MOLECULAR AND FUNCTIONAL CHARACTERISATION OF AN … Thuy Trang_Le... · 2018-01-30 · Molecular...

Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis 1

MOLECULAR AND FUNCTIONAL

CHARACTERISATION OF AN OSMOTIN

GENE FROM THE RESURRECTION PLANT

TRIPOGON LOLIIFORMIS

By

Thi Thuy Trang LE

BSc of Agronomy (Hons.)

MSc of Plant Science

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

at the

Centre for Tropical Crops and Biocommodities

Science and Engineering Faculty

Queensland University of Technology

2018

2 Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

Intentionally blank

Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon loliiformis i

Keywords

Abiotic stress, Agrobacterium-mediated transformation, Agro-infiltration, BiFC,

cell membrane integrity, co-localisation, cold stress, cold tolerance, confocal

microscopic analysis, Coomassie stain, drought stress, drought tolerance, dry biomass,

electrolyte leakage, embryogenic callus, EYFP, genetic engineering, GO term

enrichment, Gus-reporter gene, Gus stain, His tag, hygromycin resistant marker,

infiltration, KDEL, leaf damage, morphology, membrane protein tracker, Myc, NaCl,

Nicotiana benthamiana, Nicotiana tabacum, Oryza sativa, osmotin, panicle length,

plasmid cloning, photosynthesis, protein extraction, protein microarray, protein-

protein interaction, protein purification, protein structure, qRT-PCR, recombinant

proteins, resurrection plant, rice, ROS, RWC, salinity stress, salinity stress tolerance,

transcriptional expression, transgenic plant, transient expression, Tripogon loliiformis,

Ubi promoter, yield component.

ii Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis


loliiformis iii

Abstract

Abiotic stresses such as drought, salinity, and extreme temperature are key

factors that limit crop productivity and are major constraints to meeting global food

demands. The development of stress-tolerant crops that mitigate the effects of abiotic

stresses on crop productivity is crucially needed to sustain agricultural production. The

narrow genetic variation of stress-tolerant traits among crops and sexual barrier

between species have restricted the success of developing stress-tolerant crops by

conventional breeding. Genetic engineering of crops with stress-tolerant traits is a

promising approach for improving stress tolerance in crops. Prior to the development

of stress tolerant crops by genetic engineering, it is essential that key genes regulating

stress-tolerant traits are characterised.

Stress-tolerant traits in plants are genetically coded. Naturally tolerant species,

such as the resurrection plant Tripogon loliiformis, represent an ideal starting point for

the identification of genes encoding stress-tolerant traits. T. loliiformis has evolved

mechanisms to tolerate extreme dehydration down to 4% relative water content

(RWC), facilitate cellular protection and survival during desiccation, and to rapidly

recover within 48-72 h of rehydration to full metabolic activity. These mechanisms

hold great potential for the introduction into crop species. It is important to identify

the key regulators of these stress-tolerance mechanisms for effective transfer of stress-

tolerant traits into crop species.

This PhD study describes the molecular characterisation of an osmotin gene

(TlOsm) from the desiccation tolerant plant T. loliiformis. The conserved and novel

characteristics of TlOsm were identified in comparison with two osmotins, OsOlp1_A

from a drought-tolerant cultivar and OsOlp1_I from a drought-sensitive cultivar, of the

stress sensitive species Oryza sativa (rice). Protein structural-to-functional predictions,

the response of transgenic rice plants constitutively expressing each of the osmotins to

cold, drought, and salinity stress, and the profiles of plant proteins interacting with

three osmotins on the Arabidopsis protein microarrays (chip) and in living Nicotiana

benthamiana plants were analysed. The results revealed the common and unique

characteristics of TlOsm, the profiles of TlOsm protein interactors, possible

iv Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

pathways involving TlOsm, and functional roles of TlOsm in enhanced rice

tolerance to cold, drought, and salinity stresses. The results highlight the higher

functional efficacy of TlOsm, compared to rice osmotins, in regulating plant response

to stress, indicate the potential use of TlOsm for developing crops tolerant to multiple

abiotic stresses, and provide useful information for elucidating molecular mechanisms

underlying osmotin functions in regulating plant response to stress.

Transcriptional profiling of TlOsm during T. loliiformis plant development and

on exposure to cold, heat, drought, and salinity stresses indicated that TlOsm was

induced up to a thousand fold upon cold, drought, and salinity stresses. The plasma

membrane localisation of TlOsm was observed by confocal microscopy of transgenic

Nicotiana tabacum expressing Enhanced Yellow Fluorescent Protein (EYFP)-tagged

TlOsm. Sequence analysis of TlOsm revealed its conserved characteristics of an

osmotin, the close genetic relationship with monocotyledonous osmotins, and a

sequence of 50 AA at its C-terminus that is not homologous to other osmotins.

Analyses based on structural-to-functional predictions, compared to two rice osmotins,

revealed that TlOsm had more glucan-binding and phosphorylation sites than rice

osmotins and four binding sites with enzymatic functions in sugar metabolism, which

did not exist in either of rice osmotins.

The effects of TlOsm, OsOlp1_A, and OsOlp1_I on enhancing plant tolerance to

cold, drought, and salinity stress were compared in transgenic rice expressing each of

the osmotin gene. Agrobacterium-mediated transformation was used to generate 42

transgenic rice lines expressing TlOsm, OsOlp1_A, OsOlp1_I, or the Gus reporter

gene. Transgenic plants of two successive generations were assessed for enhanced

tolerance to cold, drought, and salinity stresses. The results demonstrate the capacity

of TlOsm and OsOlp1_A to enhance rice tolerance to cold, drought, and salinity

stresses and emphasise the additional efficacy of TlOsm. The tolerant traits passed on

to the next generation. The results suggest a positive correlation between functional

binding sites of the osmotins and the levels of enhanced stress tolerance in transgenic

rice.

Interactive protein partners and possible pathways involving the osmotins were

revealed by Arabidopsis protein chip assays. The results were validated in N.

benthamiana. On the protein chips, 267, 239, and 237 proteins interacted with TlOsm,

OsOlp1_A, and OsOlp1_I respectively. Osmotin interactors were found involved


loliiformis v

in the diverse biological processes and pathways fundamental in plant development

and adaptation. The three dominant pathways were fructose and mannose metabolism,

glycolysis, and pentose phosphate pathways. Interestingly, 21 proteins interacted only

with TlOsm and were involved in plant responses to stress, chemical, and endogenous

stimuli. Nine of these 21 proteins are involved in nine pathways that do not contain

any interactors of the rice osmotins. Fifteen interactions were validated in planta by

Bimolecular Fluorescence Complementation (BiFC) analysis and 14 of those

confirmed the results on the chip assays. Protein-protein interaction assays revealed

that TlOsm is capable of interacting with more stress-responsive proteins than

osmotins from sensitive species, O. sativa.

The study contributes significantly to understanding the proteomic evolution of

osmotins from tolerant and sensitive species as well as from tolerant and sensitive

cultivars within species. The results provide evidence highlighting the potential of T.

loliiformis genetic resource for identification of stress-tolerant traits to introduce into

crop species. The study also deepens our understanding of the molecular mechanisms

underlying osmotin functions in regulating plant stress response.

vi Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

List of Publications and Conferences

Thi Thuy Trang LE, Brett Williams, and Sagadevan Mundree (2017). An osmotin

from the resurrection plant Tripogon loliiformis (TlOsm) confers tolerance to multiple

abiotic stresses in transgenic rice. Physiologia Plantarum, doi: 10.1111/ppl.12585.

Thi Thuy Trang LE, Brett Williams, and Sagadevan Mundree (2016). Comparative

analysis of osmotins from Tripogon loliiformis and Oryza sativa revealed role in

abiotic stress tolerance through signalling pathways. Poster in the Combio2016

Workshop, 03-07 Oct 2016, Brisbane, Australia.

Thi Thuy Trang LE, Brett Williams, and Sagadevan Mundree (2016).

Characterization of an osmotin gene from resurrection plant Tripogon loliiformis. Oral

presentation in the 7th International Workshop on Desiccation Sensitivity and

Tolerance across Life Forms, 11-15 Jan 2016, Cape Town, South Africa.


loliiformis vii

Table of Contents

Keywords .................................................................................................................................. i

Abstract ................................................................................................................................... iii

List of Publications and Conferences ...................................................................................... vi

Table of Contents ................................................................................................................... vii

List of Figures ....................................................................................................................... xiii

List of Tables ........................................................................................................................ xvi

List of Abbreviations ........................................................................................................... xvii

Statement of Original Authorship ......................................................................................... xxi

Acknowledgements ............................................................................................................. xxiii

Chapter 1: Introduction and Literature Review ............................................... 1

1.1 INTRODUCTION ..........................................................................................................1

1.2 PLANTS AND ENVIRONMENTAL STRESSES ........................................................3 1.2.1 Plants affected by environmental factors .............................................................3 1.2.2 Plant responses to abiotic stresses ........................................................................4 1.2.3 Abiotic stress, world food security, and molecular breeding .............................11

1.3 OSMOTIN AND OLP: THE STRESS-RESPONSIVE MULTIFUNCTIONAL

PROTEINS .............................................................................................................................13 1.3.1 Osmotins and OLPs, the members of pathogenesis-related proteins .................13 1.3.2 Osmotins and OLPs play roles in multi-stress responses ...................................15 1.3.3 Expression of osmotins and OLPs enhanced plant tolerance to multiple

stress factors .......................................................................................................17 1.3.4 Possible roles of osmotins and OLPs in response to abiotic and biotic

stress ...................................................................................................................19 1.3.5 Osmotins and OLPs as potential candidate genes for enhancing multi-

stress tolerance and for other uses in food industry............................................22

1.4 RESURRECTION PLANTS: A NOVEL SOURCE FOR STRESS-RESPONSIVE

GENES ....................................................................................................................................23

1.5 RICE AS A TARGET FOR ENHANCING ABIOTIC STRESS TOLERANCE VIA

TRANSGENIC APPROACH .................................................................................................25 1.5.1 Rice is an important staple food crop .................................................................25 1.5.2 Rice is the model plant for monocots .................................................................26 1.5.3 Rice is susceptible to abiotic stresses .................................................................26

1.6 RECENT ADVANCES IN STUDYING FUNCTIONAL PROTEINS .......................28 1.6.1 Bioinformatics tools ...........................................................................................29 1.6.2 Advances in genetic manipulation ......................................................................30 1.6.3 Functional protein microarrays ...........................................................................31 1.6.4 Detection tools for protein-protein interactions in living cells ...........................32

1.7 PROBLEM STATEMENT, GAPS, AIMS, AND OBJECTIVES ...............................35

viii Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

Chapter 2: General Materials and Methods .................................................... 39

2.1 MATERIALS ............................................................................................................... 39 2.1.1 Source of general chemicals and specialized reagents ....................................... 39 2.1.2 Plant materials.................................................................................................... 39 2.1.3 Bacterial strains.................................................................................................. 40 2.1.4 Oligodeoxyribonucleotide (Primers) ................................................................. 40 2.1.5 Backbone vectors ............................................................................................... 43 2.1.6 General media, solutions: abbreviation and composition .................................. 47 2.1.7 Plant tissue culture medium ............................................................................... 48

2.2 METHODS .................................................................................................................. 49 2.2.1 Cloning and bacterial transformation................................................................. 49 2.2.2 General methods in nucleic acid extraction, amplification and analysis ........... 54 2.2.3 Agrobacterium-mediated transient transformation of plants ............................. 57 2.2.4 Confocal imaging ............................................................................................... 57 2.2.5 Relative water content ...................................................................................... 58 2.2.6 Electrolyte leakage measurement ...................................................................... 58 2.2.7 Agrobacterium-mediated plant transformation and regeneration ...................... 58 2.2.8 Bioinformatics analysis ...................................................................................... 58 2.2.9 Abiotic stress treatment of T. loliiformis ........................................................... 58 2.2.10 Transgenic rice acclimatisation and abiotic stress treatments ........................... 58 2.2.11 Protein extraction, purification and analysis ...................................................... 59 2.2.12 Protein microarray hybridisation and detection of protein-protein

interaction .......................................................................................................... 59 2.2.13 Data analysis ...................................................................................................... 59

Chapter 3: Molecular Characterisation of TlOsm, an Osmotin from

Tripogon loliiformis .................................................................................................. 61

3.1 INTRODUCTION ....................................................................................................... 61

3.2 MATERIALS AND METHODS ................................................................................. 63 3.2.1 Plant materials.................................................................................................... 63 3.2.2 Sequence analysis of TlOsm ........................................................................... 63 3.2.3 Phylogenic tree construction .............................................................................. 64 3.2.4 Comparison of TlOsm with Os-OlP1_A and OsOlp1_I by

bioinformatic tools ............................................................................................. 64 3.2.5 Growth conditions, abiotic stress treatments and sampling for T.

loliiformis plants ................................................................................................ 64 3.2.6 RNA extraction and RT_qPCR analysis ............................................................ 65 3.2.7 Generation of transgenic tobacco expressing EYFP-tagged TlOsm and

VC .................................................................................................................... 66 3.2.8 Agro-infiltration of transgenic tobacco .............................................................. 68 3.2.9 Salinity stress treatment of tobacco plants ......................................................... 68 3.2.10 Confocal imaging ............................................................................................... 69

3.3 RESULTS .................................................................................................................... 69 3.3.1 Sequence analysis of TlOsm ........................................................................... 69 3.3.2 TlOsm is induced by cold, drought and salinity stresses ................................... 74 3.3.3 TlOsm localises to the plasma membrane ...................................................... 77 3.3.4 TlOsm, OsOlp1_A and OsOlp1_I differ in active binding residues ..... 81

3.4 DISCUSSION .............................................................................................................. 83 3.4.1 TlOsm is a member of osmotins and OLPs .................................................... 83 3.4.2 TlOsm is involved in osmotic stress response of T. loliiformis plants ............... 84 3.4.3 TlOsm localises to the plasma membrane regardless of stress condition ....... 85


loliiformis ix

3.4.4 TlOsm has more binding sites typical for osmotins than OsOlp1_A

and OsOlp1_I .................................................................................................86

Chapter 4: Generation of Transgenic Rice Constitutively Expressing Oryza

sativa and Tripogon loliiformis Osmotins ............................................................... 89

4.1 INTRODUCTION ........................................................................................................89

4.2 MATERIALS AND METHODS .................................................................................91 4.2.1 Plasmid constructs and Agrobacterium strains ...................................................91 4.2.2 Plant materials and culture media .......................................................................92 4.2.3 Rice callus induction, transformation, selection and regeneration .....................92 4.2.4 Characterisation of transgenic rice plants ...........................................................94

4.3 RESULTS .....................................................................................................................97 4.3.1 Callus induction, transformation, selection and regeneration of putative

transgenic rice plants ..........................................................................................97 4.3.2 Confirmation of transgenes in putative transgenic rice lines .............................99 4.3.3 Expression of transgenes in transgenic rice plants confirmed by RT-PCR ......101 4.3.4 Expression of GUS protein confirmed in GUS-expressing rice lines. ..............103

4.4 DISCUSSION .............................................................................................................105

Chapter 5: Comparative Analysis of Transgenic Rice Constitutively

Expressing Osmotins from Tolerant and Sensitive Species ............................... 109

5.1 INTRODUCTION ......................................................................................................109

5.2 MATERIALS AND METHODS ...............................................................................111 5.2.1 Plant materials ..................................................................................................111 5.2.2 Acclimatisation of tissue-cultured rice plants ..................................................112 5.2.3 Growth conditions and stress treatments at seedling stage ...............................112 5.2.4 Germination of T1 transgenic rice plants .........................................................113 5.2.5 Screening of T1 transgenic rice plants .............................................................113 5.2.6 Growth conditions and reproductive-stage stress treatments ...........................114 5.2.7 Electrolyte leakage ...........................................................................................114 5.2.8 Relative water content determination ...............................................................115 5.2.9 Plant dry weight determination ........................................................................115 5.2.10 Measurement of photosynthetic parameters .....................................................115 5.2.11 Statistical analysis ............................................................................................116

5.3 RESULTS ...................................................................................................................117 5.3.1 Rice plants constitutively expressing TlOsm or OsOlp1_A maintained

growth under cold, drought, and salinity stresses .............................................117 5.3.2 Rice plants constitutively expressing TlOsm or OsOlp1_A produce more

tillers than WT, NT, and VC plants under cold, drought, and salinity

stresses ..............................................................................................................119 5.3.3 Rice plants constitutively expressing OsOlp1_A or TlOsm retained water

better than OsOlp1_I, VC and NT or WT plants under cold, drought, and

salinity stresses .................................................................................................121 5.3.4 Rice plants constitutively expressing osmotins maintain membrane

integrity better than VC and WT or NT plants under cold, drought, and

salinity stresses .................................................................................................123 5.3.5 Rice plants constitutively expressing TlOsm or OsOlp1_A maintained

photosynthesis efficiency under drought and salinity stresses .........................125 5.3.6 Stressed rice plantlets constitutively expressing TlOsm or OsOlp1_A

showed heathier morphological appearance than VC and WT ........................130 5.3.7 Rice plants constitutively expressing TlOsm or OsOlp1_A resulted in

higher dry biomass under cold, drought, and salinity stresses .........................133

x Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

5.3.8 Constitutive expression of TlOsm or OsOlp1_A improves survival rate

under salinity, drought and cold stress in transgenic rice. ............................... 135 5.3.9 Constitutive expression of TlOsm or OsOlp1_A improved yield under

drought and salinity in transgenic rice ............................................................. 137

5.4 DISCUSSION ............................................................................................................ 141 5.4.1 TlOsm and OsOlp1_A confers tolerance to cold, drought and salinity

stresses in rice .................................................................................................. 142 5.4.2 Retaining water, maintaining membrane integrity, and maintaining

photosynthesis activities are some strategies TlOsm and OsOlp1_A plants

used to cope with cold, drought, and salinity stresses. .................................... 145 5.4.3 TlOsm plants showed advantages over OsOlp1_A plants in drought and

cold stresses, not in salinity stresses ................................................................ 148 5.4.4 OsOlp1_I did not sufficiently enhance rice plants tolerance to cold,

drought, and salinity stresses ........................................................................... 149 5.4.5 Low stomata conductance is possibly a cause of growth penalty of TlOsm

plants under unstressed conditions. ................................................................. 150

Chapter 6: Analysis of Protein-Protein Interactions of Osmotins from Stress

Tolerant and Sensitive Species .............................................................................. 155

6.1 INTRODUCTION ..................................................................................................... 155

6.2 MATERIALS AND METHODS ............................................................................... 157 6.2.1 Plant materials.................................................................................................. 157 6.2.2 Plasmid vectors ................................................................................................ 157 6.2.3 Protein expression in Nicotiana benthamiana ................................................. 159 6.2.4 Recombinant protein extraction, purification, and enrichment ........................ 160 6.2.5 SDS-PAGE ....................................................................................................... 161 6.2.6 Coomassie blue staining .................................................................................. 161 6.2.7 Western blotting ............................................................................................... 161 6.2.8 Protein chip hybridisation and scanning .......................................................... 162 6.2.9 Identification of significant interactions .......................................................... 163 6.2.10 Determination of significant protein interactors of target osmotins ................ 163 6.2.11 Identification of pathways containing interactive protein partners of

TlOsm, OsOlp1_A, and OsOlp1_I ........................................................ 164 6.2.12 BiFC performance and analysis ......................................................................... 164

6.3 RESULTS .................................................................................................................. 167 6.3.1 Expression and purification of recombinant osmotin proteins ........................ 167 6.3.2 Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and

OsOlp1_I revealed ...................................................................................... 169 6.3.3 Gene ontology (GO) enrichment for interactors of the three osmotins ........... 172 6.3.4 Pathways of TlOsm, OsOlp1_A, and OsOlp1_I interactive protein

partners revealed .............................................................................................. 174 6.3.5 Physical interactions of selected Arabidopsis proteins with TlOsm,

OsOlp1_A, and OsOlp1_I confirmed in planta ..................................... 176

6.4 DISCUSSION ............................................................................................................ 183 6.4.1 Production of pure and functional recombinant osmotins ............................... 187 6.4.2 Analysing potential protein interactors of TlOsm, OsOlp1_A and

OsOlp1_I affirms their multiple functions .................................................. 189 6.4.3 Common and specific potential interactors of TlOsm, OsOlp1_A, and

OsOlp1_I provide testable target proteins for unravelling osmotin

functions ........................................................................................................... 191 6.4.4 Possible mechanisms underlying TlOsm, OsOlp1_A, and

OsOlp1_I functions ..................................................................................... 193


loliiformis xi

Chapter 7: General Discussion ....................................................................... 197

7.1 TlOsm has more functional efficacy in regulation of plant stress response than rice

osmotins ................................................................................................................................198

7.2 TlOsm is a multi-functional protein playing a role in plant response to stresses ....201

7.3 TlOsm (and OsOlp1_A) likely contribute to plant stress response through signal

transduction ...........................................................................................................................203

7.4 TlOsm has potential for use in improving crop tolerance to multiple abiotic stresses 206

7.5 Concluding remarks ....................................................................................................207

Appendices .............................................................................................................. 209

Bibliography ........................................................................................................... 243

xii Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis


loliiformis xiii

List of Figures

Figure 1.1 Plant gene regulation in response to salt and drought stress ...................... 6

Figure 1.2 Structure homology of osmotin, thaumatin and antifungal PR-5 ............... 15

Figure 1.3 Principle of BiFC and multicolour BiFC analysis. .................................... 34

Figure 1.4 General research outline and thesis presentation ..................................... 38

Figure 2.1 Plasmid maps for primary cloning. ........................................................... 43

Figure 2.2 Map of backbone vector used for cloning genes stably expressing in

rice................................................................................................................ 44

Figure 2.3 Maps of destination vectors for cloning EYFP-tag TlOsm and VC. ..... 45

Figure 2.4 Map of destination vector used for recombinant osmotin production. ..... 46

Figure 2.5 Maps of destination vectors used for detecting protein-protein

interaction in planta. .................................................................................... 47

Figure 3.1 Schematic diagram of gene constructs for expressing EYFP-tagged

TlOsm and EYFP control in N. tabacum ...................................................... 66

Figure 3.2 Alignment of TlOsm with selected plant osmotins.. ............................. 70

Figure 3.3 Property analysis of TlOsm. .................................................................. 71

Figure 3.4 The phylogenic tree showing the relationship of TlOsm and

osmotins from different monocotyledonous and dicotyledonous

species. ......................................................................................................... 73

Figure 3.5 Developmental stages of T. loliiformis for sampling................................ 74

Figure 3.6 Expression of TlOsm under developmental stages and various

abiotic stresses. ............................................................................................ 76

Figure 3.7 Fluorescence-based selection of transgenic tobacco expressing

EYFP-tagged TlOsm and VC. ...................................................................... 77

Figure 3.8 Confirmation of stable transgene integration in transgenic tobacco

by PCR.. ....................................................................................................... 78

Figure 3.9 Cellular localisation of TlOsm. ............................................................... 79

Figure 3.10 Subcellular co_localisation analysis of EYFP-tagged TlOsm and

EYFP in N. tabacum. ................................................................................... 80

Figure 3.11 Localisation of EYFP-tagged TlOsm and EYFP in transgenic N.

tabacum cells under unstressed and 150 mM NaCl stress. .......................... 81

Figure 4.1 Schematic diagram of gene expression cassettes for expressing

osmotins and GUS-reporter gene (control-VC) in O. sativa. .................... 92

Figure 4.2 Procedure of rice callus induction, transformation, selection, and

plant regeneration......................................................................................... 98

Figure 4.3 Characterisation of putative transgenic rice lines by PCR. .................... 100

xiv Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

Figure 4.4 Transcriptional expression of transgenes in transgenic rice by RT-

PCR.. .......................................................................................................... 102

Figure 4.5 GUS expression in transgenic rice calli and plants.. ............................... 104

Figure 5.1 Relative shoot growth of WT or NT, VC and transgenic plants

expressing OsOlp1_A, OsOlp1_I, and TlOsm. .......................................... 119

Figure 5.2 Tiller number of WT or NT, VC and transgenic plants expressing

OsOlp1_A, OsOlp1_I, and TlOsm. ............................................................. 120

Figure 5.3 Leaf relative water content (RWC) of WT or NT, VC and transgenic

plants expressing OsOlp1_A, OsOlp1_I, and TlOsm. ................................ 122

Figure 5.4 Leaf electrolyte leakage of WT or NT, VC and transgenic plants

expressing OsOlp1_A, OsOlp1_I, and TlOsm ........................................... 124

Figure 5.5 Net photosynthesis of NT, VC and transgenic plants expressing


Figure 5.6 Transpiration rate of NT, VC and transgenic plants expressing


Figure 5.7 Stomatal conductance of NT, VC and transgenic plants expressing


Figure 5.8 Morphology of T0 rice plants under cold, drought and salinity

stresses at seedling stage. ........................................................................... 131

Figure 5.9 Morphology of T1 rice plants and panicles under unstressed, drought

and salinity stresses when plants exposed to stresses at reproductive

stage. .......................................................................................................... 133

Figure 5.10 Survival rate and morphology of rice plants recovered from stress

treatments at seeding stage. ........................................................................ 136

Figure 6.1 Schematic diagram of gene expression cassettes for transiently

expressing tagged osmotins in N. benthamiana. ...................................... 158

Figure 6.2 Schematic diagram of gene expression cassettes for detecting target

osmotins and Arabidopsis protein interaction in N. benthamiana. ............ 159

Figure 6.3 Recombinant osmotin production. .......................................................... 168

Figure 6.4 Procedure of recombinant osmotins hybridising with protein chips

and data generation .................................................................................... 170

Figure 6.5 Biological processes involving protein interactors of TlOsm,

OsOlp1_A and OsOlp1_I .................................................................. 173

Figure 6.6 Analysis of in planta interactions between AtCPK4 and TlOsm,

OsOlp1_A, or OsOlp1_I. .................................................................. 178

Figure 6.7 Analysis of in planta interactions between AtCPK5 and TlOsm,

OsOlp1_A, or OsOlp1_I. .................................................................. 179

Figure 6.8 Analysis of in planta interactions between AtMS1 and TlOsm,

OsOlp1_A, or OsOlp1_I. .................................................................. 180

Figure 6.9 Analysis of in planta interactions between AtALDH7B4 and

TlOsm, OsOlp1_A, or OsOlp1_I. ................................................... 181


loliiformis xv

Figure 6.10 Analysis of in planta interactions between AtPER42 and

TlOsm, OsOlp1_A, or OsOlp1_I. ................................................. 182

Figure 6.11 Protein interaction networks of Arabidopsis genes selected for

BiFC analysis.. ........................................................................................... 186

xvi Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

List of Tables

Table 1.1 Representatives of transgenic plants expressing plant osmotins and their

phenotypes ................................................................................................... 18

Table 2.1 List of primers for plasmid cloning ............................................................ 41

Table 2.2 List of plant expression vectors constructed and used in the research ....... 51

Table 3.1 List of primers for PCR characterisation of transgenic tobacco plants ...... 68

Table 3.2 Characteristics of TlOsm, OsOlp1_A, and OsOlp1_I by

functional predictions ................................................................................... 82

Table 4.1 List of primers used for characterisation of transgenic plants ................... 95

Table 4.2 Summary of generating and characterising transgenic rice lines

expressing target osmotins and control gene in the research ..................... 105

Table 5.1 A summary of experiments in the study .................................................. 116

Table 5.2 Dry biomass of plants in seedling-stage stress treatment experiments .... 134

Table 5.3 Dry biomass of plants in reproductive-stage stress treatment

experiments ................................................................................................ 135

Table 5. 4 Yield components of TlOsm, OsOlp1_A, OsOlp1_I, VC and NT

(control) plants under unstressed, drought, and salinity stress

conditions ................................................................................................... 139

Table 6.1 Select Arabidopsis genes for BiFC analysis ............................................ 165

Table 6.2 Combinations of osmotins and Arabidopsis genes used for co-

expression and BiFC analysis .................................................................... 166

Table 6.3 Comparison of significant interactions between Arabidopsis proteins

on the chip with the three osmotins ........................................................... 171

Table 6.4 Significant pathways of Arabidopsis proteins interacting with

TlOsm, OsOlp1_A, and OsOlp1_I ................................................ 174

Table 6.5 Pathways of Arabidopsis proteins interacting with TlOsm and

OsOlp1_A, or TlOsm only ................................................................. 175

Table 6.6 Pathways of Arabidopsis proteins commonly interacting with

TlOsm, OsOlp1_A, and OsOlp1_I in relation to published and

predicted functions of osmotin ................................................................... 176


loliiformis xvii

List of Abbreviations

Abbreviations

AA = amino acids

ABA = abscisic acid

AMP = adenosine monophosphate

AMPK = Adenosine monophosphate-activated protein kinase

APX = ascorbate peroxidase

ATP = adenosine triphosphate

BAP = 6-benzylaminopurine

BiFC = Bimolecular Fluorescence Complementation

BLAST = Basic Logical Alignment Tool

bp = base pairs

BSA = bovine serum albumin

CaM = calmodulin

CaMV = Cauliflower mosaic virus

cDNA = complementary DNA

CDPK = Calcium-dependent protein kinase

CML = Calmodulin-like

CTAB = cety trimethyl ammonium bromide

CTCB = Centre for Tropical Crops and Biocommodities

C-terminal = carboxyl- terminal

DEPC = diethylpyrocarbonate

DHAR = dehydro ascorbate reductase

dH2O = distilled water

DIG = digoxygenin

DMSO = dimethyl sulphoxide

DNA = deoxyribonucleic acid

dNTPs = deoxyribonucleotide triphosphates

DTT = 1, 4-dithiothreitol

DW = dry weight

2, 4,-D = 2, 4-dichlorophenoxyacetic acid

EDTA = ethylenediaminetetraacetic acid

EL = electrolyte leakage

xviii Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

ER = endoplasmic reticulum

E. coli = Escherichia coli

EYFP = Enhanced Yellow Fluorescence Protein

FRET = Fluorescence Resonance Energy Transfer

GMO = Genetically modified organism

GUS = β-glucoronidase

His = Histidine

HK = Histidine kinase

HSP = Heat shock protein

IAA = indole-3-acetic acid

IBA = indole-3-butyric acid

IPTG = iso-propyl-β-D-thiogalatopyranoside

kbp = kilo base pair(s)

KDEL = Lys-Asp-Glu-Leu, an ER retention signal peptide

LB = Luria-Bertani

LEA = Late Embryogenic Abundant

MAB = Marker-assisted breeding

MAP = Mitogen-activated protein

MAPK = Mitogen-activated protein kinase

MDHAR = Monodehydroascorbate reductase

mRNA = messenger RNA

MS = Murashige and Skoog media

NAA = α-naphthalene acetic acid

NCBI = National Centre for Biotechnology Information

Nos = Nopaline synthase

nt = nucleotide

N-terminal = amino terminal

OD = optical density

OD600 = optical density at 600 nm

OLP = Osmotin-Like Protein

PBS = phosphate buffered saline

PCD = programmed cell death

PCR = polymerase chain reaction

pDNA = plasmid DNA

PEG = Polyethylene glycose


loliiformis xix

pH = -log (proton concentration)

PPAR = Peroxisome proliferator activated receptor

PR5 = pathogenesis-related proteins group 5

QUT = Queensland University of Technology

RKN = root-knot nematode

RLK = receptor-like kinase

RNA = ribonucleic acid

RNase = ribonuclease

ROS = reactive oxygen species

RT-PCR = reverse transcription polymerase chain reaction

RT_qPCR = reverse-transcription quantitative real-time polymerase

chain reaction

RWC = relative water content

SDS = sodium dodecyl sulphate

SDS-PAGE = sodium dodecyl sulphate polyacrylamide gel

electrophoresis

SE = standard error

SOD = superoxide dismutase

ssp = subspecies

TAE = Tris acetate EDTA

TAP = Tandem Affinity Purification

TBS = Tris buffer saline

TBS-T = Tween Tris buffer saline

TEMED = N,N,N’,N’-tetramethylethylenediamine

TLP = Thaumatin-like protein

Tris = Tris (hydroxymethyl) aminomethane

TW = turgor weight

Tween20 = polyoxyethylene (20) sorbitan monolaurate

Ubi = ubiquitin

uidA = reporter gene encoding β-glucuronidase

UTR = untranslated region

UV = ultraviolet

VC = vector control

X-gal = 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside

X-gluc = 5-bromo-4-chloro-3-indolyl-β-D-glucuronide-

cyclohexylamine salt

xx Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis

Units

°C = Degree Celsius

d = days

Da = Daltons(s)

dSm-1 = deciSiemens per metre

g = Gram(s)

g = relative centrifugal force in units of gravity

h = Hour(s)

L = Litre(s)

M = Molar

m = Metre(s)

MW = Molecular weight

min = Minute(s)

mol = Mole(s)

rpm = Revolutions per minute

s = Second(s)

V = Volt(s)

vol = Volume(s)

v/v = Volume per volume

w/v = Weight per volume

Prefixes

K = kilo

m = milli

µ = micro


loliiformis xxi

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the best

of my knowledge and belief, the thesis contains no material previously published or

written by another person except where due reference is made.

Signature:

Date: 16/01/2018

QUT Verified Signature

xxii Molecular and Functional Characterisation of an Osmotin Gene from the Resurrection Plant Tripogon

loliiformis


loliiformis xxiii

Acknowledgements

The successful completion of my thesis would not have been possible without a

supportive and encouraging supervisory committee, a diverse technical support team,

my wonderful family and friends, and funding from Australian Government.

With deep sense of gratitude, I wish to thank Professor Sagadevan Mundree my

principal supervisor for giving me the opportunity to undertake my PhD study at QUT;

for his guidance, support, and encouragement throughout my PhD research; for his

helpful criticisms and stimulating discussions during thesis preparation; and for setting

a high standard of academic conscientiousness and achievement for his students.

I would like to express my sincere thanks to my associate supervisor Dr Brett Williams

for his rigorous scientific guidance, excellent mentorship, incessant encouragement,

and his availability in times of needs during the course of my PhD research; and for

his critical guidance, comments and suggestions in the preparation of this thesis.

I acknowledge my special thanks to Dr S. Robin (deceased) and Dr M. Raveendran

my external supervisors at the Tamil Nadu Agriculture University (Coimbatore, India)

for the conceptualisation of plant osmotin evolution and for sharing experimental

information of two rice osmotins. I wish to pray for the departed soul to rest in peace.

I would like to extend my thanks to CTCB fellow HDR students, Postdocs, and

technical staff and Abiotic stress group members: Linh Hoang (rice transformation and

stress treatments), Isaac Njaci (protein modelling and confocal imaging), Peraj

Karbaschi (protein chip); Hao Long (cloning and RT-qPCR), Grace Tan

(photography), Sudipta, Alam, Jacqui, Michael, Laleh, Anthony Brinin, Tom, Pauline,

and Abagail for contributions to my project update presentations, for their friendship

and supports; Dr Benjamin Dugdale for providing the pEAQ-HT construct. The entire

CTCB family for their friendship, support, and encouragement. The assistance of all

of these fellow students and research fellows is deeply appreciated.

Special thanks go to Central Analytical Research Facility (CARF) staff: Sanjleena

Singh and Jamie Riches for their assistant with the confocal microscope.

Thanks go to the QIMT, Lea Lekieffre and Penny Groves for facility and support in

protein chip scan and analysis using the Genepix 4300A slide scanner.

I wish to acknowledge Professor Acram Taji for introducing me to such wonderful

supervisors and research team and for her ceaseless encouragement.

My dream for PhD program at QUT would not have been reached without the financial

support from Australian Government through the Endeavour Prime Minister PhD

Award scholarship. I acknowledge the support with gratitude.

I am very grateful to my family: to my husband Dai Huong Nguyen and children Le

Huong Giang Nguyen and Le Thuy Ninh Nguyen for their love, support, patience, and

encouragement; for giving me the faith and strength to complete my PhD program; to

my parents, parents-in-law, brothers, and sisters for their understanding, caring, and

encouragement.

Chapter 1: Introduction and Literature Review 1

Chapter 1: Introduction and Literature

Review

1.1 INTRODUCTION

The global population is estimated to reach 9.8 billion by 2050. To provide

sufficient food for this population globally, agricultural production must double (Ray

et al., 2013). However, increasing agricultural productivity is a massive challenge and

is limited by decreased yields and arable land as well as increased disease incidence

and abiotic stress; both of which are significantly affected by changing climate

conditions. Of the limitations, abiotic factors such as drought, extreme temperature,

and salinity have been identified as the major factors hindering agricultural production

worldwide (Cominelli et al., 2013). There is an urgent need to develop technologies

for the generation of enhanced crops that can survive long spells of stresses, and upon

return of favourable conditions, continue to grow and yield. Genetic engineering of

crops with foreign gene(s) is an approach that offers a great potential for crop

improvement particularly to abiotic stress tolerant traits. However, the complex nature

of abiotic stress responses, the availability of the stress tolerant genes and the lack of

knowledge regarding stress pathways in plants have affected the implementation of

this approach in solving problems associated with abiotic stresses (Gosal et al., 2009).

The success of genetic engineering approaches to improve plant tolerance to abiotic

stresses relies on the ability of transgene products to play a key role in tolerance. Studies

have shown that stress tolerance in plants is a multigenic trait (Sairam and Tyagi, 2004).

To develop strategies for the improvement of crops adapted to future extreme

environment, it is important to identify the key upstream regulators of stress acclimation

from the stress-adapted species and to engineer them into crop plants (Mittler and

Blumwald, 2010). It is believed that such genes might provide the crop plants the

necessary arsenal to tolerate extreme stress conditions compared to the non-modified

parental plants (Cominelli et al., 2013). A small group of angiosperms known as

resurrection plants can tolerate extreme levels of dehydration down to 4% relative water

content and resume full metabolic activity upon watering. Studies on the Australian native

2 Chapter 1: Introduction and Literature Review

resurrection grass, Tripogon loliiformis, have shown that this plant implements a number

of molecular, biochemical, physiological and structural mechanisms for rapid response to

water deficit and quick recovery upon rehydration as well as for facilitating survival

mechanism during desiccation state (Williams et al., 2015; Karbaschi et al., 2016).

Therefore, resurrection plants such as T. loliiformis represent both ideal model plants and

a unique source for the identification of novel, functionally relevant, stress-associated

genes and pathways for utilisation in enhancement of stress tolerance in crops.

Among genes involved in stress response networks, gene encoding osmotin has

shown as a potential candidate gene. Osmotins and osmotin-like proteins (OLPs) are

members of the pathogenesis-related proteins that have been proven to play key roles in

both abiotic and biotic stress responses. Osmotin and OLP genes are induced in response

to various abiotic and biotic stresses in different plant species (Singh et al., 1985; Zhu et

al., 1995; Hong et al., 2004; Zhang and Shih, 2007). Genes encoding osmotins and OLPs

have been characterised from many plant species and shown to have multiple functions in

enhancing plant stress tolerance (Singh et al., 1987; Yen et al., 1994a; Kim et al., 2002;

Onishi et al., 2006; Jami et al., 2007). Additionally, the constitutive expression of osmotin

genes in transgenic crops has improved tolerance to drought, high-salinity, and cold stresses

and some combinations of these stresses (D'Angei and Altamura, 2007; Goel et al., 2010;

Subramanyam et al., 2011; Subramannyan et al., 2012; Patade et al., 2013). Although

intensive studies have been conducted to dissect the roles of osmotins in plant stress

responses, the mechanisms by which osmotins mediate these responses have not been well

established. Primarily, it was suggested that osmotin improves salt tolerance by reducing the

accumulation of Na+ ion in the cytoplasm, the uptake of Na+ into the cells, or acting as

Na+/H+ antiporter (Singh et al., 1987; Yen et al., 1994a). Later, number of studies have

shown osmotin enhanced abiotic tolerance in plants by modulating transcript abundance and

functional expression of stress responsive genes and upregulating the levels of several

compatible osmolytes and reactive oxygen species (ROS) scavengers (Barthaker et al.,

2001; Husaini and Abdin, 2008a; Parkhi et al., 2009; Das et al., 2011; Subramanyam et al.,

2011; Subramannyan et al., 2012; Patade et al., 2013). These studies hypothesised that

osmotin might be a transcription factor of the key genes of plant response to abiotic and

biotic stresses. However, this hypothesis was later ruled out by the evidence that osmotin

structures did not contain any DNA-binding motif (Abdin et al., 2011). Osmotins were also

shown to activate MAPK proteins (Yun et al., 1998), which are the key enzymes catalysing


the phosphotransfer reactions. These reactions are fundamental to most signalling and

regulatory processes associated to enzyme activation, macro-molecules assembly, protein

localisation and degradation in plant stress responses. Osmotins role as a regulator of plant

stress tolerance through cell signalling was recently gained recognition (Viktorova et al.,

2012). Although the mode of action of osmotins remained unclear, their multifunctional

nature suggests that osmotins represent a key modulator regulating plant response to biotic

and abiotic stresses.

In field conditions, crop plants are often exposed to multiple stresses simultaneously.

Therefore, genes encoding osmotins are likely to be suitable candidates for the genetic

enhancement of crops, with respect to multiple-stress tolerance. In addition, stress-

responsive genes from highly resilient species such as T. loliiformis hold great potential

for introducing stress-tolerant traits into crop plants to cope with abiotic stresses.

Characterisation of such a gene could provide great promise for the uses in genetic

engineering approach. Moreover, understanding the pathways and the mechanisms by

which osmotin mediates multiple stress responses of plants holds huge potentials for the

gene utilization in developing broad-spectrum stress tolerant crops.

1.2 PLANTS AND ENVIRONMENTAL STRESSES

1.2.1 Plants affected by environmental factors

Plants require water, CO2, light, appropriate temperature and mineral nutrients

to support growth, development and reproduction. The requirement of these factors for

optimal growth varies depending on plant species and developmental stages.

Environmental factors that reduce plant growth and production below optimal levels

are considered as abiotic stresses. Many abiotic factors such as drought, salinity,

temperature, high light intensity, soil chemical toxicity, and UV radiation have

established stress agents in plants. Any stage of plant development such as seed

germination, seedling and vegetative growth, flowering and fruit set as well as any plant

tissue i.e. root, shoot, leaf, flower and fruit can be severely affected by abiotic stresses.

For crop plants, these effects ultimately result in yield loss. The following instances are

some effects that have been commonly reported. High salt concentrations in soils inhibit

seed germination by creating an osmotic stress in plant cells. If prolonged osmotic stress

leads to a number of modifications of plant cell plasma membranes, lipid and protein

composition that result in nutrient imbalances; causes ion toxicity that damages to root


systems, generates leaf mottling and leaf necrosis, and ultimately impairs growth and

development. The consequence of all these can ultimately cause plant death as a result

of growth arrest and molecular damage (Sairam and Tyagi, 2004). High temperature

generates high respiration and evaporation in plants. These together can push plants to

permanent wilting and temperatures exceeding 46 oC can lead to complete yield loss

(Nagarajan and Nagarajan, 2010). In self-fertilising cereals such as rice and wheat, a

short period of cold or drought stress at the young microspore stage of pollen

development results in pollen sterility that can destroy all harvested products (Dolferus

et al., 2011). In fruit crops, water logging inhibits flower bud initiation, anthesis, fruit

set, size and quality. During fruit development, if flooding occurs, the high osmotic

absorption of water through the root results in high internal pressure that causes the

fruit to burst or crack thus reducing quality (Nagarajan and Nagarajan, 2010). The

severity of the effects caused by abiotic stress is dependent on plant species, plant

developmental stages, severity of condition and harvested parts of plants.

In addition to environmental factors, crop plants are often exposed to various

pathogens that are also influenced by adverse environmental conditions. Recent

evidence suggests that climate change has altered disease complexes, triggered plant

pathogen adaptation, and changed pathogen vectors. The implications of climate

change for crop pathogens have contributed to significant yield losses and the

deterioration of crop quality (Newton et al., 2011). Pressure of weeds, pests and

diseases on crops associated with current and future changing climate has also been

evaluated and estimated with a projected increase of soil-borne pathogens linked to

their multiplication rates promoted by warmer weather (Jaggard et al., 2010). For

example, evaluation of root-knot nematode (RKN) mediated aerobic rice yield loss

combined with normal or abiotic stress conditions showed that abiotic stresses

contributed to more severe yield failure caused by RKN (Kreye et al., 2009).

Furthermore, Masutomi et al. (2009) used 18 general circulation models to estimate

the yield loss of rice in agro-ecological zones of Asia based on climatic projections

and concluded that rice yield would decrease by 8% in 2050, most of this yield

reduction to warmer winters would be the effects of weeds, pests and diseases.

1.2.2 Plant responses to abiotic stresses

Being sessile, plants have evolved numerous mechanisms in response to abiotic

stresses. Many strategies that plants implement in response to abiotic stresses have been


documented. These strategies include avoidance, adaptation, and tolerance (Shinozaki and

Yamaguchi-Shinozaki, 2007; Agarwal et al., 2013). In avoidance, some plant species

escape stress by completing their life cycles before the onset of stresses (Hasanuzzamman

et al., 2013; Pierik and Testerink, 2014). In adaptation, plants exhibit protective

mechanisms such as stomatal closure, cuticular wax formation, sink/source allocation

adjustment, and changed root architecture to prevent the effects of stress. Some plant

species retain functions during stress together with employ a number of mechanisms

including osmotic adjustment, osmoprotection, antioxidance and scavenger for tolerance

to stress (Chaves et al., 2003). Stress tolerance permits plants, such as xerophytic

vegetation, to withstand stress as well as employ a number of protective mechanisms for

promoting survival and rapid recovery with full metabolic functions upon return of

favourable conditions. However, tolerance strategy is limited to crop species (Bodner et

al., 2015). These responses are the consequences of complex gene regulation,

biochemical, and physiological changes.

1.2.2.1 Gene regulation in abiotic stress responses

Plant gene regulation during plant responses to abiotic stresses is extremely

complex. Many stress-inducible genes have been identified and their functions have

been found to vary during different stages of development. Plant genes induced by

abiotic stresses have been categorised into two groups: regulatory genes and single-

function genes. It has been shown that there is a high degree of similarity, at the cellular

level, during plant responses to salinity and drought stress and to some extent cold

stress (Sairam and Tyagi, 2004). Agarwal et al. (2013) described gene regulation

networks involved in establishing salinity and drought stress tolerance as shown in

Figure 1.1.


Figure 1.1 Plant gene regulation in response to salt and drought stress (Agarwal et al.,

2013)

According to Agarwal et al. (2013), salinity and/or drought stress are perceived

by signalling sensor molecules and sent to the cells, where the stress signal is amplified

by signal transduction pathways. Histidine kinases (HKs) and receptor-like kinases

(RLKs) are two important protein families involved in stress perception. Calcium

sensing (Ca++) is one of the most well described and most complex signal sensing

cascades; and the mitogen-activated protein (MAP) kinase cascade is one mechanism

plants use to translate the external stimuli into cellular responses. Upon detection of the

signal, transcription factors such as AREB/ABF, bZIP, CBF/DREB, MYC/MYB, NAC,

and WRKY are triggered. These transcription factors play a pivotal role in developing

abiotic stress tolerance in plants. They interact with promoters of downstream genes and

regulate the expression of these genes. Genes activated by these transcription factors will


subsequently produce many classes of molecules, which may help mitigate damage by

these stresses. These stress-involved functional proteins include ROS scavengers,

osmoprotectants, ion transporters, chaperones, photosynthesis and fatty acid metabolism

enzymes, proteinase inhibitors, late embryogenic-abundant (LEA) proteins, and heat

shock proteins (HSPs) that protect plant cells and macromolecules from damage and

ultimately lead to tolerance. In addition, many other genes encoding transcription

factors, protein kinases and phosphatases involved in signal transduction pathways are

induced in plant cells under stress conditions (Bhatnagar-Mathur et al., 2008). As a

consequence, genes induced by a specific stress are considered to function in that stress

response (Swindell, 2006; Shinozaki and Yamaguchi-Shinozaki, 2007; Ni et al., 2009).

Genes involved in stress perception, signal transduction, and immediate protection are

activated early in the initial stages of stresses. While those induced later are likely

responsible for stress adaptive establishment such as homeostasis and recovery

(Swindell, 2006; Mishra et al., 2016; Zhu, 2016).

