intra-species variation based on

discrepancy in allozymes, insecticide resistance, pathogen identification and

chromosome mapping (Behura, 2006).

However, with the progress in DNA technologies, DNA markers were found to

be superior to protein markers. DNA markers provide greater level of polymorphism

(variation) with a high stability than protein markers and are not affected by genotype

x environment interaction. Further, unlike protein, DNA can be obtained from any

tissue at any developmental stage of life. Thus, DNA markers are considered to be the

most common technique used in molecular chemical ecology in insects (Hoy, 2003;

Richardson et al., 1986).

1.7. Genome mapping

Genome mapping is one of the fundamental approaches used to describe

the relative position of DNA fragments on chromosomes. The DNA fragments that are

placed on chromosomes are known as molecular markers (coding and non-coding

DNA) (Dear, 2001). About a hundred year ago genetic map of Drosophila X-

chromosome was constructed (Sturtevant, 1913). Since then molecular markers have


16

made great contribution to quantitatively inherited trait studies and polymorphisms at

the DNA level in insects. The mapping approaches can be separated into two different

techniques, genetic mapping (linkage maps) and physical mapping.

1.7.1. Genetic mapping

Genetic mapping or linkage mapping is a technique used to construct a linkage

map indicating the location of genetic markers or known DNA sequences (DNA

fragments) corresponding to chromosomes. Linkage map is useful for locating the

genes responsible for monogenic and polygenic traits. Linkage analysis is applied to

crosses in order to score polymorphisms in parents and offspring. Normally

backcrosses and interspecies crosses are analysed through linkage analysis. Moreover,

gene location and distribution of DNA markers on linkage groups are estimated by

using different statistical tools. DNA markers commonly include morphological

mutants, microsatellites, SNPs (single nucleotide polymorphisms), RFLP analysis

(restriction fragment length polymorphisms), RAPD analysis (randomly amplified

polymorphic DNA) and AFLP analysis (amplified fragment length polymorphisms)

(Heckel, 2003). Further these markers are grouped into dominant markers (RAPD and

AFLP) and co-dominant markers (RFLP, SNPs and SSR).


17

1.8. DNA markers to evaluate genetic diversity

1.8.1. Microsatellites

Microsatellites studies of nuclear DNA markers are used in population genetics

and evolutionary relationships (Zhang, 2004). Microsatellite markers are segments of

DNA sequences which consist of tandem repeats of 2–6 nucleotides and found at high

frequency in the nuclear genome. Normally microsatellite fragment consist of 5 to 40

repeats. Commonly used microsatellites are simple sequence repeats (SSR), short

tandem repeats (STR) and variable number tandem repeats (VNTR) (Ellegren, 2004;

Selkoe and Toonen, 2006). The surrounding DNA sequence (flanking regions) of

microsatellite remain conserved within and between genomes in different species.

Primers are designed for flanking regions to amplify the microsatellite fragments

through polymerase chain reaction (PCR) (Selkoe and Toonen, 2006). Microsatellite

markers are highly abundant and variably dispersed in both coding and non-coding

DNA, thus produce great numbers of markers compared to other marker systems e.g.

AFLP (Behura, 2006). It has been recently reported that these microsatellites can be

used comprehensively beyond population genetics and phylogenetic relationship

studies (Schloetterer, 2001). Microsatellite markers have been successfully used for

linkage mapping in mosquitoes (Anopheles gambiae) (Heckel, 2003). The

disadvantage of microsatellites is that they cannot be used as neutral markers due to

their involvement in gene regulation, genetic drift and differential selection in sexes.

Hence, microsatellite markers may not be useful in evolutionary relationships and

phylogenetic analysis (Behura, 2006). The use of microsatellite markers in

Lepidoprteran insects including H. armigera is challenging (Ji et al., 2003; Zhang,

2004). In Lepidopteran genome microsatellite markers are abundant possessing almost

identical flanking DNA sequences, which result in low efficiency of microsatellite

isolation (Zhang, 2004).

1.8.2. Single nucleotide polymorphisms (SNPs)

Single nucleotide polymorphisms (SNPs) are variations based on single

nucleotide differences. Variations occur due to the introduction of point mutations in

DNA sequences without changing the overall length of the DNA sequence. SNPs exist

abundantly throughout the genome in both coding and non-coding DNA sequences.


18

Single nucleotide mutation in non-coding DNA has no direct effect on the phenotype.

However, such mutations in coding or promoter and enhancer DNA regions have

direct impact on protein structure and gene regulation (Syvanen, 2001). The

abundance of SNPs in insect genome has proven to be useful in population genetics,

marker assisted selection and genetic mapping. A number of SNPs have been reported

to be associated with insecticide resistance in several insects; including cotton-melon

aphid (Aphis gossypii), codling moth (Cydia pomonella) and red flour

beetle (Tribolium castaneum) but SNPs polymorphism study in insects is mostly

limited to Drosophila and mosquitoes (Andreev et al., 1994; Andrews et al., 2004;

Black and Vontas, 2007; Brun-Barale et al., 2005; Steichen et al., 1993). In Anopheles

gambiae (a pyrethroid resistant mosquitoe), SNPs were used for identifying resistance-

associated polymorphisms but association mapping was found to be challenging in A.

gambia (Weetman et al., 2010). Thus it is a difficult task to find out genetic variation

involved in pesticide resistance at a selected gene. Currently, due to the automation in

the form of high-throughput, automated SNP detection methods can be used for

hundreds of thousands of SNPs simultaneously. But high-throughput technology will

be expensive in case of identifying only few markers associated with an important

phenotype such as insecticide resistance.

1.8.3. Restriction fragment length polymorphisms (RFLPs)

RFLP markers are hybridization-based molecular markers and are commonly

used for genetic analysis since their introduction in 1974. In RFLPs, variations in the

length of DNA (nuclear DNA, mitochondrial DNA, and ribosomal DNA or

hypervariable sequences) fragments are identified through differential digestion of the

isolated DNA with restriction endonucleases followed by southern blot procedure

(Botstein et al., 1980; Semagn et al., 2006; Severson, 1996). Restriction enzyme

cleaves DNA at a specific recognition site within a genome. More than 3800

restriction enzymes are known out of which more than 611 are commercially available

(Roberts et al., 2007). The observed variation within and among population depends

on the number of probes and restriction enzymes used. RFLP technique is

advantageous having high reproducibility, co-dominant inheritance, DNA sequences

information is not needed and is easy to score. RFLP markers system has been used

extensively for linkage mapping in many plant and animal species and can provide


19

information about phylogenies of populations, geographic variation, parentage and

relatedness and gene flow (Botstein et al., 1980; Semagn et al., 2006; Severson, 1996).

In entomology RFLP analysis have been used for several insects including; Colorado

potato beetle (Leptinotarsa decemlineate), mosquitoes (Aedes scutellaris, Aedes

aegypti, Armigeres subalbatus, Culex pipiens and Cx. tritaeniorhynchus and

Anopheles quardrimaculatus), cicadas (Magicicada), screwworm (Cochliomyia

hominivorax), monarch butterfly (Danaus plexippus), cricket (Cryllus firmus), blowfly

(Phormia regina), apple maggot fly (Rhagoletis pomonella) and fruit fly (D.

melanogaster) (Heckel, 2003; Hoy, 2003). Furthermore the RFLP markers were used

to determine DDT resistance association with knockdown (Kdr) trait in housefly

(Musca domestica) (Behura, 2006). However, there are several limitations for RFLP

analysis; requires high quantity and quality of DNA, show low level of polymorphism

because few bands are scored per assay, is dependent of specific probe library for an

organism, costly, laborious and lengthy procedure (Semagn et al., 2006).

1.8.4. Randomly amplified polymorphic DNA (RAPD)

Randomly amplified polymorphic DNA (RAPD) also known as multiple

arbitrary amplicon profiling, is a PCR based genetic marker system. RAPD was

introduced by Williams et al., (1990). By using RAPD markers the polymorphism

within and among populations is observed by amplifying target DNA by using a single

arbitrary oligonucleotide primer (nucleotide sequence, mostly ten bases long). Further

prior knowledge of the target sequence is not required and the arbitrary primer binds

randomly at two different positions on complementary strands of DNA (Jonah et al.,

2011; Semagn et al., 2006).

The RAPD markers have been used in gene mapping and to determine isolated

populations at geographic and genetic level. Polymorphism in the non-coding DNA

sequences is revealed by using RAPD markers. Thus it is helpful to determine the

genetic structure of populations of different species (Jain et al., 2010). RAPD markers

have been used to determine parentage in Anax parthenope and Orthetrum

coerulescens (keeled skimmer), genetic linkage map in aphids, genotyping in

silkworm, vectorial ability in Triatoma infestans and mosquitoes (Jonah et al., 2011).

RAPDs have been used to construct an integrated map in tobacco budworm (H.


20

virescens) and to study genes involved in chemical and biological (Bt toxin) resistance

(Heckel, 2003). Sequence characterized amplified region (SCAR) markers, derived

from specific RAPD loci of H. armigera have been used to check the presence of H.

armigera in predator (Dicyphus tamaninii) gut. In a study on the genetic structure of

H. armigera population, using RAPD-PCR 84 possible polymorphic RAPD loci were

investigated (Agusti et al., 1999; Jonah et al., 2011). However, there are certain

limitations to the use of RAPD markers. For example, in insect ecological studies

RAPD markers have shown poor reproducibility, loss of information of recessive

characters due to their dominant nature, and as well the primer short lengths often

results in loss of bands (Behura, 2006; Jonah et al., 2011).

1.8.5. Amplified fragment length polymorphism (AFLP)

The amplified fragment length polymorphism (AFLP) is a dominant biallelic

marker system based on RFLP based polymorphism principle with more efficient PCR

amplification of restricted fragments (Vos et al., 1995). The drawbacks of RAPD

marker system are overcome by the adaptation AFLP markers. AFLP generate more

reproducible and stable markers (50-100 bands per primer pair) than RAPD and does

not require prior knowledge DNA sequence (Behura, 2006; Jonah et al., 2011). AFLPs

generally have co-dominant mode of inheritance in nature but some times dominant

AFLPs are also amplified (Behura, 2006). Due to AFLP's dominant mode of

inheritance it is not applicable to study genetic variation within same breed but is

highly informative in case of determining relationship between different breeds

(Buntjer et al., 2002; De Marchi et al., 2006). AFLPs are used for gene mapping and

QTL analysis (quantitative trait loci), construction of linkage maps of genomes,

genetic differentiation and genetic relationships (Behura, 2006; Ming and Wang,

2006). Moreover, cDNA AFLP has been used for expression profiling of differentially

expressed genes in insects; H. armigera (Wee et al., 2008). AFLP markers are useful

in understanding evolution of sexual communication in H. virescens and Heliothis

subflexa (Gould et al., 2010) and to determine differences in sexual communication

between different strains of Spodoptera frugiperda (Unbehend et al., 2013). In insects

AFLP markers have broadly been used to construct linkage maps and are available for

several insects; namely, silkworm, European corn borer, red flour beetle, Hawaiian

cricket, Hessian fly and butterfly (Behura, 2006). Similarly AFLP based linkage maps


21

for several agricultural pests including L. decemlineata, P. xylostella and H. armigera

are used to find out the loci (gene) conferring resistance to chemical and biological

(Bt) pesticides (Heckel, 2003).

1.8.6. Mitochondrial DNA (mtDNA) markers

Mitochondrial DNA (mtDNA) represents only a small fraction of total

genomic DNA of an organism but has been a valuable marker in molecular

systematics, diversity and evolutionary studies. Moreover, it has been used in gene

flow analysis, biogeography and hybridization studies (Galtier et al., 2009; Hoy,

2003). There are certain reasons for using mtDNA as a valuable marker; it has tiny

size, is easy to amplify due to presence of multiple copies per cell, remains conserved

across animals, has no intronic sequence, is highly variable in natural populations, has

maternal mode of inheritance, lacks recombination, and its variable DNA regions are

flanked by highly conserved ribosomal DNA sequences (Galtier et al., 2009; Gissi et

al., 2008). Recent studies indicate that pseudogenes are present in mtDNA which

could be a limitation. But still using mtDNA is the most suitable and inexpensive

technique for genetic exploration of new and wild species.

In insects, mtDNA has recently been used as a potential marker for the study of

population genetics and phylogenetics. Insect mitochondrial genome consists of 37

genes coding for two ribosomal RNA, 22 transfer RNA genes and 13 protein coding

genes (Hoy, 2003). Molecular techniques such as RFLP and sequencing are applied in

mtDNA ecological studies. In sequencing, specific regions or gene regions of the

mtDNA are amplified. Mitochondrial genes, cytochrome oxidase subunit I and II (COI

and COII) and cytochrome B (CytB) are usually studied. Animal mitochondrial COI

gene is adopted as the standardized tool to study the within-gene heterogeneity,

evolutionary rate and its application for evolutionary analyses (Ratnasingham and

Hebert, 2007).

DNA barcoding is a very recent term used for diversity and phylogenetic

analysis within and among the populations. Partial sequence of COI gene (658 base

pair) has been used extensively by scientists for taxonomic identification of organisms.


22

COI gene (5ʹ-end DNA sequence) is used as a standard because of its robustness and

wide range of phylogenetic signal (Hebert et al., 2003; Ramadan and Baeshen, 2012).

Several insect species; including, Reticultermes lucifugus grassei (Jenkins et

al., 2001), Coptotermes formosanus (Jenkins et al., 2002), Reticulitermes flavipes,

Reticulitermes arenincola, Reticulitermes santonensis (Ye et al., 2004), Reticulitermis

urbis (Leniaud et al., 2010), Simulium vittatum Zetterstedt (Gaudreau et al., 2010),

Planococcus citri, Planococcus minor (Rung et al., 2008), Phenacoccus solenopsis

(Ashfaq et al. 2010) and Planococcus relictus (Bon et al., 2008) have been identified

and characterised using COI gene. For H. armigera diversity study partial COI gene

was amplified from 249 individuals collected from different locations of the world.

This diversity study supports that H. zea and H. armigera belong to different

geographical regions (Behere et al., 2007).

1.9. Research objective

The present research work is aimed at the identification and investigation of

novel genes and mechanisms involved in metabolic insecticide resistance in H.

armigera with particular focus on a pyrethroid (cypermethrin) and to find out the

genes regulating the over-expression of cytochrome P450 and GSTs in the resistant

insects.

Materials and Methods Chapter 2

23

Chapter 2

General materials and methods

2.1. Insect collection

Helicoverpa armigera adults and larvae of the pyrethroid-resistant and -

susceptible strains were collected from two different geographical regions of the world

viz. Asia (Pakistan) and Australia (Table 2.1). The resistant strains were collected

from the areas where the insecticides were used frequently for bollworm control while

the susceptible strains were collected from areas under minimum exposure to

insecticides. The collected specimens were maintained in the laboratory under

insecticide-free environment. The collected samples were used for DNA/RNA

extraction (adults and larvae) and establishment of cultures for toxicological and

biochemical study.

2.2. Helicoverpa armigera diets and rearing

Larvae of different strains were reared on bioserve (general purpose

Lepidoptera diet, product No. F9772) and pinto bean diet. The bioserve diet contains

144 g/L of bioserve diet powder and 19 g/L of agar. The pinto bean diet contains pinto

bean powder 125 g/L, wheat germ 100 g/L, soy protein 50 g/L, casein 50 g/L, torula

yeast 62.5 g/L, ascorbic acid 6.0 g/L, methyl paraben (4-

hydroxybenzoesauremethylester) 5 g/L, sorbic acid 3 g/L, Vanderzant vitamin mixture

10 g/L, tetracycline 0.25 g/L and agar 35 g/L. The diet was cooked and sterilised under

UV light for 30-60 min in laminar air flow hood. The larvae were reared individually

up to adult stage in plastic cups. Emerged adults were nourished with a 10% honey-

water solution. H. armigera (larvae, adult, eggs and pupa) were placed in

environmental chambers at 26 ± 1°C, 55% RH, with 16 h light and 8 h dark

photoperiod.

2.3. Chemical insecticide and toxicity test

Resistance levels of H. armigera strains were determined against technical

grade cypermethrin (mixture of isomers, purity ≥98%, Sigma-Aldrich, Germany). Five


24

serial concentrations of cypermethrin were prepared in acetone and 1 µL of the

insecticide was applied on the thorax region of the larva using Hamilton syringe. For

every concentration 30 to 40 third instar larvae, each weighing 20 to 30 mg, were

treated. In order to investigate the possible role of P450 monooxygenases mediated

resistance, piperonyl butoxide (PBO) (Endura Fine Chemicals, Italy) was applied 2 h

prior to the application of cypermethrin. Before and after the treatment larvae were

allowed to feed on artificial diet following the normal rearing conditions. Mortality

was observed after 48 h of the treatment and a larva was considered to be dead if it did

not respond to the stimulus. Observed mortalities were transformed by probit analysis

using SPSS and Statistics software packages (version 17.0) for linear regression

analysis to determine slope of LD50 values.

2.4. Genomic DNA extraction

For DNA isolation, various methods were applied depending on tissue part and

life stage of H. armigera. DNA extraction protocol reported by Wee et al., (2008) was

used with some modifications and DNA was extracted from a whole larva or from the

thorax of the individual adults. Individual tissues were transferred into 1.5 ml

Eppendorf tubes containing metallic beads and 600 µL DNA isolation buffer (50 mM

Tris-HCL, pH 8.5, 0.1 N NaCl, 1 mM DTT, 10 mM EDTA and 0.2% SDS). The

samples were crushed with the help of Tissue Lyser II machine (cat # 85300, Qiagen,

Germany) for 2-3 min at 30 Hz. Homogenates were transferred into fresh Eppendorf

tubes containing 400 µL TE-equilibrated phenol (pH 8.0), closed the tube, vortexed

vigorously and placed on ice. Tubes were centrifuged at 13000 rpm (Micocentrifuge,

Eppendorf: Germany) for 5 min at room temperature. Aqueous fractions were

transferred to a fresh tube and after adding 3 µL of 10 mg/ml RNase A were incubated

at 37°C for 2 h. Added 400 µL chloroform, mixed it and centrifuged at 13000 rpm

(Micocentrifuge, Eppendorf: Germany) for 5 min at room temperature. Supernatant

was transferred into fresh vials and 800 µL pre-chilled 100% ethanol was added. The

vial contents were mixed by gentle inversion of the tube and allowed to precipitate for

2 h at -20°C. Centrifuged at 13000 rpm (Micocentrifuge, Eppendorf: Germany) for 20

min at 4°C, carefully decanted the supernatant to avoid loss of pellet. Pellet was

washed with 200 µL ethanol (70%) by centrifugation at 13000 rpm (Micocentrifuge,

Eppendorf: Germany) for 10 min at 4°C. Supernatant was decanted carefully and left


25

over ethanol was removed with a pipette. Pellet was dried at room temperature for 30

min, re-suspended in 100 µL nuclease free water and finally stored at -20°C until used.

2.5. RNA extraction

Total ribonucleic acid (RNA) was extracted from the whole larval body using

Trizol reagent (Invitrogen, Inc). Larvae were homogenized individually using pestle

and mortar to a fine powder in liquid nitrogen and then mixed with one ml of Trizole

reagent 50 mg tissue. Homogenate was centrifuged at 13000 rpm for 10 min at 4°C.

Supernatant was transferred to a fresh tube and incubated for 5 min at room

temperature. Added 0.2 ml chloroform per ml of trizol, vortexed vigorously, incubated

for 2-3 min at the room temperature and centrifuged for about 10 min at 13000 rpm

and 4°C. The aqueous phase was transferred into a fresh vial, added 0.5 ml isopropyl

alcohol per one ml Trizol, mixed well and incubated for 10 min at room temperature

followed by centrifugation at 13000 rpm and 4°C for 10 min. The supernatant was

decanted and the resulting pellet was washed with 75% ethanol (one ml/per ml of

trizol). Following the centrifugation for 5 min at 13000 rpm max and 4°C, supernatant

containing ethanol was discarded. Resulting RNA pellet was air dried for 5-10 min

and dissolved in 100 μL of diethylpyrocarbonate (DEPC)-treated water and stored at -

80°C.

2.6. RNA purification

a. DNase treatment

To remove DNA contamination from the isolated RNA, 10 µL of 1X DNase

buffer and 2 U of DNaseI (Ambion, Texas, USA) were mixed and incubated for 30

min at 37°C.

b. Purification

RNA was purified by using RNeasy® Mini EluteTM

clean up kit (cat # 74204,

Qiagen, Germany). Each RNA sample volume was adjusted up to 200 μL with RNase-

free water followed by the addition of 700 μL RLT Buffer and mixing. Then 500 μL

of 100% ethanol was added and mixed thoroughly by gentle pipetting. The sample


26

mixture was transferred to an RNeasy MinElute spin column and centrifuged for 15

sec at 10000 rpm. The column was placed in a new collection tube and 500 μL buffer

RPE was added into the column before centrifugation at 10000 rpm for 15 sec. RNA

attached to column membrane was washed with 500 μL of 80% ethanol by

centrifugation for 2 min at 10000 rpm. The flow-through was discarded while the

RNeasyMinElute spin column was transferred to fresh 1.5 ml collection tube. For

RNA elution, 20 μL of RNase-free water was added to the column membrane. RNA

was collected in collection tube after centrifugation for one min at 13000 rpm and

stored at -80°C.

2.7. Quantitation of DNA/RNA

The DNA/RNA was quantified with NanoDrop (ND-1000 spectrophotometer

(NanoDrop Technologies, Inc. USA). The total absorbance of the samples was

measured at 260 nm while using nuclease free or DEPC water as a blank to set

machine at zero. The purity of DNA and RNA was measured at 260 nm and 280 nm at

260/280 (ratio of absorbance). Further the purity of RNA was checked by Agilent

RNA 6000 Nano Kit (Agilent Technologies, Inc. Germany).

2.8. cDNA synthesis

Synthesis of first cDNA strand was carried out using RevertAIDTM

H Minus

first strand cDNA synthesis kit (Fermentas GmbH, Germany). For a 500 ng of total

RNA, 5X Reaction buffer, 200 U RevertAIDTM

H Minus M-MuLV reverse

transcriptase, 20 U RiboLockTM

RNase inhibitor, 10 mM dNTPS, 50 µM oligo (dT)18

primer were added in a 20 µL reaction and cDNA synthesis was performed at 42°C for

30 min, 50°C for 60 min and 95°C for 2 min.

2.9. PCR amplification

For diagnostic purpose 10 μL to 25 μL of PCR reaction mixture was used

while 50 μL of PCR reaction mixture was used for the cloning or sequencing of PCR

products. The PCR mixture contained 20 -200 ng template DNA, 1X of 10X Taq

polymerase buffer (optimised for Taq, contains 15 mM MgCl2) (Fermentas), 2.5 mM

dNTPs (Fermentas), 0.5 μM each of primers and 1 U Taq polymerase


27

(Fermentas). PCR amplification was carried out in thermal cycler (Eppendorf) which

was programmed as: 95°C for 5 min followed by 35 cycles of 94°C for 30 sec,

annealing at 50°C to 60°C for 30 sec (depending on melting temperature of primers),

72°C for variable times (dependent on the targeted region fragment length) followed

by a final extension for 5 min at 72°C.

2.10. Gel extraction and purification of PCR product

PCR product was used directly or extracted from the gel with a clean, sharp

scalpel on a UV transilluminator. Further, the DNA fragment from the excised gel

slice was extracted using a MinElute Gel Extraction Kit (Qiagen, Germany) with some

modifications. The gel slice in Eppendorf tube was weighed and 3 volumes of buffer

QG to 1 volume of gel was added. The tube was incubated for 10 min at 50°C and

vortexed until the gel slice was completely dissolved. Then 1X gel volume of

isopropanol was added to the sample and mixed. For PCR product purification

MinElute PCR Purification Kit (Qiagen, Germany) was used. Five volumes of buffer

PB to one volume of the PCR sample were added. In both kits method for direct

purification of PCR product or gel extraction the mixtures were loaded on MinElute

column and centrifuged at 10000 rpm for 30 sec. The column was washed by adding

750 µL of buffer PE followed by centrifugation 13000 rpm for 30 sec. The flow

through was discarded and the column was transferred to fresh collection tube. The

samples (DNA/PCR) were eluted from the column by adding 10 µL buffer EB or

ddH2O. The column was discarded and the eluted samples were stored at -20°C.

2.11. Ligation

The purified PCR products were quantified and then subjected to ligation into

appropriate vector. For cloning and sequencing purpose pGEM®-T vector systems

(Promega, USA) was used. Ligation mixture (10 µL) included 2X rapid ligation

buffer, 50 ng PCR product, 50 ng pGEM®-T vector, 3 U T4 DNA ligase and ddH2O.

2.12. Cloning and transformation

The ligation mixture was kept for one hour at room temperature followed by

transformation into TOP10 competent cells (Escherichia coli) (Invitrogen life


28

technologies, Germany) by the heat-shock methods described by Sambrook (1989).

Pre-thawed competent cells were mixed with the 2 μL of ligation mixture and the

resulting mixture was kept on ice for 30 min. The tube containing the transformation

mixture was heat-shocked for 30-45 sec in a water bath at 42°C followed by

immediate incubation on ice for 2 min. One ml SOC medium was added into the tube

containing transformation mixture and incubated at 37°C and 150 rpm for one hour.

One hour following the incubation, the transformation mixture was harvested and

spread on Luria Bertani (LB) medium plates supplemented with ampicillin (100

μg/ml), 20 μL of X-Gal (50 mg/ml) and 100 μL IPTG (24 mg/ml). The spread plates

were incubated overnight at 37°C. White colonies were picked and confirmed for

transformation by plasmid isolation and colony PCR.

2.13. Plasmid isolation

From a freshly grown plate of E. coli (TOP10), a single colony was picked

using sterile 200 µL tip and mixed with PCR reaction mixture for colony PCR and

then put into sterilized 15 ml falcon tube containing 5 ml LB broth supplemented with

100 μg/ml ampicillin. The plasmid was isolated using GeneJETTM

Plasmid Miniprep

kit (Fermentas, Germany). According to the kit protocol, the culture was transferred

into 1.5 ml microcentrifuge tube and centrifuged at 13000 rpm for one minute to get a

cell pellet. The supernatant was decanted and the pellet was resuspended in 250 μL

resuspension solution and vortexed. 250 μL of lysis solution was added and mixed by

inverting the tube 4-6 times. The lysis reaction was impeded by adding 350 μL

neutralization solution, mixed well and pelleted at 13000 rpm for 5 min. The

supernatant was transferred to a GeneJETTM

spin column and centrifuged at 13000

rpm for one minute. The column membrane was washed through by adding 500 μL

wash solution followed by centrifugation at 13000 rpm for 30-60 sec. Flow-through

was discarded and washing step was repeated one more time. The column was shifted

to a fresh 1.5 ml Eppendorf tube followed by the addition of 50 μL Elution buffer. The

plasmid was eluted by centrifugation at 13000 rpm for 2 min and stored at -20°C.


29

2.14. Digestion of plasmid DNA

For the confirmation of clone the isolated plasmid was digested with restriction

enzymes (Fermentas) along with their relevant buffers as per manufacturer's

instructions. Total reaction volume was 10 μL containing 100-500 ng plasmid DNA, 3

U restriction enzyme, restriction enzyme buffer and ddH2O. The mixture was

incubated at 37°C for 1-3 h and DNA fragment sizes were determined on 1% agarose

gel using standard DNA markers.

2.15. Agarose gel electrophoresis

The digested or amplified PCR product was analysed on 1.0-3.0% (depending

on PCR product fragment size) agarose gel stained with ethidium bromide (100

μg/ml). PCR product mixed with 6X loading dye (bromophenol blue) from each

sample was loaded on the gel that was already submerged in running buffer (0.5X

TAE). Samples were electrophoresed for approximately 1-4 h at 60-100 volts and the

gel was visualized under UV transilluminator for analysis of the PCR results.

2.16. Stocks preparation of cell cultures

Cell cultures were preserved in filter sterilized 30% glycerol and stored at -

80°C or liquid nitrogen (-196°C).

2.17. Sequencing

Bidirectional sequencing was performed for the purified PCR product, plasmid

containing fragment or gene. The 6 µL sequencing reaction consisted of 5pmol gene

specific or vector specific forward or reverse primer, 30 ng PCR product or 140 ng of

plasmid. The reaction mixture was run on DNA analyzer (Applied Biosystems, USA)

and the generated sequences were analysed through DNASTAR (DNASTAR, Inc) and

Sequencher® 5.0 software‟s (Gene Codes Corporation).


30

Table 2.1 Helicoverpa armigera collected from different geographical regions of the world

Strain Location Date of collection Behavior

FSD1 Faisalabad, Pakistan March, 2011 Resistant

TWBR*2 Toowoomba, Queensland, Australia January, 2003 Resistant

TWBS*2 Toowoomba, Queensland, Australia January, 2003 Susceptible

*Both strains were provided by Dr. Nicole Joussen at Department of Entomology, Max

Planck Institute for Chemical Ecology, Jena, Germany.

1FSD strain of was collected in March 2011 from chick pea grown fields in Faisalabad,

Pakistan and maintaned in lab since then.

2The TWB strain was collected from the vicinity of Toowoomba, Queensland, Australia in

January 2003 and maintained in the laboratory in Jena since August 2004.

Identification, characterisation and metabolic capabilities of cypermethrin resistance gene in H. armigera

31

Chapter 3

Identification, characterisation and metabolic capabilities of

cypermethrin resistance gene in Helicoverpa armigera

3.1. Introduction

Ever since the introduction of chemical insecticide for pest control, human

health and agriculture production have been improved. Although the use of

insecticides has greatly limited many major pests but this man-made natural selection

pressure results in the development of resistance in susceptible pest (Thacker, 2002).

Heckel (2012) defined resistance as “the heritable decline in a population‟s

susceptibility to a toxin (insecticide) to which it is exposed over successive

generations”. Thus evolution of insecticides resistance is the outcome of natural

selection (Heckel, 2012). Arthropods are known to be among the most difficult pests

to regulate chemically (Thacker, 2002). According to arthropods resistance database,

there are 7747 registered cases of resistance out of which 553 arthropod pests have

developed insecticides resistance due to the intense indiscriminate use of pesticides

(Devine, 2009). Order Lepidoptera, includes several of the world major crop pests,

such as spodoptera littoralis, Heliothis virescens and Helicoverpa armigera, which are

among the top twenty most resistant pests. It is important to understand pest

demography in order to understand these destructive pests ecology (Devine, 2009;

Mitter et al., 1993).

As mentioned earlier, H. armigera, is an economically important and a highly

polyphagous agricultural pest (Fitt, 1989). H. armigera is known as a master in

developing insecticides resistance and remained in focus as an important pest of

agricultural cash crops; almost 30% of total pesticides worldwide are used for its

control (Ahmad, 2007). H. armigera has developed resistance to a wide array of

insecticidal chemistries (48 compounds), with 671 registered cases. In addition, this

insect has evolved cross resistance to multiple pesticides; including organophosphates,

carbamates, organochlorines and pyrethroids (Whalon et al., 2013). Early detection

studies of insecticide resistance showed, in Australia, H. armigera evolved resistance

against DDT in early 1970s, followed by carbamate and organophosphate resistance

(Gunning et al., 1991). Due to the failure of DDT in controlling H. armigera, farmers


32

adopted a newer chemistry (pyrethroids) to control this notorious pest. However,

pyrethroid resistance in H. armigera was also reported in 1983 which was largely due

to the similarity in mechanism of action of DDT and pyrethroids (Ahmad, 2007).

Since then, H. armigera has developed resistance to a number of pyrethroids

(deltamethin, cypermethrin and fenvalerate) across Australia, Asia and Africa. H.

armigera is considered to be susceptible to organophosphates but a highest level of

endosulfan resistance (163-fold) was recorded in Australia in 1984 (Gunning et al.,

1998). In Asia, low to moderate levels of resistance to organophosphates has been

reported; high to low resistance to monocrotophos and chlorpyriphos has been

documented from Pakistan (Ahmad et al., 1995; McCaffery, 1998). Similarly, a

significant level of resistance to carbamate insecticides (methomyl and thiodicarb) has

been reported from Australia, China and India. However, in Pakistan resistance to

thiodicarb is at low level. In addition to chemical insecticides, H. armigera has

evolved resistance against biological insecticides (Spinosad and B. thuringiensis

derived toxins) which are used in the form of transgenic crops (Aheer et al., 2009;

Zhang et al., 2011).

Insecticide resistance is a genetic phenomenon and H. armigera has evolved

single or a combination of different resistance mechanisms against insecticides;

including behavioural change (avoidance), reduced cuticular penetration (changes in

the insect‟s cuticle or gut lining), mutation in the targets site (mutations in the sodium

channel, acetylcholinesterase and GABA receptor genes) of insecticides and enhanced

metabolic detoxification (alterations in the levels or activities of detoxification

proteins including Glutathione S-transferase, Carboxylesterase; Cytochrome P450

monooxygenase) (Ffrench-Constant, 2007; Hemingway et al., 2004; Li et al., 2007).

The behavioural resistance remains controversial due to the lack of evidence

supporting its role in resistance. However, reduced cuticular penetration appears to be

an additional feature in pyrethroid resistance mechanism, which has been confirmed in

H. armigera through in vivo and in vitro studies (Ahmad and McCaffery, 1999;

Gunning et al., 1995). The role of target site insensitivity (Kdr and super-Kdr) in

pyrethroid resistance has been reported from Asia and Australia (Ahmad et al., 1989;

Gunning et al., 1991) but reports indicated that reduction in pyrethroids selection

pressure is responsible for the replacement of pyrethroid resistance mechanisms from


33

nerve insensitivity to metabolic form of resistance (Forrester et al., 1993; Gunning et

al., 1991). Metabolic enzyme Cytochrome-P450 monooxygenases (P450) have been

documented to be the major factor in pyrethroid resistance in H. armigera from

Australia, China, India and Pakistan (Heckel et al., 1998; Joussen et al., 2012; Yang et

al., 2004). However, some studies indicate the involvement of esterases and

Glutathione S-transferase enzymes in pyrethroid resistance strain from Pakistan and

India (Ahmad, 2004; Kranthi et al., 1997; Kranthi et al., 2001). The involvement of a

particular individual or multiple P450 genes is under debate for the last two decade.

CYP6B2, CYP6B6, and CYP6B7 were the early genes to be isolated and sequenced

from pyrethroid resistant strain (Ranasinghe and Hobbs, 1998; Xiao-Ping and Hobbs,

1995), followed by CYP9A12, CYP9A14, CYP6B7 and CYP4G8 which were found to

be linked with pyrethroid resistance in China (Yang et al., 2006). However, the

presence of CYP6B7 on different linkage group (LG 14) as compared to the linkage

group 13 harboring resistant loci RFen1, results in elimination of its role in pyrethroid

resistance (Grubor and Heckel, 2007). Recent studies have shown that in Australian

pyrethroid resistant strain ANO2, CYP337b1 was found to be tightly linked to the

resistant locus RFen1, suggesting that this P450 may be responsible in fenvalerate

(pyrethroid) resistance (Wee et al., 2008). Similarly in 2012, a new chimeric gene

CYP337B3 was found which resulted from an unequal crossing over between two

parental genes, CYP337B1 and CYP337B2, explored the role of CYP337B1 in another

Australian fenvalerate resistant strain, TWB (Joussen et al., 2012).

Being a notorious pest and threat to agricultural crops, better knowledge of the

genetic basis of resistance in H. armigera is important for its control. Although a lot of

work has been done on its diversity, behaviour and toxicity against chemical and

biological insecticides. Still little is known about molecular mechanism of insecticide

resistance and involvement of particular gene involved in resistance is still questions

that need to be answered. Hence, there is a need to identify genes which have evolved

resistance against insecticide. In lepidoptera little is known about the genetics of most

of the species from this group due to difficulty in linkage detection, large number of

chromosomes and requirement of abundant markers (Heckel et al., 1999). In

lepidopteran insects the arrangement of the genes on chromosomes appears to be

highly conserved (Yasukochi et al., 2009) and the haploid number of chromosomes is


34

considered to be 31 in one fourth of its species (Robinson, 1971). Moreover, recently,

karyotype analysis confirmed 31 chromosome hypothesis of lepidoptera in H.

armigera, using fluoresce in situ hybridization technique (Sahara et al., 2013). DNA

markers are suitable for identification of resistance mechanism and genes involved in

insecticide resistance and have been used for genetic linkage mapping (Heckel et al.,

1997). But still there is the limitation of absence of complete genome sequence of H.

armigera genome and genetic markers which could cover its entire genome. This

limitation can be overcome by exploiting the biphasic nature of genetic linkage found

in lepidoptera for mapping genes involved in resistance (Heckel et al., 1999;

Robinson, 1971; Suomalainen et al., 1973). This phenomenon has been exploited

using amplified fragment length polymorphism (AFLP) markers (Vos et al., 1995) for

detection of Bt and insecticide resistance genes in H. armigera (Heckel, 2003; Wee et

al., 2008). AFLPs are ideal DNA markers which generate more number of

reproducible and stable markers (50-100 bands per primer pair) than RAPD and do not

require prior knowledge of DNA sequence (Behura, 2006; Jonah et al., 2011). AFLPs

generally have co-dominant mode of inheritance in nature but some time dominant

AFLPs are also amplified (Behura, 2006). Moreover, cDNA AFLP has been used for

expression profiling of differentially expressed genes in H. armigera (Wee et al.,

2008). Similarly AFLP based linkage maps for several agricultural pest; including L.

decemlineata, P. xylostella and H. armigera are used to find out the loci (gene)

conferring resistance to chemical and biological (Bt) resistance in agriculture pest

(Heckel, 2003).

In the current study, AFLP based approach was used by exploiting the lack of

crossing-over in H. armigera for mapping resistance gene present in FSD strain which

is responsible for cypermethrin resistance. Moreover, the insecticide (cypermethrin)

resistant gene was identified, isolated and overexpressed in insects cell line (Ha2302)

to confirm its metabolic activity against cypermethrin in vitro.


35

3.2. Materials and Methods

3.2.1. H. armigera strains and genetic crosses

The larvae of Asian resistant strain (FSD) were collected in March 2011 from

chick pea grown fields in Faisalabad, Pakistan, where cotton and chick pea are

cultivated in rotation and multiple rounds of insecticidal sprays are applied for pest

control. The larvae were reared on pinto bean diet at 26°C and 55% RH with a 16:08

(L:D) photoperiod. The Australian susceptible strain (TWBS) were used in this study

as described by Joussen et al., (2012) and maintained in the laboratory on Bio-Serv

diet (General Purpose Lepidoptera) at 26°C and 55% humidity with a 16:08 (L:D)

photoperiod. The FSD line was maintained through mass rearing; 10 pairs in a single

cross while the TWBR and TWBS lines were maintained through single-pair crosses.

To generate informative families for genetic mapping study, the Pakistani

pyrethroid resistant strain FSD was crossed with Australian pyrethroid susceptible

strain TWBS. The F1 male and female were backcrossed to susceptible strain, TWBS.

The individuals were placed in environmental chambers at 26 ± 1°C, 55% RH, with a

photoperiod of 16:08 (L:D) and were reared individually in plastic cups containing

pinto bean diet.

3.2.2. Toxicological tests

Resistance levels of H. armigera strains were determined by screening through

the technical grade cypermethrin (mixture of isomers, purity 95.1%, Sigma-Aldrich,

Germany). Different concentrations of cypermethrin (25 ng to 2000 ng) were prepared

in acetone to treat the test larvae. For each dose from resistant strain FSD, susceptible

strain TWBS and F1 population (TWBS x FSD) 30-40 3rd instar healthy larvae (20-30

mg) were selected. While in case of backcross population, 100 and 50, 3rd instar

healthy from male informative backcross (MIBC) and female informative backcross

(FIBC) respectively, were selected and treated with a discriminating dose (400 ng).

