Molecular Cloning and Pharmacological Characterization of … · 2008. 12. 31. · respectively....
Transcript of Molecular Cloning and Pharmacological Characterization of … · 2008. 12. 31. · respectively....
JPET#155283
1
Molecular Cloning and Pharmacological Characterization of Monkey
MT1 and MT2 Melatonin Receptors Showing High Affinity for the
Agonist Ramelteon
Keiji Nishiyama, Yasushi Shintani, Keisuke Hirai, Shin-ichi Yoshikubo
Pharmacology Research Laboratory, Pharmaceutical Research Division,
Takeda Pharmaceutical Company Ltd., Osaka 532-8686, Japan
(K.N., Y.S., K.H., S.Y.)
JPET Fast Forward. Published on June 25, 2009 as DOI:10.1124/jpet.109.155283
Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
2
Running title: Ramelteon is a potent melatonin receptor agonist in monkeys.
Corresponding Editor: Shin-ichi Yoshikubo, Ph.D., Pharmacology Research
Laboratory, Pharmaceutical Research Division, Takeda Pharmaceutical Company Ltd,
17-85, Jusohonmachi 2-chome, Yodogawa-ku, Osaka 532-8686, Japan
Phone: +81-6-6300-6647, Fax: +81-6-6300-6306, E-mail:
Number of pages of text: 35
Tables: 2
Figures: 8
Number of references: 40
Number of words in abstract: 217
Words in introduction: 683
Words in discussion: 963
Abbreviations: PCR, polymerase chain reaction; cAMP, adenosine 3′,5′-cyclic
monophosphate; CHO, Chinese hamster ovary; SDS-PAGE, sodium dodecyl
sulfate-polyacrylamide gel electrophoresis; PACAP, pituitary adenylate
cyclase-activating polypeptide; DMSO, dimethyl sulfoxide; Ramelteon (TAK-375),
(S)-N-[2-(1,6,7,8-tetrahydro-2H-indeno-[5,4-b]furan-8-yl)ethyl] propionamide
A recommended section assignment: Neuropharmacology
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
3
Abstract
Melatonin receptor agonists such as melatonin and ramelteon (TAK-375) have
sleep-promoting effects in humans. In preclinical models, these effects are more
similar to those observed in monkeys than in other species. However, in contrast to
the human melatonin receptors, the pharmacological characteristics of the monkey
melatonin receptors have yet to be elucidated. In this study, we cloned the
cynomolgus monkey MT1 and MT2 melatonin receptors based on rhesus monkey
genome sequences and then characterized the monkey melatonin receptors and
compared their pharmacological properties with those of the human homologues. The
overall amino acid sequences of the monkey MT1 and MT2 melatonin receptors
showed high homology to the human MT1 (95%) and MT2 (96%) receptors,
respectively. Saturation binding experiments with 2-[125I] iodomelatonin revealed that
the dissociation constant (Kd) for the monkey MT1 and MT2 melatonin receptors were
19.9 and 70.4 pM, respectively. In ligand competition assays using 2-[125I]
iodomelatonin, ramelteon displayed approximately 3- to 7-fold higher affinities than
melatonin for the recombinant monkey MT1, and MT2 melatonin receptors and
monkey suprachiasmatic nucleus membranes. This higher affinity of ramelteon
compared to melatonin has also been observed in human melatonin receptors.
Furthermore, ramelteon inhibited PACAP27-stimulated cAMP production with higher
potency than melatonin. In conclusion, this information will help us to understand the
pharmacological effects of melatonin receptor agonists in monkeys.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
4
Introduction
The hormone melatonin is produced primarily in the mammalian pineal gland and is
released in a circadian manner, with low levels during the day and high levels at night
(Tamarkin et al., 1985; Foulkes et al., 1997). Melatonin has been implicated in numerous
physiological processes, including the sleep-wake cycle, circadian entrainment, and
seasonal reproduction (Reiter, 1980; Redman et al., 1983; Bartness et al., 1993; Slotten et
al., 1999; Wyatt et al., 2006). These effects are achieved by the binding of melatonin to
specific receptors in the suprachiasmatic nucleus (SCN) of the hypothalamus (Zee and
Manthena, 2007) and in the pars tuberalis (PT) of the pituitary (Morgan, 2000).
Two high affinity melatonin receptor types, MT1 and MT2, have been cloned in
mammals: human, sheep, Siberian hamster, mouse, and rat (Reppert et al., 1994, 1995;
Weaver et al., 1996; Roca et al., 1996; Jin et al., 2003; Audinot et al., 2008). The MT1 and
MT2 melatonin receptors exhibit different molecular structure and chromosomal
localization among these species. The human MT1 and MT2 melatonin receptors exhibit
only 60% overall identity at the amino acid level, and show distinct binding profiles; the
human MT2 melatonin receptor has a lower affinity for 2-[125I] iodomelatonin compared to
the human MT1 melatonin receptor (Reppert et al., 1995; Dubocovich et al., 1997; Audinot
et al., 2003). Both receptors belong to the family of G-protein-coupled receptors that are
associated with the inhibition of adenylate cyclase (Reppert et al., 1994, 1995). Furthermore,
activation of the MT1 melatonin receptor induces a transient elevation in cytosolic calcium
ions and inositol phosphate concentration, whereas activation of the MT2 melatonin
receptor inhibits the soluble guanylate cyclase pathway in MT2 receptor-transfected cells
(Brydon et al., 1999; Petit et al., 1999; MacKenzie et al., 2002).
The expression of melatonin receptors has been studied in various tissues using
autoradiography with 2-[125I] iodomelatonin, in situ hybridization, and reverse
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
5
transcription-polymerase chain reaction (RT-PCR). The MT1 melatonin receptor is
expressed most abundantly in the SCN, and is also expressed in other regions of the brain
(e.g., the paraventricular thalamus) and some peripheral tissues (e.g., the pituitary, kidney,
and small intestine) (Reppert et al., 1994; Roca et al., 1996; Drew et al., 1998; Sallinen et
al., 2005). A targeted deletion of the MT1 melatonin receptor in mice has been demonstrated
to block the melatonin-induced inhibition of neuronal firing in SCN slices; however, the
phase-shifting responses to melatonin were only slightly impaired (Liu et al., 1997). The
MT2 receptor is expressed dominantly in the retina, and also in the SCN and hippocampus
(Reppert et al., 1995; Liu et al., 1997; Dubocovich et al., 1998). Activation of the MT2
melatonin receptor phase-shifts the circadian rhythm of neuronal activity in the SCN and
inhibits dopamine release in the retina (Dubocovich et al., 1997, 1998, 2005).
