Marine Pollution Bulletin 69 (2013) 215–218

Contents lists available at SciVerse ScienceDirect

Marine Pollution Bulletin

journal homepage: www.elsevier .com/locate /marpolbul

Baseline

Edited by Bruce J. Richardson

The objective of BASELINE is to publish short communications on different aspects of pollution of the marine environment. Only thosepapers which clearly identify the quality of the data will be considered for publication. Contributors to Baseline should refer to‘Baseline—The New Format and Content’ (Mar. Pollut. Bull. 60, 1–2).

Molecular detection of atrazine catabolism gene atzA in coastal watersof Georgia, Puerto Rico and Trinidad

Samendra P. Sherchan a, D.S. Bachoon a,⇑, Ernesto Otero b, Adesh Ramsubhag c

a Department of Biological and Environmental Sciences, Georgia College and State University, Campus Box 81, Milledgeville, GA 31061-0490, USAb Department of Marine Sciences, University of Puerto Rico, Mayaguez Campus, P.O. Box 9013, Mayaguez, PR 00681, USAc Department of Life Sciences, University of the West Indies, St. Augustine, Trinidad and Tobago

a r t i c l e i n f o a b s t r a c t

Keywords:AtrazineGeorgia coastCaribbean islandsatzA geneqPCRHerbicides

0025-326X/$ - see front matter � 2012 Elsevier Ltd. Ahttp://dx.doi.org/10.1016/j.marpolbul.2012.01.024

⇑ Corresponding author.E-mail address: Dave.bachoon@gcsu.edu (D.S. Bach

In this study, quantitative polymerase chain reaction targeting the atrazine catabolism gene, atzA, wasused to detect the presence of atrazine degrading bacteria as an indicator of atrazine contamination in11 sites in Georgia, nine coastal sites in Puerto Rico and 11 coastal sites in Trinidad. The atzA gene wasdetected in five stations in Georgia (Oak Grove Island entrance, Blythe Island Recreation Park, JekyllIsland., Village Creek Landing and Dunbar Creek Sea Island Rd Bridge). In Puerto Rico gene was detectedin five sites (Boquilla, Oro Creek, Fishers Association, Ceiba Creek and Sabalos Creek) while seven sites inTrinidad (Carli Bay, Las Cuevas Bay, Quinam Bay, Salybia River, Salybia Bay, Maracas River and MaracasBay) showed the presence of atzA.

� 2012 Elsevier Ltd. All rights reserved.

Herbicide contamination of surface water and sediments isincreasing in most coastal regions of the globe (Shaw et al., 2010)and poses a potential threat to marine ecosystems as well as tohuman health (Catenacci et al., 1993; Faust et al., 1993; Islam andTanaka, 2004). Atrazine (2-chloro-4-ethylamine-6-isopropylamino-1,3, 5 triazine), a member of s-triazine herbicide family, is designedto inhibit photosystem-II in plants and is widely used to controlbroad-leaf weeds in agricultural fields, golf courses and in residen-tial lawns (Devers et al., 2004). Atrazine can persist in coastalwaters for more than a year and has been detected in estuariesand coastal environments in many parts of the world (Pereira andHostetler, 1993; Brodie et al., 2012). The endocrine disrupting prop-erties of atrazine in mammals, amphibians and fishes are well doc-umented (Hall et al., 1995; Hayes et al., 2002, 2011) and high

ll rights reserved.

oon).

doses are believed to be carcinogenic to mammals (Gammon et al.,2005; Stevens et al., 1999). In addition, research have indicated thatatrazine can have a disruptive impact on marine communitiesincluding coral reefs (Cantin et al., 2007), phototrophic bacteria,algae (Magnusson et al., 2008), mangroves (Bell and Duke, 2005)and sea grasses (Haynes et al., 2000). Coral reefs and mangrovesrepresent a valuable economic resource to communities in theUnited States and the Caribbean Islands. Therefore, there is a needto evaluate the presence and impact of herbicides such as atrazinein coastal marine ecosystems. Reports indicate atrazine is oftendetected in water samples from the coastal regions such as Georgiaand Puerto Rico (USEPA, 2006) but in most of the Caribbeanislands including Trinidad and Tobago, no data is available onatrazine contamination of marine environments.