Toxicity test treatments were performed by applying 1µL of the test material to the

larval thorax using Hamilton syringe. To determine the resistance mechanism of the

Pakistani strain, FSD larvae were treated with piperonyl butoxide, a known P450 and

carboxylesterase inhibitor, prior to cypermethrin treatment. Each larva was exposed


36

to1 µL of PBO (30 mM) for 2 h prior to the application of cypermethrin. Larval

mortality was recorded after 48 h of the treatment. The mortality was observed on the

basis of criteria proposed by Joussen et al., (2012). The LD50 values were calculated

by Probit analysis using SPSS Statistics version 17.0 software.

3.2.3. Nucleic acid isolation

Nucleic acid was isolated using methods in Wee et al., (2008) with some

modification from killed, survived and untreated larvae. Whole larva was ground to

fine powder in liquid nitrogen, using pestle and mortar. The powdered form of larva

was transferred to 1.5 ml Eppendorf tube containing 600 µL nucleic acid isolation

buffer (50 mM Tris-HCL, pH 8.5, 0.1 N NaCl, 1 mM DTT, 10 mM EDTA and 0.2%

SDS) and immediately mixed with 400 µL TE-equilibrated phenol (pH 8.0), vortexed

vigorously and place on ice. The mixture was centrifuged (Micocentrifuge, Eppendorf:

Germany) at 13,000 rpm for 5 min at room temperature. The aqueous phase was

carefully transferred to fresh tube and extracted two more time with phenol. Then the

sample was divided into two parts; 2/3 was used for RNA extraction while the

remaining 1/3 was used for DNA extraction.

For DNA extraction, the separated 1/3 portion of the extracted sample was

treated with RNaseA (3 µL of 10 mg/ml) and incubated for 2 h at 37°C. Chloroform

(400 µL) was added, mixed vigorously and centrifuged at 13,000 rpm

(Micocentrifuge, Eppendorf: Germany) for 5 min at room temperature. The

supernatant was transferred into fresh tube and pre-chilled 100% ethanol (800 µL) was

added and mixed gently. The mixture was allowed to precipitate for 2 h at -20°C and

was centrifuged at 13,000 rpm (Micocentrifuge, Eppendorf: Germany) for 20 min at

4°C, supernatant was carefully decanted to avoid losing of pellet. Pellet was washed

by adding 200 µL ethanol (70%) and was centrifuged at 13,000 rpm (Micocentrifuge,

Eppendorf: Germany) for 10 min at 4°C. Supernatant was carefully decanted and the

last drops of ethanol were removed with a pipet. Pellet was air dried for approximately

30 min at room temperature and re-suspended in 100 µL nuclease free water and

stored at -20°C.


37

For RNA extraction the sample was mixed with 0.5 ml isopropyl alcohol and

incubated for 10 min at room temperature before centrifugation for 10 min at 13000

rpm and 4°C. After centrifugation the supernatant was decanted and the pellet was

washed with 1 ml ethanol (75%) by vortexing. Finally tubes were centrifuged for 5

min at 9000 rpm at 4°C. Ethanol was removed and RNA pellet was allowed to air dry

for 5-10 min. RNA was dissolved in 100 μL of diethylpyrocarbonate (DEPC) treated

water and was stored at -80°C. The RNA was purified from contaminated DNA

through method described earlier (section 2.6).

3.2.4. AFLP linkage mapping

AFLP polymorphism was performed using Vos et al., (1995) and Kaiser and Heckle

(2012) protocols with some modifications.

3.2.4.1. Restriction digestion

For AFLP restriction digestion, genomic DNA was digested using restriction

enzymes in their respective buffer following manufactures (New England, BioLabs®

Inc) guidelines. A total volume of 25 µL reaction was comprised of 200 ng of genomic

DNA, 6 U of EcoRI (NEB), 3 U of Mse1 (NEB) and 1.25 µL of 10X NEB buffers # 2

(with 100 µg/ml BSA). The final volume of reaction mixture was adjusted with

ddH2O. The restriction mixture was mixed gently, centrifuged briefly and incubated at

37°C for 2 h followed by the inactivation of restriction enzyme by incubating at 65°C

for 15 min.

3.2.4.2. Adaptor ligation

The 25 µL ligation reaction comprised of 12.5 µL of restricted DNA from the

previous step, 200 U T4 DNA ligase (NEB), 2.5 µL 10X T4 DNA ligase buffer

(NEB), 5 pmole Eco- adapter and 50 pmole Mse- adaptor. The final volume was

adjusted with ddH2O and was incubated in a ligation chamber at 16°C for 2 h. At the

end of ligation period, enzymes were subsequently inactivated by incubating at 65°C

for 15 min.


38

3.2.4.3. Pre-amplification

The end product of adapter ligation was diluted ten times. Diluted ligation (2

µL) was mixed with 8 µL PCR mix (1 µL 10X PCR-buffer, 15 mM MgCl2, EcoRI and

MseI primers (5 pmol each, Table 3.1), 2 mM dNTPs, and 1 U Taq DNA

polymerases). The reaction mixture was incubated (20 cycles: 30 sec at 94°C, 1 min at

56°C, 1 min at 72°C) in thermal cycler (Eppendorf). The amplified PCR product (2

µL) was analysed on 1% agarose gel as described earlier (section 2.15). The pre-

amplified DNA was diluted fifty times for future selective amplifications and stored at

-20°C.

3.2.4.4. Selective amplification

For selective amplification the 2 µL of the diluted pre-amplified DNA was

used as template. The 11 µL selective amplification reaction mixture was comprised of

1.1 µL 10X PCR buffer, 15 mM MgCl2, primers (MseI, IRDye 700 labeled EcoRI,

IRDye 700 unlabeled EcoRI, IRDye 800 labeled EcoRI, IRDye 800 unlabeled EcoRI)

1 pmole each, 2.5 mM dNTPs, 0.5 U Taq Polymerases and 2 µL template. The final

volume was adjusted with ddH2O. The reaction mixture was incubated for 12 cycles at

94°C for 10 sec, 65°C for 30 sec and 72°C for 1 min, followed by 23 cycles at 94°C

for 10 sec, 56°C for 30 sec and 72°C for 1 min, in thermal cycler (Eppendorf).

Different primer combinations were used for selective amplification. At the end 10 µL

sterile water and 15 µL licor stop solution (1 mM EDTA, 1 ng/ml bromophenole blue

and 85% formamide) was added to the selectively amplified product.

3.2.4.5. Gel separation

Selectively amplified samples were separated depending on fragment size on

8% polyacrylamide gel using DNA analyser system, LI-COR 4200 sequencer (LI-

COR Biosciences-GmbH). The samples (0.8 µL each) were loaded into 96 wells using

Hamilton 8-channel syringe (Hamilton, Bonaduz/Switzerland). In the first ten wells

(1-10) grandparents were loaded, F1 MIBC parents were loaded into wells 11-12 and

43-44 while F1 FIBC parents were loaded into 45-46 and 95-96. LI-COR STR marker

(50-700 bp) was used as DNA sizing standard and was loaded into wells 1–2 and 99–

100. The gel was run for 3.5 h and the image was developed through scanning laser


39

(detect infrared labelled DNA fragments of 700 nm and 800 nm). The generated gel

picture was saved as a tiff file.

3.2.4.6. AFLP markers scoring on gel

The gel scoring was done through semiautomatic image analysis software

Quantar 1.08 (KeyGene Products, Netherlands). This software is specifically designed

for AFLP study. The AFLP markers (fragment bands) of interest in backcrosses were

those that were present in FSD original parents and F1 (male and female). Presence of

band was considered heterozygous genotype while absence of band was considered

homozygous recessive genotypes as they are segregating 1 1. For MIBC the band

present FSD original parents (Male) and the F1 male, but were not present in the

TWBS original parents or recurrent TWBS backcross parent. Similarly for FIBC the

band present FSD original parents (Male) and the F1 female, but were not present in

the TWBS original parents or recurrent TWBS backcross parent.

3.2.4.7. Inference of resistant genotypes through PCR

Genetic map constructed by Wee et al., (2008) using cDNA-AFLPs for

mapping of pyrethroid resistance gene in Australian H. armigera, has shown that

CYP337B1 gene is tightly linked with resistance loci RFen1 on linkage group 13.

However, more recently Joussen et al., (2012) reported a new chimeric gene

CYP337B3 responsible for fenvalerate resistance in H. armigera and this gene was the

outcome of unequal crossing over between two susceptible genes CYP337B1 and

CYP337B2. Thus CYP337B3 was assumed as a candidate gene for resistance in

pyrethroid resistant strain FSD and was used to infer the resistant genotype in both

MIBC and FIBC killed and survived larvae of toxicity test used in AFLP. Amplicons

of 847 bp fragment size of CYP337B3 was generated through PCR (section 2.9) using

gene specific primers (Table 3.1).

3.2.4.8. Exon primed intron crossing PCR (EPIC-PCR)

For fine scale mapping of resistant gene exon primed intron crossing (EPIC)

primers, designed from adjacent exon sequences which flank intron. EPIC-PCR

primers were designed for four ribosomal protein genes (m14-FLX, RPL10A, RPL8


40

and RPS23) from Australian H. armigera (TWB) strain cDNA library in-house

database at Department of Entomology, Max Planck Institute for Chemical Ecology,

Jena, Germany (Table 3.1). The intron positions were predicted from the introns in B.

mori, and these intron positions are highly conserved across lepidoptera. It had been

reported that these ribosomal protein genes are located on linkage group 15 and 2 of B.

mori and H. virescens, respectively. It was assumed that they would also be on the

same order in H. armigera.

3.2.4.9. Data analysis

The obtained markers of AFLP, CYP337B3 gene and ribosomal protein genes

(m14-FLX, RPL10A, RPL8 and RPS23) were analysed to determine the number of

linkage groups and to map resistance gene within a linkage group using MAPMAKER

3.0 software. Exploiting the lack of crossing-over during oogenesis in lepidopteran

female a sequential approach was used (Heckel et al., 1999; Robinson, 1971;

Suomalainen et al., 1973). First, absolute linkage in progeny of FIMB was used to find

out the linkage group involved in resistance. Secondly, to use the recombinants of

MIBC progeny to identify the location of resistant genes on linkage group contributing

to resistance. The segregation of FIBC AFLPs was verified and correlated with

mortality data (dead and survived larvae) of cypermethrin toxicity test and linkage

relationship among AFLPs, CYP337B3 and ribosomal protein genes markers by

mapping them on linkage group contributing to resistance.


41

Table 3.1 Primers for screening of CYP337B1, CYP337B2, CYP337B3, for detection of

CYP337B3 in the AFLP analysis, for cloning of CYP337B3 and the intron region and for the

ribosomal protein genes

Gene Forward primer (5'-3') Reverse primer (5'-3')

Screening

CYP337B1 AATAATAAGCAACGCCAATGACTTAC TGCAATAACAACTATTACATTTTGAATAAA

CYP337B2 AATAATAACCAGTCCAAACGATGTGT CGCAATTATAGTCACTATGATTGCATATA

CYP337B3 AATAATAACCAGTCCAAACGATGTGT TGCAATAACAACTATTACATTTTGAATAAA

AFLP

CYP337B3 CGATGCCAGAACTAATCAAATCG TCAATTTCCTCATGTAGTTTTGCC

Cloning

CYP337B3 CACGATGGTGTTCGTAATATTACTC GATTTATATGTCTCTTAACTTTAATTCATAACC

Intron

CYP337B3 AATAATGATTCCAGTGTTCGGTCTT AAGGTAAAACGACGTAACAGCCA

Ribosomal genes

RPS23 AAAGAAGGAAAGGCCACGTT ACAACACAGCTTTGCAGCAG

RPL8 ACTTCCGTGACCCGTACAAG AGGATTGTGGCCGATAACAG

RPL10A CGCTGAGGCACTCAAGAAA GAGGGATTCTGATGCAAGGA

m14_FLX ATCTCGCCTGGATCAACACT GATGTTCATCGGACCCAGAC

AFLP Pre-amplification

EcoRI 5′-GACTGCGTACCAATTC-3′

MseI 5′-GATGAGTCCTGAGTAA-3′

RACE-PCR

3ʹRACE 5ʹ-CGACGTCGGCGACAATACCAACG -3ʹ

5ʹRACE 5ʹ-TCAGTTCGTCGGTCGGCTCCAA-3ʹ


42

3.2.5. Isolation, cloning, overexpression and characterization of CYP337B3 gene

3.2.5.1. DNA and RNA extraction

Genomic DNA and total RNA was extracted as described earlier in section 2.4

and 2.5 respectively.

3.2.5.2. PCR amplification, cloning and sequencing CYP337B3 gene

fragment

The CYP337B3 (accession no. JQ995292) was amplified using gene specific

primers (Table 3.1). The PCR product was purified using MinElute PCR Purification

Kit (Qiagen, Germany) and cloned in pGEM®-T vector systems (Promega, USA). The

presence of the insert in plasmid was checked through restriction analysis after

transformation of TOP10 E. coli cells (Invitrogen) and plasmid isolation using

GeneJETTM Plasmid Miniprep kit (Fermentas). Sequence of the DNA fragment was

determined after sequencing.

3.2.5.3. Rapid amplification of cDNA ends (RACE) PCR

The 3ʹ and 5ʹ RACE PCR was performed using SMARTer™ RACE cDNA

Amplification Kit First Choice RLM-RACE Kit (Clontech) according to the

manufacturer's instructions. Prior to performing 5ʹ- and 3ʹ-RACE reactions, RACE

ready first-strand cDNA was synthesized. cDNA synthesis reaction comprised of two

reaction mixtures. The first reaction mixture (5.25 µL) consisted of 2.0 μL 5X First-

Strand buffer, 1.0 μL DTT (20 mM), 1.0 μL dNTP Mix (10 mM), 0.25 μL RNase

Inhibitor (40 U/μL) and 1.0 μL SMARTScribe Reverse Transcriptase (100 U). The

second reaction mixture (4.75 μL) consisted of 1.0 μL RNA (1 μg), 1.0 μL 5'-CDS

Primer A and 2.75 μL ddH20) for 5'-RACE-Ready cDNA. While in the case of 3'-

RACE-Ready, cDNA reaction mixture (3.75 μL) consisted of 1.0 μL RNA (1 μg), 1.0

μL 5'-CDS Primer A and 1.75 μL ddH20 mixed and prepared in individual tube.

Further 1 μL of the SMARTer IIA oligo per reaction was added to 5' RACE cDNA

synthesis reaction. The second reaction mixtures (3'- and 5'-RACE-Ready cDNA)

were incubated for 3 min at 72°C to denature RNA and were kept on ice for 2 min

before mixing it with 5.25 µL of first reaction mixture. The final 10 µL reaction

mixtures were incubated at 42°C for 60 min, 50°C for 90 min and 70°C for 10 min


43

using a hot-lid thermal cycler. At the end 100 µL Tricine-EDTA buffer was added to

dilute the first-strand reaction product and stored at -20°C.

The 3ʹ- and 5ʹ-RACE-ready cDNA samples were used for RACE PCR reaction

to get full-length cDNA. RACE-PCR reaction mixture (25 μL) contained 18.05 μL

PCR-grade water, 2.5 μL 10X advantage 2PCR buffer, 1 μL dNTP Mix (10 mM), 1.25

μL 3ʹ- or 5ʹ-RACE-Ready cDNA, 2.5 μL universal primer mix (UPM) and 10 μM

gene specific primer (Table 3.1). The RACE-PCR reaction mixture was incubated in

master cycler (Eppendorf), programmed for preheat treatment of 95°C for 1 min

followed by 5 cycles of 95°C for 30 sec and 68°C for 3 min; 5 cycles of 95°C for 30

sec, 66°C for 30 sec and 68°C for 3 min; 25 cycles of 95°C for 30 sec, 64°C for 30 sec

and 68°C for 3 min followed final incubation at 68°C for 10 min. Each sample was

analysed on 1% agarose/EtBr gel.

3.2.5.4. Cloning and sequencing of RACE PCR products

PCR products were purified using a MinElute PCR Purification Kit (Qiagen,

Germany) and were cloned into TOPO TA cloning vector (Invitrogen), according to

the manufacturer's instructions. The ligation mixture consisted of fresh PCR product 1

μL, Salt Solution 1 μL, TOPO® vector 0.4 μL and 3.6 μL ddH2O. The reaction was

incubated at room temperature for 20 min. The ligation mixture was transformed into

TOP10 competent cells (E. coli) by using heat shock transformation method as

described earlier (section 2.12), only with the exception of blue/white selection

through X-Gal and IPTG. For the confirmation of insert 5 colonies were picked for

colony PCR from each cloning reaction. After confirmation of insert, plasmid was

isolated using GeneJETTM Plasmid Miniprep kit (Fermentas) from relevant clone

already cultured in LB broth media at 37°C for 16 h. The sequences of the clones were

determined after sequencing.

3.2.5.5. CYP337B3 cloning and characterisation of the intron

Gene-specific primers were used for CYP337B3 gene based on 3ʹ and 5ʹ RACE

PCR products sequences. The forward primer had a 5'-Kozak sequence while two

reverse primers were designed, one of them lacking the stop codon for V5 epitope and

His-tag fusion expression after ligation into the vector pIB/V5-His TOPO® TA


44

(Invitrogen) and the other primer was incorporated with stop codon resulting in

untagged proteins (Table 3.1). The gene was amplified using AccuPrime™ Taq DNA

Polymerase High Fidelity (Invitrogen). The 25 µL PCR reaction contained 100 ng

cDNA, 2.5 µL 10X AccuPrime™ PCR buffer, 0.5 µL each gene-specific primer (10

µM), 1 U AccuPrime™ Taq High Fidelity. PCR reaction mixture was incubated in

Thermo Cycler (Eppendorf) at 94°C for 2 min followed by 35 cycles of 94°C for 30

sec, 55°C for 30 sec and 72°C for 45 sec, followed by final extension at 72°C for 5

min. Resulting PCR product was analysed on 1% agarose/EtBr by agarose gel

electrophoresis.

The purified PCR product was ligated in pIB/V5-His-TOPO® vector (Figure

3.1) for expression in Lepidopteran insect cell line using pIB/V5-His TOPO®

TA

Expression Kit (Invitrogen). The 3 µL ligation mixture consisted of 1 μL PCR

product, 0.5 μL salt solution, 0.4 μL TOPO® vector and 1.1 μL ddH2O. The reaction

was incubated at room temperature for 20 min. Correct orientation of the insert was

checked by colony PCR after transformation of TOP10 E. coli cells using vector and

gene-specific primers (Table 3.1). Correct plasmids for transfection of Ha2302 cells

were determined by sequencing. The intron region of CYP337B3 was amplified from

genomic DNA using intron spanning primers (Table 3.1), gel purification and

sequenced.

3.2.5.6. Insect cell culture (Ha2302)

Ha2302 cells derived from hemolymph of 2nd

and 3rd

instar larvae from H.

armigera were available at Department of Entomology, Max Planck Institute for

Chemical Ecology, Jena, Germany. Cells were maintained on Sf-900™ II serum-free

medium (Invitrogen) and were cultivated as adherent cells at 27°C. The cell culture

was used for expression of CYP337B3 gene.

3.2.5.7. Heterologous expression of CYP337B3 gene in Ha2302 Cells

Transfection of the adherent insect cell line Ha2302 was performed as

described by Joussen et al., (2012). Confluent Ha2302 cells in 75cm2 flask were

detached and diluted 1:3 using Sf-900™ II SF medium (Invitrogen). 3 ml of diluted

cells were added in wells of a 6-well cell culture plate (one well per construct) and


45

incubated at 27°C for 1 h. For transfection, 1.8 µg of expression construct plasmid

DNA was diluted in 90 µL of SF medium per well and was added drop wise to 9 µL of

Insect GeneJuice® Transfection Reagent (Novagen) diluted with 90 µL of SF medium.

Transfection mixtures were immediately vortexed and further 720 µL of SF medium

was added to the transfection mixture after incubation for 15 min at room temperature.

Medium of the Ha2302 cells in the 6-wells plate was replaced by transfection mixture

and incubated at 27°C for 4 h. Transfection mixture was replaced by fresh 3 ml SF

medium containing 50µg ml-1

Gentamycin and was incubated at 27°C for 48 h. For the

selection of transformed cells medium was replaced by medium containing 50 µg ml-1

Gentamycin and 60 µg ml-1

of blasticidin. The cell growth and confluency under

selection pressure was observed for 5 days, while keeping the condition optimum by

replacing the medium after every 2 to 4 days. The transformed cell culture was

expanded by transferring it to 75 cm2

flasks for microsome isolation and

cryopreservation.

Microsomes were isolated from CYP337B3-transgenic and non-transgenic

Ha2302 cells using the method described by Joussen et al., (2012). Both cytosolic and

microsomal fractions were stored at -80°C. Protein content was determined by the

Bradford method (Bradford, 1976) using the Quick Start Bradford Protein Assay (Bio-

Rad). Additionally, the pellets containing the nuclei were snap frozen for isolation of

genomic DNA.


46

Figure 3.1 pIB/V5-His-TOPO® expression vector, used for cloning of CYP337B3

gene isolated from Helicoverpa armigera strain FSD and transformation into insect

cell line Ha2302.


47

3.2.5.8. Microsomal and cytosolic fractions isolation from Ha2302 Cells

Microsomes were isolated from CYP337B3-transgenic and non-transgenic

Ha2302 cells using the method described by Joussen et al., (2012). Confluent cells

were separated from their culture medium by centrifugation for 10 min at 500 g and

4°C and then washed two times with ice-cold PBS, pH 7.4. Cells were resuspended

and incubated on ice for 20 min in 3 ml hypotonic buffer (20 mM Tris, 5 mM EDTA,

1 mM DTT, 20% (v/v) glycerol, pH 7.5, 1X protease inhibitors; Protease Inhibitor

Cocktail Set III, Animal-Free, Calbiochem®

, Merck) followed by homogenization

using the Potter-Elvehjem tissue grinder (Wheaton). After homogenisation an equal

volume of sucrose buffer (20 mM Tris, 5 mM EDTA, 1 mM DTT, 500 mM sucrose,

20% (v/v) glycerol, pH 7.5, 1X protease inhibitors) was added to the lyzed cells and

centrifuged for 10 min at 1200 g and 4°C. The supernatants were pooled in fresh 50 ml

falcon and the homogenization step with pellet was repeated. After a second

homogenization step supernatants were pooled and centrifuged for 15 min at 10000 g

and 4°C using Beckman centrifuge machine (Beckman Coulter). Pellet was snap

frozen for isolation of genomic DNA and supernatant was further centrifuged for 1 h

at 38,000 rpm and 4°C. Supernatant consisting of cytosolic fraction was snap frozen

and pellet consisting of microsomal fraction was resuspended in resuspension buffer

(0.1 M potassium phosphate buffer, pH 7.4, 20% (v/v) glycerol, 1X protease

inhibitors) using Potter-Elvehjem tissue grinder and centrifuged again for 1 h at

48,000 rpm and 4°C. Supernatant was discarded and the pellet was resuspended again

in resuspension buffer and was snap frozen for storage. Both cytosolic and microsomal

isolated proteins were stored at -80°C.

3.2.5.9. Determination of protein content

Protein content in isolated microsomal and cytosolic protein was determined

by Bradford method using the Quick Start™ Bradford Protein Assay (Bio-Rad). The

samples were diluted 10 times and 20 times in resuspension buffer and the assay was

performed using a 300 μL microplate. Bovine serum albumin (BSA) was used as

standard; the standard curve was prepared by adding 2, 1.5, 1, 0.75, 0.5, 0.25, 0.125

mg/ml of standard (provided by manufacture) in each well containing 150 μL of

Bradford reagent. For samples, to 150 μL of Bradford reagent, 150 μL of protein


48

sample or standard was added and incubated for 5 min at room temperature. Bradford

reagent (150 μL) mixed with 150 μL of resuspension buffer was used as blank. The

absorbance (OD) was determind at 595 nm using Infinite 200®

PRO (Tecan)

microplate reader and readings were plotted for quantification of total protein. Protein

samples and standard were assayed in triplicates.

3.2.5.10. DNA extraction from Ha2302 cells and screening by PCR

Genomic DNA of CYP337B3-transgenic Ha2302 cells was extracted from the

nucleus fraction using the method described by Joussen et al., (2012). Cells/ nucleus

fraction was homogenized in 400 µL of homogenization buffer (0.4 M NaCl, 10 mM

Tris, 2 mM EDTA, pH 8.0) for 10 to 15 sec with 2% final concentration of SDS and

7.2 mAnsonU proteinase K and incubated at 60°C for 1 h. Before centrifugation at

13000 rpm for 30 min, 300 µL of 6 M NaCl solution was mixed with sample mixture

by vortexing for 30 sec. The supernatant was transferred to a fresh tube containing one

volume of ice cold isopropanol and incubated at -20°C over night. Samples were

centrifuged for 20 min at 13000 rpm and 4 ºC, DNA pellets were washed with 70%

ethanol, dried at room temperature and resuspended in ddH2O. The presence of

CYP337B3 gene in insect cell culture was confirmed by screening genomic DNA

through PCR using gene-specific primers (Table 3.1).

3.2.5.11. Stocks preparation of Ha2302 cells containing CYP337B3 gene

For storage purpose transformed Ha2302 cells were scratched in their old

culture medium and transferred to a 50 ml Falcon tube and centrifuged for 10 min at

400 g and 20°C. The pellet was dissolved in one microliter freezing mix (45% SF

medium containing 50 µg Gentamicin, 45% old culture medium and 10% DMSO) and

transferred to cryovial. All these steps were performed on ice. The cryovial was stored

for 4 h at -80°C followed by storage in liquid nitrogen.

3.2.5.12. SDS-PAGE and western-blot

Microsomal and cytosolic proteins (10 µg each) of CYP337B3-transgenic

Ha2302 cells were analysed by SDS-PAGE and western blot as described by Joussen

et al., (2012). Microsomal and cytosolic proteins (10 µg, each) of Ha2302 cells


49

containing CYP337B3 gene were mixed with 5 µL laemmli sample buffer (Bio-Rad).

Samples were denatured at 95°C for 5 min and kept for 2 min on ice. Denatured

samples were separated in a 10% polyacrylamide gel using the Criterion system (Bio-

Rad) with TGS buffer (25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS) at 120 V for

2 h, using a molecular weight marker. Resolved protein from gel was transferred to

PVDF bloting membrane using a tank blotter with transfer buffer (TG buffer with 10%

methanol) at 100 V for 30 min. Gel was discarded and membrane was washed briefly

in distilled water. Memebrane was incubated for 1 h in blocking buffer (TBS with

0.1% Tween 20, 5% non-fat dry milk) with agitation followed by incubation with

Anti-V5-HRP antibody (1:10,000; Invitrogen) in blocking buffer at 4°C over night

with agitation. The membrane was washed two times with TBS with 0.1% Tween 20

and one time with TBS for 10 min prior to incubation with ECL solutions. The film

was exposed to the membrane followed by film development.

3.2.5.13. Activity assays with P450 model substrates

Three groups of model substrates, 7-alkoxyresorufins (7-methoxy-, 7-ethoxy-,

7-pentoxy-, and 7-benzyloxyresorufin), 7-alkoxycoumarins (7-methoxy- and 7-

ethoxycoumarin), and 3-cyano-7-alkoxycoumarins (3-cyano-7-methoxy- and 3-cyano-

7-ethoxycoumarin), were used to determine the functionality of heterologous

CYP337B3. Activity assays were performed and measured as described by Joussen et

al., (2012). For each activity assay 0.2mg of microsomal proteins derived from

transgenic and non-transgenic Ha2302 cells were incubated with 1nmol of substrate

(dissolved in 1 µL of DMSO) and an NADPH regeneration system at 30°C for 4 h.

Samples omitting microsomes were used as background controls and two to three

replicates were used per assay. For 7-alkoxycoumarins, the extraction procedure was

carried out as described by Joussen et al., (2012).

Calibration curves of the products resorufin (0, 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 50,

100, 150, 200, and 250pmol; dissolved in DMSO) and 3-cyano-7-hydroxycoumarin (0,

1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 pmol; dissolved in DMSO), respectively, were measured

in the relevant solvents using two replicates for each amount. Differing from the

procedure by Joussen et al., (2012), for the calibration curve of the product 7-

hydroxycoumarin, two replicates for each amount (0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,


50

and 30 pmol; dissolved in DMSO) were incubated in the reaction mixture with non-

transgenic microsomes and were extracted as described for the samples. The resulting

calibration curve includes losses due to handling of aliquots and extraction. The

analysis was performed as described by Joussen et al., (2012) with one modification in

the expression of the end result. Calibration curves were transformed by subtracting

the fluorescence intensity values received by 0 pmol of product (negative values were

set to zero) from all values. For the calculation of the metabolic activity of

CYP337B3, all negative values were set to zero and the mean of the background

control was subtracted from the values of all samples to produce the net-fluorescence

intensities. Furthermore, the mean of the samples performed with non-transgenic

Ha2302 microsomes was subtracted from the mean values of all samples. At the end,

resulting corrected net-fluorescence intensities were transformed in amounts of

product formed by CYP337B3 using the corresponding calibration curve and corrected

metabolic capacities were expressed as pmol product formed by 0.2 mg of microsomal

protein in 4 h.

3.2.5.14. In vitro metabolism assays with cypermethrin and analysis

through HPLC

To determine the capability of CYP337B3 to metabolize cypermethrin in vitro

assays were performed using the method described by Joussen et al., (2012).

Microsomal proteins (0.8 mg) derived from transgenic and non-transgenic Ha2302

cells were incubated individually in amber borosilicate glass vials with 4 nmol of

cypermethrin (mixture of isomers, purity 95.1%; PESTANAL, Sigma-Aldrich;

dissolved in 4 µL of DMSO), at 30°C for 4 h. Additionally, two inhibition assays were

performed: Firstly, piperonyl butoxide (purity: at least 90%, Fluka), a known P450

inhibitor, was used in an inhibition assay with 40 nmol per assay. Secondly, an

inhibition study with the absence of NADPH was performed by omitting the NADPH

regeneration system. Samples were extracted and residues were redissolved in 25 µL

of methanol and 375 µL of H2O:acetonitrile 50:50 (organic solvents of HPLC grade)

and filtered for HPLC. As a reference in HPLC analysis, a solution of 1 nmol

cypermethrin per 100 µL was used. HPLC analysis (100 µL per sample) was executed

on a Hewlett-Packard (Agilent) HPLC 1100 Series equipped with a C18 column (EC

250/4.6 Nucleodur®

Sphinx RP, 250×4.6 mm, 5 µm particle size; Macherey-Nagel) as


51

described in Joussen et al., (2012) using the same program. Cypermethrin and its

metabolites were analysed at 210 nm, 230 nm, and 275 nm.


52

3.3. Results

3.3.1. Cypermethrin resistance in the FSD strain is metabolic and

semidominant

To elucidate the cypermethrin resistance mechanism of H. armigera observed

in field populations in Pakistan, third-instar larvae from the Pakistani FSD strain were

treated with different doses of cypermethrin for comparison with the fenvalerate-

resistant TWBR line and the susceptible TWBS line from Australia (Figure 3.2).

Larvae of the FSD strain and TWBR line were 6.94- and 5.73-fold, respectively, more

resistant than the TWBS line (Table 3.2). Piperonyl butoxide treated larvae were more

sensitive to cypermethrin, revealing a synergism ratio of 7.21 which reduced the

resistance factor (RF) to 0.96, similar to susceptible TWBS larvae (Table 3.2). These

results suggest, compared to the susceptible TWBS line, that the cypermethrin

resistance observed in Pakistani H. armigera is a metabolic resistance.

In order to determine the degree of resistance dominance, heterozygous F1

larvae derived from crosses between the resistant FSD strain and the susceptible

TWBS line were tested with different doses ofα. The resulting RF of 6.67 (Table 3.2)

is slightly lower than the RF found for the homozygous FSD strain but not

significantly different indicating a semidominant or dominant resistance, but in favour

of a semidominant resistance as this was determined in the heterozygous resistant

TWB line bioassayed with fenvalerate (Joussen et al., 2012). Based on a comparison

of the dose-response curve of the F1 larvae with that of the resistant and susceptible

parent strains, a discriminating dose of 400 ng was selected for the screening of the

backcross larvae. Backcross family F1 144 from the male-informative backcross (F1

male × TWBS female) and backcross family F223 from the female-informative

backcross (F1 female × TWBS male) showed 50% mortality at the discriminating dose

and thus were selected for further AFLP analysis.


53

Figure 3.2 Dose-response curves of the resistant FSD strain of Pakistani Helicoverpa

armigera compared to the resistant TWBR line and the susceptible TWBS line from

Australia towards cypermethrin. For each of the six doses and a control per line, 30-40

third-instar larvae were tested by topical application. Mortalities (without control) and

regression lines from probit transformed mortalities were plotted on a probit scale

against logarithmic doses of cypermethrin. Mortalities of 0% were changed to 0.01%

and of 100% were changed to 99.99% for plotting.


54

Table 3.2 Determination of cypermethrin toxicity (LD50, resistance factor (RF), and

synergistic factor (SF) with and without PBO) in 3rd

instars larvae of Helicoverpa

armigera different strain through topical application methods.

Line Treatment LD50,

ng per larva

95% confidence

Intervals Slope RF

a SR

b

TWBS Cypermethrin 76.7 57.2, 101.9 1.83 - -

FSD Cypermethrin 531.7 408.1, 770.0 2.32 6.94 -

FSD Cypermethrin +

PBO 73.8 58.4, 91.6 2.61 0.96 7.21

TWBR Cypermethrin 439.3 325.8, 600.5 1.67 5.73 -

F1 (FSD ×

TWBS) Cypermethrin 511.0 289.9, 1535.7 1.08 6.67 -

aRF, resistance factor calculated as LD50 of the resistant strain/line divided by LD50 of

the susceptible line; bSR, synergism ratio calculated as LD50 of the treatment with

cypermethrin divided by the LD50 of the treatment with cypermethrin and piperonyl

butoxide (PBO)


55

3.3.2. AFLP marker-discovery characteristics

Hexa cutter enzymes (MseI and EcoRI) and 3 additional selective bases to the

each primer strategy was used. A total of 24 different primers combinations were used

in selective amplification and 12-36 AFLP informative markers were scored per

primer combination with 57 to 711 bp band size (Table 3.3). Overall 236 AFLP

informative markers were generated from male informative backcross and 251 AFLP

informative markers from female informative backcross (Table 3.3). There were 13

such AFLP markers which were showing similar pattern with phenotypic data; the

AFLP band was present in all survived larvae while absent in dead larvae in female

informative cross while in case of male informative cross some of the dead larvae

were showing bands while some of the survived larvae missing the band (Figure 3.3).

Taking advantage of lack of crossing over in female Lepidoptera during meiosis,

MAPMAKER 3.0b inferred 31 linkage groups from 251 AFLP markers of female

informative backcross using LOD score 3.5. The number of inferred linkage groups

conferred the reported haploid (n) number of chromosomes present in H. armigera

(Robinson, 1971). All the 13 AFLP markers showing similar pattern with phenotype

were present on linkage group 13. Thus linkage group 13 contributes resistance to

pyrethroids (cypermethrin). The screening of pyrethroid resistant chimeric gene

CYP337B3 (originated due to unequal crossing over between CYP337B1 and

CYP337B3 genes) 847 bp fragment in dead and survived larvae of female informative

backcross through PCR showed that CYP337B3 gene is absent in all dead larvae and

present in all survived larvae (Figure 3.3).


56

Table 3.3 Primers combination used for MIBC and FIBC and number of informative

AFLP fragments scored per primer combination.

Mse Eco FIBC

Markers MIBC Markers

CAT

AAG(700) 15 16

CAT(800) 12 11

ACC(700) 7 9

CGC(800) 7 10

TAC(700) 17 19

GTA(800) 12 12

ACA

AAG(700) 15 8

CAT(800) 7 6

CGC(800) 13 13

GTA(800) 11 14

ACG AAG(700) 14 12

CAT(800) 10 8

ACC(700) 10 10

CGC(800) 9 5

CGA

AAG(700) 10 8

CAT(800) 8 9

ACC(700) 10 11

ACT(800) 7 7

CGC(800) 7 7

CTT

AAG(700) 13 9

CAT(800) 5 9

ACC(700) 11 9

ACT(800) 13 11

CGC(800) 9 3

Total Markers 251 236


57

Figure 3.3 AFLP banding pattern and presence of CYP337B3 associated with

resistance. (A) Part of a representative AFLP gel showing the pattern for an AFLP

fragment (indicated by the arrowhead) strongly associated with resistance. (B) The

same individuals of the female-informative backcross tested in the AFLP analysis

were screened by PCR for the presence or absence of CYP337B3 revealing a strong

correlation between the presence of CYP337B3 and resistance. A plasmid containing

CYP337B3 served as a positive control and a water sample as a negative control.


58

3.3.3. Mapping of resistant gene (CYP337B3) within linkage group 13

To localize CYP337B3 within this linkage group the occurrence of crossing-

over during meiosis in lepidopteran males was exploited by analysing the male-

informative backcross. Thus the frequencies of recombinants from male informative

backcross (F1 male x TWBS female) were used for localization of pyrethroid

resistance gene CYP337B3. MAPMAKER 3.0b analysis by 251 AFLP makers of male

informative backcross using LOD score 3.5 showed that 13 AFLP markers (presnt in

survived larvae and absent in dead larvae) were appeared on different linkage groups

in the male-informative cross, because of crossing-over in the male.

In the first step, CYP337B3 was used as marker because CYP337B1 gene is

previously mapped to linkage group 13 (Wee et al., 2008). CYP337B3 gene fragment

of 847 bp was screened in dead and survived larvae of H. armigera of male

informative backcross. PCR screening showed similar result like that of female

informative back cross, CYP337B3 absent in all dead larvae while present in survived

larvae. In second step for fine scale gene mapping on linkage group already reported

ribosomal protein genes (m14-FLX, RPL10A, RPL8 and RPS23) previously mapped to

linkage group 2 in H. virescens and to chromosome 15 of B. mori (Silk worm) (Aller

et al., 2009; Yoshido et al., 2005), were screened in dead and survived larvae of male

informative backcross through PCR using EPIC primers. The amplified intron

polymorphism revealed that out of 22 dead larvae, m14-FLX, RPL10A and RPL8 is

heterozygous in 3 larvae while RPS23 showed heterozygosity in 7 larvae. Similarly

m14-FLX, RPL10A, RPL8 and RPS23 markers were found heterozygous in 4 larvae

out of 24 survived.

After getting the markers data of CYP337B3 gene and ribosomal protein gene

the linkage map of the resistance gene CYP337B3 was constructed, first by

determining the maximum likelihood order of the four ribosomal protein gene markers

(m14-FLX, RPL10A, RPL8 and RPS23) and CYP337B3 markers followed by the

addition of the 13 AFLP markers, four at a time, and the maximum likelihood

order determined among them by the ripple command using MAPMAKER 3.0b

software. The total length of the final map was 158.1 cM (Figure 3.4A).


59

CYP337B3 was considered as a possible candidate gene for resistance (Joussen et al.,

2012), and PCR screening showed that only CYP337B3 and not CYP337B1 or

CYP337B2 occurred in the FSD strain at the time of the crosses. Further PCR analysis

showed that the presence of CYP337B3 exhibited the same pattern as the resistance-

correlated AFLP linkage group in the female-informative backcross: present in all

bioassay survivors and absent from killed individuals (Figure 3.3B).

As CYP337B3 had previously been mapped to the homolog of B. mori

Chromosome 15, additional markers known to occur on that chromosome were

included in the analysis. CYP337B3 mapped near one end of the linkage group, with

the markers showing the same order as in B. mori. Survivorship of the cypermethrin

bioassay was most strongly correlated with the CYP337B3 genotype (Figure 3.4).


60

Figure 3.4 Map of resistance-associated linkage group of Helicoverpa armigera. The

resistant gene CYP337B3 was mapped using maximum likelihood as implemented in

MAPMAKER to determine the order and spacing of the 13 AFLPs, CYP337B3, and

four marker genes. The number of progeny carrying the FSD-derived allele (RS

genotype) vs. the susceptible allele (SS) at each locus among survivors of the bioassay

and killed individuals is indicated at the right. All progeny carrying the CYP337B3

allele from FSD survived and all those lacking CYP337B3 died. For the other loci, the

correlation between the FSD-derived allele and survivorship decreases with increasing

distance from CYP337B3 along the chromosome.