Accumulating evidence suggests that melatonin can influence sleep-promoting and
sleep-wake rhythm regulating action through MT1 and MT2 melatonin receptors. Although
studies of the sleep-promoting effect of melatonin have not always yielded consistent
results, melatonin and ramelteon have been shown to have sleep-promoting effects in cats
(Miyamoto et al., 2004), monkeys (Zhdanova et al., 2002; Yukuhiro et al., 2004), and
humans (Wyatt et al., 2006; Zammit et al., 2007). Indeed, ramelteon has been approved in
the US for the treatment of insomnia. In preclinical studies, monkeys may be the most
suitable species for evaluating the sleep-promoting effect of melatonin receptor agonists.
This is because such an effect has been disputed in nocturnal animals, such as rats (Mailliet
et al., 2001; Akanmu et al., 2004). Decreases in sleep latency after the administration of
melatonin receptor agonists has been demonstrated only in monkeys and humans. However,
the pharmacological profiles of the monkey melatonin receptors remain to be determined.
Therefore, characterization of the monkey melatonin receptors is important for evaluation
and interpretation of the sleep-promoting effect in monkeys. In this study, we cloned the
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
6
MT1 and MT2 melatonin receptors of the cynomolgus monkey and analyzed their
pharmacological characteristics using melatonin and ramelteon. The results of this study
indicate that the pharmacological profiles of the monkey melatonin receptors are
comparable to those of the human melatonin receptors.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
7
Methods
Chemicals and Drugs
Ramelteon, (S)-N-[2-(1,6,7,8-tetrahydro-2H-indeno-[5,4-b]furan-8-yl)ethyl]
propionamide (TAK-375), was synthesized at Takeda Pharmaceutical Company, Ltd.
(Osaka, Japan) (Uchikawa et al., 2002). Melatonin was purchased from Sigma-Aldrich (St.
Louis, MO) and 2-iodomelatonin was obtained from Tocris Cookson Ltd. (Bristol, UK).
2-[125I] iodomelatonin was obtained from Perkin-Elmer Inc. (Wellesley, MA).
Animals
Twelve adult (9 males and 3 females) cynomolgus monkeys (Macaca fascicularis) that
weighed between 2.8 and 6.6 kg were cared for in accordance with the principles and
guidelines of the Takeda experimental animal committee.
Genomic DNA and RNA isolation
The monkeys were anesthetized with ketamine and then sacrificed. Brain tissues (SCN,
cerebral cortex, putamen, caudate nucleus, amygdala) and eyes were dissected immediately
after obtaining coronal sections of the brains, frozen quickly in dry ice, and then stored at
–80°C until use. Genomic DNA was isolated from brain tissue (putamen) using a QIAGEN
Genomic-tip 100/G and a QIAGEN Proteinase K (QIAGEN, Valencia, CA) according to the
manufacturer’s protocol. Total RNA was extracted from brain tissues and eyes using Isogen
(Nippon Gene, Tokyo, Japan), and then mRNA was isolated using a μMACS mRNA
Isolation Kit (Miltenyi Biotec, Auburn, CA) according to the manufacturer’s protocol.
Cloning of monkey MT1 melatonin receptor cDNA
The coding region of monkey MT1 melatonin receptor, which comprises two exons (exon
1 and exon 2), was obtained by nested PCR amplification of monkey genomic DNA using
primers that anneal outside the coding region of each exon. The primer design was based on
an alignment of the sequences of human MT1 melatonin receptor cDNA and the rhesus
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
8
monkey (Macaca mulatta) genome obtained from the University of California at Santa Cruz
(UCSC) genome browser (http://www.genome.ucsc.edu/). Using MT1-exon 1-1F/1R
primers (Table 1), the first PCR of exon 1 was performed in a total volume of 25 µl
containing 0.5 µl of AccuPrime GC-Rich DNA Polymerase (Invitrogen, Carlsbad, CA), 5 µl
of 5× buffer A (300 mM Tris-HCl, pH 9.2, 10 mM MgSO4, 150 mM NaCl, 1 mM dNTPs),
0.5 µl of 10 µM each primer, and 2 µl of genomic DNA (88 ng) under the conditions
described in Table 1. The second PCR was then performed under the same conditions as the
first PCR using 2 µl of a 1:400 dilution of the first-round PCR products as a template and
MT1-exon 1-2F/2R primers (Table 1). Using MT1-exon 2-1F/1R or MT1-exon 2-2F/2R
primers, the first and second PCR amplification was carried out in a total volume of 25 µl
containing 0.5 µl of Pfx50 DNA Polymerase (Invitrogen), 2.5 µl of 10× Pfx50 PCR mix,
0.75 µl of 10 mM dNTPs, 2 µl of 3.75 µM each primer, 2 µl of genomic DNA (88 ng) for
the first PCR or 1:400 dilution of the first-round PCR products for the second PCR under
the conditions described in Table 1. The full-length monkey MT1 melatonin receptor cDNA
was generated by PCR using exon 1 and exon 2 fragments with each other’s partial exon
sequence. Using MT1-exon 1-F3/R3 or MT1-exon 2-F3/R3 primers (Table 1), each
appended exon fragment was obtained by PCR under the conditions described in Table 1. In
order to conjugate the two exon fragments, PCR amplification was carried out using
MT1-exon 1-F3 and MT1-exon 2-R3 primers (Table 1) under the conditions described in
Table 1.
Cloning of monkey MT2 melatonin receptor cDNA
In order to amplify monkey MT2 melatonin receptor cDNA from monkey eye, 139 ng of
monkey eye mRNA was primed with oligo (dT)20 primer and reverse-transcribed according
to the manufacturer’s instructions (Superscript III First-Strand Synthesis SuperMix;
Invitrogen). Monkey MT2 melatonin receptor was then cloned using a nested PCR approach.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
9
The design of the specific primers for monkey MT2 melatonin receptor was based on rhesus
monkey genome data from the UCSC genome browser as well as on the monkey MT1
melatonin receptor. Using MT2-F1/R1 or MT2-F2/R2 primers (Table 1), the first and
second PCR amplifications were carried out in a total volume of 25 µl containing 0.5 µl of
Pfx50 DNA Polymerase, 2.5 µl of 10× Pfx50 PCR mix, 0.75 µl of 10 mM dNTPs, 2 µl of
3.75 µM each primer, and 2 µl of first strand cDNA or 1:400 dilution of the first-round PCR
products under the conditions described in Table 1.
DNA Sequencing
The final PCR products were purified using a QIAquick PCR Purification Kit (QIAGEN)
and subcloned into a pCR-Blunt II-TOPO vector (Invitrogen). The clones were sequenced
in both directions using a Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems,
Foster City, CA) and an ABI Prism 3700 capillary sequencer.