With the widespread application of atrazine, it is not surprisingthat numerous atrazine degrading bacteria have been isolated fromenvironmental samples. The atrazine catabolism genes have beencharacterized in atrazine degrading bacteria from geographically

Fig. 1. Location of sampling stations in South-East Georgia (USA), Western Puerto Rico, and Trinidad. A separate scale (10 km) and decimal Lat/Lon reference is given for eachregion. Sampling sites use the same numbering as Tables 1–3.

216 S.P. Sherchan et al. / Marine Pollution Bulletin 69 (2013) 215–218

distinct regions indicating that similar pathways were used by bac-teria to metabolize atrazine to hydroxyatrazine. The atzA gene en-codes for the atrazine chlorohydrolase enzyme, which degradesatrazine through a dechlorination reaction (Devers et al., 2004;Sadowsky, 2010) in various bacteria including Pseudomonas strainADP. PCR assays for the atzA marker have also been developed andwere used as an effective and rapid method for detecting the pres-ence of atrazine degrading bacteria in the environment. More re-cently, a quantitative PCR (qPCR) method was used to detect atzAgene as an indicator of atrazine contamination in freshwater envi-ronments and a positive correlation between atzA gene copies andatrazine contamination in the surface water samples was observed

(Sherchan and Bachoon, 2011). The use of qPCR detection of atzAgene as an indicator of atrazine contamination is simpler and rela-tively inexpensive when compared to current methods such as GC/MS that determine atrazine concentration. However a major draw-back of the atzA gene qPCR assay is that it cannot provide quanti-tative data on the concentration of atrazine. The objective of thepresent study was to use the atzA gene qPCR assay as a simpleand cost effective method to detect the presence of atrazine pollu-tion in coastal waters over a broad geographic range includingGeorgia, Puerto Rico and Trinidad.

Water samples were collected in duplicate or triplicate in sterilewhirlpack bags or polypropylene bottles from coastal sites in Geor-

Table 1Quantification of atrazine catabolism gene atzA from the sampling sites of Georgia.

Sitenumber

Classification Site name atzA gene copy number/100 ml of sample

1 R Oak Grove Islandentrance

7.94 � 104

2 R Blythe Island Reg.Park dock

1.35 � 104

3 R Jekyll Isl. Latitude 31pier

2.88 � 103

4 R Village CreekLanding

2.45 � 103

5 R Dunbar Ck Sea Isl Rdbridge

2.34 � 103

6 R Marsh Landing ND7 R Jack’s Hammock

Duplin RiverND

8 R Flume Duck DuplinRiver

ND

9 R Julienton River ND10 R Mud River ND11 R Shell Creek ND

ND = not detected; SU = sub-urban; U = urban; R = rural.

Table 2Quantification of atrazine catabolism gene atzA from the sampling sites of PuertoRico.

Site number Classification Site name atzA gene copynumber/100 ml ofsample

1 SU Boquilla 6.31 � 103

2 SU Oro Creek 1.50 � 105

3 U Yaguez River ND4 U Fishers Association 6.26 � 104

5 U Ceiba Creek 4.13 � 105

6 U Sabalos Creek 8.24 � 104

7 R Guanajibo River ND8 SU Joyuda Lagoon Creek ND9 SU Boqueron Creek ND

ND = not detected; SU = sub-urban; U = urban; R = rural.

Table 3Quantification of atrazine catabolism gene atzA from the sampling sites of Trinidad.

Sitenumber

Classification Site name atzA gene copy number/100 mlof sample

1 SU ChaguaramasBay

ND

2 R Las CuevasBay

3.12 � 103

3 R Balandra Bay ND4 R Carli Bay 2.90 � 104

5 R Maracas Bay 4.17 � 103

6 R Maracas River 4.06 � 103

7 R Morne DiabloBay

ND

8 R Quinam Bay 1.44 � 104

9 R Salybia River 3.66 � 105

10 R Salybia Bay 4.93 � 103

11 R Toco Bay ND

ND = not detected; SU = sub-urban; U = urban; R = rural.