61

3.3.4. Full length gene isolation of CYP337B3 gene from FSD strain

Gene-specific PCR primers of pyrethroids susceptible gene CYP337B1 and

CYP337B2 (845 bp and 844 bp fragments respectively) and resistant gene CYP337B3

(847 bps fragment) of H. armigera were used to screen the presence of these genes in

FSD strain. PCR screening and sequencing results showed that the FSD strain contain

CYP337B3 while does not possess CYP337B1 and CYP337B2. Thus the FSD strain is

homozygous for resistant gene CYP337B3.

The primers design by Joussen et al., (2012) for full length amplification of

CYP227B3 were not able to amplify the gene in FSD strain due to the non-specificity

of primers. Then RACE-PCR strategy was adopted and primers (Table 3.1) for 3ʹ and

5ʹ RACE-PCR were used from 847 bp sequence of FSD. The full length gene was

isolated through RACE-PCR. The isolated CYP337B3 gene length was 1479 bp the

same length as that of TWB Australian strain while alignment blast results showed

that both the genes have 99% identity (Table 3.4) with 21 SNPs and 3 amino acid

differences between them (Figure 3.5). The blast results showed that CYP337B3 gene

of FSD strain showed 91% identity (Table 3.4) with all three alleles of CYP337B1

gene (NCBI accession numbers: JQ284023.1, JQ284024.1 and JQ284025.1) and 87-

88% identity (Table 3.4) with all three alleles of CYP3337B2 gene (NCBI accession

numbers: JQ284026.1 JQ284027.1 and JQ284028.1).

The full length CYP337B3 gene has ligated into pIB/V5-His TOPO TA

expression vector and transformed into insect cell line Ha2302, derived from H.

armigera. Before expression in cell line the presence of CYP337B3 gene was

confirmed through PCR using genomic DNA of cell line (Figure 3.6b). The expression

of transformed gene was determined, first, isolation of micrsomes from transformed H.

armigera-derived cells and then detected through Western blot. Western blot results

showed a CYP337B3 protein (enzyme) of 55-kilo Dalton (kDa) in size, thus

confirming that the expression of CYP337B3 gene in microsomes while in cytosol of a

cell no or very little expression of CYP337B3 protein (enzymes) was observed (Figure

3.6a). CYP337B3 gene intron region was amplified from FSD strain through PCR.

Sequencing results indicate that the intron sequence is 1017 bp in length. This

sequence has been submitted to gene bank with accession number KJ636466.


62

Table 3.4 Sequence identity of CYP337B3 gene of Helicoverpa armigera FSD strain

with already reported CYP337B genes through Basic local alignment search tool

(BLAST) search.

Figure 3.5 Alignment of amino acid sequences of CYP337B3 isolated from FSD strain

and TWB strain (Australian) of Helicoverpa armigera. Amino acid difference in both

proteins are highlighted in red [isoleucine (I)-Valine(V), Leucine(L)-Serine(S) and

Cysteine(C)-Arginine(R)].

Genes from BLAST search Strain (Location) Identity Accession No

H. armigera Cyp337B3 Pakistan (FSD) - -

H. armigera Cyp337B3 Australia (TWB) 99% JQ284029.1

H. armigera Cyp337b1v1 Australia (TWB) 91% JQ284023.1







63

Figure 3.6 Confirmation of cloning and heterologous expression of CYP337B3 gene

in insect cell line Ha2302. a. Detection through western blotting using denatured

microsomal proteins of Ha2302 cells containing CYP337B3 fused to V5 epitope and

His-tag and corresponding denatured cytosolic proteins (10µg, each) were separated

by SDS-PAGE. P450 enzymes were detected by western-blot using Anti-V5-HRP

antibody. b. confirmation of CYP337B3 gene transformed into insect cell line Ha2302

through PCR screening, using genomic DNA of extracted from cell line.

1 and 3 expression in cytosol, 2 and 4 expression in mircosomes

1 and 2 CYP337b3 , 3 –ve (without template DNA) and

4 +ve (CYP337B3 containing plasmid DNA), M 100

bp plus DNA ladder


64

3.3.5. Metabolic capabilities of CYP337B3 enzyme

After successful expression of pyrethroid resistant gene CYP337B3, its

metabolic capabilities were analyzed with known P450 model substrates.

Subsequently, the heterologous CYP337B3 was tested for its functionality using

known P450 model substrates. CYP337B3 showed high activity against 7-

methoxyresorufin, low activity against 3-cyano-7-methoxycoumarin, 7-

methoxycoumarin, 7-ethoxyresorufin, and 7-benzyloxyresorufin, very low activity

against 7-ethoxycoumarin and no detectable activity against 7-pentoxyresorufin and 3-

cyano-7-ethoxycoumarin (Table 3.5). The overall activity of the Pakistani CYP337B3

is comparable to that of the Australian CYP337B3v1 (Table 3.5; Joussen et al., 2012),

but it is less active against 7-benzyloxyresorufin and 7-methoxyresorufin just as

CYP337B1v4 is less active against these model substrates than CYP337B1v1. This

might be another indication that the Pakistani CYP337B3 arose from CYP337B1v4

and the Australian CYP337B3v1 from CYP337B1v1. The different activity could be

due to the nonsynonymous SNP at position 1093 resulting in a different amino acid

365 (CYP337B1v1, 365I; CYP337B1v4, 365V) that is located in the substrate

recognition site 5 (Joussen et al., 2012) and could therefore be important for substrate

recognition and binding.

To confirm the role of CYP337B3 in the metabolism of cypermethrin, in vitro

assays were performed and analysed by HPLC. The cypermethrin mixture (four trans-

and four cis-isomers) used as parent compound was partially separated in trans-

(44.4%) and cis-isomers (55.6%) on HPLC with retention times (Rt) of 43.3 min and

43.6 min, respectively (Figure 3.7a). Under the conditions provided, CYP337B3 was

capable of metabolizing cypermethrin in 4 h to a main metabolite occurring in trans-

(8.1%) and cis-configuration (19.8%) and possessing a Rt of 39.3 min and 39.6 min,

respectively, and to a minor metabolite (1.5%) possessing a Rt of 37.8 min (Figure

3.7d). Overall, 29.3% of cypermethrin were metabolized in 4 h, while 70.7%

unmetabolized cypermethrin (37.2% trans- and 33.5% cis-cypermethrin) were

recovered. Recovery was about 79%. No turnover of cypermethrin was detected by the

microsomal enzymes of the non-transgenic Ha2302 cells and the metabolism by

CYP337B3 was inhibited completely by the absence of NADPH and also by the

addition of the P450 inhibitor piperonyl butoxide, respectively (Figure 3.7, c and e-f).


65

Table 3.5 Activity of CYP337B3 gene containing microsomes toward different model

substrates of P450 enzymes. Corrected metabolic activities were expressed as pmol

product per mg of microsomal protein per minute.

P450 MR ER PR BR

CYP337B3 255.7 6.6 n.d. 5.6

CYP337B3v1 224.3 / 201.1 6.6 / 4.2 n.d. / n.d. 9.2 / 8.1

CYP337B1v1 128.9 / 41.9 0.3 / n.d. n.d. / n.d. 31.9 / 17.1

CYP337B1v3 2.8 / n.d. n.d. / n.d n.d. / n.d. 3.2 / 0.7

CYP337B1v4 145.8 / 39.8 1.2 / 0.6 n.d. / n.d. 22.9 / 8.1

P450 MC EC CMC CEC

CYP337B3 8.3 1.9 8.4 n.d.

CYP337B3v1 15.3 / 15.3 0.9 / n.d.

9.4 / 8.2 n.d. / n.d.

CYP337B1v1 6.1 / 1.3 n.d. / n.d. 0.9 / 0.2 n.d. / n.d.b

CYP337B1v3 0.9 / 1.3 1.3 / 2.8 n.d. / n.d. n.d. / n.d.

CYP337B1v4 2.1 / n.d. n.d. / n.d. 0.7 / n.d. n.d. / n.d.

Metabolic capacities are expressed as pmol product formed by 0.2mg of microsomal

protein in 4 h. For CYP337B3v1 and the CYP337B1 allozymes, the amounts for the

enzymes lacking the V5 epitope and the His-tag are given first, followed by the

amounts for the enzymes possessing the tags (Joußen et al., 2012). For CYP337B3,

only the enzyme possessing the tags was used.

MR, 7-methoxyresorufin; ER, 7-ethoxyresorufin; PR, 7-pentoxyresorufin; BR, 7-

benzyloxyresorufin; MC, 7-methoxycoumarin; EC, 7-ethoxycoumarin; CMC, 3-

cyano-7-methoxycoumarin; CEC, 3-cyano-7-ethoxycoumarin; n.d., not detectable.


66

Figure 3.7 In vitro metabolism of cypermethrin by heterologously expressed

CYP337B3. Baselines were corrected by subtraction of a blank run. 1, cis-

cypermethrin; 2, trans-cypermethrin; 3, 4'-hydroxy-cis-cypermethrin; 4, 4'-hydroxy-

trans-cypermthrin; 5, putative cis-cypermethrin metabolite (hardly visible); 6,

piperonyl butoxide. a, cypermethrin (reference compound); b, study performed with

non-transgenic microsomes and NADPH regeneration system; c, study performed with

CYP337B3 containing microsomes and NADPH regeneration system; d, study

performed with CYP337B3 containing microsomes omitting the NADPH regeneration

system; e, study performed with CYP337B3 containing microsomes, NADPH

regeneration system, and 40nmol of piperonyl butoxide.


67

3.4. Discussion

It is essential to understand the molecular basis of ecological adaptation of pest

insects in order to protect our valuable agricultural crops from their harmful effects.

Under strong selection pressure they tend to evolve different resistance mechanisms to

fit themselves in ecosystem but the genetic bases of these changes are still not

completely understood (Orr, 1998). H. armigera a lepidopteran agricultural pest has

evolved resistance against all conventional insecticides and likely against biological

insecticides (Bt) by evolving different resistance mechanisms.. Thus there is a great

potential to explore these genetic mechanisms by constructing linkage map using

anchor loci.

It is well known that H. armigera has evolved itself against pyrethroid

insecticides. In Australia H. armigera is highly resistant to fenvalerate (Gunning et al.,

1991; Joussen et al., 2012) followed by cypermethrin (Gunning et al., 1991), while in

Pakistan H. armigera is highly resistant to cypermethrin (Aheer et al., 2009; Ahmad et

al., 1997; Yang et al., 2004). The present study demonstrates that H. armigera strains

from different geographical regions showed resistance to a common pyrethroid,

cypermethrin. FSD and TWBR showed 5.7- and 6.9-fold resistance over the

susceptible strain. By comparing LD50 of cypermethrin for FSD strain with those of

Ahmad et al., (1995) baseline of LD50 value of Pakistani susceptible strain showed an

alarming increase in LD50 (921-fold) for H. armigera in Pakistan since 1991. In

synergism study with piperonyl butoxide (PBO) a known inhibitor of mixed function

oxidases and esterases (Hodgson et al., 1999; Willoughby et al., 2007; Young et al.,

2005), showed that cypermethrin resistance in FSD was completely supressed by

PBO, suggesting that the resistance in FSD strain is mainly due to metabolic enzymes.

Similar suppression study has been reported from Australia (Forrester et al., 1993) and

Pakistan (Aheer et al., 2009; Ahmad et al., 1997; Yang et al., 2004). Thus FSD strain

is resistant against cypermethrin and has evolved metabolic resistance against it.

Then the next question was that whether one (single mechanism) or more than

one gene (single mechanism or two mechanisms) in H. armigera FSD strain is

involved in cypermethrin resistance. Previously it is known that Australian strain

ANO2 had evolved P450 mediated resistance mechanism against pyrethroid.


68

Moreover, this resistance was found to be semi-dominant due to its complete

suppression by PBO (Daly and Fisk, 1992). Later on it was found that resistance in

ANO2 is monogenic at RFen1 locus present on AFLP linkage group 13. Present study

was focused to identify the major locus involved in pyrethroid resistance and linkage

group which reside this locus in H. armigera (FSD) genome. Thus whole-genome

approach (Heckel et al., 1998) was adopted and AFLP markers system has been

successfully used in several insects for identification of resistant gene (Hawthorne,

2001; Heckel et al., 1998; Kaiser and Heckel, 2012; Sheck et al., 2006; Wee et al.,

2008). In current study FSD male was crossed with TWBS female and the F1 progeny

was investigated for resistance dominance. Comparison of dose-mortality curves of

heterozygous F1 population (Hybrids) and its resistant parental strain FSD showed

similar level of resistance against cypermethrin with 6.9- and 6.6-fold respectively.

Thus, confirming that the resistance in FSD strain is metabolic because it was

suppressed by PBO shows the involvement of P450s. Similar result has been

previously reported in Australian H. armigera fenvalerate resistant strain (Daly and

Fisk, 1992; Wee et al., 2008). Moreover, the toxicity test of back cross progeny

showed 50% mortality after application of discriminating dose, which revealed that

resistance in FSD is monogenic because the segregation occurred at single major

locus.

In the next step of this study the genomic saturation was done by using AFLPs

by scoring sufficient markers in the backcross in order to identify segregating gene

that evolved against cypermethrin in FSD strain. Additionally, the biphasic approach

in lepidoptera (i.e H. armigera) was applied for efficient mapping of the resistance

gene/loci over chromosome. In this study 251 AFLPs were scored from FIBC using 21

primer combinations and these were found to group into 31 linkage groups,

corresponding to the known number of chromosomes in H. armigera (Robinson,

1971). Moreover, 13 AFLPs were found on linkage group 13 which show strong

interaction between genotype and survivorship. Similar result has been shown by Wee

et al., (2008) that semi-dominant locus RFen1 involved in pyrethroids resistance reside

on AFLP linkage group 13 and P450 gene CYP337B1 is tightly linked to it (Heckel et

al., 1998; Wee et al., 2008). In contrast it is known that crossing-over does occur in

lepidopteran male during meiosis (Fisk, 1989) and current results confirmed this


69

phenomenon as in MIBC 13 AFLPs which have shown interaction between genotype

and survivorship, 8 AFLPs present on linkage group 13 while 5 AFLPs are present on

linkage group 2, so confirming that recombination during meiosis has occurred in FSD

male.

Next question was which P450 gene is involved in metabolic resistance in FSD

strain as previously numbers of P450 genes have been extensively studied in H.

armigera which are involved in pyrethroids resistance (Brun-Barale et al., 2010;

Grubor and Heckel, 2007; Ranasinghe and Hobbs, 1998; Wee et al., 2008; Xiao-Ping

and Hobbs, 1995; Yang et al., 2006). These P450 genes were identified on the basis of

difference in gene expression between resistant and susceptible strain. So it was

difficult to conclude how many of the P450s in the genome of H. armigera are

candidates for involvement in pyrethroid resistance and can be used as a marker gene

for screening field population.

Recently, it was found that CYP337B3 a new chimeric gene, which resulted

from an unequal crossing over between two parental genes (CYP337B1 and

CYP337B2) is mainly responsible for fenvalerate resistance (Joussen et al., 2012). It is

hypothesized that the CYP337B3 (resistant gene) and CYP337B1 and CYP337B2

(susceptible genes) could be a good marker for screening H. armigera cypermethrin

resistant strain FSD and interestingly only CYP337B3 gene was present in FSD strain.

So it can be concluded that resistance in FSD strain is mainly metabolic and could be

possibly due to CYP337B3 gene alone.

The PCR screening results of CYP337B3 gene in MIBC revealed, similar

pattern of interaction between genotype and survivorship like 13 AFLPs in FIBC do

have. Thus the location of the resistance gene (CYP337B3) reside within linkage

group13 was analysed by using MIBC recombinant AFLPs, CYP337B3 pattern and

ribosomal protein genes. Results indicated that CYP337B3 is linked to linkage group

13 and the most likely location was 9.6 centi-Morgans (cM) from ribosomal protein

gene M14_FLX. Thus the linkage results confirmed that CYP337B3 is a candidate for

detoxification which contributed to pyrethroid resistance in FSD strain, is in

agreement with the previous findings of Joussen et al., (2012) and Wee et al., (2008).


70

As discussed above a number of H. armigera P450 genes have been reported to

be involved in pyrethroid resistance and 14 P450 genes including CYP9A12,

CYP9A14, CYP6B7 and CYP337B3 possess the metabolic capabilities against different

pyrethroids (fenvalerate and esfenvalerate) (Duangkaew et al., 2011; Feyereisen, 2012;

Joussen et al., 2012; Mao et al., 2011). However, CYP6B7 has been mapped to linkage

group 14, thus eliminated from the list of candidate genes involved in insecticide

resistance in H. armigera (Grubor and Heckel, 2007). Only recently, Joussen et al.,

(2012) have shown that CYP337B3 gene isolated from Australian TWB strain is

capable to metabolise fenvalerate. Here it is demonstrated that CYP337B3 gene

isolated from FSD strain is capable of metabolising both cis- and trans-isomers of

cypermethrin insecticide in vitro. However, it is known that different strains of the

same species are capable to develop different resistance mechanisms (Brun-Barale et

al., 2010) but by comparing results with those of Joussen et al., (2012) it is clear that

similar mechanism has been evolved by Pakistani strain FSD and Australian strain

TWB. Here question arise that how is it possible that same resistance gene is present

in geographically different strains of H. armigera. The possible reason could be that

H. armigera have the ability to move at long distances even 100 kilometres (Farrow

and Daly, 1987; Rochester et al., 1996; Zhou et al., 2000). These evidences support the

involvement of CYP337B3 in pyrethroid resistance in H. armigera from different

geographical origins. These findings further strengthen the idea that CYP337B1,

CYP337B2 and CYP337B3 could be very useful markers for screening pyrethroid

resistance in field population of H. armigera.

Expression profiling of H. armigera CYP450 genes

71

Chapter 4

Expression profiling of Helicoverpa armigera cytochrome p450

monooxygenases genes and their role in insecticides resistance

4.1. Introduction

A wide range of chemical and biological pesticides are used to control

polyphagous crop pest, H. armigera (Huang et al., 2002; Lu et al., 2012; Schnepf et

al., 1998). Excessive use of chemical insecticides has resulted in the emergence of

resistant strains, and currently there are 639 registered cases of H. armigera resistance

against major chemistries of insecticides including organophosphates,

organochlorines, carbamates and pyrethroids (Ahmad, 2007; Butler, 2011; Whalon et

al., 2013). Since their introduction in 1970s, pyrethroids have been widely used for H.

armigera control. This class of neurotoxins are comparatively cheaper, easily available

and effective against insects. However, reports of H. armigera resistance to

pyrethroids have been documented since 1983 (Gunning et al., 1991). Today,

pyrethroid resistant strains are prevalent in Asia, Africa, Oceania and some parts of

Europe (Aheer et al., 2009; Brun-Barale et al., 2010; Gunning et al., 1991; Russell and

Kranthi, 2006; Torres-Vila et al., 2002; Yang et al., 2004).

Resistance to insecticides may be conferred through a single or a combination

of mechanisms (Hemingway et al., 2004). H. armigera has evolved a combination of

mechanisms of resistance, namely knockdown resistance (Kdr), reduced cuticular

penetration, and overexpression of detoxifying enzymes including cytochrome P450

(P450) monooxygenases, glutathione S-transferases and esterase (Ahmad et al., 2006;

Gunning et al., 1991; Martin et al., 2005; McCaffery, 1998; Torres-Vila et al., 2002).

Involvement of Kdr and reduced cuticular penetration in pyrethroid resistance have

been reported from Asia and Australia (Ahmad et al., 2006; Ahmad et al., 1989;

Gunning et al., 1991; Kranthi et al., 2001). Similarly, resistance development through

glutathione S-transferases (GST) has been documented in some studies (Kranthi et al.,

1997). Elevated levels of esterases are known to confer resistance against

organophosphates and carbamates (Ahmad, 2004; Gunning et al., 1995) but is less

important in pyrethroid resistance (Kranthi et al., 2001) except in Australia and Africa,


72

where overproduction of esterase isoenzymes have been shown to be involved in

pyrethroid resistance (Gunning et al., 2007; Young et al., 2005).

Studies with a synergist, piperonyl butoxide (PBO) have indicated that

resistance against pyrethroids is achieved predominantly by metabolic detoxification

through P450 monooxygenases (Aheer et al., 2009; Brun-Barale et al., 2010; Yang et

al., 2004). P450s are heme-thiolate proteins which constitute the largest superfamily of

genes catalysing chemically distant reactions involving metabolic oxidation of

endogenous compounds (hormones, lipids and steroids), and in the catabolism and

anabolism of exogenous compounds (drugs, pesticides and other toxic chemicals)

(Feyereisen, 1999; Guengerich, 2007; Nelson, 2009; Scott, 1999). Previous studies

show that multiple P450 genes are involved in metabolism of pesticides resulting in

resistance to insecticides. The number of identified P450 genes in different insect

species is more than 1700 (Liu, 2012). In most cases the constitutive overexpression of

one or more P450 genes is associated with insecticidal resistance (Feyereisen, 2006).

Although the correlation between overexpressed P450 genes and resistance is not well

understood in pyrethroid resistant strain, elevated metabolism at biochemical level has

confirmed the role of P450 genes (Yang et al., 2004).

The quest for pinpointing P450 genes involved in metabolic resistance has

continued since their role in resistance was determined for the first time. From the

CYP family, CYP6B2 was the first gene isolated and sequenced from Australian H.

armigera (Xiao-Ping and Hobbs, 1995) followed by isolation of CYP6B6 and CYP6B7

(Ranasinghe and Hobbs, 1998). Overexpression of CYP6B7 in a pyrethroid-resistant

H. armigera strain was considered to be responsible for metabolism of pyrethroids. In

another study, CYP9A12, CYP9A14 and CYP6B7 were found constitutively

overexpressed in laboratory selected pyrethroid-resistant strain of H. armigera (Yang

et al., 2006). However, CYP6B7 gene lost its credibility as a candidate gene for

resistance due to its occurrence in tandom array on same linkage group along with

fenvalerate resistant locus (RFen1), CYP6B6 and CYP6B2 genes, next to para-type

sodium channel gene (Grubor and Heckel, 2007). In Australian AN02 strain of H.

armigera, researchers reported the overexpression of two P450 genes (CYP337B1,

CYP4S1) and a glutathione S-transferase gene (Wee et al., 2008). A significant level of


73

overexpression of CYP4M6, CYP4M7, CYP6AE11, CYP9A12, CYP332A1 and

CYP337B1 has been documented in deltamethrin resistant strains of H. armigera from

Africa and Spain (Brun-Barale et al., 2010). More recently a new chimeric gene

CYP337B3, which resulted from an unequal crossing-over between two parental

genes, CYP337B1 and CYP337B2, has been reported from a resistant strain of H.

armigera, in Australia (Joussen et al., 2012). Such reports have further highlighted the

role of CYP genes in H. armigera resistance against pyrethroids.

The present study was designed to identify and analyse the expression patterns

of the key P450 genes in two pyrethroid-resistant strains of H. armigera from

geographically distant regions, the TWB strain from Australia, and the FSD strain

from Pakistan. The study further aims to understand the possible role of overexpressed

P450 genes in detoxification of pyrethroid insecticides.


74

4.2. Material and Methods

4.2.1. H. armigera strains used in quantitative real-time PCR (qRT-PCR)

Quantitative real-time PCR (qRT-PCR) was executed with individuals of the

resistant strain FSD in comparison with the resistant line TWBR and the susceptible

line TWBS. Details of these strains of H. armigera have been described earlier (Table

2.1, Section 3.2.1).

4.2.2. RNA extraction and cDNA synthesis

For qRT-PCR, total RNA was extracted and purified from fifth-instar larvae

(three larvae pooled in one biological replicate and three biological replicates per

strain) using method as described earlier (section 2.5). Quality of purified RNA was

analysed by Agilent RNA 6000 Nano Kit (Agilent Technologies, Germany). First

strand cDNA was synthesized using RevertAid H Minus First Strand cDNA Synthesis

Kit (Life Technologies, Germany) from 500 ng of total RNA in 20 µL of reaction

mixture with 5X reaction buffer, 200 U RevertAid H Minus M-MuLV reverse

transcriptase, 20 U RiboLock RNase inhibitor, 10 mM dNTPs, and 50 µM oligo (dT)

18 primer at 42°C for 30 min, 50°C for 60 min, and 95°C for 2 min.

4.2.3. Primer designing

Gene-specific primers for 64 P450 genes (genes included in Figure 4.1 and

additional for an unnamed CYP301A gene) covering four major P450 gene families,

CYP3, CYP4, CYP6, and CYP9, were designed using Primer3

(http://bioinfo.ut.ee/primer3-0.4.0/; Table 4.1). Eukaryotic Initiation Factor 4A

(eIF4A) and ribosomal protein S18 (RPS18) were used as reference genes (Table 4.1).

All primers were designed using sequences from the in-house database of the

Australian H. armigera strain TWB.

4.2.4. Quantitative real time PCR (qRT-PCR)

PCR was performed in optical 96-well plates on the Agilent Technologies

Stratagene Mx3000P Real-Time PCR System using the ABsolute QPCR SYBR Green

Mix (Thermo Fisher Scientific) to monitor the double-stranded DNA synthesis in

combination with ROX as a passive reference dye included in the PCR master mix.


75

Amplification conditions were 95°C for 10 min to activate the polymerase, followed

by 40 cycles at 95°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec. A melting and

dissociation curve analysis (MxPro 4.0 QPCR Software, Agilent Technologies) was

performed in order to verify that the amplicon possessed the correct melting

temperature and therefore exhibited the predicted length and that there was only one

PCR product amplified per reaction. Each experiment was repeated with three

independent RNA samples (biological replicates), and each reaction was repeated

three times (technical replicates) to minimize intra-experiment variations. The average

copy number ± SEM of each P450 mRNA relative to 1000 copies of mRNA of the

reference gene eIF4A was calculated using qBase (version 1.3.5). Copy numbers in

resistant strains FSD or TWBR were compared with copy numbers in the susceptible

TWBS strain using two-tailed heteroscedastic t tests in Excel.

4.2.5. Genomic DNA and RNA extraction from untreated backcross larvae for

CYP337B3 gene screening

To examine whether P450 upregulation in FSD was genetically linked to the

cypermethrin resistance in FSD, DNA and RNA were extracted from 40 larvae of the

same female-informative backcross used in the linkage mapping. These larvae had

never been exposed to cypermethrin, so any expression differences are constitutive,

not induced. Both DNA and RNA were isolated from each individual using protocol

as described (Section 2.4 and 2.5). DNA was used to examine the presence or absence

of CYP337B3 using gene specific primers (Table 3.1), and thus to identify individuals

who had received the FSD-derived resistance-associated linkage group from their F1

mother. RNA was used to study the expression level of the three P450s found to be

highly up-regulated in FSD.


76

Table 4.1 List of primer pairs used for RT-qPCR and the expression analysis

Gene Forward primer (5'-3') Reverse Primer (5'-3') GenBank

Accession No.

CYP4G8 TCTGACCTGAAGGAGGAGGA TAGCAGGCTTTGGTTGGTTT KM016724

CYP4G9 CCACCCTCAGCACTACAAGG GGTCCAGCACTGAATGGAAT KM016725

CYP4G26 TGACCTCCGATGTGACTGAG TCTGCCTGGGTTCAATCTTC KM016723

CYP4L5 GTGCTGGTCCGAGAAATTGT GTTCAGGCTCTTGAGGTGCT KM016727

CYP4L11 GCATTCTTGGACCTGTTGCT TCGTGACCCTCAAACATGAA KM016726

CYP4M6v2 AATAGCCGTAGCGGAGGTTT CAGGTCCTTCGTTCCTGAAG KM016729

CYP4M7v2 AGCGCTGGTCCTAGAAATTG ATGGTTTCGTCACTGGCTTC KM016730

CYP4M10v2 ATTGCGGAACTTCGTATTG TGAAATTGACGACCACTGGA KM016728

CYP4S2 CAGCTTGATGCCCACGAT GCGTATGGCGTCGTCTAGTT KM016732

CYP4S12 TGCGTAACTTCAAGCTGGTG AGATAGGGTCAACGGGTCTG KM016731

CYP4S13 CTATGCATCCGTACGCCTTT CGACAAATTCCACTCAGCAC EF591060

CYP4AU1 TGCAGTAGTGCCAATGGTGT TCGGTCCACACTGTTCTCTG KM016722

CYP6B2v3 ATTGGACCGAAAGGAGGAAT TTCATGGTCCGTTGTCGTTA KM016746

CYP6B6v2 ATTGGACCGAAAGGAGGAAT CCGTTACTTGTACCGTCATTATAGC KM016748

CYP6B8 CAATGGATATCAGCCCGTTT GCAGGCTTCTTGTTGACGAC KM016749

CYP6B43 TTGTAGGGAGGTTATTGAAGCAG TGCCTTCTCGTCTCAAGTCC KM016747

CYP6AB9 CATAGGTGAGCGGCTAGGTC TGCACTATGCTGGACTGAGG KM016734

CYP6AB10 TGTGTTGGTGCCAGATTAGG CTACGAAACCTTCGGAAACG KM016733

CYP6AE11 TCTCACATTGCCTTTCACTCC ACTCCCAAAGAACCCACTCC KM016735

CYP6AE12 AGATGAGGCTCTGCGTCTGT CAGATGCACCCTCAGACCTT KM016736

CYP6AE14 GGATCCGGAGGAGTATAGGC TACAAAGTCTCGGGCCTTCA KM016737

CYP6AE15v2 CCCTTACTGAGCCGATTTGA ATCTGCGTGTCGGGAGATAG KM016738

CYP6AE16 GTTCCTGCCTGAGAACAAGC CTTCGTCTTCATCCCTGGAG KM016739

CYP6AE17 GTTCCTGCCTGAGAACAAGC TAATTATTCCCGCCGTCATC KM016740

CYP6AE19 GCATATGTTCTTGCGCCTTC TTTGATTGCCCATGAATCTG KM016741

CYP6AE20v2 CTGGCAGGCCTTGTCACTAT GCATCGAACACCAGGTCTCT KM016742

CYP6AE23 ACAGCTTGTTGCCAGTTAAGC ACCGTCTATTTGCGTCCGTA KM016744

CYP6AE24 CCAAATTGAGAACCTCCTCCT CCACGCACTTAGGAACACAA KM016743

CYP6AN1 ATCGAAGAGTTGGGCATCAC TATCCGGCATGAACTTCTCC KM016745

CYP9A3 GTGCTTATTCGGGAGATGGA CCCTGTAGCTGCATGTTGAA KM016754

CYP9A12 TCTGCGAGATGAAGGTGATG TTTCAGTCGCATGTTGAAGG AY371318

CYP9A14 ATGGAAGTCAGCGAGCAGAT TATCACATCGTTGGCGTAGC KM016750


77

Table 4.1 Continued

Gene Forward primer (5'-3') Reverse Primer (5'-3') GenBank

Accession no.

CYP9A15 GGATCGAGGTTTGCTCTCTG ATTGTTAGCCGCAAGTTTGG KM016751

CYP9A17 CTATGGGCGGCACGTTTAT CCACTATTGTTTGAGCGGAGA KM016752

CYP9A23v3 CAGATCTTACGGCACATGGA AAGCCAGTGTCCTCCTTTCA KM016753

CYP9A34 TGTGCGAGATGAAAGCGATA AGGTTGAACTGATCGGGAGA KM016755

CYP9G5 TTCCCGAACCAGACAAGTTT ATCATCGCGAACCTCATACC KM016757

CYP9AJ1 GCAGCAAAGGTATTCCTGGT CCTGGGTCTCAGTATGAATGC KM016756

CYP302A1 CAAGTCCCTCAAAGCGTGA TTGCTTTAGCCCATTGCAC KM016700

CYP304F1 CCTGCCGTACAGTTTGTCCT GACGACGCGGTCTATCTCTT KM016701

CYP305B1 AGTACTCATGTCGCTGGGAGA CGCTTTCGTCAATGAACCTT KM016702

CYP306A1 ACCTCTGTTACGCTGGCTTG TAGTTGAGAGCCGTCGACCT KM016703

CYP307A1 GCAGGAGTTTGAAATAGGAGCA GAATCAATGCTTTCTGGGAATC KM016704

CYP321A5 TGGAATGGGAAACAGGACAT CTGCTGGCTTTCTGGGATAG KM016705

CYP321B1 CGAGATACGCACGAATTCAA TTGTACTGGATGCCTCCTTTG KM016706

CYP324A1 TATGCCGTTTGGAGAAGGAC TGTTTGGCAGCACTCTCACT KM016707

CYP332A1 CCCGAGGTTCTGCATAGGTA CCACGATCTTAGGTGCATCA KM016708

CYP333A1 CGGCTTCGGAATAAGGAGTT CCCTCCCACGTAACTTTGAA KM016709

CYP333B3 GGCCAACACAGTCACAGCTA GGACACAATTTCCTCCCTCA KM016710

CYP340G1 GCAGATGTCACCAAGATGGA CCTCATCCTCATCACCAACA KM016711

CYP340H1 CCGGACAAGGATCAGTTCAT CCGATACAGTTGCGTCTGC KM016712

CYP340H2 TATGCACACGCAACAGATGA GCTTGCCGAAGTCCATTTAT KM016713

CYP340J1 TCAATATGGCGGATGAACAA TGGATTTGACCCAAGAAGGA KM016714

CYP340K1 ACGGCAAACAAGACTTTGCT CGCCAACATCACCTTTCATA KM016715

CYP341B2 GGCTACCAATACGCGATGAT GCCATTACTTCTGGCCATGT KM016716

CYP341B7 AATGACACCCGTCATCCATT AGGTCACTATGCAGCCAAGG KM016717

CYP354A3 GGTCTGAGATTCGCCATGTT CTGAATGGGATCAACCGTCT KM016718

CYP367A8 TGAACCAGAAAGGGCCACTA TTTGCTGTCTTCCGTTGGTT KM016719

CYP367B2 AGAGCGGTTCAATCCAGAAA TGCCGAAGTATCTTCCCAAA KM016720

CYP428A1 CCATCTGGCAAACTCATTAGC GGCCTTTGTCCATTGAAGTG KM016721

eIF4A AGCAAATCCAAAAGGTGGTG AGAGCACGGCGAGTTATCAT JK139881

RPS18 ACTGCCATCAAGGGTGTTG TGTATTGCCTGGGGTTAGACA JK127315


78

4.3. Results

4.3.1. P450 genes in H. armigera

To examine the possible role of other P450 genes in the cypermethrin

resistance of the FSD strain, an in-house cDNA database of H. armigera was searched.

This revealed contigs of 63 P450 genes, mainly belonging to the P450 gene families

CYP6 (17), CYP4 (12), CYP9 (9), and CYP340 (25). These P450s can be clustered by

phylogenetic analysis into two clades, the CYP3 clades (Figure 4.1, bottom part) and

the CYP4 clan (Figure 4.1, top part).

4.3.2. Expression analysis of P450 Genes

The expression levels of these P450 genes were investigated through RT-qPCR

in the cypermethrin resistant FSD strain and the TWBR line using the TWBS line as a

susceptible control. Primers for 58 genes were validated for TWBS and TWBR, but

only 51 primer pairs worked in FSD, likely due to sequence divergence in one or both

primer binding sites. It was not possible to design specific RT-qPCR primers that

could discriminate between CYP337B1, CYP337B2, and CYP337B3, because of the

high sequence similarity of these genes. Initially two housekeeping genes, RPS18 and

eIF4A, were used as reference genes, but because only the expression of eIF4A

remained constant for all the three lines tested over different rounds of experiments,

RPS18 was excluded from the analysis.

4.3.2.1. Expression analysis of P450 genes in H. armigera resistant strains

i) Upregulation of P450s

Statistical analysis of the qRT-PCR data revealed that 19 and 30 P450 genes,

respectively, were up-regulated in FSD and TWBR line compared to the susceptible

TWBS line. In FSD strain 12 P450 genes were significantly up-regulated compared to

TWBS (Table 4.2). Two genes showed more than ten-fold higher expression in FSD:

CYP340G1 (147-fold) and CYP340H1 (15-fold). Expression levels in TWBR were

much more similar to TWBS


79

ii) Downregulation of P450s

As compared to TWBS 19 P450 genes (Table 4.2) were significantly down-

regulated in the FSD strain, CYP6B2v3 (22.2-fold), as the significantly highest down-

regulated gene in the FSD strain. While in TWBR line, only one significant difference,

a 73-fold down-regulation of CYP321B1 (Table 4.2).

4.3.3. Expression pattern of FSD strain up-regulated genes (CYP340G1,

CYP340H1 and CYP341B2) in F1 backcross progeny

The three P450 genes showing the highest overexpression in FSD (CYP340G1,

CYP340H1, and CYP341B2) were not overexpressed in backcross progeny receiving

the FSD-derived linkage group from the F1 mother, relative to the backcross progeny

receiving the TWBS-derived linkage group (Figure 4.2). Instead, the expression levels

were equal in these two groups, and similar to the susceptible TWBS line suggesting

that the upregulation of CYP340G1, CYP340H1, and CYP341B2 were not genetically

linked to the cypermethrin resistance in FSD strain.


80

Figure 4.1 Maximum-likelihood tree of 63 P450 proteins from Helicoverpa armigera.

Protein sequences were aligned using Clustal W, and the tree was constructed using

RAxML on the CIPRES Science Gateway server and drawn using FigTree. Asterisks

denote proteins that were not investigated using RT-qPCR in this study.


81

Figure 4.2 mRNA abundance of 3 P450 genes in backcross larvae (BC) possessing or

lacking CYP337B3 compared to the resistant FSD strain and TWBS line. Error bars

represent the standard deviation; bars from the same gene sharing the same letter are

not significantly different (p < 0.05).


82

Table 4.2 P450 mRNA expression levels in three strains of Helicoverpa armigera as

determined by RT-qPCR.

P450 FSD vs TWBS

sig. FSD ± SE per

1000 eIF4A

TWBS ± SE

per 1000 eIF4

TWBR ± SE per

1000 eIF4

TWBR vs TWBS sig.