Expression studies
The full-length monkey MT1 melatonin receptor cDNA was subcloned into the
expression vector pcDNA3.1 (Invitrogen). The myc peptide coding sequence was fused to
the C terminus of full-length and variants of the monkey MT2 receptor by PCR using
primers containing a linker and the myc sequence:
5′-CTAGTAAACGGCATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTA
G -3′. All plasmids were confirmed by sequencing analysis. CHO-K1 cells were cultured in
Eagle’s Minimum Essential Medium-α (MEM-α; Sigma-Aldrich) supplemented with 10%
fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) under
a 5% CO2/95% air atmosphere. For detection of myc-tagged monkey MT2 melatonin
receptor expression, CHO-K1 cells were transfected with pcDNA3.1 (C), or myc-tagged
full-length form (F) or a variant form (V1, V2, V3) of the monkey MT2 receptor expression
vector using Lipofectamine 2000 reagent (Invitrogen). At 5 h after transfection, the cells
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
10
were treated with vehicle (DMSO), 2 μM MG-132 (Calbiochem Novabiochem Corporation,
La Jolla, CA), or 2 μM Cathepsin inhibitor I (Calbiochem Novabiochem) for 19 h. The cells
were then homogenized in lysis buffer: 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.25%
deoxycholic acid, 1% NP40, 1% SDS, 1 mM EDTA, and protease inhibitor cocktail
(Sigma-Aldrich). The insoluble component of the lysates was removed by centrifugation at
15000 × g for 20 min. Protein concentration was determined using a BCA protein assay kit
(Pierce, Hercules, CA). The lysates (20 μg of protein/lane) were subjected to SDS-PAGE
using Bis-Tris-glycine gels (4–12%) and transferred to polyvinylidene difluoride
membranes (Invitrogen). The membranes containing transferred proteins were probed with
a monoclonal anti-c-myc antibody (dilution 1:1000; Cell Signaling Technologies, Danvers,
MA).
Membrane preparation
CHO-K1 cells were transiently transfected with either monkey MT1 or MT2 receptor
(including variant forms) expression vector using Lipofectamine 2000 reagent (Invitrogen).
The transfected cells were washed with Dulbecco’s Phosphate-Buffered Saline (PBS;
Sigma-Aldrich) and then detached with PBS containing 1 mM EDTA. The cells were
pelleted by centrifugation at 1000 × g for 5 min, resuspended in ice-cold 50 mM Tris-HCl
buffer (pH 7.7 at 25°C), and then stored at –80°C until use. Brain membranes derived from
each region (SCN, cerebral cortex, putamen, caudate nucleus, amygdala) were isolated from
the brains of twelve cynomolgus monkeys. Crude membranes (CHO membranes, monkey
brain membranes) were prepared by homogenization in 50 mM Tris-HCl buffer (pH 7.7 at
25°C) and collected by two centrifugations at 40,000 × g for 20 min.
2-[125I] iodomelatonin binding studies
Saturation binding experiments were performed using 2-[125I] iodomelatonin. The
binding assay buffer contained CHO membranes or monkey SCN membranes diluted in 50
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
11
mM Tris-HCl buffer (pH 7.7), melatonin (final conc. 1 or 10 µM) or vehicle (DMSO), and
increasing concentrations of 2-[125I] iodomelatonin (final conc. 6.25–800 pM) in a total
volume of 500 μL. After incubation for 120 min at 25°C, the reaction was terminated by the
addition of 4 ml of ice-cold 50 mM Tris-HCl buffer (pH 7.7) followed by vacuum filtration
through a Whatman GF/B filter. The filter was washed twice and radioactivity was counted
using a γ-counter. Nonspecific binding was defined as the binding in the presence of 1 μM
(monkey brain membranes) or 10 μM melatonin (CHO membranes). Protein concentration
was determined using a BCA protein assay kit (Pierce, Rockford, IL). In order to compare
melatonin receptor densities across monkey brain regions (SCN, cerebral cortex, putamen,
caudate nucleus, amygdala), specific binding of 2-[125I] iodomelatonin was measured using
200 pM 2-[125I] iodomelatonin. Competitive binding experiments were performed using
2-[125I] iodomelatonin (CHO membranes: approximately 40 pM, monkey SCN membranes:
approximately 60 pM) with increasing concentrations (final conc. 0.64 pM–10 nM) of
unlabeled melatonin and ramelteon. Experiments were performed three times in CHO
membranes and once in monkey membranes from 12 monkeys due to limited availability of
tissue. Each concentration was assayed in duplicate.
cAMP studies
The receptor cDNAs were introduced into CHO-K1 cells using Lipofectamine 2000
reagent. Briefly, transfections were performed with the following DNA suspensions: 27.3
µg of monkey MT1 or MT2 receptor expression vector and 2.7 µg of human pituitary
adenylate cyclase-activating polypeptide receptor 1 (PAC1) expression vector in medium
containing 93.8 µl Lipofectamine 2000. At 24 h after transfection, the cells were washed
with PBS, and detached with PBS containing 1 mM EDTA. The cells were collected by
centrifugation at 1000 × g for 5 min, and then the cell pellets were resuspended in Hanks’
balanced salt solution containing 0.1% bovine serum albumin, 5 mM HEPES (pH 7.3), 0.5
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
12
mM 3-isobutyl-1-methylxanthine (IBMX; Wako Pure Chemical Industries, Osaka, Japan).
The cells were stimulated with 1 nM pituitary adenylate cyclase-activating polypeptide
(PACAP27) in the presence of vehicle, melatonin, or ramelteon (0.26 pM–4 nM) for 20 min.
The amount of cAMP in the cells was measured using an AlphaScreen cAMP assay kit
(Perkin-Elmer, Wellesley, MA) according to the manufacturer’s protocol. Experiments were
performed three times in quadruplicate.
Data analysis
Equilibrium dissociation constants (Kd), receptor densities (Bmax), and IC50 values were
calculated from saturation and competition curves by nonlinear regression analysis using
PRISM software (GraphPad Software Inc., San Diego, CA). Data were fitted to a
three-parameter logistic model (binding studies), or a four-parameter logistic model (cAMP
studies) as a preferred model. Inhibition constants (Ki) were calculated from IC50 values
using the following equation:
Ki = IC50/(1 + L/Kd),
where L represents the concentration of 2-[125I] iodomelatonin in the binding assay.