Stress perception has been found to be specific for certain stress factors and to

be unique for some stress combinations (Mittler, 2006). However, drought, salt, and

cold stresses (termed osmotic stresses) have been shown to share several common

signal transduction pathways that further regulate the expression of similar gene sets

(Xiong and Zhu, 2002; Fujita et al., 2006; Barnabas et al., 2008; Fujii and Zhu, 2012;

Mishra et al., 2016). In fact, the genes induced by drought stress were found to be

identical to those induced by salinity stress and some of those induced by cold stress

(Qureshi et al., 2007). Studies have suggested that osmotic stresses are transmitted

through at least two pathways: ABA-dependent and ABA-independent pathways. The

existence of cross-talk or convergence between these signalling pathways has also

been demonstrated (Fujita et al., 2006; Baena-Gonzalez and Sheen, 2008; Huang et

al., 2012). As a result, there is an overlap in the expression pattern of stress-responsive

genes after cold, drought, high salt, and ABA application. For example, analysis of

cDNA harvested from rice exposed to cold, drought, high-salinity stresses and ABA

application by cDNA microarray followed by RNA gel blot indicated that (1) 40% of

drought-or high salinity-inducible genes were also inducible by cold and (2) more than

98% of the high salinity- and 100% of ABA inducible genes were induced by drought

stress (Rabbani and Maruyama, 2003). The convergent point among abiotic stress

signalling pathways was thought to be a MAP kinase cascade because it connects


diverse sensors to a broad range of cellular responses to abiotic stress (Fujita et al.,

2006; Huang et al., 2012). For instance, an Arabidopsis gene, AtMPK3, was found to

be induced at the mRNA level by drought, cold, high salinity and mechanical stresses

that regulate the expression of many stress-responsive genes including pathogen

defense genes (Mizuguchi et al., 1996). Perhaps, it is this convergent point among

abiotic stress signalling pathways that enables plants to efficiently respond and adapt

to multiple stresses during their life cycles in their changing living environments.

Regarding to functions of stress-inducible gene products in initial stress response and

in establishing plant stress tolerance together with the existence of convergent points

among various stresses, targeting genes in stress signalling pathways for engineering

plants with enhanced abiotic stress tolerance appears to be the most promising

approach (Mittler and Blumwald, 2010). These reports suggest that it is feasible to

generate crop varieties that are tolerant to multiple abiotic stresses.

1.2.2.2 Biochemical changes in abiotic stress responses affect crop quality

Upon detection of abiotic stress, numerous biochemical changes occur in plant

tissues. Initial abiotic stresses generate ROS that in turn cause oxidation of membrane

lipids, proteins, and nucleic acids in plant cells and subsequently cause biochemical

changes. In the development of stress tolerance, numerous biochemical reactions occur

that alter the chemical composition of plant cells. With regard to crop plants, these

chemical alterations affect the quality of harvested products. Observed biochemical

changes affecting food quality are available in the literature (Nagarajan and Nagarajan,

2010; Wang and Frei, 2011; Halford et al., 2015); and several major changes related to

the above-mentioned gene expression network are summarised herein as examples.

Under stress conditions, a higher protein concentration in harvested parts of crops has

been observed as a result of increased expression of various genes. Similarly,

antioxidants such as phenol, ascorbate, carotenoids and tocopherol have been recorded

to be produced at higher levels for detoxifying ROS during stress responses. In the case

of carbohydrates, changes in chemical composition vary depending on the plant tissues.

Grain crops experiencing abiotic stress, especially during drought and heat stress,

reduced grain starch concentrations and most possibly due to reduced activity of the

enzyme starch synthase. In tuber crops such as potato, cassava, and sweet potato,

decreases in starch concentration due to inhibition of starch synthase activity and

increases in concentration of maltose due to higher activity of β-amylase, which


decomposes starch to maltose, have been observed. Sugar concentration in fruit and

vegetable crops was not consistent across crops. Sugars and sugar alcohol such as

mannitol and sorbitol play an important role in abiotic stress tolerance and are

accumulated during stress responses by conversion from other sugars such as fructose-

6-phosphate and glucose by stress induced enzymes Therefore, changing concentration

of certain forms of sugars under stress may be the result of the conversion from one form

to another. Leaf senescence as a result of programmed cell death induced by ROS,

together with a reduction of chlorophyll content and leaf water content negatively affects

physical and sensory traits of vegetables. Alterations in fatty acid composition of oil

crops under stress have also been recorded with the general trend of increased and

decreased proportions of saturated fatty acids and (poly) unsaturated fatty acids,

respectively. These are believed to be due to changing activities of enzymes involved in

lipid synthesis and conversion (Nagarajan and Nagarajan, 2010). Changes in membrane

lipid composition by increased unsaturated fatty acids were found in chilling

temperature adapted cells and transgenic tobacco plants with increased levels of

unsaturated fatty acids have shown improved in chilling tolerance (Bhatnagar-Mathur et

al., 2008).

In general, from initial responses to adaptation establishment in crop plants

undergoing abiotic stresses, various sets of stress-responsive genes are activated and

resulted in the changes to biochemical profiles of harvested parts. Many biochemical

substances such as phytochemicals, vitamins, antioxidants, proteins, sugars, free amino

acids, oils, and aroma volatiles are important determinants for food quality and safety.

As analysed in the above-mentioned studies, some of the changes including increased

antioxidants, proteins, and monounsaturated fatty acids were found to be beneficial for

food quality. However, most of the changes were identified to have negative impacts on

food quality and food safety.

1.2.2.3 Physiological adaptation

Stresses including drought, salinity, and cold inhibit plant growth by primarily

osmotic stress and decreasing cell turgor leading to the arrestment of shoot growth, cell

division and expansion. To counteract the effects of osmotic stress and maintain cell

turgor, adaptive plants use efficient osmotic adjustment strategies. Numerous

physiological mechanisms, as a result of osmotic adjustments, are significantly

advantageous for drought and salinity stress adaptation of plants include maintaining cell


stability, accumulating antioxidants and compatible solutes, effectively using water,

increasing soil water extraction by changing root architecture, maintaining higher leaf

relative water contents, controlling stomatal closure to reduce water loss (Manavalan and

Nguyen, 2012; Shabala and Munns, 2012). Additional beneficial physiological

mechanisms that reduce sodium ion toxicity caused by salinity stress include exclusion of

Na+ uptake by the root, sequestration of Na+ at intracellular and extracellular levels,

retention of K+ in the cytosol and uptake of Na+ to the vacuole (Shabala and Munns, 2012).

As a consequence of adjustments to stresses, various physiological, anatomical,

and morphological changes have been observed and considered as essential features in

plant adaptation to these stresses. Cell wall and leaf folding to avoid desiccation have

been found to be important and novel features in resurrection plants (Mundree et al.,

2002; Ingle et al., 2007; Karbaschi et al., 2016). Similarly, some heat-tolerant wheat

cultivars implement leaf rolling to prevent structural and functional damage of the

pigment antenna complexes, the reaction centre of photosynthetic system (PS) II, and

the electron transport between PSII and PSI (Sarieva et al., 2010). Changes of root

architecture by increasing branch root growth that enhance total root surface area for

better access to water and nutrients have been identified as desirable traits of adaptive

plants to both salinity and drought stresses (Manavalan and Nguyen, 2012; Shabala and

Munns, 2012; Pierik and Testerink, 2014). For example, studies on how maize roots

adjusted to optimize water and nitrogen uptake in different soil environments revealed a

number of root architecture alterations contributing to effective water and nutrients

uptake or avoidance of toxicity in their living environments (Lynch, 2013). The

modulations upon stresses on the primary root diameter, the growth angles of seminal

roots, the numbers of lateral roots, the length of root hairs, the branching ability of crown

roots, the abundance of cortical aerenchym, the size of cortical cells resulted in a deeper

or shallower root system to match the water and nutrient conditions in the soil. Leaf

modifications have been found to facilitate protection of photosynthetic machinery,

preventing toxicity of ionic and oxidative radicals, and reducing leaf transpiration, light

and UV irradiation damage. Salinity and drought adapted genotypes can be identified

by several morphological features of leaves such as smaller and thicker leaves, leaf

surface covered by epicuticular wax, anthocyanin pigmentation, glaucous layer, or

pubescent layer. Salt glands and bladders were found in leaves of many halophytes, the

salt tolerant plants (Manavalan and Nguyen, 2012; Shabala and Munns, 2012; Karbaschi

et al., 2016).


The above-mentioned plant responses to abiotic stresses showed that the response

is complex and depends on the species and genotype, the type of stresses, the length and

severity of stresses, the age and stage of plant development, the organ and cell type, the

subcellular compartment, gene and its mode of action. Understanding the full picture of

how plants respond to abiotic stress will enable the determination of key processes that

contribute to crop yield under stress. This knowledge will be valuable for plant breeding

towards improving crop yield stability under changing climatic conditions.

1.2.3 Abiotic stress, world food security, and molecular breeding

Abiotic stresses negatively affect plant growth, reduce crop productivity, food

quality, and impact global food security. It has been shown that over 85% of crop loss is

due to environmental stresses (USDA, 2017). For cereal crops, the most important staple

food of most human societies, even a mild abiotic stress without affecting survival of the

vegetative parts at a short period before anthesis could irreversibly affect grain yield

(Dolferus et al., 2011). Wang and Frei (2011) extensively analysed the impact of the five

most common environmental stresses on seven parameters used for evaluating food

quality. Their results showed that only two parameters, levels of protein and antioxidants,

were positively affected while five parameters including lipids, non-structural

carbohydrates, minerals, feed value and sensory traits were negatively affected; the net

effects were also negative. Moreover, in most of the future climate-change projections, an

increase in aridity of many areas in the globe is the major concern for sustainability of

global agriculture. It is predicted that about 7% of total land area and 20% of the irrigated

agriculture land is affected by soil salinity (Agarwal et al., 2013). The impacts of abiotic

stresses undoubtedly impose threats for global agricultural sustainability and food

security. Future increases in the human population and living standards combined with

soil water deficits and salinisation as a result of climate changes continuously threaten

global agricultural sustainability and food security. These remain constraints for plant

breeders towards ensuring food security for future populations. Enhancing plant resilience

to the effects of abiotic stresses shows great potential as the most effective target for

improved agricultural sustainability (Newton et al., 2011).

Many attempts have been made by plant breeders worldwide to improve abiotic

stress tolerance. Conventional breeding has been extensively used with limited success

(Bhatnagar-Mathur et al., 2008; Gosal et al., 2009; Ashraf, 2010; Agarwal et al., 2013;

Shahbaz and Ashraf, 2013). In fact, although a number of cereal crop cultivars tolerant to


drought developed through conventional breeding have been commercialised, the

effectiveness is very low (Ashraf, 2010). A number of reasons accounting for the limited

success of this breeding method include (1) reliance on the existence of naturally tolerant

cultivars among species because of the sexual barrier between species, (2) the procedure

is time-consuming, cost-and labour-intensive, and (3) the transference of unwanted linked

traits along with desirable traits. Marker-assisted breeding (MAB), a procedure combining

conventional breeding with DNA markers, has also been applied for improving abiotic

stress tolerance in crops with better results. This process is still reliant upon conventional

breeding for producing new cultivars, however the efficiency has been significantly

enhanced as using DNA markers for selection reduces the length of breeding cycles

(Cominelli et al., 2013). The combination of DNA markers in this breeding method have

allowed high-throughput screening of germplasm for beneficial traits and the

identification of quantitative trait loci (QTLs) of abiotic tolerant traits. A number of QTLs

for abiotic stress tolerance have been identified in important crops including QTLs for

salinity stress tolerance in rice (Shahbaz and Ashraf, 2013), QTLs for drought tolerance

in maize, barley, cotton, sorghum, and rice (Ashraf, 2010). However, due to a lack of

understanding of the key genes underlying the QTLs, the undesirable agronomic traits

involved in QTLs from donor parents are also brought along with stress tolerance

(Bhatnagar-Mathur et al., 2008). While MAB has still been widely used, the development

of enhanced abiotic stress tolerant crops by genetic engineering approaches has recently

gained attention. These approaches overcome the limitations of the two previously

mentioned methods because it uses genes from tolerant species, across the genetic barrier,

and only transfers the desirable traits into pre-selected elite cultivars. During the last

several decades, many genes from different sources have been transferred to a variety of

crop species to develop abiotic stress tolerant lines. These genes can be categorized into

two groups: structural and regulatory genes (Gosal et al., 2009; Agarwal et al., 2013).

Currently, transgenic crop lines are being evaluated under laboratory, greenhouse and field

conditions. For example, maize plants transformed with a nuclear factor ZmNF-YB2

improved yields under drought stress at both greenhouse and field conditions (Nelson et

al., 2007). Similarly, Shi et al. (2015) used ZmARGOS8, a regulator of ethylene signal

transduction, to overexpress in maize plant and demonstrated that ZmARGOS8-

overexpressing maize plants increased grain yield under drought stress conditions without

reduction of grain yield under unstressed conditions. Furthermore, Shi et al. (2017)

generated the maize ARGOS8 variants using genome editing technology, the CRISPR-


Cas9. The maize lines carrying ARGOS8 genome-edited variants were tested in the field

of eight locations across the United State with different environmental conditions. The

results showed that maize lines carrying ARGOS8 genome-edited variants improved grain

yield under field drought stress conditions and had no yield loss under well-water

conditions. There are still some considerations on the types of genes that should be used

for this method. Genetic engineering is currently thought to hold the greatest potential in

developing enhanced abiotic stress tolerance crops. It is believed that the gaps between

future required food and what conventional breeding can provide will be filled by

achievements of genetic engineering technology in a sustainable and responsible manner

(Oliver, 2014).

To fulfil the task of sustainable future food demand, the future crops need to

maintain high yield under stressful environmental conditions and unpredictable changing

climates. It is likely that crops of the future need to be stacked with multiple desired traits

for higher yielding while mitigate the effects of abiotic stresses and complex pathogenesis

incidences triggered by changing climates. Therefore, combining multiple desired traits

into existing nutritive value and high yielding varieties through genetic engineering

appears to be the most appropriate approach to generate such crops. While multigene

manipulation remains the technical hurdles impeding the combination of numerous genes

into single selective genotype (Halpin, 2005), using single gene of upstream regulators to

activate the balanced adaptive response that will enhance plant tolerance to different

stresses has been considered the most effective strategy to achieve multiple desired traits

combined in future crop generation (Mittler and Blumwald, 2010; Cominelli et al., 2013).

1.3 OSMOTIN AND OLP: THE STRESS-RESPONSIVE

MULTIFUNCTIONAL PROTEINS

1.3.1 Osmotins and OLPs, the members of pathogenesis-related proteins

Osmotin protein was first isolated and characterised in tobacco cells cv.

Wisconsin 38 adapted to grow in vitro in a medium containing high concentrations of

NaCl or polyethylene glycol (PEG) (Singh et al., 1985). This 26 kDa protein was

suggested to be involved in the adaptation to NaCl and water stress of tobacco cells.

When cultured for long durations in a medium containing high levels of NaCl, tobacco

cells synthesized and accumulated osmotin up to 12% of total cellular protein (Singh

et al., 1987). Since these initial experiments, genes encoding osmotin and OLPs have

been identified in many other plants such as petunia, Petunia hybrida (Kim et al.,


2002), pepper, Capsicum annuum (Hong et al., 2004), soybean, Glycine max (Onishi

et al., 2006) black nightshade, Solanum nigrum (Jami et al., 2007), strawberry,

Fragaria x ananassa (Zhang and Shih, 2007), ginger, Zingiber officinale (Prasath et

al., 2011), and black pepper, Piper colubrinum (Mani and Manjula, 2010), to name a

few. Although the accumulation of osmotin in plant cells has been found to be related

to osmotic stress, its antifungal activity and its sequence homology with thaumatin, a

pathogenesis-related protein, have reclassified osmotin as a pathogenesis-related

protein group 5 (PR-5) (Singh et al., 1987; Yen et al., 1994b; Zhu et al., 1995; Husani

and Rafiqi, 2012). Based on their isoelectric point (pI), PR-5 proteins are divided into

three subclasses, osmotin proteins were in the basic subclass and OLPs in the neutral

subclass (Koiwa et al., 1994).

Tobacco osmotin can exist in two forms; an aqueous soluble form (osmotin-I) and

a detergent soluble form (osmotin-II). Characterisation of tobacco osmotin showed

slight differences in their pI (7.8, and 8.2) and molecular weight of the two forms, the

N-terminal sequences however were identical (Singh et al., 1987). Tobacco osmotin is

synthesized as a pre-protein with a molecular weight of 26 kDa, the mature form has a

24 kDa (Singh et al., 1989). The N-terminal sequence and an alanine in the cleavage site

of N-terminus are conserved among PR5 proteins (Min et al., 2004). This N-terminal

signal peptide is responsible for protein transport across endoplasmic reticulum (ER)

membrane. Like other PR5 proteins, osmotin was thought to be synthesized as precursor

with an N-terminus, after sorting in ER the signal peptide is cleaved off and the mature

form has slightly smaller weight (Singh et al., 1989).

Crystal structure analysis of tobacco osmotin revealed a noncrystallographic

dimer in the asymmetric unit; its two monomers were slightly different in tertiary

structure; and its folding was similar to that of thaumatin and other PR proteins (Min et

al., 2004) (Figure 1.2). The comparison of the three-dimensional structure of tobacco

osmotin with other osmotin and OLPs showed that the osmotins comprise three

conserved domains and one large acidic cleft. Domain I consists of an 11-strand flattened

β-sandwich that forms the compact core of the molecule. Domain II consists of several

loops extending from domain I that is stabilized by four disulfide bonds. Domain III

consisted of a small loop with two disulfide bonds. The tertiary structures of osmotin,

thaumatin, zeamatin, and antifungal PR-5 showed high homology (Fig 1.2). Small

differences however were observed in domain II and the distribution of surface charge


(Anzlovar and Dermastia, 2003). It is widely accepted that this acidic cleft possesses

amino acid residues acting as catalytic pair capable of glucan hydrolysis and this

structural feature is required for antifungal activity of osmotins and other PR5 proteins

(Mani et al., 2012).

Figure 1.2 Structure homology of osmotin, thaumatin and antifungal PR-5

(Min et al., 2004). Surface representation of the clefts of osmotin (A), PR-5d (B), zeamatin (C)

and thaumatin (D) depicting the electrostatic potential with a colour scale that varies from blue

to red, representing positive and negative potential, respectively.

The presence of alanine at the cleavage site of N-terminal sequence and 16

cysteine residues distributed throughout the protein sequence and linked by disulfide

bridge formation was considered the conserved features of PR5 protein (Min et al.,

2004). The 8 disulfide bridges formed by these conserved cysteines were found to be

responsible for stability and correct folding of the molecule, supporting its resistance

to protease degradation and its stability under extreme thermal and pH conditions (Liu

et al., 2010). In addition, the presence of acidic clefts, as a common feature, in the PR5

protein structures was found to be essential for their antifungal activities against

diverse fungal pathogens (Liu et al., 2010).

1.3.2 Osmotins and OLPs play roles in multi-stress responses

Osmotin and OLP genes are reported to be induced by at least ten hormonal,

pathogenesis and environmental stimuli (Kononowicz et al., 1992; LaRosa et al.,

1992; Raghothama et al., 1993; Zhu et al., 1995). These stimuli included ABA, auxin,

ethylene, drought, salinity, cold, UV light, tobacco mosaic virus infection, fungal

infection, and wounding. Expression profiling studies have demonstrated the

involvement of osmotin in both osmotic and pathogenic defence functions. However,

the abundance of mRNA did not always reflect the levels of protein accumulation. In

tobacco cells, the osmotin mRNA in cells adapted to salt are approximately 15 fold

higher than the non-adapted cells and present at a constant level. The mRNA was


decreased in exponential phase of growth and increased in stationary phase in non-

adapted cells. The osmotin protein was synthesized and accumulated in NaCl-adapted

cells; in non-adapted cells the protein was synthesized but not accumulated (LaRosa

et al., 1992). In tobacco plants, the protein accumulated to substantial amounts only

treated with ethylene, fungal infection or long-term exposed to salinity or water

deficits. The levels of osmotin accumulation could go up to 12% total cellular protein

when cultured for long duration in high-NaCl containing medium (Singh et al., 1987).

Studies on osmotin promoters have also shown activity in response to a number

of stress factors. The promoter region of a tobacco OLP contains two AGCCGCC

sequences responsible for ethylene-induced expression that are common in PR5

proteins (Sato et al., 1996). Additionally, the tobacco osmotin promoter has three

elements specifically interacting with nuclear factors (Liu et al., 1995) and contains

several sequences that are highly similar to ABRE, as-1 and E-8 cis element sequences

(Raghothama et al., 1993) or OLP from Curcuma amada had the GT-1 box and

TGTCA element (Prasath et al., 2011), which are typical for response to osmotic

stresses. Subsequent analysis of the promoter sequences of Arabidopsis and rice in

thaumatin-like protein (TLP) and OLP genes showed that most OLP genes of

Arabidopsis contain the binding elements associated with fungal response while these

binding elements are absent in all OLP genes of rice (Dehimi et al., 2012). These

results have suggested the involvement of osmotins and OLPs in both abiotic and

biotic responses of plants and that investigation on the promoter together with the

coding sequence may provide more information supporting the functions of certain

osmotin and OLP genes.

Subcellular localisation of a protein is typically related to its functions (O'Rourke

et al., 2005). Tobacco osmotin was found to target to vacuole inclusion bodies and this

localisation was dictated by the presence of a C-terminal 20 amino acid peptide sequence

(Singh et al., 1987). CaOsm1 from pepper, Capsicum annuum, was validated to

localise to the plasma membrane (Choi et al., 2013). Other osmotins have been shown

be secreted proteins and localise to other sub-cellular organelles. The presence of an N-

terminal signal peptide was found to be essential for transport to endoplasmic reticulum,

the first location within the secretion pathway (Sato et al., 1995). Depending on their

either N- or C- signal peptides, osmotin or OLPs are predicted to localise in either

extracellular matrix, plasma membrane, chloroplast, vacuole, or endoplasmic reticulum.


The diverse subcellular localisations of plant osmotins and OLPs have demonstrated

their multiple functions in response to various stress factors.

1.3.3 Expression of osmotins and OLPs enhanced plant tolerance to multiple

stress factors

Osmotin and OLP genes have been expressed in various crops. Some of these

plants are presented in the Table 1.1. In these transgenic plants, osmotin and OLPs

have consistently shown stress-responsive multifunctional roles that enhanced

tolerance to salt, drought, and cold stress as well as improved bacterial and fungal

resistance. These results have validated the functional involvements of osmotins and

OLPs in plant response to abiotic and biotic stresses. The ability of osmotins to exhibit

dual functions in a broad-range of abiotic and biotic stresses has indicated osmotins as

potential candidate genes for resolving global problems in agriculture such as

increasing severity of drought, salinity, low temperature and rising disease incidence.


Table 1.1 Representatives of transgenic plants expressing plant osmotins and

their phenotypes

Transgenic

plant

Source of

osmotin gene Phenotype of transgenic plants References

Potato Tobacco Resistance to Phytophthora infestans (Liu et al., 1994)

Rice Rice Resistance to Rhizoctonia solani (Datta et al., 1999)

Olive tree Tobacco Tolerance to cold stress (D'Angei and

Altamura, 2007)

Strawberry Tobacco Tolerance to salinity stress

(Husaini and Abdin,

2008a)

(Husaini and Abdin,

2008b)

Wheat Tobacco Enhanced ability to produce roots in

high 250 mM NaCl

(Noori and Sokhansanj,

2008)

Cotton Tobacco

(truncated) Tolerance to drought (Goel et al., 2010)

Chilli

pepper Tobacco Tolerance to salinity stress

(Subramanyam et al.,

2011)

Mulberry Tobacco

Tolerance to drought and salinity,

resistant to Fusarium pallidoroserum,

Collectotrichum gloeosporioide and

C. dematium

(Das et al., 2011)

Soybean Tobacco Tolerance to salinity stress and

resistance to fungal infection

(Subramannyan et al.,

2012)

Tomato Tobacco Tolerance to cold stress (4 oC) (Patade et al., 2013)

Arabidopsis Pepper Resistance to Pseudomonas syringe

and Hyaloferronosspra arabidopsidis (Choi et al., 2013)

Tea Tobacco Improved drought tolerance and

quality

(Bhattacharya et al.,

2014)

Carrot Tobacco Tolerance to drought (Annon et al., 2014)

Soybean Solanum

nignum Tolerance to drought (Weber et al., 2014)


1.3.4 Possible roles of osmotins and OLPs in response to abiotic and biotic stress

The mechanisms by which osmotins mediate plant defence have not been fully

understood. Similar to other PR-5 proteins, osmotin and OLP have antifungal properties

against a broad range of plant pathogens. Tobacco osmotin is involved in antifungal

responses by permeabilizing the plasma membrane and killing fungal cells (Abad et al.,

1996). Inducing fungal membrane permeabilization was also shown as antifungal

properties of CpOsm from Calotropis procera (Freitas et al., 2011). In addition, osmotins

have been associated with the MAPK pathway in yeast to weaken yeast cells and resulted

in rapid cell death (Ibeas et al., 1998) or to suppress the Ras2/cAMP stress response

pathway causing apotosis in yeast (Narasimhan et al., 2001). The role of pepper osmotin

(CaOsm1) in anti-microbial responses was demonstrated to be associated with the

hypersensitive cell death response and oxidative signalling (Choi et al., 2013). The

common constituents of fungal cell walls are glucan molecules, a type of polysaccharide.

Typical structural features of osmotins are glucan binding and hydrolysation into simpler

carbohydrates. Binding β-1,3-glucan was thought to be required for antifungal activities

of osmotin (Prasath et al., 2011; Mani et al., 2012). A study on two osmotins with

differential antifungal activity from Piper colubrium revealed that an internal deletion of

50 amino acid residues of the smaller one (PcOsm1), as compared to the PcOsm2,

resulted in its structure distortion in domain III and reduced the number of active binding

sites to β-1,3-glucan, 17 in PcOsm1 vs 21 in PcOsm2. Corresponding in vitro

antifungal assay of these two osmotins revealed a significant difference in antifungal

activity. While PcOsm1 showed undetectable antifungal activity, PcOsm2 exhibited

strong antifungal activity (Mani et al., 2012). It has been proposed that osmotin requires

cell wall components of fungal target for its functions (Abad et al., 1996). Phosphomanno

proteins, the mannoproteins on the outer layer of yeast cell wall were determined to be a

surface determinant for osmotin binding to the yeast cell wall (Yun et al., 1997). In

addition, Narasimhan et al. (2005) provided evidence that PHO36, a seven

transmembrane domain receptor-like polypeptide, which regulates lipid and phosphate

metabolism, was an osmotin binding plasma membrane protein that is required for full

sensitivity to osmotin in yeast. Although the antifungal activities of osmotin have been

demonstrated, its receptors and factors facilitating osmotin binding on fungal cells have

been determined and the mechanisms of its actions have been proposed, a full

understanding of its mode of action is still unclear and needs to be further elucidated.


There is evidence of osmotin binding cytokinin, a hormonal signalling molecule.

The biological implementations of osmotins in hormonal signalling is yet to be elucidated

but its binding to protein receptors has shown to affect ion flux, phosphorylation of

regulatory proteins, transcription, translation, and secretion (Kobayashi et al., 2000). It has

been proposed that binding to cytokinin may be a mechanism by which osmotin mediates

plants resistance to bacteria. Many bacteria, such as Agrobacterium tumefaciens, modulate

host plant activities to produce specific cytokinins. By binding to cytokinins, osmotin

deactivates of cytokinins, which prevents the spreading of bacterial infection (Viktorova

et al., 2012). Thus, binding hormonal signalling molecules may be involved in host

defence mechanism of osmotin.

Diverse functions of osmotin have been exhibited in response to abiotic stresses.

Tobacco osmotin found to be associated with salt adaptation and localised in the vacuole

together with an OLP identified from the intercellular space of halophyte led to the

suggestion that osmotin is involved in salt tolerance mechanisms of plants by reducing the

build-up of Na+ ion in the cytoplasm and the uptake of that ion into the cell or acting as

Na+/H+ antiporter (Singh et al., 1987; Yen et al., 1994b). Binding and hydrolysing glucan,

particularly β-1,3- and β-1,4-glucan may be one of the mechanisms of osmotin

contributing to abiotic stress tolerance in plants. It has been known that small sugar

molecules can act as osmolytes and contribute to maintaining cell turgor under osmotic

stress and/or play roles in organelle membrane formation, chloroplast protection under

drought (Dway and Smille, 1971; Satoh et al., 1976; Lee et al., 2003). β-1,3-glucan is a

component of plant cell wall and β-1,4-glucan is available in cytoplasm. Thus, osmotin

may generate osmolytes through β-1,3- and β-1,4-glucanase hydrolysing activities for

enhancing abiotic stress tolerance in plants. However, a direct evidence of plant cell wall

β-1,3-glucan binding to osmotin is still lacking and need to be further exploited. The

performance of plants expressing osmotin suggested its roles in signalling pathway.

Programmed cell death (PCD) induction is one of the features related to cold adaptation

of olive trees. In transgenic olive trees, osmotin was proven to induce PCD by blocking

cold-induced calcium signalling and modifying cytoskeleton in response to cold stimuli

(D'Angei and Altamura, 2007), suggested its relationship to calcium signalling cascade.

Osmotin has shown enhanced cold tolerance in transgenic tomato by modulating transcript

abundance and functional expression of stress-responsive genes (Patade et al., 2013);

enhanced salt and drought stresses in other above-mentioned transgenic plants by

upregulating the levels of several compatible osmolytes and ROS scavengers (Barthaker


et al., 2001; Husaini and Abdin, 2008a; Parkhi et al., 2009; Das et al., 2011; Subramanyam

et al., 2011; Subramannyan et al., 2012; Annon et al., 2014). These observations together

with the similarity in molecular weight to transcription factors suggest that osmotin might

regulate plant responses to abiotic stress by acting as either a transcription factor or cell

signal modulator, or both (Abdin et al., 2011). However, osmotin does not have any DNA-

binding motif to function as a transcription factor, the role in signalling pathways as a cell

signal modulator has been strongly supported (Abdin et al., 2011; Viktorova et al., 2012;

Kumar et al., 2015). Moreover, tobacco osmotin was proven to interact with AMP-

activated protein kinase, a member of MAP kinase (Narasimhan et al., 2005). MAP kinase

represents the key molecules catalysing the phosphotransfer reaction fundamental to most

signalling and regulatory processes associated with enzyme activation, macro-molecule

assembly, protein localisation and degradation in plant stress responses. In plants, MAPKs

and calcium-dependent protein kinases (CDPKs) are in two major signal transduction

pathways involved in plant response to various abiotic and biotic stresses. Some members

of the two protein family were found working together to mediate crosstalk that triggers

common stress responses such as ROS and hormonal signalling, accumulation of

osmoprotectants and ROS scavengers, stomatal closure, osmotic adjustment leading to

cross-tolerance to different stress conditions (Fujita et al., 2006; Wurzinger et al., 2011;

Mohanta and Sinha, 2016). The roles of osmotins in plant response have shown to be

associated with these two signalling pathways that helps osmotin-expressing plants

tolerance to different abiotic and biotic stress factors. The intensive studies on osmotins

discussed above have linked functions of osmotins and OLPs to a number of signalling

crosstalk between abiotic and biotic stress responses. Although the mode of action of

osmotins remains unclear, their multifunctional nature suggested that osmotins represent

the key regulators mediating plant response to biotic and abiotic stresses.

Even though osmotin was discovered early and identified as the most abundant

protein in cultured tobacco cells adapted to osmotic stress (Singh et al., 1985), the

difficulties in recombinant osmotin productions have prevented functional studies on the

protein level and resulted in its poor elucidated mode of action (Viktorova et al., 2012).

To date, only two published studies described the expression and purification of

recombinant osmotins in microbial systems (Campos et al., 2008; Tzou et al., 2011). The

poor availability of purified recombinant osmotin was demonstrated to be due to its

toxicity and physical properties. Failure to produce recombinant tobacco osmotin in

microbial systems in earlier studies was believed to be caused by osmotin antimicrobial


activity that resulted in toxicity to osmotin expressing microbes (Tzou et al., 2011). In

addition, osmotin protein structure has eight disulfide bonds and proper folding of these

disulfide bonds is required for maintaining its functions. To minimize toxicity to bacterial

cell, Campos et al (2008) and Tzou et al. (2011) targeted recombinant osmotin (Solanum

nigrum OLP and truncated tobacco osmotin, respectively) accumulation in inclusion

bodies and the system resulted in high accumulation of recombinant osmotin up to 30%

of total protein extracts. However, targeting osmotins to inclusion bodies resulted in a

majority of insoluble and aggregated form with misfolded protein present and the correct

eight disulfide bonds in osmotin structure were not achieved. Further steps designed for

denaturing and refolding these recombinant osmotins led to the highly pure osmotin with

antifungal activities against a broad range of plant and human fungal pathogens. The

protocols for expression and purification of recombinant osmotins in bacteria are now

available but including the denaturation and refolding steps that have made it difficult for

application in large scale. For proper folding of recombinant osmotins, the use of plant

expression systems seem to be more feasible. However, the high hydrophobic nature of

osmotins and the fact that many osmotins contain a membrane binding domain need to be

taken into consideration when manipulating gene constructs for expressing in plants.

1.3.5 Osmotins and OLPs as potential candidate genes for enhancing multi-

stress tolerance and for other uses in food industry

Intensive studies and experimental data on biological systems have provided

various practical evidences for the roles of osmotin and OLPs as master regulators in

plant stress signalling that activates the acclimation response leading to enhancing

plant tolerance to multiple abiotic and biotic stress factors. Hence, osmotin appears to

be one of the potential candidate genes for developing multi-stress tolerant crops to

suit the requirements for future crop generations, as discussed above. The expression

of osmotin or OLP genes improved plant resistance to various fungal and bacterial

pathogens. Recombinant osmotin maintained antifungal activities against a broad

spectrum of fungi. These functions have made osmotin to be recommended for uses as

a food preservative in food industry and as plant-derived fungicide in feed stock for

organic meat industry (Liu et al., 2010; Viktorova et al., 2012; Kumar et al., 2015).

Besides, recent studies in mammalian system have shown that osmotin shares

similar functions of human adiponectin, the hormone playing critical role in obesity,

insulin resistance and atherosclerosis in human. Thus, osmotin was suggested to be


used as a therapeutic component in replace of adiponectin for treatment of diseases

related to adiponectin deficiency. Tobacco osmotin shares similarity in both structure

and function with human adiponectin. Adiponectin functions by binding to its plasma

membrane receptors called AdipoRs that further activates either 5’ adenosine

monophosphate-activated protein kinase (AMPK) pathways in skeletal muscles or

peroxisome proliferator activated receptor (PPARs) pathway in the liver to increase

insulin sensitivity and decrease inflammation. Osmotin competes with adiponectin for

binding to its receptors (Miele et al., 2011). Further experiment revealed that tobacco

osmotin acted as an adiponectin agonist in type II diabetes and obesity and could be

used as a therapeutic agent in replacement of adiponectin for type II diabetes and

obesity treatment in human (Trivedi et al., 2012). Similarly, a study on a rat model

system showed that both adiponectin and osmotin involved in neuroprotection against

glutamate-induced synaptic dysfunction, excitotoxicity and neurodegeneration in

developing brain, in which the role of osmotin as adiponectin agonist was confirmed.

The study indicated the beneficial use of osmotin in the treatment of human

neurodegenerative diseases (Shah et al., 2014). Adiponectin deficiency relates to some

diseases such as insulin resistance found in obesity and diabetic type II patients,

coronary artery disease, inflammation, and liver fibrosis. With the prevalence of

diseases related to adiponectin deficits, the use of osmotin as pharmaceutical products

appears to be feasible.

In summary, multifunctional properties of osmotin have made it a potential

candidate for future applications in engineering crop plants for enhanced stress

tolerance, in food and feed stock industries and as therapeutic agent in treatment

various mammalian disorders related to adiponectin deficiency.

1.4 RESURRECTION PLANTS: A NOVEL SOURCE FOR STRESS-

RESPONSIVE GENES

Resurrection plants belong to a small group of angiosperms that can tolerate

extreme levels of dehydration down to 4% relative water content and are thought to

possess unique mechanisms to cope with desiccation. Unlike their desiccation

sensitive counterparts, resurrection plants have developed a distinctive strategy to

withstand drought. Examples of their physiological responses to desiccation include

(1) the loss of all free water in vegetative tissues then rehydration when water becomes

available; (2) shading or dismantling photosynthetic machinery to reduce net


photosynthetic rate during severe cellular water deficit by either leaf folding and

anthocyanin accumulation or disassembling chloroplasts and chlorophyll on drying;

(3) regulating protection mechanisms to minimize cell damage such as forming

multiple vacuoles to maintain cell volume, cell wall folding to prevent mechanical

damage, or replacing water by compatible solutes (Mundree et al., 2002). With respect

to biochemical responses, resurrection plants have evolved a number of mechanisms

against subcellular stresses as listed by Ingle et al. (2007). These include changes in

cell wall composition, cytoplasmic packaging, and membrane lipid composition for

preventing mechanical damage; increasing enzymatic activities in degradation of

chlorophyll and elevating antioxidant production for reducing photosynthetic

damages. The synthesis of compatible solutes such as sucrose, trehalose, LEA, and

chaperone proteins for protecting the integrity of macromolecular is another strategy

used by resurrection plants. Proteomic analysis of the resurrection plant Xerophyta

viscosa during dehydration by Ingle et al. (2007) identified a number of dehydration-

responsive proteins including antioxidants, RNA-binding proteins and photosynthesis-

related proteins. These identified proteins provide evidence of the biochemical

changes that occur during desiccation tolerance of this plant species. Therefore,

resurrection plants represent both ideal model plants and a unique source for the

identification of novel, functionally relevant, stress-associated genes and pathways

(Mundree et al. 2002).

Primary studies on the Australian native resurrection grass that is a close relative of

the economically important cereals such as rice, sorghum and maize, the T. loliiformis,

have highlighted important strategies this plants used to withstand dehydration (Williams

et al., 2015; Karbaschi et al., 2016). The study by Karbaschi et al. (2016) showed that this

plant utilizes a number of physiological and structural mechanisms for rapid response to

water deficit and quick recovery upon rehydration. These mechanisms include (1) leaf

folding, cell wall folding and vacuole fragmenting quickly at the onset of dehydration that

mitigate the mechanical damages to tissues; (2) shutting off the photosynthesis at early

stage of dehydration for protecting the photosynthetic machinery and avoiding the

subcellular damages caused by ROS laid down upon stress; and (3) accumulating of

anthocyanin pigments and maintaining membrane integrity during drying resulted in the

protection of tissues during drying and minimizing repairs needed upon rehydration.

Williams et al. (2015) demonstrated that T. loliiformis modulates the trehalose metabolism


to induce and maintain autophagy pathways that prevent senescence and program cell

death, contributing to desiccation tolerance. These mechanisms suggested the potential of

T. loliiformis for exploiting genes for utilisation in enhancement of stress-tolerance in

crops, with special consideration in its close genetic relationship to important cereal crops.

With their unique ability to tolerate severe water deficit in drying vegetative

tissues, resurrection plants represent a potentially rich source of genes conferring

tolerance to abiotic stresses. A number of genes conferring dehydration tolerance have

been isolated from resurrection plants including XvINO1encoding a myo-inositol 1-

phosphate synthase (Lehner et al., 2008), XvSAP1 encoding a stress responsive protein

(Garwe et al., 2003), and XvGolS encoding galatinol synthase enzyme responsible for

the first catalytic step in raffinose family oligosaccharides (Peters et al., 2007). While

the gene product of XvSAP1 was thought to play roles in stabilizing plasma membrane

to prevent membrane damage, products of XvGolS and XvINO1 were proven to enhance

carbohydrate accumulation during response to water deficit. The expression of XvSAP1

in Arabidopsis thaliana enhanced tolerance to salinity, osmotic, and high temperature

stresses (Garwe et al., 2006). For effective utilisation of this potential genetic source for

the generation of genetic engineered crops with enhanced abiotic stress tolerance, other

genes involved in important abiotic stress responsive pathways need more investigation.

If considering the combined tolerance to multiple abiotic and biotic stress factors,

osmotin from resurrection plants is one of the most potential candidates for utilisation

through genetic engineering due to increasing evidence supporting the role of osmotin as

key regulators in response to abiotic and biotic stresses (as discussed in section 1.3.4).

1.5 RICE AS A TARGET FOR ENHANCING ABIOTIC STRESS

TOLERANCE VIA TRANSGENIC APPROACH

1.5.1 Rice is an important staple food crop

Rice is among the most important cereal crops and is the staple food for more than

a half of the world’s population. More than 90% of world rice production has been

produced and consumed in developing Asian countries that are experiencing a

population boom. Prediction of future climate change has led to an estimation that

affected rice culture areas will double at the end of this century (Jagadish et al., 2011),

thus impacting the food security of many Asian regions (Lobell et al., 2008). Manavalan

and Nguyen (2012) indicated that temperature increase, rising seas and changes in

patterns of rainfall and its distribution under global climate changes are the main causes


of substantial modifications in land and water resources for rice production and the

productivity of rice crops grown in different parts of the world, resulting in a threat of

global food security. Increasing rice production and productivity under such predicted

climate conditions is a challenging task but imperative to feed the increasing population

and to maintain world food security.

1.5.2 Rice is the model plant for monocots

Rice has been considered to be the model plant for monocots for many reasons.

Rice has the smallest genome size among cereal crops, estimated as 430 Mb. though

small the rice genome is 3.7 times larger than the model plant, Arabidopsis thaliana. Its

genome has high degrees of synteny among cereal genomes (Goff, 1999). In fact, rice

has been a favourite crop for genetic studies due to a well-defined protocol for genetic

transformation as well as widely distributed high density and physical maps (Shahbaz

and Ashraf, 2013). The complete genome sequences of the two major sub-species of

rice, indica and japonica, are now available (Londo et al., 2006) that have enabled the

discovery of genes and molecular pathways associated with diverse agronomic traits,

thus providing great opportunities for genetic improvements of this crop (Edwards and

Batley, 2010; Bolger et al., 2014). Rice is familiar with most populations around the

world because it is among the earliest domesticated crops, which is now cultivated

globally (Londo et al., 2006). In addition, its short life cycle and the ease to be handled

in laboratory conditions have made it a desirable crop for genetic studies. Many

screening and phenotyping techniques as well as modern tools developed on rice (Singh

et al., 2010; Zhang et al., 2014) have facilitated researches on rice. These advantages

have made rice to be a model crop for monocots.

1.5.3 Rice is susceptible to abiotic stresses

Among cereal crops, rice has been classified as a susceptible crop to major abiotic

stresses such as drought, high salinity, heat, and cold. Based on the salinity threshold

used to compare the salinity tolerance between species, rice is rated as a salt-sensitive

crop with a threshold of 3 dSm-1 and a slope of 12% per dSm-1. This means that rice

yield starts reducing when cultured in 30 mM NaCl and from that point, rice yield reduce

12% per 10 mM NaCl increasing of saturated soil extract (Sankar et al., 2011; Shabala

and Munns, 2012). Differential effects by salinity were found at different developmental

stages of rice plants, duration and severity of stress (Negrao et al., 2011). Rice

germination stage is more tolerant to salt than seedling stage, and reproductive stage is


the most susceptible phase. The mild stress at growth stage usually results in reducing

photosynthesis and growth that lead to decreased yields. A long duration of exposure to

even low salt concentration at 30 mM NaCl leads to reduced number of tillers per plant,

number of spikelets per panicle, spikelet fertility, and grain weight and reduced grain

production (Gay et al., 2009). Higher salt concentration leads to mature leaf death, and

if the rate of leaf death overtakes the rate of new leaf initiation and expansion then the

plant death occurs due to the lack of photosynthetic supply for further growth and

development (Munns and Tester, 2008). During growth stage, exposure of rice plants to

> 100 mM NaCl causes plant death before mature; but to < 50 mM NaCl delays panicle

initiation and flowering, reduces pollen viability and results in poor seed setting.

Reproductive stage is most susceptible to salt stress since ion toxicity affects pollen

viability and high level of toxic ions can lead to sterility (Negrao et al., 2011).

Drought is the leading factor affecting global rice production and severe effects

have been found in rainfed rice accounting for 45% of rice cultivation area (Babu, 2010).

Rice has been found to be susceptible to drought stress throughout its life cycle but if

stress occurs during flowering results in huge failure or complete yield loss (Swamy and

Kumar, 2013). The effects of drought on rice production is much more serious when

drought occurs in combination with heat stress (Barnabas et al., 2008; Dolferus et al.,

2011; Rang et al., 2011; Powell et al., 2012). According to these authors, rice is sensitive

to drought stress at the critical stage of flower development such as anthesis, pollination,

and pollen germination. Drought stress during flowering together with heat stress (above

37 oC) at a short period can lead to complete yield loss because these combined stresses

results in spikelet sterility. Drought brought about by recent changed climate conditions

has affected rice production in almost all rice culture areas and caused tremendous loss,

even in well-irrigated lands, and resulted in enormous social impacts (Breviariao and

Genga, 2013). These severe impacts were evidenced by the 2002 drought in India and

the 2004 drought in Thailand that affected 300 million Indian and 8 million Thai people,

respectively (Mohanty et al., 2013).

Likewise, the “cold spell” or low temperature threshold (typically night

temperature) for rice is 16 oC, considerably higher than other cereal crops. Under cold

conditions, rice exhibits poor seedling establishment at the start of the season, resulting

in delayed growth and massive grain losses at the end of the season when temperatures

drop below 16 oC at night (Dolferus et al., 2013). If temperatures drop below 12 oC at


the young microspore stage of rice pollen development, pollen sterility occurs resulting

in maximum yield losses (Oliver et al., 2005; Powell et al., 2012). Cold stress is

problematic for rice cultured in temperate or elevated regions and temperatures below

cold spell can lead to yield reductions of over 40% (Dolferus et al., 2013).

The young microspore stage of pollen development of rice has been shown to be

the most sensitive stage to a number of major abiotic stresses that account for a major

grain losses. The growth stage of rice is not sensitive to abiotic stresses as that of the

reproductive stage to most abiotic stresses, however, sensitivity to abiotic stress is

evaluated based on yield reduction. Therefore, rice has been classified as an abiotic stress

susceptible crop.

Being an important crop that provides staple food for a large part of world

population, rice production must be maintained in a sustainable way to ensure the food

supply for an increasing population. Its importance and abiotic stress susceptible features

have attracted numerous research programs for improving productivity while mitigating

stress effects. Intensive studies on rice genetic improvement have brought about various

tools, protocols, techniques for rice transformation, phenotyping, and genome sequence

readily for uses. Much information and knowledge of rice response to abiotic stresses

have also been revealed. These make rice the best target for expressing foreign stress-

responsive genes.

1.6 RECENT ADVANCES IN STUDYING FUNCTIONAL PROTEINS

Traditional methods for characterising a plant gene have relied mainly on primary

DNA sequence and transcriptional expression profile. It is well known that biological

functions are carried out mostly by proteins but RNA expression levels do not always

correlate with protein expression levels. In addition, biological properties of a protein

encoded by a given gene cannot be predicted based on its RNA expression profiles. It

has been widely recognised that studying protein structures, functionalities, and protein-

protein interactions will provide a direct way to characterise biological functions of a

given gene (Hu et al., 2011). However, the laborious and time-consuming nature of

traditional methods such as X-ray crystal analysis for protein structures and yeast two-

hybrid systems for protein interactions, together with the shortage of detection systems

have limited the functional studies of genes. In addition, the difficulties in solubilising,

separating, and identifying membrane proteins have limited functional studies on


membrane proteins (Tan et al., 2008). The recent innovation of bioinformatics and the

development of modern technologies for studying biological functions have enabled

researchers to mine data for protein functions, target binding predictions and structure-

to-function relationships. Many newly-developed high-throughput tools provide

opportunities to effectively unravel crucial questions related to protein functions and

structures that were previously laborious, time-consuming or impossible. Likewise,

recent advances in genetic manipulation have facilitated recombinant protein

productions in various biological expression systems, which further make it possible to

study gene functions at protein levels.