S.P. Sherchan et al. / Marine Pollution Bulletin 69 (2013) 215–218 217

gia, Puerto Rico and Trinidad (Fig. 1) from January to December2010, kept on ice and processed within 6 h. Sampling sites wereclassified as Urban/Suburban and Rural based on arbitrary knowl-edge of existing population density. Along the Georgia coast, watersamples were collected from eight coastal areas: Oak Grove IslandEntrance, Blythe Island Reg., Jekyll Island, Village Creek Landing,Dunbar Creek, Sea Island Rd bridge, Marsh Landing, Jack’sHammock Duplin River, and Flume Duck Duplin River. Sampleswere obtained from nine sites in Puerto Rico encompassing coastalcreeks and outlets, estuarine and freshwater sites in urban,suburban and rural areas (Fig. 1). In Trinidad, water samples werecollected from 11 coastal areas used for recreational or commercialfishing activities. Samples were taken at the mouth of two rivers(Salybia and Maracas Rivers respectively) just at the merging pointwith the ocean. All sites were in rural areas except ChaguaramasBay, which was close to a sub-urban zone and is in close proximityto marina facilities. Although situated in rural areas, some siteswere generally impacted by human settlements and agriculture.

Water samples were filtered through, 0.22-lm-pore nitrocellu-lose membrane filter (Type GS, Millipore, Billerica, MA, USA). Thefilters were frozen and shipped on dry ice by overnight courierto Milledgeville, GA. Filters were processed with the MoBioUltraclean™ Soil DNA Kit (Carlsbad, CA, USA) using a modifiedprotocol (Bachoon et al., 2010; Sherchan and Bachoon, 2011). Thisinvolved separating the bead solution from the beads and placing itin a 15-ml centrifuge tube containing the filter. Solutions S1 andIRS were placed in the tube and vortexed vigorously for 15 min.

The solution was removed from the centrifuge tube and placed inthe beaded tube. From this point onwards, the manufacturer’sprotocol was followed. Extracted DNA was quantified using aNanodrop ND-1000 Spectrophotometer (Wilmington, DE).

qPCR were performed on 1 ll of extracted DNA as described by(Sherchan and Bachoon, 2011), to a final volume of 25 ll (perreaction): 12.5 ll Stratagene (La Jolla, CA), Full- Velocity, SYBRGreen; 0.25 ll of each forward and reverse primer (10 lM) atzAF(AATTCTATGACTGGCTGTTC) and atzA R(CGCACAATACAACCTCAC)to produce a product of 92 bp (Sherchan and Bachoon, 2011). Thereactions were monitored in a CFX96™ Real Time PCR DetectionSystem (BioRad

�, Hercules, CA), under the following conditions:

95 �C for 5 min; 39 cycles of 95 �C for 15 s, annealing temperatureof 60 �C for 15 s, extension at 72 �C for 15 s followed by meltingcurve analysis at 65–95 �C every 1 �C for 5 s. Cycle threshold (Ct)was determined automatically on the thermal cycler followingmanual adjustment of the threshold fluorescence. The specificityof the primers were checked with a BLAST search (Blast, NCBI).Pseudomonas sp strain ADP was graciously provided by Dr. MichaelSadowsky (Department of Soil, Water, and Climate, University ofMinnesota, St. Paul, MN) and was used as a positive control foratrazine degrading bacteria (atzA gene). The detection limit foratrazine degrading bacteria was 1.35 � 102 cells per 100 ml. Sam-ples and controls were run in duplicates. PCR assay were optimizedagainst Escherichia coli strain B genomic DNA (Sigma� D4889) andBifidobacterium adolescentis genomic DNA (ATCC� number15703D™) as described by Sherchan and Bachoon (2011).

Since its introduction in the 1950s atrazine has become one ofthe most popular herbicides used for the control of unwantedweeds. Herbicide water pollution is a growing threat to the healthyfunctioning of estuaries, coral reefs and mangrove swamps(Pennington and Scott, 2001). Often runoff from agricultural, golfcourses or residential lawns is the likely source of coastal atrazinecontamination. Sites from Georgia, Puerto Rico and Trinidad wereevaluated for atrazine pollution using the atzA gene of atrazinedegrading bacteria as an indicator for the presence of thiscompound. Recent research has indicated that there is a positivecorrelation between atzA gene copy number and atrazine concen-tration in environmental samples (Sherchan and Bachoon, 2011).