The values (Kd, Ki, and IC50) for recombinant monkey melatonin receptors expressed in
CHO cells represent the mean ± S.E.M of three independent experiments.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
13
Results
Cloning of the monkey MT1 and MT2 melatonin receptors
We initially cloned the monkey MT1 and MT2 melatonin receptors by nested PCR
amplification of monkey SCN and eye mRNA-derived cDNAs, using exon 1- and exon
2-untranslated region primers based on an alignment of human melatonin receptor
sequences and the rhesus monkey genome sequence. Although monkey MT1 melatonin
receptor was not amplified from monkey SCN-derived cDNA using the nested PCR
approach, it was cloned from monkey genomic DNA (Fig. 1). The full-length monkey MT2
melatonin receptor and three novel splicing variant receptors (V1, V2, V3) were obtained
from monkey eye-derived cDNA (Figs. 2 and 3). The variant receptors had an additional
insertion between exon 1 and exon 2 of the monkey MT2 melatonin receptor gene. The
inserted sequences were found between exon 1 and exon 2 of rhesus monkey MT2
melatonin receptor genome sequence, and all of exon-intron splice junctions follow the
GT-AG rule. The insertions led to a frameshift in the coding sequence and the introduction
of a premature stop codon. The monkey MT1, MT2, and three variant (V1, V2, V3)
melatonin receptors encoded proteins of 352, 362, 88, 86, and 101 amino acids, respectively
(Figs. 1–3). The variant proteins consisted of 74 amino acids identical to the amino
terminus of the full-length monkey MT2 melatonin receptor, and unique carboxyl-terminal
amino acid sequences (Fig. 3). All the variants contained nonsense mutations in the coding
region of the deduced protein, and had only the first putative transmembrane domain.
Comparison of the amino acid sequences of MT1 melatonin receptors revealed that the
monkey MT1 melatonin receptor has the highest amino acid homology with the human MT1
melatonin receptor (95% identity) and has 85% and 84% identity to mouse and rat MT1
melatonin receptor, respectively (Fig. 1). Similarly, the monkey MT2 melatonin receptor
showed higher homology (96% identity) to the human MT2 melatonin receptor compared
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
14
with mouse or rat MT2 melatonin receptor (Fig. 2). The amino acid sequence of monkey
melatonin receptors deduced from the rhesus monkey genome sequence was not fully
identical to those of the cloned receptors (MT1: a methionine to isoleucine exchange at
amino acid residue 203, MT2: an aspartate to asparagine exchange at amino acid residue 3).
Expression of the monkey MT2 variant receptors in CHO-K1 cells
To determine whether the monkey MT2 variant receptors have an ability to bind
melatonin receptor ligand, their binding properties were examined using CHO-K1 cells
transiently expressing the monkey MT2 receptor or variant receptors. The full-length
monkey MT2 melatonin receptor showed high specific binding to 2-[125I] iodomelatonin,
whereas none of the variant receptors did (Fig. 4). In order to confirm whether the variant
receptors were indeed translated in CHO-K1 cells, a myc tag was fused to the C terminus of
the full-length receptor (a positive control) and the variant receptors, and then their
expression levels were assessed by western blot analysis. A diffuse band of an
approximately 42-kDa protein representing myc-tagged full-length MT2 receptor protein
was expressed at a relatively high level (Fig. 5). The diffuse patterns of the full-length MT2
receptor and the human MT1 receptor proteins might be attributable to protein glcosylation
and high hydrophobicity (Brydon et al., 1999). In contrast, myc-tagged variant receptor
proteins (V1, V2, V3) were clearly detected only in the presence of the proteasome inhibitor
MG-132 (Fig. 5). Furthermore, two major bands were detected in the V3 variant lysates.
These results suggest that monkey MT2 variant receptor proteins were rapidly degraded by
proteasomes in CHO-K1 cells and also that the V3 variant receptor protein was cleaved by
an unknown mechanism.
Binding of 2-[125I] iodomelatonin to the recombinant and native monkey melatonin
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
15
receptors
Previously, it was demonstrated that 2-[125I] iodomelatonin binds to both human MT1 and
MT2 melatonin receptors with high affinity (Reppert et al., 1994, 1995). We examined
whether monkey melatonin receptors had ligand binding characteristics similar to those of
human receptors by performing saturation binding experiments. Figure 6 shows saturation
curves of specific 2-[125I] iodomelatonin binding to CHO membranes expressing monkey
MT1 (Fig. 6A) or MT2 (Fig. 6B) receptors. For these receptors, 2-[125I] iodomelatonin
bound to a single class of high affinity binding sites. The equilibrium dissociation constant
(Kd) and maximum binding (Bmax) values (mean ± S.E.M; n = 3 experiments) were 19.9 ±
6.87 pM and 1.11 ± 0.33 pmol/mg protein, respectively, for the monkey MT1 receptor and
70.4 ± 7.05 pM and 1.35 ± 0.47 pmol/mg protein, respectively, for the monkey MT2
receptor. Thus, similar to the data previously published on the human MT1 and MT2
receptors, the monkey MT1 receptor had higher affinity for 2-[125I] iodomelatonin compared
to the monkey MT2 receptor (Kd = 21 ± 3 pM, 15 ± 3 pM for human MT1, and 107 ± 11 pM,
328 ± 12 pM for human MT2; Audinot et al., 2003, Kato et al., 2005, respectively). No
specific binding was detected in mock-transfected membranes (data not shown). We
proceeded to further characterize the 2-[125I] iodomelatonin binding sites in the monkey
SCN, which were expected to mediate the sleep-promoting effects of melatonin and
ramelteon. Autoradiographic studies with 2-[125I] iodomelatonin have revealed the presence
of high affinity binding sites in the rhesus monkey SCN (Weaver et al., 1993). The monkey
SCN membranes specifically bound 2-[125I] iodomelatonin with 4-times lower affinity (Fig.
6C; Kd = 80.5 pM) than that of the recombinant monkey MT1 melatonin receptor. In
addition, the amount of specific 2-[125I] iodomelatonin binding in SCN membrane was
higher than that in membranes from other regions of the monkey brain (SCN, 0.466
fmol/mg protein; cerebral cortex, 0.005 fmol/mg protein; putamen, 0.145 fmol/mg protein;
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
16
caudate nucleus, 0.173 fmol/mg protein; amygdala, 0.106 fmol/mg protein).