1.6.1 Bioinformatics tools

The creation of bioinformatics tools such as 3-D protein modelling and sequence-

or structure-based functional prediction has sped up gene characterisation and enabled

precise predictions of biological functions of target genes in an evolutionary relationship

manner, without the need of prior knowledge of gene identity. For example, to predict

the function of a protein, researchers need to retrieve similar structures from huge protein

databases and classify them into the same protein fold, which was a time-consuming

process, but this process is now more efficient and more precise (Mirceva and Davcev,

2009). Computational tools can be used to discover new roles of genes according to their

promoter architecture and co-expressed gene analyses. Dehimi et al. (2012) used this

approach to demonstrate the multiple roles of TLP and OLP in biotic and abiotic stresses

and recommended it as an effective means to discover unknown functions of genes.

Various methods developed for protein structure prediction are now available and have

made it possible for biologists without background in bioinformatics to access and

investigate their genes of interest (Kelley and Sternberg, 2009; Roy et al., 2010;

Jaroszewski et al., 2011). The quality and precision of these methods have been

progressively assessed and improved for the best accuracy possible (Kryshtafovych and

Fidelis, 2009; Schmidt et al., 2009; Zhang, 2009). In addition, many methods for

determining protein properties such as subcellular localisation, ligand binding, protein-

protein interactions and predicting active binding sites of protein are now accessible

(Chen et al., 2007; Emanuelsson et al., 2007; Hernandez et al., 2009; Wass et al., 2010;

Plasnas-Iglesias et al., 2013). Undoubtedly, these promising tools play a critical role in

gene characterisation studies today.


1.6.2 Advances in genetic manipulation

Unlike nucleic acids, proteins are prone to denature or degrade in standard buffer

conditions and at ambient temperature; protein conformations change depending on the

expressing systems; and so far proteins cannot be routinely amplified in artificial

conditions using protein templates, reaction reagents, and amino acids like PCR-

amplification-based for nucleic acid. These features have made it more challenging to

study protein functions. The studies on functional proteins would not have been possible

without the achievements of genetic manipulation and the availabilities of different

expression vector systems. Besides binary vector systems that have been widely used

for stably expressing foreign proteins in plants, many overexpression vector systems

have been developed to facilitate the ability to easily express proteins of cloned genes

and to enhance the protein expression levels of target genes required for functional

analysis. For example, Gateway-compatible vectors have been developed to facilitate

high-throughput cloning of target genes and have been demonstrated to be useful in

studying protein localisation, protein-protein interactions, specificity of promoters, gene

knockdown mutants, and protein production for affinity purification (Earley et al.,

2006). Due to its features of efficient cloning and high sensitivity of fluorescent

detection, Gateway vectors are increasingly used for studying subcellular localisation of

proteins and testing the interactions of target protein with other fluorescently tagged

proteins within living cells. Similarly, the pEAQ vectors have been designed to allow

easy and quick production of recombinant proteins in plants (Peyret and Lomonossoff,

2013). Using pEAQ vectors allows cloning and expressing proteins of interest within

several weeks that has made it the most suitable for agrobacterium infiltration and

transient expression studies. The most advantages of pEAQ vector are the use of the

Cowpea Mosaic Virus hypertranslational “CPMV-HT” that produces extremely high

yield of recombinant proteins through enhancing high translational efficiency and the

incorporation of P19 suppressor of gene silencing in the expression cassette that reduces

the complicacy in sample preparation and maximizes expression efficiency. These

distinct features have accelerated the utilisation of pEAQ in transient expression of

recombinant proteins in plants. Another achievement that can be used to enhance protein

production in plants is the incorporation of Lys-Asp-Glu-Leu (KDEL) peptide in the C-

terminus of target protein. The KDEL retention peptide was discovered as a C-terminal

signal peptide that makes proteins permanently reside in the lumen of the endoplasmic

reticulum (ER) (Munro and Pelham, 1987). This signal peptide has been shown to be


essential for retention of transmembrane proteins in the ER by preventing them from

secretion (Jackson et al., 1990). The KDEL peptide has been incorporated in a number

of recombinant proteins expressed in plants and shown to significantly enhance the

accumulation levels of recombinant proteins that primarily were cytoplasmic, secretion,

or transmembrane proteins (Wandelt et al., 1992; Schouten et al., 1996). The

accumulation level was reported up to 100 fold higher than control in leaf tissues of

transgenic tobacco plants (Wandelt et al., 1992). It has been evidenced from these

studies that the high accumulation levels of KDEL-tag proteins were the results of

increasing protein stability, reducing exposure of proteins to proteases during

translocation pathways, and increasing yield of protein extraction from ER as in the case

of membrane proteins. In addition, the achievements in genetic manipulation have

allowed to design a number of vector series for validating and visualizing the protein-

protein interactions in living plant cells (Lee et al., 2008; Nishimura et al., 2015;

Kamigaki et al., 2016). The progresses in genetic manipulation have facilitated studies

on protein functions that have allowed to gain knowledge on protein mechanism and

mode of action and have made it more convincible in explaining functions of a gene.

1.6.3 Functional protein microarrays

Alternative to the high-throughput methodologies established for identifying

protein-protein interactions, such as protein complex purification coupled with mass

spectrometry analysis and the yeast two-hybrid system, functional protein microarray

technology has recently emerged as a powerful approach for simultaneously studying

thousands of proteins. A protein microarray (protein chip) is a solid surface on which

thousands of different proteins are immobilized in discrete spatial locations, forming a

high density protein dot matrix (Hu et al., 2011). To identify which proteins interact with

a target plant protein, the gene is first fused with affinity and detecting tags and cloned;

the recombinant protein will then be expressed in a suitable plant, extracted and purified;

the purified recombinant protein will then be labeled and hybridised with a plant protein

chip; an appropriate detection system will be applied to analyse interactions between

target protein and known proteins in the chip. The applications of protein microarrays

have enhanced efficiency for characterisation of protein-protein interactions,

identification of relevant binding substrates for proteins under investigation and

exploration of novel functions of known proteins (Popescu et al., 2007b; Fukao, 2011).

Calcium sensor and MAP kinase are two major cascades in stress signalling and


transduction of plants. Using Arabidopsis protein microarrays has allowed researchers

to screen binding targets and identify uncharacterised targets of Calmodulin (CaM) and

Calmodulin-like (CML) proteins that unravel the unknown roles of CaMs/CMLs in

calcium sensor network contributing to plant growth, development, and stress and

defense responses (Popescu et al., 2007a). Similarly, a total of 570 MAPK

phosphorylation substrates involved in MAP kinase network were revealed by one study

using an Arabidopsis protein array (Popescu et al., 2009). Functional protein

microarrays are now available and considered a valid tool for high-throughput

characterisation of protein-protein interactions (Sutandy et al., 2013). Hu et al. (2011)

stated that functional protein microarrays will soon become an indispensable tool in

proteomics research and systems biology. In plant system, the commercial availability

of Arabidopsis microarrays together with public-accessible progresses in functional and

pathway analysis of Arabidopsis proteins allow the rapid identification of pathway and

interactive protein partners of an under-studied plant protein. This system provides a

mean to speed up functional protein studies.

1.6.4 Detection tools for protein-protein interactions in living cells

Detection of protein interactions in living cells is of significant importance for

studying protein-protein interactions because it allows the capture of the interactions that

occur in a particular cell with a full complement of proteins present in the cell and the

external stimuli that influence the cell. The visualisation and detection of protein-protein

interaction in plant living cells is now eased by Bimolecular Fluorescence

Complementation (BiFC) technique, in which the interaction of two non-fluorescence

proteins, separately fused with N-terminus or C-terminus of a fluorescence molecule, is

indicated by fluorescence emission (Kerppola, 2008) (Fig. 1.3 A). Even two protein

complexes can be simultaneously detected in a single plant cell by BiFC using two

coloured fluorescent complementary pairs (Kodama and Wada, 2009) (Figure. 1.3 B).

Tsutsumi et al. (2009) used BiFC to study Ras proteins and successfully determined

their spatio-temporal regulation in signalling. Ras proteins are monomeric GTPases that

have a complex effectors and regulate a number of signal transduction cascades involved

in cell growth, differentiation, survival and mortality. Application of BiFC in this study

revealed the mechanism that Ras exploits different effectors via Ras-PI3K interaction,

Ras subsequently regulates downstream signalling in the endosome. Likewise, a

multicolour BiFC technique has been used to analyse the efficiencies of complex


formation between small subunits of the large family of cytoplasmic G protein (Dupre

et al., 2006; Mervine et al., 2006). As compared with alternative methods for the

visualisation of protein-protein interaction, including fluorescence resonance energy

transfer (FRET), Kerppola (2008) indicated six advantages of using BiFC instead of

FRET. BiFC method has become a standard approach for visualising protein interactions

in living cells and has been applied in a variety of research applications during the last

five years. There are still considerations in choosing fluorescent fragments for avoiding

spontaneous association and for enhancing fluorescence intensity; in preparing an

adequate control system for avoiding false positive; and in the quantitative evaluation of

the efficiency of complex formation, many protocols and guidance for using BiFC are

available (Hu et al., 2005; Kerppola, 2009, 2013). In addition, Identification of different

fluorescence proteins and improvement of fluorescence intensity for BiFC use have been

progressively carried out. Consequence, at least 15 fluorescence proteins have been

developed for BiFC and some mutant versions of fluorescent proteins have improved

intensity up to 8 fold as compared to their native versions (Komada and Hu, 2012). Its

advantages and recent progress have made BiFC become a key technique that should be

incorporated into studies on protein-protein interaction.

These above-mentioned advances provide significant means to promote research

on the identification, characterisation and validation of protein functions.


Figure 1.3 Principle of BiFC and multicolour BiFC analysis (Kerppola, 2009).

A. Principle of BiFC: The red and blue rectangles represent putative interaction partners (A

and B). They are fused to fragments of a fluorescent protein, represented by silver half-

cylinders (YN and YC). If the proteins interact with each other, they can facilitate association

of the fluorescent protein fragments to produce a fluorescent complex (green cylinder YN-

YC). The image shows an example of a complex formed by nuclear proteins.

B. Principle of Multicolar BiFC: Two alternative interaction partners (A and B) are fused to

fragments of different fluorescent protein fragments (tinted grey half-cylinders). These fusions

are co-expressed in cell with a shared interaction partner, Z, fused to a complementary fragment

(grey half-cylinder). Complexes formed by A and Z can be distinguished from complexes

formed by B and Z based on the difference in their fluorescence spectra. The image shows an

example of the visualization of two protein complexes in the same cell, one nucleolar (cyan)

and the other nucleoplasmic (yellow).

A

B


1.7 PROBLEM STATEMENT, GAPS, AIMS, AND OBJECTIVES

The current and the predicted changing climate scenarios could result in more

prevalent of environmental stress factors such as drought, salinity, extreme

temperature and excess UV radiation. These environmental factors have been

identified as the key limiting factors in agricultural productivity and food quality

(Lobell et al., 2008; Wang and Frei, 2011). With the projected future increasing human

population, the global food production was estimated to be double by 2050 with a

significant annual grain yield increase of 44 million metric tons will be need (Tester

and Langridge, 2010). However, the massive increase agricultural production have

been challenged by such environmental stress conditions together with the reduced

agricultural land (due to urbanisation, industrialisation, and desertification brought

about by climate change) and the declined available resources (Oliver, 2014). It is

obvious that food security for future population is threatened. To meet the food

demand (both quantity and quality) of future rising population, the challenges of

improving crops production in unfavourable environmental conditions and limited

agricultural resources need to be addressed. The current rate of crop improvement,

mostly contributed by conventional breeding, was found to be far below the future

rising food demand (Ray et al., 2013). Oliver (2014) indicated that the agricultural

production gaps between future food demand and crop improvement brought by

conventional breeding can be filled by the applications of genetically-modified

organism (GMO) technologies, which offer more rapid crop improvement, novel

genetic strategies for crop improvement and the ability to use genes from all sources

regardless of origin. Besides, identifying the key factors for crop adaptation to adverse

climate conditions could shape the severity of climate change impacts on food

production (Lobell et al., 2008).

Plant adaptive response to environmental stress is a multigenic trait that involved

a complex gene network. For more efficient use of GMO technologies in improving

crop adaptation to environmental stresses, it is important to identify the master

regulators of stress adaptation from the stress-tolerant species and engineer them into

crop plants (Mittler and Blumwald, 2010; Cominelli et al., 2013). The Australian

native resurrection plant T. loliiformis represents the ideal starting point for searching

potential candidate genes for developing stress-tolerant crops, regarding the adaptive

strategies this plant implements to cope with the environmental stresses (Section 1.4).


Among the functional and regulatory genes identified to be involved in plant stress

response, plant osmotin holds great potential for enhancing stress tolerance in crops

through genetic engineering approach, due to increasing evidence supporting the role

of osmotin as key regulators in plant stress response (Husani and Rafiqi, 2012;

Viktorova et al., 2012; Kumar et al., 2015).

Intensive studies conducted on osmotin have shown its potential for enhancing

both abiotic and biotic stress tolerance in plants but the mechanisms by which osmotin

mediates plants response to stress remains for further elucidation. Osmotin and OLP

genes have been shown to be induced by a number of abiotic and biotic stresses and

hormonal stimuli indicating their involvement in plant response to these factors

(Section 1.3.2). Transgenic plants expressing osmotin and OLP genes have shown

consistently enhanced tolerance to various abiotic stresses, bacterial and fungal

pathogens (as discussed in Section 1.3), which indicate critical roles of osmotins and

OLPs in promoting plant tolerance to abiotic and biotic stresses and the multifunction

nature of the proteins. However, the direct evidence explaining stress response

mechanisms of osmotins and OLPs such as stress-responsive pathways, their

interactive protein partners, and their mode of action are still shortage in the literature.

Regardless the early discovery of osmotins and a large number of studies designed to

dissect the role of osmotins and OLPs in plant stress response, the difficulties in

obtaining recombinant osmotins remain the obstacle for functional studies directly at

protein levels. Recent advances in studying functional proteins (discussed in Section

1.6) would provide useful means for facilitating the discovery of osmotin functions

and pathways. Likewise, comparative studies of osmotins from natural drought-

tolerant species with those of drought-sensitive species would provide novel insights

into molecular mechanisms required for adaptive response to stresses and shed the

light for identifying unknown functions of osmotins.

In this study, an osmotin from the native Australian resurrection plant T. loliiformis

(TlOsm), previously isolated from a drought-induced cDNA library of T. loliiformis,

was molecularly characterised and functionally validated on transgenic plants in

comparison with the two osmotin genes (OsOlp1_A and OsOlp1_I) from drought-

tolerant (Apo) and -sensitive (IR64) cultivars of the stress sensitive crop, Oryza sativa

(rice). Despites large numbers of osmotins and OLPs have been characterised from

many plant species and numerous transgenic crops expressing osmotins and OLPs


have shown enhanced tolerance to abiotic and biotic stresses (Section 1.3), none of

osmotins from a desiccation tolerant species such as the resurrection plant T.

loliiformis has been characterised. Resurrection plants possess a unique ability to

tolerate severe water deficit in vegetative tissues and represent a potentially rich source

of genes conferring tolerance to abiotic stresses (Ingle et al. 2007; Karbaschi et al.

2016; Mundree et al. 2002; Williams et al. 2015). Even though a number of genes

conferring dehydration tolerance have been isolated from other resurrection plants

(Garwe et al. 2003; Garwe et al. 2006; Lehner et al. 2008; Peters et al. 2007), very

little has been reported about the expression of these stress-responsive genes in crop

species. A comparative drought responsive transcriptome analysis of the tolerant and

susceptible rice genotypes (Apo vs IR64) identified two osmotin genes (OsOlp1-A and

OsOlp1-I, respectively) that are only different in 10 amino acid of their encoded protein

sequences but are differentially expressed in response to drought stress. Further analysis of

these two proteins suggested that changes in amino acid residues on the functional sites of

the proteins may account for their differential responses to drought of these two rice

genotypes (unpublished, personal communication with S. Robin, TNAU-India). Therefore,

the incorporation of two rice osmotin genes OsOlp1-A and OsOlp1-I into the study is

necessary for comparison with TlOsm and to understand the mechanisms that these osmotins

regulate abiotic stress responses in plants. In the field, crop plants are often exposed to

multiple stresses either simultaneously or successively. Therefore, genes encoding osmotins

are likely to be suitable candidates for the genetic enhancement of plants, with respect to

multiple-stress tolerance. Understanding the molecular characteristics and functions of

TlOsm in plant defense holds a great promise for the gene utilisation in improving crop

tolerance to abiotic stresses through genetic engineering.

The overall aim of this research was to address a number of key questions that will

improve our understanding of the roles of plant osmotin in general and TlOsm

specifically:

1. Whether TlOsm plays a role in abiotic stress response?

2. How does TlOsm act during abiotic stress response?

3. Which stress responsive pathway is TlOsm involved in?

4. What is the role of TlOsm in abiotic stress responses in a crop species?


This overall aim was addressed through the following specific objectives:

Objective 1: Determining the molecular characteristics of TlOsm

Objective 2: Generating transgenic plants constitutively expressing target osmotins

and appropriate reporter gene.

Objective 3: Investigating the roles of TlOsm, in comparision with OsOlp1_A and

OsOlp1_I, in abiotic stress responses of transgenic rice plants.

Objective 4: Identifying interactive protein partners of the TlOsm, OsOlp1_A, and

OsOlp1_I and exploring stress responsive pathways involving these osmotins.

The general research outline and thesis presentation are shown in the Figure 1.4

Figure 1.4 General research outline and thesis presentation

Chapter 2: General Materials and Methods 39

Chapter 2: General Materials and Methods

This chapter describes the general materials and methods used throughout the

entire research project. The materials include general chemicals and specialized

reagents, Tripogon loliiformis, Oryza sativa, Nicotiana tabacum and Nicotiana

benthamiana plants, bacteria, primers, backbone vectors, and common solutions and

media in Section 2.1. Section 2.2 presents the general methods for gene construct

cloning, E. coli transformation, Agrobacterium tumefaciens transformation, DNA and

RNA extraction, purification and amplification. Specific methods relevant to particular

objectives will be referred to Chapter 3, 4, 5 and 6.

2.1 MATERIALS

2.1.1 Source of general chemicals and specialized reagents

All general laboratory reagents of analytical grade were obtained from Sigma-

Alrich (USA), Merck Millipore (USA), Chem-supply (Australia), unless otherwise

stated. Agarose used for gel electrophoresis was supplied by Roche (Australia).

Restriction enzymes were supplied by Roche (Astralia) or New England Biolabs

(Australia). DNA markers and PCR reaction mix were supplied by Promega (USA)

and Invitrogen (USA). Miniprep plasmid extraction kits was supplied by Promega.

Plant tissue culture media and phyto hormone were supplied by PhytoTech (USA).

Plant DNA extraction kits and Plant RNA extraction kits were supplied by QiAgen

(Netherlands). His Spintrap columns and protein G Mag sepherose Xtra were supplied

by GE Healthcare Life Sciences. Ligation enzymes, LR recombination reaction, cDNA

reverse transcription reaction and antibodies was purchased from Invitrogen. Protein

chip ArabidopsisChip1 and plasmid pYL436 were purchased from Arabidopsis

Resource center (ABRC-USA).

2.1.2 Plant materials

2.1.2.1 Plant materials for T. loliiformis mixed elicitor cDNA libraries

Tripogon loliiformis plants were germinated from seeds originally colected from

Charliville (GPS: 26o42’ S 146o15’ E) Queensland, Australia and propagated for

generations in glasshouse. The plants were grown in a glasshouse under a 12 h

40 Chapter 2: General Materials and Methods

photoperiod (light intensity of 900 ±100 µmol m-2 s-1) with day/night temperature of

27 oC.

2.1.2.2 Plant materials for stable transformation

Rice seeds (Oryza sativa L. spp Japonica cv. Nipponbare) previously provided

by Yanco Agricultural Institude (NSW, Australia) and propagated in a glasshouse

under a 12 h photoperiod with day/night temperature of 27 oC were used to generate

calli for stable transformation.

Nicotiana tabacum plants were maintained in sterile closed tissue culture

vessels with monthly sub-cultured and placed in growth chamber at 16 h photoperiod,

25 oC and moderate light. In vitro microcutting plants after 2-3 weeks sub-cultured in

fresh medium were used to provide leaves for stable transformation.

2.1.2.3 Plant materials for transiently expression assays

Nicotiana benthamiana plants were used for both producing recombinant

osmotins and detecting protein-protein interactions in planta. The plants were

germinated in 1.6-L pots with 3 plants/pot. They were grown under controlled

conditions of 25 oC, light intensity of 900 ±100 µmol m-2 s-1, 65% relative humidity

and 16 h photoperiod. Plants were ready for Agro-infiltration after 4-5 weeks.

2.1.3 Bacterial strains

Escherichia coli (E. coli) strain XL-1-Blue was used for all general plasmid

cloning, except for plasmid carrying the lethal ccdB gene. Agrobacterium

tumefaciences strain LBA4404 was used for tobacco transformation and strain Agl1

was used for both rice stable transformation and transient expression assays in N.

benthamiana. Except for the One Shot® ccdB Survival™ 2 T1R Competent Cells were

supplied by Invitrogen (used for cloning plasmid carrying the lethal ccdB gene), other

bacterial competent cells were readily available within the CTCB.

2.1.4 Oligodeoxyribonucleotide (Primers)

All primers used for plasmid consruction and confirm the presence of the target

genes in the plasmids in this chapter are shown in Table 2.1. Details of primers for

characterisation of transgenic rice and tobacco and TlOsm expression in T. loliiformis

refer to Chapter 4. All primers were synthesised by GeneWorks (Hindmarsh, South

Australia). Primers were diluted to a concentration of 100 µM and working stocks of

10 µM were prepared for PCRs and 3.2 µM stocks were for sequencing.


Table 2.1 List of primers for plasmid cloning

Primer

set Primer name Sequence (5'-3')

Product size

(bp) Aims

A1 TlOsmBamHI F GGATCCATGGCGAGATTACGAGGGGCTG

1232 Amplify TlOsm and Nos terminator in the

pCambia2300-TlOsm NosTerHindIII R AAGCTTCCCGATCTAGTAACATAGATGACA

A2 UidA BamHI F GGATCCATGGTCCGTCCTGTAGA

2083 Amplify UidA gene and Nos terminator

in the pCambia1300 NosTerHindIII R AAGCTTCCCGATCTAGTAACATAGATGACA

A3 OsOsmApoBamHI F GGATCCATGGGATTAGACCAAGCTGC

836 Amplify OsOlp1_A from 13ABRIKP-

OsOsmApo_pMK_RQ M13 R AACAGCTATGACCATG

A4 OsOsmIR64BamHI F GGATCCATGGCTTCTGCCAAGCTG

836 Amplify OsOlp1_I from 13ABRIKP-

OsOsmIR64_pMK_RQ M13 R AACAGCTATGACCATG

B1 EYFPTopo F CACCATGGTGCCTAGCGTGACCAAGG

838 Amplify EYFP gene with the Topo

overhang from pEarleyGate 101 EYFPTopo R TTAAGCGTAATCTGGAACATCG

B2 TlOsmTopo F CACCATGGCGAGATTACGAGGGGCTG

943

Amplify TlOsm with Topo overhang and

no stop codon from pCambia 2300-

TlOsm TlOsmTopo R GTGCAGGGCACCAGCGAGCACGAG

B3 TlOsmTopo F CACCATGGCGAGATTACGAGGGGCTG

952

Amplify TlOsm with Topo overhang and

with the stop codon from pCambia 2300-

TlOsm TlOsmBstEII R GGTCACCTCAGTGCAGGCCACGAG

C1 AttR1_AGEF ACCGGTACAAGTTTGTACAAAAAAGCTGAACG

2798


Primer

set Primer name Sequence (5'-3')

Product size

(bp) Aims

IgG_KDEL_StuIR AGGCCTTCAGAGTTCATCCTTTACCGAGCTCGAATTCGCGTC

Amplify fragment from AttR1 to IgG of

pYL436 with KDEL signal sequence and

AgeI and StuI sites for modifying

pEAQ_HT

C2 OsOsmApoTopoF CACCATGGGATTAGACCAAGCTGC

745

Amplify OsOlp1_A without the stop

codon from 13ABRIKP-

OsOsmApo_pMK_RQ OsOsmApoTopoR GTGGCAGAAGATGACCTTGAGCTC

C3 OsOsmIR64TopoF CACCATGGCTTCTGCCAAGCTG

745

Amplify OsOlp1_I without the stop

codon from 13ABRIKP-

OsOsmIR64_pMK_RQ OsOsmApoTopoR GTGGCAGAAGATGACCTTGAGCTC

D1 AtCPK4_Topo F CACCATGGAGAAACCAAACCCTAGAAGAC

1507

Amplify AtCPK4 with Topo overhang

and no stop codon from Arabidopsis

thaliana cDNA AtCPK4_Topo R CTTTGGTGAATCATCAGATTTAGCAG

D2 AtCPK5_Topo F CACCATGGGCAATTCTTGCCGTG

1672

Amplify AtCPK5 with Topo overhang


thaliana cDNA AtCPK5_Topo R CGCGTCTCTCATGCTAATGTTTA

D3 AtALDH7_TOPO F CACCATGGGTTCGGCGAACAACG

1528

Amplify AtALDH7B4 with Topo

overhang and no stop codon from

Arabidopsis thaliana cDNA AtALDH7_TOPO R ACCGAAGTTAATTCCTTGCGCTAGAG

D4 AtMS1_TOPO F CACCATGGCTTCACACATTGTTGGATACC

2299

Amplify AtMS1 with Topo overhang and

no stop codon from Arabidopsis thaliana

cDNA AtMS1_TOPO R CTTGGCACTGGCGAGCTGGG

D5 AtPER42_TOPO F CACCATGGGAGGCAAAGGTGTG

994

Amplify AtPER42 with Topo overhang


thaliana cDNA AtPER42_TOPO R ATGGTTCTTGTTTGCGAGATTACATTG


2.1.5 Backbone vectors

2.1.5.1 Vector for primary cloning

The pGEM®T Easy vector (Figure 2.1A) was used for primary amplification of

the genes used for common cloning by restriction enzyme digestion and then ligation.

The pENTR/D-TOPO® was used for primary cloning of genes for GatewayTM

recombination cloning technology.

Figure 2.1 Plasmid maps for primary cloning. A) pGEM®T Easy vector used for amplification of genes for common cloning and B)

pENTR/D-TOPO® used as entry vector for GatewayTM recombination cloning technology.

2.1.5.2 Vector for cloning genes stably expressing in rice

The pYC27 UidA vector (Figure 2.2) was used as a backbone plasmid for

cloning the OsOlp1_A, OsOlp1_I, TlOsm, and UidA genes that were stably

transformed into rice.

A B

https://www.google.com.au/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&ved=0ahUKEwi9y4LPzq7QAhXDS7wKHWqyBZEQjRwIBw&url=https://www.promega.com/products/pcr/pcr-cloning/pgem_t-easy-vector-systems/&psig=AFQjCNG-LBlzN5MbdPXgXVfGmHwMBbLWnQ&ust=1479431675483063

https://www.google.com.au/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&ved=0ahUKEwi9y4LPzq7QAhXDS7wKHWqyBZEQjRwIBw&url=https://www.promega.com/products/pcr/pcr-cloning/pgem_t-easy-vector-systems/&psig=AFQjCNG-LBlzN5MbdPXgXVfGmHwMBbLWnQ&ust=1479431675483063


Figure 2.2 Map of backbone vector used for cloning genes stably expressing in rice.

2.1.5.3 Destination vectors for cloning genes stably expressing in tobacco

The vector pCE100, pCE101, and pCE104 (Figure 2.3) were previously

modified from vector series pEaleyGate 100, 101, and 104, respectively. These vectors

were used as destination vectors in GatewayTM recombination cloning to generate the

vector control and EYFP-tagged TlOsm used for stable transformation of tobacco.

pYC27 UidA

12999 bp

UidA

hptII Ubi promoter

35S

NosT

BamHI (2016)

EcoRI (1)

SmaI (11955)

XmaI (11953)

HindIII (4093)

PstI (23)

PstI (2014)

ApaLI (1319)

ApaLI (2955)

ApaLI (3280)

ApaLI (8460)

ApaLI (8958)

ApaLI (11353)

ApaLI (11655)


Figure 2.3 Maps of destination vectors for cloning EYFP-tag TlOsm and VC.

A) pCE100 used for the expression of EYFP control, B) pCE101 used for tagging EYFP at C-

terminus of TlOsm, C) used for tagging EYFP at N-terminus of TlOsm

pCE100

12221 bp

Hyg(R)

Kan(R)

CCDB

Cm(R)

left border

bom site from pBR322

STA from pVS1

right border

aTTR2

aTTR1

M13R CaMV35S promoter

lacZ promoter

CaMV 35S promoter, duplicated

pBR322 origin of replication

pVS1-REP

CaMV 3'UTR

nos 3'UTR

Octopine Synthase Terminator

A

pCE104

13077 bp

Hyg(R)

Kan(R)

left border


STA from pVS1

right border

nos 3'UTR

attR1

Cm(R)

ccdB

aTTR2

EYFP

M13R

CaMV35S promoter

lacZ promoterCaMV 35S promoter, duplicated


pVS1-REP

CaMV 3'UTR

Octopine Synthase Terminator

C

pCE101

13026 bp

Hyg(R)

Kan(R) E-YFP

Cm(R)

CCDBleft border


STA from pVS1

right border

nos 3'UTR

attR2

M13R

CaMV35S promoter

lacZ promoterCaMV 35S promoter, duplicated


pVS1-REP

CaMV 3'UTR

Octopine synthase terminator

attR1

HindIII (3359)

HindIII (4196)

B


2.1.5.4 Destination vector for recombinant osmotin production

The vector pEAQ-436 (Figure 2.4) was used as destination vector in gerarating

plasmids for producing recombinant osmotins in N. benthamiana. This vector was

modified from pYL436 and pEAQ-HT (Appendix A-Figure 2) by incoparating the

AgeI and StuI restriction sites and KDEL sequence into the GatewayTM recombination

site and the Tandem affinity purification (TAP) of pYL436, then inserting whole

sequence within AgeI and StuI sites into backbone pEAQ-HT at AgeI and StuI sites.

Figure 2.4 Map of destination vector used for recombinant osmotin production.

2.1.5.5 Destination vectors used for detecting protein-protein interaction in

planta

The pE3132 (Figure 2.5A) and pE3134 (Figure 2.5B) were used as destination

vectors for cloning plasmids used in Bimolecular fluorescence complementation

(BiFC) assays which was used for detecting protein-protein interactions in planta. The

pEA Q -436

12737 bp

P19

NPTIII

TrfA

NPTII

ccdB

KDEL

attR1-CmR-ccdB-attR2 GATEW AY cassette

9x myc tag

6x HIS tag

protease 3C cleavage site

2x IgG binding domain

Cm(R)

C1

C3

35S promoter

CaMV 35S promoter

ColE1

OriV

35S terminator

Nos Terminator

CPMV RNA-2 3'UTR

CPMV RNA-2 5'UTR

LB

RB

attR1

attR2

AgeI (1296)

Stu I (4090)


pE3132 was used for the fusion of the half C-EYFP (from AA 175 to the end of the

molecuole) with Arabidopsis genes. The pE 3134 was used to for the fusion of half N-

EYFP (from AA 1 to 174 of the molecuole) with OsOlp1_A, OsOlp1_I, and TlOsm.

Figure 2.5 Maps of destination vectors used for detecting protein-protein interaction in

planta.

2.1.6 General media, solutions: abbreviation and composition

Acetosyringone: 100 mM acetosyringone; dissolved in DMSO

Agarose gel loading dye (6X)

0.25% (w/v) bromophenol blue, 50% TE (w/v), 50% (v/v) glycerol

Alkaline lysis solution I

50 mM Glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0

Alkaline lysis solution II: 0.2 M NaOH, 1% (w/v) Sodium Dodecyl Sulphate (SDS)

Alkaline lysis solution III: 2 M Glacial acetic acid, 3 M potassium acetate

Ampicillin (100 mg mL-1): Dissolved in ampicillin in deionised water, filter sterilised

BAP (1 mg mL-1): Dissolve 6-Benzylaminopurine in 1 M NaOH

CHCl3: IAA: Chloroform isoamyl alcohoh in a ratio of 24:1 (v/v)

Coomassie Blue solution:

50% ethanol, 10% acetic acid, 0.1% Coomassie Blue G-250 (Biorad)

CTAB buffer: 2% CTAB (cetyltrimethylammonium bromide), 2 M NaCl, 25 mM

EDTA pH 8, 100 mM Tris-HCl, 2% polyvinylpyrrolidone (PVP 40 000)

EDTA: 0.5 M Ethylene diamine tetra-acetic acid, pH 8.0

pSAT5 DEST cEYFP N1 (pE3132)

5743 bp

Cm R

ccdB

Amp R

c(175 end)EYFP

TEV enhancer

att R2

att R1

35S

35S

35S terminator

A

pSAT4 DEST nEYFP N1 (pE3134)

6054 bp

Cm R

ccdB

Amp R

(n174)EYFP

TEV enhancer

attR1

attR2

35S promoter

35S promoter

35S terminator

B


Fixation solution: 4% paraformaldehyde, 0.1% PBS buffer, pH 7.2

Gus stain solution: 100 mM phosphate buffer pH 7.0, 10 mM EDTA, 1 mM

potassium ferriccyanide, 0.1% Triton X-100, 2 mM 5-bromo-4-chloro- 3-indolyl-β-D-

glucuronide.

IAA (2 mg mL-1): Dissolved indole-3-acetic acid in 1 N NaOH

Infiltration medium: 10 mM MES, 10 mM MgCl2, 100 mM acetosyringone

IPTG: 0.1 M Isopropyl-β-B-thiogalactopyranoside in sterile water

Kanamycin (100 mg mL-1): Dissolved kanamycin in deionised water, filter sterilised

Kinetin (2 mg mL-1): Dissolved kinetin in 1 N KOH

Luria Bertani (LB) solid medium: 10 g L-1 tryptone; 5 g L-1 yeast extract; 10 g L-1

NaCl; 1 5 g L-1 agar (pH to 7.5, autoclaved)

Luria Bertani (LB) liquid medium

10 g L-1 tryptone; 5 g L-1 yeast extract; 10 g L-1 NaCl (pH to 7.5, autoclaved)

NAA (1 mg mL-1): Dissolved 1-Naphthaleneacetic acid in ethanol

PBS buffer: 137 mM NaCl, 10 mM phosphate (10 mM Na2HPO4 and 1.8 mM

KH2PO4), 2.7 mM KCl, pH 7.4

Phosphate buffer (50 mM pH 7.4): 9.5 mM NaH2PO4, 40.5 mM Na2HPO4

Rifampicin (25 mg mL-1): Dissolved rifampicin in DMF (dimethylformanmide)

SDS-PAGE destaining solution: 15% ethanol, 10% acetic acid

SDS-PAGE loading buffer:

50 mM Tris pH 6.8, 1% SDS, 10% glycerol, 10 mM DTT, 0.025% bromophenol blue

SDS-PAGE running buffer (1X): 25 mM Tris, 192 mM glycin, 0.1% (w/v) SDS

TAE buffer: 10 mM Tris-HCl, 0.5 mM EDTA pH 7.8

TBS buffer: 100 mM Tris pH 7.5, 150 mM NaCl

TBS-T buffer: TBS buffer, 0.1% Tween 20

TE buffer: 10 mM Tris-HCL pH 8.0, 1 mM EDTA

Timentin (200 mg mL-1): Dissolved timentin in deionzed water, filter sterilized

TPS buffer: 100 mM Tris, 1 M KCl, 10 mM Na2EDTA

Western blotting buffer: 25 mM Tris, 192 mM glycin, 20% methanol

X-gal: 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, 2% (w/v) prepared DMF

2.1.7 Plant tissue culture medium

Refer to tobacco and rice transformation in Chapter 3 and 4


2.2 METHODS

2.2.1 Cloning and bacterial transformation

2.2.1.1 Primary cloning

The primers in the primer set A1, A2, A3, A4 and C1 and the respective

templates in the Table 2.1 (refer to Appendix A-Figure 1 & 2 for the maps of plasmids)

were used in PCR reactions to amplify the target genes by Taq polymerase for PCR

product with A-tail. The A-tailed PCR products were cloned into pGEM-T Easy®

vector system (Promega) in a 10 µL reaction mixture containing 3 µL of purified DNA

fragments, 1 µL vector DNA, 5 µL 2X ligation buffer, 1U of T4 DNA Ligase and

topped to volume with dH2O. The mixture was incubated overnight at 14 oC to

maximize the number of ligations. The mixture was transformed into E. coli. The

transformants were analysed by restriction enzyme analysis to identify transformants

containing the target genes. The positive transformants were further grown to isolate

plasmids (using Promega wizard miniprep plasmid isolation kit, Promega, USA) and to

sequence plasmids for confirming the genes of interest. The pGEMT-easy vectors carrying

the confirmed sequences were used to sub-clone into appropriate backbone vectors. The

resulted vectors and their use in different purposes in the project is shown in Table 2.2.

The primers in the primer set B1-B3, C2-C3, and D1-D5 and their respective

templates in the Table 2.1 were used in PCR reactions to amplify the target genes by

Taq polymerase for PCR products containing target genes with Topo-overhang. The

PCR products containing target genes with Topo-overhang were purified from agarose

gel after electrophoresis using a Freeze ‘N Squeeze DNA gel extraction spin column

(Bio-Rad) follow the manufacturer’s protocol. The purified fragments were cloned

into the pENTRTM Directional TOPO® vector (Invitrogen) in a 10 µL reaction mixture

containing 1 µL vector DNA, 1 µL of salt solution, 8 µL of purified DNA fragments

diluted in dH2O to get the insert/vector molar ratio of 3:1 in the reaction. The mixture

were incubated overnight at room temperature for 5 min. The mixture was transformed

into E. coli. The transformants were analysed by restriction enzyme analysis to identify

transformants containing the target genes. The positive transformants were further grown

to isolate plasmids and to sequence plasmids for confirming the genes of interest. The

pENTR vectors carrying the confirmed sequences were used to sub-clone into appropriate

destination vectors. The resulted vectors and their use as entry vectors in different purposes

in the project is shown in Table 2.2.


2.2.1.2 Sub-cloning by restriction enzyme digestion and ligation by T4 ligase

This method was used for generating 4 plasmid constructs used in rice

transformation and the pEAQ-436 destination vector for enhancing recombinant

osmotin production. The pGEMT vectors containing the target genes and their

corresponding backbone vectors (Table 2.2) were separately digested with appropriate

restriction enzymes. To avoid re-circulation of plasmid backbone without the cloned

insert, the phosphate group of linearized plasmid DNA 5’ ends were removed using

alkaline phosphatase enzyme (AP). One unit of AP and 1 X AP buffer was added to

the 20 µL digest reaction mixture and incubated for 40 min; after which the AP was

inactivated by incubation at 65 oC for 10 min. The digested products of pGEMT

vectors containing the target insert sequences and the backbone vectors were separated

by agarose gel electrophoresis and the target insert fragments and backbone were

separately purified using the High Pure PCR product purification kits (Roche) as per

manufacturer’s instruction. The purified DNA was quantified by a NanoDropTM 2000

spectrophotometer (Thermo scientific, USA). In the ligation reaction, using the insert:

backbone molar ratio of 3:1 with 50 ng of backbone for 10 µL reaction together with

1 X ligation buffer, 1U of T4 DNA Ligase (Promega) and topped to volume with dH2O.

The mixture was incubated overnight at 14 oC to maximize the number of ligations.

2.2.1.3 Sub-cloning by GatewayTM recombination technology

This method was used to sub-clone the target genes in the pENTR vectors into

their corresponding destination vectors (Table 2.2). In this project, the resulted

expression vectors were used in detecting of TlOsm localisation, producing

recombinant osmotins for protein chip hybridisation, and detecting protein-protein

interaction in planta. The pENTR vectors containing the target genes were digested

with appropriate restriction enzyme and fragments containing the target genes together

with the attL1 and attL2 recombination sites were purified from agarose gel after

electrophoresis using the Freeze ‘N Squeeze DNA gel extraction spin column (Bio-

Rad). The purified fragments with their corresponding destination vectors were used

in a 10 µL LR recombination reaction using Gateway LR Clonase II enzyme mix

(Invitrogen) according to the manufacturer’s protocol. After termination of the LR

reaction, each 2 µL of reaction mixture was used for E. coli transformation. All

resulted expression vectors were verified by restriction enzyme digestion and PCR


with gene specific primers. The confirmed expression vectors were then transformed

into Agrobacterium tumefaciens for expressing in plants.

Table 2.2 List of plant expression vectors constructed and used in the research

Primer

set

Name of entry

vectors

Destination

and backbone

vectors

Name of expression

vectors Purposes of uses

A1 pGEMT-TlOsm pYC27 UidA pYC-TlOsm Stably expressing TlOsm in rice

A2 pGEMT-Gus pYC27 UidA pYC-Ubi-Gus Stably expressing the GUS-reporter

gene in rice (control)

A3 pGEMT-OsOlp1_A pYC_TlOsm pYC-OsOlp1_A Stably expressing OsOlp1_A in rice

A4 pGEMT-Oslp1_I pYC_TlOsm pYC-OsOlp1_I Stably expressing OsOlp1_I in rice

B1 pENTR-EYFP pCE100 pCE100-EYFP Stably expressing EYFP in tobacco for

detecting protein localisation (control)

B2 pENTR-TlOsm pCE101 pCE101-TlOsm

Stably expressing EYFP-C-terminus-

tagged TlOsm in tobacco for detecting

TlOsm localisation

pEAQ-436 pEAQ-TlOsm Producing recombinant TlOsm for

protein chip hybridisation

pE3134 pE3134-TlOsm BiFC assay for detecting protein-

protein interaction in planta

B3 pENTR-TlOsm w

TGA pCE104 pCE104-TlOsm

Stably expressing EYFP-N-terminus-

tagged TlOsm in tobacco for detecting

TlOsm localisation

C1 pGEMT-436 pEAQ-HT pEAQ-436

Modifying backbone vector for

enhancing recombinant osmotin

production

C2 pENTR-OsOlp1_A pEAQ-436 pEAQ-OsOlp1_A Producing recombinant OsOlp1_A for


pE3134 pE3134-OsOlp1_A BiFC assay for detecting protein-


C3 pENTR-OsOlp1_I pEAQ-436 pEAQ-OsOlp1_I Producing recombinant OsOlp1_I for


pE3134 pE3134-OsOlp1_I BiFC assay for detecting protein-


D1 pENTR-AtCPK4 pE3132 pE3132-AtCPK4 BiFC assay for detecting protein-


D2 pENTR-AtCPK5 pE3132 pE3132-AtCPK5 BiFC assay for detecting protein-


D3 pENTR-AtALDH7 pE3132 pE3132-AtALDH7 BiFC assay for detecting protein-


D4 pENTR-AtMS1 pE3132 pE3132-AtMS1 BiFC assay for detecting protein-


D5 pENTR-AtPER42 pE3132 pE3132-AtPER42 BiFC assay for detecting protein-



2.2.1.4 E. coli transformation, growth in liquid culture and storage

Chemically-competent E. coli XL1 Blue cells were transformed using the heat

shock method as described by Inoue et al. (1990). A 2 µL aliquot of either T4 ligation

reaction mixture, Topo reaction mixture, or LR recombination reaction mixture in a 2-

mL tube was mixed with 50 µL of thawed competent E. coli cells and incubated on ice

for 20 min. Cells were heat shocked at 42 oC for 90 sec, immediately transferred to ice

for 2 min, resuspended in 500 µL LB media and incubated at 37 oC for 60 min on a

rotary shaker at 200 rpm for aeration. The transformant was spread onto LB agar plates

containing appropriate antibiotic and selecting agents and incubated at 37 oC

overnight. The single and well growth colonies were selected to inoculate in overnight

liquid cultures for subsequent plasmid DNA extraction.

The commercial E. coli strain ccdB minus competent cells (Invitrogen) were

used for transformation of plasmid constructs pCE100, pCE101, pCE104, and pEAQ-

436 by the same heat shock method.

E. coli liquid cultures were initiated from either single colony or from glycerol

stock and inoculated in liquid LB supplemented with appropriate antibiotics. E. coli

liquid cultures were incubated at 37 oC for up to 16 h or overnight on a rotary shaker

at 200 rpm.

For storage, an aliquot of 500 µL overnight-incubated E. coli liquid culture was

mixed with 500 µL of autoclaved 80% glycerol in an autoclaved 2-mL cryovial. The

cryovials were snap-frozen in liquid nitrogen and stored in -80 oC freezer.

2.2.1.5 Agrobacterium tumefaciens transformation, growth in liquid culture and

storage

Electro-competent cells of Agrobacterium either strain Agl1 or LBA4404 (used

for tobacco transformation) were transformed using electroporation. An aliquot of 100

µL Agrobacterium electro-competent cells was thawed on ice and 1 µL of mini-

prepped plasmid DNA was added and gently mixed by aspiration with a pipette. The

mixture was transferred into a sterile pre-chilled electro cuvette before electroporation

at 1.8 KV for 5 ms using an EC100 electroporator (Thermo EC). Cells were allowed

to recuperate in 600 µL of LB for 2 h at 28 oC on a rotary shaker at 200 rpm. A 100

µL aliquot of cells was spread on each Petri plate containing LB agar supplemented

with 25 mg L-1 rifampicin and appropriate antibiotic. The remaining cells were

centrifuged at 12,000 rpm for 1 min, discarded the supernatant, re-suspended the pellet,


and plate on another Petri plate containing the same medium and selecting agents. The

plates were incubated at 28 oC for 48 h to allow the transformed colonies to grow. The

transformed single colonies were selected for liquid cultures for verification of

transformants containing the desired plasmid.

Agrobacterium liquid cultures were initiated from either single colonies or from

glycerol stock and inoculated in liquid LB supplemented with appropriate antibiotics.

Agrobacterium liquid cultures were incubated at 28 oC for 48 h on a rotary shaker at

200 rpm. Agrobacterium liquid cultures were used for preparation of plasmid

verification, plant tissue transformation, infiltration, and storage.

Similar protocol for storage of E. coli in glycerol stock was applied to storage of

Agrobacterium.

2.2.1.6 Plasmid DNA extraction and purification

A standard alkaline lysis protocol (Sambrook et al., 2001) was used to isolate

plasmid DNA from E. coli cultures in primary cloning and from Agrobacterium

cultures for verification of bacterial clones carrying the desired plasmid constructs. A

2 mL of E. coli or 4 mL of Agrobacterium culture aliquot was centrifuged at 14,000

rpm for 1 min and the resulting pellet was resuspended in 100 µL of Solution I.

Bacteria was lysed in 200 µL of Solution II and mixed by inversion. Bacterial proteins

and chromosomal DNA were then precipitated by the addition of 150 µL Solution III

and cellular components were separated by centrifugation at 14,000 rpm for 5 min at

room temperature. Plasmid DNA was then precipitated by transferring 400 µL of the

supernatant to 1 mL of ice-cold 100% ethanol and centrifuged at 14,000 rpm for 5 min.

The pellet was washed with 70% ethanol, re-centrifuged at 14,000 rpm for 5 min,

allowed to air dry and finally resuspended in 50 µL dH2O with 10 ng mL-1 of RNaseA

(Roche).

Alternatively, the pure plasmid DNA from E. coli cultures used for sequencing

and confirming the desired expression vectors was isolated using the Wizard® Plus SV

Minipreps DNA Purification Kits (Promega) as per the manufacturer protocol. The

concentration and purity of the plasmid DNA were determined using a NanoDropTM

2000 spectrophotometer (Thermo scientific, USA).


2.2.1.7 Plasmid DNA sequencing

All sequencing reactions were performed using the Big Dye Terminator Cycle

Sequencing KitTM version 3.1 (Applied Biosystems). Each reaction contained 200 ng

of purified plasmid DNA template, 20 pmol primer, 4 µL of 5X reaction buffer and 1

µL BDTv3.1 ready mix in a final volume of 20 µL topped up with dH2O. All

sequencing PCRs used an initial denaturation at 96 oC for 1 min prior to 35 cycles of

96 oC for 10 s, 50 oC for 5 s and 60 oC for 4 min. After cycling, PCR products were

precipitated by the additional two volumes of 100% ethanol, 2 µL of 3 M sodium

acetate (pH 5.2), 2 µL of 125 mM EDTA (pH 8.0), incubation at room temperature for

30 min, and centrifugation at 14,000 rpm for 20 min. DNA pellets were washed with

500 µL of 80% ethanol and centrifuged for further 10 min at 14,000 rpm. DNA pellets

were air dried and capillary sequenced at the Molecular Genetics Research Facility

(QUT).