Up Down up down

CYP340G1 146.6 ** 40.1 ± 8.0 0.3 ± 0.2 1.6 ± 0.4 5.7 ns

CYP340H1 15.3 *** 12.3 ± 1.5 0.8 ± 0.1 6.2 ± 2.0 7.7 ns

CYP341B2 6.5 ** 7.1 ± 1.2 1.1 ± 0.1 0.7 ± 0.1 1.6 ns

CYP9AJ1 5.0 ** 2.2 ± 0.4 0.4 ± 0.1 0.7 ± 0.2 1.5 ns

CYP340H2 4.6 * 0.1 ± 0.03 0.03 ± 0.01 0.3 ± 0.1 8.2 ns

CYP9G5 4.0 ns 4.1 ± 1.3 1.0 ± 0.2 1.2 ± 0.1 1.2 ns

CYP367B2 3.2 ns 3.4 ± 1.3 1.1 ± 0.2 1.3 ± 0.2 1.2 ns

CYP9A3 3.2 *** 34.0 ± 2.2 10.6 ± 0.6 14.8 ± 1.5 1.4 ns

CYP6AB9 3.1 *** 425.3 ± 44.5 138.9 ± 8.6 195.0 ± 20.7 1.4 ns

CYP4S12 2.3 *** 10.2 ± 0.7 4.4 ± 0.9 2.9 ± 0.3 1.5 ns

CYP341B7 2.0 * 1.0 ± 0.1 0.5 ± 0.1 0.8 ± 0.2 1.5 ns

CYP6B6v2 1.7 ns 16.4 ± 5.1 9.9 ± 6.2 60.2 ± 22.9 6.1 ns

CYP4G8 1.5 ns 2448.2 ± 393.2 1602.9 ± 148.0 1800.7 ± 250.9 1.1 ns

CYP6AE17 1.5 ns 514.8 ± 68.1 337.8 ± 48.5 232.5 ± 25.6 1.5 ns

CYP9A34 1.4 * 40.3 ± 3.9 28.1 ± 1.7 82.2 ± 17.1 2.9 ns

CYP4S13 1.4 ns 4.3 ± 0.6 3.0 ± 0.8 4.1 ± 0.4 1.3 ns

CYP6AE14 1.4 * 42.8 ± 3.8 30.8 ± 1.7 19.6 ± 2.8 1.6 ns

CYP4M7v2 1.0 ns 26.9 ± 4.0 25.9 ± 1.1 41.1 ± 4.3 1.6 ns

CYP306A1 1.0 ns 23.6 ± 5.4 22.8 ± 4.1 38.3 ± 4.5 1.7 ns

CYP4G26 1.0 ns 36.0 ± 7.9 36.4 ± 6.1 35.6 ± 4.3 1.0 ns

CYP6AB10 1.1 ns 13.1 ± 3.1 14.3 ± 7.2 26.3 ± 16.4 1.8 ns

CYP4G9 1.1 ns 143.3 ± 25.0 158.0 ± 11.2 212.2 ± 21.3 1.3 ns

CYP4AU1 1.1 ns 4.1 ± 0.8 4.7 ± 0.7 4.6 ± 0.4 1.0 ns

CYP6AE16 1.2 ns 2.3 ± 0.2 2.7 ± 0.2 1.0 ± 0.1 2.7 ns

CYP304F1 1.3 ns 0.1 ± 0.02 0.1 ± 0.02 0.04 ± 0.01 1.6 ns

CYP6B43 1.4 ns 7.1 ± 0.6 9.6 ± 2.3 7.4 ± 0.2 1.3 ns

CYP4S2 1.4 ns 0.1 ± 0.02 0.2 ± 0.02 0.3 ± 0.04 1.6 ns

CYP9A23v3 1.6 ns 8.5 ± 1.7 13.6 ± 1.9 8.0 ± 1.2 1.7 ns

CYP9A12 1.7 ns 1.0 ± 0.1 1.7 ± 0.1 1.4 ± 0.1 1.2 ns

CYP4L5 1.7 ** 256.5 ± 39.9 430.9 ± 23.9 315.6 ± 15.6 1.4 ns

CYP340J1 1.7 * 11.4 ± 2.5 19.6 ± 2.5 33.4 ± 8.1 1.7 ns

CYP6B8 2.0 ns 4.6 ± 0.6 9.1 ± 4.4 13.7 ± 4.8 1.5 ns

CYP6AN1 2.1 *** 187.0 ± 18.0 389.5 ± 22.9 599.6 ± 134 1.5 ns

CYP333A1 2.4 *** 10.7 ± 0.4 25.4 ± 1.4 23.6 ± 1.0 1.1 ns

CYP305B1 2.6 * 24.5 ± 10.2 63.4 ± 12.4 12.0 ± 1.0 5.3 ns

CYP9A15 2.6 *** 0.6 ± 0.1 1.6 ± 0.1 6.1 ± 2.0 3.8 ns

CYP4L11 2.7 *** 82.5 ± 6.2 223 ± 16.8 202.1 ± 11.7 1.1 ns

CYP321A5 2.8 * 308.3 ± 79.2 850.3 ± 194.3 421.6 ± 95.2 2.0 ns

CYP428A1 2.8 ** 6.0 ± 2.6 16.8 ± 1.5 19.9 ± 1.1 1.2 ns


83

P450 FSD vs TWBS Sig. FSD ± SE per

1000 eIF4A

TWBS ± SE

per 1000

eIF4A

TWBR ± SE per

1000 eIF4A

TWBR vs TWBS sig.

Up Down Up Down

CYP332A1 2.8 ** 65.7 ± 14.1 183.7 ± 32.7 104.4 ± 15.4 1.8 ns

CYP6AE12 2.9 *** 34.4 ± 2.1 98.5 ± 9.5 74.0 ± 11.0 1.3 ns

CYP333B3 3.0 *** 0.4 ± 0.1 1.1 ± 0.1 2.0 ± 0.2 1.8 ns

CYP307A1 3.1 * 1.8 ± 0.5 5.4 ± 1.1 3.1 ± 0.6 1.8 ns

CYP6AE24 3.1 ** 260.0 ± 7.0 80.1 ± 12.8 109.5 ± 21.7 1.4 ns

CYP354A3 3.6 *** 12.4 ± 1.1 45.0 ± 3.7 38.9 ± 3.0 1.2 ns

CYP4M6v2 3.8 ns 28.0 ± 18.1 107.3 ± 40.6 116.6 ± 13.4 4.2 ns

CYP6AE19 3.9 *** 1.3 ± 0.3 5.1 ± 0.6 24.0 ± 5.8 4.7 ns

CYP9A14 5.3 * 4.1 ± 1.0 22.0 ± 5.0 14.9 ± 3.6 1.5 ns

CYP6AE11 6.0 *** 139.0 ± 36.8 831.1 ± 79.6 275.6 ± 39.0 3.0 ns

CYP4M10v2 10.2 ns 1.3 ± 0.4 13.6 ± 6.2 16.5 ± 11.1 1.2 ns

CYP6B2v3 22.2 *** 14.8 ± 1.9 328.4 ± 49.2 146.5 ± 29.0 2.2 ns

CYP6AE23 nd 8.6 ± 1.2 31.3 ± 8.5 3.7 ns

CYP6AE20v2 nd 0.2 ± 0.03 0.3 ± 0.1 1.6 ns

CYP6AE15v2 nd 7.2 ± 0.5 10 ± 0.9 1.4 ns

CYP9A17 nd 269.6 ± 22.4 191.1 ± 52.8 1.4 ns

CYP302A1 nd 0.02 ± 0.02 0.01 ± 0.01 1.7 ns

CYP324A1 nd 47.5 ± 12.9 13.4 ± 4.5 3.5 ns

CYP321B1 nd 34.8 ± 9.7 0.5 ± 0.2 73.2 *

CYP340K1 nd nd nd

CYP367A8 nd nd nd

Copy number estimates ± standard error of the mean are given per 1000 copies of

mRNA for reference gene eIF4A. Ratios of copy numbers are shown in separate

columns for up- or down-regulation in each resistant strain, relative to the susceptible

TWBS strain. sig., statistical significance of t-test: ns P > 0.05; * P < 0.05, ** P <

0.01, *** P < 0.001 nd, not detected.


84

4.4. Discussion

Based on previous results that metabolic resistance gene CYP337B3 is present

in cypermethrin resistant Pakistani strain FSD (Section 2) and fenvalerate resistant

Australian strain TWBR (Joussen et al., 2012) there was a need to find out whether the

pyrethroid resistance in these strains is only due to CYP337B3 or there could be the

involvement of multiple P450 genes. As increased P450 mediated detoxification and

overexpression of multiple P450 genes have been found to be associated with

enhanced metabolic detoxification of insecticides in pyrethroid resistant insects (Brun-

Barale et al., 2010; Yang et al., 2004; Zhang et al., 2010; Zhu et al., 2008). Moreover,

the evolution of different resistance mechanisms by the same species emphasizes the

importance of geographical origin of the strain (Brun-Barale et al., 2010) a variety of

chemical signals induce overexpression of cytochrome P450 genes (Conney, 2003).

For this reason in this study the expression pattern of 64 P450 genes were analysed

both resistant strain (FSD and TWBR) compared to susceptible strain TWBS.

Combined, these genes cover the three fourth of the total P450 genes reported from

Drosophila melanogaster (90 genes (Tijet et al., 2001)), and B. mori (86 genes (Yang

et al., 2006)). P450 genes upregulation was observed in FSD parental strain and two

genes (CYP340G1 and CYP340H1) showed more than ten-fold higher expression

while the expression levels of P450s in TWBR were much more similar to TWBS.

However, previous reports show that overexpression of different P450 genes in

pyrethroid resistant H. armigera is encoded by the gene families, CYP6 and CYP4. An

earlier non-quantitative northern blot analysis shows that in pyrethroid resistant strain

from Australia, CYP6B7, CYP6B2 and CYP6B6 overexpressed followed by the slight

overexpression of CYP4G8 (Pittendrigh et al., 1997; Ranasinghe and Hobbs, 1998) but

CYP6B7 was rejected as a candidate for fenvalerate resistance by Gruber and Heckel,

(2007). Further, cDNA-AFLP analysis in Australian fenvalerate resistant strain AN02

indicates that the overexpressing P450 gene CYP337B1 is tightly linked to the resistant

locus RFen1 (Heckel et al., 1998; Wee et al., 2008). They did not observe

overexpression of CYP6B7, CYP6B2 or CYP6B6 which was previously reported in

Australian strain. Strong overexpression of CYP9A12, CYP9A14 and CYP6B7 was

observed in pyrethroid resistant H. armigera from China (Yang et al., 2006; Zhang et

al., 2010). Significant overexpression of multiple CYP genes CYP4L5, CYP4L11,


85

CYP6AE11, CYP332A1, CYP9A14, CYP4M6, CYP4M7, CYP9A12, and CYP337B1

has been reported in deltamethrin resistant H. armigera (Brun-Barale et al., 2010). By

comparing with these results it was found that none of the previously reported

overexpressed genes were found upregulated in FSD or TWBR strain.

This study provides the first report on downregulation of P450 genes in

pyrethroid resistant strain of H. armigera. The genes which showed downregulation

belong to the same P450 gene families and clans (CYP3, CYP4, CYP6 and CYP9).

The extent of downregulation varied from very high to low. The mechanism of P450

downregulation is poorly understood. Many P450 genes are suppressed due to various

endogenous and exogenous compounds in insects and vertebrates (Carvalho et al.,

2010; Davies et al., 2006; Marinotti et al., 2005; Riddick et al., 2004). Complex

transcription factor cascades and regulatory proteins have been reported to be involved

in down regulation of P450 genes (Riddick et al., 2004). Previously proposed

mechanisms responsible for the P450 genes downregulation are: first, a

pathophysiological response to stress stimuli (inflammation, infection and toxin);

second, an adaptive homeostatic response to regulate the controlled generation of P450

derived reactive oxygen species to protect cells from harmful effect; and third, the

dedication of transcriptional machinery in other important physiological pathways

(Morgan, 2001; Yang and Liu, 2011). A similar explanation was given by Yang and

Liu for insecticide resistance in insecticide resistant mosquitoes, Culex

quinquefasciatus; down regulation of P450 occurred to protect insect cells from the

deleterious effects of P450 derived oxidizing species and metabolites of oxidation

reaction which results from the overexpression of cytochrome P450 genes involved in

insecticide resistance.

But after analysing the three P450 genes (CYP340G1, CYP340H1, and

CYP341B2) showing the highest overexpression in FSD were not overexpressed in

backcross progeny receiving the FSD-derived linkage group from the F1 mother,

relative to the backcross progeny receiving the TWBS-derived linkage group. Instead,

the expression levels were equal in these two groups, and similar to the susceptible

TWBS line. Therefore, the overexpression of these P450 genes in the FSD strain is not

linked to cypermethrin resistance in the FSD strain.


86

Therefore, in the present case the different expression levels of the P450 genes

studied have no confirmed influence on the level of resistance indicating that the up-

regulation of a gene does not necessarily prove its involvement in the observed

resistance.

Population structure and frequency of pyrethroid resistant gene CYP337B3

87

Chapter 5

Population structure and frequency of pyrethroid resistance gene

CYP337B3 in Helicoverpa armigera in pakistan

5.1. Introduction

Subfamily Heliothinae (Lepidoptera: Noctuidae) includes several of the world's

major crop pests including Helicoverpa zea, Heliothis virescens and Helicoverpa

armigera. (Mitter et al., 1993). H. armigera feeds and sustains itself on a wide range

of economically important crops including cotton, maize, sorghum, pigeon pea, chick

pea, soybean, groundnut, sunflower and a range of vegetables (King, 1994; Wu et al.,

2008). It is one of the most widely distributed species of the genus Helicoverpa

(Venette et al., 2003), due to the ability of its adults to migrate over several hundred

kilometres (Farrow and Daly, 1987; Rochester et al., 1996; Zhou et al., 2000). It has

been reported that this pest can fly 200-300 kms in one night (Armes and Cooter,

1991) and has been reported in Ascension Island, 2000 kilometers away from the

African coast (Widmer and Schofield, 1983). Moreover, H. armigera is considered a

quarantine pest in South and North America but recent studies have shown its

presence in North and Northeast of Brazil (Czepak et al., 2013; Mastrangelo et al.,

2014) which is an alarming situation for this region.

Along with its migrating capability, H. armigera has a high variability in

number of generations, host plants, diapause and seasonal abundance (Fitt, 1989; Zhou

et al., 2000). Most of the time the damage caused by H. armigera is controlled by both

chemical and biological pesticides (Schnepf et al., 1998) but extensive use of chemical

pesticides has resulted in high levels of resistance (Ahmad, 2007; Endersby et al.,

2007).

This pest is a challenge for ecological and evolutionary studies and its status as

a pest makes it important to understand its demography (Mitter et al., 1993). Different

marker systems, including sodium channel gene analysis (Stokes et al., 1997),

isozymes (Nibouche et al., 1998), randomly amplified fragment length polymorphism

(RFLP) (Zhou et al., 2000), mitochondrial DNA (mtDNA) (Behere et al., 2007),

microsatellites (Vassal et al., 2008) and exon primed intron crossing PCR (EPIC-PCR)


88

(Behere et al., 2013; Tay et al., 2008) have been used to study genetic diversity in H.

armigera. In Australia sodium channel gene, isozymes and mtDNA markers

polymorphism analysis revealed no or little genetic divergence among widely

dispersed populations of H. armigera, signifying the widespread gene flow (Behere et

al., 2007; Nibouche et al., 1998; Stokes et al., 1997). On the contrary, highly

polymorphic microsatellite marker analysis revealed substantial genetic divergence

among different populations of H. armigera collected from the same locality during

different cropping seasons round the year (Ji et al., 2003; Scott et al., 2005a; Scott et

al., 2005b; Scott et al., 2006). However, using the microsatellite markers, Endersby et

al., (2007) observed no significant genetic divergence in Australian H. armigera

populations. These contradictory findings of microsatellite markers based studies

could be due to mutation in the primers annealing site (allele drop out and null allele)

(Endersby et al., 2007) or possible association with non-long terminal repeats (LTR)

retro-transposable elements (Tay et al., 2010). The limitation of microsatellite markers

was overcome by developing EPIC-PCR markers for H. armigera (Tay et al., 2008).

Moreover, using these markers Behere et al., (2013) have reported significant genetic

differences at host crop, time and geographical levels among different populations of

H. armigera collected from diverse locations in India. EPIC-PCR is a valuable marker

system to investigate population genetic structure of H. armigera but these markers

are still prone to null alleles due to variation in primer binding site of exon regions.

Recently 650 bp from 5ʹ-end of COI gene has been adopted as a universal

marker for identification and diversity analysis of animal species and termed “DNA

barcode”. DNA barcoding has emerged as a rapid and reliable technique for

identification of organisms (Hebert and Gregory, 2005). COI was adopted as a

standard because of its robustness and wide range of phylogenetic signal (Hebert et al.,

2003; Ramadan and Baeshen, 2012). DNA barcoding has been successfully used for

species discrimination in a wide range of animals including insects (Ashfaq et al.,

2013; Ashfaq et al., 2014; Hastings et al., 2008; Hebert et al., 2004). DNA barcoding

of H. armigera can be used as an additional valuable source for population structure

and phylogenetic analysis along with other marker systems. Recently DNA barcoding

has been used for the detection and genetic diversity analysis of H. armigera

populations in Brazil and its demarcation from H. zea (Mastrangelo et al., 2014).


89

The study decribed here was intiated to determine genetic variation in H.

armigera populations across Pakistan by DNA barcoding. Another objective of this

study was to develop a DNA barcode reference library for biodiversity analysis and to

understand the population structure and gene flow in H. armigera. In addition, this

study also aimed at elucidating the distribution of the resistant genes CYP337B1,

CYP337B2 and CYP337B3 in H. armigera collected from different geographical

regions of Pakistan.


90

5.2. Materials and Methods

5.2.1. Specimen sampling

H. armigera adults and larvae were collected from 37 geographic locations of

Central, Southern and Northern Pakistan during 2010-2013. Ecologically these

collection points are spread across different climatic zones; including desert,

temperate, tropical and subtropical, with varying altitudes 17 m – 2137 m. The larvae

were collected from field crops (Okra, chickpea, trifolium) and mixed shrubs and were

stored at -20°C, while the adults were collected by light trap and were preserved in

collection boxes for subsequent molecular analysis. The collected samples were

recorded during collection in the following order: collector name, date of collection,

location and host plant. The collection sites were mapped using online tool

(http://www.simplemappr.net) along with GPS coordinates.

5.2.2. DNA barcoding

The collected samples were labelled, assigned the specimen numbers and were

photographed before processing for DNA barcoding. Specimen data along with

collection information were submitted to the Barcode of Life Data System (BOLD)

(http://www.boldsystems.org/). A small piece of leg from moth or tissue from larva

was excised with a pair of sterile forceps. The excised tissues were transferred to a 96

well microplate (one specimen per well) containing 30 µL of 95% ethanol in each

well. Amplification and sequencing of the 5′ region of the COI (barcode region) were

performed at the Canadian Centre for DNA Barcoding (CCDB), the Biodiversity

Institute of Ontario (BIO) following standard protocols (Hebert et al., 2003; Ivanova et

al., 2006). In total DNA barcodes from 65 specimens collected from different

locations in Pakistan were sequenced.

5.2.3. Data analysis

COI sequence from each specimen was BLAST searched against the known

barcode sequences in the databases (i.e. GenBank and BOLD) for the similarity

analysis. Previous studies have shown that most lepidopterans show an intraspecific

sequence divergence of ≤2% at CO1 (Hebert et al., 2003; Strutzenberger et al., 2011).

A threshold of 2% sequence divergence was used for the species discrimination.

http://www.simplemappr.net/

http://www.boldsystems.org/


91

Moreover, samples with sequence length less than 500 bp were excluded from the

study. Distance analysis was performed using MEGA5 (Tamura et al., 2011) following

Kimura 2-parameter (K2P) model (Kimura, 1980) and pairwise deletion.

Haplotype groups were determined by DnaSP 5.10 (Librado and Rozas, 2009).

The generated haplotypes were grouped into three populations; Northern, Central and

East Southern Pakistan for analysis of molecular variance (AMOVA). Significance of

variation among and within populations was calculated using Alrequin ver 3.5.1.2

(Excoffier and Lischer, 2010). Minimum spanning trees of 20 haplotypes generated in

Alrequin were used for COI haplotype network using HapStar 0.5 (Teacher and

Griffiths, 2011). Single nucleotide polymorphism (SNP) markers were employed to

determine the population structure and kinship of the collected samples. SNP markers

were retrieved from sequences using MEGA5 and were employed to program

STRUCTURE 2.3.4 (based on Bayesian clustering method) (Falush et al., 2007;

Pritchard et al., 2000). Structure model was used to identify population structure,

admixed individuals and population genetic clusters (K) by using simulation of 10

iterations, with each iteration consisting of 10,000 burnin and run length of 20,000

Markov Chain Monte Carlo (MCMC) replications and testing for K = 1 to K = 10. The

structure software results were imported to STRUCTURE HARVESTER software to

calculate exact value of ΔK (Earl and vonHoldt, 2012b)

(http://taylor0.biology.ucla.edu/structureHarvester/).

5.2.4. Screening of CYP337B1, CYP337B2 and CYP337B3 genes

For PCR screening fast tissue-to-PCR kit (Fermentas, Germany) was used. A

small piece of leg from adult or tissue from larval body was mixed with 100 µL of

tissue lysis solution and 10 µL proteinase K solution by vortexing. The reaction

mixture was incubated for 10 min at 25°C, followed by incubation for 3 min at 95°C.

The reaction was neutralized by adding 100 µL of neutralization solution T and mixed

by vortexing. Neutralized tissue extracts were used immediately in PCR.

The allele frequency of CYP337B1, CYP337B2 and CYP337B3 was

determined to estimate the resistance level of the population. The screening of these

genes was done by the method as described earlier (section 3.2.5.2) using 1 to 40

specimens per location.

http://taylor0.biology.ucla.edu/structureHarvester/


92

5.3. Results

To determine the population structure and frequency of pyrethroid resistant

gene CYP337B3, in field population of H. armigera in Pakistan. Collection of

specimens was done from 37 different locations across Northern, Central and East

Southern Pakistan (Figure 5.1). The collected H. armigera adults and larvae were

identified initially based on their morphological characteristics. For DNA barcoding

and population structure analysis, COI gene was sequenced from the specimens

collected from 27 locations.

Figure 5.1 Map of Pakistan showing collection localities of Helicoverpa armigera.

Collection points are indicated by black dots. The map was constructed using

(http://www.simplemappr.net)


93

5.3.1. Genetic diversity of H. armigera

5.3.1.1. DNA barcoding

COI sequences >500 bp were obtained from 64 H. armigera specimens

collected from 27 locations. The K2P divergence among these sequences was less than

2% (ranged 0.0 to 1.39%). COI divergence between H. armigera from Pakistan and

those from Australia, Europe, Africa and Asia was <2%. The ABGD analyses (Figure

5.2) also found 1 group (prior maximal distance P = 0.001668) in Pakistan H.

armigera.

The sequences from the 64 H. armigera specimens were analysed for number

of expected haplotype groups which revealed 20 H. armigera haplotypes, with

haplotypes diversity 0.829 ± 0.035. Moreover, there were 17 polymorphic sites (SNPs)

among these haplotypes. Haplotype 1 also covers nine different locations with 14

samples from all three geographical regions including Northern Pakistan (Kalam (2),

Mingora (1), Dargai (1) and Shogran (1)), Central Pakistan (Bahawalpur (1),

Faisalabad (2) and Multan (1)) and East Southern Pakistan (Sadiqabad (4) and Sanghar

(1)). Similarly haplotypes 2 covers fifteen different locations with 22 samples from all

three geographical regions; Northern Pakistan (Kalam (1), Peer Chinasi (1), Charsada

(1), Dassu (1) and Muree (1)), Central Pakistan (Khewra (3), Bahawalpur (3),

Faisalabad (1), Lahore (1) and Jehlum (1)) and East Southern Pakistan (Sadiqabad (3),

Hatango Khupru (1), Jamaro (1), Karchat (1) and Sanghar (1)). Halpotype 3 cover one

location (Faisalabad (1), Haplotype 4, cover five different locations with 5 specimens

from Northern and Central geographical regions; Nothern Pakistan (Besham (1) and

Balakot (1)) and Chiniot (1), Bahawalpur (1) and Sadiqabad (1)), Halpotype 5 cover

one location (Faisalabad (1). Haplotype 6 and 7 cover four different locations with 4

DNA barcoded specimens from Northern and Central geographical regions; Haplotype

6 (Dasu (1), Mansehra (1), Khewara (1) and Faisalabad (1)) and Haplotype 7 (Balakot

(1), Bhakkar (1), Bahawalpur (1) and Sadiqabad (1). The remaining fifteen haplotypes

contain one sequence each, in which six haplotypes; Haplotype 10 (Sadiqabad),

Haplotype 12 (Dargai), Haplotype 13 (Charsadda), Haplotype 18 (Gilgit) and

Haplotype 19 (Shogran) and Haplotype 20 (Muree) are present in one branch of

haplotype tree while nine haplotypes; Haplotype 8 (Khewra), Haplotype 9


94

(Bahawalpur), Haplotype 11 (Kel), Haplotype 14 (Bhakkar), Haplotype 15 (Nagar

Parkar), Haplotype 16 (Jehlum) and Haplotype 17 (Jamorao) are present on the other

branch.

AMOVA was performed using haplotype data derived from DnaSP 5.10. The

analysis (Table 5.1) revealed that H. armigera populations from different geographic

regions of Pakistan showed similar level of genetic variability regardless of their

origin (-0.00587% population variance). Moreover, the population variations among

those within geographic regions and within populations were 5.12% and 95.46%,

respectively, but these variations were not significant. Arlequin output data file of 20

haplotypes was used for the construction of a minimum spanning tree using HapStar.

Figure 5.3 shows that the haplotypes were clustered into two groups connected

through haplotype 6. Moreover, the tree did not show any link between haplotypes and

geographic region and indicated that H. armigera across Pakistan belongs to a single

species and that there is a possibility that the Pakistani H. armigera populations

originated from two ancestors.


95

Table 5.1 Comparisons between geographic regions (Northern Pakistan, Central Pakistan and East Southern Pakistan) by AMOVA using COI

gene sequences of Helicoverpa armigera.

Model Hierarchical levels Degree of

freedom Sum of square Variance components Fixation indices

Percentage of

variation P-value

Geographical

Regions

Among Groups 2 1.901 -0.00536 -0.00587 FCT -0.59 0.47801

Among populations

within groups 24 23.340 0.04676 0.05092 FSC 5.12 0.32063

Within populations 37 32.249 0.87159 -0.04535 FST 95.46

0.24633

Total 63 57.490 0.91300


96

Figure 5.2 Distance analysis; pairwise distance divergence (%) of Helicoverpa

armigera from Pakistan as generated by ABGD (Puillandre et al., 2012)

Figure 5.3 HapStar profile of COI gene haplotypes tree of Helicoverpa armigera from

Pakistan. Haplotype number and frequency is indicated inside and besides the

corresponding circle, respectively.


97

5.3.2. Population structure

Haplotypes polymorphic sites SNPs from DnaSP were used to calculate model-

based simulation of population structure. For analysis the population genetic clusters

(K) was selected from 1 to 20 based on calculated number of haplotypes. Results

indicated that at maximum likelihood and minimum α best K value was calculated as

K = 2 with highest ΔK value (Figure 5.4a and b). At K = 2 the mean value of α was

0.0613 with Fst value for group-I and II was 0.53 and 0.51 respectively. Further there

were 100% admixed ancestry because no pure inbreed was found (Figure 5.4b).

The second maximum value of ΔK was recorded at K = 4 (Figure 5.4c) with α

value 0.0397. The 64 samples broke up into four groups and the Fst values of Group I,

II, III and VI were 0.0370, 0.6000, 0.8054 and 0.7127, respectively. Similarly at this

value no pure inbreed of H. armigera was present in all the analysed samples.

Moreover, no specificity of any particular group was observed with any of the

geographic region of Pakistan (Northern, Central and East Southern).


98

Figure 5.4 STRUCTURE analysis results of Helicoverpa armigera populations

collected from Pakistan based on SNPs. (a) Graph showing K = 2 as suspected

population (b) Bar graph of all 65 individuals at K = 2 (c) Bar graph of all 65

individuals at K = 4.

(a)

(c)

a.

b.

c.


99

5.3.3. Geographical distribution of H. armigera pyrethroids resistant

(CYP337B3) and susceptible genes (CYP337B1 and CYP337B2) in Pakistan

All the collected individuals from 37 different sites were tested for the

presence of pyrethroid resistance gene CYP337B3 and its parental genes CYP337B1

and CYP337B2 by PCR using the primers already successfully used for the FSD strain

(Table 3.1). PCR screening revealed that a high frequency of CYP337B3 (100%) is

present in H. armigera populations across Pakistan (Figure 5.5, Table 5.2). The

parental genes CYP337B1 and CYP337B2 were not detected in Pakistani populations

of H. armigera.


100

Table 5.2 Distribution of CYP337B1, CYP337B2 and CYP337B3 genes across

Pakistan

Province/State Region CYP337B1 CYP337B2 CYP337B3

Gilgit Baltistan Gilgit - - +

Dassu - - +

Azad Kashmir

Kel - - +

Peer Chinassi - - +

Shahdarra - - +

Ath Maqam - - +

Rawalakot - - +

Ghari Dupatta - - +

Khyber Pakhtunkhwa

Kalam, Swat - - +

Manglawer, Swat - - +

Matta, Swat - - +

Dargai, Malakand - - +

Charsada - - +

Besham - - +

Balakot - - +

Shogran - - +

Mansehra - - +

Changla Gali - - +

Punjab

Muree - - +

Khewra - - +

Jehlum - - +

Mian Channu - - +

Chiniot - - +

Faisalabad - - +

Lahore - - +

DG Khan - - +

Mankara - - +

Multan - - +

Sadiqabad - - +

Bahawalpur - - +

Sindh

Sanghar - - +

Hatango Khupru - - +

Nagar Parkar - - +

Jamrao - - +

Karchat - - +

Mithi - - +

Islamabad Islamabad (Capital) - - +

(+) gene present, (-) gene absent


101

Figure 5.5 PCR screening for the presence or absence of CYP337B1, CYP337B2 and

CYP337B3 in collected samples. A representative gel picture of PCR screening of

larvae collected from Swat. a. CYP337B1 gene, b. CYP337B2 gene and c. CYP337B3.

Lane 1-36 (Helicoverpa armigera larvae), Lane –ve (negative control, without

template DNA) and Lane +ve (positive control, CYP337B3 containing plasmid).


102

5.4. Discussion

In present study the DNA barcoding was used for species identification,

genetic divergence and population genetic structure of H. armigera and to determine

the possible relationship between genetic structure and pyrethroid resistance. The

DNA barcode analysis of 64 different locations of Northern, Central and East

Southern Pakistan strongly support that all these samples are conspecific to H.

armigera. Normally it is estimated that sequence divergence among lepidopterans

remains low (Caterino et al., 2000; Hebert et al., 2003) and DNA barcoding results of

the current study are adequate to support recognition of the divergence. The calculated

sequence divergence (K2P and p-distance) was from 0.00% to 1.39% (<2%). Using

this threshold value (<2%) of DNA barcoding, H. armigera has been successfully

identified and discriminated among lepedopteran species in Brazil (Mastrangelo et al.,

2014) and China (Li et al., 2011).

The proposed threshold value of sequence divergence to classify insect and

mammal species is from 2-3% (Hebert et al., 2003). However, the rate of genetic

changes between classes is a dynamic process (Rubinoff et al., 2006), thus sequence

divergence could be extremely fluid. Variation in species threshold value could be

possible among different lepidopteran studies; as in case of skipper butterflies (Hebert

et al., 2004) the threshold value was low (0.32%), while in case of Ithoninae butterflies

(Whinnett et al., 2005) it was higher (0.23 to 6.4%).

Further, the haplotype analysis (Figure 5.3) depicts that there is no specific

haplotype linked to both within and across geographical regions (Northen, Central and

East Southern) of Pakistan. Similarly, AMOVA analysis revealed that variation

present among groups and different populations are non-significant, indicating that

these haplotypes have wide geographic distribution, thus confirming the long distance

migration of H. armigera (Farrow and Daly, 1987; Rochester et al., 1996; Zhou et al.,

2000).

For more comprehensive grouping of H. armigera populations in Pakistan

model based population structure analysis was performed which in comparison to

phylogenetic analysis model based genetic structure gives more comprehensive

grouping (Goldstein, 1991). The population structure analysis using SNP markers


103

showed maximum likelihood of ΔK when K = 2. However, there was 100% admixed

ancestry because no pure inbreed was found (Figure 5.4b) and low population

structure. These results further validate that the H. armigera population found in

Pakistan is homozygous and no significant population substructure exists with respect

to specific geographic region.

However, using different molecular techniques, many studies have shown

similar patterns of genetic variation in insect pests due to their ability to migrate over

long distances such as H. armigera. Using isozyme allele no significant genetic

variation was detected between Australian H. armigera populations collected within

3,000 km range (Daly and Gregg, 1985). Using the same molecular technique samples

collected from both sides of the Sahara desert showed very small variation, indicating

that even desert cannot bar long-distance movement of H. armigera (Nibouche et al.,

1998). Similarly using RAPD-PCR technique, no significant genetic variation between

Israeli and Turkish H. armigera population was found (Zhou et al., 2000). Using

microsatellite loci, Endersby et al., (2007) reported that there is no evident genetic

structure present in H. armigera populations from Australia and New Zealand.

Similarly the partial mtDNA COI data of H. armigera from Asia, Australia and Africa

showed low nucleotide diversity and Fst values (Behere et al., 2007). In India no

significant population structure was found in H. armigera populations collected from

different crops irrespective of cropping season using EPIC-PCR markers (Behere et

al., 2013).

Based on the findings that CYP337B3 is responsible for metabolic resistance

against cypermethrin in Pakistani H. armigera (Chapter 3), the present study was

focused to determine the frequency of resistance gene (CYP337B3) and its parental

pyrethroid susceptible genes (CYP337B1 and CYP337B2) in the H. armigera

populations in Pakistan. The results indicated that only CYP337B3 gene was detected

whereas no susceptible genes were present in the analyzed specimens. Thus the

CYP337B3 gene was considered to be responsible for pyrethroids resistance and found

to be extremely common and wide-spread in field collected H. armigera from

Pakistan. Moreover, wide spread applications of synthetic pyrethroids across Pakistan

is assumed to be responsible for the presence of only resistant parent in Pakistan

instead of both resistant and susceptible parents. Although there could be more than


104

one resistance mechanisms (cuticular penetration, target site and metabolic) in H.

armigera (Ahmad et al., 1989; Gunning, 2006; Gunning et al., 1995; Gunning et al.,

1991) but CYP337B3 gene (metabolic resistance) seems to be underlining the most

common resistance mechanism present in Pakistani populations of H. armigera.

However, proper screening of pyrethroid resistant gene (CYP337B3) and

understanding the population structure of this invasive pest is essential for its effective

control and quick response to any incursion, and to invistigate that whether the

CYP337B3 gene evolved in Australia or it was already present throughout the world?

Giving us a clue that might be CYP337B3 gene evolved in Australia and this resistant

strain reached to Pakistan through agricultural products. But still there is a need, to

screen the presence of pyrethroid resistant (CYP337B3) and susceptible genes

(CYP337B1 and CYP337B2) in different geographical regions; mainly Asia, Australia

and Africa to confirm the origin of this new resistant chimeric gene.

Overall, the present study reveals that pyrethroid resistance gene CYP337B3 is

present in all collected samples of H. armigera across Pakistan but sill there is need to

screen H. armigera populations from all geographical locations of Pakistan. While the

populations from Northern, Central and East Southern of Pakistan under significant

gene flow indicating that this migratory pest is not restricted to specific geographic

region.

Chapter 6 General Discussion

105

Chapter 6

General Discussion

The increasing level of insecticide resistance in insect pests limit their control

and threatens agriculture. A number of mechanisms of resistance against pyrethroids

have been reported in H. armigera, including target site insensitivity (Gunning, 1996;

McCaffery, 1998), metabolism by carboxylesterases (Gunning, 1996; Gunning et al.,

1999; Gunning et al., 2007; Young et al., 2005; Young et al., 2006), and activiation of

P450s (Brun-Barale et al., 2010; Daly and Fisk, 1992; Heckel et al., 1998; Pittendrigh

et al., 1997; Ranasinghe et al., 1998; Ranasinghe and Hobbs, 1998; Ranasinghe and

Hobbs, 1999; Wee et al., 2008; Yang et al., 2004).

Recently, it has been reported that a new P450 gene, CYP337B3, emerged by

unequal crossing-over between CYP337B1 and CYP337B2 from the Australian

fenvalerate resistant H. armigera strain TWB (Joussen et al., 2012). This study

revealed the presence of the same gene in cypermethrin-resistant H. armigera in

Pakistan and suggest that the gene is evidently not restricted to Australian populations

as previously thought. Full-length cloning and sequencing revealed a number of

sequence differences between the Pakistani CYP337B3 and the Australian

CYP337B3v1(Figure 6.1). The two alleles differ by three nonsynonymous SNPs and

the resulting differences in the deduced amino acid sequence located at the C-terminus

reflect the differences previously described between the CYP337B1 allozymes

(Joussen et al., 2012). Thus, the Australian CYP337B3v1 resembles CYP337B1v1 or

CYP337B1v3 at its 3‟ end, while the Pakistani CYP337B3 resembles CYP337B1v4.

Furthermore, it is possible that the unequal crossover event shifted a few nucleotides

up-stream of the proposed position of the Australian CYP337B3v1 (Joussen et al.,

2012). In addition, the intron differs in length and sequence between the Pakistani

CYP337B3 (1017 bp) and the Australian CYP337B3v1 (921 bp). Taking all three lines

of evidence, it is likely that rather than individuals of H. armigera carrying CYP337B3

from Australia to Pakistan or vice versa, CYP337B3 instead evolved independently

twice by unequal crossing-over between CYP337B2 and two different CYP337B1

alleles. The very similar crossover region was most likely favoured by a longer stretch

of sequence identity between CYP337B1 and CYP337B2. However, the verification of


106

this hypothesis is hampered by the fact that the parental genes, CYP337B1 and

CYP337B2, have so far not been found in Pakistani populations. The parental genes

were probably selected against due to high selection pressure by pyrethroids, which

selects for individuals homozygous for CYP337B3 which consequently have lost

CYP337B1 and CYP337B2, because only heterozygous individuals can possess all

three genes (Joussen et al., 2012).

The slightly different amino acid sequence of the Pakistani CYP337B3 seems

to have no impact on its metabolic capacity against pyrethroids compared to the

Australian CYP337B3v1. The heterologous enzyme showed a similar activity towards

the model substrates tested and acts in the same position on cypermethrin as the

Australian CYP337B3v1 acts on fenvalerate resulting in 4'-hydroxycypermethrin

identified as the main metabolite. The formation of the corresponding metabolite could

be explained by the fact that fenvalerate and cypermethrin share the same

phenoxybenzyl alcohol moiety. It is known that larvae of H. virescens and H.

armigera are capable of metabolizing trans-cypermethrin by hydrolysis to trans-3-

(2,2-dichloroethenyl)-2,2-dimethylcyclopropane carboxylic acid and by oxidation to

2'- and 4'-hydroxy-trans-cypermethrin (Lee et al., 1989; Little et al., 1989). Both cis-

and trans-cypermethrin are oxidatively metabolized by mouse liver microsomes

mainly to 4'-hydroxycypermethrin, but also to 5-hydroxycypermethrin and trans-

hydroxymethyl-cypermethrin, that are further oxidized to the corresponding aldehydes

and carboxylic acids (Shono et al., 1979). Carboxylesterases of the gut and the

integument of Trichoplusia ni larvae hydrolyse trans-cypermethrin two- to six-fold

faster than cis-cypermethrin (Ishaaya and Casida, 1980). Current findings support the

observations that cis-isomers of cypermethrin are more sensitive to oxidation than

trans-isomers (Shono et al., 1979) as CYP337B3 is more active on cis-cypermethrin

than on trans-cypermethrin.

Toxicity bioassays including the resistant FSD strain, the resistant TWBR line,

and the susceptible TWBS line revealed a 7- and 6-fold resistance, respectively, for the

resistant larvae vs the susceptible larvae demonstrating similar resistance levels in the

Pakistani strain and the resistant Australian line (Chapter 3). This indicates that the

resistance level observed is most likely due to the metabolic activity of CYP337B3,


107

because the presence of CYP337B3 is the most important difference between the

resistant and the susceptible lines.

Comparison of resistance levels indicates that other mechanisms, including

target-site insensitivity, may be important in other pyrethroid-resistant strains of H.

armigera. The cypermethrin-resistance level observed in the FSD strain is much lower

than that reported by Yang et al., (2004) for the Pakistani field-collected strain PAK of

H. armigera (RF: 4,100), by Alvi et al., (2012) for another Pakistani population (RF:

1,949), by Forrester et al., (1993) for an Australian strain (RF: 25) and by Ahmad and

McCaffery, (1999) for a resistant Thai strain (RF: 20) (to trans-cypermethrin). Tan

and McCaffery, (2007) described a 182-fold resistance of the Chinese H. armigera

strain CMR to cypermethrin, a 487-fold resistance to cis-cypermethrin and an 86-fold

resistance to trans-cypermethrin. Because the resistance factor is calculated by the

division of the LD50 of the resistant strain by the LD50 of the susceptible strain, both an

increased LD50 of the resistant strain and a decreased LD50 of the susceptible strain

may lead to an increased resistance factor. A comparison of the LD50 of the Pakistani

FSD (532ng/larva) to the Chinese CMR (310 ng/larva) regarding cypermethrin reveals

that FSD is more resistant than CMR. The RF reported by Tan and McCaffery, (2007)

is higher because they compared the CMR strain to the extremely susceptible Reading

strain, a laboratory strain that was collected more than 20 years ago in South Africa,

possessing a LD50 of 2ng per larva while the susceptible TWBS line possesses a LD50

of 77ng per larva, thus being 39-fold more resistant than Reading. However, the

Pakistani PAK strain exhibits a LD50 of 23,752ng per larva (Yang et al., 2004) and is

thus 45-fold more resistant than the FSD strain. The susceptible laboratory SCD strain

used by Yang et al., (2004), which was originally collected from the Cote D‟Ivoire in

the 1970s and was provided by Bayer Crop Science, possesses a LD50 of 5.8ng per

larva so that it is 13-fold less resistant than the susceptible TWBS line. The resistance

level of FSD can be suppressed by PBO to the resistance level found in TWBS but not

below this level. This indicates that FSD has a basal resistance level similar to TWBS

but is more resistant because of the presence of CYP337B3, and that FSD and TWB

have an additional resistance mechanism compared to Reading and SCD that is not

suppressible by PBO.