Competition by ramelteon and melatonin for 2-[125I] iodomelatonin binding to the
recombinant and native monkey melatonin receptors
We determined the affinities of ramelteon and melatonin for recombinant and native
monkey melatonin receptors by performing competition binding experiments. Figure 7
illustrates the concentration-dependent inhibition of 2-[125I] iodomelatonin binding to
recombinant (Fig. 7A, 7B) and native monkey melatonin receptors (Fig. 7C) by ramelteon
and melatonin (0.64 pM–10 nM). Ramelteon displayed 3- to 7-fold higher affinities for
recombinant and native monkey melatonin receptors than melatonin, which is consistent
with the results for human melatonin receptors (Table 2). Nevertheless, although the affinity
of ramelteon for monkey MT1 melatonin receptor was comparable to that for human MT1
melatonin receptor, its affinity for monkey MT2 melatonin receptor was higher than that for
human MT2 melatonin receptor (Ki = 14 ± 0.5 pM and 112 ± 5 pM for the human MT1
and MT2 melatonin receptors, respectively; Kato et al., 2005).
Inhibition of PACAP27-stimulated cAMP production in CHO cells transiently
coexpressing human PAC-1 with the monkey melatonin receptors.
In order to confirm that the recombinant monkey melatonin receptors are functionally
coupled to adenylate cyclase, we examined the effects of ramelteon and melatonin on
PACAP27-stimulated cAMP production in CHO-K1 cells transiently coexpressing human
PAC-1 with the monkey MT1 or MT2 melatonin receptors. Previous studies have shown that
melatonin suppresses PACAP-induced phosphorylation of Ca2+/cAMP response element
binding protein (CREB) in mice (von Gall et al., 2000). Ramelteon and melatonin caused a
dose-dependent inhibition of the cAMP production induced by PACAP27 (Fig. 8A, 8B). For
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
17
ramelteon, the IC50 values (n = 3) were 28.5 ± 8.55 pM and 20.1 ± 9.25 pM for the monkey
MT1 and MT2 receptors, respectively, whereas the corresponding values for melatonin were
274 ± 40.2 pM and 111 ± 24.6 pM. Thus, the agonist activity of ramelteon at monkey MT1
and MT2 receptors was 9.6 and 5.5 times more potent, respectively, than melatonin.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
18
Discussion
In this study, we characterized the cynomolgus monkey MT1 and MT2 melatonin
receptors, and determined the in vitro activity of ramelteon at these receptors as compared
with melatonin. Ramelteon displayed higher affinities than melatonin for monkey
recombinant and native melatonin receptors; moreover, these affinities for monkey
receptors were comparable to those for human receptors (Fig. 2; Kato et al., 2005).
Furthermore, ramelteon inhibited PACAP27-induced cAMP production with a higher
potency than melatonin. These observations indicate that the pharmacological profiles of
the monkey melatonin receptors are similar to those of the human melatonin receptors.
We initially cloned the novel genes for cynomolgus monkey MT1 and MT2 melatonin
receptors, and also three MT2 splice variants. The monkey MT1 and MT2 melatonin
receptors had significant amino acid homology with the human MT1 and MT2 melatonin
receptors, i.e., 95% and 96% identity, respectively. In addition, the monkey melatonin
receptors showed high amino acid homology with rat (84% for MT1, 80% for MT2,
respectively) and mouse homologues (85% for MT1, 80% for MT2, respectively).
Site-directed mutagenesis studies dealing with melatonin receptors have demonstrated that
some amino acid residues are critical for ligand binding. Two serine residues (Ser110 and
Ser114) in transmembrane domain 3 (TM3) of human MT1 receptor were required for
agonist binding (Conway et al., 2001). Furthermore, a valine residue and a histidine residue
in the TM5 of ovine melatonin receptor (corresponding to Val192 and His195 in the human
MT1 receptor) were associated with the binding affinities and potencies of ligands (Conway
et al., 1997). On the basis of a 3-D model of human MT2 receptor obtained using the X-ray
structure of bovine rhodopsin as a template, Mazna et al. (2004) reported that a valine
(Val204) residue in TM5, a leucine (Leu272) residue in TM6, and a tyrosine (Tyr298) residue
in TM7 were involved in 2-iodomelatonin binding. These amino acid residues are
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
19
conserved in the respective receptors of the 4 species mentioned above (Figs. 1 and 2). In
accord with these high amino acid identities, the Kd and Ki values (ramelteon and
melatonin) for the monkey melatonin receptors, especially MT1 receptor, were comparable
to those for the human melatonin receptors expressed in the same cell line of CHO cells
(Audinot et al., 2003, Kato et al., 2005). The monkey MT2 variant receptors each contained
different new exons between exon 1 and exon 2. Both human MT1 and MT2 melatonin
receptor genes contain a conserved intron splice site in the first cytoplasmic loop. This
intron could lead to alternative splicing forms of these receptors (Reppert et al., 1995).
Indeed, Slominski et al. (2003) reported that the human MT2 variant receptor had an
insertion of 154 bp from intron 1 and lacked a 200 bp from exon 2, which generated a
frameshift and premature translation termination; the resultant truncated protein consisted
of 73 N-terminal amino acids. The Siberian hamster MT2 receptor lacks exon 1, and also
has two nonsense mutations in the coding region (Weaver et al., 1996). Similar to the
monkey MT2 variant receptors, it is unlikely that such variants are functional.
We demonstrated the binding profiles of the native monkey melatonin receptor in the
cynomolgus monkey SCN. High affinity binding sites of 2-[125I] iodomelatonin are
observed in the SCN of humans (Kd, 53.3 pM), rhesus monkeys (Weaver et al., 1993), and
rats (Kd, 52.8 pM; Laitinen and Saavedra, 1990). The binding affinity at monkey SCN
membranes (Kd, 80.5 pM, Fig. 6C) is consistent with these reports, whereas the Kd value for
the monkey SCN membranes was different to that for either of the cloned monkey
melatonin receptors. It remains unclear whether the MT2 melatonin receptor is expressed in
the monkey SCN. Consistent with mouse and rat SCN, the majority of 2-[125I]
iodomelatonin binding in the monkey SCN may be due to the presence of the MT1
melatonin receptor (Liu et al., 1997; Dubocovich et al., 1998).
For functional studies, we used CHO-K1 cells transiently coexpressing human PAC-1
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
20
with the monkey MT1 or MT2 melatonin receptors. In order to increase the maximum
potency of melatonin, which inhibits PACAP27-stimulated cAMP production, the ratio of
amounts of PAC-1 vector to either the MT1 or MT2 melatonin receptor was approximately
1/10. Melatonin inhibits the PACAP-induced phosphorylation of CREB in the mouse SCN
mediated by MT1 melatonin receptor and presumably MT2 melatonin receptor (von Gall et
al., 1998). The cotransfected cells may mimic cAMP signaling in the SCN cells. For both
the monkey MT1 and MT2 melatonin receptors, ramelteon was shown to be an agonist with
a higher potency than melatonin. Activation of the monkey MT1 and MT2 melatonin
receptors by ramelteon and melatonin, as determined by the inhibition of
PACAP27-stimulated cAMP production, was correlated with their binding affinities. For
example, ramelteon exhibited a 3.2-fold higher affinity and 5.5-fold higher potency than
melatonin at the monkey MT2 melatonin receptor. In contrast, the relative potency of
ramelteon and melatonin at the human MT2 melatonin receptor differs considerably from
that predicted by binding activity (Kato et al., 2005). Melatonin has a 17-fold lower potency
than ramelteon compared with a 3.4-fold lower affinity at the human MT2 receptor. The
species differences in MT2 melatonin receptor sequence may be involved in this
phenomenon.