2.2.1.8 Restriction enzyme digestion of plasmid DNA

A reaction contained 1 µg of plasmid DNA, 5-10 U of appropriate restriction

endonuclease, specific buffer, topped up to 20 µL with dH2O. The reaction was

incubated at corresponding temperature for specific enzyme for 1 h. For double

digestion with non-compatible buffers, sequential digests were performed.

2.2.2 General methods in nucleic acid extraction, amplification and analysis

2.2.2.1 Extraction of plant total DNA

Genomic DNA from putative transgenic rice lines and WT was extracted using

the DNeasy® plant mini kits (Qiagen). Approximately 100 mg of frozen rice leaves in

a 2 mL Eppendorf containing a metal bead was frozen by immersing in liquid nitrogen

and homogenised using TissueLyser (Qiagen) at maximum frequency for 30 sec and

the tube was immersed back in liquid nitrogen. Genomic DNA was subsequently

extracted from the ground leaf samples following the manufacturer’s instruction.

Genomic DNA from transgenic tobacco leaves and T1 transgenic rice leaves was

isolated following the rapid release DNA protocol (Thomson and Henry, 1995). An

aliquot of 50 mg of frozen leaves in a 2 mL Eppendorf containing a metal bead sample

was homogenised as described above. 100 µL of ice-cold TPS buffer was added to the

tube and the tube was incubated at 95 oC for 10 min following by a quench on ice.

Proteins, pigments, and other organic compounds were extracted by adding 100 µL of


chloroform: isoamyl alcohol (24:1) to the slurry. The resulting mixture was mixed by

gently flicking and was centrifuged at 14,000 rpm for 5 min at room temperature. The

resulting aqueous supernatant (40 µL) was carefully transferred to a fresh 1.5 mL microtube.

The dilution of the supernatant in dH2O (1:5 ratio) was used in the PCR reaction (1 µL in

20 µL PCR reaction).The stock extract and dilution were stored at -20 oC.

2.2.2.2 Extraction of plant total RNA

Total RNA from roots and shoots of T. loliiformis and transgenic rice leaves was

extracted using RNeasy® plant mini kits (Qiagen). An aliquot of approximately 100

mg of frozen plant tissues was ground in liquid nitrogen using a mortar and a pestle.

The total RNA was subsequently extracted from the ground leaf samples as per

manufacturer’s instruction.

2.2.2.3 Quality and quantitative assessment of nucleic acids

The concentration and purity of isolated DNA and RNA were determined using

the NanodropTM 2000 spectrophotometer. Sample absorbance was measured at

wavelengths of 230, 260 and 280 nm. The purity of the RNA was assessed using the

ratio of absorbance at 260/280 and 260/230 nm and the samples with absorbance ratios

approximate to 2 were acceptable. For the DNA, a 260/280 of ~ 1.8 was desirable. The

total RNA was further assessed for integrity by agarose gel electrophoresis analysis with

the presence of two ribosomal RNA bands at approximately 1.6 and 2 Kbp and the

intensity of the 2 Kbp band as twice as the 1.6 Kbp band. The presence of genomic DNA

in the rapid-released extract was analysed by PCR reaction with the primer forward (5’-

CATCACAGGATTTCGGTCCT-3’) and reverse (5’AGACAAATCGCTCCACCAAC-

3’) followed by agarose gel electrophoresis with the presence of a unique band of 507 bp.

2.2.2.4 Elimination of genomic DNA from total RNA

Total RNA was treated with DNase I to eliminate any traces of genomic DNA using

an RQ1 RNase-free DNase Kit (Promega) as per manufacturer’s instructions. The treated

RNA was used as template in a PCR reaction with the primer forward (5’-

CATCACAGGATTTCGGTCCT-3’) and reverse (5’AGACAAATCGCTCCACCAAC-

3’) followed by agarose gel electrophoresis to confirm the absence of genomic DNA in

RNA samples. The presence of a 507 bp band on the gel indicated the contamination of

genomic DNA in RNA samples, whereas no amplified products indicated the absence of

genomic DNA in RNA samples.


2.2.2.5 First-strand complementary DNA synthesis

Total DNA-free RNA was reverse transcribed using an anchored-oligo (dT)20

primer to generate cDNA using the SuperScript® III First-Strand Synthesis kit

(Invitrogen) following the manufacturer’s protocol. Briefly, a two-step procedure was

followed. In the first step, 1 µg of total RNA was mixed with 1 µL of 50 mM anchored-

oligo (dT)20 primer, 1 µL 10 mM dNTP mix and topped up to 10 µl reaction volume

with nuclease-free water. The reaction mixture was incubated for 5 min at 65 oC and

placed on ice for 2 min. In step 2, a 10 µL reaction master mix containing 2 µL 10X

Reverse Transcriptase Reaction Buffer, 4 µL 25 mM MgCl2, 2 µL 0.1 M DTT, 1 µL

RNaseOUT (40 U/ µL) and 1 µL of SuperScript® III Reverse Transcriptase (200

U/µL) was added to bring the total reaction volume to 20 µL. The final reaction

mixture was incubated at 50 oC for 50 min followed by inactivation of the Reverse

Transcriptase at 85 oC for 5 min. The reaction products were chilled on ice for 5 min,

then 1 µL of RNase H was added and incubated at 37 oC for 20 min. The final reaction

products were stored at -80 oC for further gene expression analysis.

2.2.2.6 PCR amplification

PCRs were carried out using a Peltier Thermo Cycler-200 (MJ Research) using

the GoTaq® master mix (Promega) or Phusion® High-Fidelity DNA Polymerase. All

PCRs were performed in a final volume of 20 µL containing 5 pmol of each primers.

Unless otherwise stated, all PCRs were initially denatured at 94 oC for 2 min prior to

35 cycles of 94 oC for 30 s, appropriate annealing temperature for 30 s and 72 oC for

1 min per 1 Kb of expected product. A final extension step of 72 oC for 7 min was also

included.

2.2.2.7 Agarose gel electrophoresis

Unless otherwise stated, separation of nucleic acids was carried out in 1% (for

DNA) and 1.5% (for RNA or DNA fragments less than 500 bp) agarose gel in 1 X

Tris-Acetate-EDTA (TAE buffer) premixed with 0.25X SYBR SafeTM DNA gel stain

solution (Invitrogen). With the exception of PCR reaction performed with Gotaq®

master mix, 6X gel loading buffer was added to all samples before being loaded onto

agarose gel. A DNA ladder 2-Log DNA was load alongside samples for band size

comparison. Gels were run in either mini or midi-multi sub electrophoresis system

(Bio-Rad). Electrophoresis was performed at 100 V for 40-60 min and the gels were

viewed on Safe ImagerTM (Invitrogen) with a blue-light transilluminator installed in a


G:Box gel documentation system (Syngene) and documented using a computer

installed with GeneSnapTM version 6.07 image acquisition software (Syngene).

2.2.2.8 Purification of DNA from agarose gels

Restriction digested DNA or PCR products were separated by electrophoresis on

agarose gel. DNA fragments were visualised under UV light, and the fragments

corresponding to the expected size were excised from the stained gels using sterile

scalpel blades and purified using either the Freeze ‘N Squeeze DNA gel extraction

spin column (Bio-Rad) or the High Pure PCR product purification kits (Roche) as per

manufacturer’s instructions.

2.2.2.9 RT-qPCR analysis

Refer to Chapter 3

2.2.3 Agrobacterium-mediated transient transformation of plants

Agro infiltration was performed in wild type N. benthamiana for recombinant

osmotin production and for protein-protein interaction in planta analysis as well as in

transgenic tobacco plants for co-localisation analysis. A. tumefaciens strain Agl1

carrying the target plasmid was grown in a 5 mL LB medium supplemented with

rifampicin (25 µg mL-1) and appropriate antibiotic in a 50-mL Falcon tube and

incubated at 28 oC for 48 h with shaking at 200 rpm. The culture volume was increased

with LB containing the same set of antibiotic and incubated overnight at 28 oC with

shaking at 200 rpm. The bacterial cell culture was collected by centrifugation at 4000

rpm for 10 min, washed three times with infiltration medium (10 mM 2-(N-

morpholino) ethaesulfonic acid (MES), pH 5.5, 10 mM MgCl2), and resuspended with

an infiltration medium containing 200 µM acetosyringone to a concentration of OD600

= 0.8. The bacterial suspension was incubated for further 3 h with gentle shaking at

room temperature prior to infiltration. The bacteria were delivered into the underside

of leaves of 5-week-old WT N. benthamiana plants or 3-week-acclimatised transgenic

tobacco plants using a blunt tipped plastic syringe and applying gentle pressure.

2.2.4 Confocal imaging

Leaves and roots of wild-type and transgenic tissue cultured tobacco plants

expressing EYFP, TlOsm-EYFP, or EYFP-TlOsm were cut into 0.5 x 0.5 cm squares

or 0.5 cm long, washed in PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,

1.8 mM KH2PO4, pH 7.4), fixed in 4% paraformaldehyde at 4 oC for 1 h and stored in


PBS buffer at 4 oC until being viewed. Organelle protein tracker-infiltrated transgenic

tobacco leaves collected at 4-day post infiltration and leaves of infiltrated N.

benthamiana collected at 2-day post infiltration were cut into 0.5 x 0.5 cm squares and

fixed in 4% paraformaldehyde in a similar way as with tissue cultured samples. The

fixed samples were examined under A1 Confocal Microscope (Nikon, Japan). For

tissue cultured tobacco samples and infiltrated N. benthamiana samples, the green

images representing EYFP fluorescence (autofluorescence as well) were captured

under 488 nm laser channel with emission of 500-550 nm as contrast to red images

resulted from emission of chloroplast at excitation of 638 nm in a 663-738 nm

emission. For organelle protein tracker-infiltrated tobacco samples, the fluorescence

images were captured under the combination of excitation 488 nm, 561 nm (emission

of 552-617 nm) and 638 nm.

2.2.5 Relative water content (RWC)

The percentage of RWC was calculated according to Bars and Weatherley

(1962). T. loliiformis shoots and O. sativa leaves were weighed upon sampling to get

the fresh weight, FW. The shoot or leaf samples were placed 15-mL Falcon tubes

containing water overnight, botted dried with paper towel and weighed to get their

turgid weight, TW. After that, samples were dried overnight in a vacuum oven at 80

oC and weighed to get final dry weight, DW. The percentage of the RWC of samples

was calculated using the formula: RWC (%) = (FW-DW)*100/ (TW-DW).

2.2.6 Electrolyte leakage measurement

Refer to Chapter 5

2.2.7 Agrobacterium-mediated plant transformation and regeneration

Refer to Chapter 3 for tobacco transformation,

Refer to Chapter 4 for rice transformation

2.2.8 Bioinformatics analysis

Refer to Chapter 3

2.2.9 Abiotic stress treatment of T. loliiformis

Refer to Chapter 3

2.2.10 Transgenic rice acclimatisation and abiotic stress treatments

Refer to Chapter 5


2.2.11 Protein extraction, purification and analysis

Refer to Chapter 6

2.2.12 Protein microarray hybridisation and detection of protein-protein

interaction

Refer to Chapter 6

2.2.13 Data analysis

All graphs and standard errors were prepared using Microsoft Excel. Statistical

analysis of TlOsm transcriptional expression upon abiotic stresses and developmental

stages was done using BioRad CFX ManagerTM software. Genetic relationship of

TlOsm with other osmotins was analysed by default program in MEGA 7 software

(refer to Chapter 3). Growth and physiological parameters of transgenic rice were

analysed using ANOVA and significant differences among experimental treatments

were analysed by Tukey’s HSD tests (Arend, 2010; refer to Chapter 5). Statistical

analyses used for significant protein interactors of the three osmotins, gene ontology

(GO) term enrichment of the protein sets, and significant pathways involving the

osmotins were the default programs of indicated software and web servers (refer to

Chapter 6).

Chapter 3: Molecular Characterisation of TlOsm, an Osmotin from Tripogon loliiformis 61

Chapter 3: Molecular Characterisation of

TlOsm, an Osmotin from

Tripogon loliiformis

Chapter 3 starts with an introduction to the first objective of this research project

which includes the identification of novel and conserved characteristics of TlOsm,

examination of expression profile of TlOsm upon major abiotic stresses and during

developmental stages, and determination of TlOsm sub-cellular localisation. Section

3.2 briefly describes the materials and methods used to achieve the goals of this

objective. Section 3.3 presents the identified novel and conserved characteristics of

TlOsm, the expression profile of TlOsm upon abiotic stress and developmental stages,

the sub-cellular localisation of TlOsm. The discussion of the results and findings in

this objective is presented in Section 3.4.

3.1 INTRODUCTION

Abiotic stresses have been identified as the key limiting factor on agricultural

production (Mittler and Blumwald, 2010). Rising food demand due to increasing

global population is another challenge for future agriculture. Couple together,

changing climate and increasing population undoubtedly pose a significant threat to

agricultural production in meeting the global food demand. It has been estimated that

agricultural production must be increased by at least 60% globally and doubled in

some particular regions to fulfil the global food demand by 2050 (FAO, 2016).

Progresses made by genetic improvement and agricultural resource management

during the last century have significantly contributed to sustaining current food needs.

To meet the needs for future food, agricultural productivity need to be constantly

increased and that can only be achieved by both genetic improvement and sufficient

management of agricultural production system. However, the current trends in yield

improvement of major crops were not sufficient for future food demand (Ray et al.,

2013). While crop yield progress made by conventional breeding reaches plateau and

is unable to keep pace with the target crop production, the production of biotechnology

together with genetically-engineered crops would be potentially filling the gap (Oliver,

2014). The abilities of more rapid and precise genetic improvement and transfer genes

62 Chapter 3: Molecular Characterisation of TlOsm, an Osmotin from Tripogon loliiformis

across species barriers have made genetic engineering an attractive tool to achieve the

desired traits in crops to gain necessary yield sustainable in the near future.

There is a great need to identify the key factors contributing to genetic engineering

applications for steadily increasing crop production under predicted adverse climate

conditions. Characterisation of stress-responsive genes is necessary for utilisation in

genetic engineering to generate enhanced crops that can cope with stresses and in

return of favourable conditions they continue to grow and gain maximum yield. It has

been suggested that the introduction of stress-responsive genes from stress-adapted

species to crops might enable them to withstand more extreme abiotic stresses (Mittler

and Blumwald, 2010). Resurrection plants, such as T. loliiformis, possess unique

tolerant mechanisms in their vegetative tissues enable them to survive dehydration to

air-dried state and restore full physiological activity and growth upon several days of

rehydration (Dinakar and Bartels, 2013; Gaff and Oliver, 2013; Karbaschi et al., 2016).

Therefore, resurrection plants represent an ideal genetic resource for seeking genes

encoding for unique stress-adaptive mechanisms allow plants to survive extreme stress

conditions.

Identification of key upstream regulators of stress adaptation and use of these for

enhancing abiotic stress tolerance are believed to be more effective in genetic

engineering approach (Mittler and Blumwald, 2010; Cominelli et al., 2013). Among

the genes isolated from a drought-induced cDNA library of T. loliiformis at the Centre

for Tropical Crop and Biocommodities (CTCB), Queensland University of

Technology (QUT), TlOsm was one of the candidate genes for use in developing

enhanced abiotic stress tolerant crops. Plant osmotins have been found to be the key

proteins associated with plant response to abiotic and biotic stresses. As discussed in

Section 1.3, osmotin genes have been identified and characterised from many plant

species and demonstrated to have multi-functions in plant response to abiotic and

biotic stresses. Expression of osmotins has been used to generate a number of

transgenic plants tolerant to drought, high salinity, cold, fungal pathogens and some

combinations of these (see Table 1.1 for phenotype of transgenic osmotin plants and

references). There have been progressive evidence showing osmotin roles as key

regulators in plant defense response. However, no such osmotin from the resurrection

plants, particularly in T. loliiformis, has been characterised.


The aim of this research was to identify the novel and conserved characteristics of

TlOsm, an osmotin from the resurrection plant T. loliiformis. The specific objectives

of this chapter were to:

1. Identify the novel and conserved characteristics of TlOsm

2. Examine the transcriptional expression profile of TlOsm upon major abiotic

stresses and during developmental stages.

3. Determine the sub-cellular localisation of TlOsm.

3.2 MATERIALS AND METHODS


Seeds of T. loliiformis were propagated though multiple generations in

glasshouse conditions, air dried at room temperature, and stored at 4 oC. These seeds

were used to germinate plants for examining the transcriptional expression of TlOsm

under major abiotic stresses and developmental stages.

Tobacco plants as described in Section 1.1.1 were used for generation of

transgenic tobacco plants expressing EYFP-tagged TlOsm and EYFP control.

3.2.2 Sequence analysis of TlOsm

The nucleotide sequence of TlOsm was translated at the ExPASY translation tool

(Gasteiger et al., 2005). Hydropathy profile of TlOsm based on Kyle & Doolittle

scale was performed using the ExPASY Proscale. Molecular weight of TlOsm was

calculated using the ExPASY Compute pI/Mw tool. Physicochemical properties of the

protein were obtained from the ExPASY ProtParam. Disulfide bridges were predicted

on the ExPASY ProSite. The BLAST program of the National Centre for

Biotechnological Information (NCBI) was used to search the sequences with similarity

to TlOsm. Multiple sequence alignment of TlOsm with other selected osmotins was

done using the T-coffee program (Tommaso et al., 2011) using the ClustalW method.

To predict the signal peptide and cleavage site, SignalP server and TargetP 1.1 server

were used (Emanuelsson et al., 2007). Subcellular localisation of TlOsm was

predicted in the WoLF PSORT server (Horton et al., 2007), the SMART program

(Schultz et al., 1998), and the MEMSAT server (Buchan et al., 2010). SUMOylation

sites of TlOsm was predicted using SUMOsp server (Xue et al., 2006).


3.2.3 Phylogenic tree construction

Amino acid sequences of 39 osmotins and OLPs were obtained from the NCBI

Protein Bank. Among these, 20 sequences originated from dicots that had been well–

characterised and functionally validated and 19 sequences originated from monocot

that had evidences of expression upon stress. The entire phylogenetic analysis was

performed in MEGA 7 software. The amino acid sequence of TlOsm and 39 above-

mentioned proteins were aligned using the ClustalW with all default settings for

protein weight matrix. This alignment was used as input data for phylogenetic tree

construction. The tree was constructed by the Maximum Likelihood method with all

default settings and the JTT model method (Jones et al., 1992). The gaps/missing data

were treated by partial deletion with site coverage cutoff 95%. The phylogeny was

treated by Bootrapping with 1000 replications.

3.2.4 Comparison of TlOsm with Os-OlP1_A and OsOlp1_I by bioinformatic

tools

The sequence similarities of the three osmotins were compared and aligned using

the ClustalW method of the T-coffee program (Tommaso et al., 2011). All the methods

for signal peptide identification, protein localisation, SUMOylation site predictions

applied for TlOsm (Section 3.2.2) were also applied for OsOlp1_A and OsOlp1_I.

The active binding residues of the three osmotins were determined by submitting the

three corresponding sequences to the I-TASSER for protein 3-D structure modelling

and function predictions (Zhang, 2008; Roy et al., 2010). After receiving the packages

from the server, the number one model suggested by the server of each osmotin was

used for determine the active binding residues (also indicated for each model by the

server) (Yang et al., 2015) and for comparison. Similarly, the sequences of the three

osmotins were submitted to the GPS web server (Xue at el., 2005) and SUMOsp for

prediction of potential phosphorylation sites and SUMOylation sites respectively.

Then, the functional site comparison were made based on the results provided by these

servers.

3.2.5 Growth conditions, abiotic stress treatments and sampling for T. loliiformis

plants

Seeds of T. loliiformis were germinated and grown in 50-mL pots in glasshouse

at 27 oC and 16 h photoperiod until stress treatments were applied and samples were

taken. For cold stress, 6-week old plants were placed in a cold room at 4 oC for 24 h


with 16 h light and 8 h dark conditions; then the cold-stressed plants were recovered

in the glasshouse. Samples were taken at 0, 1, 3, 6, 9, 12 and 24 h during stress and 48

h after recovery (72 h post initial stress). For heat stress, plants were grown at 45 oC

in a growth chamber in a similar way as cold stress and samples were taken at the same

time-points as cold stress. For salinity stress treatment, 6-week old plants in plastic

pots were first treated with 200 mM NaCl solution when the leaf relative water content

(RWC) was about 85% and the second treatment was 48 h later in a manner that the

potting mix was saturated by NaCl solution and the exceeded NaCl solution was

absorbed by paper towel placed underneath the pots. After 96 h and two 200 mM NaCl

solution applications, salt solution was washed off from potting mix by submerging

the pots in water and draining off for 5 times (change water every time). Plants were

led to recover and were watered with a 2-day interval until the data collection for

recovered plants completed. Salinity stress samples were taken at 0, 1, 3, 6, 12, 24, 48

and 96 h after salt treatment and 1 and 5 days after recovery. Previous to drought stress

treatment, the morphological changes in shoots of T.loliiformis plants corresponding

to specific leaf RWC (80, 70, 60, 40 and < 10%) were determined. In drought stress,

40-day old plants were fully watered in the late afternoon and the fully-hydrated

samples were taken in the morning of the next day. Plants were then challenged by

withholding water for a period of time until the leaf RWC reached the pre-determined

points. Then the plants with <10% RWC were re-watered with a 2-day interval for

recovery. Samples were taken at full hydration, 80, 70, 60, 40, <10% RWC and 24 and

72 h after re-hydration. In sampling for different developmental stages, plants were

sampled at 2, 4, 6, 8 and 10 weeks post germination. For the drought stress, 8 pots of

multiple plants were collected for each RWC point and RWC was determined for

plants in each pot based on randomly-selected 15 leaves. For the remaining

experiments, four pots of multiple plants were collected for each stress or

developmental time-points. Each pot was considered as one biological replicate.

Leaves and roots of the above stress-treated plants and the corresponding controls

sampled at different stress time-points and developmental stages were snap frozen in

liquid nitrogen and stored at -80 oC for RNA extraction.

3.2.6 RNA extraction and RT_qPCR analysis

Total RNA was extracted from 100 mg of shoot or root samples using the

methods described in Section 2.2.2.2. Genomic DNA in the total RNA samples was


eliminated as in Section 2.2.2.4. cDNA was synthesized from 1 µg of total RNA in a

25 µl reaction using the methods described in Section 2.2.2.5. The synthesized cDNA

was used as templates in PCR assay using a specific pair of primers that yields

distinguish amplicons from T. loliiformis cDNA and genomic DNA to confirm the

complete elimination of genomic DNA in each of cDNA samples. Real-time RT-PCR

was performed on an optical 384-well plate with a BioRad CFX 384TM Real-time PCR

system using SYBR premix (BioRad) according to the manufacturer’s protocol and

TlOsm specific primers forward (5’- CTGCAAGCCGTCGCAGTACT-3’) and reverse

(5’-AGGTGATGGCGTAGGTGGTGT-3’). The T. loliiformis Actin1 and Ubi10

genes were used as internal references. The PCR thermal cycling protocol was as

follows: 95 oC for 10 s, followed by 40 cycles at 95 oC for 5 s and 60 oC for 30 s.

BioRad CFX ManagerTM software was used for data analysis. The RT-qPCR products

with highest, medium and lowest levels of TlOsm expression were ligated into

pGEMT-easy vector (Invitrogen) and transformed into E. coli. Five individual E. coli

colonies were randomly selected from each RT-qPCR product for sequencing to

confirm the same amplicons of TlOsm.

3.2.7 Generation of transgenic tobacco expressing EYFP-tagged TlOsm and VC

3.2.7.1 Plasmids for tobacco transformation

Three plasmids pCE101-TlOsm, pCE104-TlOsm, and pCE100-EYFP

constructed by the methods described in Section 2.2.1 were used for tobacco

transformation. The gene expression cassette between left and right borders of these

plasmids are shown in Figure 3.1.

Figure 3.1 Schematic diagram of gene constructs for expressing EYFP-tagged TlOsm

and EYFP control in N. tabacum


3.2.7.2 Agrobacterium-mediated transformation of tobacco

N. tabacum transformation, selection and regeneration were performed by leaf

disc transformation as described by Clemente (2006). Leaves from 4-6 week-old N.

tabacum plants germinated in vitro and cultured at 16 h photoperiod, 25 oC, and

moderate light were used as target tissues for transformation. The day before

transformation, Agrobacterium carrying the pCE-100-EYFP, pCE-101-TlOsm and

pCE-104-TlOsm plasmids stored in glycerol were cultured overnight in LB medium

(100 µl of bacterial stock in 10 ml of liquid LB). On the day of transformation,

agrobacterial overnight cultures were diluted in inoculation medium containing full

strength MS salts and 3% sucrose to get the OD600 of 0.1. Leaf discs about 1 cm in

diameter were punched from fresh leaves, immersed in diluted bacterial suspension

for 10 min with well agitation 3 times, blotted on filter paper and placed upside down

on co-cultivation medium in Petri plates. These plates were incubated for 1 day at 25

oC in darkness. The infected leaf discs were washed 3 times with autoclaved water

containing 200 mg L-1 timentin and cultured on Petri plates containing 30 mL of

selection medium (full-strength MS salts and vitamins, 30 g L-1 of sucrose, 1 mg L-1 of

NAA, 3 mg L-1 of BA, 8 g L-1 of agar, 200 mg L-1 of timentin and 25 mg L-1 of

hygromycin, pH 5.7). These plates were placed in the growth room with 16 h

photoperiod, 25 oC, and moderate light and frequently subcultured at 2 week intervals

until shoot formation. For each plasmid construct, 10 plates of 10 leaf discs per plate

were used in transformation.

3.2.7.3 Selection and regeneration of transgenic tobacco plants

Shoots just emerged from calli induced by leaf disc after 3 subsequent selections

in Petri plates were scanned under fluorescent microscope (Zeiss SteREO Lumar

V.12). The well-defined stem shoots expressing EYFP, which was not observed in

WT, were transferred into selection rooting medium containing 1/2 strength MS salts,

200 mg L-1 of timentin and 25 mg L-1 of hygromycin. For each plate, 5 strongest shoots

were selected from 5 different leaf discs to ensure independent lines. Rooted plantlets

were scanned under fluorescent microscope to ensure the EYFP expression in both

root and shoot of plants. Well-rooted plantlets constitutively expressing EYFP were

subjected for molecular characterisation of the transgenes. When the transgenic status

were confirmed, plants were in vitro multiplied, subjected for analysis and

acclimatised in the controlled growth room.


3.2.7.4 PCR confirmation of transgenes in regenerated transgenic tobacco

PCR analysis was used to confirm the presence of TlOsm and EYFP genes in

EYFP expressing tobacco plants. Two WT and 12 normal-looking plants transformed

with each plasmid construct were chosen. Genomic DNA from 38 tobacco leaf

samples was isolated by following rapid protocol (Thomson and Henry, 1995) with a

minor modification as described in Section 2.2.2.1. The presence of DNA in 38 rapid-

released extracts were confirmed by PCR using Musa 18Sr primers (Table 3.1). For

PCR and agarose gel electrophoresis, refer to methods as described in Section 2.2.2.6

and 2.2.2.7.

Table 3.1 List of primers for PCR characterisation of transgenic tobacco plants

Gene Primer sequence (5’-3’) Annealing

temperature (oC)

Amplicon

size (bp)

TlOsm TGGCCGAGTTCACCATGGAC

AGGTGATGGCGTAGGTGGTGT 60 405

EYFP CACCATGGTGCCTAGCGTGACCAAGG

TTAAGCGTAATCTGGAACATCG 50 838

Musa 18Sr CATCACAGGATTTCGGTCCT

AGACAAATCGCTCCACCAAC 56 507

3.2.8 Agro-infiltration of transgenic tobacco

The binary plasmid Pm-rk CD3-1007 (Nelson et al., 2007) carrying the

mCherry-tagged protein targeting plasma membrane was used for co-localisation

analysis. A. tumefaciens strain Agl1 carrying the plasmid were grown, prepared, and

infiltrated into acclimatised transgenic tobacco plants expressing either EYFP,

EYFP:TlOsm, or TlOsm: EYFP by the methods described in Section 2.2.3.

3.2.9 Salinity stress treatment of tobacco plants

Tissue cultured transgenic tobacco plants were placed in autoclaved pots

containing autoclaved half-strength MS medium with vitamins supplemented with 150

mM NaCl solution until the solution surface reached 1 cm above the root collar. Pots

were placed in growth chamber with conditions as for tissue culture tobacco plants for

24 h. Roots of treated plants were used for preparing fixed samples in confocal analysis

of TlOsm localisation under salinity stress as described in Section 2.2.4.


3.2.10 Confocal imaging

Refer to Section 2.2.4

3.3 RESULTS

3.3.1 Sequence analysis of TlOsm

3.3.1.1 TlOsm belongs to Thaumatin-like protein (TLP) superfamily but has a

non-homologous C-terminal sequence

Osmotin, OLP, and TLP are relatively low-molecular-weight proteins that plants

produce in response to abiotic and biotic stresses (Liu et al., 2010). TlOsm was

previously isolated from a T. loliiformis drought-induced cDNA library (unpublished,

Williams). The full-length TlOsm cDNA encoded a protein consisting of 313 amino

acids (AA). Its molecular weight was estimated to be 31 kDa. The BLAST search on

the NCBI database revealed it to be homologous to those of a GH64-TLP_SF

superfamily (osmotin, OLP, and TLP proteins) with a high similarity at its 26-252 AA

sequence. The protein has 8 predicted disulfide bridges, which are conserved across

osmotins, formed by 16 cysteine residues. Its theoretical pI is 4.75. To compare the

TlOsm AA sequence with other osmotins, the five selected osmotin AA sequences,

which were well characterised and validated to have roles in plant stress tolerance,

were aligned with TlOsm. The alignment showed high identity only between N-

terminus to AA 252 of TlOsm AA sequence (Figure 3.2). TlOsm sequence of AA

253-313 was not found homologous to other proteins in the database.


Figure 3.2 Alignment of TlOsm with selected plant osmotins. Arabidopsis thaliana

(accession number NM117234.2), Capsicum annuum (AY262059), Glycine max

(NM001249476.1); Nicotiana tabacum (X65701.1); and Solanum nigrum (AF450276.1), as

in order from the top. The identical amino acid are indicated as *. The 16 conserved Cysteines

among osmotins are boxed. Multiple alignment was done in the T-coffee program

(http://www.ebi.ac.uk/Tools/msa/tcoffee/) using the ClustalW). Arrow indicates the signal

peptide of TlOsm.

The hydropathy profile showed that TlOsm is highly hydrophobic at the N- and

C-terminus and is neutral in the middle of its sequence (Figure 3.3 A). It was predicted

that TlOsm has a 24 AA N-terminal signal peptide with a cleavage site between Ser

and Lys. Following cleavage of the signal peptide, TlOsm molecular weight was

http://www.ebi.ac.uk/Tools/msa/tcoffee/


estimated to be 28.76 kDa with a pI of 4.60. A transmembrane α-helix at its AA

sequence 294-309 determines TlOsm to be an integral transmembrane protein type I

(Figure 3.3 B).

Figure 3.3 Property analysis of TlOsm. A: Hydropathy profile of TlOsm based on Kyte

& Doolittle scale was performed at http://web.expasy.org/protscale/. B: Sub-cellular

localisation prediction of TlOsm using MEMSAT server

(http://bioinf.cs.ucl.ac.uk/psipred/?memsatsvm=1)

http://web.expasy.org/protscale/

http://bioinf.cs.ucl.ac.uk/psipred/?memsatsvm=1


3.3.1.2 TlOsm is closely related to osmotins of monocotyledonous plants

To gain an understanding of the genetic relationship of TlOsm and other plant

osmotins, a phylogenetic tree was generated for TlOsm with other osmotin sequences,

19 from monocotyledonous plants and 20 from dicotyledonous plants (Figure 3.4).

The respective sequences were grouped in two distinct clades. All sequences from

dicotyledonous plants formed one clade and the other clade grouped by those of

monocotyledonous plants. The clade of monocotyledonous osmotins had two sub-

groups, with TlOsm grouped to a sub-group containing the majority of sequences (15

sequences). TlOsm AA sequence was found to be closest to the osmotins of Setaria

italica (foxtail millet).


Figure 3.4 The phylogenic tree showing the relationship of TlOsm and osmotins from

different monocotyledonous and dicotyledonous species.

Only the complete published sequences of osmotin and osmotin-like proteins were selected

including 20 sequences from dicotyledonous species and 19 sequences from

monocotyledonous species. The amino acid sequences were obtained from the NCBI Protein

bank with accession number indicated. Entire phylogenetic analysis was performed in MEGA

7 software. Alignment of 40 sequences was done using the ClustalW. The tree was constructed

by the Maximum Likelihood method with all default settings. The gap/missing data were

treated by partial deletion with site coverage cutoff 95%. The phylogeny was tested by

Bootstrapping with one thousand replications. Arrow indicates the position of TlOsm. Two

rice osmotins used to compare with TlOsm in this study were boxed: the sequence in red box

from the drought-tolerant cultivar Apo and the sequence in blue box from the drought-sensitive

cultivar IR 64.


3.3.2 TlOsm is induced by cold, drought and salinity stresses

Determination of critical sampling time-points is necessary for examining the

expression pattern of TlOsm during developmental stages. To determine the time-

points for sampling, the life cycle of T. loliiformis plants in controlled glasshouse

conditions was first observed. T. loliiformis plants started tillering at about 4 weeks

after germination and reached maximum density at 6 weeks. The plants started

flowering at week 7 and in week 8, all of them were bearing flowers. Their seeds were

all filled at week 10 and could be harvested at week 12. The plants completed their life

cycle at about 12-14 weeks after germination. Therefore, five time-points including 2-

, 4-, 6-, 8- and 10-week post germination were determined for examining TlOsm

expression during developmental stages (Figure 3.5). Then, transcriptional expression

of TlOsm during developmental stages was determined on these five time-point

samples. The expression of TlOsm remained unchanged in shoots during development

(Figure. 3.6 A) but was found at higher level in roots only at 6-week post germination

(Figure 3.6 B).

Figure 3.5 Developmental stages of T. loliiformis for sampling. Time-points indicated as

weeks after germination. Plants at 6 weeks were used for all stress treatments


To determine the expression profile of TlOsm in response to abiotic stresses, the

6-week old plants were separately exposed to four major abiotic stresses including cold

(4 oC), heat (45 oC), salinity (200 mM NaCl) and drought. Samples were collected at

different time-points during the course of stress as indicated in the graphs in Figure

3.6 and analysed by RT-qPCR. TlOsm was down-regulated in shoot within first 12 h

exposure to heat stress, then went up to the level before stress at 24 h and during

recovery (Figure 3.6 C); while its expression levels in root remained unchanged during

the course of heat stress and recovery (Figure 3.6 D). In response to cold stress, TlOsm

was rapidly and transiently activated in both roots and shoots after only 1 - 3 h of

treatment, then went down to normal levels after 6 h in shoots (Figure 3.6 E) and down-

regulated during 6 - 24 h of stress in roots (Figure 3.6 F). Under drought stress, TlOsm

expression was similar in shoots and roots that was sharply induced at 80% RWC,

reached a peak at 70% RWC, and remained high levels at 60% RWC (Figure 3.6 G &

H). The different response of roots and shoots in drought stress was found at 40-10%

RWC where TlOsm transcripts went down to level of before stress in shoots (Figure

3.6 G) but remained significantly higher than unstressed levels in roots (Figure 3.6 H).

TlOsm was rapidly and sharply activated upon exposure to salt stress in roots, reached

thousand fold after only 1 h of stress treatment and remained significantly high levels

within 12 h of salt stress (Figure 3.6 G). The activation in shoots was slower (started

at 3 h), at lower levels, but lasted longer (until 96 h of stress) as compared to that in

root (Figure 3.6 I).

Together, this investigation showed that TlOsm gene expression is sharply

activated at early stages of osmotic stress (cold, drought, and salinity) in both roots

and shoots of T. loliiformis. In plant recovery from all four types of abiotic stresses,

the expression of TlOsm remained unchanged as compared to pre-stress levels for both

roots and shoots.


Figure 3.6 Expression of TlOsm under developmental stages and various abiotic stresses.

Type of tissues and stresses are indicated. Sampling time-points during developmental stages

expressed as weeks post-germination. Six week old T. loliiformis plants were subjected to cold

(4 oC), heat (45 oC), salt (200 mM NaCl) and drought (withholding the water supply from the

plants) stresses. The transcript expression levels were determined by RT-qPCR and

normalized to the Actin and Ubi endogenous controls. Values represent means + SE of three

biological replicates x 3 technical replicates (* indicates significant differences at P ≤ 0.05).

Sequencing data from RT-qPCR products of the highest, medium, and lowest expression levels

confirmed single product of TlOsm.


3.3.3 TlOsm localises to the plasma membrane

To gain insights into the function of TlOsm, its subcellular localisation was

analysed. Predictions by bioinformatics tools suggested membrane localisation for

TlOsm (Figure 3.3 B). To validate the subcellular localisation of TlOsm in planta,

transgenic tobacco plants stably expressing EYFP-tagged TlOsm were generated and

transgenic plants were subjected to confocal laser scanning analysis.

3.3.3.1 Generation of transgenic tobacco stably expressing EYFP-tagged TlOsm

TlOsm was tagged with EYFP at its either C- or N-terminus together with EYFP

control (vector control, VC), these three gene constructs (Figure 3.1) were stably

transformed in N. tabacum by Agrobacterium-mediated transformation using leaf disc

method (Clemente, 2006). After 3 cycles of culture in fresh selective media, newly

emerging shoots expressing EYFP (Figure 3.7 A) were selected for further regeneration.

When plants were fully regenerated, their roots were scanned for the expression of

EYFP, which was not seen in WT, to confirm plants expressing EYFP (Figure 3.7 B).

Figure 3.7 Fluorescence-based selection of transgenic tobacco expressing EYFP-tagged

TlOsm and VC. A: representatives of newly emerging shoots expressing EYFP selected for

regeneration. B: representative of regenerated plant roots expressing EYFP. Type of under-

expressing genes are indicated.


When the EYFP-expressing status of tobacco plants was confirmed, 12 lines

with normal-looking morphology transformed with each gene construct and 2 WT

plants were selected for PCR analysis of transgene presence. The presence of DNA in

rapid-released DNA samples were confirmed by using the Musa 18Sr primers in PCR

reactions. All 38 samples showed the presence of genomic DNA, including 12

TlOsm:EYFP plants (Figure 3.8 A), 12 EYFP:TlOsm plants (Figure 3.8 B), 12 EYFP

plants (Figure 3.8 G) and 2 WT plants (Figure 3.8 A & B). The presence of TlOsm

gene in the plants transformed with EYFP-tagged TlOsm was shown in Figure 3.8 C

& E. Similarly, the presence of EYFP gene in EYFP expressing plants but not in WT

plants was confirmed (Figure 3.8 D, F & H).

Figure 3.8 Confirmation of stable transgene integration in transgenic tobacco by PCR. The presence of DNA in rapid-released DNA solutions of WT1 and 12 TlOsm:EYFP plants

(A) WT2 and 12 EYFP:TlOsm plants (B) and EYFP plants (G). The presence of TlOsm gene

in TlOsm:EYFP plants (C) and EYFP:TlOsm plants (E). The presence of EYFP gene in

TlOsm:EYFP plants (D), EYFP:TlOsm (F), and EYFP plants (H). ML: molecular ladder, P:

positive control-plasmid DNA, N: negative control, Kb: kilo base pair.


3.3.3.2 TlOsm localised to the plasma membrane in unstressed conditions

To examine the subcellular localisation of TlOsm, confocal laser scanning

microscopy was used for leaf samples of tissue-cultured transgenic N. tabacum plants.

As shown in Figure 3.9, in the EYFP-tagged TlOsm plants, the fluorescence was

surrounding the cell borders of leaf cells. However, in N. tabacum cells expressing

EYFP alone, the fluorescence was distributed throughout the cell.

Figure 3.9 Cellular localisation of TlOsm. A: leaf tissues expressing EYFP, B: leaf tissues

expressing TlOsm:EYFP, C: leaf tissues expressing EYFP:TlOsm. The wavelengths captured

the images are indicated. Fitc light channel captures the EYFP fluorescence, Cy5 light captures

red fluorescence of chlorophyll (where green autofluorescence emitted), bars 10 µm.

To confirm the localisation of TlOsm, a positive control for a plasma

membrane-localised protein, a fusion construct of AtPIP2 with red fluorescent protein

mCherry (Nelson et al. 2007), was agro-infiltrated into leaves of acclimatised

transgenic N. tabacum expressing EYFP tagged TlOsm and EYFP control. As shown

in Figure 3.10, the EYFP-tagged TlOsm in both C- and N terminus co-localised with


the plasma membrane protein marker as shown by the overlap of red and yellow

fluorescence (Figure 3.10 B & C). The distribution of yellow fluorescence in cells

expressing EYFP alone was throughout the cells and the overlap with red fluorescence

pattern was not observed (Figure 3.10 A). These results confirmed the localisation of

TlOsm to the plasma membrane.

Figure 3.10 Subcellular co_localisation analysis of EYFP-tagged TlOsm and EYFP in

N. tabacum. Confocal microscopy images of leaf tissues co-expressing plasma membrane

protein tracker AtPIP2A-mCherry with (A) EYFP, (B) EYFP:TlOsm, and (C) TlOsm:EYFP

are shown. Images taken under Fitc light channel (488nm) captured green and EYFP

fluorescence, Tritc (561 nm) captured plasma membrane tracker AtPIP2A-mCherry (and some

photosynthesis pigments as well), Cy5 (668 nm) captured red fluorescence of chlorophyll

(where auto-fluorescence and photosynthesis pigment emitted). Bars 10µm.

3.3.3.3 Localisation of TlOsm remains unchanged under salinity stress

It has been evidenced that some stress-responsive proteins containing

SUMOylation motifs translocate during stress conditions in order to perform their

functions (Johnson, 2004). Two SUMOylation motifs were predicted to be present in

TlOsm AA sequence, suggesting that TlOsm protein might translocate under stress

conditions. To determine if TlOsm localises differently under unstressed and stressed


conditions, tissue cultured plants expressing EYFP, EYFP:TlOsm, and TlOsm:EYFP

were stressed by culture in liquid medium supplemented with 150 mM NaCl for 24 h.

Then, roots of these plants were subjected to confocal laser scanning analysis. As

shown in Figure 3.11, fluorescence distributions in the cells were the same for plants

that had undergone unstressed and 150 mM NaCl stress treatments for all EYFP,

EYFP:TlOsm, and TlOsm:EYFP samples. The results indicated that localisation of

TlOsm was unchanged under salinity stress.

Figure 3.11 Localisation of EYFP-tagged TlOsm and EYFP in transgenic N. tabacum

cells under unstressed and 150 mM NaCl stress. Confocal microscopy images of root tissues

expressing (A) EYFP, (B) EYFP:TlOsm, and (C) TlOsm:EYFP under unstressed (first

column) and 150 mM NaCl stress treatment (the second and third columns). Images taken

under Fitc light channel (488nm) captured green and EYFP fluorescence. Bars 10µm

3.3.4 TlOsm, OsOlp1_A and OsOlp1_I differ in active binding residues

OsOlp1_A and OsOlp1_I were isolated from drought-tolerant cultivar (Apo) and

drought-sensitive cultivar (IR 64) of the stress sensitive species O. sativa. The two

genes share 96% similarity in their encoded AA sequences but found differentially

expressed upon drought. Thus, their only 10 AA difference must make the differences

of their response to drought. To gain insights the functions and mechanisms of TlOsm

and possible differences between osmotins from tolerant vs. sensitive species as well


as from tolerant vs. sensitive cultivars within species in plant abiotic stress response,

these two genes were incorporated in all the experiments for validating the role of

TlOsm in biological system. Functional predictions for the three proteins were carried

out using bioinformatic tools, as described in Section 3.2.4. Some of the characteristics

in relevant to stress response of plant genes, which were different among the three

proteins, are presented in Table 3.2.

Table 3.2 Characteristics of TlOsm, OsOlp1_A, and OsOlp1_I by functional

predictions (numbers indicate the number of binding sites)

Characteristics TlOsm OsOlp1_A OsOlp1_I

Localisation Plasma

membrane

ER or

chloroplast Apoplast

SUMOylation motifs 2 3 3

Glucan-endo 1,3-beta-D

glucosidase 8 5 2

Isoamylase activity 1 0 0

Cellulase activity 1 0 0

Chondroitin AC lyase activity 1 0 0

Beta-fructofuranosidase activity 1 0 0

Serine/threonine type

phosphorylation residue 55 14* 14*

Tyrosine type phosphorylation

residue 9 1 1

(*) the same number of residues but different in one site: Ser142 in OsOlp1_A and Thr144

in OsOlp1_I

The predictions showed the difference in the localisation, SUMOylation motifs,

and active binding residues of the three proteins. Glucan hydrolysis and

phosphorylation have been proposed to be functions of osmotins in response abiotic

and biotic stresses. TlOsm was predicted to have more glucan binding residues and

potential phosphorylation sites than 2 rice osmotins. OsOlp1_A has more glucan-

binding residues than OsOlp1_I. Even OsOlp1_A and OsOlp1_I has the same

number of potential phosphorylation residues, one site was found different in their

protein sequences (Appendix B-Figure 1; Appendix B-Table 1). Four binding residues

of the four enzymes (Isoamylase, Chondroitin AC lyase, Cellulase, and Beta-

fructofuranosidase) responsible for break down carbohydrate into small sugar

molecules such as monosaccharide or disaccharide only present in TlOsm (Appendix


B-Figure 2). These differences may provide the key mechanism in the functions of

these osmotins.

3.4 DISCUSSION

Osmotins and OLPs belong to the pathogenesis-related PR-5 family and have

been shown to be a key protein associated with osmotic adjustment in plants. Large

numbers of osmotins and OLPs have been characterised from diverse plant species. In

addition, numbers of transgenic crops expressing osmotins and OLPs have

demonstrated enhanced tolerance to abiotic and biotic stresses (D'Angei and Altamura,

2007; Goel et al., 2010; Subramanyam et al., 2011; Subramannyan et al., 2012; Patade

et al., 2013). However, no osmotin from a desiccation tolerant species such as the

resurrection plant T. loliiformis has been characterised. Resurrection plants possess a

unique ability to tolerate severe water deficit in vegetative tissues and represent a

potentially rich source of genes conferring tolerance to abiotic stresses (Mundree et

al., 2002; Ingle et al., 2007; Williams et al., 2015; Karbaschi et al., 2016). In this study,

we characterised an osmotin gene from T. loliiformis. The common and novel

characteristics, transcriptional expression profile under various developmental stages

and abiotic stresses, and the subcellular localisation of TlOsm were revealed. In

addition, the predictions on proposed functional characteristics of TlOsm were made

and compared with two rice osmotin genes, which were further incorporated in

functional validation of TlOsm. Results from this study suggest the involvement of

TlOsm in plant response to multiple stresses including cold, drought and salinity.

3.4.1 TlOsm is a member of osmotins and OLPs

Osmotins and OLPs have been characterised in many monocotyledonous and

dicotyledonous plant species. Thus, a large number of partial and complete sequences

of osmotin are available in the NCBI database. A BLAST search of the database

revealed that the AA sequence of TlOsm has high similarity to osmotins and OLPs at

its 26-252 AA sequence only. TlOsm has the conserved characteristics of an osmotin

or OLP such as 16 cysteine residues that form 8 disulfide bonds, N-terminus signal

peptide, and a protease cleavage site. However, the alignment of TlOsm AA sequence

with other five osmotins that were well characterised and validated to have roles in

plant stress tolerance revealed the identities up to 54% (Figure 3.2). Hydrophobic

nature, which has shown in common of an osmotin and made it difficult for


recombinant osmotin production, was also shown in TlOsm (Figure 3.3).