108

The AFLP analysis in the backcross of FSD with TWBS did not identify any

further genes in addition to CYP337B3 contributing to the cypermethrin resistance of

the FSD strain (Chapter 3). The phenotype of resistance, and the CYP337B3 gene,

were both mapped to the linkage group homologous to B. mori Chromosome 15, while

expression differences of other P450s were not influenced by this linkage group. This

shows that up-regulation of a P450 gene in a resistant strain does not necessarily prove

its involvement in resistance (as previously pointed out by Brun-Barale et al., (2010)

for African H. armigera). Although rarely attempted, testing for linkage between the

phenotype of resistance and the phenotype of P450 expression level is important. Not

only that this test can rule out involvement of upregulation in resistance (e.g. Grubor

and Heckel, (2007) for CYP6B enzymes in Australian pyrethroid-resistant H.

armigera), it can also confirm the role of upregulation. For example, in the classic

case of P450-mediated insecticide resistance in the housefly, the genetic factor causing

constitutive overexpression of CYP6A1 maps to the same locus determining diazinon

resistance, while the diazinon-metabolizing CYP6A1 itself maps to a different

chromosome (Cariño et al., 1994; Cohen et al., 1994; Sabourault et al., 2001).

Multiple origins of the same insecticide resistance mechanism have been

convincingly documented by recent studies in other organisms. Identical point

mutations in the voltage-gated sodium channel, the primary target of pyrethroid

insecticides, have been found associated with different haplotypes in different

geographical regions, in mosquitoes (Pinto et al., 2007) and in houseflies (Rinkevich

et al., 2012). Similarly, distinctly different haplotype backgrounds have been found to

harbour the same point mutations in an esterase gene conferring organophosphorus

resistance in the sheep blowfly (Newcomb et al., 2005). Such examples are rare,

although not unexpected in cases where a single amino acid substitution can confer

target-site insensitivity, or dramatically alter the substrate specificity of an enzyme.

The background nucleotide substitution rate would be the rate-limiting factor in the

occurrence of such multiple origins. Although in the current study the background rate

of unequal crossing-over was estimated because it is likely to be much lower; attesting

to the powerful selective force of insecticide resistance in bringing these extremely

rare events to the fore. These findings greatly increase the importance of this


109

resistance mechanism, which may play a prominent role in the pyrethroid resistance of

H. armigera worldwide.

After screening different populations of H. armigera across Pakistan, only

CYP337B3 gene was found, indicating that Pakistani strain has evolved the resistance

gene. As there could be more than one resistance mechanisms (cuticular penetration,

target site and metabolic) in H. armigera (Ahmad et al., 1989; Gunning, 2006;

Gunning et al., 1995; Gunning et al., 1991) but CYP337B3 gene (metabolic

resistance), the study underlines the most common resistance mechanism present in all

Pakistani populations of this insect. After finding that parental susceptible genes

(CYP337B1 and CYP337B2) are lacking in indigenous population of H. armigera in

Pakistan, the question arose that where in the world the evolutionary process of

chimeric CYP337B3 gene formation occurred. Genetic divergence and population

genetic structure analysis strongly support that different populations of H. armigera in

Pakistan are conspecific. Although the population structure analysis using SNP

markers showed that there could be two possible ancestors from which current

population of H. armigera derived but still 100% admixed ancestry was found because

no pure inbreed was found and the population structure was low. These results further

authenticate that the H. armigera population found in Pakistan is homozygous and no

significant population substructure with respect to specific geographic region exist.

These results support the presence of only one type of strain (resistant containing

CYP337B3 gene) instead of both resistant and susceptible strain. Thus there is a need

to screen the H. armigera population at global level. The finding that the presence or

absence of CYP337B3 can be easily detected in a population by a simple PCR

screening provides a tool to rapidly distinguish resistant from the susceptible H.

armgira populations in the field.


110

Figure 6.1 Alignment of CYP337B3v1 from Australian and CYP337B3 from

Pakistani Helicoverpa armigera with the CYP337B1 alleles and CYP337B2. For

clarity, only the 21 nucleotides that differ between both CYP337B3 alleles are shown.

There are more SNPs between the alleles of CYP337B1 and CYP337B2, respectively.

Both CYP337B3 alleles are compared to CYP337B2 (blue) at their 5′ ends and to the

CYP337B1 alleles CYP337B1v1/v3 (green) and CYP337B1v4 (red) at their 3′ ends. All

nucleotides of the CYP337B3v1 and CYP337B3, which match the nucleotides of one

of the genes or alleles they are compared to, are highlighted in the respective colour.

Nonsynonymous SNPs are framed. The putative region of the unequal crossing-over

event is highlighted in grey.

RECOMMENDATIONS/ FUTURE WORK

111

Recommendations/ Future Work

As CYP337B3 is mainly responsible for pyrethroid resistance in H. armigera, the

CYP337B1, CYP337B2 and CYP337B3 may be considered as screening markers for

evaluating pyrethroid resistant field population in Pakistan. The characterization of the

CYP337B-subfamily of H. armigera in more depth will help to obtain a suitable tool

for advising farmers regarding the control of pyrethroid-resistant populations. These

goals will be approached by

1. Elucidation of the structure-function relationship of CYP337B3 and its parental

enzyme CYP337B1, and within the CYP337B1 allozymes by site-directed

mutagenesis and docking modeling. To explore the possibility to mutate CYP337B3

by changing one or several amino acids to a CYP337B1-like enzyme so that it loses its

capability of metabolizing cypermethrin.

2. Identification of common structural moieties of pyrethroid favoring cross-

resistance in FSD via detoxification by CYP337B3. To determine which structure

moieties are necessary for pyrethroid insecticides for being metabolized by

CYP337B3 related to cross-resistance of FSD strain.

3. Determination of the geographical distribution of CYP337B3 in field populations

of H. armigera and closely related species (Spodoptera littoralis) in Pakistan. That

CYP337B3 could be detected in field populations of H. armigera and closely related

species in different countries indicate a more common resistance mechanism toward

pyrethroid insecticides and if so what is the allele frequency of this resistance gene and

its sequence variation.

Chapter 7 References

112

Chapter 7

References

Abate, T., Ampofo, J.K.O., 1996. Insect pests of beans in Africa: Their ecology and

management. Annu Rev Entomol 41, 45-73.

Abate , T., van Huis, A., Ampofo, J.K.O., 2000. Pest management strategies in

traditional agriculture: An African perspective. Annu Rev Entomol 45, 631-659.

Achaleke, J., Martin, T., Ghogomu, R.T., Vaissayre, M., Brévault, T., 2009. Esterase-

mediated resistance to pyrethroids in field populations of Helicoverpa armigera

(Lepidoptera: Noctuidae) from Central Africa. Pest Manag Sci 65, 1147-1154.

Agusti, N., De Vicente, M.C., Gabarra, R., 1999. Development of sequence amplified

characterized region (SCAR) markers of Helicoverpa armigera: a new polymerase

chain reaction-based technique for predator gut analysis. Mol Ecol 8, 1467-1474.

Aheer, G.M., Aziz, M.A., Hameed, A., Ali, A., 2009. Evaluation of resistance to

different insecticides in field strains of Helicoverpa armigera (Lepidoptera:

Noctuidae) in Punjab, Pakistan. Entomol Res 39, 159-167.

Ahmad, M., 2004. Potentiation/antagonism of deltamethrin and cypermethrins with

organophosphate insecticides in the cotton bollworm, Helicoverpa armigera

(Lepidoptera: Noctuidae). Pestic Biochem Physiol 80, 31-42.

Ahmad, M., 2007. Insecticide resistance mechanisms and their management in

Helicoverpa armigera (Hubner) a review. J Agric Res 45, 319-335.

Ahmad, M., Arif, I.M., Ahmad, Z., 1995. Monitoring insecticide resistance of

Helicoverpa armigera (Lepidoptera: Noctuidae) in Pakistan. J Econ Entomol 88, 771-

776.

Ahmad, M., Arif, M.I., Attique, M.R., 1997. Pyrethroid resistance of Helicoverpa

armigera (Lepidoptera: Noctuidae) in Pakistan. Bull Entomol Res 87, 343-347.


113

Ahmad, M., Denholm, I., Bromilow, R.H., 2006. Delayed cuticular penetration and

enhanced metabolism of deltamethrin in pyrethroid-resistant strains of Helicoverpa

armigera from China and Pakistan. Pest Manag Sci 62, 805-810.

Ahmad, M., Gladwell, R.T., McCaffery, A.R., 1989. Decreased nerve sensitivity is a

mechanism of resistance in a pyrethroid resistant strain of Heliothis armigera from

Thailand. Pestic Biochem Physiol 35, 165-171.

Ahmad, M., McCaffery, A.R., 1999. Penetration and metabolism of trans-

cypermethrin in a susceptible and a pyrethroid-resistant strain of Helicoverpa

armigera. Pestic Biochem Physiol 65, 6-14.

Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M.,

Trinh, Y.T., Zhang, Q., Urbatsch, I.L., 2009. Structure of P-glycoprotein reveals a

molecular basis for poly-specific drug binding. Science 323, 1718-1722.

Alvi, A.H., Sayyed, A.H., Naeem, M., Ali, M., 2012. Field evolved resistance in

Helicoverpa armigera (Lepidoptera: Noctuidae) to Bacillus thuringiensis toxin

Cry1Ac in Pakistan. PloS One 7, e47309.

Andreev, D., Rocheleau, T., Phillips, T.W., Beeman, R.W., 1994. A PCR diagnostic

for cyclodiene insecticide resistance in the red flour beetle Tribolium castaneum.

Pestic Sci 41, 345-349.

Andrews, M.C., Callaghan, A., Field, L.M., Williamson, M.S., Moores, G.D., 2004.

Identification of mutations conferring insecticide-insensitive AChE in the cotton-

melon aphid, Aphis gossypii Glover. Insect Mol Biol 13, 555-561.

Armes, N.J., Cooter, R.J., 1991. Effects of age and mated status on flight potential of

Helicoverpa armigera (Lepidoptera: Noctuidae). Physiol Entomol 16, 131-144.

Ashfaq, M., Akhtar, S., Khan, A.M., Adamowicz, S.J., Hebert, P.D., 2013. DNA

barcode analysis of butterfly species from Pakistan points towards regional endemism.

Mol Ecol Resour 13, 832-843.


114

Ashfaq, M., Hebert, P.D.N., Mirza, J.H., Khan, A.M., Zafar, Y., Mirza, M.S., 2014.

Analyzing Mosquito (Diptera: Culicidae) Diversity in Pakistan by DNA Barcoding.

PLoS ONE 9, e97268.

Behere, G.T., Tay, W.T., Russell, D.A., Heckel, D.G., Appleton, B.R., Kranthi, K.R.,

Batterham, P., 2007. Mitochondrial DNA analysis of field populations of Helicoverpa

armigera (Lepidoptera: Noctuidae) and of its relationship to Helicoverpa zea. BMC

Evol Biol 7, 117.

Behere, G.T., Tay, W.T., Russell, D.A., Kranthi, K.R., Batterham, P., 2013.

Population genetic structure of the cotton bollworm Helicoverpa armigera (Hübner)

(Lepidoptera: Noctuidae) in India as inferred from EPIC-PCR DNA markers. PLoS

ONE 8, e53448.

Behura, S.K., 2006. Molecular marker systems in insects: current trends and future

avenues. Mol Ecol 15, 3087-3113.

Benson, K.R., 2001. TH Morgan's resistance to the chromosome theory. Nat Rev

Genet 2, 469-474.

Black, I., W. C., Vontas, J.G., 2007. Affordable assays for genotyping single

nucleotide polymorphisms in insects. Insect Mol Biol 16, 377-387.

Bon, M., Hoelmer, K., Coutinot, D., Ramualde, N., 2008. PCR-based, rapid diagnosis

of parasitism of Lygus spp.(Hemiptera: Miridae) by Peristenus relictus (Hymenoptera:

Braconidae). Biocontrol Sci Technol 18, 505-516.

Botstein, D., White, R.L., Skolnick, M., Davis, R.W., 1980. Construction of a genetic

linkage map in man using restriction fragment length polymorphisms. Am J Hum

Genet 32, 314.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72,

248-254.

Brown, T.M., Bryson, P.K., 1992. Selective inhibitors of methyl parathion-resistant

acetylcholinesterase from Heliothis virescens. Pestic Biochem Physiol 44, 155-164.


115

Brun-Barale, A., Bouvier, J.-C., Pauron, D., Bergé, J.-B., Sauphanor, B., 2005.

Involvement of a sodium channel mutation in pyrethroid resistance in Cydia

pomonella L, and development of a diagnostic test. Pest Manag Sci 61, 549-554.

Brun-Barale, A., Héma, O., Martin, T., Suraporn, S., Audant, P., Sezutsu, H.,

Feyereisen, R., 2010. Multiple P450 genes overexpressed in deltamethrin-resistant

strains of Helicoverpa armigera. Pest Manag Sci 66, 900-909.

Buntjer, J., Otsen, M., Nijman, I., Kuiper, M., Lenstra, J., 2002. Phylogeny of bovine

species based on AFLP fingerprinting. Heredity 88, 46-51.

Busvine, J.R., 1971. The biochemical and genetic bases of insecticide resistance. Trop

Pest Manag 17, 135-146.

Butler, D., 2011. Mosquitoes score in chemical war. Nature 275, 19.

Cariño, F.A., Koener, J.F., Plapp Jr, F.W., Feyereisen, R., 1994. Constitutive

overexpression of the cytochrome P450 gene CYP6A1 in a house fly strain with

metabolic resistance to insecticides. Insect Biochem Mol Biol 24, 411-418.

Carvalho, R., Azeredo-Espin, A.M., Torres, T., 2010. Deep sequencing of New World

screw-worm transcripts to discover genes involved in insecticide resistance. BMC

Genomics 11, 695.

Caterino, M.S., Cho, S., Sperling, F.A., 2000. The current state of insect molecular

systematics: a thriving Tower of Babel. Annu Rev Entomol 45, 1-54.

Clarke, T., Ottea, J.A., 1997. Expression and inheritance of target site resistance to

pyrethroids in the tobacco budworm, Heliothis virescens. Pro Belt Cott Confe 2, 1011-

1013.

Cohen, M.B., Keener, J.F., Feyereisen, R., 1994. Structure and chromosomal

localization of CYP6A1, a cytochrome P450-encoding gene from the house fly. Gene

146, 267-272.

Conney, A.H., 2003. Induction of drug-metabolizing enzymes: A path to the discovery

of multiple cytochromes P450. Annu Rev Pharmacol Toxicol 43, 1-30.


116

Cunningham, J.P., West, S.A., Wright, D.J., 1998. Learning in the nectar foraging

behaviour of Helicoverpa armigera. Ecol Entomol 23, 363-369.

Cunningham, J.P., Zalucki, M.P., 2014. Understanding Heliothine (Lepidoptera:

Heliothinae) Pests: What is a Host Plant? J Econ Entomol 107, 881-896.

Czepak, C., Albernaz, K.C., Vivan, L.M., Guimarães, H.O., Carvalhais, T., 2013. First

reported occurrence of Helicoverpa armigera (Hübner)(Lepidoptera: Noctuidae) in

Brazil. Pesqui Agropecu Trop 43, 110-113.

Daly, J.C., Fisk, J.H., 1992. Inheritance of metabolic resistance to the synthetic

pyrethroids in Australian Helicoverpa armigera (Lepidoptera: Noctuidae). Bull

Entomol Res 82, 5-12.

Daly, J.C., Gregg, P., 1985. Genetic variation in Heliothis in Australia: species

identification and gene flow in the two pest species H. armigera (Hübner) and H.

punctigera Wallengren (Lepidoptera: Noctuidae). Bull Entomol Res 75, 169-184.

Davies, L., Williams, D.R., Aguiar-Santana, I.A., Pedersen, J., Turner, P.C., Rees,

H.H., 2006. Expression and down-regulation of cytochrome P450 genes of the CYP4

family by ecdysteroid agonists in Spodoptera littoralis and Drosophila melanogaster.

Insect Biochem Mol Biol 36, 801-807.

Davies, T.G.E., Field, L.M., Usherwood, P.N.R., Williamson, M.S., 2007. DDT,

pyrethrins, pyrethroids and insect sodium channels. IUBMB Life 59, 151-162.

De Marchi, M., Dalvit, C., Targhetta, C., Cassandro, M., 2006. Assessing genetic

diversity in indigenous Veneto chicken breeds using AFLP markers. Anim Genet 37,

101-105.

Dear, P.H., 2001. Genome Mapping. John Wiley & Sons, Ltd.

Devine, G., 2009. Global pesticide resistance in Arthropods. Entomol Exp Appl 131,

106-106.

Duangkaew, P., Pethuan, S., Kaewpa, D., Boonsuepsakul, S., Sarapusit, S.,

Rongnoparut, P., 2011. Characterization of mosquito CYP6P7 and CYP6AA3:


117

differences in substrate preference and kinetic properties. Arch Insect Biochem

Physiol 76, 236-248.

Eilenberg, J., 2002. Biology of fungi from the order Entomophthorales: with emphasis

on the genera Entomophthora, Strongwellsea and Eryniopsis : a contribution to insect

pathology and biological control. The Royal Veterinary and Agricultural University,

Department of Ecology.

Ellegren, H., 2004. Microsatellites: simple sequences with complex evolution. Nat

Rev Genet 5, 435-445.

Enayati, A.A., Ranson, H., Hemingway, J., 2005. Insect glutathione transferases and

insecticide resistance. Insect Mol Biol 14, 3-8.

Endersby, N., Hoffmann, A., McKechnie, S., Weeks, A., 2007. Is there genetic

structure in populations of Helicoverpa armigera from Australia? Entomol Exp Appl

122, 253-263.

Ensley, S., 2007. Pyrethrins and pyrethroids, in: Ramesh, C.G. (Ed.), Veterinary

toxicology. Academic Press, Oxford, pp. 494-498.

Excoffier, L., Lischer, H.E., 2010. Arlequin suite ver 3.5: a new series of programs to

perform population genetics analyses under Linux and Windows. Molecular ecology

resources 10, 564-567.

Falush, D., Stephens, M., Pritchard, J.K., 2007. Inference of population structure using

multilocus genotype data: dominant markers and null alleles. Mol Ecol Notes 7, 574-

578.

Faria, M.R.d., Wraight, S.P., 2007. Mycoinsecticides and Mycoacaricides: A

comprehensive list with worldwide coverage and international classification of

formulation types. Biol Control 43, 237-256.

Farrow, R., Daly, J., 1987. Long-range movements as an adaptive strategy in the genus

Heliothis (Lepidoptera, Noctuidae)-a review of its occurrence and detection in 4 pest

species. Aust J Zool 35, 1-24.


118

Ferré, J., Van Rie, J., 2002. Biochemistry and genetics of insect resistance to Bacillus

thuringiensis. Annu Rev Entomol 47, 501-533.

Feyereisen, R., 1999. Insects P450 enzymes. Annu Rev Entomol 44, 507-533.

Feyereisen, R., 2005. Insect Cytochrome P450, in: Lawrence, I.G., Kostas, I., Sarjeet,

S.G. (Eds.), Comprehensive Molecular Insect Science. Elsevier, Amsterdam, pp. 1-77.

Feyereisen, R., 2006. Evolution of insect P450. Biochem Soc Trans 36, 1252-1255.

Feyereisen, R., 2012. Insect CYP genes and P450 enzymes. Insect Mol Biol Biochem,

236-316.

Ffrench-Constant, R., H. , Daborn, P.J., Goff, G.L., 2004. The genetics and genomics

of insecticide resistance. Trends Genet 20, 163-170.

Ffrench-Constant, R.H., 2007. Which came first: insecticides or resistance? Trends

Genet 23, 1-4.

Fisk, J.H., 1989. Karyotype and achiasmatic female meiosis in Helicoverpa armigera

(Hübner) and H. punctigera (Wallengren)(Lepidoptera: Noctuidae). Genome 32, 967-

971.

Fitt, G.P., 1989. The ecology of Heliothis species in relation to agroecosystems. Annu

Rev Entomol 34, 17-53.

Fitt, G.P., 1994. Cotton pest management: Part 3. An Australian perspective. Annu

Rev Entomol 39, 543-562.

Forrester, N.W., Cahill, M., Bird, L.J., Layland, J.K., 1993. Management of pyrethroid

and endosulfan resistance in Helicoverpa armigera (Lepidoptera: Noctuidae) in

Australia. Bulletin of Entomological Research: Supplement Series, 132.

Galtier, N., Nabholz, B., Glémin, S., Hurst, G., 2009. Mitochondrial DNA as a marker

of molecular diversity: a reappraisal. Mol Ecol 18, 4541-4550.


119

Gaudreau, C., Larue, B., Charpentier, G., 2010. Molecular comparison of Quebec and

Newfoundland populations of the blackfly, Simulium vittatum, species complex. Med

Vet Entomol 24, 214-217.

Ghulam, H.M., 2007. Review of the current status of insecticide resistance in insect

pests of cotton and their management. Pak J Bot 39, 2699-2703.

Gill, S.S., Cowles, E.A., Pietrantonio, P.V., 1992. The mode of action of Bacillus

thuringiensis endotoxins. Annu Rev Entomol 37, 615-634.

Gissi, C., Iannelli, F., Pesole, G., 2008. Evolution of the mitochondrial genome of

Metazoa as exemplified by comparison of congeneric species. Heredity 101, 301-320.

Goldstein, H., 1991. Multilevel modelling of survey data. The Statistician, 235-244.

Gould, F., Estock, M., Hillier, N.K., Powell, B., Groot, A.T., Ward, C.M., Emerson,

J.L., Schal, C., Vickers, N.J., 2010. Sexual isolation of male moths explained by a

single pheromone response QTL containing four receptor genes. Proc Natl Acad Sci

107, 8660-8665.

Grubor, V.D., Heckel, D.G., 2007. Evaluation of the role of CYP6B cytochrome

P450s in pyrethroid resistant Australian Helicoverpa armigera. Insect Mol Biol 16,

15-23.

Guengerich, F.P., 2007. Cytochrome P450 and chemical toxicology. Chem Res

Toxicol 21, 70-83.

Gujar, G., Kumari, A., Kalia, V., Chandrashekar, K., 2000. Spatial and temporal

variation in susceptibility of the American bollworm, Helicoverpa armigera (Hübner)

to Bacillus thuringiensis var. kurstaki in India. Curr Sci 78, 995-1001.

Gunning, R., 2006. Inhibition of carbamate-insensitive acetylcholinesterase by

piperonyl butoxide in Helicoverpa armigera. J Mol Neurosci 30, 21-22.

Gunning, R.V., 1996. Bioassay for detecting pyrethroid nerve insensitivity in

Australian Helicoverpa armigera (Lepidoptera: Noctuidae). J Econ Entomol 89, 816-

819.


120

Gunning, R.V., Dang, H.T., Kemp, F.C., Nicholson, I.C., Moores, G.D., 2005. New

resistance mechanism in Helicoverpa armigera threatens transgenic crops expressing

Bacillus thuringiensis Cry1Ac Toxin. Appl Environ Microbiol 71, 2558-2563.

Gunning, R.V., Devonshire, A.L., Moores, G.D., 1995. Metabolism of esfenvalerate

by pyrethroid-susceptible and -resistant Australian Helicoverpa armigera

(Lepidoptera: Noctuidae). Pestic Biochem Physiol 51, 205-213.

Gunning, R.V., Easton, C.S., Balfe, M.E., Ferris, I.G., 1991. Pyrethroid resistance

mechanisms in Australian Helicoverpa armigera. Pestic Sci 33, 473-490.

Gunning, R.V., Moores, G.D., Devonshire, A.L., 1998. Insensitive

acetylcholinesterase causes resistance to organophosphates in Australian Helicoverpa

armigera (Hübner) (Lepidoptera: Noctuidae). Pestic Sci 54, 319-320.

Gunning, R.V., Moores, G.D., Devonshire, A.L., 1999. Esterase inhibitors synergise

the toxicity of pyrethroids in Australian Helicoverpa armigera (Hübner) (Lepidoptera:

Noctuidae). Pestic Biochem Physiol 63, 50-62.

Gunning, R.V., Moores, G.D., Jewess, P., Boyes, A.L., Devonshire, A.L., Khambay,

B.P.S., 2007. Use of pyrethroid analogues to identify key structural features for

enhanced esterase resistance in Helicoverpa armigera (Hübner) (Lepidoptera:

Noctuidae). Pest Manag Sci 63, 569-575.

Gupta, R.C., Milatovic, D., 2012. Organophosphates and carbamates, Veterinary

Toxicology, 2nd ed. Academic Press, Boston, pp. 573-585.

Hardwick, D.F., 1970. A generic revision of the North American heliothidinae

(Lepidoptera: Noctuidae). Mem Entomol Soc Can 102, 5-59.

Hastings, J.M., Schultheis, P.J., Whitson, M., Holliday, C.W., Coelho, J.R., Mendell,

A.M., 2008. DNA barcoding of new world cicada killers (Hymenoptera: Crabronidae).

Zootax, 27-38.

Hawthorne, D.J., 2001. AFLP-based genetic linkage map of the Colorado potato beetle

Leptinotarsa decemlineata: sex chromosomes and a pyrethroid-resistance candidate

gene. Genetics 158, 695-700.


121

Hebert, P.D., Cywinska, A., Ball, S.L., 2003. Biological identifications through DNA

barcodes. Proc R Soc Lond 270, 313-321.

Hebert, P.D., Gregory, T.R., 2005. The promise of DNA barcoding for taxonomy. Syst

Biol 54, 852-859.

Hebert, P.D., Penton, E.H., Burns, J.M., Janzen, D.H., Hallwachs, W., 2004. Ten

species in one: DNA barcoding reveals cryptic species in the neotropical skipper

butterfly Astraptes fulgerator. Proc Natl Acad Sci U S A 101, 14812-14817.

Heckel, D.G., 2003. Genomics in pure and applied entomology. Annu Rev Entomol

48, 235-260.

Heckel, D.G., 2012. Insecticide resistance after silent spring. Science 337, 1612-1614.

Heckel, D.G., Gahan, L.J., Daly, J.C., Trowell, S., 1998. A genomic approach to

understanding Heliothis and Helicoverpa resistance to chemical and biological

insecticides. Philos Trans R Soc Lond B Biol Sci 353, 1713-1722.

Heckel, D.G., Gahan, L.J., Gould, F., Daly, J.C., Trowell, S., 1997. Genetics of

Heliothis and Helicoverpa resistance to chemical insecticides and to Bacillus

thuringiensis. Pestic Sci 51, 251-258.

Heckel, D.G., Gahan, L.J., Liu, Y.-B., Tabashnik, B.E., 1999. Genetic mapping of

resistance to Bacillus thuringiensis toxins in diamondback moth using biphasic linkage

analysis. Proc Natl Acad Sci 96, 8373-8377.

Hemingway, J., Hawkes, N.J., McCarroll, L., Ranson, H., 2004. The molecular basis

of insecticide resistance in mosquitoes. Insect Biochem Mol Biol 34, 653-665.

Hill, D.S., 1997a. Beneficial insects, The economic importance of insects. Springer

Netherlands, pp. 7-50.

Hill, D.S., 1997b. Harmful Insects, The economic importance of insects. Springer



122

Hodgson, E., Levi, P.E., Denys Glynne, J., 1999. Interactions of Piperonyl butoxide

with cytochrome P450, Piperonyl butoxide. Academic Press, London, pp. 41-II.

Höfte, H., Whiteley, H.R., 1989. Insecticidal crystal proteins of Bacillus thuringiensis.

Microbiol Rev 53, 242-255.

Hoy, M.A., 2003. Molecular systematics and evolution of Arthropods, Insect

Molecular Genetics, 2nd ed. Academic Press, Burlington, pp. 350-399.

Huang, J., Rozelle, S., Pray, C., Wang, Q., 2002. Plant biotechnology in China.

Science 295, 674-676.

Huber, J., 1986. Use of baculoviruses in pest management programs, The biology of

baculoviruses. CRC press, Boca Raton, pp. 181-202.

Ikawa, T., Okabe, H., Hoshizaki, S., Suzuki, Y., Fuchi, T., Cheng, L., 2002. Species

composition and distribution of ocean skaters Holobates (Hemiptera: Gerridae) in the

western Pacific Ocean. Entomol Sci 5, 1-6.

IRAC, 2013. Resistance definition: In Resistance management for sustainable

agriculture and improved public health, pp. Accessed: 31 March, 2014.

Ishaaya, I., Casida, J.E., 1980. Properties and toxicological significance of esterases

hydrolyzing permethrin and cypermethrin in trichoplusia ni larval gut and integument.

Pestic Biochem Physiol 14, 178-184.

Ivanova, N.V., Dewaard, J.R., Hebert, P.D.N., 2006. An inexpensive, automation-

friendly protocol for recovering high-quality DNA. Mol Ecol Notes 6, 998-1002.

Jain, S.K., Neekhra, B., Pandey, D., Jain, K., 2010. RAPD marker system in insect

study: A review. Indian J. Biotechnol. 9, 7-12.

James, C., 2012. Global status of commercialized biotech/GM crops: 2012. ISAAA

Brief No. 44. ISAAA: Ithaca, NY.


123

Jenkins, T.M., Dean, R.E., Forschler, B.T., 2002. DNA technology, interstate

commerce, and the likely origin of Formosan subterranean termite (Isoptera:

Rhinotermitidae) infestation in Atlanta, Georgia. J Econ Entomol 95, 381-389.

Jenkins, T.M., Dean, R.E., Verkerk, R., Forschler, B.T., 2001. Phylogenetic analyses

of two mitochondrial genes and one nuclear intron region illuminate European

subterranean termite (Isoptera: Rhinotermitidae) gene flow, taxonomy, and

introduction dynamics. Mol Phylogenet Evol 20, 286-293.

Ji, Y.J., Zhang, D.X., Hewitt, G.M., Kang, L., Li, D.M., 2003. Polymorphic

microsatellite loci for the cotton bollworm Helicoverpa armigera (Lepidoptera:

Noctuidae) and some remarks on their isolation. Mol Ecol Notes 3, 102-104.

Jonah, P., Bello, L., Lucky, O., Midau, A., Moruppa, S., 2011. Review: The

importance of molecular markers in plant breeding programmes. Glob J Sci Front Res

11.

Joussen, N., Agnolet, S., Lorenz, S., Schoene, S.E., Ellinger, R., Schneider, B.,

Heckel, D.G., 2012. Resistance of Australian Helicoverpa armigera to fenvalerate is

due to the chimeric P450 enzyme CYP337B3. Proc Natl Acad Sci 109, 15206-15211.

Kaiser, T.S., Heckel, D.G., 2012. Genetic Architecture of Local Adaptation in Lunar

and Diurnal Emergence Times of the Marine Midge Clunio marinus (Chironomidae,

Diptera). PloS one 7, e32092.

Kimura, M., 1980. A simple method for estimating evolutionary rates of base

substitutions through comparative studies of nucleotide sequences. J Mol Evol 16,

111-120.

King, A.B.S., 1994. Heliothis/Helicoverpa (Lepidoptera: Noctuidae), Insect pests of

cotton. CAB International, Wallingford, U.K., pp. 39-106.

Kranthi, K.R., Armes, N.J., Rao, N.G.V., Raj, S., Sundaramurthy, V.T., 1997.

Seasonal dynamics of metabolic mechanisms mediating pyrethroid resistance in

Helicoverpa armigera in central India. Pestic Sci 50, 91-98.


124

Kranthi, K.R., Jadhav, D., Wanjari, R., Kranthi, S., Russell, D., 2001. Pyrethroid

resistance and mechanisms of resistance in field strains of Helicoverpa armigera

(Lepidoptera: Noctuidae). J Econ Entomol 94, 253-263.

Lee, K.S., Walker, C.H., McCaffery, A., Ahmad, M., Little, E., 1989. Metabolism of

trans-cypermethrin by Heliothis armigera and H. virescens. Pestic Biochem Physiol

34, 49-57.

Leniaud, L., Dedeine, F., Pichon, A., Dupont, S., Bagnères, A.-G., 2010. Geographical

distribution, genetic diversity and social organization of a new European termite,

Reticulitermes urbis (Isoptera: Rhinotermitidae). Biol Invasions 12, 1389-1402.

Li, H.B., Wu, K.M., Yang, X.R., 2006. Trend of occurrence of cotton bollworm and

control efficacy of Bt cotton in cotton planting region of Southern Xinjiang. Chin Agri

Sci 39, 199-205.

Li, Q., Li, D., Ye, H., Liu, X., Shi, W., Cao, N., Duan, Y., 2011. Using COI gene

sequence to barcode two morphologically alike species: the cotton bollworm and the

oriental tobacco budworm (Lepidoptera: Noctuidae). Mol Biol Rep 38, 5107-5113.

Li, X., Schuler, M.A., Berenbaum, M.R., 2007. Molecular mechanisms of metabolic

resistance to synthetic and natural xenobiotics. Annu Rev Entomol 52, 231-253.

Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics 25, 1451-1452.

Little, E.J., McCaffery, A.R., Walker, C.H., Parker, T., 1989. Evidence for an

enhanced metabolism of cypermethrin by a monooxygenase in a pyrethroid-resistant

strain of the tobacco budworm (Heliothis virescens F.). Pestic Biochem Physiol 34,

58-68.

Liu, N., 2012. Pyrethroid resistance in insects: Genes, mechanisms, and regulation., in:

Perveen, F. (Ed.), Insecticides - advances in integrated pest management. CBS

Publishers & Distributors Pvt. Ltd., pp. 257-468.

Lu, Y., Wu, K., Jiang, Y., Guo, Y., Desneux, N., 2012. Widespread adoption of Bt

cotton and insecticide decrease promotes biocontrol services. Nature 487, 362-365.


125

Mao, W., Schuler, M.A., Berenbaum, M.R., 2011. CYP9Q-mediated detoxification of

acaricides in the honey bee (Apis mellifera). Proc Natl Acad Sci 108, 12657-12662.

Marinotti, O., Nguyen, Q.K., Calvo, E., James, A.A., Ribeiro, J.M.C., 2005.

Microarray analysis of genes showing variable expression following a blood meal in

Anopheles gambiae. Insect Mol Biol 14, 365-373.

Martin, T., Ochou, G.O., Djihinto, A., Traore, D., Togola, M., Vassal, J.M., Vaissayre,

M., Fournier, D., 2005. Controlling an insecticide-resistant bollworm in West Africa.

Agric Ecosyst Environ 107, 409-411.

Mastrangelo, T., Paulo, D.F., Bergamo, L.W., Morais, E.G.F., Silva, M., Bezerra-

Silva, G., Azeredo-Espin, A.M.L., 2014. Detection and genetic diversity of a

Heliothine invader (Lepidoptera: Noctuidae) from North and Northeast of Brazil. J

Econ Entomol 107, 970-980.

McCaffery, A.R., 1998. Resistance to insecticides in Heliothine Lepidoptera: a global

view. Philos Trans R Soc Lond B Biol Sci 353, 1735-1750.

Melander, A.L., 1914. Can Insects Become Resistant to Sprays? J Econ Entomol 7,

167-173.

Metcalf, R.L., 2000. Insect control, Ullmann's encyclopedia of industrial chemistry.

Wiley-VCH Verlag GmbH & Co. KGaA.

Ming, Q., Wang, C., 2006. Genetic differentiation of Helicoverpa armigera (Hübner)

and H. assulta (Guene) (Lepidoptera: Noctuidae) based on AFLP markers. Insect Sci

13, 437-444.

Mitter, C., Poole, R.W., Matthews, M., 1993. Biosystematics of the Heliothinae

(Lepidoptera: Noctuidae). Annu Rev Entomol 38, 207-225.

Mora, C., Tittensor, D.P., Adl, S., Simpson, A.G.B., Worm, B., 2011. How many

species are there on earth and in the ocean? PLoS Biol 9, e1001127.

Morgan, E.T., 2001. Regulation of cytochrome P450 by inflammatory mediators: why

and how? Drug Metab Dispos 29, 207-212.


126

Moscardi, F., 1999. Assessment of the application of Baculoviruses for control of

lepidoptera. Annu Rev Entomol 44, 257-289.

Mullin, C., A., Scott, J., G., 1992. Biomolecular basis for insecticide resistance,

Molecular mechanisms of insecticide resistance. American Chemical Society, pp. 1-

13.

Nelson, D.R., 2009. The cytochrome p450 homepage. Hum Genomics 4, 59-65.

Nelson, D.R., Koymans, L., Kamataki, T., Stegeman, J.J., Feyereisen, R., Waxman,

D.J., Waterman, M.R., Gotoh, O., Coon, M.J., Estabrook, R.W., Gunsalus, I.C.,

Nebert, D.W., 1996. P450 superfamily: update on new sequences, gene mapping,

accession numbers and nomenclature. Pharmacogenetics 6, 1-42.

Newcomb, R., D, Gleeson, D., M, Yong, C., G, Russell, R., J, Oakeshott, J., G, 2005.

Multiple mutations and gene duplications conferring organophosphorus insecticide

resistance have been selected at the Rop-1 locus of the sheep blowfly, Lucilia cuprina.

J Mol Evol 60, 207-220.

Nibouche, S., Buès, R., Toubon, J.-F., Poitout, S., 1998. Allozyme polymorphism in

the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae): comparison of

African and European populations. Heredity 80, 438-445.

Orr, H.A., 1998. The population genetics of adaptation: the distribution of factors

fixed during adaptive evolution. Evolution, 935-949.

Pinto, J., Lynd, A., Vicente, J.L., Santolamazza, F., Randle, N.P., Gentile, G., Moreno,

M., Simard, F., Charlwood, J.D., do Rosário, V.E., Caccone, A., della Torre, A.,

Donnelly, M.J., 2007. Multiple origins of knockdown resistance mutations in the

afrotropical mosquito vector Anopheles gambiae. PLoS ONE 2, e1243.

Pittendrigh, B., Aronstein, K., Zinkovsky, E., Andreev, O., Campbell, B., Daly, J.,

Trowell, S., Ffrench-Constant, R.H., 1997. Cytochrome P450 genes from Helicoverpa

armigera: Expression in a pyrethroid-susceptible and -resistant strain. Insect Biochem

Mol Biol 27, 507-512.


127

Pittendrigh, B.R., Margam, V.M., Sun, L., Huesing, J.E., 2007. Resistance in the Post-

Genomics Age. Insect Resistance Management, 39-68.

Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of population structure

using multilocus genotype data. Genetics 155, 945-959.

Ramadan, H.A., Baeshen, N.A., 2012. Biological identifications through DNA

barcodes, in: Lameed, b.A. (Ed.), Biodiversity conservation and utilization in a diverse

world. InTech, Janeza Trdine, Rijeka, Croatia.

Ranasinghe, C., Campbell, B., Hobbs, A.A., 1998. Over-expression of cytochrome

P450 CYP6B7 mRNA and pyrethroid resistance in Australian populations of

Helicoverpa armigera (Hübner). Pestic Sci 54, 195-202.

Ranasinghe, C., Hobbs, A.A., 1998. Isolation and characterization of two cytochrome

P450 cDNA clones for CYP6B6 and CYP6B7 from Helicoverpa armigera (Hubner):

possible involvement of CYP6B7 in pyrethroid resistance. Insect Biochem Mol Biol

28, 571-580.