The presence of high atzA copy number (>1.51 � 102 per 100 mlof water) was detected in five samples from the Georgia coast, fivesamples from Puerto Rico and seven samples from Trinidad. Thisindicates the presence of significant numbers of atrazine degradingbacteria which could be due to atrazine pollution at these sites. It isnot surprising to detect atrazine in coastal waters as several stud-ies have indicated its presence in oceans, at concentrations ranging

218 S.P. Sherchan et al. / Marine Pollution Bulletin 69 (2013) 215–218

from 1 to 100 ng/l and in estuaries at concentrations of 200 ng/l(Bester and Huhnerfuss, 1993).

Along the Georgia Coast qPCR results indicated (Table 3) thatthe lowest atzA gene copies (1.35 � 104 per 100 ml sample) wasdetected in the Blythe Island area and the highest levels were de-tected near the golf courses on Jekyll island (2.88 � 105 per 100 mlsample). This trend suggests that atrazine contamination wasoccurring near or around golf courses and was gradually diluted to-wards the Atlantic Ocean.

Recent research has indicated that there is a positive correlationbetween atzA gene copy number and atrazine concentration inenvironmental samples (Sherchan and Bachoon, 2011). Based onthe atzA gene assay, it appears that five of the study sites in PuertoRico had relatively high levels of atrazine pollution (Table 2). CeibaCreek had the highest atzA gene copies (4.13 � 105 per 100 ml ofwater) followed by Oro Creek (1.50 � 105 per 100 ml of water).The other three sites Sabalos Creek, Fishers Creek and Boquillahad lower atzA gene copies and therefore probably had lower lev-els of atrazine contamination compared to Ceiba Creek and OroCreek.

In Trinidad the atzA gene was detected in Las Cuevas Bay, CarliBay, Quinam Bay, Maracas Bay, Maracas River, Salybia River andSalybia Bay. Salybia Bay River had the highest level of atzA genecopies (3.66 � 105 per 100 ml) with lower levels of the gene de-tected at Maracas River and Salybia River and the lowest gene cop-ies (3.12 � 103 per 100 ml) were detected at Las Cuevas Bay. Thesource of the atrazine contamination may be attributed to agricul-tural activities since the areas where the atzA gene was detectedwere generally close to zones with small to medium scale crop.The detection of the atzA gene indicates that marine life forms inTrinidad could be threatened by atrazine pollution. Several studieshave shown that there is a threat of atrazine exposure to estuarineenvironment (Haynes et al., 2000; Lewis et al., 2009) and coralreefs (Jones et al., 2003; Brodie et al., 2012). Although the islandlacks extensive coral reefs, there are a limited number of relativelysmall reefs on the northeastern coast, within or close to SalybiaBay. Thus the putative presence of atrazine contamination maybe potentially exerting harmful effects on these reefs. Future re-search should examine the concentration of atrazine in the coralreef systems of Puerto Rico and Trinidad and Tobago.

Acknowledgements

This project is supported by Georgia College and State Univer-sity and by a research grant by the Puerto Rico Sea Grant Program(R-92-1-08). We are thankful to Lisa Gentit and Garvin Perry forproviding us with the water samples.

References

Bachoon, D.S., Miller, C.M., Green, C.P., Otero, E., 2010. Comparison of fourpolymerase chain reaction methods for the rapid detection of human fecal

pollution in marine and inland waters. Int. J. Microbiol. http://dx.doi.org/10.1155/2010/595692 (Article ID 595692).

Bell, A.M., Duke, N.C., 2005. Effects of photosystem II inhibiting herbicides onmangroves preliminary toxicology trials. Mar. Pollut. Bull. 51, 297–307.

Bester, K., Huhnerfuss, H., 1993. Triazines in the Baltic and North Sea. Mar. Pollut.Bull. 26, 423–427.

Brodie, J.E. et al., 2012. Terrestrial pollutant runoff to the Great Barrier Reef: anupdate of issues, priorities and management responses. Mar. Pollut. Bull. 65,81–100 <http://dx.doi.org/10.1016/j.marpolbul.2011.12.012>.

Cantin, N.E., Negri, A.P., Willis, B.L., 2007. Photoinhibition from chronic herbicideexposure reduces reproductive output of reef-building corals. Mar. Ecol. Prog.Ser. 344, 81–93.

Catenacci, G., Barbieri, F., Bersani, M., Ferioli, A., Cottica, D., Maroni, M., 1993.Biological monitoring of human exposure to atrazine. Toxicol. Lett. 69 (2), 217–222.