Phylogenetic analysis describing the relationship between TlOsm with 39 other

osmotins from monocots and dicots showed that TlOsm has close genetic relationship

to major group of osmotins from monocots and closest to the osmotins of Setaria

italica (Figure 3.4). These results demonstrated that TlOsm is a member of osmotins

and OLPs, has close genetic relationship to monocotyledonous osmotins, but has a

non-homologous C-terminal sequence of about 50 AA.

3.4.2 TlOsm is involved in osmotic stress response of T. loliiformis plants

Plant osmotin genes have been shown to be induced by at least ten abiotic and

biotic stimuli (Raghothama et al., 1993). Osmotin was primarily named on the basis of

its activation upon osmotic stress response (Singh et al., 1985). Results from this study

showed that TlOsm was induced by cold, drought and salinity stresses. Transcriptional

profiling of TlOsm under major abiotic stress and during developmental stages

suggested the involvement of TlOsm in osmotic stress tolerance. TlOsm was up-

regulated sharply in both roots and shoots at early stages of cold, drought, and salinity

stress exposure. The gene was activated at highest levels within 1 - 3 h upon cold stress,

at 80%-60% of leaf RWC in drought stress, and at 1 – 3 h in roots to 3 - 6 h in shoots

upon salinity stress exposure (Fig. 2 E - J). High salt levels cause plant stress in two

phases, osmotic stress at early phase and ion stress at later phase (Munns and Tester,

2008). TlOsm expression levels were reduced sharply in shoots and to the levels of

unstressed in roots only after 12 h from the onset of NaCl stress, suggested that TlOsm

is not directly involved in ion stress mechanism. In heat stress, TlOsm expression

remained unchanged in roots but was down-regulated in shoots during the first 12 h of

stress. While the direct evidence in regulating stomata has not been reported for

osmotin, the main different responses of plants to osmotic stress and heat stress are the

regulation of stomata. One of the responses of plants to osmotic stress is stomatal

closure to reduce water loss, while in heat stress stomata are open to reduce heat

(Mittler, 2006). It could be the reason that the expression of TlOsm connected to

stomatal closure generating no advantage for leaf response to heat stress, resulted in

the reduced TlOsm expression in shoots during heat stress. During the recovery from

each of the four stresses, TlOsm expression levels were not different with those of

before stress. This indicated that the gene does not play a role in plant recovery. During

the course of development, the TlOsm expression remained unchanged except a slight


increase at 6 weeks in roots. Although osmotin was found to express at basal levels in

the cells that were not exposed to osmotic stress (Singh et al. 1985), the involvement

of osmotin in plant development has not been reported so far. T. loliiformis plants had

maximum density at this stage might consume more water that could generate the

temporary water deficits in root environment at the time of sampling and might be the

reason for this increase of TlOsm transcripts.

The expression levels of TlOsm upon stresses were found much higher than other

characterised osmotins. It is difficult to make a comparison among studies because different

methods were used to monitor the gene expression in the reports. However, if the comparison

made by measuring mRNA using RT-qPCR, the expression levels of TlOsm by stress stimuli

were by far higher. For example, strawberry FaOLP was induced up to 40 fold upon salicylic

acid (Zhang and Shih, 2007). Similarly, PhOsm from Petunia were induced 40-80 fold by

salt, wounding, jasmonic acid and salicylic acid (Kim et al., 2002). In this study, TlOsm was

up-regulated a thousand fold in shoot after 1 h exposure to cold (Figure 3.6 E), in roots

exposed to 200 mM NaCl (Figure 3.6 J) for 1 h or drought at 70% leaf RWC (Figure 3.6 H).

It is not known if very high expression level of a gene upon stress would provide additive

advantages for stress resilience in plants, the noticeably high expression levels of stress-

responsive genes under drought were also found in other resurrection plants such as

Haberlea rhodopensis (Gechev et al., 2013) and Craterostigma plantagineum (Rodriguez et

al., 2010) by transcriptome analysis. It has been suggested that genes activated rapidly upon

stress stimuli are involved in stress signalling while those activated later during the course of

stresses are involved in adaptation (Zhu, 2016). In addition, there are some existing

convergences among signal transduction pathways of different stress stimuli that help plants

induce similar responses to a wide range of stresses and develop cross-tolerance to various

stresses (Qin et al., 2011). TlOsm was sharply induced by a broad range of abiotic stress and

at early stage of stress duration implies that the gene plays a positive role in plants stress

response and might be involved in stress signalling pathway.

3.4.3 TlOsm localises to the plasma membrane regardless of stress condition

In subcellular localisation analysis of TlOsm, the stable expression of EYFP-

tagged TlOsm and EYFP control in tobacco was chosen for more convenience and

facilitating analysis of plants undergone stress. The fluorescent signal in transgenic

samples was critical for the detection of TlOsm localisation. Thus, the selection of

tobacco plants for regeneration was based on the EYFP expression. When the stable


integrations of the transgenes were confirmed, all the obtained transgenic plants

showed EYFP expression. This selection basis had more advantages for localisation

analysis of transgenes in transgenic plants because it eliminates the case of transgene

silencing. All the transgenic tobacco lines regenerated from this experiment had strong

EYFP fluorescence signal that made it easier for TlOsm localisation analysis.

Plant osmotins have been shown to localise to different cellular compartments

including chloroplast, endoplasmic reticulum, plasma membrane, and vacuole. The in

situ localisation analysis showed that TlOsm is in the secretory pathway (SMART

program), and with a transmembrane binding domain, plasma membrane was

predicted to be its destination. The evidence here revealed by confocal analysis either

on roots or leaves, tissue-cultured or acclimatised plants, plants undergone unstressed

or stress conditions constantly indicated that TlOsm localises to the plasma

membrane. Memsat server predicted a transmembrane fragment in TlOsm sequence

(Figure 3.3 B), which is homologous to those of major facilitator superfamily (MFS)

membrane transporters, suggesting this sequence responsible for the plasma

membrane localisation of the TlOsm protein. Despite the presence of two

SUMOylation motifs in TlOsm sequence, the cellular localisation of TlOsm

remained unchanged when plants undergone unstressed or stress conditions,

suggesting that these motifs do not function in translocation of TlOsm.

It is generally accepted that plasma membrane contains proteins that are

fundamental for stress-signal perception and transduction of stress signals into

downstream cellular responses. Previous studies have shown that plant osmotin and

OLPs are likely within signal transduction pathway of stress response (Abdin et al.,

2011; Husani and Rafiqi, 2012; Viktorova et al., 2012). Our results on the plasma

membrane localisation and early activation of mRNA in stress response of TlOsm

strongly support the functions of TlOsm in stress signalling pathway.

3.4.4 TlOsm has more binding sites typical for osmotins than OsOlp1_A and OsOlp1_I

As discussed in Section 1.3, osmotins and OLPs have been considered as crucial

mediators of plant response to diverse stresses; and various functions and mechanisms

have been suggested for osmotins. The resurrection plants, such as T. loliiformis,

implement unique environmental stress response mechanism that enables them to

rapidly response to stresses and immediately recover upon the return of favourable


conditions (refer to Section 1.4). To investigate whether proteins from T. loliiformis

have evolved unique characteristics contributing to additional level of stress tolerance,

as compared to their desiccation sensitive counterparts, the comparison among

TlOsm OsOlp1_A and OsOlp1_I were made based on functional predictions.

It is generally accepted that the presence of glucan-binding residues around

acidic cleft is essential for antifungal activity of PR5 proteins. Osmotins have been

thought to use endoglucanase catalytic activity to hydrolyse the fungal cell wall for

killing fungi (Mani et al., 2012). The products of glucan hydrolysis were believed to

act as osmolytes plants use for osmotic adjustment and organelle membrane formation

(Dway and Smille, 1971; Satoh et al., 1976; Lee et al., 2003) but the direct evidence that

links endoglucanase catalytic property of osmotins to plant abiotic stress response is

still lacking. Functional predictions indicated that TlOsm contains more glucan-

binding residues than the two rice osmotins; and the osmotin from rice drought tolerant

cultivar also contains more glucan-binding residues than the osmotin from rice drought

sensitive cultivar (Table 3.2). Hence, this predicted feature may represent the

important clues insight the mechanism of these osmotins in plant stress response.

Calcium-signalling and MAPK cascades represent the core plant stress-signalling

pathways mainly regulated by CDPKs and MAPKs (Mohanta and Sinha, 2016; Zhu,

2016). The common features of CDPKs and MAPKs are the phosphorylation

activities. Some pathways involving CDPKs and MAPKs were found to regulate

crosstalk between abiotic and biotic stress and function in multiple stress responses of

plants (Mohanta and Sinha, 2016). Osmotin has been shown to interfere calcium

signalling for enhancing cold stress tolerance in olive tree (D'Angei and Altamura,

2007). It has been demonstrated that tobacco osmotin triggered an AMP kinase

pathway in yeast and mammalian cells (Narasimhan et al., 2005). These observations

suggested that the function of osmotin involving kinase activities. Predictions on

phosphorylation activities showed that both serine/threonine type and tyrosine type are

present in TlOsm and rice osmotins, OsOlp1_A and OsOlp1_I, but the number of

potential phosphorylation sites of both types in TlOsm is significantly higher (Table

3.2). Accumulation of small sugar molecules such as sucrose, trehalose, and raffinose

at remarkably high levels in vegetative tissues has been proven to be unique in

desiccation tolerant plants for effective cellular protection during dehydration (Alpert

and Oliver, 2002; Dinakar and Bartels, 2013; Gaff and Oliver, 2013). Such small sugar


molecules was thought to protect the cells by maintaining hydrophilic interactions in

the membrane and proteins during dehydration and by vitrification of cytoplasm of dry

cells (Alpert and Oliver, 2002). Structural-functional prediction by ITASSER showed

that four binding sites of four different enzymes catalysing the reactions for breaking

down the high molecular weight sugar into smaller molecules are present only in

TlOsm, not in the two rice osmotins (Table 3.2). It has been known that predicted

information only can be used as reference for supporting biological experiments, but

these predictions revealed the common and unique functional characteristics of

TlOsm in comparison to the two rice osmotins. These functional predictions might

provide some clues for investigation and validation the role of TlOsm in plant stress

response. The correlation between predicted and actual functions of TlOsm can only

be proven by experimental evidence.

In summary, research in this chapter revealed the conserved and novel

characteristics of TlOsm. In addition, the predicted functional features of TlOsm

were compared to those of two rice osmotins, which were found differentially

expressing upon drought stress. Sequence analysis affirmed TlOsm as an osmotin

with all conserved characteristics and a close genetic relationship to

monocotyledonous osmotins and pointed out the presence of a non-homologous

sequence at its C-terminus. Transcriptional expression profile of TlOsm upon major

abiotic stresses and developmental stages indicated its involvements in cold, drought

and salinity stress response of T. loliiformis. Subcellular localisation analysis

confirmed the plasma membrane localisation of TlOsm and supported its possible

function in stress signalling. Functional predictions with respect to plant stress

response suggested it functions in both abiotic and biotic response with more

functional active elements than the rice osmotins. However, the involvement of

TlOsm in mediating plant stress response and the characteristics revealed in the

research need to be further investigated and validated. Studies in the next objectives

will focus on elucidating the roles of TlOsm in abiotic stress response. The two rice

osmotin genes, OsOlp1_A and OsOlp1_I, were incorporated throughout the

experiments for comparison with TlOsm. This elucidation was done by investigating

the role of TlOsm in abiotic stress response of transgenic rice, identifying interactive

protein partners of the three osmotins and pathways involving them, and validating

physical interactions of the osmotins with other stress-responsive proteins in planta.

Chapter 4: Generation of Transgenic Rice Constitutively Expressing Oryza sativa and Tripogon loliiformis

Osmotins 89

Chapter 4: Generation of Transgenic Rice

Constitutively Expressing Oryza

sativa and Tripogon loliiformis

Osmotins

In the previous chapter, the conserved and novel characteristics of TlOsm were

described. Transcriptional expression analyses indicated the role of TlOsm in T.

loliiformis response to cold, drought, and salinity stresses. The subcellular localisation

analysis revealed that TlOsm is a plasma membrane protein. Functional prediction of

TlOsm compared with two rice osmotins provided some insights into their differential

active binding residues, which could be useful for understanding the functions and

stress response mechanisms of these osmotins. The suggested information and

predicted functions of these osmotins need to be elucidated in biological experiments.

Generation of transgenic plants is a critical step to study the functions of transgenes in

plant system. This chapter outlines the methods used to develop and characterise

transgenic rice plants expressing osmotin genes and a control gene. The outcome

transgenic plants from this chapter were used for experiments in Chapter 5.

4.1 INTRODUCTION

Rice is among the most important cereals with more than a half of the world

population reliant upon it as a staple crop. During the last few decades, abiotic stresses

such as drought, salinity, and extreme temperature have represented the most important

factors limiting rice production (Das et al., 2015; Mohanty et al., 2013; Tripathi et al.,

2012; Wani and Sah, 2014). Among cereals, rice is the most sensitive crop to drought,

salinity, and extreme temperature. For instance, rainfed rice cultivation which accounts

for 45% of global production has been substantially affected by drought (Wani and Sah,

2014). The 2002 drought in India affected 55% of country area and 300 million people,

reduced rice production by 20% inter-annual baseline trend (Pandey and Bhandari,

2007). Salinity is the second most prevalent abiotic stress limiting rice production with

approximately 30% of rice cultivation regions containing salt levels higher than

threshold for normal rice yield (Das et al., 2015; Singh et al., 2010; Wani and Sah, 2014).

The reduction of rice yield under salt-affected soil was estimated to be 68% (Naheed et

90 Chapter 4: Generation of Transgenic Rice Constitutively Expressing Oryza sativa and Tripogon loliiformis

Osmotins

al., 2007). Similarly, in temperate areas, rice production is severely declined by cold

stress (Zhang et al., 2014). Rice plants expose to cold stress during seedling stage display

poor establishment, delayed growth and ununiformed maturation (Kim et al., 2012); if

cold occurs during the reproductive stage, complete yield loss may occur (Powell et al.,

2012). Therefore, rice is an ideal plant for study toward understanding the effects of

abiotic stress tolerant traits.

Given its importance in global agriculture, countless attempts have been made to

improve abiotic stress tolerance in rice. Conventional rice breeders have screened

existing stress tolerant cultivars and made genetic alterations that have resulted in

commercial cultivars adapting to a wide range of environments of rice ecosystems

(Das et al., 2015; Sankar et al., 2011; Swamy and Kumar, 2013). The utilisation of

molecular marker-assisted breeding techniques has contributed to significant progress

in breeding programs, resulting in the generation of a number of current commercial

stress tolerance cultivars. For example, combination of major-effect QTL for grain

yield under drought into conventional breeding lines have generated drought tolerant

rice cultivars that gained an increase of 150-500 kg ha-1, account for 10-30% yield

advantage over parental genotypes (Swamy and Kumar, 2013). Similarly, the

mutagenesis-induced VTL5 cultivar was developed and recommended for commercial

cultivation in the coastal ecosystem of Kerala (Shylaraj and Sasidharan, 2005). The

low success of rice breeding for abiotic stress tolerance through crossing was mainly

due to (1) incompatibility between subspecies (Guo et al., 2016); (2) the low levels of

stress tolerant traits present in existing compatible species (Singh et al., 2008); (3) the

yield drag associated with conventional breeding (Peng et al., 2009; Sankar et al.,

2011); and (4) a lack of understanding of the complex genetics underlying stress

tolerance (Singh et al., 2008). Genetic engineering addresses many of the challenges

associated with the development of tolerant rice varieties by breeding and is now

considered an attractive option for developing abiotic stress tolerant rice. Genetic

engineering has been used to develop abiotic stress tolerant rice with promising results

at the glasshouse scale (Babu 2010; Das et al. 2015; Sankar et al. 2011; Singh et al.

2008; Swamy and Kumar 2013; Wani and Sah 2014). Hence, rice represents a suitable

crop plant for engineering stress-responsive traits. Besides improvement of agronomic

traits, transgenic plants have offered informative means for studying the functions and

regulations of biochemical, physiological, and developmental processes (Hansen and


Osmotins 91

Wright, 1999; Ziemienovicz, 2014). Therefore, generation of transgenic rice

expressing stress-responsive genes is critical for gaining knowledge in the functions

and regulations of the transgenes affecting rice stress tolerance.

Several strategies have been suggested for the effective improvement rice with

enhanced abiotic stress tolerance via genetic engineering. These strategies include the

use of genes from stress tolerant species as well as the use of key regulators of multiple

stress tolerant trait (Das et al., 2015; Singh et al., 2008). It is believed that genes from

tolerant species would introduce additional tolerant effects that enable rice plants

withstand more extreme stress conditions. In addition, the key regulator would provide

rice more effective response to multiple stresses. In previous study, an osmotin gene

(TlOsm) from desiccation tolerant plant T. loliiformis was characterised and

demonstrated to have role in T. loliiformis response to multiple stresses including cold,

drought, and salinity stresses. A comparison on functional sites of TlOsm with those

of two rice osmotins suggested some potential differential functions in regulating

stress response among three osmotins. To understand the functions these osmotins and

to determine if more functional sites of TlOsm would bring advantage effects to

enhanced plant stress tolerance compared with osmotins from sensitive species, we

need to develop transgenic plants expressing the three osmotin genes.

The aim of this study was to develop transgenic rice plants constitutively

expressing the three osmotins and control gene for further experimental investigations.

With the availability of transformation protocols for rice, the specific objectives of this

study were set as follow:

1. Transform Nipponbare rice embryogenic calli with OsOlp1_A, OsOlp1_I,

TlOsm and UidA genes.

2. Generate for each gene about 10 independent transgenic rice lines.

3. Confirm the stable integration of transgenes in the rice genome and the

constitutive expression of the transgenes.


4.2.1 Plasmid constructs and Agrobacterium strains

Plasmids pYC-OsOlp1_A, pYC-OsOlp1_A, pYC-TlOsm, and pYC-Ubi-Gus

(VC) constructed by the methods described in Section 2.2.1 were used for rice

transformation. Agrobacterium strain Agl1 was used for carrying these plasmids.


Osmotins

Figure 4.1 presents the T-DNA of these plasmids. Briefly, the target osmotin genes

and GUS-reporter gene (UidA) are under driven of the Ubi promoter and the Nos

terminator, the selection marker is hygromycin resistant gene (hpt) regulated by the

CaMV 35S promoter and the Nos terminator.

Figure 4.1 Schematic diagram of gene expression cassettes for expressing osmotins and

GUS-reporter gene (control-VC) in O. sativa. LB: left border, RB: right border

4.2.2 Plant materials and culture media

Rice seeds of O. sativa L. spp Japonica cv. Nipponbare propagated and

maintained as described in Section 2.1.2.2 were used to induce embryogenic calli as

explants for Agrobacterium infection. Media for rice callus induction, transformation,

selection, and plant regeneration were the basic N6 medium (Appendix C) added with

growth hormones and other supplements depending on the stages of culture (described

when appropriate).

4.2.3 Rice callus induction, transformation, selection and regeneration

Rice embryogenic callus initiation, transformation and regeneration process

followed the protocol established by Khanna and Raina (1999) with some minor

modifications in regeneration step as in Sahoo et al. (2011).

4.2.3.1 Rice callus induction

Rice seeds were de-husked, washed 3 times in deionised water, sterilised in 70%

ethanol for 1 min followed by 4% sodium hypochlorite for 30 mins in a shaker.

Sterilised de-husked seeds were washed 3 times with autoclaved deionised water and

10 seeds were placed on each Petri plate containing callus induction medium (N6 basal


Osmotins 93

salts and vitamins supplemented with 60 g L-1 sucrose, 0.3 mg L-1 casein hydrolysate,

0.5 mg L-1 proline, 2 mg L-1 2,4-D, 3 mg L-1 BAP, 0.5 mg L-1 NAA, pH 5.8 and 2.5 g

L-1 phytogel). The plates were placed in the dark at 27 oC for 2 weeks. Embryogenic

calli induced from scutellum of seeds were isolated and place on Petri plates containing

the same callus induction medium and culture conditions for 2 weeks. Then calli were

multiplied by frequently subcultured with 2-week intervals.

4.2.3.2 Transformation of rice

Four days before transformation, embryogenic calli were selected and

transferred onto the same callus induction medium except pH 5.5 with the same culture

conditions. These calli were used as target tissues for transformation. Agrobacterium

tumefaciens strain Agl1 separately carrying pYC-OsOlp1_A, pYC-OsOlp1_I, pYC-

TlOsm, and pYC-Ubi-GUS stored in glycerol was used for transformation. Four days

prior to transformation, Agrobacterium from glycerol stocks was grown in LB liquid

medium containing 50 mg L-1 of kanamycin and 25 mg L-1 of rifampicin in a shaking

incubator at 28 oC, 200 rpm for 40 h to get maximum density. Cultures were then

transferred to a large volume of growth medium and grown for a further 16 h. On the

day of transformation, Agrobacterium cultures were grown in medium containing 200

mM glucose and 200 µM acetosyringone to activate virulence of Agrobacterium. Rice

calli were heat shocked by placing in a water bath at 45 oC for 5 min then placing in a

fridge at 4 oC for 30 min. Heat-shocked calli were immersed in activated

Agrobacterium suspension, centrifuged for 10 min at 1000 rpm, then inoculated for 30

min in the hood, and decanted. The decanted calli were inoculated for 3 days at 25 oC

in Petri plates containing 30 mL of MS medium. Infected calli were washed 4 times

with liquid medium (N6 basal salts and vitamins containing 200mg L-1 timentin) by

submersing in liquid medium for 1h per each wash with shaking at 100 rpm, then

blotting on sterile towel paper. Ten clumps of washed calli were cultured on solid first

selection medium (callus induction medium containing 200 mg L-1 of timentin and 25

mg L-1 of hygromycin). Plates were placed in the dark at 27 oC for 2 weeks. A total of

4 batches of transformation was done in this study (2 batches in 4 week calli, 1 batch

in 6 week calli, and 1 batch in 8-week calli).

4.2.3.3 Selection and regeneration of putative transgenic rice plants

Transformed calli from the first selection medium were sequentially sub-

cultured for 3 times with 2-week intervals on second selection medium (the first


Osmotins

induction medium but hygromycin increased to 50 mg L-1). Only calli strongly

proliferating on selection medium were selected for regeneration. Single clump of

selected calli was cultured on each plate containing 30 mL of first regeneration

medium (N6 basal salts and vitamins supplemented with 30 g L-1 sucrose, 0.1 mg L-1

casein hydrolysate, 0.5 mg L-1 proline, 2 mg L-1 kinetin, 3 mg L-1 BAP, 0.2 mg L-1

NAA, pH 5.8, 10 g L-1 agarose, 200 mg L-1 of timentin and 25 mg L-1 of hygromycin)

and cultured under the light at 25 oC for 3 weeks. Then, somatic embryos were transfer

onto plates containing 30 mL of second regeneration medium (N6 basal salts and

vitamins supplemented with 30 g L-1 sucrose, 0.1 mg L-1 casein hydrolysate, 0.5 mg

L-1 proline, 2 mg L-1 kinetin, 3 mg L-1 BAP, 0.1 mg L-1 NAA, pH 5.8, 10 g L-1 agar,

200 mg L-1 of timentin and 25 mg L-1 of hygromycin) and cultured under the light at

25 oC until shoot formation. Shoots were selected and rooted in 250-mL pots

containing 80 mL of rooting medium (half strength N6 basal salts and N6 vitamins

supplemented with 10 g L-1 sucrose, 0.1 mg L-1 casein hydrolysate, 0.5 mg L-1 proline,

2 mg L-1 kinetin, 1 mg L-1 BAP, 0.2 mg L-1 IAA, pH 5.8, 9 g L-1 agar, 200 mg L-1

timentin and 25 mg L-1 hygromycin). Plantlets from each plate were cultured in two

pots, one pot with the best plantlet for confirming the transgenic status, the other

containing the rest of regenerated plantlets as a back-up. Until the transgenic status

was confirmed by PCR, the confirmed transgenic plantlets were sub-cultured in 500-

mL pot containing 150 mL of rooting medium and samples were taken from these

plants for RT-PCR to confirm transcriptional expression of the transgenes. Then the

transgenic plants were in vitro multiplied in 500-mL pots containing 150 mL rooting

medium without growth hormone and hygromycin. A similar process was concurrently

used to generate wild-type (WT) plants. However, Agrobacterium was not included in

the inoculation medium for WT callus and hygromycin was excluded in selection,

regeneration, and rooting medium for WT.

4.2.4 Characterisation of transgenic rice plants

4.2.4.1 PCR analysis

To confirm the presence of transgenes in putative transgenic lines, PCR analyses

were performed using gene specific primers of the target genes, hygromycin resistant

gene specific primers, and virC gene primers (Table 4.1). Genomic DNA from

independent putative transgenic lines and wild-type control was extracted from 100

mg fresh rice leaf tissue using the DNeasy Plant Mini Kit. The plasmids used to


Osmotins 95

transform rice were used as positive control. PCR analyses were carried out in a 20-µl

reaction mixture containing 10 µl of 2 x Gotaq green (Promega), 0.5 µl of each forward

and reverse primers, 100 ng of genomic DNA, and nuclease-free water up to 20 µl.

PCR was conducted in a Peltier Thermal Cycler following the previously-optimised

temperature procedure for each pair of primers (Table 4.1). The PCR products were

separated on 1% agarose gel by electrophoresis. Details of reagents and methods for

DNA extraction, qualification, and quantification, PCR and agarose gel

electrophoresis are described in Section 2.2.2.

Table 4.1 List of primers used for characterisation of transgenic plants

Gene Primer sequence (5’-3’) Annealing

Temperature (oC)

Amplicon

size (bp)

(i) For presence of transgenes in transgenic plants by PCR

OsOlp1_A GTTGGGCGGTCGTTCATTCG

CGACCAGAGAAGCAGCTTGGTCTAATC

54 445

OsOlp1_I GTTGGGCGGTCGTTCATTCG

ACCAGGAGAAGCAGCTTGGCAG

54 443

TlOsm GGATCCATGGCGAGATTACGAGGGGCTG

AGGTGATGGCGTAGGTGGTGT

58 754

UidA GTTGGGCGGTCGTTCATTCG

GTAACGCGCTTTCCCACCAACGC

52 731

HygR ATGCTTTGGGCCGAGGACTG

TACTCTATTTCTTTGCCCTCGGACG

54 487

VirC GCCTTAAAATCATTTGTAGCGACTTCG

TCATCGCTAGCTCAAACCTGCTTTCTG

57 738

(ii) For transcriptional expression of transgenes in transgenic plants by RT-PCR

OsOlp1_A GGATCCATGGGATTAGACCAAGCTGC

GTGGCAGAAGATGAC

54 747

OsOlp1_I GGATCCATGGCTTCTGCCAAGCTG

GTGGCAGAAGATGAC

54 747

TlOsm GGATCCATGGCGAGATTACGAGGGGCTG

AGGTGATGGCGTAGGTGGTGT

58 754

UidA TGAACATGGCATCGTGGTGA

GCTAACGTATCCACGCCGTA

50 500

Musa 18Sr CATCACAGGATTTCGGTCCT

AGACAAATCGCTCCACCAAC

56 507


Osmotins

4.2.4.2 RT-PCR analysis

RT-PCR analysis was performed to confirm the transcriptional expression of

transgenes in transgenic rice lines. Total RNA was isolated from 100 mg leaves of

each transgenic rice line or WT using the RNeasy Plant Mini Kit following

manufacturer’s protocol. Genomic DNA in the total RNA samples was eliminated by

using the RQ1-RNase_Free DNase as per manufacturer’s protocol. The complete

elimination of genomic DNA in the RNA samples was confirmed by PCR reactions

with Musa 18Sr housekeeping gene primers (Table 4.1) and RNA samples as

templates. cDNA was synthesized from total RNA using the SuperScriptTM III First-

strand synthesis system for RT-PCR according to the manufacturer’s instruction. The

cDNA samples of transgenic and 2 WT plants were confirmed by PCR reactions with

the Musa 18Sr primers. The partial sequences of the transgenes were amplified from

corresponding cDNA samples using gene specific primers, Platinum® Taq DNA

Polymerase high fidelity kits (Invitrogen) and previously-optimised temperature

procedure. The RT-PCR products were separated on 1% agarose gel by

electrophoresis. Details of reagents and methods for RNA extraction, qualification,

and quantification, RT-PCR reactions and agarose gel electrophoresis are described in

Section 2.2.2.

4.2.4.3 Histochemical GUS assay

Histochemical GUS assays were performed on rice calli and plants transformed

with plasmid control, the pYC-Ubi-GUS. Transformed calli after 9-week selection

were immersed in a GUS staining solution containing 100 mM phosphate buffer (pH

7.0), 10 mM EDTA, 1mM potassium ferriccyanide, 0.1% Triton X-100, and 2 mM 5-

bromo-4chloro-3-indolyl-β-D-glucuronide. The calli in the GUS staining solution

were then vacuum infiltrated for 10 min and incubated overnight at 37 oC. The staining

solution was removed and calli were washed and reimmersed in 75% ethanol. Calli

were viewed with a Zeiss Steri-2000-C stereomicroscope and images were acquired

with a Digital microscope camera Progress®C5 (Jenoptic, Germany). The same GUS

stain protocol was applied for transgenic T0 plants and images were captured by a

Canon camera.


Osmotins 97

4.3 RESULTS

4.3.1 Callus induction, transformation, selection and regeneration of putative

transgenic rice plants

Genetic engineering has become a great avenue to modify crops with desired

traits and to provide solutions to gain an understanding of the functions and regulations

of foreign genes in plants. The combination of genetic engineering and conventional

breeding has made it possible to incorporate the important traits encoded by exogenous

genes into commercial crop cultivars, which has overcome the existing species barrier

faced by conventional breeding. Moreover, transgenic plants have provided

informative means for understanding the functions and regulations of biochemical,

physiological, and developmental processes modulated by a foreign gene (Hansen and

Wright, 1999; Ziemienovicz, 2014). Therefore, generation of transgenic rice plants

expressing the target osmotins is critical for gaining knowledge in the functions and

mechanisms of the three osmotins in regulating abiotic stress response of rice.

Among the methods developed for genetic engineering, Agrobacterium-

mediated transformation has been considered as a method of choice thanks to its ability

to transfer a defined DNA fragment (T-DNA) into plant genome; and low copy number

of T-DNA integrated in plant chromosomes (Gelvin, 2003; Tzfira and Citovsky, 2006).

The plant transformation would not have achieved such progress without the success

in plant tissue culture, in which plants can regenerate from various types of initial

explants. Somatic embryogenesis has been shown to be a preferred method for

developing transgenic plants because plants regenerated from single cell origin that

can eliminate problems associated with chimeras (Deo et al., 2010). Embryogenic calli

induced from scutellum of mature seeds were reported to be the best explants of rice

transformation due to the high transformation efficiency and the availability of initial

explants (Hiei and Komari, 2008).

In this study, the transgenic rice expressing three osmotins and a GUS-reporter

gene were generated by transformation of calli produced from mature seeds of the rice

Nipponbare cultivar using Agrobacterium carrying each of the plasmid described in

Section 4.2.3. Generally, explants underwent the process as described in Figure 4.2.


Osmotins

Figure 4.2 Procedure of rice callus induction, transformation, selection, and plant

regeneration. A: calli induced from scutellum of mature seeds after 2 weeks in callus

induction medium, B: calli at the stage used as explants for transformation, C: representative

one plate of transformed calli entered first step of selection, D: transformed callus proliferation

after 4 steps of selection, E: transformed somatic embryos germination in selection medium;

F: putative transgenic plants regenerated after 7 steps of selection; arrows indicate selected

calli and plants.


Osmotins 99

Primarily, the transformation experiment was designed to transform calli at 4, 6, and

8 weeks in order to determine if any effect of callus age on transformation efficiency and

plant regeneration capacity. Three batches of transformation on calli induced from 3,000

seeds and 1000 callus clumps per each batch underwent 4-5 cycles of selection. However,

temperature fluctuation in the tissue culture lab due to the laboratory refurbishment led to

heating the culture room that damaged all the embryos and the plantlets from 1-5 weeks

in regeneration medium (the same stage in Figure 4.2 D & F). Therefore the forth batches

of transformation was carried out on 4-week-old calli. A total of 43 independent lines were

regenerated from calli transformed with 4 plasmid constructs.

4.3.2 Confirmation of transgenes in putative transgenic rice lines

To confirm the transgenes stably integrated into genome of regenerated plants,

genomic DNA was extracted from leaves of each independent line transformed with

different constructs and WT plants. These DNA samples were used as templates for

PCR. Both selectable marker hygromycin resistant, hpt, and gene-specific primers

were used for PCR. In addition, the VirC primers (Table 4.1) were also used for PCR

to detect the Agrobacterium residual in order to eliminate the possibility of false

positive PCR. The PCR products followed by agarose electrophoresis are presented in

Figure 4.3.

All 43 independent lines had the presence of hpt gene because of the presence of

the expected 487 bp amplicon when using hpt gene primers in PCR mixtures (Figure 4.3

A, C, E & G). However, one of the 12 lines transformed with pYC-OsOlp1-A did not

have the band in agarose gel running PCR product of OsOlp1-A specific primers (Figure

4.3 B). In this particular line, three leaf samples were taken at different times for DNA

extractions and PCR reactions, the same results appeared that confirmed the absence of

OsOlp1-A gene in this line. All 10 lines transformed with pYC-OsOlp1-I (Figure 4.2 D),

9 lines with pYC-TlOsm (Figure 4.2 F), and 12 lines with pYC-Ubi-Gus (Figure 4.2 H)

construct had the presence of expected bands in PCR products using gene specific

primes. Each of 43 lines was checked for the presence of Agrobacterium residual by

using VirC gene primers. The results showed that none of the lines had the presence of

Agrobacterium, suggesting that these bands were the hpt gene and other target genes

stably integrated in the genome of these rice lines. The results also showed that 42 of 43

regenerated lines had both hpt gene and target gene insertions.


Osmotins

Figure 4.3 Characterisation of putative transgenic rice lines by PCR. A: PCR products of

putative OsOlp1_A plants with hpt primers and B: with gene specific primers, C: PCR products

of putative OsOlp1_I plants with hpt primers and D: with gene specific primers, E: PCR

products of putative TlOsm plants with hpt primers and F: with gene specific primers, G: PCR

products of putative GUS plants with hpt primers and H: with gene specific primers, I-L: PCR

products of putative OsOlp1_A, OsOlp1_I, TlOsm, and GUS plants with VirC gene primers.

M: molecular DNA ladder, P: positive control, N: negative control, WT: wild type, Kb: kilo

base pair, numbers above each gel indicate the line ID.


Osmotins 101

4.3.3 Expression of transgenes in transgenic rice plants confirmed by RT-PCR

To confirm the transcriptional expression of the target transgenes in transgenic

rice, RT-PCR was used. Forty-four RNA samples were extracted from leaves of 42

transgenic rice lines and 2 WT plants. RQ1-DNase was used to eliminate the DNA

contaminated in these RNA samples. Then, PCR with house-keeping gene Musa 18Sr

primers was performed to confirm if the genomic DNA was completely removed from

RNA samples. Results showed that none of the PCR products from these 44 RNA

samples had the presence of 507 bp amplicon, suggesting that these RNA samples

were DNA free (Figure 4.4 I-L).

cDNAs were then reverse transcribed from these RNA samples. PCR with

house-keeping gene Musa 18Sr primers was again used to confirm if the cDNAs were

successfully transcribed from each of RNA samples. The presence of a bright 507 bp

band in all cDNA samples from 42 transgenic rice lines and 2 WT plants indicated the

presence of cDNA in all the samples (Figure. 4.4 B, D, F & H).

PCR with gene specific primers and cDNA samples of 42 transgenic rice lines

and the control were performed by pre-determined annealing temperature for specific

pair of primers. Results showed that 11 OsOlp1_A lines (Figure 4.4 A), 10 OsOlp1_I

lines (Figure 4.4C ), 9 TlOsm lines (Figure 4.4 E), and 12 UidA (GUS) lines (Figure

4.4 G) had the expected bands, which were the same sizes with corresponding control

but absence in the WT and negative control samples. The intensity of RT-PCR

products found varying among lines transformed with the same gene suggested that

there may be some different levels of transgene expression among the lines. These

results indicated that the target transgenes expressed at transcriptional level in all 42

transgenic rice lines.


Osmotins

Figure 4.4 Transcriptional expression of transgenes in transgenic rice by RT-PCR. A:

RT-PCR products of OsOlp1_A plants with gene specific primers and B: with Musa 18Sr

primers, C: RT-PCR products of OsOlp1_I plants with gene specific primers and D: with Musa

18Sr primers, E: RT-PCR products of TlOsm plants with gene specific primers and F: with

Musa 18Sr primers, G: RT-PCR products of GUS plants with gene specific primers and H:

with Musa 18Sr primers, I-L: PCR products of the RQ1-DNase treated RNA samples from

OsOlp1_A, OsOlp1_I, TlOsm, and GUS plants with Musa 18Sr primers. M: molecular DNA

ladder, P: positive control, N: negative control, WT: wild type, Kb: kilo base pair, numbers

above each gel indicate the line ID.


Osmotins 103

4.3.4 Expression of GUS protein confirmed in GUS-expressing rice lines.

In order to investigate if GUS-reporter gene expresses at protein level in these

transgenic rice plants and how the transgene expresses under the regulation of the Ubi

promoter, a histochemical GUS assay was conducted on all lines of selective calli after

9 weeks of selection in hygromycin-containing media and regenerated plants. Results

showed that GUS expression and activity indicated as blue colour was observed in the

entire callus clumps of all lines proliferated after 9 weeks in selective media, while no

blue colour observed in the control (Figure 4.5 A). In the plants, a strong GUS activity

was detected in all parts of tissues throughout 12 independent transgenic lines at 2

different stages of regeneration but not in the WT control (Figure 4.5 B). Since the

GUS gene in pYC-Ubi-Gus had an intron, this expression should not be interfered by

Agrobacterium residues that may be attached in rice tissues. GUS-staining results

confirmed that GUS gene was constitutively regulated by the Ubi promoter that led to

GUS expression at different stages and in all the cell types. Thus, OsOlp1_A,

OsOlp1_I, and TlOsm should be regulated in the same manner.


Osmotins

Figure 4.5 GUS expression in transgenic rice calli and plants. A: GUS expression of

representative transgenic rice calli after 9 weeks of transformation and selection in 50 mg L-1

hygromycin – containing media, B: GUS expression of transgenic rice plants; upper row shows

plants at 4 weeks regenerated from somatic embryos and lower row shows plants at 8 weeks

regenerated from somatic embryos, WT: wild type, numbers indicate the ID of independent

transgenic lines.


Osmotins 105

Table 4.2 summarises all transgenic rice lines generated from this research and

the confirmation of transgene intergration and expression in regenerated rice plants.

Generally, among 43 rice lines regenerated from transformation and intensive

selection, 42 lines showed the stable integration and expression of the target

transgenes. There was a little variation in the number of transgenic lines for each gene

with the smallest number of lines expressing TlOsm (9 lines) and the largest number

of lines expressing GUS reporter gene (12 lines). The objectives of obtaining about 10

transgenic lines for each gene and the constitutive expression of transgenes in

transgenic rice lines were achieved.

Table 4.2 Summary of generating and characterising transgenic rice lines expressing

target osmotins and control gene in the research

Plasmid construct N0 of lines PCR (+) result RT-PCR (+) GUS (+)

hpt primers Gene specific

primers

pYC-OsOlp1_A 12 12 11 11

pYC-OsOlp1_I 10 10 10 10

pYC-TlOsm 9 9 9 9

pYC-Ubi-Gus 12 12 12 12 12

Total 43 43 42 42 12

4.4 DISCUSSION

Rice is one of the most important cereal crops and is used as stable food for a

large human population worldwide. Besides, rice is a susceptible crop to major abiotic

stresses. Thus, rice has been recognised as an attractive crop for intensive studies on

genetic improvement of abiotic stress tolerance. Progresses in rice research have

brought about numerous methods, protocols for conducting experiments, phenotyping,

and genetic engineering; and have updated our understanding on how rice response to

environmental stresses (Wani and Sah, 2014; Zhang et al., 2014; Das et al., 2015).

Rice research also indicated genetic engineering as a potential approach for improving

rice production and enhancing rice tolerance to abiotic stresses (Grover and Minhas,

2000; Wani and Sah, 2014; Ansari et al., 2015). With the estimation of increasing rice

cultivation areas affected by future changing climate condition (Jagadish et al., 2011)


Osmotins

and the needs to increase 60% rice production to fulfil the demand of increasing

world’s population by 2020 (Grover and Minhas, 2000), the key factors for sustainably

increasing rice grain yield production while minimising effects by environmental

stresses needed to be addressed. Hence, rice appears to be an appropriate target crops

for expressing and validating the functions of stress-responsive genes in crop plants.

In addition, an effective transformation and plant regeneration process plays a key role

in the success of functional studies of foreign genes in rice plants.

Agrobacterium-mediated transformation is now a dominant method for plant

genetic engineering. However, the efficiency of a transformation protocol depends on

many factors such as virulence of Agrobacterium strain, types of initial plant tissues,

regeneration capability of target plants, and strength of selectable marker (Tzfira and

Citovsky, 2006). Rice has been a favourite cereal crop for genetic studies and protocol

for Agrobacterium-mediated transformation has been established and routinely used

in many laboratories worldwide. Somatic embryogenic callus is a preferred starting

tissues for rice transformation. However, regeneration of transformed calli has been

identified as a major obstacle for rice transformation (Sahoo et al., 2011). Moreover,

initiation of rice embryogenic calli for transformation is a time-consuming and tedious

process. In this study, beside the purpose of obtaining transgenic rice plants for

evaluating abiotic stress tolerance, we attempted to investigate the effects of callus

stages for transformation on plant regeneration efficiency in order to recommend the

best callus stage as target tissues for transformation. However, this objective failed to

achieve due to heating in culture room during embryo germination, which is the most

sensitive stage to heat, led to most of 300 putative transgenic lines damaged.

Nevertheless, 43 independent lines were regenerated (Table 4.2). Hygromycin

selection was reported to be very efficient for the selection of transformed rice with

the concentration ranged from 20-50 mg L-1 (Zuraida et al., 2013). In this study,

transformed calli were first selected in the medium containing 25 mg L-1 of

hygromycin, followed by three cycles of selection in 50 mg L-1 of hygromycin; then

embryo germination, shooting, and rooting were selected in the medium containing 25

mg L-1 of hygromycin. This selection process resulted in 100% regenerated plants had

the hpt gene integration (Figure 4.1) and expression and evidenced by the survival of

transgenic plants in the selection media. The results confirm the effectiveness of

hygromycin selection marker in rice transformation. Among 43 regenerated lines, one


Osmotins 107

line transformed with pYC-OsOlp1_A did not show the presence of the target

OsOlp1_A, despite the hygromycin selection marker was detected. Agrobacterium has

been used as a method of choice for genetic transformation due to its ability to transfer

a well-defined T-DNA fragment (Tzfira and Citovsky, 2006); but in this case it was

not known why the T-DNA fragment was truncated. The purpose of this study was to

obtain enough transgenic rice lines expressing the target transgenes for further

experiments on gene functions. Thus the mechanism by which T-DNA truncated was

beyond the objectives of this study and did not get attention.

The choice of an appropriate promoter for driving the target transgenes is

another factor needed to be considered in generating transgenic plants. The purpose of

this study was to generate transgenic rice plants constitutively expressing the genes of

interest and the Zea maize Ubi (ZmUbi or Ubi) promoter was chosen for directing the

TlOsm, OsOlp1_A, OsOlp1_I, and UidA. The Ubi promoter was reported to regulate

the high levels of constitutive gene expression in rice and other cereal crops (Cornejo

et al., 1993; Rooke et al., 2000). This promoter was shown to be active in many cell

types and direct the strongest expression in dividing tissues such as young roots and

leaves of transgenic rice (Cornejo et al., 1993). Hence, this promoter has been widely

used in genetic transformation of monocots. In our study, all 42 transgenic rice lines

expressing target genes under the control of Ubi promoter showed the expression of

transgenes at transcriptional level (Figure 4.4). Furthermore, the results from the

histochemical GUS assay conducted on all lines of selective calli and regenerated

plants demonstrated the constitutive expression of GUS-reporter gene in the selected

rice lines. The presence of GUS protein and its activity indicated as blue colour were

observed in entire callus clumps, while no blue colour observed in the control (Figure

4.5 A) proved the uniform expression of GUS in the callus clumps. In the plants, a

strong GUS activity was detected all parts of tissues throughout 12 independent

transgenic lines at either 4 or 8 weeks after regeneration but not in the WT control

plants, indicating the presence and activity of GUS in all the plant parts at both stages

of regenerated plants (Figure 4.5 B). Since an intron was included in the GUS-reporter

gene in the pYC-Ubi-Gus plasmid, the presence of GUS should only be the results of

GUS expression in rice plants, not of Agrobacterium residues that may be attached in

rice tissues. GUS-staining results confirmed that the Ubi promoter used for regulating


Osmotins

the genes in this study is a constitutive promoter that expresses at different stages and

all the cell types.

Conclusion: using the established agrobacterium-mediated rice transformation

system, total of 42 transgenic rice lines constitutively expressing either OsOlp1_A,

OsOlp1_I, TlOsm, or GUS-reporter gene were generated. These transgenic rice lines

together with WT will be tested for cold, drought, and salinity stress tolerance in

Chapter 5.

Chapter 5: Comparative Analysis of Transgenic Rice Constitutively Expressing Osmotins from Tolerant and

Sensitive Species 109

Chapter 5: Comparative Analysis of

Transgenic Rice Constitutively

Expressing Osmotins from

Tolerant and Sensitive Species

Results from Chapter 3 suggested the involvement of TlOsm in Tripogon

loliiformis responses to cold, drought and salinity stresses and identified possible

functional differences among TlOsm, OsOlp1_A, and OsOlp1_I. Analysis of

these differences might provide useful information for understanding the functions of

osmotins in plant stress response. In Chapter 4, 42 transgenic rice lines constitutively

expressing TlOsm, OsOlp1_A, OsOlp1_I, and the Gus-reporter gene as vector control

(VC) were generated together with wild type (WT) control plants. This chapter details

the assessment of the transgenic plants expressing TlOsm, OsOlp1_A, and OsOlp1_I

for enhanced tolerance to cold, drought and salinity stresses.

5.1 INTRODUCTION

Previous studies have proposed additional advantages of using genes from stress

tolerant species for engineering crops with enhanced abiotic stress tolerance (Mittler and

Blumwald, 2010; Cominelli et al., 2013). It is believed that such genes would bring to

engineered crops additional resilience not observed in parental crops. Thus, naturally

tolerant species have great potential for seeking stress-responsive genes for use in

improving abiotic stress tolerance in crops. Among stress tolerant species, the

Australian-native resurrection grass, T. loliiformis, has great potential as a genetic

resource for the identification of stress tolerant genes. T. loliiformis is capable of

withstanding desiccation of its vegetative tissues which regain for metabolic function

within 24 - 72 h of watering (Karbaschi et al., 2016; Williams et al., 2015). In Chapter

3, an osmotin from T. loliiformis (TlOsm) was identified and demonstrated to play role

in T. loliiformis response to salinity, drought, and cold stresses. Comparision of TlOsm

amino acid (AA) sequence and predicted structure with those of two osmotins from

stress sensitive species, O. sativa, revealed some possible differences in their functions

110 Chapter 5: Comparative Analysis of Transgenic Rice Constitutively Expressing Osmotins from Tolerant and

Sensitive Species

(Table 3.2). Two rice osmotins, OsOlp1_A and OsOlp1_I were identified from rice

drought tolerant and drought sensitive cultivar, respectively. However, only OsOlp1_A

was induced by drought. Comparative analysis of the three protein sequences and

structures indicated differences in number of the potential glucan-binding and

phosphorylation sites. TlOsm encoded the highest number of both potential glucan-

binding sites (8) and phosphorylation sites (64). OsOlp1_A contained five glucan-

binding sites while OsOlp1_I encoded two. OsOlp1_A and OsOlp1_I encode the same

number of phosphorylation sites (15) but one Ser site in OsOlp1_A is replaced by the

Thr site in OsOlp1_I. In addition, TlOsm has four binding sites of four enzymes

including isoamylase, cellulase, chondroitin AC lyase and beta-fructofuranosidase that

function in breaking high molecular-weight into lower molecular-weight sugars (Table

3.2). The differences in the predicted protein structures of the three osmotins suggest

differences in their functions. Here, we hypothesized that proteins with more functional

sites would have more functional activities.