In conclusion, this study provides new information on the characters of native and
recombinant monkey melatonin receptors. Similar to human homologues, ramelteon
exhibited higher binding affinities and more potent functional activities than melatonin at
monkey melatonin receptors. This information on monkey melatonin receptors will help us
to gain an understanding of the pharmacological effects (e.g., sleep promotion) of melatonin
receptor agonists in monkeys. In addition, the sequence and functional similarities between
the melatonin receptors of monkeys and humans suggest that an evaluation of
sleep-promoting effect of melatonin receptor agonists in monkeys may be useful for
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
21
predicting the efficacy of such agonists in humans.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
22
Acknowledgements
We wish to thank Margarita L. Dubocovich, Hideaki Nagaya, and Takeo Wada for
critical reading of the manuscript and valuable comments; Hisao Nishikawa, Yoshiyuki
Furukawa, Eiji Nishida, and Ryoetsu Imai for collecting monkey tissues; Minoru Maruyama
for donating the PACAP 1 receptor expression vector; and Michiyasu Takeyama and Yugo
Habata for useful technical suggestions.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
23
References
Akanmu MA, Songkram C, Kagechika H, and Honda K (2004) A novel melatonin
derivative modulates sleep-wake cycle in rats. Neurosci Lett 364: 199-202.
Audinot V, Mailliet F, Lahaye-Brasseur C, Bonnaud A, Le Gall A, Amossé C, Dromaint S,
Rodriguez M, Nagel N, Galizzi JP, Malpaux B, Guillaumet G, Lesieur D, Lefoulon F,
Renard P, Delagrange P, and Boutin JA (2003) New selective ligands of human cloned
melatonin MT1 and MT2 receptors. Naunyn Schmiedebergs Arch Pharmacol 367:
553-61.
Audinot V, Bonnaud A, Grandcolas L, Rodriguez M, Nagel N, Galizzi JP, Balik A,
Messager S, Hazlerigg DG, Barrett P, Delagrange P, and Boutin JA (2008) Molecular
cloning and pharmacological characterization of rat melatonin MT1 and MT2 receptors.
Biochem Pharmacol 75: 2007-2019.
Bartness TJ, Powers JB, Hastings MH, Bittman EL, and Goldman BD (1993) The timed
infusion paradigm for melatonin delivery: what has it taught us about the melatonin
signal, its reception, and the photoperiodic control of seasonal responses? J Pineal Res
15: 161-190.
Brydon L, Roka F, Petit L, Coppet P de, Tissot M, Barrett P, Morgan PJ, Nanoff C,
Strosberg AD, and Jockers R (1999) Dual signaling of human Mel1a melatonin receptors
via G(i2), G(i3), and G(q/11) proteins. Mol Endocrinol 13: 2025-2038.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
24
Conway S, Canning SJ, Barrett P, Guardiola-Lemaitre B, Delagrange P, and Morgan PJ
(1997) The roles of valine 208 and histidine 211 in ligand binding and receptor function
of the ovine Mel1a beta melatonin receptor. Biochem Biophys Res Commun 239:
418-423.
Conway S, Mowat ES, Drew JE, Barrett P, Delagrange P, and Morgan PJ (2001) Serine
residues 110 and 114 are required for agonist binding but not antagonist binding to the
melatonin MT(1) receptor. Biochem Biophys Res Commun 282: 1229-1236.
Drew JE, Williams LM, Hannah LT, Barrett P, and Abramovich DR (1998) Melatonin
receptors in the human fetal kidney: 2-[125I] iodomelatonin binding sites correlated with
expression of Mel1a and Mel1b receptor genes. J Endocrinol 156: 261-267.
Dubocovich ML, Masana MI, Iacob S, and Sauri DM (1997) Melatonin receptor antagonists
that differentiate between the human Mel1a and Mel1b recombinant subtypes are used to
assess the pharmacological profile of the rabbit retina ML1 presynaptic heteroreceptor.
Naunyn Schmiedebergs Arch Pharmacol 355: 365-375.
Dubocovich ML, Yun K, Al-Ghoul WM, Benloucif S, and Masana MI (1998) Selective
MT2 melatonin receptor antagonists block melatonin-mediated phase advances of
circadian rhythms. FASEB J 12: 1211-1220.
Dubocovich ML, Hudson RL, Sumaya IC, Masana MI, and Manna E (2005) Effect of MT1
melatonin receptor deletion on melatonin-mediated phase shift of circadian rhythms in
the C57BL/6 mouse. J Pineal Res 39: 113-120.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
25
Foulkes NS, Borjigin J, Snyder SH, and Sassone-Corsi P (1997) Rhythmic transcription: the
molecular basis of circadian melatonin synthesis. Trends Neurosci 20: 487-492.
Jin X, von Gall C, Pieschl RL, Gribkoff VK, Stehle JH, Reppert SM, and Weaver DR
(2003) Targeted disruption of the mouse Mel (1b) melatonin receptor. Mol Cell Biol 23:
1054-1060.
Kato K, Hirai K, Nishiyama K, Uchikawa O, Fukatsu K, Ohkawa S, Kawamata Y,
Hinuma S, and Miyamoto M (2005) Neurochemical properties of ramelteon (TAK-375),
a selective MT1/MT2 receptor agonist. Neuropharmacology 48:301-310.
Laitinen JT and Saavedra JM (1990) Characterization of melatonin receptors in the rat
suprachiasmatic nuclei: modulation of affinity with cations and guanine nucleotides.
Endocrinology 126: 2110-2115.
Liu C, Weaver DR, Jin X, Shearman LP, Pieschl RL, Gribkoff VK, and Reppert SM (1997)
Molecular dissection of two distinct actions of melatonin on the suprachiasmatic
circadian clock. Neuron 19: 91-102.