Ranasinghe, C., Hobbs, A.A., 1999. Induction of cytochrome P450 CYP6B7 and

cytochrome b5 mRNAs from Helicoverpa armigera (Hubner) by pyrethroid

insecticides in organ culture. Insect Mol Biol 8, 443-447.

Ratnasingham, S., Hebert, P.D.N., 2007. bold: The barcode of life data system

(http://www.barcodinglife.org). Mol Ecol Notes 7, 355-364.

Raymond, M., Berticat, C., Weill, M., Pasteur, N., Chevillon, C., 2002. Insecticide

resistance in the mosquito Culex pipiens: What have we learned about adaptation?,

Microevolution Rate, Pattern, Process. Springer Netherlands, pp. 287-296.

Reed, W., 1965. Heliothis armigera (Hb.) (Noctuidae) in Western Tanganyika.

Biology, with special reference to the pupal stage. Bull Entomol Res 56, 117-125.

Richardson, B.J., Baverstock, P.R., Adams, M., 1986. Allozyme Electrophoresis, A

Handbook for Animal Systematics and Population Studies. Academic Press.

http://www.barcodinglife.org)/


128

Riddick, D.S., Lee, C., Bhathena, A., Timsit, Y.E., Cheng, P.-Y., Morgan, E.T.,

Prough, R.A., Ripp, S.L., Miller, K.K.M., Jahan, A., Chiang, J.Y.L., 2004.

Transcriptional suppression of cytochrome P450 genes by endogenous and exogenous

chemical. Drug Metab Dispos 32, 367-375.

Rinkevich, F.D., Hedtke, S.M., Leichter, C.A., Harris, S.A., Su, C., Brady, S.G.,

Taskin, V., Qiu, X., Scott, J.G., 2012. Multiple origins of kdr-type resistance in the

house fly, Musca domestica. PLoS ONE 7, e52761.

Roberts, D.M., Dissanayake, W., Rezvi Sheriff, M.H., Eddleston, M., 2004.

Refractory status epilepticus following self-poisoning with the organochlorine

pesticide endosulfan. J Clin Neurosci 11, 760-762.

Roberts, R.J., Vincze, T., Posfai, J., Macelis, D., 2007. REBASE--enzymes and genes

for DNA restriction and modification. Nucleic Acids Res 35, 269-270.

Robinson, R., 1971. Lepidoptera genetics. Cambridge Univ Press.

Rochester, W.A., Dillon, M.L., Fitt, G.P., Zalucki, M.P., 1996. A simulation model of

the long-distance migration of Helicoverpa spp. moths. Ecol Model 86, 151-156.

Rubinoff, D., Cameron, S., Will, K., 2006. A genomic perspective on the

shortcomings of mitochondrial DNA for “barcoding” identification. J Hered 97, 581-

594.

Rung, A., Scheffer, S., Evans, G., Miller, D., 2008. Molecular identification of two

closely related species of mealybugs of the genus Planococcus (Homoptera:

Pseudococcidae). Ann Entomol Soc Am 101, 525-532.

Russell, D., Kranthi, K., 2006. Insecticide resistant in cotton bollworm (H. armigera),

Cotton bollworm control in small-scale cotton production systems, pp. 40-58.

Sabourault, C., Guzov, V.M., Koener, J.F., Claudianos, C., Plapp, F.W., Feyereisen,

R., 2001. Overproduction of a P450 that metabolizes diazinon is linked to a loss-of-

function in the chromosome 2 ali-esterase (MdαE7) gene in resistant house flies. Insect

Mol Biol 10, 609-618.


129

Sahara, K., Yoshido, A., Shibata, F., Fujikawa, N., Okabe, T., Tanaka-Okuyama, M.,

Yasukochi, Y., 2013. FISH identification of Helicoverpa armigera and Mamestra

brassicae chromosomes by BAC and fosmid probes. Insect Biochem Mol Biol 43,

644-653.

Schloetterer, C., 2001. Genealogical inference of closely related species based on

microsatellites. Genet Res 78, 209-212.

Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler,

D.R., Dean, D.H., 1998. Bacillus thuringiensis and Its pesticidal crystal proteins.

Microbiol Mol Biol Rev 62, 775-806.

Scott, J.G., 1999. Cytochromes P450 and insecticide resistance. Insect Biochem Mol

Biol 29, 757-777.

Scott, J.G., 2008. Insect cytochrome P450s: Thinking beyond detoxification. In recent

advances in insect physiology, toxicology and molecular biology. Toxicol Mol Biol,

117-124

Scott, K., Wilkinson, K., Lawrence, N., Lange, C., Scott, L., Merritt, M., Lowe, A.,

Graham, G., 2005a. Gene-flow between populations of cotton bollworm Helicoverpa

armigera (Lepidoptera: Noctuidae) is highly variable between years. Bull Entomol

Res 95, 381.

Scott, K.D., Lawrence, N., Lange, C.L., Scott, L.J., Wilkinson, K.S., Merritt, M.A.,

Miles, M., Murray, D., Graham, G.C., 2005b. Assessing moth migration and

population structuring in Helicoverpa armigera (Lepidoptera: Noctuidae) at the

regional scale: example from the Darling Downs, Australia. J Econ Entomol 98, 2210-

2219.

Scott, L.J., Lawrence, N., Lange, C.L., Graham, G.C., Hardwick, S., Rossiter, L.,

Dillon, M.L., Scott, K.D., 2006. Population dynamics and gene flow of Helicoverpa

armigera (Lepidoptera: Noctuidae) on cotton and grain crops in the Murrumbidgee

Valley, Australia. J Econ Entomol 99, 155-163.


130

Seifert, J., Scott, J.G., 2002. The CYP6D1v1 allele is associated with pyrethroid

resistance in the house fly, Musca domestica. Pestic Biochem Physiol 72, 40-44.

Selkoe, K.A., Toonen, R.J., 2006. Microsatellites for ecologists: a practical guide to

using and evaluating microsatellite markers. Ecol Lett 9, 615-629.

Semagn, K., Bjornstad, A., Ndjiondjop, M., 2006. An overview of molecular marker

methods for plants. Afr J Biotechnol 5.

Severson, D., 1996. RFLP analysis of insect genomes, in: Crampton, J., Beard, C.B.,

Louis, C. (Eds.), The Molecular Biology of Insect Disease Vectors. Springer


Shah, P.A., Pell, J.K., 2003. Entomopathogenic fungi as biological control agents.

Appl Microbiol Biotechnol 61, 413-423.

Shanower, T., Romeis, J., Minja, E., 1999. Insect pests of pigeonpea and their

management. Annu Rev Entomol 44, 77-96.

Sharif, M.M., Hejazi, M.J., Mohammadi, A., Rashidi, M.R., 2007. Resistance status of

the Colorado potato beetle, Leptinotarsa decemlineata, to endosulfan in East

Azarbaijan and Ardabil provinces of Iran. J Insect Sci 7, 1-7.

Sharma, H.C., 2005. Heliothis/Helicoverpa management, in: Sharma, H.C. (Ed.),

Emerging trends and strategies for future research. Oxford & IBH Publishing Co. Pvt.

Ltd, New Dehli, India.

Sheck, A., Groot, A., Ward, C., Gemeno, C., Wang, J., Brownie, C., Schal, C., Gould,

F., 2006. Genetics of sex pheromone blend differences between Heliothis virescens

and Heliothis subflexa: a chromosome mapping approach. J Evol Biol 19, 600-617.

Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. Structure, function and

evolution of glutathione transferases: implications for classification of non-

mammalian members of an ancient enzyme superfamily. Biochem J 360, 1-16.


131

Shono, T., Ohsawa, K., Casida, J.E., 1979. Metabolism of trans- and cis-permethrin,

trans- and cis-cypermethrin, and decamethrin by microsomal enzymes. J Agri Food

Chem 27, 316-325.

Sparks, T.C., Lockwood, J.A., Byford, R.L., Graves, J.B., Leonard, B.R., 1989. The

role of behavior in insecticide resistance. Pestic Sci 26, 383-399.

Speight, M.R., Hunter, M.D., Watt, A.D., 1999. Ecology of insects: concepts and

applications. Blackwell Science Ltd.

Steichen, J., Rocheleau, T., Aronstein, K., Roush, R., 1993. A single-amino acid

substitution in a gamma-aminobutyric acid subtype A receptor locus is associated with

cyclodiene insecticide resistance in Drosophila populations. Proc Natl Acad Sci 90,

1957-1961.

Stokes, N.H., Mckechnie, S.W., Forrester, N.W., 1997. Multiple allelic variation in a

sodium channel gene from populations of australian Helicoverpa armigera

(Hübner)(Lepidoptera: Noctuidae) detected via temperature gradient gel

electrophoresis. Aust J Entomol 36, 191-196.

Strutzenberger, P., Brehm, G., Fiedler, K., 2011. DNA barcoding-based species

delimitation increases species count of Eois (Geometridae) moths in a well-studied

tropical mountain forest by up to 50%. Insect Science 18, 349-362.

Sturtevant, A.H., 1913. The linear arrangement of six sex-linked factors in Drosophila,

as shown by their mode of association. J Exp Zool 14, 43-59.

Suomalainen, E., Cook, L.M., Turner, J.R., 1973. Achiasmatic oogenesis in the

heliconiine butterflies. Hereditas 74, 302-304.

Symondson, W., 2002. Molecular identification of prey in predator diets. Mol Ecol 11,

627-641.

Syvanen, A., 2001. Accessing genetic variation: genotyping single nucleotide

polymorphisms. Nat Rev Genet 2, 930-942.


132

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011.

MEGA5: molecular evolutionary genetics analysis using maximum likelihood,

evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28, 2731-

2739.

Tan, J., McCaffery, A.R., 2007. Efficacy of various pyrethroid structures against a

highly metabolically resistant isogenic strain of Helicoverpa armigera (Lepidoptera:

Noctuidae) from China. Pest Manag Sci 63, 960-968.

Tay, W., Behere, G., Heckel, D., Lee, S., Batterham, P., 2008. Exon-primed intron-

crossing (EPIC) PCR markers of Helicoverpa armigera (Lepidoptera: Noctuidae).

Bull Entomol Res 98, 509-518.

Tay, W.T., Behere, G.T., Batterham, P., Heckel, D.G., 2010. Generation of

microsatellite repeat families by RTE retrotransposons in lepidopteran genomes. BMC

Evol Biol 10, 144.

Teacher, A., Griffiths, D., 2011. HapStar: automated haplotype network layout and

visualization. Mol Ecol Resour 11, 151-153.

Thacker, J.R.M., 2002. Modern synthetic insecticides. , In an introduction to arthropod

pest control Cambridge Unversity Press, pp. 50-79.

Tijet, N., Helvig, C., Feyereisen, R., 2001. The cytochrome P450 gene superfamily in

Drosophila melanogaster: Annotation, intron-exon organization and phylogeny. Gene

262, 189-198.

Torres-Vila, L.M., Rodriguez-Molina, M.C., Lacasa-Plasencia, A., Bielza-Lino, P.,

Rodriguez-del-Rincon, A., 2002. Pyrethroid resistance of Helicoverpa armigera in

Spain: current status and agroecological perspective. Agric Ecosyst Environ 93, 55-66.

Udomsinprasert, R., Pongjaroenkit, S., Wongsantichon, J., Oakley, A.J.,

Prapanthadara, L., Wilce, M.C.J., Ketterman, A.J., 2005. Identification,

characterization and structure of a new delta class glutathione transferase isoenzyme.

Biochem. J. 388, 763-771.


133

Unbehend, M., Hänniger, S., Meagher, R., Heckel, D., Groot, A., 2013. Pheromonal

divergence between two strains of Spodoptera frugiperda. J Chem Ecol 39, 364-376.

Urlacher, V.B., Girhard, M., 2012. Cytochrome P450 monooxygenases: an update on

perspectives for synthetic application. Trends Biotechnol 30, 26-36.

Vassal, J., Brevault, T., Achaleke, J., Menozzi, P., 2008. Genetic structure of the

polyphagous pest Helicoverpa armigera (Lepidoptera: Noctuidae) across the Sub-

Saharan cotton belt. Commun Agric Appl Biol Sci 73, 433.

Venette, R.C., Davis, E.E., Zaspel, J., Heisler, H., Larson, M., 2003. Mini risk

assessment, Old World bollworm, Helicoverpa armigera (Hubner) (Lepidoptera:

Noctuidae), in: Cooperative Agricultural Pest Survey, A.a.P.H.I.S. (Ed.), US

Department of Agriculture.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., van De Lee, T., Hornes, M., Friters, A.,

Pot, J., Paleman, J., Kuiper, M., 1995. AFLP: a new technique for DNA fingerprinting.

Nucleic Acids Res 23, 4407-4414.

Wan, P., Zhang, Y., Wu, K., Huang, M., 2005. Seasonal expression profiles of

insecticidal protein and control efficacy against Helicoverpa armigera for Bt cotton in

the Yangtze River valley of China. J Econ Entomol 98, 195-201.

Ware, G.W., Whitacre, D.M., 2004. An introduction to insecticides, The Pesticide

Book. Meister Publisher Willoughby, Ohio, USA, pp. 1-23.

Wee, C., Lee, S., Robin, C., Heckel, D., 2008. Identification of candidate genes for

fenvalerate resistance in Helicoverpa armigera using cDNA-AFLP. Insect Mol Biol

17, 351-360.

Weetman, D., Wilding, C.S., Steen, K., Morgan, J.C., Simard, F., Donnelly, M.J.,

2010. Association mapping of insecticide resistance in wild Anopheles gambiae

populations: major variants identified in a low-linkage disequilbrium genome. PLoS

One 5, e13140.

Whalon, M.E., Mota-Sanchez, D., Hollingworth, R.M., 2013. Arthropod resistance

data base.


134

Whinnett, A., Zimmermann, M., Willmott, K.R., Herrera, N., Mallarino, R., Simpson,

F., Joron, M., Lamas, G., Mallet, J., 2005. Strikingly variable divergence times

inferred across an Amazonian butterfly „suture zone‟. Pro R Soc Biol Sci 272, 2525-

2533.

Widmer, M., Schofield, P., 1983. Heliothis dispersal and migration. Tropical

Development and Research Institute, London, United Kingdom.

Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990. DNA

polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic

Acids Res 18, 6531-6535.

Willoughby, L., Batterham, P., Daborn, P.J., 2007. Piperonyl butoxide induces the

expression of cytochrome P450 and glutathione S-transferase genes in Drosophila

melanogaster. Pest Manag Sci 63, 803-808.

Wu, K.-M., Lu, Y.-H., Feng, H.-Q., Jiang, Y.-Y., Zhao, J.-Z., 2008. Suppression of

cotton bollworm in multiple crops in China in areas with Bt toxin–containing cotton.

Science 321, 1676-1678.

Wu, K., Guo, Y., Lv, N., Greenplate, J.T., Deaton, R., 2003. Efficacy of transgenic

cotton containing a cry1Ac gene from Bacillus thuringiensis against Helicoverpa

armigera (Lepidoptera: Noctuidae) in Northern China. J Econ Entomol 96, 1322-

1328.

Xiao-Ping, W., Hobbs, A.A., 1995. Isolation and sequence analysis of a cDNA clone

for a pyrethroid inducible cytochrome P450 from Helicoverpa armigera. Insect

Biochem Mol Biol 25, 1001-1009.

Yang, T., Liu, N., 2011. Genome analysis of cytochrome P450s and their expression

profiles in insecticide resistant mosquitoes, Culex quinquefasciatus. PLoS ONE 6,

e29418.

Yang, Y., Chen, S., Wu, S., Yue, L., Wu, Y., 2006. Constitutive overexpression of

multiple cytochrome P450 genes associated with pyrethroid resistance in Helicoverpa

armigera. J Econ Entomol 99, 1784-1789.


135

Yang, Y., Wu, Y., Chen, S., Devine, G.J., Denholm, I., Jewess, P., Moores, G.D.,

2004. The involvement of microsomal oxidases in pyrethroid resistance in

Helicoverpa armigera from Asia. Insect Biochem Mol Biol 34, 763-773.

Yasukochi, Y., Tanaka-Okuyama, M., Shibata, F., Yoshido, A., Marec, F., Wu, C.,

Zhang, H., Goldsmith, M.R., Sahara, K., 2009. Extensive conserved synteny of genes

between the karyotypes of Manduca sexta and Bombyx mori revealed by BAC-FISH

mapping. PLoS One 4, e7465.

Ye, W., Lee, C.-Y., Scheffrahn, R.H., Aleong, J.M., Su, N.-Y., Bennett, G.W., Scharf,

M.E., 2004. Phylogenetic relationships of nearctic Reticulitermes species (Isoptera:

Rhinotermitidae) with particular reference to Reticulitermes arenincola Goellner. Mol

Phylogenet Evol 30, 815-822.

Yoshido, A., Bando, H., Yasukochi, Y., Sahara, K., 2005. The Bombyx mori karyotype

and the assignment of linkage groups. Genetics 170, 675-685.

Young, S.J., Gunning, R.V., Moores, G.D., 2005. The effect of piperonyl butoxide on

pyrethroid resistance associated esterases in Helicoverpa armigera (Hübner)

(Lepidoptera: Noctuidae). Pest Manag Sci 61, 397-401.

Young, S.J., Gunning, R.V., Moores, G.D., 2006. Effect of pretreatment with

piperonyl butoxide on pyrethroid efficacy against insecticide-resistant Helicoverpa

armigera (Lepidoptera: Noctuidae) and Bemisia tabaci (Sternorrhyncha: Aleyrodidae).

Pest Manag Sci 62, 114-119.

Zalucki, M., Daglish, G., Firempong, S., Twine, P., 1986. The biology and ecology of

Heliothis armigera (Hubner) and Heliothis punctigera Wallengren (Lepidoptera,

Noctuidae) in Australia - What do we know. Aust J Zool 34, 779-814.

Zhang, D.-X., 2004. Lepidopteran microsatellite DNA: redundant but promising.

Trends Ecol Evol 19, 507-509.

Zhang, H., Tang, T., Cheng, Y., Shui, R., Zhang, W., Qiu, L., 2010. Cloning and

expression of cytochrome P450 CYP6B7 in fenvalerate-resistant and susceptible

Helicoverpa armigera (Hübner) from China. J Appl Entomol 134, 754-761.


136

Zhang, H., Yin, W., Zhao, J., Jin, L., Yang, Y., Wu, S., Tabashnik, B.E., Wu, Y.,

2011. Early warning of cotton bollworm resistance associated with intensive planting

of Bt cotton in China. PLoS One 6, e22874.

Zhou, X., Faktor, O., Applebaum, S.W., Coll, M., 2000. Population structure of the

pestiferous moth Helicoverpa armigera in the Eastern Mediterranean using RAPD

analysis. Heredity 85, 251-256.

Zhu, F., Li, T., Zhang, L., Liu, N., 2008. Co-up-regulation of three P450 genes in

response to permethrin exposure in permethrin resistant house flies, Musca domestica.

BMC Physiol 8, 18.

Publications

137

Publications

Rasool, A., Jouben, N., Lorenz, S., Ellinger, R., Schneider, B., Khan, S.A., Ashfaq,

M., Heckel, D.G., 2014. An independent occurence of the chimeric P450 enzyme

CYP337B3 of Helicoverpa armigera congers cypermethrin resistance in Pakistan.

Insect Biochem Mol Biol 53, 54-65.

(Attached)

lable at ScienceDirect

Insect Biochemistry and Molecular Biology 53 (2014) 54e65

Contents lists avai

Insect Biochemistry and Molecular Biology

journal homepage: www.elsevier .com/locate/ ibmb

An independent occurrence of the chimeric P450 enzyme CYP337B3of Helicoverpa armigera confers cypermethrin resistance in Pakistan

Akhtar Rasool a, 1, 3, Nicole Joußen a, *, 3, Sybille Lorenz b, Renate Ellinger c,Bernd Schneider c, Sher Afzal Khan a, Muhammad Ashfaq d, 2, David G. Heckel a

a Department of Entomology, Max Planck Institute for Chemical Ecology, Hans-Kn€oll-Str. 8, 07745 Jena, Germanyb Research Group Mass Spectrometry, Max Planck Institute for Chemical Ecology, Hans-Kn€oll-Str. 8, 07745 Jena, Germanyc Research Group Biosynthesis/Nuclear Magnetic Resonance, Max Planck Institute for Chemical Ecology, Hans-Kn€oll-Str. 8, 07745 Jena, Germanyd Insect Molecular Biology Lab, National Institute for Biotechnology and Genetic Engineering (NIBGE), P.O. Box 577, Jhang Road, Faisalabad, Pakistan

a r t i c l e i n f o

Article history:Received 2 April 2014Received in revised form8 July 2014Accepted 11 July 2014Available online 24 July 2014

Keywords:Pest managementHelicoverpa armigeraCytochrome P450 monooxygenaseCYP337B3Unequal crossing-overPyrethroid resistanceCypermethrin

Abbreviations: AFLP, amplified fragment length plabad; Punjab, Pakistan; P450, cytochrome P450 mquantitative real-time polymerase chain reaction; SAustralia; TWBS, susceptible line of the Helicoverpa a* Corresponding author. Tel.: þ49 (0) 3641 57 1552

E-mail addresses: [email protected] (A. R(R. Ellinger), [email protected] (B. Schneider), sk

1 Present address: Insect Molecular Biology Lab, NPakistan Institute of Engineering and Applied Science

2 Present address: Biodiversity Institute of Ontario,3 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.ibmb.2014.07.0060965-1748/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

The increasing resistance level of insect pest species is amajor concern to agricultureworldwide. The cottonbollworm,Helicoverpa armigera, is one of themost important pest species due tobeing highly polyphagous,geographically widespread, and resistant towards many chemical classes of insecticides. We previouslydescribed the mechanism of fenvalerate resistance in Australian populations conferred by the chimericcytochrome P450 monooxygenase CYP337B3, which arose by unequal crossing-over between CYP337B1and CYP337B2. Here, we show that thismechanism is also present in the cypermethrin-resistant FSD strainfrom Pakistan. The Pakistani and the Australian CYP337B3 alleles differ by 18 synonymous and threenonsynonymous SNPs and additionally in the length and sequence of the intron. Nevertheless, the activityof both CYP337B3 proteins is comparable. We demonstrate that CYP337B3 is capable of metabolizingcypermethrin (trans- and especially cis-isomers) to the main metabolite 4'-hydroxycypermethrin, whichexhibits no intrinsic toxicity towards susceptible larvae. In a bioassay, CYP337B3 confers a 7-fold resistancetowards cypermethrin in FSD larvae compared to susceptible larvae from the AustralianTWB strain lackingCYP337B3. Linkage analysis shows that presence of CYP337B3 accounts for most of the cypermethrinresistance in the FSD strain; up-regulation of other P450s in FSD plays no detectable role in resistance. Thepresence or absence of CYP337B3 can be easily detectedbya simple PCR screen, providing a powerful tool torapidly distinguish resistant from susceptible individuals in the field and to determine the geographicaldistribution of this resistance gene. Our results suggest that CYP337B3 evolved twice independently byunequal crossing-over between CYP337B2 and two different CYP337B1 alleles.

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction

The cotton bollworm, Helicoverpa armigera (Hübner), is one ofthemost significant pests of agricultureworldwide. This is due to itsextremely wide geographical distribution, its highly polyphagous

olymorphism; BC, backcross; EPIC,onooxygenase; PBO, piperonyl buR, synergism ratio; TWBR, resistrmigera strain TWB..asool), [email protected], [email protected] (S.A. Khan), mashational Institute for Biotechnologys (PIEAS), Nilore, Islamabad, PakisUniversity of Guelph, ON, Canada

life style, and its ability to quickly evolve resistance against controlagents from different chemical classes. H. armigera can be found inmost countries of Africa, Asia, Oceania, and Europe, and even inregions where no overwintering is possible because of its ability tomigrate long distances (Nibouche et al.,1998). Recently, likely due to

exon-primed intron-crossing primer; FSD, Helicoverpa armigera strain from Faisa-toxide; RF, resistance factor; Rt, retention time; RT-qPCR, reverse transcription-ant line of the Helicoverpa armigera strain TWB from Toowoomba; Queensland,

[email protected] (N. Joußen), [email protected] (S. Lorenz), [email protected]@uoguelph.ca (M. Ashfaq), [email protected] (D.G. Heckel).and Genetic Engineering (NIBGE), P.O. Box 577, Jhang Road, Faisalabad, Pakistan;

tan..

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_surname

Delta:1_given name

Delta:1_surname

mailto:[email protected]









http://crossmark.crossref.org/dialog/?doi=10.1016/j.ibmb.2014.07.006&domain=pdf

www.sciencedirect.com/science/journal/09651748

http://www.elsevier.com/locate/ibmb

http://dx.doi.org/10.1016/j.ibmb.2014.07.006



A. Rasool et al. / Insect Biochemistry and Molecular Biology 53 (2014) 54e65 55

human activity, H. armigera invaded the state of Bahia and othernorth-eastern states of Brazil, and thus also occurs now on theAmerican continent (Tay et al., 2013). In Bahia, the infestation willlead to estimated costs of about $1 billion in soybean, cotton, andmaize fields due to increased insecticide applications and yieldlosses (Stewart, 2013). H. armigera is highly polyphagous with morethan 200 host plants, including important crop plants like cotton,tobacco, potato, soybean, and maize (Brun-Barale et al., 2010).Furthermore, its control is hampered by its resistance level that is byfar the highest known from all noctuid species with evolved resis-tance against pyrethroids, organophosphates, carbamates, organo-chlorines (www.pesticideresistance.org), and recently against themacrocyclic lactones spinosad (Aheer et al., 2009; Alvi et al., 2012)and abamectin (Alvi et al., 2012), as well as Bacillus thuringiensis-derived toxins (Alvi et al., 2012; Zhang et al., 2011).

In Pakistan, resistance of H. armigera against the pyrethroidcypermethrin was observed first by Ahmad et al. (1995) in 1991.Since then, cypermethrin resistance has been reported severaltimes from different populations (Aheer et al., 2009; Ahmad, 2004;Ahmad et al., 1997; Alvi et al., 2012; Yang et al., 2004), but theresistance mechanism and the underlying genes remained un-identified until now, even though Yang et al. (2004) proposed aresistancemediated by cytochrome P450monooxygenases (P450s).

Recently,we characterized anovel P450enzyme that is responsiblefor the resistance of Australian H. armigera towards the pyrethroidfenvalerate (Joußen et al., 2012). CYP337B3 is a chimeric gene thatarose by unequal crossing-over between the two parental P450 genes,CYP337B1 and CYP337B2. The chimeric gene is allelic to its parents, i.e.either CYP337B3 occurs alone or CYP337B1 and CYP337B2 occur in atandem array on Chromosome 15. We showed that only CYP337B3 iscapable of metabolizing fenvalerate to the nontoxic 4'-hydrox-yfenvalerate, while CYP337B1 and CYP337B2 exhibit no detectablefenvaleratemetabolism.ThepolymorphicAustralianH.armigera strainTWB was bred into a susceptible line (TWBS) possessing only theparental genes CYP337B1 and CYP337B2 and a resistant line (TWBR)possessing only CYP337B3. In bioassays, we demonstrated that thepresence of CYP337B3 confers a 42-fold resistance towards fenvaler-ate, which is comparable to the resistance factor of 49 reported byForrester et al. (1993) for an Australian field-collected population.

Here, we focus on the cypermethrin-resistant PakistaniH. armigera strain FSD collected from a chickpea field in Faisalabad,Punjab. Bioassays with a synergist indicated involvement of P450s,and the chimeric P450 CYP337B3 was identified as a candidategene. We describe sequence differences between the Pakistani andthe Australian CYP337B3 alleles that are relevant to the question ofwhether this chimeric gene has a single origin or evolved twicethrough independent unequal crossing-over events. Heterologousexpression and functional analysis of CYP337B3 with model sub-strates and the pyrethroids cypermethrin and a-cypermethrinwereconducted, including larval toxicity bioassays of the FSD strain incomparison with the susceptible Australian TWBS line lackingCYP337B3 to determine the resistance level conferred by CYP337B3.Through linkage analysis using AFLPs and expression level analysisof 51 P450 genes, the involvement of other genes in the cyper-methrin resistance was assessed. CYP337B3 is the major cyper-methrin resistancemechanism in the FSD strain, and its presence inthe disjunct regions of Pakistan and Australia hints at a moreextensive worldwide distribution.

2. Materials and methods

2.1. H. armigera strains

For the Pakistani pyrethroid-resistant strain FSD of H. armigera(Hübner) (Lepidoptera: Noctuidae) about 250 larvae were collected

in March 2011 from a chickpea field in Faisalabad, Punjab, Pakistan,where cotton and chickpea are used in rotation and multiplerounds of pyrethroid insecticides are applied for pest control. Thelarvae were reared on pinto bean diet (Joyner and Gould, 1985) at26 �C and 55% humidity with a 16:8 (light:dark) photoperiod. TheAustralian pyrethroid-resistant line TWBR (CYP337B3 line) and thesusceptible line TWBS (CYP337B1-CYP337B2 line) described inJoußen et al. (2012) were maintained on Bio-Serv diet (GeneralPurpose Lepidoptera) under the same conditions. The FSD strainwas maintained through mass rearing (10 pairs in a single cross),while the TWBR and TWBS lines were maintained through single-pair crosses.

2.2. Toxicity bioassays with cypermethrin and its main metabolite

Resistance levels of H. armigera strains were determined byscreening with technical grade cypermethrin (mixture of isomers,purity 95.1%, PESTANAL, SigmaeAldrich). Six different doses ofcypermethrin in a range from 10 ng to 3162.3 ng were prepared inacetone. Thirty to forty healthy third-instar larvae of the FSD strain,the TWBR line, the TWBS line, and of crosses between the FSDstrain and the TWBS line received topical application on the thoraxof 1 mL of the specific dose using a Hamilton syringe fixed in aHamilton PB600-1 Repeating Dispenser (Hamilton Messtechnik).For the FSD strain, the toxicity bioassay was repeated with a pre-treatment of the larvae with piperonyl butoxide (PBO; Endura FineChemicals; 1 mL of 30 mM PBO in acetone), a known P450 andesterase inhibitor (synergist), 2 h prior to the application ofcypermethrin. Larvae were kept on their normal diet under normalrearing conditions. Larval mortality was recorded after 48 h on thebasis of criteria proposed by Joußen et al. (2012). Observed mor-talities were transformed by probit analysis using SPSS Statisticsversion 17.0 to determine regression lines including slope and LD50values.

A toxicity bioassay was also performed with the main metabo-lite of a-cypermethrin using the HPLC-purified metabolite from theupscaled in vitro assay. Fourteen third-instar larvae of the suscep-tible TWBS line were treated with approximately 0.17 mg ofmetabolite (dissolved in 1 ml of acetone; determined by HPLC).

2.3. Screening for the presence or absence of CYP337B1, CYP337B2,and CYP337B3

Genomic DNAwas extracted as described in Joußen et al. (2012)with slight modifications. Genomic DNAwas resuspended in 100 mLof nuclease-free water and stored at �20 �C. DNA from 36 FSDadults were screened by PCR (for primers, see Table S1) for thepresence or absence of CYP337B1, CYP337B2, and CYP337B3.

2.4. Amplified fragment length polymorphism (AFLP) analysis

To generate informative families for genetic mapping, ten malesof the resistant FSD strain were crossed with ten females of thesusceptible TWBS line in a mass mating. F1 males and females werebackcrossed to TWBS in single-pair matings. To determine theresistance dominance in the F1 population, F1 larvae were treatedwith different doses of cypermethrin as described above. Addi-tionally, 100 third-instar larvae of one male-informative backcrossfamily derived from a F1 father and 50 larvae of one female-informative backcross family from a F1 mother were treated withthe discriminating dose of 400 ng of cypermethrin. All treatedlarvae, dead or survived, and 50 untreated third-instar larvae werefrozen at �80 �C for subsequent analysis.

For AFLP analysis, we followed the method published by Voset al. (1995) with a few modifications described by Kaiser and

http://www.pesticideresistance.org

A. Rasool et al. / Insect Biochemistry and Molecular Biology 53 (2014) 54e6556

Heckel (2012). The extracted DNA (200 ng) of five grandparents(five males and five females) per cross, of the parents, and of 24killed and 24 surviving cypermethrin-treated larvae of the male-informative backcross and of 15 killed and 15 survivingcypermethrin-treated larvae of the female-informative backcrosswere digested with MseI and EcoRI. Primer combinations for se-lective amplification are given in Table S2. Sterile water (10 ml) andLI-COR stop solution (15 ml; 1 mM EDTA, 1 ng mL�1 bromophenolblue, and 85% formamide) were added to the selectively amplifiedPCR products and an aliquot of 0.8 mL was separated along with theDNA marker LI-COR STR (50e700 bp) on an 8% polyacrylamide gelusing the DNA analyzer system LI-COR 4200 sequencer (LI-CORBiosciences-GmbH). The gel was run for 3.5 h and the image wasdeveloped by laser scanning (detection of infrared labelled DNAfragments of 700 nm and 800 nm). Gel scoring was executed withsemiautomatic image analysis software Quantar 1.08 (KeyGeneProducts). In backcross individuals, AFLP markers (fragment bands)of interest were those that were also present in the FSD grand-parent and in the F1 parent (male or female), but not in the TWBSgrandparent or TWBS backcross parent. The presence of a band wasconsidered as the heterozygous genotype while the absence of aband was considered as the homozygous recessive genotype,because the bands were segregating 1:1.

2.5. Mapping of the resistance gene to a linkage group

CYP337B3 (Joußen et al., 2012) was considered as a candidategene involved in cypermethrin resistance of the FSD strain and wasmapped to the linkage groups identified by AFLP analysis. CYP337B3amplicons of 844 bp were generated by PCR using gene specificprimers (Table S1). For fine scale mapping of the resistance gene,four marker genes were chosen (thiol peroxidase m14_FLX and ri-bosomal protein genes RPL10A, RPL8, and RPS23) which wereassumed on the basis of homology to Bombyx mori (Yoshido et al.,2005) to be located on the same linkage group as CYP337B3.Exon-primed intron-crossing primers (EPIC; designed from adja-cent exon sequences which flank the intron, Table S1) weredesigned using the in-house cDNA library (Department of Ento-mology, Max Planck Institute for Chemical Ecology) of the Austra-lian H. armigera strain TWB. The intron positions were predictedfrom those in B. mori, as intron positions are highly conserved inLepidoptera.

The AFLP markers, CYP337B3, and the marker genes wereanalyzed using MAPMAKER 3.0b to determine the number oflinkage groups by exploiting the lack of crossing-over duringoogenesis in lepidopteran females (Heckel et al., 1999; Robinson,1971; Suomalainen et al., 1973). A sequential approach was used:First, absolute linkage in female-informative backcross progenywas used to identify the linkage group involved in resistance.MAPMAKER produced 31 linkage groups from the 252 AFLPmarkers using a LOD score of 3.5. The segregation of 13 resistance-linked AFLPs was verified by correlation with the mortality data(killed and surviving larvae) from the toxicity bioassay withcypermethrin. Second, recombinants among male-informativebackcross progeny were used to identify the position of CYP337B3on the resistance-associated linkage group. Mapping was con-ducted by determining the maximum likelihood order of CYP337B3and the four marker genes (by the ripple command usingMAPMAKER) and, secondly, by including the 13 resistance-linkedAFLP markers (four at a time) building up to the final map.

2.6. RT-qPCR of multiple P450 genes

Reverse transcription-quantitative real-time PCR (RT-qPCR) wasconducted with individuals of the resistant strain FSD in

comparison with the resistant line TWBR and the susceptible lineTWBS. Gene-specific primers for 64 P450 genes (genes included inFigure S1 and additional for an unnamed CYP301A gene) coveringfour major P450 gene families, CYP3, CYP4, CYP6, and CYP9, weredesigned using Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/;Table S3). eIF4A (eukaryotic Initiation Factor 4A) and RPS18 (ribo-somal protein S18) were used as reference genes (Table S3). Allprimers were designed using sequences from the in-house data-base of the Australian H. armigera strain TWB. For RT-qPCR, totalRNA was extracted from fifth-instar larvae (three larvae pooled inone biological replicate and three biological replicates per strain)using TRIzol reagent (Molecular Research Center) following man-ufacturer's instructions. Extracted RNA was treated with DNaseI(Life Technologies) in order to eliminate traces of genomic DNA andpurified through RNeasy MinElute Cleanup Kit (Qiagen). Quality ofpurified RNA was checked by Agilent RNA 6000 Nano Kit (AgilentTechnologies). First strand cDNA was synthesized using RevertAidH Minus First Strand cDNA Synthesis Kit (Life Technologies) from500 ng of total RNA in 20 mL of reaction mixture with 1 � reactionbuffer, 200 U RevertAid H Minus M-MuLV reverse transcriptase, 20U RiboLock RNase inhibitor, 10 mM dNTPs, and 50 mM oligo (dT) 18primer at 42 �C for 30 min, 50 �C for 60 min, and 95 �C for 2 min.PCR was performed in optical 96-well plates on an Agilent Tech-nologies Stratagene Mx3000P Real-Time PCR System using theABsolute QPCR SYBR Green Mix (Thermo Fisher Scientific) tomonitor the double-stranded DNA synthesis in combination withROX as a passive reference dye included in the PCR master mix.Amplification conditions were the following: 95 �C for 10 min toactivate the polymerase, followed by 40 cycles at 95 �C for 30 s,60 �C for 30 s, and 72 �C for 30 s. A melting and dissociation curveanalysis (MxPro 4.0 QPCR Software, Agilent Technologies) wasperformed in order to verify that the amplicon possessed the cor-rect melting temperature and therefore exhibited the predictedlength and that there was only one PCR product amplified per re-action. Each experiment was repeated with three independent RNAsamples (biological replicates), and each reaction was repeatedthree times (technical replicates) to minimize intra-experimentvariations. The average copy number ±SEM of each P450 mRNArelative to 1000 copies of mRNA of the reference gene eIF4A wascalculated using qBase. Copy numbers in resistant strains FSD orTWBR were compared with copy numbers in the susceptible TWBSline using two-tailed heteroscedastic t tests in Excel. Initially twohousekeeping genes, RPS18 and eIF4A, were used as referencegenes, but because only the expression of eIF4A remained constantfor all the three lines tested over different rounds of experiments,RPS18 was excluded from the analysis.

Expression levels of the three P450 genes which had shown thehighest overexpression in FSD relative to TWBS were comparedamong backcross progeny that were heterozygous resistant (withone copy of CYP337B3) vs. homozygous susceptible. Offspring thathad never been exposed to insecticide were frozen, and subse-quently both DNA and RNAwere isolated from each individual. DNAwas analyzed by PCR for each offspring to determine its CYP337Bgenotype, and RNAwas pooled for each of the two genotype classesfor RT-qPCR.

2.7. Full-length cloning of the chimeric gene CYP337B3 andcharacterization of the intron

To obtain the full-length CDS of CYP337B3 from the FSD strain ofH. armigera 3' and 5' RACE-PCR was performed using cDNA from anindividual larva, the SMARTer™ RACE cDNA Amplification Kit(Clontech) and the First Choice RLM-RACE Kit (Life Technologies)according to the manufacturer's instructions. The cloning strategywas adopted from Joußen et al. (2012). Gene-specific primers for

http://bioinfo.ut.ee/primer3-0.4.0/


CYP337B3 were designed from the sequence derived from 3' and 5'RACEePCR with the forward primer including a 5'-Kozak sequenceand the reverse primer lacking the stop codon (Table S1) for V5epitope and His-tag fusion expression after ligation into the vectorpIB/V5-His TOPO® TA (Life Technologies). The gene was amplifiedusing AccuPrime™ Taq DNA Polymerase High Fidelity (Life Tech-nologies). Correct orientation and sequence of the insert wasverified by colony PCR after transformation of TOP10 Escherichiacoli cells (Life Technologies) and by sequencing, respectively.

The intron region of CYP337B3was amplified from genomic DNAusing intron spanning primers (Table S1) and was sequenced aftergel purification.