Typically osmotins and other PR5 protein structures contain three domains with

glucan-binding sites and an acidic cleft (Min et al., 2004). Previous studies have

suggested that glucan-binding sites surrounding the acid cleft are essential for the

antifungal activities of osmotins (Liu et al., 2010; Mani et al., 2012; Min et al., 2004;

Viktorova et al., 2012). How glucan-binding sites contribute to the capacity of

osmotins to regulate plant tolerance to abiotic stress however remains to be elucidated.

Tobacco osmotin has been demonstrated to activate an AMPK cascade in yeast and

mammalian cells (Narasimhan et al., 2001; Narasimhan et al., 2005). In transgenic

plants, osmotin functions are linked to MAP kinase activities (Viktorova et al., 2012).

The main function of most protein kinases is phosphorylation. These suggest that

phosphorylation activities might contribute to osmotin functions. Rohrig et al. (2006)

investigated the involvement of phosphorylation during acquisition of desiccation

tolerance in resurrection plant C. plantagineum. They showed that at least two LEA

proteins CDeT11-24 and CDeT6-19 were transiently phosphorylated during

dehydration. Dinakar and Bartels (2013) proposed that the increased phosphorylation

activities of these stress-responsive proteins might increase the hydrophilic residues

necessary for interaction with macromolecules, which is required for cellular

protection during desiccation tolerance. In addition, soluble sugar metabolism and

accumulation during desiccation tolerance have been found distinct features of



resurrection plants for protection of their vegetative tissues from damage. Four

functional sites for sugar metabolism were found in the predicted structure of TlOsm,

but none of them was found in two rice osmotins. To understand the effects of the

three osmotins on enhancing plant abiotic stress tolerance, in relation to their predicted

functional binding sites, we developed transgenic plants independently expressing the

three osmotins and assessed them for enhanced abiotic stress tolerance.

To gain an understanding insights into the functions of these osmotins in

improved rice tolerance to abiotic stress, the physiological and morphological

responses of transgenic rice expressing TlOsm, OsOlp1_A, and OsOlp1_I need to be

investigated. Moreover, comparative analysis of transgenic rice expressing TlOsm,

OsOlp1_A, and OsOlp1_I might reveal any superior role of osmotin from highly

tolerance species over those from rice. In this chapter, the response of transgenic rice

constitutively expressing TlOsm, OsOlp1_A, OsOlp1_I, and the Gus-reporter gene

were comparatively analysed under unstressed, cold, drought, and salinity stresses.

The comparisons were made on T0 generation with stress treatments at seedling stage

and on T1 generation with stress treatments at reproductive stage.

The objectives of this study were set as follows:

1. Investigation of physiological response of the T0 and T1 transgenic rice plants

exposure to cold, drought and salinity stresses at seedling and reproductive

stages.

2. Investigation of morphological response of the T0 and T1 transgenic rice plants

exposure to cold, drought and salinity stresses at seedling and reproductive

stages.

3. Comparison of the effects of TlOsm, OsOlp1_A, and OsOlp1_I on enhancing

rice tolerance to cold, drought, and salinity stresses.



Nine transgenic lines for each gene construct and the WT were included for

evaluation of cold, drought, and salinity stress tolerance at the seedling stage. T0 plants

were multiplied and maintained in tissue culture for assessment at seedling stage.

Seeds from T0 plants were harvested from plants grown in controlled glasshouse

conditions. T1 plants germinated from seed pools of all available lines were used for


Sensitive Species

reproductive stage evaluation and the segregated non-transgenic (NT) plants were used

as control.

5.2.2 Acclimatisation of tissue-cultured rice plants

Tissue cultured rice plants were acclimatised using 50-mL plastic pots and

premium potting mix (Searles, Sunshine coast, Qld, Australia) following the protocol

described by Hoang et al. (2014). Plants containing one tiller were transplanted into

pots containing potting mix moistened with tap water. Pots were placed in a container

filled with tap water to one-third the height of the pots and the container was covered

with clear plastic foil and placed in a growth room at 24 oC, day/night cycle of 12 h/12

h, light intensity of 800 ± 100 µmol m-2 s-1, and relative humidity at 65%. Plants were

sprayed with water twice a day for seven days and then the plastic foil was removed.

Plants were grown for another seven days with water added into the container to cover

the height of the pots. After that, Aquasol fertiliser (Yates, Pastow, NSW, Australia)

containing nitrogen, phosphorus, potassium and trace elements (N: P: K: 23: 3.95: 14)

was added to the water in the container to the concentration of 0.5 g L-1 and plants

were grown for another seven days.

5.2.3 Growth conditions and stress treatments at seedling stage

Cold, drought and salinity stresses were applied to 3-week post acclimatised

plants when three fully expanded leaves had developed and the forth leaf had just

emerged. For salinity stress, water in the container was drained out and 100 mM NaCl

solution was poured in until the surface of salt solution was 1 cm above the potting

mix level. The water level was maintained at this level by adding tap water daily into

the container. After three weeks in 100 mM NaCl solution, plants were recovered by

removing the salt solution from the container, washing off salt in the potting mix by

submerging in water and draining five times. Tap water was added to the containers

containing washed pots to the level of 1 cm above the potting mix level. For drought

stress, the pots containing plants in water containers were drained off (potting mix

saturated with water) and transferred to empty containers. Water was not added to

these plants for three weeks. After stress, plants were recovered by adding tap water

to the containers at a height of 1 cm above the potting mix. The survival rate was

calculated three weeks after recovery for both experiments. In the unstressed

experiment, water was maintained daily in the same level of 1 cm above the potting

mix level during the course of experiment. Plants were grown in growth chambers



(Thermoline, Japan) at 27 oC, day/night cycle of 12 h/12 h, light intensity of 800 ± 100

µmol m-2 s-1 and humidity at 65%. For cold stress, 4-leaf-stage plants were divided into

two parts and concurrently placed in unstressed (27 oC) and cold stress (10 oC)

conditions for 4 weeks. Cold water (10 oC) was added to plants in cold treatment at the

same time with tap water added to unstressed plants to replace the evaporated water.

After that, temperature in the cold treatment was changed to (27 oC) for plants to

recover. The survival rate was calculated three weeks after recovery.

5.2.4 Germination of T1 transgenic rice plants

Seeds harvested from glasshouse grown T0 transgenic rice were dried in an oven

at 37 oC for a week and maintained at room temperature for 4-5 months. Seeds from

plants transformed with each gene construct were separately placed on paper towels

moistened with tap water in a plastic box and the boxes were placed in the dark at room

temperature for a week. The germinated seeds were transferred into 50-mL pots

containing potting mix moistened with tap water. Pots were placed in a container filled

with tap water to one-third the height of the pots and the container was covered with

clear plastic foil and placed in growth room at 24 oC, day/night cycle of 12 h/12 h,

light intensity of 800 ± 100 µmol m-2 s-1, and relative humidity at 65%. Plants were

sprayed daily with water for seven days and then the plastic foil was removed. Plants

were grown for another seven days with water added into the container to cover the

height of the pots. After that, the Aquasol fertiliser was added weekly to the water in

the container to the concentration of 0.5 g L-1 and plants were grown for another 14

days for screening of transgenic T1 plants.

5.2.5 Screening of T1 transgenic rice plants

The T1 transgenic rice plants were screened by PCR for the presence of the

transgenes. One leaf from each 2- to 3-leaf stage plants was sampled and subjected for

quick-released DNA following the rapid release DNA protocol by Thomson and Henry

(1995) as described in Chapter 2 (Section 2.2.2.1). One microliter of each quick-

released DNA sample was used as template in a 20 µl PCR mixture with either

hygromycin resistant gene primers or gene-specific primers. The PCR products were

separated in 1% agarose gels by electrophoresis. Plants that were PCR positive using

both hygromycin resistant gene primers and gene-specific primers were considered

transgenic. The plants generated a faint band with either primer pairs or both were


Sensitive Species

eliminated. The plants negative to both pairs of primers were considered as segregated

non-transgenic and used as non-transgenic (NT) control.

5.2.6 Growth conditions and reproductive-stage stress treatments

Four weeks post germination and following the confirmation of the transgene,

plants of a similar size and stage were selected and transferred into 1.2-L pots containing

full volume of potting mix moistened with tap water. At this stage, the selected plants

had one tiller and four fully expanded leaves with an immature fifth leaf and plant height

varied from 13 to 17 cm. The plants in 1.2-L pots were placed in containers filled with

tap water to 1 cm above the potting mix. Containers with plants were placed in a

controlled glasshouse at 27 ± 3 oC, day/night cycle of 12 h/12 h, light intensity of 900 ±

100 µmol m-2 s-1, and relative humidity at 65%. Plants were grown for further 14 days

with water added daily to maintain the same water levels and Aquasol fertiliser was

added weekly to the water in the containers to a concentration of 0.5 g L-1.

Drought and salinity stresses were separately applied to 6-week post germinated

plants and concurrently compared with unstressed plants. For salinity stress, water in

the container was drained out and replaced with a 100 mM NaCl solution until the

solution was 1 cm above the potting mix level. The water level was maintained at 1

cm above the potting mix level by adding tap water daily into the container. After four

weeks in 100 mM NaCl, plants were recovered using the method applied for treatment

plants at seedling stage. For drought stress, similar method applied for drought

treatment and recovery at seedling-stage was used, except for the period of water

withholding was 18 days. In the unstressed experiment, water was maintained daily in

the same level of 1 cm above the potting mix surface during the course of experiment.

For each experiment, 30 plants expressing each gene or NT control were randomly

arranged in three replicates. After 28 days, a half of plants per each replicate from all

three experiments were randomly selected for dry biomass determination and another

half were left for recovery and calculating yield components.

5.2.7 Electrolyte leakage

Electrolyte leakage was measured from leaves using a CM 100-2 conductivity

meter (Reid and Associates CC, Durban, South Africa) following the manufacturer’s

instruction. Briefly, the second youngest fully-expanded leaf was placed in a plastic

bag and immediately put on ice. Leaves were washed twice in deionised water and



blotted dry with paper towel. A 5-cm middle part of each leaf was cut into 0.5 cm

pieces, rinsed in deionised water and loaded into wells of the CM 100-2 conductivity

meter containing 1.25 ml of deionised water. Each well contained 2 pieces of leaf and

5 wells were used for each leaf as technical replicates. Measurement was carried out

every 2 min over a 60 min period. Samples were removed and dried in an oven at 80

oC overnight (until the weight remained unchanged) for measurement of dry weight

(DW). Electrolyte leakage was calculated as the slope of electrolyte leakage over time

and normalised by DW.

5.2.8 Relative water content determination

Leaf relative water content (RWC) was determined using the method described

by Lafitte (2002). Approximately 10 cm of leaf was cut off from the middle part of the

youngest fully expanded leaf, weighed (fresh weight - FW), and placed in a 15 ml

Falcon tube. The tube was kept on ice until it was filled with deionised water and kept

in dark at 4 oC overnight. The next morning, the leaf was blotted dry with tissue towel

for 30 s and weighed (turgid weight – TW). The samples were then dried in a vacuum

oven at 70 oC for 3 days and weighed (dry weight- DW). The relative water content

was calculated as RWC (%) = (FW-DW)*100/ (TW-DW).

5.2.9 Plant dry weight determination

Plants were sampled in unstressed and stress treatments at the end of treatment

periods from transgenic, WT or NT plants for dry weight determination. Six pots per

line per plasmid construct were sampled for each type of stress treatment in seedling-

stage tested experiments and fifteen plants per plasmid construct were sampled for

each type of stress treatment in reproductive-stage tested experiments. The plants in a

pot were carefully pulled out along with root and potting mix adhering to the root was

removed. Roots and shoots were dried in a vacuum oven at 80 oC for 72 h until the

weight remained unchanged. Then the dry weights were determined.

5.2.10 Measurement of photosynthetic parameters

Photosynthetic parameters such as net photosynthesis, stomatal conductance,

and transpiration rate were measured using a LI-COR Infra-Red Gas Analyser Li-6400

XT (John Morris Scientific, Chatswood, NSW, Australia). Measurements were

performed on the second fully expanded leaf at early stage or flag leaf (if available) at

day 0, 3, 6, 12, and 18 for drought stressed plants and additional day 21 for salinity


Sensitive Species

stressed and unstressed plants. For each data record, nine representative plants for each

gene constructs in each experiment were randomly chosen for measurement.

5.2.11 Statistical analysis

All experiments were conducted using a randomized complete block design and

data were analysed using one-way ANOVA. When ANOVA results showed a significant

difference at P ≤ 0.05, the Tukey’s HSD tests were used to analyse the significant

differences among each experimental treatment (using Minitab 17 Statistical Software).

All graphs and standard errors were prepared using Microsoft Excel. The number of

randomly selected samples used to calculate each mean is indicated in each graph.

Table 5.1 details all the experiments conducted in this study to assess the

transgenic rice expressing TlOsm, OsOlp1_A, OsOlp1_I, and the Gus-reporter gene

together with WT or NT control for enhanced plant tolerance to cold, drought, and

salinity stresses.

Table 5.1 A summary of experiments in the study

Seedling stage Reproductive stage

Materials T0 generation, tissue cultured propagation T1 generation, seed

propagation

Day 0 plants 1 tiller, 4 leaves, 3-week post acclimatisation 3 tillers, 6-week post

germination

Control WT and VC NT and VC

Scale Growth chambers Glasshouse

Set 1 Set 2

Experiments Unstressed, drought,

salinity (100 mM NaCl)

Unstressed and cold Unstressed, drought,

salinity (100 mM NaCl)

Stress period 3-week treatment 4-week treatment 18 days for drought

28 days for salinity

Size 9 lines x 15 plants per line

per gene construct for

each experiment (675

plants per experiment)

8 lines x 15 plants per line

per gene construct for

each experiment (600


30 plant per gene construct

for each experiment (150


Parameters Shoot growth, tiller

number, electrolyte

leakage, RWC, dry

biomass, survival rate

Shoot growth, tiller

number, electrolyte

leakage, RWC, dry

biomass, survival rate

Shoot growth, tiller

number, electrolyte

leakage, RWC, dry

biomass, photosynthesis-

related parameters, yield

components



5.3 RESULTS

5.3.1 Rice plants constitutively expressing TlOsm or OsOlp1_A maintained

growth under cold, drought, and salinity stresses

TlOsm was isolated from a drought-induced cDNA library of desiccation tolerant

species, T. loliiformis, made at the Centre for Tropical Crops and Biocommodities

(CTCB) (Williams, unpublished). OsOlp1_A and OsOlp1_I were identified from

drought-tolerant cultivar Apo and –sensitive cultivar IR64, respectively, of the stress

sensitive species, O. sativa. The two rice osmotins were differentially expressed upon

drought but different from each other in only 10 AA of their protein sequences.

Structural-to-functional prediction for the three proteins suggested their functions

associated with glucan-binding and phosphorylation sites. As shown in Table 3.2,

TlOsm has the highest potential glucan-binding and phosphorylation sites.

OsOlp1_A has more glucan-binding sites than OsOlp1_I, five vs. two sites. The

two rice osmotins have the same number of phosphorylation sites but one Ser residue

in OsOlp1_A is replaced by the Thr residue in OsOlp1_I (Appendix B-Figure 1

and Table 1). Besides, TlOsm has four unique binding sites of the enzymes function

in sugar metabolism (Appendix B-Figure 2). To determine whether these glucan-

binding sites correlate with improved stress tolerance and if the additional

phosphorylation sites and the unique binding sites of TlOsm contribute to stress

tolerance, transgenic rice expressing TlOsm, OsOlp1_A and OsOlp1_I were generated

and subjected to cold, drought, and salinity stresses. Three type of control plants:

vector control (VC), wild type (WT), and non-transgenic (NT) were included in the

assessments. The VC plants expressing the Gus-reporter gene (UidA). Similar to T0

transgenic plants, WT plants went through process of callus induction, transformation,

selection, plant regeneration, and tissue-culture multiplication, except the presence of

Agrobacterium in inoculation media and of Hygromycin in selection media (Chapter

4). The NT plants were the non-transgenic segregation in the same generation with

transgenic plants and produced by the same parental plants as transgenic plants. The

performance of these plants were assessed based on growth, physiological, and

photosynthesis-related parameters, recovery ability, and yield components.

Shoot growth rate is one of the indicators for rice stress tolerance, with higher

growth rate under stress associated with higher level of tolerance (Zhang et al., 2014).

To evaluate growth rate, plant height were measured at the day before stress


Sensitive Species

application (day 0) and 18 days after the onset of salinity and drought stress in both

seedling-stage and reproductive-stage experiments. For cold stress, growth was

measured at 25 days post stress treatment. For all stress experiments, corresponding

unstressed controls were also included. The differences in plant growth, expressed as

shoot increment, among osmotin-, Gus-expressing plants and WT or NT control were

observed in all cold, drought, and salinity stresses at both stages of plant development

that stress treatments applied (Figure 5.1). At the seedling-stage, both drought and

salinity stress significantly reduced plant growth (Figure 5.1 A). However, the growth

reduction was greater in VC and WT plants, followed by OsOlp1_I plants in

comparison to TlOsm and OsOlp1_A plants. A similar trend was observed following

cold stress with TlOsm and OsOlp1_A plants was displaying significantly higher

growth rate than the OsOlp1_I, VC, and WT plants (Figure 5.1 B). Notably, TlOsm

plants showed superior growth to OsOlp1_A plants. When stress was applied before

the transition between growth and reproductive stage on the T1 generation, the growth

reduction was also observed in 100 mM NaCl and drought exposed plants, as

compared to unstressed plants (Figure 5.1 C). At this stage, all three osmotin

expressing plants exhibited significantly greater shoot growth than the NT and VC

plants. TlOsm plants exhibited leading shoot growth in both 100 mM NaCl and drought

exposure while shoot increment of OsOlp1_A plants was only comparable to that of

TlOsm plants in 100 mM NaCl treatment (Figure 5.1). Shoot growth of OsOlp1_I

plants was significantly smaller than that of OsOlp1_A and TlOsm plants in both 100

mM NaCl and drought stress treatments. The results here demonstrated that TlOsm

and OsOlp1_A plants maintained growth better than OsOlp1_I, NT and VC plants.



Figure 5.1 Relative shoot growth of WT or NT, VC and transgenic plants expressing

OsOlp1_A, OsOlp1_I, and TlOsm grown in unstressed, 100 mM NaCl, and drought stress at

seedling stage (A); in unstressed and cold stress (B); and in unstressed, 100 mM NaCl, and

drought stress at reproductive stage (C). Data present the mean + SE of three replicates. Number

of plants (n) used to calculate each mean is indicated in the corresponding charts. Data in the

same treatment category followed by different letters are significantly different at P ≤ 0.05.

5.3.2 Rice plants constitutively expressing TlOsm or OsOlp1_A produce more

tillers than WT, NT, and VC plants under cold, drought, and salinity

stresses

Tiller number is another indicative parameter for rice growth under stress with

more tillers related to higher tolerance and potentially contribute to higher yield

(Tripathi et al., 2012). Tiller number in all experiments was recorded at the same day


Sensitive Species

as plant height, i.e. day 18 for 100 mM NaCl and drought stress with corresponding

unstressed experiments and day 25 of cold stress with its unstressed control. Figure

5.2 presents number of tillers of WT, NT, transgenic plants expressing Gus-reporter

gene, OsOlp1_A, OsOlp1_I, and TlOsm in all unstressed and cold, drought, and

salinity stress treatments.

Figure 5.2 Tiller number of WT or NT, VC and transgenic plants expressing OsOlp1_A,

OsOlp1_I, and TlOsm grown in unstressed, 100 mM NaCl, and drought stress (A); in

unstressed and cold stress (B) at seedling stage; and in unstressed, 100 mM NaCl, and drought

stress at reproductive stage (C). Data present the mean + SE of three replicates. Number of

plants (n) used to calculate each mean is indicated in the corresponding charts. Data in the

same treatment category followed by different letters are significantly different at P ≤ 0.05.



No significant difference was observed in tiller numbers among the plants under

unstressed conditions in all three experiments. However, in all three stress conditions

and regardless of plant generations and developmental stages at which stresses applied,

OsOlp1_A and TlOsm plants produced significantly more tillers than OsOlp1_I, VC

and WT or NT plants. Only T1 generation and in drought stressed at reproductive stage,

tiller numbers of TlOsm plants were significantly higher than that of OsOlp1_A plants

(Figure 5.2 C). A significant difference in tiller numbers of OsOlp1_I plants compared

to VC, WT or NT plants was observed in 100 mM NaCl stress at seedling stage (Figure

5.2 A) and both 100 NaCl and drought stresses at reproductive stage (Figure 5.2 C).

Data presented in Figure 5.2 indicate that TlOsm and OsOlp1_A plants produce more

tillers than WT, NT, and VC plants under cold, drought, and salinity stresses.

Moreover, in exposure to drought stress at reproductive stage, TlOsm plants produced

significantly more tillers than OsOlp11_A plants.

5.3.3 Rice plants constitutively expressing OsOlp1_A or TlOsm retained water

better than OsOlp1_I, VC and NT or WT plants under cold, drought, and

salinity stresses

Relative water content (RWC) is considered an appropriate measurement of

plant water status that reflects the physiological consequence of cellular water deficits

(Gonzalez and Gonzalez-Vilar, 2001). Studies on rice have shown that tolerant plants

maintain higher leaf RWC during stress (Lafitte et al., 2006; Cha-um et al., 2009; Kim

et al., 2012; Zhang et al., 2014). To understand the physiological difference among

plants expressing OsOlp1_A, OsOlp1_I and TlOsm with VC, and WT or NT plants,

leaf RWC was measured in all unstressed and stressed plants. As presented in Figure

5.3, in all three sets of unstressed plants, leaf RWC of OsOlp1_A, OsOlp1_I, TlOsm,

VC, and WT or NT plants was similar. After subjection to 100 mM NaCl, drought or

cold stresses, leaf RWC of all plants was dramatically reduced, with a noticeable RWC

reduction of plants exposed to drought stress. Leaf RWC of OsOlp1_A and TlOsm was

always significantly higher than that of OsOlp1_I, VC, and WT or NT plants

regardless of stress types, transgenic generations, and developmental stages that

stresses applied. In seedling-stage stress treatments, RWC of TlOsm was significantly

higher than that of OsOlp1_A only in drought stress (Figure 5.3 A). When stresses

applied at reproductive stage on T1 transgenic plants, leaf RWC of TlOsm plants was

significantly higher than that of OsOlp1_A in both drought and salinity stresses (Figure

5.3 C). The significant difference in leaf RWC of OsOlp1_I over VC and NT plants


Sensitive Species

was observed in both drought and salinity stresses when stresses applied at

reproductive stage (Figure 5.3 C). Among stress treatments at seedling stage, leaf

RWC of OsOlp1_I plants was significantly greater than that of WT plants only in

drought stress condition (Figure 5.3 A). Previous studies have indicated the ability to

maintain higher leaf RWC during stress as advantage trait of rice stress-tolerant

cultivars. Data from these experiments proved that OsOlp1_A and TlOsm plants

exhibited better water retention under cold, drought and salinity stresses; thus

contributing to their higher stress tolerance.

Figure 5.3 Leaf relative water content (RWC) of WT or NT, VC and transgenic plants

expressing OsOlp1_A, OsOlp1_I, and TlOsm grown in unstressed, 100 mM NaCl, and

drought stress (A); in unstressed and cold stress (B) at seedling stage; and in unstressed, 100

mM NaCl, and drought stress at reproductive stage (C). Day of measurement was indicated.

Data present the mean + SE of three replicates. Number of samples (n) used to calculate each

mean is indicated in the corresponding charts. Data in the same treatment category followed

by different letters are significantly different at P ≤ 0.05.



5.3.4 Rice plants constitutively expressing osmotins maintain membrane

integrity better than VC and WT or NT plants under cold, drought, and

salinity stresses

Electrolyte leakage reflects the ability of cells to maintain membrane integrity

and has been used as an indicator of membrane damage. Lower electrolyte leakage has

been found in rice stress-tolerant cultivars (Cha-um et al., 2009; Kim et al., 2012;

Zhang et al., 2014; Das et al., 2015). Leaf electrolyte leakage was another parameter

being measured to understand the physiological difference among plants expressing

OsOlp1_A, OsOlp1_I and TlOsm with VC, and WT or NT plants. Leaf electrolyte

leakage was measured at the same day of RWC measurement in all unstressed and

stress-treated experiments and data are presented in Figure 5.4.


Sensitive Species

Figure 5.4 Leaf electrolyte leakage of WT or NT, VC and transgenic plants expressing

OsOlp1_A, OsOlp1_I, and TlOsm grown in unstressed, 100 mM NaCl, and drought stress

(A); in unstressed and cold stress (B) at seedling stage; and in unstressed, 100 mM NaCl, and

drought stress at reproductive stage (C). Day of measurement was indicated. Data present the

mean + SE of three replicates. Number of samples (n) used to calculate each mean is indicated

in the corresponding charts. Data in the same treatment category followed by different letters

are significantly different at P ≤ 0.05.

In these experiments, relative electrolyte leakage of leaf cells was calculated as

a slope of electrolytes leaked out of cells against time in 1 h increment. The greater

electrolyte leakage is associated with higher cellular damage. In three sets of plants in

unstressed conditions, electrolyte leakage values were very small (range from 0.02 to

< 0.1, dependent on stages) and similar across the transgenic OsOlp1_A, OsOlp1_I,



TlOsm, and VC, and WT or NT plants. Under stress, these values sharply increased.

There was a noticeable increase in electrolyte leakage of drought stressed plants. The

values of OsOlp1_A and TlOsm plants were always smaller than those of OsOlp1_I,

VC, and WT or NT plants. Electrolyte leakage from TlOsm tissues was significant less

than from OsOlp1_A tissues during cold stress at the seedling stage and at both drought

and salinity stress at the reproductive stage. Except for cold stress, OsOlp1_I cells had

significantly less electrolyte leakage than that of the WT or NT plants in drought and

salinity stress at both seedling-stage and reproductive stage stress treatments. The

results on electrolyte leakage measurement demonstrated that TlOsm and OsOlp1_A

plants maintained the membrane integrity better than OsOlp1_I, VC, and WT or NT

plants. This ability of TlOsm plants was found to be superior to that of OsOlp1_A

plants when exposed to cold stress at the seedling stage and drought and salinity

stresses at the reproductive stage.

5.3.5 Rice plants constitutively expressing TlOsm or OsOlp1_A maintained

photosynthesis efficiency under drought and salinity stresses

Photosynthesis is a basic physiological process plants use to produce energy for

their development and coping with environmental challenges. Abiotic stresses leading

to photosynthesis reduction and ultimately inhibition have been well documented in

rice (Babu, 2010; Zhang et al., 2014; Das et al., 2015). Stress tolerant rice cultivars

maintain higher photosynthetic activity during stress (Moradi et al., 2007). To

investigate the physiological differences among transgenic plants expressing Gus-

reporter gene, OsOlp1_A, OsOlp1_I, and TlOsm and NT plants, photosynthetic

parameters were measured in the plants exposed to drought and salinity stresses at

reproductive stage together with corresponding unstressed control. Photosynthetic

measurements were carried out from day 0 to day 21 of stress exposure for salinity

stressed plants and unstressed control; and to day 18 for drought stressed plants.

Photosynthesis data of these plants are presented in Figure 5.5. As shown in Figure

5.5.A, in unstressed conditions, net photosynthesis of TlOsm plants was significantly

lower that of OsOlp1_I, NT and VC plants during the course of measurement. The

significantly higher photosynthesis rates of OsOlp1_A plants over TlOsm plants were

also detected at day 0, 3, 18, and 21. Net photosynthesis of OsOlp1_A plants was found

lower than NT plants at day 0 and day 12. There were some variations in

photosynthesis rate among different times of measurement, probably due to the


Sensitive Species

changes in developmental stages. Under unstressed condition, panicle initiation started

at around day 6 with the appearance of flag leaf and at day 18, 36% of OsOlp1_I, NT

and VC plants flowered. Thus, from day 12 to day 21 photosynthesis was measured

on flat leaves of unstressed plants. When exposed to 100 mM NaCl (Figure 5.5 B),

photosynthesis of OsOlp1_I, NT and VC plants was significantly reduced since day 6

with a sharp reduction from day 12. Photosynthesis reduction was also observed in

OsOlp1_A and TlOsm plants but with smaller reduction and at the later stage (day 12).

Photosynthesis rate of OsOlp1_A and TlOsm plants was similar from day 12 to day 21,

which was significantly higher than NT and VC plants. Significant lower

photosynthesis rate of OsOlp1_I in comparison to OsOlp1_A and TlOsm plants was

found from day 18 to day 21. A similar trend of photosynthesis rate was observed

when plants exposed to drought stress (Figure 5.5 C). At day 6 of withholding water,

photosynthesis of OsOlp1_I, NT and VC plants was significantly reduced and

continued to reduce to very low rate (about 10% of normal levels) at day 18. OsOlp1_A

maintained normal photosynthesis efficiency until day 6 of withholding water, then

declined but kept significantly greater than those of OsOlp1_I, NT and VC plants.

Photosynthesis rates of TlOsm plants were only significantly decreased after day 12 of

withholding water. At the end of drought stress period (day 18), net photosynthesis of

TlOsm plants was highest, followed by OsOlp1_A plants and significantly

distinguished with those of OsOlp1_I, NT and VC plants. During the course of drought

stress, OsOlp1_I plants did not show any difference in photosynthesis rate in compared

to NT and VC plants. TlOsm and OsOlp1_A`plants maintain better photosynthesis

efficiency than OsOlp1_I, NT and VC plants under drought and salinity stresses

suggesting that this is one of the strategies TlOsm and OsOlp1_A plants used to cope

with drought and salinity stresses.



Figure 5.5 Net photosynthesis of NT, VC and transgenic plants expressing OsOlp1_A,

OsOlp1_I, and TlOsm grown in unstressed (A) and exposure to 100 mM NaCl (B) and drought

stress (C) at reproductive stage. Data present the mean ± SE of nine observations. * indicates

significant difference at P ≤ 0.05.

Transpiration is the process of water loss through stomata. The trends of

transpiration of OsOlp1_A, OsOlp1_I, TlOsm, VC and NT plants under unstressed,

salinity and drought conditions (Figure 5.6) were similar as those of photosynthetic

activity. Under unstressed condition (Figure 5.6 A), TlOsm plants exhibited lower

transpiration rate than OsOlp1_I, VC and NT plants. Transpiration rate of OsOlp1_A

was lower than those of OsOlp1_I, VC and NT plants but higher than TlOsm plants.

As shown in Figure 5.6 B, at the first 6 days of exposure to 100 mM NaCl, transpiration

rate of OsOlp1_I, VC and NT plants remained the levels similar to unstressed and


Sensitive Species

significantly higher than that of TlOsm plants. Since day 12, transpiration rate of these

plants dramatically decreased. TlOsm and OsOlp1_A plants had smaller values of

transpiration rate at the first 6 day of NaCl exposure, their significant transpiration

decrease compared with before stress was found at day 18. The reduction in

transpiration rate of TlOsm and OsOlp1_A plants was slower than that of OsOlp1_I,

VC and NT plants, resulting in their significant higher transpiration rate from day 12

to day 21. Similarly, transpiration rate of all plants sharply decreased after 6 days of

withholding water (Figure 5.6 C), but the reduction rate was faster for the OsOlp1_I,

VC and NT plants, resulting in their significant lower transpiration rate in compared

with that TlOsm and OsOlp1_A plants since day 12.

Figure 5.6 Transpiration rate of NT, VC and transgenic plants expressing OsOlp1_A,

OsOlp1_I, and TlOsm grown in unstressed (A), exposure to 100 mM NaCl (B) and drought





Transpiration partially reflects the plant photosynthesis activity and water

balance. TlOsm and OsOlp1_A plants have lower levels of transpiration rate in

unstressed and at beginning of stress period would help in retaining water. At the later

stages of drought and salinity stresses, transpiration remained higher than OsOlp1_I,

VC and NT plants, suggesting their photosynthesis machinery was still active.

In plant, stomata control gas exchange between plant and atmosphere, thus drive

CO2 influx into leaves for photosynthesis and water vapour as transpiration. Regulation

of stomatal movement is a central mechanism to maintain photosynthesis efficiency and

water balance in plants exposure to osmotic stress (Belin and Thomine, 2010). To

understand the cause of variations in photosynthesis and transpiration among plants,

stomatal conductance of OsOlp1_A, OsOlp1_I, TlOsm, VC and NT plants under

unstressed, salinity and drought conditions was calculated and presented in the Figure 5.7.

Figure 5.7 Stomatal conductance of NT, VC and transgenic plants expressing OsOlp1_A,

OsOlp1_I, and TlOsm grown in unstressed (A), exposure to 100 mM NaCl (B) and drought




Sensitive Species

In unstressed conditions, stomatal conductance of TlOsm plants was

significantly lower than that of OsOlp1_I, VC and NT plants during the course of

measurement, and also of OsOlp1_A plants at day 0, day 18 and day 21. When exposed

to 100 mM NaCl, stomatal conductance of OsOlp1_I, VC and NT plants was reduced

with a noticeable reduction after day 6, while that of TlOsm plants found significant

difference with before stress only from day 18, and of OsOlp1_A from day 12. Since

day 12, conductance of OsOlp1_A and TlOsm plants was similar and significantly

higher than that of NT and VC plants. The conductance of OsOlp1_I plants was found

higher than that of the NT and VC plants only at day 12 and 18, but declined to the

same level at day 21. Similarly, six days after water was withheld, stomatal

conductance of all plants was declined. However, TlOsm plants maintained the highest

values of stomatal conductance, followed by OsOlp1_A, OsOlp1_I; the NT and VC

had the same lowest values. Regulation of stomatal closure is one of the mechanisms

plants use to tolerate osmotic stresses by reducing water loss and balancing

photosynthesis process. Constitutive expression of TlOsm or OsOlp1_A in rice resulted

in transgenic plants with lower stomatal conductance, suggesting that functions of

TlOsm and OsOlp1_A I are linked to stomatal regulation. At the later stages of drought

and salinity stress exposure, TlOsm and OsOlp1_A plants maintained significant

higher stomatal conductance than OsOlp1_I, NT and VC plants. The results here once

support that the photosynthesis machinery was still active in TlOsm and OsOlp1_A

plants in these stress treatments.

5.3.6 Stressed rice plantlets constitutively expressing TlOsm or OsOlp1_A

showed heathier morphological appearance than VC and WT

The phenotypic differences among TlOsm, OsOlp1_A, OsOlp1_I, WT and VC

plants were apparent in all cold, drought and salinity stress conditions applied at

seedling stage. Figure 5.8 shows the images capturing morphology of representative

plants before and after a given period of stress exposure. Before entering stress

treatments, plants were selected at the same stage and their morphologies were similar

across all OsOlp1_A, OsOlp1_I, TlOsm, VC, and WT plants (Figure 5.8 A and B).

Eighteen days later, in unstressed conditions all plants looked equally healthy except

for shorter shoots of TlOsm plant (Figure 5.8 C). However, upon drought (Figure 5.8

E) and salinity (Figure 5.8 F) stresses, VC and WT plants completely stopped tillering,

leaves yellowing or discoloured while the TlOsm and OsOlp1_A plants had more



tillers, plants were greener, only the leaf tips damaged but entire leaves. OsOlp1_I

plants were healthier than VC and WT plants but were not comparable to TlOsm and

OsOlp1_A plants. Similarly, after 25 days undergone cold stress (Figure 5.8. D),

OsOlp1_I, WT and VC plants had severely damaged appearance and the death of

youngest leaves while TlOsm and OsOlp1_A had less leaf and stem damages and had

more tillers.

Figure 5.8 Morphology of T0 rice plants under cold, drought and salinity stresses at

seedling stage. Images A and B were taken right before plants undergone unstressed, 100 mM

NaCl, and drought stress for three weeks (A) or unstressed and cold stress for 4 weeks (B). C, E,

and F: representatives of plants in (A) after 18 days undergone unstressed, drought, and salinity

stress respectively. D: Representative of plants in (B) after 25 days undergone cold stress.


Sensitive Species

Four weeks after germination when transgenic status was confirmed, T1 rice

plants grown in 50-ml pots were selected at similar size and at 5-leaf stage and were

transplanted into 1.2-L pots. Plants were grown for further 2 weeks in glasshouse

condition before the stresses applied. The day before stress exposure (day 0),

appearance of all plants was similar but the shorter shoots of TlOsm plants could be

observed (Figure 5.9 A). At this time, all plants typically had 3 tillers. After 18 days

of withholding water (Figure 5.9 B), leaves of NT, VC and OsOlp1_I plants were

completely rolled and discoloured, their newly-developed tillers were dried despite

their stems of main culm survived. Most leaves of TlOsm plants and some of

OsOlp1_A plants stayed expended and relatively greener, some of their newly-

developed tillers stayed alive, their stems were greener and looked healthier than those

of NT, VC and OsOlp1_I plants. After exposure to 100 mM NaCl for 28 days (Figure

5.9 B), severe senescence was observed in NT, VC and OsOlp1_I plants but not in

TlOsm and OsOlp1_A plants. TlOsm and OsOlp1_A plants looked similar in term of

green appearance and tillering.



Figure 5.9 Morphology of T1 rice plants and panicles under unstressed, drought and

salinity stresses when plants exposed to stresses at reproductive stage. A: plants before

stress treatment; B-C: representatives of plants in (A) after 18 days under drought (B) and

28 days exposed to salinity stress (C) respectively. D-F Representative of panicles in plants

undergone unstressed (D), drought (E) and salinity stress (F).

5.3.7 Rice plants constitutively expressing TlOsm or OsOlp1_A resulted in higher

dry biomass under cold, drought, and salinity stresses

Dry biomass of TlOsm, OsOlp1_A, OsOlp1_I, VC, and WT or NT plants was

determined at the end of stress periods, i.e. day 21 for plants in set 1 exposed to drought

and salinity stress at seeding stage, day 28 for plants in set 2 exposed to cold stress at

seeding stage, and day 28 for T1 plants with stresses applied at reproductive stages,

together with corresponding unstressed controls. As a result of growth arrest under


Sensitive Species

stresses, dry biomass was dramatically reduced in all TlOsm, OsOlp1_A, OsOlp1_I,

VC, WT, and NT plants in all stress conditions (Table 5.2 and 5.3). However, the

reduction in dry biomass was smaller for TlOsm plants, followed by OsOlp1_A,

OsOlp1_I plants and equally higher for VC and WT or NT plants. As shown in Table

5.2, when stresses were applied at seeding stage, dry biomass of TlOsm plants reduced

by 1.21, 1.22, and 1.66 fold for drought, salinity, and cold stress, respectively, in

comparison with corresponding unstressed control. But reduction was 2.58, 2.21, 3.50

fold for WT and 2.50, 2.18, and 2.47 for VC plants, in the same order. Dry biomass of

TlOsm plants was significantly greater than that of OsOlp1_A plants in drought and

cold stresses, but not in salinity stress. OsOlp1_I plants only produced significantly

higher dry biomass than WT plants in salinity stress.

Table 5.2 Dry biomass of plants in seedling-stage stress treatment experiments

Experiment Plants Dry biomass1 per plant (mg)

Seedling

stage plant

set 1, day 21

Unstressed Drought Salinity

OsOlp1_A 525a ± 18.9 343b ± 18.9 353a ± 20.5

OsOlp1_I 535a ± 23.1 281c ± 25.8 271b ± 18.2

TlOsm 472b ± 19.1 390a ± 28.8 386a ± 17.3

VC 562a ± 22.4 257c ± 19.6 245bc ± 15.6

WT 559a ± 15.3 253c ± 44.7 216c ± 15.7

Seedling

stage

plant set 2,

day 28

Unstressed Cold

OsOlp1_A 585a ± 13.1 218b ± 12.9

OsOlp1_I 575a ± 10.0 175c ± 10.8

TlOsm 488b ± 13.7 294a ± 12.6

VC 567a ± 11.7 166c ± 9.1

WT 584a ± 27.1 167c ± 19.2 1 data represent mean ± SE of 54 plants. Data in the same treatment category followed by

different letter are significantly different at P ≤ 0.05.



Table 5.3 Dry biomass of plants in reproductive-stage stress treatment experiments

Plants Dry biomass1 per plant (mg)

Unstressed Drought Salinity

NT 1652a ± 48 802

cd ± 36 875

c ± 38

OsOlp1_A 1598ab

± 53 1034b ± 35 1118

a ± 47

OsOlp1_I 1676a ± 51 876

c ± 39 998

b ± 56

TlOsm 1537b ± 46 1157

a ± 35 1093a ± 38

VC 1692a ± 55 795

d ± 32 895

bc ± 55

1 data represent mean ± SE of 15 plants. Data in the same treatment category

followed by different letters are significantly different at P ≤ 0.05.

Consistent with results in seedling-stage stress treatment, drought and salinity stresses

applied at the reproductive stage also sharply decreased dry biomass of all plant types (Table

5.3). Under drought stress TlOsm plants still produced highest dry biomass, followed by

OsOlp1_A plants, and both had significantly higher dry biomass than NT, VC and OsOlp1_I

plants. Under salt stress, dry biomass of TlOsm and OsOlp1_A was not different but

significantly higher than that of NT, VC and OsOlp1_I plants. Dry biomass of OsOlp1_I

plants was found greater than VC plants in drought stress, and NT plants in salinity stress.

5.3.8 Constitutive expression of TlOsm or OsOlp1_A improves survival rate

under salinity, drought and cold stress in transgenic rice.

After stress treatment, the plants were recovered and the survival rates were assessed

after 3 weeks of recovery (Figure 5.10). For salinity stress, the rates of survival plants were

42.22%, 45.56%, 50%, 70% and 74.44% for WT, VC, OsOlp1_I, OsOlp1_A, and TlOsm

plants respectively (Figure 5. 10 A); while that rates were 24.07%, 28. 40%, 48.15%, 76.54%

and 86.42% for drought stress (Figure 5.10 C). In cold stress, a symptom commonly observed

in WT and VC plants was that in the same plant the newly emerging (youngest) leaves died

while the mature leaves and stems remained alive. The tillers with the youngest leaf mortality

stopped growth and panicle initiation that ultimately became infertile. Despite the severe

effects under cold stress, in recovery, plants with infertile tillers continued tillering and new

tillers developed normally in recovery conditions and that resulted in relatively high survival

rates of cold stressed plants, compared to drought and salinity stresses (Figure 5. 10 E). The

plants with infertile tillers had less grain yield. In this respect, 75.71% TlOsm plants and 63%

of OsOlp1_A plants recovered without infertile tillers, while that rates were only 25.4%,

22.95% and 21.32% for OsOlp1_I, VC, and WT plants.


Sensitive Species

Figure 5.10 Survival rate and morphology of rice plants recovered from stress treatments

at seeding stage. A & B: salinity, C&D: drought, E & F: cold. Data present the mean + SE of

81 plants in three replicates. Data in A, C, and E followed by different letters are significantly

different at P ≤ 0.05.

In recovery, TlOsm and OsOlp1_A plants showed greener and healthier

appearance and had more tillers than the OsOlp1_I, VC, and WT plants (Figure 5.10

B, D & F). The significant higher survival rate and healthier recovery of TlOsm and

OsOlp1_A plant under these three stress conditions demonstrated that TlOsm and

OsOlp1_A enhanced tolerance to cold, drought, and salinity stresses in transgenic rice.



5.3.9 Constitutive expression of TlOsm or OsOlp1_A improved yield under

drought and salinity in transgenic rice

Morphologically, panicles and seeds of TlOsm, OsOlp1_A, OsOlp1_I, VC and

NT plants developed normally under unstressed condition with shorter panicle length

and condensed distribution of seeds found in TlOsm plants (Figure 5.9 D). In both

drought and salinity stress, panicles were shorter and seeds were smaller for all TlOsm,

OsOlp1_A, OsOlp1_I, VC and NT plants (Figure 5.9 E & F). Additionally, many

brown spots were observed on filled seeds of salt stressed plants (Figure 5.9 F),

probably due to the consequence of oxidative stress.

The parameters used in this study for evaluating yield are indicative components

contributing to rice grain yield (Tripathi et al., 2012). Yield components were

calculated for all plants in drought, salinity, and unstressed experiments when stressed

applied at reproductive stage and data are presented in Table 5.4. In drought-stressed

plants, TlOsm plants had leading values in all observed parameters, including number

of panicles per plant, panicle length, and number of spikelets per panicle, percentage

of filled seeds, total filled seeds per plant and seed weight (expressed as weight of 100

seeds). Both TlOsm and OsOlp1_A plants produced significantly higher values of yield

components than OsOlp1_I, VC, and NT plants. Panicle length and number of

spikelets per panicle of OsOlp1_A were comparable to those of TlOsm plants.

However, OsOlp1_A plants produced significantly less panicles than TlOsm plants and

the percentage of filled seeds was also significantly smaller in OsOlp1_A than in

TlOsm plants. These resulted in significant less seeds per plant of OsOlp1_A plants as

compared to TlOsm plants. In addition, OsOlp1_A seed weight was significantly

smaller than that of TlOsm. This would further contribute to less grain yield of

OsOlp1_A plants.

Similarly, in salinity stress all the yield components of TlOsm and OsOlp1_A

were significant higher than those of OsOlp1_I, VC, and NT plants. Across all yield

parameters, values of TlOsm and OsOlp1_A plants were comparable under salinity

stress conditions. As compared with applied drought stress conditions, values of all

yield parameters of each type of plants were higher in applied salinity stress conditions.

This indicates that the drought treatment has severer effects on rice yield than the

salinity treatment.


Sensitive Species

In unstressed conditions, there was no difference in number of panicles per plant,

number of spikelets per panicle, percentage of filled seeds, and total seeds per plant

among TlOsm, OsOlp1_A, OsOlp1_I, NT, and VC plants, despite significantly shorter

panicle length was observed for both TlOsm and OsOlp1_A. However, seed weight of

TlOsm and OsOlp1_A plants was significantly smaller, with the lowest value for

TlOsm seeds.

Results on yield components here demonstrate that constitutive expression of

either TlOsm or OsOlp1_A improved rice yield under drought and salinity stress.

Significant higher yield of TlOsm plants over OsOlp1_A was observed in drought

stress.