MacKenzie RS, Melan MA, Passey DK, and Witt-Enderby PA (2002) Dual coupling of
MT(1) and MT(2) melatonin receptors to cyclic AMP and phosphoinositide signal
transduction cascades and their regulation following melatonin exposure. Biochem
Pharmacol 63: 587-595.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
26
Mailliet F, Galloux P, and Poisson D (2001) Comparative effects of melatonin, zolpidem
and diazepam on sleep, body temperature, blood pressure and heart rate measured by
radiotelemetry in Wistar rats. Psychopharmacology (Berl) 156: 417-426.
Mazna P, Obsilova V, Jelinkova I, Balik A, Berka K, Sovova Z, Ettrich R, Svoboda P, Obsil
T, Teisinger J (2004) Molecular modeling of human MT2 melatonin receptor: the role of
Val204, Leu272 and Tyr298 in ligand binding. J Neurochem 91: 836-842.
Miyamoto M, Nishikawa H, Doken Y, Hirai K, Uchikawa O, and Ohkawa S (2004) The
sleep-promoting action of ramelteon (TAK-375) in freely moving cats. Sleep 27:
1319-1325.
Morgan PJ (2000) The pars tuberalis: the missing link in the photoperiodic regulation of
prolactin secretion. J. Neuroendocrinol 12: 287-295.
Petit L, Lacroix I, Coppet P de, Strosberg AD, and Jockers R (1999) Differential signaling
of human Mel1a and Mel1b melatonin receptors through the cyclic guanosine 3′-5 ′
-monophosphate pathway. Biochem Pharmacol 58: 633-639.
Redman J, Armstrong S, and Ng KT (1983) Free-running activity rhythms in the rat:
entrainment by melatonin. Science 219: 1089-1091.
Reiter RJ (1980) The pineal and its hormones in the control of reproduction in mammals.
Endocr Rev 1: 109-131.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
27
Reppert SM, Weaver DR, and Ebisawa T (1994) Cloning and characterization of a
mammalian melatonin receptor that mediates reproductive and circadian responses.
Neuron 13: 1177-1185.
Reppert SM, Godson CG, Mahle CD, Weaver DR, Slaugenhaupt SA, and Gusella JF (1995)
Molecular characterization of a second melatonin receptor expressed in human retina and
brain: the Mel1b-melatonin receptor. Proc Natl Acad Sci USA 92: 8734-8738.
Roca AL, Godson C, Weaver DR, and Reppert SM (1996) Structure, characterization, and
expression of the gene encoding the mouse Mel1a melatonin receptor. Endocrinology
137: 3469-3477.
Sallinen P, Saarela S, Ilves M, Vakkuri O, and Leppäluoto J (2005) The expression of MT1
and MT2 melatonin receptor mRNA in several rat tissues. Life Sci 76: 1123-1134.
Slominski A, Pisarchik A, Zbytek B, Tobin DJ, Kauser S, and Wortsman J (2003)
Functional activity of serotoninergic and melatoninergic systems expressed in the skin. J
Cell Physiol 196: 144-153.
Slotten HA, Pitrosky B, and Pévet P (1999) Influence of the mode of daily melatonin
administration on entrainment of rat circadian rhythms. J Biol Rhythms 14: 347-353.
Tamarkin L, Baird CJ, and Almeida OF (1985) Melatonin: a coordinating signal for
mammalian reproduction? Science 227: 714-720.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
28
Uchikawa O, Fukatsu K, Tokunoh R, Kawada M, Matsumoto K, Imai Y, Hinuma S, Kato K,
Nishikawa H, Hirai K, Miyamoto M, and Ohkawa S (2002) Synthesis of a novel series of
tricyclic indan derivatives as melatonin receptor agonists. J Med Chem 45: 4222-4239.
von Gall C, Weaver DR, Kock M, Korf HW, and Stehle JH (2000) Melatonin limits
transcriptional impact of phosphoCREB in the mouse SCN via the Mel1a receptor.
Neuroreport 11: 1803-1807.
Weaver DR, Stehle JH, Stopa EG, and Reppert SM (1993) Melatonin receptors in human
hypothalamus and pituitary: implications for circadian and reproductive responses to
melatonin. J Clin Endocrinol Metab 76: 295-301.
Weaver DR, Liu C, and Reppert SM (1996) Nature’s knockout: the Mel1b receptor is not
necessary for reproductive and circadian responses to melatonin in Siberian hamsters.
Mol Endocrino 10: 1478-1487.
Wyatt JK, Dijk DJ, Ritz-de Cecco A, Ronda JM, and Czeisler CA (2006) Sleep-facilitating
effect of exogenous melatonin in healthy young men and women is circadian-phase
dependent. Sleep 29: 609-618.
Yukuhiro N, Kimura H, Nishikawa H, Ohkawa S, Yoshikubo S, and Miyamoto M (2004)
Effects of ramelteon (TAK-375) on nocturnal sleep in freely moving monkeys. Brain Res
1027: 59-66.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
29
Zammit G, Erman M, Wang-Weigand S, Sainati S, Zhang J, and Roth T (2007) Evaluation
of the efficacy and safety of ramelteon in subjects with chronic insomnia. J Clin Sleep
Med 3: 495-504.
Zee PC and Manthena P (2007) The brain’s master circadian clock: Implications and
opportunities for therapy of sleep disorders. Sleep Med Rev 11: 59-70.
Zhdanova IV, Geiger DA, Schwagerl AL, Leclair OU, Killiany R, Taylor JA, Rosene DL,
Moss MB, and Madras BK (2002) Melatonin promotes sleep in three species of diurnal
nonhuman primates. Physiol Behav 75: 523-529.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
30
Footnotes
Reprint Requests: Shin-ichi Yoshikubo, Ph.D., Pharmacology Research Laboratory,
Pharmaceutical Research Division, Takeda Pharmaceutical Company Ltd, 17-85,
Jusohonmachi 2-chome, Yodogawa-ku, Osaka 532-8686, Japan
Phone: +81-6-6300-6647, Fax: +81-6-6300-6306, E-mail:
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
31
Legends for figures
Fig. 1. Comparison of the amino acid sequences of monkey, human, mouse, and rat MT1
melatonin receptors. Consensus amino acid residues in more than three receptors are boxed.
Gaps in the sequences are represented by dashes. The putative seven transmembrane
domains are overlined. The DNA sequences for monkey, human, mouse, and rat MT1
melatonin receptors have been deposited in GenBank under the accession numbers
FJ918400, NM_005958, NM_008639, and NM_053676, respectively.
Fig. 2. Comparison of the amino acid sequences of monkey, human, mouse, and rat MT2
melatonin receptors. Consensus amino acid residues in more than three receptors are boxed.
Gaps in the sequences are represented by dashes. The putative seven transmembrane
domains are overlined. The DNA sequences for monkey, human, mouse, and rat MT2
melatonin receptors have been deposited in GenBank under the accession numbers
FJ905899, NM_005959, NM_145712, and NM_001100641, respectively.