Devers, M., Soulas, G., Martin-Laurent, F., 2004. Real-time reverse transcription PCRanalysis of expression of atrazine catabolism genes in two bacterial strainsisolated from soil. J. Microbiol. Methods 56 (1), 3–15.

Faust, M., Altenburger, R., Boedeker, W., Grimme, L.H., 1993. Additive effects ofherbicide combinations on aquatic non-target organisms. Sci. Total Environ.134, 941–952.

Gammon, D.W., Aldous, C.N., Carr Jr., W.C., Sanborn, J.R., Pfeifer, K.F., 2005. A riskassessment of atrazine use in California: human health and ecological aspects.Pest Manage. Sci. 61 (4), 331–355.

Hall Jr., L.W., Ziegenfuss, M.C., Anderson, R.D., Tierney, D.P., 1995. The influence ofsalinity on the chronic toxicity of atrazine to an estuarine copecod: implicationsfor development of an estuarine chronic criterion. Arch. Environ. Contam.Toxicol. 28, 344–348.

Hayes, T.B., Collins, A., Lee, M., Mendoza, M., Noriega, N., Stuart, A., Vonk, A., 2002.Hermaphroditic, demasculinized frogs after exposure to the herbicide atrazineat low ecologically relevant doses. Proc. Natl. Acad. Sci. 99 (8), 5476–5480.

Hayes, T.B. et al., 2011. Demasculinization and feminization of male gonads byatrazine: consistent effects across vertebrate classes. J. Steroid Biochem. Mol.Biol. 127 (1–2), 64–73. http://dx.doi.org/10.1016/j.jsbmb.2011.03.015.

Haynes, D., Muller, J., Carter, S., 2000. Pesticide and herbicide residues in sedimentsand seagrasses from the Great Barrier Reef World Heritage Area andQueensland coast. Mar. Pollut. Bull. 41, 279–287.

Islam, S., Tanaka, M., 2004. Impacts of pollution on coastal and marine ecosystemsincluding coastal and marine fisheries and approach for management: a reviewand synthesis. Mar. Pollut. Bull. 48, 624–649.

Jones, R.J., Muller, J., Haynes, D., Schreiber, U., 2003. Effects of herbicides diuron andAtrazine on corals of the Great Barrier Reef, Australia. Mar. Ecol. Prog. Ser. 251,153–167.

Lewis, S.E., Brodie, J.E., Bainbridge, Z.T., Rohde, K.W., Davis, A.M., Masters, B.L.,Maughan, M., Devlin, M.J., Mueller, J.F., Schaffelke, B., 2009. Herbicides: a newthreat to the Great Barrier Reef. Environ. Pollut. 157, 2470–2484.

Magnusson, M., Heimann, K., Negri, A.P., 2008. Comparative effects of herbicides onphotosynthesis and growth of tropical estuarine microalgae. Mar. Pollut. Bull.56, 1545–1552.

Pennington, P.L., Scott, G.I., 2001. Toxicity of Atrazine to the EstuarinePhytoplankton Pavlova sp. (Pyrmnesiophyceae): increased sensitivity afterlong-term, low-level population exposure. Environ. Toxicol Chem. 20, 2237–2242.

Pereira, W.E., Hostetler, F.D., 1993. Nonpoint source contamination of theMississippi River and the tributaries by herbicides. Environ. Sci. Technol. 27,1542–1552.

Sadowsky, M.J., 2010. Atrazine and the s-triazine herbicide. Ecol. Ind. Pollut., 207–225.

Shaw, M., Furnas, M.J., Fabricius, K., Haynes, D., Carter, S., Eaglesham, G., Mueller,J.F., 2010. Monitoring pesticides in the Great Barrier Reef. Mar. Pollut. Bull. 60,113–122.

Sherchan, S.P., Bachoon, D.S., 2011. The presence of atrazine and atrazine degradingbacteria around Lake Oconee. J. Appl. Microbiol. 111 (2), 293–299.

Stevens, J.T., Breckenridge, C.B., Wetzel, L., 1999. A risk characterization for atrazineoncogenicity profile. J. Toxicol. Environ. Health 56 (2), 69–109.

USEPA, 2006. Decision Documents for atrazine. http://www.epa.gov/oppsrrd1/REDs/atrazine_combined_docs.pdf (verified 04.02.08).