Chapter 5: Comparative Analysis of Transgenic Rice Constitutively Expressing Osmotins from Tolerant and Sensitive Species 139

Table 5. 4 Yield components of TlOsm, OsOlp1_A, OsOlp1_I, VC and NT (control) plants under unstressed, drought, and salinity stress conditions

A) Drought stress

Plants # of panicles/plant Panicle length (cm) # of spikelets/panicle Filled seeds (%) # of seeds/plant 100-seed weight (mg)

NT 1.93d ± 0.27 13.07

b ± 0.31 38.76

b ± 2.19 35.12

c ± 4.01 28

c ± 4 1669

c ± 14

OsOlp1_A 3.40b ± 0.16 13.85

a ± 0.26 45.84

a ± 1.57 57.69

b ± 3.22 92

b ± 7 1752

b ± 16

OsOlp1_I 2.87c ± 0.20 13.19

b ± 0.17 38.72

b ± 1.41 26.72

c ± 3.42 30

c ± 5 1651

c ± 15

TlOsm 4.73a ± 0.19 13.82

a ± 0.11 44.10

a ± 1.02 74.25

a ± 2.96 155

a ± 6 1790

a ± 9

VC 2.40d ± 0.22 13.21

b ± 0.18 37.04

b ± 1.45 30.78

c ± 3.16 29

c ± 4 1654

c ± 12

B) Salinity stress


NT 2.87c ± 0.20 13.02

b ± 0.19 40.62

b ± 1.27 47.02

b ± 3.14 53

b ± 4 1763

b ± 11

OsOlp1_A 5.87a ± 0.17 13.64

a ± 0.15 43.97

a ± 0.99 73.58

a ± 2.35 191

a ± 7 1825

a ± 8

OsOlp1_I 3.67b ± 0.19 12.87

b ± 0.15 39.15

b ± 2.16 40.55

b ± 3.77 58

b ± 3 1782

b ± 10

TlOsm 5.93a ± 0.16 13.77

a ± 0.11 45.15

a ± 0.79 74.06

a ± 2.45 197

a ± 7 1816

a ± 7

VC 2.93c ± 0.24 13.16

b ± 0.14 41.65

b ± 0.94 45.32

b ± 2.90 55

b ± 6 1772

b ± 9

C) Unstressed


NT 9.20ns

± 0.46 16.61a ± 0.23 66.68

ns ± 2.75 84.13

ns ± 1.98 515

ns ± 19 2190a ± 31

OsOlp1_A 8.93ns

± 0.51 16.04b ± 0.28 66.15

ns ± 2.51 84.47

ns ± 1.83 497

ns ± 18 2109

b ± 24

OsOlp1_I 8.33ns

± 0.45 16.45ab

± 0.25 70.08ns

± 3.57 86.26ns

± 1.74 503ns

± 16 2214a ± 22

TlOsm 8.73ns

± 0.30 15.07c ± 0.27 65.48

ns ± 3.40 87.62

ns ± 1.66 489

ns ± 21 2042

c ± 25

VC 8.60ns

± 0.31 16.53a ± 0.19 66.88

ns ± 2.78 83.79

ns ± 2.21 495

ns ± 20 2170

a ± 23

Data represent mean ± SE. Data in the same treatment category followed by different letter are significantly different at P ≤ 0.05; ns: none significance



5.4 DISCUSSION

Rice is one of the most sensitive crops to abiotic stress. Countless efforts have

been made to improve abiotic stress tolerance in rice through conventional breeding

and the supports of advanced molecular assisted breeding techniques. Attempts in rice

abiotic-stress-tolerant improvement have resulted in various commercial cultivars

adapted to a wide range of rice cultivation areas but the success has reached the

limitations (Das et al., 2015; Sankar et al., 2011; Swamy and Kim 2013). Genetic

engineering allows researchers to breach species boundaries and incorporate genes

from other species for enhancing abiotic stress tolerance. Incorporation of stress-

responsive genes from naturally tolerant species for engineering rice with enhanced

abiotic stress tolerance is essential to add adaptive traits into this species. In Chapter

3, an osmotin (TlOsm) from desiccation tolerant plant, T. loliiformis, was characterised

and proven to respond to cold, drought, and salinity stresses. In Chapter 4, transgenic

rice plants constitutively expressing TlOsm, OsOlp1-A, OsOlp1_I and Gus-reporter

gene as control were generated. This chapter investigated the response of these rice

plants under different stress and unstressed conditions.

The first aim was to validate if constitutive expression of TlOsm in rice confers

tolerance to drought, salinity and cold stresses. Secondly, OsOlp1-A and OsOlp1_I

were isolated from drought-tolerant and -sensitive cultivars Apo and IR64,

respectively. The two genes encode two proteins containing high (96%) homology at

the AA sequence level but are differentially expressed upon drought; only OsOlp1-A

is induced by drought. Functional predictions based on sequences and structures of

these three osmotins revealed different number of glucan-binding and phosphorylation

sites among them. Thus, comparatively analysing rice plants expressing these three

osmotins might reveal the key insights into osmotin functions and effects of functional

binding sites on enhancing plant stress tolerance. To date, only one study by Mani et

al. (2012) compared two Piper colubrinum osmotins, which are different in five

glucan-binding sites, on their differential antifungal activities. According to the study,

the two osmotin isoforms differ in 50 AA that results in disorder in domains I and III

and less glucan-binding sites in the smaller isoform (22 sites in the larger isoform vs.

17 sites in the smaller one). Both isoforms were transcriptionally expressed by

pathogen, wounding, jasmonic acid, and ethylene. However, recombinant protein of

smaller isoform displayed much less activity against Phytophthora capsici and


Sensitive Species

Fusarium oxysporum as compared to the larger isoform in in vitro conditions. The loss

of antifungal activity of the smaller isoform was presumably due to the disorder in

domain I and III. Thus, this study extended the possible effects of glucan-binding sites

of osmotins on their functions in regulating plant response to abiotic stresses including

cold, drought, and salinity. Thirdly, it has been proposed that genes from highly stress

tolerance species would provide more level of tolerance over those of stress sensitive

species. Additional glucan-binding and phosphorylation sites together with unique

functional sites in sugar metabolism were found in TlOsm compared to rice osmotins.

Some stress-responsive proteins of resurrection plant have been demonstrated to

maintain phosphorylation reaction during desiccation and this reaction has been

believed to be required for cellular protection during desiccation tolerance (Rohrig et

al., 2006; Dinakar and Bartels, 2013). Thus, high number of phosphorylation sites of

TlOsm might contribute to its function in regulating plant adaptive response.

Furthermore, accumulation of soluble sugars at remarkably high levels during

desiccation tolerance is a distinct characteristic of resurrection plants (Alpert and

Oliver, 2002; Dinakar and Bartels, 2013; Gaff and Oliver, 2013). The unique binding

sites with potential functions in sugar metabolism of TlOsm might be beneficial for

its modulation of plant stress response. Hence, analysing the advantage in abiotic stress

response of TlOsm expressing plants over OsOlp1-A or OsOlp1_I expressing plants

was also included in this study.

5.4.1 TlOsm and OsOlp1_A confers tolerance to cold, drought and salinity stresses

in rice

Previous studies have indicated that the effects of cold, drought, and salinity

stresses are more severe to rice when they occur at seedling stage, before tillering, and

at the transition between growth stage and reproductive stage (Lafittle et al., 2004; Das

et al., 2015). Therefore, these two stages were chosen for the assessments in this study.

Throughout the stress experiments, the control plants, NT or WT of rice Nipponbare

cultivar exhibited severe growth reduction, less tillering, leaf senescence and dry,

reduced leaf water retention, severe membrane damage, photosynthesis inhibition,

decreased survival rate, reduced panicle number and length, less spikelets, inadequate

grain filling, and reduced seed weight. The severe effects of salinity, drought, and cold

stresses on rice growth and reproductivity were sharply improved by expressing either

TlOsm or OsOlp1_A in the same rice cultivar. The only difference among the transgenic



plants were the genes they express; while WT and NT differed from transgenic plants

by the absence of transgenes. Thus, the enhanced tolerance to cold, drought, and salinity

stresses of TlOsm and OsOlp1_A plants must be a consequence of TlOsm or

OsOlp1_A functions. Moreover, the enhanced stress tolerance of TlOsm and

OsOlp1_A plants was constant through two successive generations of transgenic rice,

the T0 and T1, suggesting that the tolerant traits were passed on next generations.

Shoot growth, tillering, dry biomass, number of panicle per plants, number of

spikelets, and percentage of filled seeds per panicle were all found to directly

contribute to final grain yield of rice. These parameters together with survival rate and

plant overall health were recommended as effective parameters to evaluate abiotic

stress tolerance in rice (Singh et al., 2013). Regardless of transgenic generation and

developmental stages on which stresses applied, as compared to VC and WT or NT,

TlOsm and OsOlp1-A plants constantly maintained significantly higher shoot growth

(Figure 5.1) and produced greater number of tillers (Figure 5.2) under cold, drought,

and salinity conditions. As a result of higher growth and tillering, dry biomass of

TlOsm and OsOlp1-A plants was significantly higher than that of VC and WT or NT

(Table 5.2 & 5.3). The purpose of investigating stress response at seedling stage was

to observe the survival ability of plants after certain period of stresses and their

recovery capability. Under all cold, drought, and salinity stresses, the survival rate of

TlOsm and OsOlp1_A plants was by far higher than of the VC and WT plants. The

recovered TlOsm and OsOlp1_A plants were taller, greener and had more tillers than

the VC and WT plants (Figure 5.10). In the case of cold stress, the percentage of plants

recovered without the infertile tillers was improved in TlOsm and OsOlp1_A plants,

which would further reduce yield loss in cold stressed plants. Rice was found more

tolerant to abiotic stress at the tillering stage (Singh et al., 2010). Thus, the same

concentration of NaCl stress and mild drought applied at the tillering stage on T1

generation of transgenic rice did not cause plant death but ultimately caused severe

reduction on grain yield. Once again, this severe grain yield reduction was significantly

improved when expressing either TlOsm or OsOlp1-A in the same rice cultivar (Table

5.4). Taken all together, the results from these experiments proved that TlOsm and

OsOlp1_A confer tolerance to cold, drought, and salinity stresses. In the same genetic

background of Nipponbare cultivar for all tested plants, the tolerance to cold, drought,

and salinity stresses was enhanced in only TlOsm and OsOlp1_A plants. Thus, the


Sensitive Species

tolerance of TlOsm and OsOlp1_A plants must be a consequence of TlOsm or

OsOlp1_A expression. Results here demonstrated that both TlOsm and OsOlp1_A

played key roles in the tolerance to cold, drought, and salinity stresses in rice.

Intensive studies on transgenic plants expressing osmotins have proven the

physiological functions of osmotins in plant tolerance, but little is known about how

osmotins regulate plants tolerant to abiotic stresses. For example, tolerance to cold

stress of transgenic tomato expressing tobacco osmotin was accompanied by

increasing transcript abundance of some stress responsive genes such as transcription

factor (CBF1), osmotic adjustment (P5CS), and ROS scarvenger (APX) and the

accumulation of osmoprotectants proline and antioxidant ascorbate (Patade et al.,

2013). Drought tolerance of soybean expressing osmotin from Solanum nigrum was

associated with increased leaf water retention and maintained photosynthesis activities

(Weber et al., 2014). Similarly, enhanced salinity tolerance of transgenic chili pepper

expressing tobacco osmotin was linked to increased chlorophyll content, osmolyte

accumulation, antioxidant enzyme activities, and water retention, and decreased

membrane damage (Subramanyan et al., 2011). Generally, cold, drought, and salinity

tolerance of other transgenic osmotin plants were associated with molecular,

biochemical, and physiological changes. Molecular changes are linked to the

transcriptional activation of stress responsive genes, which function as transcription

factor, ROS scarvenger, and osmoprotectants (Patade et al., 2013). Biochemical

changes are associated with accumulation of osmolytes and non-enzymatic

antioxidants, increased activities of antioxidative enzymes, and higher chlorophyll

content (Husaini and Abdin, 2008; Goel et al., 2010; Subramanyam et al., 2011; Das

et al., 2011; Subramanyam et al., 2012; Patade et al., 2013; Bhattacharya et al., 2014;

Annon et al., 2014; Weber et al., 2014). Regardless the source of osmotins and plant

species expressing osmotins, in these studies the common physiological alterations in

osmotin expressing plants include increased water retention, maintain membrane

integrity, and maintain photosynthesis activities. Based on these changes of osmotin-

expressing plants, it has been proposed that osmotins function as a regulator in stress-

signalling pathway that modulates the expression of downstream stress-responsive

genes leading to accumulation of adaptive compounds and resulting in stress-adaptive

physiological traits (Husani and Rafiqi, 2012; Viktorova et al., 2012; Kumar et al.,

2015). Although molecular and biochemical changes were not measured in TlOsm and



OsOlp1_A plants, the physiological changes in rice plants expressing TlOsm and

OsOlp1_A were in agreement with those reported for other osmotin-expressing

plants. Therefore, we would expect TlOsm and OsOlp1_A to have similar functions

in regulating plant stress response, as other osmotins.

To the extent of this study, the levels of enhanced rice stress tolerance

positively correlated with the number of glucan-binding sites of osmotins they

expressing. TlOsm has the highest number of potential glucan-binding, 8 sites (Table

3.2) and TlOsm plants showed the highest level of stress tolerance. As compared with

OsOlp1_I, OsOlp1_A has three more glucan-binding sites (five for OsOlp1_A

vs. two for OsOlp1_I). As shown throughout the study, OsOlp1_A plants

significantly improved tolerance to cold, drought, and salinity stresses over OsOlp1_I

plants. It is accepted that glucan-binding residues around acidic cleft of osmotin

structure are required for osmotin antifungal activities (Prasath et al., 2011; Mani et

al., 2012). However, in plant abiotic stress response, osmotin functions linked with the

glucan-binding and hydrolysing activities remain to be elucidated. The responses of

transgenic rice expressing each of the three osmotins to cold, drought, and salinity

stress revealed from this study highlight a correlation of the number of glucan-binding

sites of osmotins and their efficacy in enhanced rice tolerance to cold, drought, and

salinity stress.

5.4.2 Retaining water, maintaining membrane integrity, and maintaining

photosynthesis activities are some strategies TlOsm and OsOlp1_A plants

used to cope with cold, drought, and salinity stresses.

Unlike drought condition where water is unavailable in root zone for plants to

uptake, in cold and salinity stress, water is available in root zone but the physiological

changes and the ion toxicity lead to the restriction of water-uptake ability of plants and

resulted in reduced cellular water potential. The common consequences of plants

exposed to cold, drought and salinity are cellular osmotic stress (Huang et al., 2012).

However, the stress-adaptive plants are able to cope with stresses by regulating

osmotic adjustment (Xiong and Zhu, 2002). RWC has been identified as a useful

measurement of plant water status in terms of the physiological consequence of

cellular water deficit, due to both leaf water potential and osmotic adjustment ability

are considered in the measurement (Gonzalez and Gonzalez-Vilar, 2001). In these

experiments, rice plants exposed to all cold, drought and salinity stresses either at


Sensitive Species

seedling or reproductive stage resulted in sharp decrease of leaf RWC. TlOsm- or

OsOlp1_A- expressing tissues had significantly higher RWC than those of WT and VC

under these stresses (Figure 5.3), indicating that they have better strategy for retaining

water in their tissues under osmotic stress. Ability to maintain water under stress has

been considered as an advantage trait for selection of rice cultivars tolerant to osmotic

stress (Cha-um et al., 2009; Dionisio-Sese and Tobita, 1998; Kim et al., 2012; Zhang

et al., 2014). Osmotic adjustment for retaining cell water under osmotic stress seems

to be one of the physiological mechanisms TlOsm and OsOlp1_A plants used to cope

with osmotic stress. Thus, functions of TlOsm and OsOlp1_A are likely linked with

the regulation of osmotic adjustment. In coping with osmotic stress, adaptive plants

use osmolytes in water replacement, glass formation, and chemical stability for

protection of biomolecules and osmotic adjustment (Agarwal et al., 2013). Proline is

one of the osmolytes repeatedly found to accumulate in osmotin-expressing plants.

The gene encoding a proline synthetic enzyme, the ∆1-Pyrroline 5 - Carboxylate

Synthase (P5CS), was found to be sharply activated in cold tolerant tomato expressing

tobacco osmotin (Patade et al., 2013). Hence, it is in agreement with reported functions

of osmotins that TlOsm and OsOlp1_A mediate osmotic adjustment in osmotic-

stress-exposed rice leading to higher water retention.

The cell membrane is the primary site for perception of environmental stress

signals. Under osmotic stress, plant cells generate excessive ROS production that

facilitates lipid peroxidation, resulting in membrane damage and further loss of cell

membrane integrity. One of the mechanisms plants adapted to stresses is developing a

number of changes to maintain the membrane intact (Mansour, 2013). The ability of

maintaining membrane integrity has been considered a key to conferring tolerance to

cold, drought and salinity stresses in plants (Manavalan and Nguyen, 2012; Shabala

and Munns, 2012; Zhang et al., 2014). Monitoring electrolyte leakage has been

commonly used to reflect the level of membrane damage (Bajji et al., 2002). In rice,

measurement of leaf electrolyte leakage has been used as characteristic to screen the

stress tolerant cultivars with lower electrolyte leakage indicating higher stress

tolerance (Cha-um et al., 2009; Dionisio-Sese and Tobita, 1998; Kim et al., 2012;

Zhang et al., 2014). In this study, electrolyte leakage was measured from leaves of

TlOsm, OsOlp1_A, OsOlp1_I, VC, and WT or NT plants exposed to cold, drought and

salinity stresses at seedling stage and to drought and salinity stresses at reproductive



stage. Regardless of stress types, TlOsm and OsOslp1_A plants had significantly lower

electrolyte leakage values as compared with the control plants (Figure 5.4). These

results indicated that leaf cells of TlOsm and OsOslp1_A plants maintain higher

membrane integrity than their control counterparts under all these stress conditions.

Thus, ability to maintain membrane integrity is likely to be another physiological

mechanism implemented in TlOsm and OsOlp1_A rice plants, contributing to their

tolerance to cold, drought and salinity stresses. Importantly, plasma membrane damage

by osmotic stress is mostly contributed by lipid peroxidation caused by excessive ROS

(Gill and Tuteja, 2010). To inhibit lipid peroxidation and maintain membrane intact,

plants have developed a complex antioxidative defense that scavenges stress-induced

ROS. The antioxidative defense is governed by non-enzymatic and enzymatic

antioxidants. Ascorbate is the most abundant non-enzymatic antioxidant. Ascorbate

was reported to highly accumulate in osmotin-expressing plants, and enzyme involved

in ascorbate biosynthesis (APX) was found activated in osmotin-expressing plants

(Subramanyam et al., 2012; Patade et al., 2013). Similarly, membrane integrity of

osmotin-expressing plants exposed to stresses has been demonstrated as consequence

of lipid peroxidation inhibition resulted from increased activities of antioxidative

enzymes such as APX, CAT, DHAR, MDHAR, and SOD (Parkhi et al., 2009;

Bhattacharya et al., 2014; Annon et al., 2014). Therefore, maintenance of membrane

integrity in TlOsm and OsOlp1_A plants is probably resulted from an effective ROS

scavenge mediated by TlOsm and OsOlp1_A.

Photosynthesis is a basic biological process plants use to produce all sources of

energy for their living activities. Abiotic stress factors such as drought and salinity

cause damage to photosynthetic machinery and result in photosynthesis inhibition

(Kreslavski et al., 2013). Maintenance of photosynthetic activities under stresses is a

desired trait of stress adaptive plants to produce energies necessary to maintain growth

and reproduction (Manavalan and Nguyen, 2012). Under the same period of exposing

to 100 mM NaCl or withholding water, photosynthesis activities of TlOsm and

OsOlp1_A plants lasted longer than of VC and NT plants (Figure 5.5), suggesting that

maintenance of photosynthetic activities is one of the strategies TlOsm and OsOlp1_A

plants used to overcome adverse growth reduction affected by drought and salinity

stresses and ultimately contribute to their higher dry biomass. The disturbance of

photosynthesis activities in plant response to stresses is mainly due to the disturbance


Sensitive Species

of stomatal regulation (Shabala and Munns, 2012). In plants, stomata are specialized

cells performing gas exchange that regulates the diffusion of CO2 for photosynthetic

activities and water loss through transpiration. When leaf water potential decreases,

stomata close (Brodribb and Holbrook, 2003). Changes in stomatal aperture when

exposed to osmotic stresses have been a reliable measurement for evaluating whole

plants response to stresses. (Shabala and Munns, 2012). Data in these experiments

showed that, stomatal conductance of VC and NT plants dramatically decreased after

6 days exposure to 100 mM NaCl or withholding water (Figure 5.6). The rapid

decrease of stomata conductance in VC and NT plants was positively correlated with

the reduction of net photosynthesis and transpiration rate (Figure 5.5 & 5.7).

Constitutively expressing TlOsm or OsOlp1_A caused rice plants reduced stomatal

conductance in unstressed conditions but prevented its rapid reduction in drought and

salinity stresses, suggesting that functions of TlOsm and OsOlp1_A in stress

response are related to stomatal regulation. Lower transpiration rate of TlOsm and

OsOlp1_A plants in unstressed conditions and early stage of stress exposure seems to

be contributed to their higher leaf water retention. Maintenance of photosynthesis has

been highlighted as an advanced physiological trait of TbOsm mulberry tolerant to

drought salinity (Das et al., 2011), SnOsm soybean tolerant to salinity, and TbOsm

soybean tolerant to drought (Weber et al., 2014). In these studies, the maintained

photosynthesis was believed to be the result of higher chlorophyll content in osmotin-

expressing plants. The results from our study indicated that the maintained

photosynthesis activities and water balance in TlOsm and OsOlp1_A plants were

associated with stomatal regulation. Thus, the role in stomatal regulation was

highlighted for TlOsm and OsOlp1_A.

5.4.3 TlOsm plants showed advantages over OsOlp1_A plants in drought and cold

stresses, not in salinity stresses

TlOsm was isolated from desiccation tolerant species T. loliiformis and was

shown to be rapidly induced to very high levels by cold, drought and salinity (Chapter

3). OsOlp1_A was isolated from drought tolerant cultivar of drought sensitive species

O. sativa and shown to be activated by drought but information on its response to cold

and salinity stresses was not available. Evaluation of transgenic TlOsm and OsOlp1_A

rice plants together with their control counterparts under cold, drought and salinity

stresses at seedling stage on T0 generation and under drought and salinity stresses at



reproductive stage on T1 generation constantly showed the significant improved stress

tolerance of TlOsm and OsOlp1_A plants. These data demonstrated that both TlOsm

and OsOlp1_A are positively involved in enhancing plant stress tolerance. These

data also showed that the stress tolerance of TlOsm and OsOlp1_A plants was passed

on the next generation. In comparison between TlOsm and OsOlp1_A plants in all the

measured parameters, the performance of TlOsm and OsOlp1_A plants in salinity

stress was undistinguishable except for the RWC at day 18 of reproductive stage stress

treatment. In drought conditions, TlOsm plants showed superior to OsOlp1_A plants

in most of the measured parameters. Cold stress at seedling stage caused more severe

damage to OsOlp1_A leaf cells, as measured by electrolyte leakage (Figure 5.4), more

reduction in dry biomass (Table 5.1), and produced more infertile tiller than to TlOsm

plants. Thus, TlOsm plants exhibited more advantages than OsOlp1_A plants in cold

stress response. The overlap in plant response to cold, drought and salinity stresses is

osmotic adjustment. As discussed in Chapter 3, TlOsm seems not directly involved in

ion stress at later phase of salt stress but likely to be in regulation of osmotic response

because the gene was not up-regulated at later stage of salt stress. Effective osmotic

adjustment allow plants to maintain cellular turgor when tissue water potential

declines, maintain stomatal conductance and photosynthesis at lower water potentials,

delay leaf senescence and death, reduce flower abortion, and improve plant growth

(Manavalan and Nguyen, 2012). TlOsm and OsOlp1_A are likely to have similar

functions in osmotic adjustment of plants. However, data resulting from the

experiments on TlOsm and OsOlp1_A plants suggested that osmotic adjustment in

TlOsm plants is more efficient than in OsOlp1_A plants. Based on the functional

prediction (Table 3.2), TlOsm has more than OsOlp1_A three glucan-binding and

48 phosphorylation sites, and distinct four active residues of enzymes involved in

carbohydrate metabolism. The more effective osmotic adjustment of TlOsm plants

over OsOlp1_A plants is probably a functional consequence of these additional active

residues of TlOsm. The remained question is whether these three types of residues all

contribute to the more effective functions of TlOsm.

5.4.4 OsOlp1_I did not sufficiently enhance rice plants tolerance to cold, drought,

and salinity stresses

OsOlp1_I was found different with OsOlp1_A in only 10 AA in its protein

sequence but the OsOlp1_I was isolated from drought sensitive cultivar IR64.


Sensitive Species

Additionally, transcripts of OsOlp1_I was not induced by drought stress. As compared

with VC and WT or NT plants, transgenic plants expressing OsOlp1_I did show some

slight enhancements in some parameters such as shoot growth, RWC, electrolyte

leakage, survival rate, and dry biomass but the patterns were not consistent throughout

the generations, types of stresses, and the stages that stresses applied. Importantly, grain

yield components, the target for rice improvement under stresses and the ultimate

outcome necessary in rice stress tolerance, were not found improved in OsOlp1_I plants

(Table 5.4). It has been demonstrated in rice that genes involved in stress tolerance at

seedling stage are not necessarily involved in tolerance at reproductive stage (Sankar et

al., 2011). OsOlp1_I might contribute to rice response to cold, drought, and salinity

stresses at growth phase but its contribution was not very sufficient to be detectable in

some measurements. In addition, during the adaptation process to a given environment,

plants that are insufficient to reproduce will not be able to thrive and will not considered

adaptive (Rosa et al., 2009). High proportion of OsOlp1_I spikelets was infertile when

plants exposed to drought and salinity stresses and that resulted in low percentage of

filled seeds. Even though OsOlp1_I plants produced more panicles than NT and VC

under drought and salinity stresses, the total productive seeds per plant were not

improved due to very high proportion of sterile spikelets. Seed weight of OsOlp1_I

plants was similar as those of NT and VC plants. These results pointed out that OsOlp1_I

did not confer tolerance in transgenic rice. Disregard its high sequence identity to

OsOlp1_A, OsOlp1_I did not confer tolerance to cold, drought, and salinity stresses.

Thus, activation by certain stress of a gene provides better indication for the involvement

of the gene to that stress. Moreover, three lesser glucan-binding sites and one changed

phosphorylation site as compared to OsOlp1_A would account for the lower functions

of OsOlp1_I in plant stress response.

5.4.5 Low stomata conductance is possibly a cause of growth penalty of TlOsm

plants under unstressed conditions.

Rice plants constitutively expressing TlOsm had similar morphology and

tillering capacity to control plants under unstressed conditions (Figure 5.2 & 5.8). The

ripened seeds were harvested from all nine independent lines grown in glasshouse

conditions and germinated normally, indicating that rice plants expressing TlOsm were

fertile. However, relative to control plants, in all three sets of plants under unstressed

conditions, growth rate of TlOsm plants was significantly slower (Figure 5.1), which



further resulted in less dry biomass (Table 5.2 & 5.3), reduced panicle length, and seed

weight (Table 5.4) that affected grain yield. Analysis of photosynthesis efficiency

under unstressed conditions clearly indicated that net photosynthesis, stomatal

conductance, and transpiration rate were all significantly lower in TlOsm plants.

Therefore, low stomatal conductance leading to low CO2 diffusion and resulting in low

net photosynthesis seems to be one of the possible causes for growth penalty of TlOsm

plants under unstressed conditions. There may be other causes related to energy uses

for osmotic adjustment contributing to this growth penalty in TlOsm plants and need

to be further explored. Despite the shorter panicle length, number of seeds per panicle

was not reduced in TlOsm plants, as compared with the controls suggesting that

constitutive expressing TlOsm did not alter the seed number determination. However,

the yield penalty of TlOsm plants was from the smaller seeds and lower seed weight.

It was not validated in this study but TlOsm contains potential four binding sites,

which function in breaking down high molecular-weight sugars into smaller molecules

(Table 3.2). Using soluble sugars for stress adaptation was found to be an effective

strategy in plants (Rosa et al., 2009). Resurrection plants have been found to

accumulate noticeably high level of soluble sugar for desiccation tolerance (Alpert and

Oliver, 2002; Dinakar and Bartels, 2013; Gaff and Oliver, 2013). Thus, TlOsm might

be involved in sugar metabolism to produce soluble sugars for stress adaptation that

resulted in less starch accumulation and led to smaller seed weight. However, this

assumption needs to be validated by an appropriate measurement. Similar trend was

observed in T1 OsOlp1_A plants but the lower stomatal conductance was not always

detected, which makes it difficult for an obvious explanation. A similar growth penalty

was reported in transgenic mulberry constitutively expressing tobacco osmotin (Das

et al., 2011). However, plants expressing the same gene under stress-inducible

promoter did not exhibit growth reduction in unstressed conditions. While other causes

of growth penalty in TlOsm plants need to be further exploited, the growth reduction

of transgenic TlOsm (or OsOlp1_A) plants in unstressed conditions may be improved

with the use of stress inducible promoter.

It has been known that stress tolerance in plants is a multi-genetic trait

regulated by various molecular, biological and physiological processes (Sairam and

Tyagi, 2004). However, recent studies have revealed a large overlap of genes function

in plant stress signalling pathways enable some genotypes tolerate to multiple stress


Sensitive Species

factors (Manavalan and Nguyen, 2012; Shabala and Munns, 2012). Two strategies

have been suggested for genetic engineering rice with improved multi-abiotic stress

tolerance: (1) incorporating a key regulator in common stress signalling pathways or

(2) combining a whole QTL of important tolerant traits into elite rice cultivar (Babu,

2010; Swamy and Kumar, 2013). The limited number of genes that can be engineered

into single genotype has made it difficult to combine whole QTL into one elite

genotype (Atkinson and Urwin, 2012; Halpin, 2005; Mittler, 2006). Thus, seeking

genes confer tolerance to multiple abiotic stresses holds a great promise for improving

rice multi-abiotic stress tolerance that further ensures sustainable rice productivity

under projected adverse climate conditions (Babu, 2010). Investigations in this study

showed that tolerance of rice plants to cold, drought, and salinity stresses was

significantly enhanced by expressing either TlOsm or OsOlp1_A, with a higher level

of tolerance achieved in TlOsm expression. These results indicated the key functions

of TlOsm and OsOlp1_A in enhancing plant tolerance to multi abiotic stress factors

and highlight the potential of these genes for future uses in improvement of crops

tolerance to cold, drought and salinity.

In conclusion, this chapter details the investigations in abiotic stress response of

transgenic rice plants expressing osmotin genes (TlOsm, OsOlp1_A and OsOlp1_I)

from stress tolerant and sensitive species (T. loliiformis vs. O. sativa). In contrast to

VC and WT plants, TlOsm and OsOlp1_A plants displayed enhanced tolerance to cold,

drought, and salinity stresses. This enhanced tolerance was demonstrated by

maintained shoot growth and tillering capacity that resulted in higher dry biomass,

survival rate, and grain yield than the control plants in exposure to the stresses. The

highest level of tolerance was found in TlOsm plants. The enhanced stress tolerance of

OsOlp1_I (identified from drought sensitive cultivar) was not sufficient due to few

differences in compared with VC and WT plants and no yield improvement of

OsOlp1_I plants. Tolerance of TlOsm and OsOlp1_A plants to cold, drought and

salinity was found related to abilities to retain water, to maintain cell membrane

integrity, and to maintain photosynthesis activities. The functions of TlOsm and

OsOlp1_A were found associated with the regulation of osmotic adjustment,

membrane protection, and stomatal movement. Importantly, the results pointed out a

positive correlation between levels of stress tolerance and the number of active glucan-

binding sites in the osmotin protein structures that rice plants expressing. The results



also highlighted the additional effects of osmotin from tolerant species (TlOsm) in

enhanced rice tolerance to cold and drought stresses, as compared with osmotin from

sensitive species (OsOlp1_A). The molecular characteristics associated with the

functions of these three osmotins will be investigated in the next chapter. The results

in this study demonstrated the roles of TlOsm and OsOlp1_A in osmotic stress

tolerance and highlighted the potential for their uses in developing crops tolerance to

multiple abiotic stresses including cold, drought, and salinity. However, what needed

in sustaining crop productivity for future food demand is a generation of crops that has

high yield potential and adapted to adverse climate conditions. Hence, osmotic stress

tolerance by lower stomatal conductance is not a desired trait due to its effects on

productivity under unstressed conditions. The growth and yield penalty of TlOsm and

OsOlp1_A plants in this study is probably a consequence of constitutively expressing

the transgenes. For a practical use of TlOsm and OsOlp1_A, an inducible expression

should be considered to minimize the effects on plant growth and productivity under

unstressed conditions.


Sensitive Species

Chapter 6: Analysis of Protein-Protein Interactions of Osmotins from Stress Tolerant and Sensitive Species 155

Chapter 6: Analysis of Protein-Protein

Interactions of Osmotins from

Stress Tolerant and Sensitive

Species

In Chapter 3, the comparison of potential functional binding sites of TlOsm

from stress tolerant species (T. loliiformis) with two osmotins, OsOlp1_A and

OsOlp1_I, from sensitive species (O. sativa) indicated TlOsm contained more

potential glucan-binding and phosphorylation sites, followed by OsOlp1_A and

lowest in OsOlp1_I. In Chapter 5, assessment of transgenic rice plants expressing

TlOsm, OsOlp1_A or OsOlp1-I under cold, drought, and salinity stresses confirmed

functional roles of TlOsm and OsOlp1_A in enhancing rice tolerance to cold,

drought, and salinity stresses. Notably, plants expressing TlOsm were more stress

tolerant. Osmotic stress tolerance levels in transgenic rice were found to be correlated

with numbers of predicted functional sites of osmotins that rice plants expressing.

Functions of TlOsm and OsOlp1_A in enhanced rice stress tolerance were

demonstrated to be associated with the abilities to retain water, maintain membrane

integrity and photosynthesis efficiency. These data suggest that the functional sites in

osmotins contribute to the regulation of plant stress tolerance and that osmotin from

stress tolerant species (TlOsm) have increased efficacy. Thus, an understanding of

the protein binding complexes formed by these osmotins will provide the key

information for the elucidation of the molecular mechanisms underlying their

functions. This chapter aimed to identify potential plant proteins interacting with three

target osmotins and possible stress responsive pathways involving them.

6.1 INTRODUCTION

Biological processes are driven by protein-protein interactions and the functional

properties of many proteins are determined by their respective protein-protein

interactions (Hu et al., 2005). Therefore, the study of protein-protein interaction can

provide insight into the biological functions and complex cellular networks of protein

with unknown functions (Fukao, 2012). The laborious and time-consuming procedures

associated with protein studies in the past have limited the discovery of gene functions

156 Chapter 6: Analysis of Protein-Protein Interactions of Osmotins from Stress Tolerant and Sensitive Species

at protein levels (Hu et al., 2011). The recent availability of advanced technologies

enables unprecedented options for high-throughput identification of protein-protein

interactions and visualisation of protein-protein interactions in living cellular

environment. Various studies using protein microarrays have indicated the

Arabidopsis protein microarray as an excellent platform for high throughput screening

the plant proteins interacting with a given protein (Popescu et al., 2007a; Popescu et

al., 2007b; Popescu et al., 2009). The protein-protein interactions in living cells can

be directly visualised by bimolecular fluorescence complementation (BiFC) analysis

(Kerppola, 2013). These advances offer a valuable complement to unravel biological

functions for the proteins of interest.

Osmotins are a class of pathogenesis-related proteins that play key roles in both

abiotic and biotic stress responses of plants. However, the mechanisms underlying

their functions in plant stress responses remain to be elucidated due to the lack of

information in their protein interactive partners and pathways. Numerous studies

have been carried out on osmotins, but to date only few interactive partners of

osmotin have been revealed. One of the major limitations for direct study osmotin

protein is the difficulties associated with producing recombinant osmotins. Osmotin

has been known for its hydrophobicity, anti-microbial property and the presence of

8 disulfide bonds in its structure that have made it difficult for expressing in

microbial system with proper folding of resulted proteins. The current protocols for

recombinant osmotin production in microbial system require targeting osmotin in the

inclusion bodies, denaturing osmotin during protein extraction and refolding the

protein (Campos et al., 2008; Tzou et al., 2011). However, with 8 disulfide bonds in

the structure, the refolding osmotin is a difficult step accompanied with limited

protein yield upon water-insoluble of the hydrophobic protein. These limitations

would be overcome by the progresses of genetic manipulation and protein expression

system (discussed in Section 1.6.2). For the ultimate purpose of functionally

characterising TlOsm, we compared the predicted functional sites of TlOsm with

two rice osmotins and demonstrated the roles of TlOsm and OsOlp1_A in

enhanced rice tolerance to cold, drought, and salinity stresses (in Chapter 3 and 5).

This study aimed to gain insights into functions and pathways of these osmotins via

their interactive partners and biological networks involving their interactive protein

partners.


The objectives of this study were set as follows:

1. Produce and purify functional recombinant osmotins (TlOsm, OsOlp1_A,

and OsOlp1_I).

2. Identify potential protein partners by Arabidopsis protein chip assays.

3. Identify biological pathways that play role in osmotin functionalities.

4. Validate interactions of the three osmotins with Arabidopsis stress-responsive

proteins in planta.



Nicotiana benthamiana plants were used for both transient expression of

recombinant osmotins and co-expression of osmotins with their putative Arabidopsis

interactive protein partners in the BiFC analysis. Plants were germinated, grown, and

prepared for Agro-infiltration as described in Section 2.1.2.3.

6.2.2 Plasmid vectors

6.2.2.1 Plasmid vectors for expressing recombinant osmotins

The plasmid pEAQ-TlOsm, pEAQ-OsOlp1-A, and pEAQ-OsOlp1-I were used

for producing recombinant osmotins. In these plasmids, osmotins were tagged with

different elements necessary for high protein production, purification, and detection of

protein-protein interaction on protein microarrays. The gene expression cassettes of

these plasmids are shown in Figure 6.1. Generally, the tagged osmotins are driven by

the CaMV 35S promoter and the Nos terminator and placed within the Cowpea Mosaic

Virus 5’ upstream translational enhancer. The P19 gene under control of the CaMV

35S promoter and terminator used for suppressing of gene silencing, which is usually

faced in plant transiently expressing of foreign genes. The NptII gene under regulation

of the Nos promoter and terminator was plant selectable marker against kanamycin

antibiotic. The methods used for constructing these plasmid are described in Section

2.2.1.


Figure 6.1 Schematic diagram of gene expression cassettes for transiently expressing

tagged osmotins in N. benthamiana. LB: left border, RB: right border

6.2.2.2 Plasmid vectors for detection of protein-protein interactions

Plasmids with the gene expression cassettes shown in Figure 6.2 were used in

the BiFC assay for detecting protein-protein interaction in planta. The TlOsm,

OsOlp1_A and OsOlp1_I genes were fused at their protein C-terminus with a DNA

fragment encoding half molecule of EYFP from N-terminus to AA 174. Five

Arabidopsis genes AtCPK4, AtCPK5, AtMS1, AtALDH7B4, and AtPER42 were fused

at their protein C-terminus with a DNA fragment encoding half molecule of EYFP

from AA 175 to the end of protein molecule. The Tobacco Etch Virus translational

enhancer was incorporated upstream of all the three osmotins and five Arabidopsis

genes. The fused genes together with the enhancer were driven by the tandem CaMV

35S promoter and terminator. Details of methods used for constructing these plasmids

were presented in the Section 2.2.1.


Figure 6.2 Schematic diagram of gene expression cassettes for detecting target osmotins

and Arabidopsis protein interaction in N. benthamiana. A) TlOsm, OsOlp1_A, or OsOlp1_I

cloned in the pE3134 destination vector; B) 5 Arabidopsis genes separately cloned in the

pE3132 destination vector. LB: left border, RB: right border

6.2.3 Protein expression in Nicotiana benthamiana

Wild type N. benthamiana plants were grown in pots in a growth chamber under

the conditions described in Section 2.1.2.3 for at least five weeks then were used for

agro-infiltration. The plant overexpression vectors pEAQ-TlOsm, pEAQ-OsOlp1-A,

and pEAQ-OsOlp1-I were separately transformed into Agrobacterium strain Alg1

using the methods described in Section 2.2.1.5. Agrobacterium Alg1 containing


pEAQ-TlOsm, pEAQ-OsOlp1-A, or pEAQ-OsOlp1-I vectors were grown and

prepared for infiltration, and infiltrated into N. benthamiana leaves of 5-week-old

plants by the methods described in Section 2.2.3. Fifteen plants with 3 leaves (number

3-5 from the top) per plant were used for each plasmid construct and the WT control

was infiltrated with the infiltration medium. Four days after infiltration, N.

benthamiana leaves were harvested. Aliquots of approximately two grams of

infiltrated leaves were wrapped in aluminium foil, immediately frozen in liquid

nitrogen, and stored at -80 oC for protein extraction.

6.2.4 Recombinant protein extraction, purification, and enrichment

Extraction of total proteins from the frozen leaf tissues was done in 50 mM

phosphate buffer. Frozen infiltrated leaf samples were ground to a fine powder in liquid

nitrogen prior to homogenisation in 6 mL of 50 mM phosphate extraction buffer (50 mM

phosphate buffer pH 7.4, 300 mM NaCl, 10% glycerol, 0.1% Triton X-100, 1 mM PMSF

and 1x complete protease inhibitor cocktail (Sigma, St. Louise, MO, USA). Samples were

homogenised by gentle rotation at 4 oC for two hours. Cell debris was removed by

centrifugation at 4000 g at 2 oC for 5 min. Further removal of solids was performed by

centrifugation of the supernatant at 14 000 g at 4 oC for 20 min. The recombinant proteins

were enriched and purified using a three-step purification protocol described below. Each

total protein extract was pre-purified using 3 His-spin columns of His-Spin Trap Kits (GE

healthcare Life Sciences) following the manufacturer’ protocol, then eluted into 1200 mL

of elution buffer. The solution containing pre-purified proteins was incubated at 4 oC with

Protein G Mag SepharoseTM Xtra beads (GE healthcare Life Sciences) overnight with

gentle rotation. Beads with bound proteins were then washed two times with Wash buffer

(137 mM NaCl, 2.7 mM KCL, 100 mM Na2HPO4, 2 mM KH2PO4, pH 7.4). The

recombinant proteins were eluted from the beads through incubation with 12 µL (50 units)

of 3C protease (Precision protease; Amersham Biosciences) in 500 µL of cleavage buffer

(50 mM Tris HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1% Triton)

overnight in a cold room with gentle rotation. The following day, the recombinant proteins

in the cleavage were first separated from the beads, and went through the His-Spin

columns to eliminate the excess protease and other track elements. The proteins trapped

in the His-Spin columns were eluted, mixed with glycerol to a final concentration of 30%,

and stored at -80 oC. Protein concentration was determined using the Bradford assay

(Bradford, 1976).


6.2.5 SDS-PAGE

SDS-PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis) was

used to separate proteins. The protein extracts were run on a 12% resolving gel (dH2O

4.170 mL, 1.5 M tris pH 8.8 2.5 mL, 10% SDS 100 µL, 40% acryl/bis (29:1) 3.125 mL,

10% ammonium persulphate 100 µL and TEMED 5 µL) and 5% stacking gel (dH2O 2.916

mL, 1 M tris pH 6.8 0.5 mL, 10% SDS 40 µL, 40% acryl/bis (29:1) 0.5 mL, 10%

ammonium persulphate 40 µL and TEMED 4 µL). Gel was prepared using a Mini SDS-

PAGE gel apparatus (Bio-Rad, Hercules, CA, USA) according to the manufacturers’

protocol. Protein extracts and loading buffer were mixed in a ratio of 4:1 (v/v), followed

by a short spin and then heated for 10 min at 95 oC. A 15 µL aliquot was loaded to each

well and the gel was run for 3 h at 120 V. Coomassie blue dye was used for verification

of proteins on the SDS-PAGE gel.

6.2.6 Coomassie blue staining

The separated proteins in the SDS-PAGE gel were stained in Coomassie blue

solution (0.1% Coomassie Brilliant blue R-250, 50% methanol and 10% glacial acetic

acid) for at least 1 h with gentle agitation until the gel was in a uniform blue colour.

Gels were de-stained overnight in a 25% methanol and 10% glacial acetic acid solution

with gentle agitation until the background cleared. Images were captured using a

Cannon camera with a white light background.

6.2.7 Western blotting

After electrophoresis, proteins in the SDS-PAGE gel were transferred onto a

nitrocellulose membrane (immobilonTM; Millipore) using a mini SDS-PAGE apparatus

tank (Bio-Rad, Hercules, CA, USA). The sandwich was prepared according to the

manufacturers’ protocol, placed in the tank filled with blotting buffer (25 mM Tris, 192

mM glycine, 10% methanol) and proteins were transferred overnight at 15 V in the cold

room. The following day, the apparatus was disassembled. The membrane was blocked

using blocking buffer (TBST, 5% (v/w) skim milk powder) for 1 h with gentle shaking

on a rotate shaker. The blocking solution was discarded and 12 mL of a dilute (1:5000)

of primary antibody (mouse monoclonal anti-human c-myc unconjugated antibody)

(Invitrogen, Carlsbad, CA, USA) in 5%-skim milk TBS buffer solution was added. The

membrane was incubated overnight in the cold room with gentle agitation. Following

incubation, the membrane was washed four times with TBST buffer with gentle


agitation, 10 min per each wash. The membrane was incubated with secondary antibody

(Goat-Anti-Mouse IgG (H+L)-HRP) (Life Technologies) diluted at a 1:20000 ratio in

5%-skim milk containing TBS solution for 1 h at room temperature with gentle agitation.

Following the incubation, the membrane was washed four times with TBST buffer with

gentle agitation, 10 min per each wash. The chemiluminescent detection assay was

performed according to the DIG (Roche) protocol.

6.2.8 Protein chip hybridisation and scanning

The high-density Arabidopsis protein microarrays (chip or slide; 5000-

AtPROTEINCHIP1) were provided by Dinesh-Kumar Laboratory (Department of

Plant Biology & Genome Centre, University of California, Davis, USA) and purchased

from the Arabidopsis Research Centre (Ohio, USA). These chips were used to identify

Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and OsOlp1_I. The

protein slides stored at -80 oC were equilibrated at 4 oC by putting each slide into a 50-

ml Falcon tube with closed cap and placed in the cold room for 15 min. The slides

were blocked in PBS-T (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM

KH2PO4, 0.1% (v/v) Tween-20, and 1% (w/v) BSA) for 1 h. Eight micrograms of

purified recombinant osmotin in 50 mM phosphate buffer were diluted in a probing

solution (1X PBS, 5 mM MgCl2, 0.05% (v/v) Triton X-100, 5% (v/v) glycerol and 1%

(w/v) BSA) to the final volume of 250 µL. The probing solution containing each

osmotin was separately applied to each slide surface and the slide was covered by a

glass slide, incubated for 1.5 h at 4 oC. Slides were then washed 3 times with probing

solution with a gentle agitation for 10 min per each wash. The slides were incubated

with 12 mL of a dilute (1:5000) primary antibody (mouse monoclonal anti-human c-

myc unconjugated antibody) (Invitrogen) in probing solution for 2 h in the cold room.

The unbound antibody was removed from the slides by washing the slides 4 times in

probing solution with 10 min per wash on an orbital shaker. The slides were incubated

with Cy5 conjugated-Goat-anti-mouse IgG antibody (Jackson ImmunoResearch

Laboratory, Inc.) diluted in probing buffer (1:700) for 1 h at room temperature with a

gentle agitation. The slides were washed for 3 times with probing solution with a gentle

agitation for 10 min per each wash to remove the unbound secondary antibody. The

slides were then dried by draining off the washing solution and putting into a 50-mL

Falcon tube with a piece of Kimwipe tissues at the bottom of the tube. The tube

containing slide was spined for 1 min at 1000 g. Slides were stored inside the Falcon


tube at room temperature until being scanned in the day after. Slides were scanned

using a Genepix 4300A slide scanner (Axon Instruments).

6.2.9 Identification of significant interactions

The scanned microarray images were subsequently processed following the

instruction described by Zhou-Da et al. (2008). The GenePix Pro software (Molecular

Devices, Union City, CA) was used to determine the spot intensity. A grid of circles

was placed over the protein spots on the chip. The position and size of the spots were

adjusted to be insight the circles for an accurate intensity data. For each slide, an output

file containing mean, median, and standard deviation of array spots and background

intensity was created by the program. These output files with background intensity of

each spot were subjected for analysis of significant interactions (Diez et al., 2012).

The mean, standard deviation, and standard error of the mean values were calculated

for 5210 entry names on the slides including all Arabidopsis proteins on the chip and

multiple positive and negative controls. The significant probe-binding candidates were

determined using one-sided Student’s t-test, pooled variance and 5% significance

level. All the mean values that were not significant lower than the mean values of

positive control, the RIN4-cMyc (12 spots) were considered as significant candidates

for further analysis.

6.2.10 Determination of significant protein interactors of target osmotins

The description of the Arabidopsis proteins on the chip significantly interacted with

the target osmotins was looked up through the DAVID database (Huang et al., 2009;

Sherman et al., 2007) using TAIR_ID identifier. The entire list of interactors of each target

osmotin was submitted to the Gene Name Batch Viewer tool for revealing the name of the

osmotin interactors. Gene ontology (GO) term enrichment was performed separately for

the protein sets considered to significant interacted with all three osmotins (271 proteins)

with TlOsm and OsOlp1_A (11 proteins), or with only TlOsm (21 proteins) using

agriGO web server (Du et al., 2010). The entire list of each set of interactors was submitted

to the analysis tool using Singular Enrichment Analysis (SEA). Each gene set was

enriched using a Fisher’s exact test with the Arabidopsis genomodel 9 as a reference and

biological process as a category. For statistical significance, P-values were corrected

according to Benjamini and Hochberg (1995) and a critical false discovery rate (FDR) q-

value of 0.05 was applied. The significant GO term for each protein set was summarised

and visualised by REVIGO server (Supek et al., 2011) and viewed as Treemap.