Fig. 3. Comparison of the amino acid sequences of monkey full-length MT2 melatonin
receptor and three types of MT2 splicing variant (variants 1–3). Consensus amino acid
residues in more than three receptors are boxed. The putative seven transmembrane
domains are overlined. The DNA sequences for monkey MT2 splicing variants have been
deposited in GenBank under the accession numbers FJ905900, FJ905901, and FJ905902,
respectively.
Fig. 4. Specific binding of 2-[125I] iodomelatonin to vehicle or 2 μM MG-132-treated CHO
membranes expressing full-length (F) or variant forms (V1, V2, V3) of monkey MT2
receptor. Data shown are mean ± S.E.M. of three experiments.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
32
Fig. 5. Rapid degradation of monkey MT2 variant receptor proteins by proteasomes.
CHO-K1 cells were transiently transfected with control vector (C), myc-tagged full-length
form (F), or variant forms (V1, V2, V3) of monkey MT2 receptor expression vectors, and
then treated with vehicle (lanes 1 to 5), 2 μM MG-132 (lanes 6 to 9); or 2 μM cathepsin
inhibitor I (lanes 10 to 13) for 19 h. Cells were harvested for western blotting of
myc-tagged protein. Although the expression of myc-tagged full-length MT2 receptor
proteins was verified, MT2 variant receptor proteins were clearly detected only after
MG-132 treatment. Molecular weights in kilodaltons (kDa), determined from prestained
standards, are indicated on the left.
Fig. 6. Saturation binding of 2-[125I] iodomelatonin to CHO membranes expressing monkey
MT1 (A) or MT2 (B) receptors and monkey suprachiasmatic nucleus (SCN) membranes (C).
(Inset) Scatchard plot of the saturation data. Data shown are for representative experiments
with each point representing duplicate determinations.
Fig. 7. Competition by ramelteon and melatonin for 2-[125I] iodomelatonin binding to CHO
membranes expressing monkey MT1 (A) or MT2 (B) receptors and monkey suprachiasmatic
nucleus (SCN) membranes (C). Values are expressed as a percentage of specific binding.
Data shown are mean ± S.E.M. of three (A, B) experiments or from a single (C) experiment,
with each point representing duplicate determinations. Ki values are listed in Table 2.
Fig. 8. Inhibition of PACAP27-stimulated cAMP production in CHO cells transiently
coexpressing human PACAP receptor 1 (PAC-1) with monkey MT1 (A) or MT2 (B) receptor.
The 100% value is the mean cAMP production induced with 1 nM PACAP27. Data shown
are mean ± S.E.M. of three experiments with each point representing quadruplicate
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
33
determinations.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
34
Table 1. Primer sequences and conditions used for PCR amplification
Primer name Sequence (5′-3′) Conditions
Primers for MT1
MT1-exon1-F1 ACACGTGAATGAACAGCCTCGCTG 95°C × 3 min, 1 cycle / 95°C × 30 s, 61.8°C × 30 s,
MT1-exon1-R1 GTCCCCATAGGAAAGAGAATGCGACTCT 72°C × 30 s, 25 cycles / 72°C × 10 min, 1 cycle
MT1-exon2-F1 GCAGCTGTGACGTCAGGTCATCAG 94°C × 2 min, 1 cycle / 94°C × 15 s, 60°C × 20 s,
MT1-exon2-R1 AAGCTGGAAGGTTCCTCCACCA 68°C × 90 s, 20 cycles / 68°C × 5 min, 1 cycle
MT1-exon1-F2 AAGCGGGCTCGCGACGGA 95°C × 3 min, 1 cycle / 95°C × 30 s, 61.8°C × 30 s,
MT1-exon1-R2 CGATGGGCAGGCTGGAGGAAGA 72°C × 30 s, 25 cycles / 72°C × 10 min, 1 cycle
MT1-exon2-F2 GCAGGCAGAAGCAGCTCCTTCTT 94°C × 2 min, 1 cycle / 94°C × 15 s, 60°C × 20 s,
MT1-exon2-R2 AGGCAACACGGAAAGGCGTG 68°C × 90 s, 30 cycles / 68°C × 5 min, 1 cycle
MT1-exon1-F3 ATGCCGGGCAACGGCAGCGCGCTGC 95°C × 3 min, 1 cycle / 95°C × 30 s, 55°C × 30 s,
MT1-exon1-R3 AAGATGTTTCCTGCGTTCCGGAGCTTCTTGTTCC
G 72°C × 30 s, 30 cycles / 72°C × 10 min, 1 cycle
MT1-exon2-F3 CGGAACGCAGGAAACATCTTTGTGGTGAGCTTA
GC 94°C × 2 min, 1 cycle / 94°C × 15 s, 60°C × 20 s,
MT1-exon2-R3 TTAAACCGAGTCCACCTTTACTAGA 68°C × 1 min, 20 cycles / 68°C × 5 min, 1 cycle
MT1-exon1-F3 95°C × 3 min, 1 cycle / 95°C × 30 s, 55°C × 30 s,
MT1-exon2-R3 72°C × 30 s, 30 cycles / 72°C × 10 min, 1 cycle
Primers for MT2
MT2-F1 CAGTACTGCGCGAGCCCTGCG 94°C × 2 min, 1 cycle / 94°C × 15 s, 68.4°C × 20 s,
MT2-R1 CACCATTTCATGAGTTTGTCGTGC 68°C × 90 s, 20 cycles / 68°C × 5 min, 1 cycle
MT2-F2 AAAGCGCAGCGCGGGAGAGT 94°C × 2 min, 1 cycle / 94°C × 15 s, 66.8°C × 20 s,
MT2-R2 AGCTGGTGTGCCTCAGATCCAG 68°C × 90 s, 30 cycles / 68°C × 5 min, 1 cycle
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
JPET#155283
35
Table 2. Affinities of ramelteon and melatonin for native and recombinant monkey
melatonin receptors. The inhibition constants (Ki) of ramelteon and melatonin were
calculated from IC50 and Kd using the Cheng-Prusoff equation. Values for recombinant
receptors represent the mean ± S.E.M. of three independent experiments.
Ki (pM)
Compound Monkey MT1 (CHO) Monkey MT2 (CHO) Monkey SCN
Ramelteon 12.3 ± 1.00 40.4 ± 2.86 49.4
Melatonin 67.4 ± 24.3 129 ± 16.8 329
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on June 25, 2009 as DOI: 10.1124/jpet.109.155283
at ASPE
T Journals on M
ay 12, 2021jpet.aspetjournals.org
Dow
nloaded from