2.8. Heterologous expression of CYP337B3 in Ha2302 cells andisolation of microsomal and cytosolic fractions

Transfection of the adherent insect cell line Ha2302 was per-formed as described by Joußen et al. (2012) using the Insect Gen-eJuice Transfection Reagent (Novagen). Three ml of diluted (with 3-fold of medium) confluent Ha2302 cells were added to onewell of a6-well cell culture plate andwere transfectedwith 1.8 mg of plasmidDNA. Stably transfected cells were selected 48 h post selectionwith60 mgmL�1 of blasticidin. High selection pressurewas reduced aftera few passages to 10 mg mL�1 of blasticidin. The stable transfectedcell culture was cryopreserved and used for microsomal isolation.

Microsomes were isolated from CYP337B3-transgenic and non-transgenic Ha2302 cells using the method described by Joußenet al. (2012). Both cytosolic and microsomal fractions were storedat�80 �C. Protein content was determined by the Bradford method(Bradford, 1976) using the Quick Start Bradford Protein Assay (Bio-Rad). Additionally, the pellets containing the nuclei were snapfrozen for isolation of genomic DNA.

2.9. Confirmation of successful transfection of Ha2302 cells

Genomic DNA of CYP337B3-transgenic Ha2302 cells wasextracted from the nucleus fraction using the method proposed byAljanabi and Martinez (1997) with modifications described byJoußen et al. (2012). Genomic DNA was resuspended in H2O. Thepresence of CYP337B3 was confirmed through PCR using gene-specific primers designed for full-length cloning (for primers, seeTable S1).

Microsomal and cytosolic proteins (10 mg each) of CYP337B3-transgenic Ha2302 cells were analyzed by SDS-PAGE and westernblot as described by Joußen et al. (2012). The tagged P450 proteinwas detected with an Anti-V5-HRP antibody (1:10,000; LifeTechnologies).

2.10. Activity assays with P450 model substrates

Three groups of model substrates, 7-alkoxyresorufins (7-methoxy-, 7-ethoxy-, 7-pentoxy-, and 7-benzyloxyresorufin), 7-alkoxycoumarins (7-methoxy- and 7-ethoxycoumarin), and 3-cyano-7-alkoxycoumarins (3-cyano-7-methoxy- and 3-cyano-7-ethoxycoumarin), were used to determine the functionality ofheterologous CYP337B3. Activity assays were performed andmeasured as described by Joußen et al. (2012). For each activityassay 0.2 mg of microsomal proteins derived from transgenic andnon-transgenic Ha2302 cells were incubated with 1 nmol of sub-strate (dissolved in 1 mL of DMSO) and an NADPH regenerationsystem at 30 �C for 4 h. Samples omitting microsomes were used asbackground controls and two (to three) replicates were used perassay. For 7-alkoxycoumarins, the extraction procedure was carriedout by following Waxman and Chang (2006) with few modifica-tions described in Joußen et al. (2012).

Calibration curves of the products resorufin (0, 1, 2, 3, 4, 5, 6, 7, 8,9, 10, 50, 100, 150, 200, and 250 pmol; dissolved in DMSO) and 3-cyano-7-hydroxycoumarin (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 pmol;dissolved in DMSO), respectively, were measured in the relevantsolvents using two replicates for each amount. Differing from theprocedure by Joußen et al. (2012), for the calibration curve of theproduct 7-hydroxycoumarin, two replicates for each amount (0, 2,4, 6, 8, 10, 12, 14, 16, 18, 20, and 30 pmol; dissolved in DMSO) wereincubated in the reaction mixture with non-transgenic microsomesand were extracted as described for the samples. The resultingcalibration curve includes losses due to handling of aliquots andextraction. The analysis was performed as described by Joußenet al. (2012) with one modification in the expression of the endresult. Calibration curves were transformed by subtracting thefluorescence intensity values received by 0 pmol of product(negative values were set to 0) from all values. For the calculation ofthe metabolic activity of CYP337B3, all negative values were set to0 and the mean of the background control was subtracted from thevalues of all samples to produce the net-fluorescence intensities.Furthermore, the mean of the samples performed with non-transgenic Ha2302 microsomes was subtracted from the meanvalues of all samples. At the end, resulting corrected net-fluorescence intensities were transformed in amounts of productformed by CYP337B3 using the corresponding calibration curve andcorrected metabolic capacities were expressed as pmol productformed by 0.2 mg of microsomal protein in 4 h.

2.11. In vitro metabolism assays with cypermethrin and a-cypermethrin and analysis through HPLC

To determine the capability of CYP337B3 to metabolize cyper-methrin and a-cypermethrin in vitro assays were performed usingthe method described by Joußen et al. (2012). Microsomal proteins(0.8 mg) derived from CYP337B3-transgenic and non-transgenicHa2302 cells were incubated individually in amber borosilicateglass vials with 4 nmol of cypermethrin (mixture of isomers, purity95.1%; PESTANAL, SigmaeAldrich; dissolved in 4 mL of DMSO) anda-cypermethrin (purity 99.7%; PESTANAL, SigmaeAldrich; dis-solved in 4 mL of DMSO), respectively, at 30 �C for 4 h. Additionally,two inhibition assays were performed: Firstly, piperonyl butoxide(purity: at least 90%, Fluka), a known P450 inhibitor, was used in aninhibition assay with 40 nmol per assay. Secondly, an inhibitionstudy with the absence of NADPH was performed by omitting theNADPH regeneration system. Samples were extracted and residueswere redissolved in 25 mL of methanol and 375 mL of H2O:aceto-nitrile 50:50 (organic solvents of HPLC grade) and filtered for HPLC.As a reference in HPLC analysis, a solution of 1 nmol cypermethrinand a-cypermethrin, respectively, per 100 ml was used. HPLCanalysis (100 ml per sample) was executed on a HewlettePackard(Agilent) HPLC 1100 Series equipped with a C18 column (EC 250/4.6Nucleodur® Sphinx RP, 250 � 4.6 mm, 5-mm particle size;MachereyeNagel) as described in Joußen et al. (2012) using thesame program. Cypermethrin, a-cypermethrin, and their metabo-lites were detected at 210 nm, 230 nm, and 275 nm.

2.12. Isolation and identification of the main metabolite of a-cypermethrin

Themain metabolite of a-cypermethrinwas isolated in multipleruns by preparative HPLC from upscaled in vitro assays followingthe method described by Joußen et al. (2012). Microsomal proteins(10.0 mg) from CYP337B3-overexpressing Ha2302 cells were incu-bated with 50 nmol of a-cypermethrin (20.8 mg, purity 99.7%;PESTANAL, SigmaeAldrich; dissolved in 50 mL of DMSO; threereplicates) in a total volume of 10 mL at 30 �C and 110 rpm (orbital

Fig. 1. Doseeresponse curves of the resistant FSD strain of Pakistani H. armigeracompared to the resistant TWBR line and the susceptible TWBS line from Australiatowards cypermethrin. For each of the six doses and a control per line, 30e40 third-instar larvae were tested by topical application. Mortalities (without control) andregression lines from probit transformed mortalities were plotted on a probit scaleagainst logarithmic doses of cypermethrin. Mortalities of 0% were changed to 0.01%and of 100% were changed to 99.99% for plotting.


shaker CERTOMAT IS, Sartorius) for 24 h. Samples were preparedfor HPLC as described above with the following exceptions: forextraction 5 mL of ethyl acetate (HPLC grade; stirring for 10 min)were used per extraction step and residues of the combined rep-licates were redissolved in 50 mL of methanol and 1150 mL ofacetonitrile (both HPLC grade) and filtered. The main metabolitewas isolated through two HPLC systems and identified by gaschromatography with electron impact mass spectrometry (GC/EI-MS) and nuclear magnetic resonance (NMR) spectroscopy.

GCeMS was performed on a HewlettePackard gas chromato-graph 6890 (Agilent) combined with MS02 mass spectrometerfrom Micromass (Waters) operated in EI mode (70 eV). A ZB5mscolumn (30 m � 0.25 mm, 0.25-mm film thickness; Phenomenex)was used with helium as carrier gas and a flow rate of 1 ml min�1.One ml of sample was injected (splitless) using an injector tem-perature of 250 �C. The samples were run with a temperaturegradient program (40 �C for 2 min, increase of 15 �C min�1 up to300 �C, held on 300 �C for 3 min) and were scanned in a range ofm/z 50e500. HPLC-purified a-cypermethrin main metabolite (2 mg, ina-cypermethrin equivalents) was dissolved in dichloromethane(HPLC grade). a-Cypermethrin (purity 99.7%; PESTANAL, Sigma-eAldrich) was used as reference compound.

1H NMR and 1He1H COSY spectra were recorded at 300 K on aBruker Avance 500 NMR spectrometer equipped with a TCIcryoprobe (5 mm) and operating at a proton NMR frequency of500.13 MHz. HPLC-purified a-cypermethrin main metabolite(5 mg, in a-cypermethrin equivalents) was dissolved in meth-anol-d4 (85 mL) and transferred into a 2 mm capillary for mea-surement. a-Cypermethrin (purity 99.7%; PESTANAL,SigmaeAldrich) was used as reference compound. Six hundredforty transients were collected at 32,000 data points with aspectral width of 10 ppm by using 90� pulse, 3.27 s acquisitiontime, and a relaxation delay of 2 s for 1H NMR. The water signalwas suppressed by PURGE sequence (Simpson and Brown, 2005).The cumulative FID was Fourier transformed to 64,000 datapoints by using line broadening of 0.1 Hz. The resulting spectrumwas manually phased, baseline corrected, and calibrated to thecentral solvent signal (d 3.30) in TOPSPIN version 2.1. The 1He1HCOSY spectrum was acquired with a presaturation pulsesequence for suppressing the residual water signal. A relaxationdelay of 2.0 s was applied and the spectral width was 15 ppm inboth dimensions.

3. Results

3.1. Cypermethrin resistance in the FSD strain is metabolic andsemidominant

To elucidate the cypermethrin resistance mechanism ofH. armigera observed in field populations in Pakistan, third-instarlarvae from the Pakistani FSD strain were treated with differentdoses of cypermethrin for comparison with the fenvalerate-resistant TWBR line and the susceptible TWBS line from Australia(Fig.1). Larvae of the FSD strain and TWBR linewere 6.94- and 5.73-fold, respectively, more resistant than the TWBS line (Table 1). Todetermine the resistance mechanism of the Pakistani strain, FSDlarvae were treated with piperonyl butoxide, a known P450 andcarboxylesterase inhibitor, prior to cypermethrin treatment.Piperonyl butoxide treated larvae were more sensitive to cyper-methrin, revealing a synergism ratio of 7.21 which reduced theresistance factor (RF) to 0.96, similar to susceptible TWBS larvae(Table 1). These results suggest, compared to the susceptible TWBSline, that the cypermethrin resistance observed in PakistaniH. armigera is a metabolic resistance most likely due to one or moreP450 enzymes.

In order to determine the degree of resistance dominance,heterozygous F1 larvae derived from crosses between the resistantFSD strain and the susceptible TWBS line were tested with differentdoses of cypermethrin. The resulting RF of 6.67 (Table 1) is slightlylower than the RF found for the homozygous FSD strain but notsignificantly different indicating a semidominant or dominantresistance, but in favour of a semidominant resistance as this wasdetermined in the heterozygous resistant TWB line bioassayedwithfenvalerate (Joußen et al., 2012). Based on a comparison of thedoseeresponse curve of the F1 larvae with that of the resistant andsusceptible parent strains, a discriminating dose of 400 ng wasselected for the screening of the backcross larvae. Backcross familyF114 from the male-informative backcross (F1 male � TWBS fe-male) and backcross family F223 from the female-informativebackcross (F1 female � TWBS male) showed 50% mortality at thediscriminating dose and thus were selected for further AFLPanalysis.

3.2. Cypermethrin resistance in the FSD strain is monogenic,autosomal and linked to CYP337B3

To determine the number and location of genes involved incypermethrin resistance of the FSD strain, a genetic linkage analysisusing amplified fragment length polymorphisms (AFLPs) asmarkers was performed on backcross progenies bioassayed at thediscriminating dose of cypermethrin. Overall, 236 AFLPs (fragmentsof interests) were scored from the male-informative backcross and252 AFLPs from the female-informative backcross (Table S2). Takingadvantage of the lack of crossing-over in lepidopteran females,MAPMAKER produced 31 linkage groups from the 252 AFLPs of thefemale-informative backcross using a LOD score of 3.5, as expectedfrom the known number of chromosomes in H. armigera (Robinson,

Table 1Characteristics of the Pakistani FSD strain and the Australian TWB lines of H. armigera.

Line Treatment LD50, ng per larva 95% confidence intervals Slope RFa SRb

TWBS Cypermethrin 76.7 57.2, 101.9 1.83 e e

FSD Cypermethrin 531.7 408.1, 770.0 2.32 6.94 e

FSD Cypermethrin þ PBO 73.8 58.4, 91.6 2.61 0.96 7.21TWBR Cypermethrin 439.3 325.8, 600.5 1.67 5.73 e

F1 (FSD � TWBS) Cypermethrin 511.0 289.9, 1535.7 1.08 6.67 e

a RF, resistance factor calculated as LD50 of the resistant strain/line divided by LD50 of the susceptible line.b SR, synergism ratio calculated as LD50 of the treatment with cypermethrin divided by the LD50 of the treatment with cypermethrin and piperonyl butoxide (PBO).


1971; Sahara et al., 2013; Tang et al., 2005). A single linkage groupconsisting of 13 AFLPs showed a strong correlation with resistance,with AFLP bands present only in bioassay survivors and absent fromkilled individuals (Figure S2A).

CYP337B3 was considered as a possible candidate gene forresistance (Joußen et al., 2012), and PCR screening showed thatonly CYP337B3 and not CYP337B1 or CYP337B2 occurred in the FSDstrain at the time of the crosses. Further PCR analysis showed thatthe presence of CYP337B3 exhibited the same pattern as theresistance-correlated AFLP linkage group in the female-informativebackcross: present in all bioassay survivors and absent from killedindividuals (Figure S2B).

To localize CYP337B3within this linkage group the occurrence ofcrossing-over during meiosis in lepidopteran males was exploitedby analyzing the male-informative backcross. As CYP337B3 hadpreviously been mapped to the homologue of B. mori Chromosome15, additional markers known to occur on that chromosome wereincluded in the analysis. CYP337B3 mapped near one end of thelinkage group, with the markers showing the same order as inB. mori. Survivorship of the cypermethrin bioassay was moststrongly correlated with the CYP337B3 genotype (Fig. 2).

3.3. Multiple P450 genes are overexpressed in the FSD strain but notgenetically linked to cypermethrin resistance

To examine the possible role of other P450 genes in the cyper-methrin resistance of the FSD strain, an in-house cDNA database ofH. armigera was searched. This revealed contigs of 59 P450 genes,mainly belonging to the P450 gene families CYP6 (17), CYP4 (12),CYP9 (9), and CYP340 (5) (Figure S1). These P450s can be clusteredby phylogenetic analysis into two clans, the CYP3 clan (Figure S1,bottom part) and the CYP4 clan (Figure S1, top part). The expressionlevels of these P450 genes were investigated through RT-qPCR inthe cypermethrin resistant FSD strain and the TWBR line using theTWBS line as a susceptible control. Primers for 58 genes werevalidated for TWBS and TWBR, but only 51 primer pairs worked inFSD, likely due to sequence divergence in one or both primerbinding sites. It was not possible to design specific RT-qPCR primersthat could discriminate between CYP337B1, CYP337B2, andCYP337B3, because of the high sequence similarity of these genes.Statistical analysis of the RT-qPCR data revealed that 12 P450 geneswere significantly up-regulated and 19 were significantly down-regulated in the FSD strain compared to TWBS (Table S4). Threegenes showed more than five-fold higher expression in FSD:CYP340G1 (147-fold), CYP340H1 (15-fold), and CYP341B2 (7-fold).Expression levels in TWBR were much more similar to TWBS, withonly one significant difference, a 73-fold down-regulation ofCYP321B1 (Table S4).

To examine whether P450 upregulation in FSD was geneticallylinked to the cypermethrin resistance in FSD, DNA and RNA wereextracted from 40 larvae of the same female-informative backcrossused in the linkage mapping. These larvae had never been exposedto cypermethrin, so any expression differences are constitutive, not

induced. DNA was used to examine the presence or absence ofCYP337B3, and thus to identify individuals who had received theFSD-derived resistance-associated linkage group from their F1mother. RNA was used to study the expression level of the threeP450s found to be most highly up-regulated in FSD. A higherexpression level of a given P450 among the untreated backcrosslarvae that had received the FSD linkage group would indicategenetic linkage of resistance to that P450 and a cis-acting factorcausing its higher expression, or to a trans-acting factor on thatlinkage group causing higher expression of that P450 located onanother chromosome (Grubor and Heckel, 2007). The three P450genes showing the highest overexpression in FSD (CYP340G1,CYP340H1, and CYP341B2) were not overexpressed in backcrossprogeny receiving the FSD-derived linkage group from the F1mother, relative to backcross progeny receiving the TWBS-derivedlinkage group (Figure S3). Instead, the expression levels were equalin these two groups, and similar to the susceptible TWBS line.Therefore the overexpression of these P450 genes in the FSD strainis not linked to cypermethrin resistance in the FSD strain.

3.4. A new allele of CYP337B3 occurs in the FSD strain

Gene-specific PCR primers for the amplification of CYP337B1and CYP337B2 (845-bp and 847-bp fragments, respectively) andCYP337B3 (844-bp fragment) were used to screen for the presenceof these genes in the FSD strain of H. armigera. The PCR screeningshowed that only CYP337B3was present in all 36 FSD adults tested,while CYP337B1 and CYP337B2were not detected in any adults. Thisindicates that the FSD strain is homozygous for the resistance geneCYP337B3.

The primers reported for the full-length amplification ofCYP337B3(v1) (GenBank: JQ284029) from the Australian TWBstrain (Joußen et al., 2012) did not amplify this gene from the FSDstrain. However, by RACE-PCR using primers designed from the844-bp fragment of CYP337B3, the 3' and 5' ends were successfullyamplified providing the full-length CDS of CYP337B3. The codingsequence is 1479 bp in length, like CYP337B3v1 of the TWB strain.However, the sequences differ by 18 synonymous and 3 non-synonymous SNPs, and the resulting 3 amino acid substitutionsdetermine the FSD sequence as a newallele, which has been namedby the P450 Nomenclature Committee as CYP337B3v2 (DavidNelson, pers. comm.). The resulting differences in the deducedamino acid sequence located at the C-terminus (I365V, L416S,C484R; TWB/FSD) correspond to amino acid differences previouslyfound between the CYP337B1 alleles (denoted as v1 to v4) (Joußenet al., 2012). A comparison of the nucleotide sequences of the twoCYP337B3 alleles with the sequences of the CYP337B1 and CYP337B2alleles revealed that the Australian CYP337B3v1 is more similar toCYP337B1v1 (GenBank: JQ284023) or CYP337B1v3 (GenBank:JQ284024) in its 3’ end, while the Pakistani CYP337B3v2 is moresimilar to CYP337B1v4 (GenBank: JQ284025) (Fig. 3). Furthermore,it seems that the sequence of the Pakistani CYP337B3v2 resemblesthe sequence of CYP337B2 over a longer region than the Australian

Fig. 2. Map of resistanceeassociated linkage group of Helicoverpa armigera. The resistance gene CYP337B3 was mapped using maximum likelihood as implemented in MAPMAKERto determine the order and spacing of the 13 AFLPs, CYP337B3, and four marker genes. The number of progeny carrying the FSD-derived allele (RS genotype) vs. the susceptible allele(SS) at each locus among survivors of the bioassay and killed individuals is indicated at the right. All progeny carrying the CYP337B3 allele from FSD survived and all those lackingCYP337B3 died. For the other loci, the correlation between the FSD-derived allele and survivorship decreases with increasing distance from CYP337B3 along the chromosome.

Fig. 3. Alignment of CYP337B3v1 from Australian and CYP337B3v2 from Pakistani Helicoverpa armigera with the CYP337B1 alleles and CYP337B2. For clarity, only the 21 nucleotidesthat differ between both CYP337B3 alleles are shown. There are more SNPs between the alleles of CYP337B1 and CYP337B2, respectively. Both CYP337B3 alleles are compared toCYP337B2 (blue) at their 50 ends and to the CYP337B1 alleles CYP337B1v1/v3 (green) and CYP337B1v4 (red) at their 30 ends. All nucleotides of the CYP337B3 alleles, which match thenucleotides of one of the genes or alleles they are compared to, are highlighted in the respective colour. Nonsynonymous SNPs are framed. The putative region of the unequalcrossing-over event is highlighted in grey. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)


Table 2Metabolic capacities of CYP337B3v2, CYP337B3v1, and CYP337B1 allozymes towards7-alkoxyresorufins and -coumarins.

P450 MR ER PR BR

CYP337B3v2 255.7 6.6 n.d. 5.6CYP337B3v1 224.3/201.1 6.6/4.2 n.d./n.d. 9.2/8.1CYP337B1v1 128.9/41.9 0.3/n.d. n.d./n.d. 31.9/17.1CYP337B1v3 2.8/n.d. n.d./n.d n.d./n.d. 3.2/0.7CYP337B1v4 145.8/39.8 1.2/0.6 n.d./n.d. 22.9/8.1

P450 MC EC CMC CEC

CYP337B3v2 8.3 1.9 8.4 n.d.CYP337B3v1 15.3/15.3 0.9/n.d. 9.4/8.2 n.d./n.d.CYP337B1v1 6.1/1.3 n.d./n.d. 0.9/0.2 n.d./n.d.CYP337B1v3 0.9/1.3 1.3/2.8 n.d./n.d. n.d./n.d.CYP337B1v4 2.1/n.d. n.d./n.d. 0.7/n.d. n.d./n.d.

Metabolic capacities are expressed as pmol product formed by 0.2mg of microsomalprotein in 4 h. For CYP337B3v1 and the CYP337B1 allozymes, the amounts for theenzymes lacking the V5 epitope and the His-tag are given first, followed by theamounts for the enzymes possessing the tags (Joußen et al., 2012). For CYP337B3v2,only the enzyme possessing the tags was used.MR, 7-methoxyresorufin; ER, 7-ethoxyresorufin; PR, 7-pentoxyresorufin; BR, 7-benzyloxyresorufin; MC, 7-methoxycoumarin; EC, 7-ethoxycoumarin; CMC, 3-cyano-7-methoxycoumarin; CEC, 3-cyano-7-ethoxycoumarin; n.d., not detectable.


CYP337B3v1 does (Fig. 3) suggesting a possible shift of the unequalcrossing-over event a few nucleotides up-stream of the proposedposition of the crossover event of the Australian CYP337B3v1(Joußen et al., 2012). Additionally, the intron differs in length andsequence between the Pakistani CYP337B3v2 (1017 bp; GenBank:KJ636466) and the Australian CYP337B3v1 (921 bp; GenBank:JQ995292).

3.5. CYP337B3v2 from the FSD strain is capable of metabolizingcypermethrin and a-cypermethrin

The full length sequence of CYP337B3v2 was ligated into the pIB/V5-His TOPO TA expression vector and was used to transfect cells ofthe insect cell lineHa2302. ThepresenceofCYP337B3v2 in thegenomeof the transfected cells was confirmed by PCR and its successfulexpression by Western blot. Sufficient amounts of CYP337B3v2 weredetected byWestern blot in themicrosomal fraction and only traces inthe cytosolic fraction confirming the association of CYP337B3v2 withthe membrane of the endoplasmic reticulum.

Subsequently, the heterologous CYP337B3v2 was tested for itsfunctionality using known P450 model substrates. CYP337B3v2showed high activity against 7-methoxyresorufin, low activityagainst 3-cyano-7-methoxycoumarin, 7-methoxycoumarin, 7-ethoxyresorufin, and 7-benzyloxyresorufin, very low activityagainst 7-ethoxycoumarin and no detectable activity against 7-pentoxyresorufin and 3-cyano-7-ethoxycoumarin (Table 2). Theoverall activity of the Pakistani CYP337B3v2 is comparable to thatof the Australian CYP337B3v1 (Table 2; Joußen et al., 2012), but it isless active against 7-benzyloxyresorufin and 7-methoxycoumarinjust as CYP337B1v4 is less active against these model substratesthan CYP337B1v1. This might be another indication that the Pak-istani CYP337B3v2 arose from CYP337B1v4 and the AustralianCYP337B3v1 from CYP337B1v1. The different activity could be dueto the nonsynonymous SNP at position 1093 resulting in a differentamino acid 365 (CYP337B1v1, 365I; CYP337B1v4, 365V) that islocated in the substrate recognition site 5 (Joußen et al., 2012) andcould therefore be important for substrate recognition and binding.

To confirm the role of CYP337B3v2 in the metabolism ofcypermethrin, in vitro assays were performed and analyzed byHPLC. The cypermethrin mixture (four trans- and four cis-isomers)used as parent compound was partially separated in trans- (44.4%)and cis-isomers (55.6%) on HPLC with retention times (Rt) of43.3min and 43.6min, respectively (Fig. 4Ab). Under the conditionsprovided, CYP337B3v2 was capable of metabolizing cypermethrinin 4 h to a main metabolite occurring in trans- (8.1%) and cis-configuration (19.8%) and possessing a Rt of 39.3 min and 39.6 min,respectively, and to a minor metabolite (1.5%) possessing a Rt of37.8 min (Fig. 4Ad). Overall, 29.3% of cypermethrin were metabo-lized in 4 h, while 70.7% unmetabolized cypermethrin (37.2% trans-and 33.5% cis-cypermethrin) were recovered. Recovery was about79%. These results show that CYP337B3v2 is more active on cis-isomers (turnover of 22.1%) than on trans-isomers (turnover of7.2%), which is consistent with statements in the literature that cis-isomers of cypermethrin are more sensitive to oxidative meta-bolism (Shono et al., 1979), while trans-isomers are more sensitiveto hydrolysis (Roberts and Hutson, 1999; Shono et al., 1979). Thisphenomenon was verified using a-cypermethrin as a substrate forCYP337B3v2. In total, the enzyme metabolized in 4 h 60.4% of theapplied a-cypermethrin resulting in 45.1% of the main metaboliteand 15.2% of the minor metabolite (Fig. 4Bc). The recovery wasabout 64%. No turnover of cypermethrin was detected by themicrosomal enzymes of the non-transgenic Ha2302 cells and themetabolism by CYP337B3v2 was inhibited completely by theabsence of NADPH and also by the addition of the P450 inhibitorpiperonyl butoxide, respectively (Fig. 4Ac and e and f).

A bioassay using the main metabolite revealed it to be notintrinsically toxic to susceptible larvae, as none of the treated larvaedied within 48 h, thus indicating that the hydroxylation is a bio-logically significant detoxification mechanism in vivo.

3.6. The main metabolite was identified as 40-hydroxy-a-cypermethrin

The main metabolite was isolated from scaled-up in vitro assaysperformed with a-cypermethrin as parent compound. a-Cyper-methrin was chosen to simplify the identification of the mainmetabolite by GC/EI-MS and 1H NMR; it consists only of two cis-isomers [(1S-cis, aR) and (1R-cis, aS)], that contribute about 25% tothe cypermethrin mixture and produce 90% of the insecticidal ac-tivity with the (1R-cis, aS)-isomer being the most toxic (Casidaet al., 1983). CYP337B3v2 metabolized on average 74% of theapplied a-cypermethrin in 24 h producing 46% of the mainmetabolite and 28% of the minor metabolite. The recovery was onlyabout 46%. In total, approximately 7.2 mg of the main metabolite (ina-cypermethrin equivalents), with a purity of almost 100% deter-mined at 230 nm by using the first HPLC system, could be isolated.The minor metabolite was lost during this isolation proceduremostlikely due to characteristics of the compound. The main metabolitewas further analyzed by GCeMS and 1H NMR.

Additionally using GCeMS, the main metabolite was separatedinto two peaks at 21.5 min and 21.7 min in a ratio of 1:5 (17% and83%, respectively). The mass spectra underlying both peaks belongto two different isomers of the same substance. The mass spectra(Figure S4) shows a molecular ion of m/z 431 that reflects the massof a-cypermethrin increased by the mass of 16, which indicates anadditional oxygen atom in the metabolite forming a hydroxylgroup. The fragment of m/z 224 is characteristic for the metaboliteand absent from the fragmentation pattern of the parent compoundsuggesting the hydroxyl group being attached to the aryloxy ring ofthe phenoxybenzyl alcohol moiety. Furthermore, the fragmenta-tion pattern shows that the fragments containing the two chlorineatoms of the acid moiety, indicated by a 10:6:1 isotope peak ratiowith a mass difference of m/z 2 in those fragments, are unchangedcompared to the parent compound.

The structure of the main metabolite was further elucidated bycomparing its 1H NMR spectra with that of a-cypermethrin(Table S5). In addition to extraction from the JHeH spinespincoupling constants, 1He1H connectivities were established by cross

Fig. 4. In vitro metabolism of cypermethrin by heterologously expressed CYP337B3v2. Depicted are HPLC chromatograms of in vitro metabolism studies with 4 nmol of cyper-methrin (A) and a-cypermethrin (B), respectively, per 0.8 mg of microsomal proteins and 4 h of incubation at 30 �C. Relevant parts of the chromatograms derived from detection at230 nm are displayed. Baselines were corrected by subtraction of a blank run. 1, cis-cypermethrin; 2, trans-cypermethrin; 3, 4'-hydroxy-cis-cypermethrin; 4, 4'-hydroxy-trans-cypermthrin; 5, putative cis-cypermethrin metabolite (hardly visible); 6, piperonyl butoxide. A. a, a-cypermethrin (reference compound); b, cypermethrin (reference compound); c,study performed with non-transgenic microsomes and NADPH regeneration system; d, study performed with CYP337B3v2 containing microsomes and NADPH regenerationsystem; e, study performed with CYP337B3v2 containing microsomes omitting the NADPH regeneration system; f, study performed with CYP337B3v2 containing microsomes,NADPH regeneration system, and 40 nmol of piperonyl butoxide. B. All studies were performed by using the NADPH regeneration system. a, a-cypermethrin (reference compound);b, study performed with non-transgenic microsomes; c, study performed with CYP337B3v2 containing microsomes.


signals observed in the corresponding 1He1H COSY spectra. Thechemical shifts and J values of the signals of the acidmoiety [3-(2,2-dichlorovinyl)-2,2-dimethylcylopropane carboxylate moiety]remained almost unchanged in the 1H NMR spectra of the metab-olite, excluding enzymatic modification in that part of the mole-cule. The signals of H-a and the four-spin system H-2/H-4 to H-6(for numbering of C atoms see Figure S4) exhibited only minorchanges of the chemical shifts suggesting that the cyanobenzyl unitof the alcohol moiety remained unchanged as well. The protons ofthe 3-phenoxy ring, which appeared in the parent a-cypermethrinas an AA'MM'C spin system, changed into an AA'MM0 characteristicfor a 1,4-disubstituted aryl ring. Hence, the new hydroxyl group isattached to C-4' of the 3-aryloxy ring and the main metabolite hasbeen identified as being 40-hydroxy-a-cypermethrin [a-cyano-3-(4-hydroxyphenoxy)-benzyl-3-(2,2-dichlorovinyl)-2,2-dimethylcylopropane carboxylate]. Comparable to the GS-MSanalysis, two isomers of this metabolite were found by 1H NMRin a ratio of 1:5 indicating that CYP337B3v2 is capable of metabo-lizing both isomers present in a-cypermethrin or that the twoisomers could be converted to each other spontaneously. Becausea-cypermethrin is a subset of cypermethrin the position of the newhydroxyl group is assumed to be the same for both compounds.

4. Discussion

The increasing insecticide resistance level of insect pest specieshinders their control and threatens agriculture. Different resistancemechanisms to pyrethroids have been reported in H. armigera,including target site insensitivity (Gunning, 1996; Gunning et al.,1991; McCaffery, 1998), metabolism by carboxylesterases(Gunning et al., 2007, 1999, 1996; Young et al., 2006, 2005), andP450s (Daly and Fisk, 1992; Heckel et al., 1998; Pittendrigh et al.,1997; Ranasinghe and Hobbs, 1999, 1998; Ranasinghe et al., 1998;Wee et al., 2008; Yang et al., 2004; Brun-Barale et al., 2010).

Recently, we described a new P450 gene, CYP337B3, that arose byunequal crossing-over between CYP337B1 and CYP337B2 from theAustralian fenvalerate resistantH. armigera strainTWB (Joußen et al.,2012). Here, we report on the same resistance gene that is evidentlynot restricted to Australian populations as previously thought, but is

also present in cypermethrin resistant populations in Pakistan. Full-length cloning and sequencing of the Pakistani CYP337B3v2 revealeda number of sequence differences compared to the AustralianCYP337B3v1. The two alleles differ by three nonsynonymous SNPsand the resulting differences in the deduced amino acid sequencelocatedat theC-terminus reflect thedifferencespreviously describedbetween the CYP337B1 allozymes (Joußen et al., 2012). Thus, theAustralian CYP337B3v1 resembles CYP337B1v1 or CYP337B1v3 at its3’ end, while the Pakistani CYP337B3v2 resembles CYP337B1v4.Furthermore, it is possible that the unequal crossover event shifted afew nucleotides up-stream of the proposed position of the crossoverevent of the Australian CYP337B3v1 (Joußen et al., 2012). In addition,the intron differs in length and sequence between the PakistaniCYP337B3v2 (1017 bp) and the Australian CYP337B3v1 (921 bp).Taking all three lines of evidence, it is likely that rather than in-dividuals ofH. armigera carryingCYP337B3 fromAustralia to Pakistanor vice versa, CYP337B3 instead evolved independently twice byunequal crossing-over between CYP337B2 and two differentCYP337B1 alleles. The very similar crossover region was most likelyfavoured by a longer stretch of sequence identity between CYP337B1and CYP337B2. However, the verification of this hypothesis ishampered by the fact that the parental genes, CYP337B1 andCYP337B2, have so far not been found in Pakistani populations. Theparental genes were probably selected against due to high selectionpressure by pyrethroids, which selects for individuals homozygousfor CYP337B3v2 which consequently have lost CYP337B1 andCYP337B2, because only heterozygous individuals can possess allthree genes (Joußen et al., 2012).

The slightly different amino acid sequence of the PakistaniCYP337B3v2 seems to have no impact on its metabolic capacityagainst pyrethroids compared to the Australian CYP337B3v1. Theheterologous enzyme showed a similar activity towards the modelsubstrates tested and acts in the same position on cypermethrin asthe Australian CYP337B3v1 acts on fenvalerate resulting in 4'-hydroxycypermethrin identified as the main metabolite. The for-mation of the corresponding metabolite could be explained by thefact that fenvalerate and cypermethrin share the same phenox-ybenzyl alcohol moiety. It is known that larvae of Heliothis virescensand H. armigera are capable of metabolizing trans-cypermethrin by


hydrolysis to trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylic acid and by oxidation to 2'- and 4'-hydroxy-trans-cypermethrin (Lee et al., 1989; Little et al., 1989). Both cis- andtrans-cypermethrin are oxidatively metabolized by mouse livermicrosomes mainly to 4'-hydroxycypermethrin, but also to 5-hydroxycypermethrin and trans-hydroxymethyl-cypermethrin,that are further oxidized to the corresponding aldehydes and car-boxylic acids (Shono et al., 1979). Carboxylesterases of the gut andthe integument of Trichoplusia ni larvae hydrolyze trans-cyper-methrin two- to six-fold faster than cis-cypermethrin (Ishaaya andCasida, 1980). It is possible that the minor metabolite, that wasdetected after incubation of CYP337B3v2 with a-cypermethrin butremained unidentified, was a hydroxymethyl-cypermethrin. Ourresults support the observations that cis-isomers of cypermethrinare more sensitive to oxidation than trans-isomers (Shono et al.,1979) as CYP337B3v2 is more active on cis-cypermethrin than ontrans-cypermethrin.

Toxicity bioassays including the resistant FSD strain, the resis-tant TWBR line, and the susceptible TWBS line revealed a 7- and 6-fold resistance, respectively, of the resistant larvae compared to thesusceptible larvae demonstrating similar resistance levels in thePakistani strain and the resistant Australian line. This indicates thatthe resistance level observed is most likely due to the metabolicactivity of CYP337B3, because the presence of CYP337B3 is themostimportant difference between the resistant and the susceptiblelines. We also demonstrated in a bioassay with susceptible larvaethat the main metabolite 4'-hydroxy-a-cypermethrin is either notintrinsically toxic, or that it could be easily metabolized to anontoxic compound even in the susceptible larvae, as we previ-ously reported for 4'-hydroxyfenvalerate (Joußen et al., 2012). Thehydroxylated metabolite may be further glycosylated in the larvaeincreasing its hydrophilicity even more compared to the highlylipophilic (log KOW of 6.6; Roberts and Hutson, 1999) and almostwater insoluble (4 mg L�1 at 20 �C; Roberts and Hutson, 1999)parent compound, which would greatly facilitate its excretion.

Comparison of resistance levels indicates that other mecha-nisms, including target-site insensitivity, may be important in otherpyrethroid-resistant strains of H. armigera. The resistance levelobserved in the FSD strain is much lower than reported by Yanget al. (2004) for the Pakistani field collected strain PAK ofH. armigerawith a resistance factor (RF) of 4100 (to cypermethrin),by Alvi et al. (2012) for another Pakistani population with a RF of1949 (to cypermethrin), by Forrester et al. (1993) for an Australianstrain with a RF of 25 (to cypermethrin) and by Ahmad andMcCaffery (1999) for a resistant Thai strain with a RF of 20 (totrans-cypermethrin). Tan and McCaffery (2007) describe a 182-foldresistance of the Chinese H. armigera strain CMR to cypermethrin, a487-fold resistance to cis-cypermethrin and an 86-fold resistanceto trans-cypermethrin. Because the resistance factor is calculatedby the division of the LD50 of the resistant strain by the LD50 of thesusceptible strain, both an increased LD50 of the resistant strain anda decreased LD50 of the susceptible strain may lead to an increasedresistance factor. A comparison of the LD50 of the Pakistani FSD(532 ng/larva) to the Chinese CMR (310 ng/larva) regardingcypermethrin reveals that FSD is more resistant than CMR. The RFreported by Tan and McCaffery (2007) is higher because theycompared the CMR strain to the extremely susceptible Readingstrain, a laboratory strain that was collectedmore than 20 years agoin South Africa, possessing a LD50 of 2 ng per larva while the sus-ceptible TWBS line possesses a LD50 of 77 ng per larva, thus being39-fold more resistant than Reading. However, the Pakistani PAKstrain exhibits a LD50 of 23,752 ng per larva (Yang et al., 2004) and isthus 45-fold more resistant than the FSD strain. The susceptiblelaboratory SCD strain used by Yang et al. (2004), which was origi-nally collected from the Cote D'Ivoire in the 1970s andwas provided

by Bayer CropScience, possesses a LD50 of 5.8 ng per larva so that itis 13-fold less resistant than the susceptible TWBS line. The resis-tance level of FSD can be suppressed by PBO to the resistance levelfound in TWBS but not below this level. This indicates that FSD hasa basal resistance level similar to TWBS but is more resistantbecause of the presence of CYP337B3, and that FSD and TWB havean additional resistance mechanism compared to Reading and SCDthat is not suppressible by PBO.

The AFLP analysis in the backcross of FSD with TWBS did notidentify any further genes in addition to CYP337B3v2 contributing tothe cypermethrin resistance of the FSD strain. The phenotype ofresistance, and theCYP337B3v2gene,werebothmapped to the linkagegroup homologous to B. mori Chromosome 15, while expression dif-ferences of other P450swerenot influencedby this linkage group. Thisshows that up-regulation of a P450 gene in a resistant strain does notnecessarily prove its involvement in resistance (as previously pointedout by Brun-Barale et al. (2010) for African H. armigera). Althoughrarely attempted, testing for linkage between the phenotype of resis-tance and the phenotype of P450 expression level is important. Notonly can this test rule out involvement of upregulation in resistance(e.g. Grubor and Heckel (2007) for CYP6B enzymes in Australianpyrethroid-resistant H. armigera), it can also confirm the role ofupregulation. For example, in the classic case of P450-mediatedinsecticide resistance in the housefly, the genetic factor causingconstitutive overexpression of CYP6A1 maps to the same locus deter-mining diazinon resistance, while the diazinon-metabolizing CYP6A1itselfmaps to a different chromosome (Cohen et al.,1994; Carin~o et al.,1994; Sabourault et al., 2001).

Multiple origins of the same insecticide resistance mechanismhave been convincingly documented by recent studies in otherorganisms. Identical point mutations in the voltage-gated sodiumchannel, the primary target of pyrethroid insecticides, have beenfound associated with different haplotypes in different geograph-ical regions, in mosquitoes (Pinto et al., 2007) and in houseflies(Rinkevich et al., 2012). Similarly, distinctly different haplotypebackgrounds have been found to harbour the same point mutationsin an esterase gene conferring organophosphorus resistance in thesheep blowfly (Newcomb et al., 2005). Such examples are rare,although not unexpected in cases where a single amino acid sub-stitution can confer target-site insensitivity, or dramatically alterthe substrate specificity of an enzyme. The background nucleotidesubstitution ratewould be the rate-limiting factor in the occurrenceof such multiple origins. Although we cannot estimate the back-ground rate of unequal crossing-over, it is likely to be much lower;attesting to the powerful selective force of insecticide resistance inbringing these extremely rare events to the fore.

We have found that the chimeric P450 gene CYP337B3 is morewidespread among populations of H. armigera from differentgeographical origins than previously thought, and that the encodedenzyme confers also cross-resistance to at least one more pyre-throid insecticide than determined earlier. These findings greatlyincrease the importance of this resistance mechanism, which mayplay a prominent role in the pyrethroid resistance of H. armigeraworldwide. The fact that the presence or absence of CYP337B3 canbe easily detected in a population by a simple screening PCR is apowerful tool to rapidly distinguish resistant from susceptiblepopulations in the field. Currently, we are investigating H. armigerapopulations from different countries to determine the geographicaldistribution of CYP337B3 and to address the possible multipleorigin of the remarkable CYP337B3 gene.

Acknowledgements

We thank Dr. Heiko Vogel for providing access to the cDNA li-brary of the H. armigera strain TWB, Dr. Mushtaq Ahmad for


guidance in performing toxicity bioassays, Dr. Yannick Pauchet forhis help with the 5' and 3' RACE-PCRs, Dr. Melanie Unbehend, AnneKarpinski, and Susanne Donnerhacke for their help in the AFLPanalysis, Domenica Schnabelrauch for sequencing, and AnnekePurz and Rico Arnold for technical assistance in rearing the TWBSand TWBR lines. Financial support was provided by the HigherEducation Commission of Pakistan and the Max-Planck-Gesellschaft, Germany. N.J. was supported by a grant from theDeutsche Forschungsgemeinschaft (DFG, Germany; JO 855/1-1).

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.ibmb.2014.07.006.

References

Aheer, G.M., Aziz, M.A., Hameed, A., Ali, A., 2009. Evaluation of resistance todifferent insecticides in field strains of Helicoverpa armigera (Lepidoptera:Noctuidae) in Punjab. Pak. Entomol. Res. 39, 159e167.

Ahmad, M., 2004. Potentiation/antagonism of deltamethrin and cypermethrinswith organophosphate insecticides in the cotton bollworm, Helicoverpa armi-gera (Lepidoptera: Noctuidae). Pestic. Biochem. Physiol. 80, 31e42.

Ahmad,M., Arif, M.I., Ahmad, Z.,1995.Monitoring insecticide resistance ofHelicoverpaarmigera (Lepidoptera: Noctuidae) in Pakistan. J. Econ. Entolmol. 88, 771e776.

Ahmad, M., Arif, M.I., Attique, M.R., 1997. Pyrethroid resistance of Helicoverpaarmigera (Lepidoptera: Noctuidae) in Pakistan. Bull. Entomol. Res. 87, 343e347.

Ahmad, M., McCaffery, A.R., 1999. Penetration and metabolism of trans-cyper-methrin in a susceptible and a pyrethroid-resistant strain of Helicoverpa armi-gera. Pestic. Biochem. Physiol. 65, 6e14.

Aljanabi, S.M., Martinez, I., 1997. Universal and rapid salt-extraction of high qualitygenomic DNA for PCR-based techniques. Nucleic Acids Res. 25, 4692e4693.

Alvi, A.H.K., Sayyed, A.H., Naeem, M., Ali, M., 2012. Field evolved resistance inHelicoverpa armigera (Lepidoptera: Noctuidae) to Bacillus thuringiensis toxinCyp1Ac in Pakistan. PLoS ONE 7, e47309.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein-dye binding. Anal.Biochem. 72, 248e254.

Brun-Barale, A., H�ema, O., Martin, T., Suraporn, S., Audant, P., Sezutsu, H.,Feyereisen, R., 2010. Multiple P450 genes overexpressed in deltamethrin-resistant strains of Helicoverpa armigera. Pest Manag. Sci. 66, 900e909.

Carin~o, F.A., Koener, J.F., Plapp Jr., F.W., Feyereisen, R., 1994. Constitutive over-expression of the cytochrome P450 gene CYP6A1 in a housefly strain withmetabolic resistance to insecticides. Insect Biochem. Mol. Biol. 24, 411e418.

Casida, J.E., Gammon, D.W., Glickman, A.H., Lawrence, L.J., 1983. Mechanisms ofselective action of pyrethroid insecticides. Ann. Rev. Pharmacol. Toxicol. 23,413e438.

Cohen, M.B., Koener, J.F., Feyereisen, R., 1994. Structure and chromosomal locali-zation of CYP6A1, a cytochrome P450-encoding gene from the housefly. Gene146, 267e272.

Daly, J.C., Fisk, J.H., 1992. Inheritance of metabolic resistance to the synthetic py-rethroids in Australian Helicoverpa armigera (Lepidoptera: Noctuidae). Bull.Entomol. Res. 82, 5e12.

Forrester, N.W., Cahill, M., Bird, L.J., Layland, J.K., 1993. Management of pyrethroidand endosulfan resistance in Helicoverpa armigera (Lepidoptera: Noctuidae) inAustralia. Bull. Entomol. Res. Suppl. 1, 1e132.

Grubor, V.D., Heckel, D.G., 2007. Evaluation of the role of CYP6B cytochrome P450sin pyrethroid resistant Helicoverpa armigera. Insect Mol. Biol. 16, 15e23.

Gunning, R.V.,1996. Bioassay for detecting pyrethroid nerve insensitivity in AustralianHelicoverpa armigera (Lepidoptera: Noctuidae). J. Econ. Entomol. 89, 816e819.

Gunning, R.V., Easton, C.S., Balfe, M.E., Ferris, I.G., 1991. Pyrethroid resistancemechanisms in Australian Helicoverpa armigera. Pestic. Sci. 33, 473e490.

Gunning, R.V., Moores, G.D., Devonshire, A.L., 1999. Esterase inhibitors synergise thetoxicity of pyrethroids in Australian Helicoverpa armigera (Hubner) (Lepidop-tera: Noctuidae). Pestic. Biochem. Physiol. 63, 50e62.

Gunning, R.V., Moores, G.D., Devonshire, A.L., 1996. Esterases and esfenvalerateresistance in Australian Helicoverpa armigera (Hübner) Lepidoptera:Noctuidae.Pestic. Biochem. Physiol. 54, 12e23.

Gunning, R.V., Moores, G.D., Jewess, P., Boyes, A.L., Devonshire, A.L., Khambay, B.P.S.,2007. Use of pyrethroid analogues to identify key structural features forenhanced esterase resistance in Helicoverpa armigera (Hübner) (Lepidoptera:Noctuidae). Pest Manag. Sci. 63, 569e575.

Heckel, D.G., Gahan, L.J., Daly, J.C., Trowell, S., 1998. A genomic approach to un-derstanding Heliothis and Helicoverpa resistance to chemical and biologicalinsecticides. Philos. Trans. R. Soc. Lond. B Biol. Sci. 353, 1713e1722.

Heckel, D.G., Gahan, L.J., Liu, Y.-B., Tabashnik, B.E., 1999. Genetic mapping of resis-tance to Bacillus thuringiensis toxins in diamondback moth using biphasiclinkage analysis. Proc. Natl. Acad. Sci. USA 96, 8373e8377.

Ishaaya, I., Casida, J.E., 1980. Properties and toxicological significance of esteraseshydrolyzing permethrin and cypermethrin in Trichoplusia ni larval gut andintegument. Pestic. Biochem. Physiol. 14, 178e184.

Joußen, N., Agnolet, S., Lorenz, S., Sch€one, S.E., Ellinger, R., Schneider, B.,Heckel, D.G., 2012. Resistance of Australian Helicoverpa armigera to fenvalerateis due to the chimeric P450 enzyme CYP337B3. Proc. Natl. Acad. Sci. USA 109,15206e15211.

Joyner, K., Gould, F., 1985. Developmental consequences of cannibalism in Heliothiszea (Lepidoptera, Noctuidae). Ann. Entomol. Soc. Am. 78, 24e28.

Kaiser, T.S., Heckel, D.G., 2012. Genetic architecture of local adaptation in lunar anddiurnal emergence times of the marine midge Clunio marinus (Chironomidae,Diptera). PloS ONE 7, e32092.

Lee, K.-S., Walker, C.H., McCaffery, A., Ahmad, M., Little, E., 1989. Metabolism oftrans-cypermethrin by Heliothis armigera and H. virescens. Pestic. Biochem.Physiol. 34, 49e57.

Little, E.J., McCaffery, A.R., Walker, C.H., Parker, T., 1989. Evidence for an enhancedmetabolism of cypermethrin by a monooxygenase in a pyrethroid-resistantstrain of the tobacco budworm (Heliothis virescens F.). Pestic. Biochem. Phys-iol. 34, 58e68.

McCaffery, A.R., 1998. Resistance to insecticides in heliothine Lepidoptera: a globalview. Philos. Trans. R. Soc. Lond. B Biol. Sci. 353, 1735e1750.

Nibouche, S., Bu�es, R., Toubon, J.-F., Poitout, S., 1998. Allozyme polymorphism in thecotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae): comparison ofAfrican and European populations. Heredity 80, 438e445.

Newcomb, R.D., Gleeson, D.M., Yong, C.G., Russell, R.J., Oakeshott, J.G., 2005. Mul-tiple mutations and gene duplications conferring organophosphorus insecticideresistance have been selected at the Rop-1 locus of the sheep blowfly, Luciliacuprina. J. Mol. Evol. 60, 207e220.

Pinto, J., Lynd, A., Vicente, J.L., Santolamazza, F., Randle, N.P., Gentile, G., Moreno, M.,Simard, F., Charlwood, J.D., do Ros�ario, V.E., Caccone, A., della Torre, A.,Donnelly, M.J., 2007. Multiple origins of knockdown resistance mutations in theAfrotropical mosquito vector Anopheles gambiae. PLoS ONE 2, e1243.

Pittendrigh, B., Aronstein, K., Zinkovsky, E., Andreev, O., Campbell, B., Daly, J.,Trowell, S., ffrench-Constant, R.H., 1997. Cytochrome P450 genes from Heli-coverpa armigera: expression in a pyrethroid-susceptible and -resistant strain.Insect Biochem. Mol. Biol. 27, 507e512.

Ranasinghe, C., Hobbs, A.A., 1999. Induction of cytochrome P450 CYP6B7 and cy-tochrome b5 mRNAs from Helicoverpa armigera (Hubner) by pyrethroid in-secticides in organ culture. Insect Mol. Biol. 8, 443e447.

Ranasinghe, C., Hobbs, A.A., 1998. Isolation and characterization of two cytochromeP450 cDNA clones for CYP6B6 and CYP6B7 from Helicoverpa armigera (Hubner):possible involvement of CYP6B7 in pyrethroid resistance. Insect Biochem. Mol.Biol. 28, 571e580.

Ranasinghe, C., Campbell, B., Hobbs, A.A., 1998. Over-expression of cytochromeP450 CYP6B7 mRNA and pyrethroid resistance in Australian populations ofHelicoverpa armigera (Hübner). Pestic. Sci. 54, 195e202.

Rinkevich, F.D., Hedtke, S.M., Leichter, C.A., Harris, S.A., Su, C., Brady, S.G., Taskin, V.,Qiu, X., Scott, J.G., 2012. Multiple origins of kdr-type resistance in the house fly,Musca domestica. PLoS ONE 7, e52761.

Roberts, T., Hutson, D., 1999. Metabolic Pathways of Agrochemicals e Part Two:Insecticides and Fungicides. R. Soc. Chem., Cambridge, pp. 610e622.

Robinson, R., 1971. Lepidoptera Genetics. Pergamon Press, Oxford.Sabourault, C., Guzov, V.M., Koener, J.F., Claudianos, C., Plapp Jr., F.W., Feyereisen, R.,

2001. Overproduction of a P450 that metabolizes diazinon is linked to a loss-of-function in the chromosome 2 ali-esterase (MdaE7) gene in resistant houseflies. Insect Mol. Biol. 10, 609e618.

Sahara, K., Yoshido, A., Shibata, F., Fujikawa, N., Okabe, T., Tanaka-Okuyama, M.,Yasukochi, Y., 2013. FISH identification of Helicoverpa armigera and Mamestrabrassicae chromosomes by BAC and fosmid probes. Insect Biochem. Mol. Biol.43, 644e653.

Shono, T., Ohsawa, K., Casida, J.E., 1979. Mechanism of trans- and cis-permethrin,trans- and cis-cypermethrin, and decamethrin by microsomal enzymes. J. Agric.Food Chem. 27, 316e325.

Simpson, A.J., Brown, S.A., 2005. Purge NMR: effective and easy solvent suppression.J. Magn. Reson. 175, 340e346.

Stewart, A., 2013. http://agfax.com/2013/03/25/caterpillars-attack-brazils-crops/,9th of January 2014.

Suomalainen, E., Cook, L.M., Turner, J.R., 1973. Achiasmatic oogenesis in the heli-coniine butterflies. Hereditas 74, 302e304.

Tan, J., McCaffery, A.R., 2007. Efficacy of various pyrethroid structures against ahighly metabolically resistant isogenic strain of Helicoverpa armigera (Lepi-doptera: Noctuidae) from China. Pest Manag. Sci. 63, 960e968.

Tang, Q., Yan, Y., Zhao, X., Wang, C., 2005. Testes and chromosomes in interspecifichybrids between Helicoverpa armigera (Hübner) and Helicoverpa assulta(Guen�ee). Chin. Sci. Bull. 50, 1212e1217.

Tay, W.T., Soria, M.F., Walsh, T., Thomazoni, D., Silvie, P., Behere, G.T., Anderson, C.,Downes, S., 2013. A brave newworld for an old world pest: Helicoverpa armigera(Lepidoptera: Noctuidae) in Brazil. PLoS ONE 8, e80134.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., van De Lee, T., Hornes, M., Friters, A.,Pot, J., Paleman, J., Kuiper, M., 1995. AFLP: a new technique for DNA finger-printing. Nucleic Acids Res. 23, 4407e4414.

Waxman, D.J., Chang, T.K.H., 2006. Use of 7-ethoxycoumarin to monitor multipleenzymes in the human CYP1, CYP2, and CYP3 families. In: Phillips, I.R.,Shephard, E.A. (Eds.), Methods in Molecular Biology, Cytochrome P450 Pro-tocols, second ed., vol. 320. Humana, Totowa, NJ, pp. 153e156.



http://refhub.elsevier.com/S0965-1748(14)00118-0/sref1











































































































































































http://agfax.com/2013/03/25/caterpillars-attack-brazils-crops/


























Wee, C.W., Lee, S.F., Robin, C., Heckel, D.G., 2008. Identification of candidate genesfor fenvalerate resistance in Helicoverpa armigera using cDNA-AFLP. Insect Mol.Biol. 17, 351e360.

Yang, Y., Wu, Y., Chen, S., Devine, G.J., Denholm, I., Jewess, P., Moores, G.D., 2004. Theinvolvement of microsomal oxidases in pyrethroid resistance in Helicoverpaarmigera from Asia. Insect. Biochem. Mol. Biol. 34, 763e773.

Yoshido, A., Bando, H., Yasukochi, Y., Sahara, K., 2005. The Bombyx mori karyotypeand the assignment of linkage groups. Genetics 170, 675e685.

Young, S.J., Gunning, R.V., Moores, G.D., 2006. Effect of pretreatment with piperonylbutoxide on pyrethroid efficacy against insecticide-resistant Helicoverpa

armigera (Lepidoptera: Noctuidae) and Bemisia tabaci (Sternorrhyncha: Aleyr-odidae). Pest Manag. Sci. 62, 114e119.

Young, S.J., Gunning, R.V., Moores, G.D., 2005. The effect of piperonyl butoxide onpyrethroid-resistance-associated esterases in Helicoverpa armigera (Hübner)(Lepidoptera: Noctuidae). Pest Manag. Sci. 61, 397e401.

Zhang, H., Yin, W., Zhao, J., Jin, L., Yang, Y., Wu, S., Tabashnik, B.E., Wu, Y., 2011. Earlywarning of cotton bollworm resistance associated with intensive planting of Btcotton in China. PLoS ONE 6, e22874.
























1

Supplementary Material

Figures and tables

Figure S1. Maximum-likelihood tree of 63 P450 proteins from H. armigera. Protein

sequences were aligned using Clustal W, and the tree was constructed using RAxML on the

CIPRES Science Gateway server and drawn using FigTree. Asterisks denote proteins that

were not investigated using RT-qPCR in this study.

2

Figure S2. AFLP banding pattern and presence of CYP337B3 associated with resistance. (A) Part of a representative AFLP gel showing the pattern for an AFLP fragment (indicated

by the arrowhead) strongly associated with resistance. (B) The same individuals of the

female-informative backcross tested in the AFLP analysis were screened by PCR for the

presence or absence of CYP337B3 revealing a strong correlation between the presence of

CYP337B3 and resistance. A plasmid containing CYP337B3 served as a positive control and a

water sample as a negative control.

Figure S3. mRNA abundance of three P450 genes in backcross larvae (BC) possessing

the resistance gene CYP337B3v2 or lacking CYP337B3v2 compared to larvae of the

resistant FSD strain and the susceptible TWBS line. Error bars represent the standard

deviation; bars from the same gene sharing the same letter are not significantly different at p <

0.05.

3

Figure S4. Mass spectra of 4′-hydroxy-α-cypermethrin in comparison to its parent

compound α-cypermethrin. Peaks corresponding to the fragments indicated by the lines in

the chemical structure are highlighted by their masses. The 10:6:1 isotope peak ratio with a

mass difference of m/z 2 of some fragments indicates the presence of the chlorine atom in

those fragments. The molecular ion of the metabolite appears at m/z 431 reflecting an increase

by the mass of 16 compared to its parent compound α-cypermethrin (m/z 415). Carbon atoms

of the chemical structure of 4′-hydroxy-α-cypermethrin are numbered consecutively matching

the numbers used in the analysis of the 1H-NMR spectrum (Table S5). *, chiral centers.

4

Table S1. Primers for screening of CYP337B1, CYP337B2, CYP337B3, for detection of

CYP337B3 in the AFLP analysis, for cloning of CYP337B3v2 and the intron region and

for the ribosomal protein genes

Gene Forward primer (5'-3') Reverse primer (5'-3')

Screening

CYP337B1 AATAATAAGCAACGCCAATGACTTAC TGCAATAACAACTATTACATTTTGAATAAA

CYP337B2 AATAATAACCAGTCCAAACGATGTGT CGCAATTATAGTCACTATGATTGCATATA

CYP337B3 AATAATAACCAGTCCAAACGATGTGT TGCAATAACAACTATTACATTTTGAATAAA

AFLP

CYP337B3 CGATGCCAGAACTAATCAAATCG TCAATTTCCTCATGTAGTTTTGCC

Cloning

CYP337B3v2 CACGATGGTGTTCGTAATATTACTC GATTTATATGTCTCTTAACTTTAATTCATAACC

Intron

CYP337B3 AATAATGATTCCAGTGTTCGGTCTT AAGGTAAAACGACGTAACAGCCA

Ribosomal genes

RPS23 AAAGAAGGAAAGGCCACGTT ACAACACAGCTTTGCAGCAG

RPL8 ACTTCCGTGACCCGTACAAG AGGATTGTGGCCGATAACAG

RPL10A CGCTGAGGCACTCAAGAAA GAGGGATTCTGATGCAAGGA

m14_FLX ATCTCGCCTGGATCAACACT GATGTTCATCGGACCCAGAC

5

Table S2. Primer combinations used for male- and female-informative backcrosses and

number of informative AFLP markers per cross and primer combination

Mse Eco Male-informative Female-informative

CAT

AAG(700) 15 16

CAT(800) 12 11

ACC(700) 7 9

CGC(800) 7 10

TAC(700) 17 19

GTA(800) 12 12

ACA

AAG(700) 15 8

CAT(800) 7 6

CGC(800) 13 13

GTA(800) 11 14

ACG

AAG(700) 14 12

CAT(800) 10 8

ACC(700) 10 10

CGC(800) 9 5

CGA

AAG(700) 10 8

CAT(800) 8 9

ACC(700) 10 11

ACT(800) 7 7

CGC(800) 7 7

CTT

AAG(700) 13 9

CAT(800) 5 9

ACC(700) 11 9

ACT(800) 13 11

CGC(800) 9 3

Total markers 252 236

6

Table S3. List of primer pairs used for RT-qPCR and the expression analysis Gene Forward primer (5'-3') Reverse Primer (5'-3') GenBank Accession no.

CYP4G8 TCTGACCTGAAGGAGGAGGA TAGCAGGCTTTGGTTGGTTT KM016724

CYP4G9 CCACCCTCAGCACTACAAGG GGTCCAGCACTGAATGGAAT KM016725

CYP4G26 TGACCTCCGATGTGACTGAG TCTGCCTGGGTTCAATCTTC KM016723

CYP4L5 GTGCTGGTCCGAGAAATTGT GTTCAGGCTCTTGAGGTGCT KM016727

CYP4L11 GCATTCTTGGACCTGTTGCT TCGTGACCCTCAAACATGAA KM016726

CYP4M6v2 AATAGCCGTAGCGGAGGTTT CAGGTCCTTCGTTCCTGAAG KM016729

CYP4M7v2 AGCGCTGGTCCTAGAAATTG ATGGTTTCGTCACTGGCTTC KM016730

CYP4M10v2 ATTGCGGAACTTCGTATTG TGAAATTGACGACCACTGGA KM016728

CYP4S2 CAGCTTGATGCCCACGAT GCGTATGGCGTCGTCTAGTT KM016732

CYP4S12 TGCGTAACTTCAAGCTGGTG AGATAGGGTCAACGGGTCTG KM016731

CYP4S13 CTATGCATCCGTACGCCTTT CGACAAATTCCACTCAGCAC EF591060

CYP4AU1 TGCAGTAGTGCCAATGGTGT TCGGTCCACACTGTTCTCTG KM016722

CYP6B2v3 ATTGGACCGAAAGGAGGAAT TTCATGGTCCGTTGTCGTTA KM016746

CYP6B6v2 ATTGGACCGAAAGGAGGAAT CCGTTACTTGTACCGTCATTATAGC KM016748

CYP6B8 CAATGGATATCAGCCCGTTT GCAGGCTTCTTGTTGACGAC KM016749

CYP6B43 TTGTAGGGAGGTTATTGAAGCAG TGCCTTCTCGTCTCAAGTCC KM016747

CYP6AB9 CATAGGTGAGCGGCTAGGTC TGCACTATGCTGGACTGAGG KM016734

CYP6AB10 TGTGTTGGTGCCAGATTAGG CTACGAAACCTTCGGAAACG KM016733

CYP6AE11 TCTCACATTGCCTTTCACTCC ACTCCCAAAGAACCCACTCC KM016735

CYP6AE12 AGATGAGGCTCTGCGTCTGT CAGATGCACCCTCAGACCTT KM016736

CYP6AE14 GGATCCGGAGGAGTATAGGC TACAAAGTCTCGGGCCTTCA KM016737

CYP6AE15v2 CCCTTACTGAGCCGATTTGA ATCTGCGTGTCGGGAGATAG KM016738

CYP6AE16 GTTCCTGCCTGAGAACAAGC CTTCGTCTTCATCCCTGGAG KM016739

CYP6AE17 GTTCCTGCCTGAGAACAAGC TAATTATTCCCGCCGTCATC KM016740

CYP6AE19 GCATATGTTCTTGCGCCTTC TTTGATTGCCCATGAATCTG KM016741

CYP6AE20v2 CTGGCAGGCCTTGTCACTAT GCATCGAACACCAGGTCTCT KM016742

CYP6AE23 ACAGCTTGTTGCCAGTTAAGC ACCGTCTATTTGCGTCCGTA KM016744

CYP6AE24 CCAAATTGAGAACCTCCTCCT CCACGCACTTAGGAACACAA KM016743

CYP6AN1 ATCGAAGAGTTGGGCATCAC TATCCGGCATGAACTTCTCC KM016745

CYP9A3 GTGCTTATTCGGGAGATGGA CCCTGTAGCTGCATGTTGAA KM016754

CYP9A12 TCTGCGAGATGAAGGTGATG TTTCAGTCGCATGTTGAAGG AY371318

CYP9A14 ATGGAAGTCAGCGAGCAGAT TATCACATCGTTGGCGTAGC KM016750

CYP9A15 GGATCGAGGTTTGCTCTCTG ATTGTTAGCCGCAAGTTTGG KM016751

CYP9A17 CTATGGGCGGCACGTTTAT CCACTATTGTTTGAGCGGAGA KM016752

CYP9A23v3 CAGATCTTACGGCACATGGA AAGCCAGTGTCCTCCTTTCA KM016753

CYP9A34 TGTGCGAGATGAAAGCGATA AGGTTGAACTGATCGGGAGA KM016755

CYP9G5 TTCCCGAACCAGACAAGTTT ATCATCGCGAACCTCATACC KM016757

CYP9AJ1 GCAGCAAAGGTATTCCTGGT CCTGGGTCTCAGTATGAATGC KM016756

CYP302A1 CAAGTCCCTCAAAGCGTGA TTGCTTTAGCCCATTGCAC KM016700

CYP304F1 CCTGCCGTACAGTTTGTCCT GACGACGCGGTCTATCTCTT KM016701

CYP305B1 AGTACTCATGTCGCTGGGAGA CGCTTTCGTCAATGAACCTT KM016702

CYP306A1 ACCTCTGTTACGCTGGCTTG TAGTTGAGAGCCGTCGACCT KM016703

CYP307A1 GCAGGAGTTTGAAATAGGAGCA GAATCAATGCTTTCTGGGAATC KM016704

CYP321A5 TGGAATGGGAAACAGGACAT CTGCTGGCTTTCTGGGATAG KM016705

CYP321B1 CGAGATACGCACGAATTCAA TTGTACTGGATGCCTCCTTTG KM016706

CYP324A1 TATGCCGTTTGGAGAAGGAC TGTTTGGCAGCACTCTCACT KM016707

CYP332A1 CCCGAGGTTCTGCATAGGTA CCACGATCTTAGGTGCATCA KM016708

CYP333A1 CGGCTTCGGAATAAGGAGTT CCCTCCCACGTAACTTTGAA KM016709

CYP333B3 GGCCAACACAGTCACAGCTA GGACACAATTTCCTCCCTCA KM016710

CYP340G1 GCAGATGTCACCAAGATGGA CCTCATCCTCATCACCAACA KM016711

CYP340H1 CCGGACAAGGATCAGTTCAT CCGATACAGTTGCGTCTGC KM016712

7

CYP340H2 TATGCACACGCAACAGATGA GCTTGCCGAAGTCCATTTAT KM016713

8

Table S3. Continued

Gene Forward primer (5'-3') Reverse Primer (5'-3') GenBank Accession no.

CYP340J1 TCAATATGGCGGATGAACAA TGGATTTGACCCAAGAAGGA KM016714

CYP340K1 ACGGCAAACAAGACTTTGCT CGCCAACATCACCTTTCATA KM016715

CYP341B2 GGCTACCAATACGCGATGAT GCCATTACTTCTGGCCATGT KM016716

CYP341B7 AATGACACCCGTCATCCATT AGGTCACTATGCAGCCAAGG KM016717

CYP354A3 GGTCTGAGATTCGCCATGTT CTGAATGGGATCAACCGTCT KM016718

CYP367A8 TGAACCAGAAAGGGCCACTA TTTGCTGTCTTCCGTTGGTT KM016719

CYP367B2 AGAGCGGTTCAATCCAGAAA TGCCGAAGTATCTTCCCAAA KM016720

CYP428A1 CCATCTGGCAAACTCATTAGC GGCCTTTGTCCATTGAAGTG KM016721

eIF4A AGCAAATCCAAAAGGTGGTG AGAGCACGGCGAGTTATCAT JK139881

RPS18 ACTGCCATCAAGGGTGTTG TGTATTGCCTGGGGTTAGACA JK127315

9

Table S4. P450 mRNA expression levels in three strains of Helicoverpa armigera as

determined by RT-qPCR. Copy number estimates ± standard error of the mean are given per

1000 copies of mRNA for reference gene eIF4A. Ratios of copy numbers are shown in

separate columns for up- or down-regulation in each resistant strain, relative to the susceptible

TWBS strain. sig., statistical significance of t-test: ns P > 0.05; * P < 0.05, ** P < 0.01, *** P

< 0.001, nd, not detected.

P450 FSD vs TWBS

sig. FSD ± SE per 1000 eIF4A

TWBS ± SE per 1000 eIF4A

TWBR ± SE per 1000 eIF4A

TWBR vs TWBS sig.

up down up down

CYP340G1 146.6 ** 40.1 ± 8.0 0.3 ± 0.2 1.6 ± 0.4 5.7 ns

CYP340H1 15.3 *** 12.3 ± 1.5 0.8 ± 0.1 6.2 ± 2.0 7.7 ns

CYP341B2 6.5 ** 7.1 ± 1.2 1.1 ± 0.1 0.7 ± 0.1 1.6 ns

CYP9AJ1 5.0 ** 2.2 ± 0.4 0.4 ± 0.1 0.7 ± 0.2 1.5 ns

CYP340H2 4.6 * 0.1 ± 0.03 0.03 ± 0.01 0.3 ± 0.1 8.2 ns

CYP9G5 4.0 ns 4.1 ± 1.3 1.0 ± 0.2 1.2 ± 0.1 1.2 ns CYP367B2 3.2 ns 3.4 ± 1.3 1.1 ± 0.2 1.3 ± 0.2 1.2 ns

CYP9A3 3.2 *** 34.0 ± 2.2 10.6 ± 0.6 14.8 ± 1.5 1.4 ns

CYP6AB9 3.1 *** 425.3 ± 44.5 138.9 ± 8.6 195.0 ± 20.7 1.4 ns CYP4S12 2.3 *** 10.2 ± 0.7 4.4 ± 0.9 2.9 ± 0.3 1.5 ns

CYP341B7 2.0 * 1.0 ± 0.1 0.5 ± 0.1 0.8 ± 0.2 1.5 ns

CYP6B6v2 1.7 ns 16.4 ± 5.1 9.9 ± 6.2 60.2 ± 22.9 6.1 ns CYP4G8 1.5 ns 2448.2 ± 393.2 1602.9 ± 148.0 1800.7 ± 250.9 1.1 ns

CYP6AE17 1.5 ns 514.8 ± 68.1 337.8 ± 48.5 232.5 ± 25.6 1.5 ns

CYP9A34 1.4 * 40.3 ± 3.9 28.1 ± 1.7 82.2 ± 17.1 2.9 ns CYP4S13 1.4 ns 4.3 ± 0.6 3.0 ± 0.8 4.1 ± 0.4 1.3 ns

CYP6AE14 1.4 * 42.8 ± 3.8 30.8 ± 1.7 19.6 ± 2.8 1.6 ns

CYP4M7v2 1.0 ns 26.9 ± 4.0 25.9 ± 1.1 41.1 ± 4.3 1.6 ns CYP306A1 1.0 ns 23.6 ± 5.4 22.8 ± 4.1 38.3 ± 4.5 1.7 ns

CYP4G26 1.0 ns 36.0 ± 7.9 36.4 ± 6.1 35.6 ± 4.3 1.0 ns

CYP6AB10 1.1 ns 13.1 ± 3.1 14.3 ± 7.2 26.3 ± 16.4 1.8 ns CYP4G9 1.1 ns 143.3 ± 25.0 158.0 ± 11.2 212.2 ± 21.3 1.3 ns

CYP4AU1 1.1 ns 4.1 ± 0.8 4.7 ± 0.7 4.6 ± 0.4 1.0 ns

CYP6AE16 1.2 ns 2.3 ± 0.2 2.7 ± 0.2 1.0 ± 0.1 2.7 ns CYP304F1 1.3 ns 0.1 ± 0.02 0.1 ± 0.02 0.04 ± 0.01 1.6 ns

CYP6B43 1.4 ns 7.1 ± 0.6 9.6 ± 2.3 7.4 ± 0.2 1.3 ns

CYP4S2 1.4 ns 0.1 ± 0.02 0.2 ± 0.02 0.3 ± 0.04 1.6 ns CYP9A23v3 1.6 ns 8.5 ± 1.7 13.6 ± 1.9 8.0 ± 1.2 1.7 ns

CYP9A12 1.7 ns 1.0 ± 0.1 1.7 ± 0.1 1.4 ± 0.1 1.2 ns CYP4L5 1.7 ** 256.5 ± 39.9 430.9 ± 23.9 315.6 ± 15.6 1.4 ns

CYP340J1 1.7 * 11.4 ± 2.5 19.6 ± 2.5 33.4 ± 8.1 1.7 ns

CYP6B8 2.0 ns 4.6 ± 0.6 9.1 ± 4.4 13.7 ± 4.8 1.5 ns CYP6AN1 2.1 *** 187.0 ± 18.0 389.5 ± 22.9 599.6 ± 134 1.5 ns

CYP333A1 2.4 *** 10.7 ± 0.4 25.4 ± 1.4 23.6 ± 1.0 1.1 ns

CYP305B1 2.6 * 24.5 ± 10.2 63.4 ± 12.4 12.0 ± 1.0 5.3 ns CYP9A15 2.6 *** 0.6 ± 0.1 1.6 ± 0.1 6.1 ± 2.0 3.8 ns

CYP4L11 2.7 *** 82.5 ± 6.2 223 ± 16.8 202.1 ± 11.7 1.1 ns

CYP321A5 2.8 * 308.3 ± 79.2 850.3 ± 194.3 421.6 ± 95.2 2.0 ns

CYP428A1 2.8 ** 6.0 ± 2.6 16.8 ± 1.5 19.9 ± 1.1 1.2 ns

CYP332A1 2.8 ** 65.7 ± 14.1 183.7 ± 32.7 104.4 ± 15.4 1.8 ns

CYP6AE12 2.9 *** 34.4 ± 2.1 98.5 ± 9.5 74.0 ± 11.0 1.3 ns CYP333B3 3.0 *** 0.4 ± 0.1 1.1 ± 0.1 2.0 ± 0.2 1.8 ns

CYP307A1 3.1 * 1.8 ± 0.5 5.4 ± 1.1 3.1 ± 0.6 1.8 ns

CYP6AE24 3.1 ** 260.0 ± 7.0 80.1 ± 12.8 109.5 ± 21.7 1.4 ns CYP354A3 3.6 *** 12.4 ± 1.1 45.0 ± 3.7 38.9 ± 3.0 1.2 ns

CYP4M6v2 3.8 ns 28.0 ± 18.1 107.3 ± 40.6 116.6 ± 13.4 4.2 ns

CYP6AE19 3.9 *** 1.3 ± 0.3 5.1 ± 0.6 24.0 ± 5.8 4.7 ns CYP9A14 5.3 * 4.1 ± 1.0 22.0 ± 5.0 14.9 ± 3.6 1.5 ns

CYP6AE11 6.0 *** 139.0 ± 36.8 831.1 ± 79.6 275.6 ± 39.0 3.0 ns

CYP4M10v2 10.2 ns 1.3 ± 0.4 13.6 ± 6.2 16.5 ± 11.1 1.2 ns CYP6B2v3 22.2 *** 14.8 ± 1.9 328.4 ± 49.2 146.5 ± 29.0 2.2 ns

CYP6AE23 nd 8.6 ± 1.2 31.3 ± 8.5 3.7 ns CYP6AE20v2 nd 0.2 ± 0.03 0.3 ± 0.1 1.6 ns

CYP6AE15v2 nd 7.2 ± 0.5 10 ± 0.9 1.4 ns

CYP9A17 nd 269.6 ± 22.4 191.1 ± 52.8 1.4 ns CYP302A1 nd 0.02 ± 0.02 0.01 ± 0.01 1.7 ns

CYP324A1 nd 47.5 ± 12.9 13.4 ± 4.5 3.5 ns

CYP321B1 nd 34.8 ± 9.7 0.5 ± 0.2 73.2 *

CYP340K1 nd nd nd

10

CYP367A8 nd nd nd

11

Table S5. 1H NMR data (500 MHz, MeOH-d4) of 4'-hydroxy-α-cypermethrin and the

parent compound, α-cypermethrin

Position -Cypermethrin 4'-Hydroxy--cypermethrin

H (J, Hz) H (J, Hz)

3-(2,2-Dichlorovinyl)-2,2-dimethylcylopropane carboxylate

1 2.02 (1H, d, 8.3) 2.02 (1H, d, 8.3)

3 2.19 (1H, dd, 8.7, 8.3) 2.20 (1H, dd, 8.7, 8.3)

1'' 6.22 (1H, d, 8.7) 6.22 (1H, d, 8.7)

2-CH3 1.25 (3H, s) 1.25 (3H, s)

2-CH3 1.18 (3H, s) 1.17 (3H, s)

-Cyanobenzyl moiety

α 6.55 (1H, s) 6.54 (1H, s)

2 7.13 (1H, br s) 7.02 (1H, br s)

4 7.08 (1H, dd, 8.0, 2.4) 6.98 (1H, dd, 8.0, 2.4)

5 7.56 (1H, dd, 8.0, 7.8) 7.39 (1H, dd, 8.0, 7.8)

6 7.30 (1H, br d, 7.8) 7.20 (1H, br d, 7.8)

3-Aryloxy ring

2'/6' 7.03 (2H, d, 8.2) 6.89 (2H, d-like, 8.9)

3'/5' 7.39 (2H, dd, 8.2, 7.7) 6.81 (2H, d-like, 8.9)

4' 7.17 (1H, t, 7.7)

12

Table S6. MIQE-précis: Minimum information for quantitative real-time PCR

Sample/Template Details Check

Source larvae, 3 per biological rep, x 3 biological reps yes

Method of preservation liquid nitrogen, storage at -80 °C yes

Storage time (if appropriate) < 6 months yes

Handling fresh or frozen yes

Extraction method TRIzol reagent yes

RNA: DNA-free DNaseI treatment, intron-spanning primers yes

Concentration Nanodrop spectrophotometer yes

RNA: integrity Agilent RNA 6000 Nano Kit yes

Inhibition-free dilution series yes

Assay optimisation/validation

Accession number Table S3 yes

Amplicon details 80 -168 bp yes

Primer sequence Table S3 yes

Probe sequence no probe, SYBR green yes

In silico BLAST, Primer3 yes

empirical Tm = 60 yes

Priming conditions oligo-dT, 3xRT (1%-10% deviation) yes

PCR efficiency not performed no

Linear dynamic range yes yes

Limits of detection 0.01 copies per 1000 molecules reference gene yes

Intra-assay variation standard errors in Table S4 yes

RT/PCR

Protocols M&M section 2.6 yes

Reagents M&M section 2.6 yes

Duplicate RT 3xRT (1%-10% deviation) yes

NTC Cq > 40, melt curves vs bona fide samples yes

NAC no probe, SYBR green yes

Positive control inter-run calibrators yes

Data analysis

Specialist software MxPro 4.0 QPCR Software (Agilent); qBase yes

Statistical justification biological replicates, heteroscedastic t-tests yes

Transparent, validated

normalisation eIF4A yes

Molecular evidence of insecticide resistance in ...

Documents

Transcript of Molecular evidence of insecticide resistance in ...