6.2.11 Identification of pathways containing interactive protein partners of

TlOsm, OsOlp1_A, and OsOlp1_I

The entire list of three osmotin interactive protein partners was submitted to the

DAVID Database for Annotation, Visualisation and Integrated Discovery (version 6.8)

for gene ID conversion, using TAIR ID as gene identifier, to convert the list into Genomic

GI Accessions (GIs). The output GIs list was retrieved and used as input for automated

annotation and identification of enriched pathways (KEGGS, Panther and BioCyc) using

KOBAS 2.0 web server (Wu et al., 2006; Xie et al., 2011). Statistical significance P-values

were corrected according to Benjamini and Hochberg and applied a False Discovery rate

q-value of 0.05.

6.2.12 BiFC performance and analysis

6.2.12.1 Determination of Arabidopsis candidate genes for BiFC analysis

All potential protein partners of TlOsm, OsOlp1_A, and OsOlp1_I that

were identified as significant on the protein chip were classified into 7 categories: (1)

the common interactors of all three osmotins, (2) the interactors of TlOsm and

OsOlp1_A, (3) the interactors of TlOsm and OsOlp1_I, (4) the interactors of

OsOlp1_A and OsOlp1_I, the interactors of only (5) TlOsm, (6) OsOlp1_A, or

(7) OsOlp1_I. The selection of candidate genes for BiFC analysis focused on the

common interactors, the TlOsm and OsOlp1_A, and the TlOsm only interactors.

The AtPER42 was used as negative control due to non-detected interaction with all

three osmotins on the chip. The candidates were selected based on their well-

characterised roles in plant stress response. The selective candidate genes for BiFC

analysis are presented in Table 6.1. The full length cDNA sequences of the selective

genes were retrieved from the NCBI database and used for primer design in plasmid

vector cloning. The genes were amplified from Arabidopsis cDNA and cloned in the

pE3132 vector as described in Section 2.2.1 and the gene expression cassettes of the

vectors are in Figure 6.2.


Table 6.1 Select Arabidopsis genes for BiFC analysis

TAIR ID Gene name Description Category

AT4G09570 AtCPK4 Calcium-dependent protein kinase 4 Common interactor of

all three osmotins

AT4G35310 AtCPK5 Calcium-dependent protein kinase 5

Common interactor of

all three osmotins

AT5G17920 AtMS1 5-methyltetrahydropteroyltriglutamate-

-homocysteine methyltransferase

Interactor of TlOsm

and OsOlp1_A

AT1G54100 AtALDH7B4 Aldehyde dehydrogenase family 7

member B4

Interactor of TlOsm

only

AT4G21960 AtPER42 Peroxidase 42 Negative control

6.2.12.2 Co-expression of target osmotins and Arabidopsis genes in N.

benthamiana

Five-week-old wild type N. benthamiana plants were grown in pots in a growth

chamber under the conditions described in Section 2.1.2.3. The Agrobacterium strain

Alg1 separately carrying each vector in Figure 6.2 and the pCE100_EYFP (positive

control) were grown and prepared for infiltration as method described in Section 2.2.3.

Before infiltration, equal amount of each Agrobacterium sample containing each

osmotin and each Arabidopsis gene were combined (the combinations are shown in

Table 6.2) and infiltrated into N. benthamiana leaves of 5-week-old plants by the

methods described in Section 2.2.3.


Table 6.2 Combinations of osmotins and Arabidopsis genes used for co-expression and

BiFC analysis

N0 Combinations Interaction on the chips

1 pE3134-TlOsm and pE3132-AtCPK4 +

2 pE3134-OsOlp1_A and pE3132-AtCPK4 +

3 pE3134-OsOlp1_I and pE3132-AtCPK4 +

4 pE3134-TlOsm and pE3132-AtCPK5 +

5 pE3134-OsOlp1_A and pE3132-AtCPK5 +

6 pE3134-OsOlp1_I and pE3132-AtCPK5 +

7 pE3134-TlOsm and pE3132-AtMS1 +

8 pE3134-OsOlp1_A and pE3132-AtMS1 +

9 pE3134-OsOlp1_I and pE3132-AtMS1 -

10 pE3134-TlOsm and pE3132-AtALDH7B4 +

11 pE3134-OsOlp1_A and pE3132-AtALDH7B4 -

12 pE3134-OsOlp1_I and pE3132-AtALDH7B4 -

13 pE3134-TlOsm and pE3132-AtPER42 -

14 pE3134-OsOlp1_A and pE3132-AtPER42 -

15 pE3134-OsOlp1_I and pE3132-AtPER42 -

16 pCE100_EYFP Positive control

17 Infiltration medium Negative_WT control

6.2.12.3 Sample preparation and imaging

Two days post-infiltration, leaves from each combination were harvested and

fixed using the methods described in Section 2.2.4. The fixed samples were examined

under the A1 Confocal Microscope (Nikon, Tokyo, Japan). The images were captured

under 488 nm laser channel with emission of 500-550 nm for green fluorescence and

638 nm laser channel with emission of 663-738 nm for autofluorescence. The captured

images were used for analysis of target osmotins and Arabidopsis protein interactions

in planta.


6.3 RESULTS

6.3.1 Expression and purification of recombinant osmotin proteins

To perform hybridisation of protein probes and the protein chips, the protein

probes need to be pure, functional, and containing the tags necessary for detection.

Gene constructs containing osmotins with all tags necessary for recombinant osmotin

purification and detection on the chip and elements for enhancing protein production

were prepared. The gene constructs were transiently expressed in N. benthamiana.

Recombinant osmotins were extracted in 50 mM phosphate buffer and purified

through 3 steps based on His and IgG tags fused with the osmotins. First, recombinant

osmotins were enriched by passing the protein extract through a His SpinTrap column

that only binds the protein with His tag. The elution from His SpinTrap columns was

inoculated with Protein G Mag Sepharose Xtra beads that bind to the IgG tag of

recombinant osmotins. The proteins were cleaved from the beads by incubating with

Precision Proteases. Then the cleaved protein solutions once went through the His

SpinTrap columns to eliminate all the tag elements and the excessive protease in the

buffer so that only proteins with His tag bound to the columns. Following elution from

the final His SpinTrap columns, the protease-cleaved and purified osmotins were

confirmed by Coomassie staining of SDS-PAGE gel and western blot analysis. Figure

6.3 presents the schematic of recombinant osmotins with estimated sizes before and

after cleavage and the images of Coomassie stained SDS-PAGE gel and western blot

film of the purified recombinant osmotins.


Figure 6.3 Recombinant osmotin production. A-B) schematic diagram of recombinant

osmotins and estimated sizes before (A) and after protease cleavage (B); C-D) visualisation of

cleaved and purified osmotins by Coomassie staining of PAGE gel (C) and western blot (D);

film was exposed for 5 min; ML, molecular ladder; WT-Ctrl, wild type control

Results from SDS-PAGE gel Coomassie stain and western blot analysis

indicated that all three recombinant osmotins were obtained at high purity and identity.

Coomassie stained SDS-PAGE gel (Figure 6.3 C) showed the bands of OsOlp1_A,

OsOlp1_I and TlOsm with 9xMyc and His-6 downstream tags similar to their

estimated sizes (Figure 6.3 B). The bands were intense with little smearing, thus

suggesting the intact and purity of resulted osmotins. Western blotting using antibody

against Myc tag verified the identity of the purified proteins as demonstrated by

intensive bands after only 5 min of film exposure. The results here demonstrated that

the purpose of obtaining pure recombinant OsOlp1_A, OsOlp1_I and TlOsm with

all necessary tags was achieved by using advanced gene manipulation and multi-step

protein purification.


6.3.2 Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and OsOlp1_I

revealed

The functions of unknown proteins can be discovered through the study of their

respective protein partners with known functions (Rao et al., 2014). TlOsm from

desiccation tolerant species, T. loliiformis, and its counterparts, the OsOlp1_A and

OsOlp1_I, from drought-tolerant and –sensitive cultivars of stress sensitive species,

O. sativa, were previously compared in their predicted functional residues and in their

contribution in enhanced stress tolerance of transgenic rice. To provide new insights

into the mechanisms and pathways of TlOsm and its counterparts in plant stress

response, Arabidopsis proteins on the 5000-AtPROTEINCHIP1 interacting with the

three osmotins were screened. Each of purified recombinant TlOsm, OsOlp1_A,

and OsOlp1_I downstream by Myc epitope and His tags was probed with separate

protein chip. The primary antibody, the anti-Myc IgG, detected the Myc epitope was

incubated for detecting the interaction. Then, the anti-IgG antibody with Cy5

conjugated was incubated to bind the anti-Myc IgG. The protein-protein interaction

was detected by scanning with the Cy5 fluorescence for the indication of interaction.

The GenePix Pro software was used to determine the fluorescence intensity of the

spots. Fluorescent intensity of the interaction was analysed according to the instruction

of the software. For each slide, an output file containing mean, median, and standard

deviation of array spots and background intensity was created by the program. These

output files with background intensity of each spot were subjected for analysis of

interactions. This procedure is illustrated in Figure 6.4.


Figure 6.4 Procedure of recombinant osmotins hybridising with protein chips and data

generation

6.3.2.1 Identification of Arabidopsis proteins on the chip interacting with TlOsm,

OsOlp1_A, and OsOlp1_I

The mean, standard deviation, and standard error of the mean values were

calculated for each spot (5210 entry names) on each slide including all Arabidopsis

proteins (expressed as TAIR_ID) on the chip and multiple positive and negative

controls. One-sided Student’s t-test was used and the false discovery rate by FDR

method (Storey, 2002) was applied to determine the significant interactions. Total of

271 Arabidopsis proteins on the chips were found significantly interacted with

TlOsm, OsOlp1_A, and OsOlp1_I. The list of total 271 Arabidopsis proteins

either common or specific interacted with OsOlp1_A, OsOlp1_I, and TlOsm was

analysed against the DAVID database for functional analysis using TAIR_ID identifier

(Jiao et al., 2012). The profile for all Arabidopsis proteins on the chip interacting with

each respective osmotins is provided in Appendix E-Table 1. These proteins were in

various families and appeared to be involved in a diverse biological process of plant

stress responses and development.


6.3.2.2 More Arabidopsis proteins on the chip interacted with TlOsm than with

OsOlp1_A, and OsOlp1_I

Structural-to-functional predictions suggested more functional sites for TlOsm

than two rice osmotins. For rice osmotins, OsOlp1_A has three more glucan-binding

sites than OsOlp1_I; and the two differ in one phosphorylation site. Functional

validation in transgenic rice indicated the positive correlation between the levels of

stress tolerance and functional sites of the transgenes they expressed. In order to prove

the hypothesis that protein with more functional sites binds to more proteins in the

same condition, chips containing 5000 Arabidopsis proteins were separately

hybridised with each target osmotin. As indicated in Table 6.3, TlOsm had 267

significant interactors while OsOlp1_A had 239 interactors, and OsOlp1_I

interacted with 237 proteins. In the same hybridisation conditions and the same

quantity of proteins applied, there were more proteins interacting with osmotin from

T. loliiformis than with those from O. sativa. The results are in agreement with the

hypothesis.

Table 6.3 Comparison of significant interactions between Arabidopsis proteins on the

chip with the three osmotins

Parameters Number of Arabidopsis

proteins

All proteins interacting with 3 osmotins 271

Proteins interacting with TlOsm 267

Proteins interacting with OsOlp1_A 239

Proteins interacting with OsOlp1_I 237

Proteins commonly interacting with the 3 osmotins 225 (83.03%)

Proteins interacting with OsOlp1_A and TlOsm

(not OsOlp1_I)

11 (4.05%)

Proteins interacting with OsOlp1_A and

OsOlp1_I (not TlOsm)

1 (0.37%)

Proteins interacting with OsOlp1_I and TlOsm

(not OsOlp1_A)

10 (3.69%)

Proteins specifically interacting with TlOsm 21 (7.75%)

Proteins specifically interacting with OsOlp1_A 2 (0.74%)

Proteins specifically interacting with OsOlp1_1 1 (0.37%)


The interactors of these three osmotins were categorised into 7 groups: those

commonly interacted with all three osmotin (83.03%), those interacted with

OsOlp1_A and TlOsm (not OsOlp1_I) (4.05%); those interacted with

OsOlp1_A and OsOlp1_I (not TlOsm) (0.37%), those interacted with OsOlp1_I

and TlOsm (not OsOlp1_A) (3.69%), those specifically interacted with only

TlOsm (7.75%), OsOlp1_A (0.74%) and OsOlp1_I (0.37%). In Chapter 5, TlOsm

and OsOlp1_A genes were proven to confer tolerance to cold, drought, and salinity

stresses with the higher level of stress tolerance found for TlOsm plants. Thus, the

interactors of OsOlp1_A and TlOsm and with only TlOsm were highlighted for

further analysis on their functions in cold, drought, and salinity response (Table 6.3).

The common interactors of these osmotins hold potential for understand the common

functions of these osmotins in biotic stress response and plant development.

6.3.3 Gene ontology (GO) enrichment for interactors of the three osmotins

To help understand the molecular function and biological process of the

Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and OsOlp1_I, the GO

enrichment was performed for all the 271 proteins interacted with the three osmotins.

The GO terms were enriched in agriGO web server against the Arabidopsis genomodel

9 background (Du et al., 2010). A total of 37767 GO terms was suggested and 127 GO

terms were found significantly enriched in the protein-binding gene set (adjusted P-

value ≤ 0.05) (Appendix E-Table 2). All the significant GO terms displayed by

biological process were summarised and visualised by REVIGO web server (Supek et

al., 2011) using Treemap. Figure 6.5 presents the biological processes that the 271

interactors of TlOsm, OsOlp1_A, and OsOlp1_I significantly participate in.

The data showed that TlOsm, OsOlp1_A, and OsOlp1_I bound proteins are

involved in the diverse biological process of plant stress responses and development such

as response to abiotic stress, disease, endogenous stimuli, signal transduction, carboxylic

acid biosynthesis, cellular process and metabolism. Thus, the data suggest that the

functions of these osmotins in multiple stress responses and development of plants.

A total 83.03% of the 271 three osmotins interactors are in common for TlOsm,

OsOlp1_A, and OsOlp1_I. However, TlOsm, OsOlp1_A, and OsOlp1_I

differentially responded to cold, drought and salinity stresses as evidenced by the

results in the Chapter 5. The key functional mechanisms underlying the different

regulations of TlOsm, OsOlp1_A, and OsOlp1_I in plant stress response could


rely on the 16.97% of their different interactive partners. Only TlOsm and

OsOlp1_A conferred tolerance to cold, drought and salinity stresses in transgenic

rice with the higher levels of tolerance to cold and drought for TlOsm. Hence,

interactors of TlOsm and OsOlp1_A should be the focus for understanding the

underlying mechanisms for abiotic stress tolerance of TlOsm and OsOlp1_A. Thus,

GO term enrichment and biological process involving the interactors of TlOsm and

OsOlp1_A and those of TlOsm only were analysed and highlighted as the black and

red ovals in Figure 6.5.

Figure 6.5 Biological processes involving protein interactors of TlOsm, OsOlp1_A and

OsOlp1_I based on Gene Ontology analysis. Area of rectangles reflects the proportion of GO

terms; back ovals indicate the GO distribution of 11 interactors of TlOsm and OsOlp1_A (not

OsOlp1_I); red ovals indicate the GO distribution of 21 interactors of TlOsm.

Interestingly, proteins interacting with TlOsm and OsOlp1_A participate in

a number of biological processes (Figure 6.5, back ovals); while those only interacting

with TlOsm participated in response to stress and stimuli only (Figure 6.5, red ovals).

Interacting with more proteins in the process of plant response to stresses and stimuli

would explain for higher effects on enhancing rice tolerance to abiotic stresses of

TlOsm (Chapter 5).


6.3.4 Pathways of TlOsm, OsOlp1_A, and OsOlp1_I interactive protein

partners revealed

Understanding the pathways involved in a set of genes or proteins provides valuable

biological insights into their functions (Wu et al. 2006). To investigate the biological

pathways involving the target osmotins, the pathways of their interactors were analysed.

The entire list of TlOsm, OsOlp1_A, and OsOlp1_I interactors with TAIR_ID

identity was converted into gene identity (GI) in DAVID knowledgebase server. The list

with GIs was used as input for pathway analysis in KOBAS 2.0 server (Xie et al., 2011).

In this analysis, GIs were subjected for automated annotation and a Fisher’s exact test for

differential GO term distribution. The pathway enrichment analysis based on automated

annotation generated by KOBAS was further used to look up the number of interactors for

each osmotin interactor category. The details of entire putative pathways involving all

interactors of the osmotins are presented in the Appendix E-Table 3.

Table 6.4 Significant pathways of Arabidopsis proteins interacting with TlOsm,

OsOlp1_A, and OsOlp1_I (background indicates the number of proteins in the pathways

available in the database)

Biological pathway Background

number

TlOsm

interactors

OsOlp1_A interactors

OsOlp1_I interactors

Fructose and mannose

metabolism 62 8 7 6

Glycolysis 113 11 10 9

Pentose phosphate pathway 54 7 6 5

Benzoate biosynthesis II 6 3 2 2

Alkane oxidation 6 3 2 2

Riboflavin metabolism 9 3 1 1

Super pathway of lysine,

threonine and methionine

biosynthesis

24 5 4 4

Fatty acid alpha oxidation I 7 3 2 2

Flavonoid biosynthesis 21 4 3 2

Ethanol degradation II 16 4 3 3

Interactive protein partners of the three osmotins are involved in diverse putative

biological pathways, suggesting the involvements of the osmotins in various pathways.

No pathway specific to rice osmotin interactors was identified but nine pathways were

found specific for TlOsm interactors. Notably, even in conserved pathways, the numbers

of TlOsm, OsOlp1_A, OsOlp1_I interactors were different with TlOsm binding to


more proteins in the pathways. Table 6.4 presents the ten most significant pathways

involving interactors of TlOsm, OsOlp1_A, and OsOlp1_I. These pathways provide

more informative indicator for testing hypothesized functions of these osmotins.

Moreover, the interactors involved in nine pathways specific for TlOsm would offer great

targets for exploiting any additional functions of osmotin from stress tolerant species.

Since the focuses of this study were to understand the mechanisms and pathways

associated with the osmotins conferred tolerance to abiotic stresses, the pathways only

containing TlOsm and OsOlp1_A were used for further analysis. Table 6.5 lists all the

pathways containing interactors of TlOsm and OsOlp1_A, or TlOsm only. Among

these 18 pathways, 9 pathways contain proteins interacting with TlOsm and OsOlp1_A

and 9 pathways contain proteins only interacting with TlOsm. These pathways are within

biosynthesis, oxidative phosphorylation, and amino acid degradation.

Table 6.5 Pathways of Arabidopsis proteins interacting with TlOsm and OsOlp1_A,

or TlOsm only (background indicates the number of proteins in the pathways available in

the database; input indicates the numbers of osmotin interactors)

Pathway name Database

Background

number Input TlOsm&

OsOlp1_A

TlOsm only

Scopoletin biosynthesis BioCyc 9 2 1 1

Suberin monomers

biosynthesis BioCyc 17 2 1 1

Chlorogenic acid

biosynthesis I BioCyc 17 2 1 1

Phenylalanine metabolism KEGG PATHWAY 42 2 1 1

Phenylpropanoid

biosynthesis BioCyc 37 2 1 1

Stilbenoid, diarylheptanoid

and gingerol biosynthesis KEGG PATHWAY 61 2 1 1

UDP-sugars interconversion BioCyc 19 1 1

Carotenoid biosynthesis KEGG PATHWAY 29 1 1

Oxidative phosphorylation KEGG PATHWAY 162 1 1

Valine biosynthesis BioCyc 6 1 1

Superpathway of isoleucine

and valine biosynthesis BioCyc 7 1 1

Quercetin sulfate

biosynthesis BioCyc 8 1 1

Leucine biosynthesis BioCyc 8 1 1

Superpathway of flavones

and derivatives biosynthesis BioCyc 8 1 1

UDP-D-xylose biosynthesis BioCyc 11 1 1

Leucine degradation I BioCyc 12 1 1

Valine degradation I BioCyc 14 1 1

Superpathway of leucine,

valine, and isoleucine

biosynthesis BioCyc 15 1 1


Beside the roles in abiotic stress tolerance, osmotin has been suggested to

participate in plant signalling and pathogen defense and to be used as a therapeutic

component for human disease treatment (discussed in Section 1.3). Thus, the pathways

related to these aspects and containing three osmotin interactors were also analysed and

presented in Table 6.6. Even though these 10 pathways were common for interactors of

all three osmotins, the number of TlOsm interactors was higher in five pathways.

Table 6.6 Pathways of Arabidopsis proteins commonly interacting with TlOsm,

OsOlp1_A, and OsOlp1_I in relation to published and predicted functions of osmotin

Pathway name Database Background

number Input

Common

interactors

TlOsm& OsOlp1_A

TlOsm& OsOlp1_I

TlOsm

only

Plant-pathogen

interaction

KEGG

PATHWAY 167 10 7 1 1 1

Cadherin signalling

pathway PANTHER 8 2 1 1

Nicotinic acetylcholine

receptor signalling

pathway

PANTHER 15 2 1 1

Apoptosis signalling

pathway PANTHER 21 1 1

Phosphatidylinositol

signalling system

KEGG

PATHWAY 68 2 2

Plant hormone signal

transduction

KEGG

PATHWAY 271 8 7 1

Inflammation mediated

by chemokine and

cytokine signalling

pathway

PANTHER 19 2 1 1

Insulin resistance KEGG

PATHWAY 37 1 1

Huntington disease PANTHER 36 3 2 1

Parkinson disease PANTHER 42 1 1

6.3.5 Physical interactions of selected Arabidopsis proteins with TlOsm,

OsOlp1_A, and OsOlp1_I confirmed in planta

Analyses of proteins interacted with the three osmotins revealed their

involvement in intricate biological processes and pathways. However, the evaluation

of protein interactions on the chip was an artificial procedure and might not reflect

what happens in a living system. Thus, the validation of the protein-protein interaction

in planta was necessary before any conclusion was drawn. BiFC is a proven method

for visualisation of protein-protein interactions in planta (Hu et al., 2005) (refer to


Figure 1.3 for the principle of BiFC analysis). The BiFC assays were used for

validating the interactions of the three osmotins with selected Arabidopsis proteins.

Among the 7 categories of Arabidopsis proteins interacting with three target

osmotins, only three categories were selected for validation in planta due to the

interests in the osmotic stress tolerant mechanisms. These categories included those

commonly interacted with all three osmotins, those interacted with TlOsm and

OsOlp1_A, and those interacted with TlOsm only. In addition, a protein did not

interact with all three osmotins on the chip was selected as negative interaction control,

the AtPER42. To select the candidates in the three chosen categories, the sub-cellular

localisation of the osmotins and their putative interactors were considered. TlOsm

was proven to localise to the plasma membrane in both normal and salt stressed

conditions (Chapter 3). The localisation of OsOlp1_A and OsOlp1_I were

unknown but bioinformatics predictions suggested the apoplast localisation for

OsOlp1_I and either ER or chloroplast localisation for OsOlp1_A. Thus, in order

for Arabidopsis proteins contact with the three osmotins, the candidate proteins should

not localise to the nucleus. Hence, all the nuclear localised proteins were eliminated

from the list. Moreover, the proteins had been well characterised and shown to play

roles in stress tolerance were selected as priority. Taken all selection criteria together,

the AtCPK4, AtCPK5 were selected as representatives of proteins commonly

interacted with all three osmotins; the AtMS1 for representing those interacted with

TlOsm and OsOlp1_A but not OsOlp1_I; and AtALDH7B4 for representing

those interacted with TlOsm only.

The TlOsm, OsOlp1_A, and OsOlp1_I were separately fused with the half N-

terminus of EYFP gene in the pE3134 plasmid vector (Figure 6.2 A). The five selected

Arabidopsis genes were separately fused with the half C-terminus of EYFP gene in the

pE3132 plasmid vector. Co-expression of target osmotin genes and selected

Arabidopsis genes together with positive and negative control (Table 6.2) was

performed transiently in N. benthamiana by agro-infiltration method. Two days after

infiltration, agro-infiltrated leaves from all combinations and controls were harvested

and fixed. These samples were subjected to confocal laser scanning microscopic

analysis. Representative images captured the fluorescence of experimental leaf

samples are presented in the Figure 6.6, 6.7, 6.8, 6.9 and 6.10.


Figure 6.6 Analysis of in planta interactions between AtCPK4 and TlOsm, OsOlp1_A,

or OsOlp1_I. The protein combinations are indicated underneath the images. Images were

taken under Fitc light channel (488nm) captured green and EYFP fluorescence and Cy5 light

channel (668 nm) captured red fluorescence of chlorophyll. Bar 10 µm.


Results shown in Figure 6.6 indicated the interactions of AtCPK4 with TlOsm

and OsOlp1_A but not with OsOlp1_I. Few green fluorescent spots in Figure 6.6

C reflect the autofluorescence from chlorophyll not from EYFP fluorescence as the

results of the two protein interactions, indicating no interaction of OsOlp1_I with

AtCPK4 taken place. Hence, only the interactions between AtCPK4 with TlOsm

and with OsOlp1_A were demonstrated to happen in planta. AtCPK4 and

OsOlp1_I were showed strong interaction on the chip but that interaction did not take

play in living N. benthamiana plants.

Figure 6.7 Analysis of in planta interactions between AtCPK5 and TlOsm, OsOlp1_A,

or OsOlp1_I. The protein combinations are indicated underneath the images. Light channels

for capturing images and corresponding controls refer to Figure 6.8. Bar 10 µm.

Figure 6.7 confirmed the interactions of all TlOsm, OsOlp1_A, and

OsOlp1_I with AtCPK5 in planta.


Figure 6.8 Analysis of in planta interactions between AtMS1 and TlOsm, OsOlp1_A,

or OsOlp1_I. The protein combinations are indicated underneath the images. Light channels

for capturing images and corresponding controls refer to Figure 6.5. Bar 10 µm.

Fluorescent images in the Figure 6.8 proved the interactions between AtMS1

with TlOsm and with OsOlp1_A, not with OsOlp1_I. The interactions of these

protein combinations in living N. benthamiana plants were in agreement with the

results generated from screening interactions on the chip.


Figure 6.9 Analysis of in planta interactions between AtALDH7B4 and TlOsm,

OsOlp1_A, or OsOlp1_I. The protein combinations are indicated underneath the images.

Light channels for capturing images and corresponding controls refer to Figure 6.6. Bar 10 µm.

Fluorescent images from the Figure 6.9 demonstrated the interactions between

AtALDH7B4 only with TlOsm, not with OsOlp1_A and OsOlp1_I. The results

of these interactions in planta completely reflected what had been observed on the

chip.


Figure 6.10 Analysis of in planta interactions between AtPER42 and TlOsm,

OsOlp1_A, or OsOlp1_I. The protein combinations are indicated underneath the images.

Light channels for capturing images refers to Figure 6.6. Bar 10 µm.


In comparison with the fluorescence signals from the positive and the

negative_WT controls, the results shown in Figure 6.10 indicated that no interaction

between AtPER42 and TlOsm, OsOlp1_A, or OsOlp1_A takes play in planta.

These results affirmed the observations acquired from in vitro hybridisations of the

three target osmotins with the protein chips.

BiFC analysis indicated a total of eight interactions between the three target

osmotins and the selected Arabidopsis genes as indicated by the fluorescent emission

from leaf cells of eight combinations (Figure 6.6-6.9). Among nine combinations

showed significant interactions on the chip, one combination (OsOlp1_I and

AtCPK4) did not show interaction in planta. Seven combinations not significantly

interacting on the chip were confirmed in planta. Fourteen out of 15 combinations of

three osmotins with 5 Arabidopsis proteins in planta affirmed the results generated

from protein chip hybridisation. These results showed the reliability of the interactions

screened from hybridising the three osmotins and Arabidopsis proteins on the chip.

The results of BiFC analysis provided a firm evidence for the interactions of the

osmotins with plant proteins in living plants. These results also offered the basis for

elucidating the functions of TlOsm and OsOlp1_A in plant response to osmotic

stresses.

6.4 DISCUSSION

Plant osmotins have been proven as key regulators in both abiotic and biotic

stress responses of plants (Liu et al., 2010). However, the mechanisms underlying their

functions in plant stress response are not well established due to the lack of information

in their interaction partners and pathways. The difficulties in producing recombinant

osmotins with functionality and purity have additionally slowed the progress of

studying osmotins at protein levels. Intensive studies have been carried on osmotin but

to date only few evidences on osmotin binding to other proteins have been

demonstrated. In addition, none of the physical interactions between osmotin and plant

proteins have been reported in the literature. Interactions of osmotin to the Pir proteins

were validated in the Saccharomyces cerevisiae strain resistant to osmotin (Yun et al.,

1997). Similarly, binding of osmotin to phosphomannans on the cell-wall was proven

in S. cerevisiae strain sensitive to osmotin (Ibeas et al., 2000). The binding of osmotin

to PHO36 leading to the suppression of fungal apoptosis signalling pathway was also

evidenced in S. cerevisiae (Narasimhan et al., 2001; Narasimhan et al., 2005).


Evidence of osmotin functions as agonist of adiponectin for binding to adiponectin

receptor was demonstrated in mammalian C2C12 cell line (Narasimhan et al., 2005).

Nevertheless, the validation of these few interactions has contributed to the dissection

of osmotin functions and mechanisms of its in vitro toxicity to fungi and its

adiponectin-mimic functions.

In the previous chapter, the roles in enhancing plant tolerance to cold, drought

and salinity stresses of TlOsm, OsOlp1_A, and OsOlp1_I were compared in

transgenic rice. The results demonstrated the capacity in enhancing cold, drought, and

salinity stress tolerance in transgenic rice of TlOsm and OsOlp1_A, with the

superior tolerant levels to cold and drought stresses of TlOsm expressing plants. In this

study, to understand the functions and stress-responsive pathways by which these

osmotins mediate plant response to stresses, the potential interactive protein partners

of each TlOsm, OsOlp1_A, and OsOlp1_I were assessed by the Arabidopsis

protein microarray. Recombinant osmotin proteins were obtained with purity and

identity needed for probing with the proteins on the microarray. Arabidopsis proteins

interacting with each osmotin on the chip were identified. More proteins on the chip

interacted with TlOsm than with rice osmotins. In comparison within rice osmotins,

the OsOlp1_A from drought tolerant cultivar interacted with two more proteins than

OsOlp1_I from drought sensitive cultivar; they have 225 common interactors, 14

interactors specific to OsOlp1_A and 12 interactors specific to OsOlp1_I. The

interactors of osmotins were found to participate in a diverse biological process.

Interestingly, all proteins only interacting with TlOsm were found involved in plant

responses to stress and stimuli. Pathway analysis of osmotins interactors revealed the

conserved pathways among three osmotins and specific pathways for osmotins

conferred tolerance to abiotic stress and nine unique pathways for osmotin from T.

loliiformis.

Putative interactors of osmotins were selected for validating the interactions in

planta upon their well-characterised functions in plant stress response. CPK4 and

CPK5 belong to calcium-dependent protein kinase family that play the crucial

regulatory roles in plant signalling to diverse stress conditions including both abiotic

and biotic stresses (Mohanta and Sinha, 2016; Steinhorst and Kudla, 2013). Both

CPK4 and CPK5 were found to directly regulate ROS signalling through modulation

of RBOH by NADPH oxidases. Kobayashi et al. (2007) demonstrated in potato

(Solanum tuberosum) that StCPK4 and StCPK5 phosphorylated NADPH oxidase


and regulated the production of ROS. Arabidopsis CPK4 together with

CPK1/CPK2/CPK11 was shown to phosphorylate NADPH oxidases in vitro and

was considered as important components for the production of ROS during immune

signalling (Gao et al., 2013). Similarly, AtCPK5 was proposed to be a key component

of self-propagating activation circuit regulating cell-to-cell communication.

AtCPK5-dependent phosphorylation activated RBOHD that generated an apoplastic

ROS wave that further enabled signal propagation upon pathogen-associated

molecular pattern stimulation to distal parts of the plants. Thus, AtCPK5 represents

a positive regulator of the NADPH oxidising RBOHD during pathogen immune

defense in Arabidopsis (Dubiella et al., 2013). Moreover, AtCPK4 was proven to

regulate ABA signal transduction in Arabidopsis (Zhu et al., 2007). Accordingly,

AtCPK4 was evidenced to be induced by ABA stimulus and to regulate ABA signal

transduction pleiotropically in seed germination, seedling growth, stomatal movement,

and in plant response to salt stress. Another stress-responsive gene, the AtMS1, was

demonstrated to interact with TlOsm and OsOlp1_A but not with OsOlp1_I on

the chip. AtMS1 is involved in various biological processes including methionine

biosynthesis, methylation, and homocysteine metabolic process and in response to salt

stress, to zinc ion, and to cadmium ion. In the significant pathways of osmotin

interactors described in Table 6.4, AtMS1 is within the super pathway of lysine,

threonine, and methionine biosynthesis. Among the four proteins selected for

elucidating interactions with osmotins in N. benthamiana plants, AtMS1 has the most

complex protein interaction network (Figure 6.11 C). This protein is involved in

biosynthesis of compounds beneficial for plant adaptation. Abiotic stresses generate

ROS that consequently cause excessive accumulation of aldehydes in plant cells.

Aldehyde dehydrogenases (ALDHs) work as aldehyde scavengers to eliminate

aldehyde toxicity caused by oxidative stress (Hou and Bartels, 2014). As a member

of the ALDH family, AtALDH7B4 was demonstrated to enhanced A. thaliana plants

tolerant to abiotic stress by protecting plants against lipid peroxidation and oxidative

stress (Kotchoni et al., 2006). According to the authors, plants overexpressing

AtALDH7B4 showed higher level of AtALDH7B4 protein accumulation and

conferred tolerance to osmotic and oxidative stresses. The stress tolerance of

AtALDH7B4-overexpresing plants was accompanied by a decreasing level of H2O2 and

MDA generated from cellular lipid peroxidation. The AtALDH7B4-knockout mutant

plants exhibited higher sensitivity to drought and salinity stresses than WT plants. The


currently available protein-protein interaction networks of the selected Arabidopsis

stress-responsive proteins are presented in Figure 6.11.

Figure 6.11 Protein interaction networks of Arabidopsis genes selected for BiFC analysis. AtCPK4 (A); AtCPK5 (B); AtMS1 (C); AtALDH7B4 (D). Images were retrieved from

String server.

Validation of the protein-protein interactions in planta showed very high

correlation with results obtained from the chip. The differential interactors of these

osmotins provide the key mechanisms underlying the functions of osmotins in plant

stress response. In addition, the study provides the evidence, for the first time, on the

physical interactions between target osmotins and other plant stress-responsive

proteins in planta.


6.4.1 Production of pure and functional recombinant osmotins

Critical criteria for recombinant proteins used to hybridise with the protein chip

require purity, functional activity, and appropriate tags for detection of interactions.

Therefore, the gene manipulation and expression system for recombinant target

osmotin production needed to consider all the elements necessary for enhancing

protein production, facilitating proper protein folding, supporting purification process,

remaining protein activity after purification, and promoting detection of interactions.

The hydrophobicity, anti-microbial property and the presence of 8 disulfide bonds in

the structure of osmotins have made it difficult for expressing in microbial system with

proper folding of resulted proteins. Due to its toxicity to expressing microbes, osmotin

was targeted to inclusion bodies that resulted in water insoluble and aggregated form

and with misfolded proteins (Campos et al., 2008; Viktorova et al., 2012). Two current

existing protocols for recombinant osmotins in E. coli by Compos et al. (2008) and

Tzou et al. (2011) did not suit our purposes. The protocol by Compos et al. (2008)

requires targeting osmotin in the inclusion bodies, denaturing osmotin during protein

extraction and refolding the protein. However, with 8 disulfide bonds in the structure,

refolding osmotin is a difficult step accompanied with limited protein yield upon

water-insoluble of hydrophobic protein. The protocol by Tzou et al. (2011) developed

for C-terminus truncated tobacco osmotin that resulted in extra cellular secretion of

recombinant osmotin with reasonable yield and antifungal activities of recombinant

osmotin remained. However, TlOsm is a plasma membrane protein with a membrane

binding domain at its C-terminus. Truncated TlOsm at its C-terminus might affect its

native activities. Hence, another strategy was needed for gene manipulation and

expression of the three target osmotins.

Popescu et al. (2007b) compared two eukaryotic systems for protein expression,

S. cerevisiae and N. benthamiana, in order to identify the biological system that

allowed native protein folding and post-translational modification to occurs, providing

necessary cofactors for protein activity to be used on the protein chips. Their results

indicated that even though the proteins expressed at comparable levels in the two

systems, proteins produced by plants retained their enzymatic functions after

purification better than the yeast expression system. Therefore, expression of osmotins

in plant system would produce protein with more proper folding and functionally

active on the chip similarly to their cellular counterparts. However, TlOsm was


validated to be a plasma membrane protein. If protein localises naturally, the extraction

of recombinant TlOsm must require the disruption of the plasma membrane to release

the protein. The chemicals used to disrupt cell membrane could cause protein

denatured, change protein conformation that may further effect protein activity.

Numerous studies have proven that addition of a KDEL sequence to the C-terminus of

a protein allowed it retained in the ER (discussed in Section 1.6.2). Incorporation of

the KDEL sequence in cytoplasmic, transmembrane, and other secreted proteins has

been proven to result in ER retention, higher level of expression, stabilisation, and

accumulation of recombinant proteins as compared to their native derivatives (Jackson

et al., 1990; Wandelt et al., 1992; Schouten et al., 1996). Thus, a KDEL sequence were

attached to the C-terminus of the target recombinant osmotins for their ER retention

and improvement in protein expression, stabilisation, and accumulation. Moreover,

progresses in cloning studies have identified number of elements necessary for

stabilising and maintaining native protein activities. Thus, various gene constructs

have been developed for enhancing protein production in transient expression systems

and for facilitating protein purification. The CPMV-HT sequence and P19 suppressor

of gene silencing in the gene expression cassette have been found to be advantages of

pEAQ vector for enhancing recombinant protein expression and for maximizing

expression efficiency in a transient expression system (Preyret and Lomonossoff,

2013). The Tandem affinity purification (TAP) tagged to the C-terminus of a protein

was found to be an efficient approach for isolation of recombinant protein in a plant

protein complex (Rubio et al., 2005). Taking all the considerations required for

recombinant osmotins and the advances of gene cloning into gene manipulation

strategy, we generated the plasmid constructs for expressing target osmotins with the

schematic T-DNA shown in Figure 6.1. In these gene expression cassettes, the CPMV-

HT sequence and P19 gene silencing suppressor were incorporated; and the

recombinant osmotins included either TlOsm, OsOlp1_A, or OsOlp1_I

downstreamed by 9xMyc epitope, His-6, a rhinovirus 3C protease cleavage site, the

2xIgG binding domain of protein A, and the KDEL sequence. These gene constructs

were used for transient expression in N. benthamiana by agro-infiltration method.

The recombinant osmotin proteins were purified through three-step purification

protocol. The osmotin proteins were obtained with purity and identity as evidenced by

the Coomassie staining of SDS-PAGE and western blot analysis (Figure 6.3).


Functional activities of recombinant target osmotins were further demonstrated by

higher levels of interaction signals detected from some spots on the chip, as compared

to positive control spots (Figure 6.4). Thus, the protocols for cloning, transient

expression in plant system, and protein purification used in this study provide an

alternative method for producing pure and functional recombinant osmotin.

6.4.2 Analysing potential protein interactors of TlOsm, OsOlp1_A and

OsOlp1_I affirms their multiple functions

Protein-protein interaction is one of the fundamental networks reflecting the

complex biological processes in living organisms. Identification of protein interactors

for a protein under study is a crucial desire to unravel the mechanisms underlying the

protein functions. Revealing and cataloguing these protein interactors would provide

a comprehensive understanding of cellular functions and regulatory network of the

under-studied gene in living organism (Popescu et al., 2007a). Numerous studies on

osmotin by various methods have identified only few proteins interacting with

osmotin. These proteins include Pir proteins (Yun et al., 1997), phosphomanno

proteins (Ibeas et al., 2000), the PHO36 regulating the Ras/cAMP pathway in yeast

(Narasimhan et al., 2001), and a mammalian adiponectin receptor (Narasimhan et al.,

2005). Using the Arabidopsis protein microarrays containing 5000 proteins for

separately hybridising with TlOsm, OsOlp1_A, and OsOlp1_I, total of 271

interactive protein partners were identified. Further analysis of the osmotin interactors

revealed their involvement in diverse protein families, biological processes and

pathways. The results demonstrated the effectiveness of using protein microarray to

identify osmotin interactive protein partners that further facilitates the progress for

functional characterisation of these osmotins. The results also confirm the assumption

that TlOsm has more functional sites would interact with more proteins than the rice

osmotins, OsOlp1_A and OsOlp1_I.

Analysis of significant pathways involving three osmotin interactors indicated

the three most dominant pathways to be fructose and mannose metabolism, glycolysis

and pentose phosphate pathways (Table 6.4), with corrected P-value < 0.05. In plants,

soluble sugars not only serve as cell metabolic resources and structural constituents

but also signalling regulators in various processes of plant growth, development, and

response to stress stimuli. Members of the soluble sugar metabolism have been

evidenced to play important roles in plant signalling and adaptive response to abiotic


stress (Rosa et al., 2009). Glycolysis is a central metabolic pathway present in all

organisms. Different to non-plant systems, plant glycolysis occurs both in the cytosol

and the plastid. The cytosolic glycolysis has been known to provide essential

components for promoting plant development and adaptation to environmental stress

(Plaxton, 1996). Parallel to glycolysis, the pentose phosphate pathway is a metabolic

pathway generating NADPH and pentoses including ribose-5-phosphate that is

fundamental for the synthesis of nucleotides and for building other molecules. In

plants, the pentose phosphate pathway has been shown to be linked with other

pathways including proline biosynthesis, antioxidant response pathway, and phenolic

biosynthesis (Shetty, 2004; Kishor et al., 2005). In the study by Shetty (2004), the

author argued that products of all these pathways are beneficial for plant and also

animal response to stresses. Thus, they suggested the key components that link the

pentose phosphate pathway to these three pathways to be exploited for producing

functional food for use in manage human diseases such as diabetes, cardiovascular,

inflammatory, and cognition diseases, and cancer; and for enhancing plant

environmental stress tolerance. Beside these three dominant pathways, less significant

numbers of osmotin interactors are involved in other 7 pathways (Table 6.4; corrected

P-value < 0.1) that somewhat relate to plant response to environmental and pathogenic

stress factors (Dong and Beer, 2000; Ferreyra et al., 2012; Kishor et al., 2005; Gerdes

et al., 2012). The involvement of osmotin interactors in numbers of fundamental

pathways in plant development and stress response demonstrated the functional roles

of osmotins in above-discussed pathways.

Screening Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and

OsOlp1_I using protein microarray identified a large group of proteins with

recognised roles in biological processes associated with plants response to abiotic and

biotic stresses and development. The involvements of the osmotin interactors in

multiple biological processes and pathways demonstrate the multiple functions of the

osmotins in plant development and adaptation. However, the interactions of these

osmotins with the proteins on the chips were generally artificial environment, where

the sub-cellular localisation of interactive protein partners were not considered.

Therefore, the actual interactors of these osmotins in plants can only be drawn by the

validation of interactions in an appropriate living system.


6.4.3 Common and specific potential interactors of TlOsm, OsOlp1_A, and

OsOlp1_I provide testable target proteins for unravelling osmotin functions

Osmotin has been demonstrated to be a multi-functional protein and a key

modulator in plant defense against pathogens and environmental stresses (Husaini &

Rafiqui, 2012; Viktorova et al., 2012; Kumar et al., 2015). As discussed in Section

1.3, its roles in both abiotic and biotic stress response of plants have been proven by

analysing gene expression upon stress stimuli, promoters, and various transgenic

plants expressing osmotins from different species. In addition, osmotins have shown

antifungal activities in vitro against a broad range of fungi. Although the mechanisms

underlying osmotin functions in plant defense have not been elucidated, some

mechanisms of osmotin antifungal properties in vitro have been determined via

proteins it interacted with. For examples, mechanisms underlying osmotin functions

that cause fungal cell permeability and susceptible to osmotin were discovered by its

interaction with cell wall phosphomanno proteins (Ibeas et al., 2000). Similarly,

resistance to osmotin toxicity of some S. cerevisiae strains was determined by the

interaction of osmotin with the Pir proteins, the cell-wall-localised stress proteins (Yun

et al., 1997). The mechanism of osmotin causing apoptosis in yeast was found by its

interaction with PHO36, which regulates lipid and phosphate metabolism. In

interacting with PHO36, osmotin suppresses the downstream RAS2/cAMP cell death

signalling pathway and causes apoptosis to yeast cells. The function of tobacco

osmotin as an agonist of mammalian adiponectin was demonstrated based on its

interaction with adiponectin receptors, which resulted in activation of AMP kinase

signalling in C2C12 myocyte cells (Narasimhan et al., 2005). Therefore, the list of 11

interactors of both TlOsm and OsOlp1_A and 21 interactors of TlOsm only

(highlighted in Table 6.3) holds a great target for understand the mechanisms by which

TlOsm and OsOlp1_A regulate plants response to cold, drought, and salinity

stresses. The comparision among TlOsm, OsOlp1_A and OsOlp1_I in transgenic

rice only focussed on plant response to abiotic stresses, particularly to cold, drought

and salinity. TlOsm and OsOlp1_A conferred tolerance to cold, drought, and

salinity in transgenic rice with a higher tolerant levels to cold and drought of TlOsm.

Thus, the mechanisms that TlOsm and OsOlp1_A use to regulate cold, drought, and

salinity stress response could be related to 11 proteins involved in various biological

processes (Table 6.3 and Figure 6.5). The physiological changes in transgenic rice

associated with additional effects of TlOsm over OsOlp1_A were higher osmotic


adjustment, better membrane protection, and better regulation of stomatal closure. The

21 proteins, which interacted with only TlOsm and are involved in biological process

of plant response to stress, to toxic chemical, and to endogenous stimuli, would be the

ideal target for determination the mechanism of TlOsm leading to such physiological

changes.

Osmotin has been suggested to function in pathogen defence pathway and a

number of signalling pathways. Pathway analysis of osmotin interactors indicated the

involvements of various interactors in plant-pathogen interaction pathway and

numerous stress-signalling pathway such as cadherin signalling, plant hormone signal

transduction, apoptosis signalling pathways (Table 6.6). Interestingly, tobacco

osmotin has shown to share structural and functional similarities with adiponectin, an

insulin sensitising hormone in mammals (Miele et al., 2011), to mimic adiponectin in

activating AMP kinase phosphorylation in mammalian cells (Narasimhan et al., 2005),

and to function as human adiponectin in type II diabetes and obesity (Trivedi et al.,

2012). Since adiponectin has anti-diabetic, anti-atherogenic, and anti-inflammatory

activities, osmotin has been suggested to be used as a therapeutic compound in

replacement of adiponectin for treatment of human diseases related to insulin

resistance (refer to Section 1.3.5). Few proteins interacted with three osmotins on the

chip are also involved in insulin resistant pathway and inflammation mediated by

chemokine and cytokine signalling pathway. Likewise, in mammalian model systems,

osmotin has been demonstrated to function in preventing neurodegeneration and been

suggested to be used as a neuroprotective agent (Shah et al., 2014; Naseer et al., 2014).

Several proteins either commonly or specifically interacted with the three osmotins on

the chip were found to function in the Huntington’s disease and Parkinson disease, the

two neurodegenerative diseases in Human (Table 6.6). These demonstrate the relations

of the results generated from screening protein-protein interactions on the chip to the

previously reported roles of osmotin. Therefore, the osmotin interactors identified

from this study offer a direct targets for testing hypothesis on the mechanisms

underlying these osmotin functions.

Similar to other osmotins, all TlOsm, OsOlp1_A and OsOlp1_I potentially

play roles in defense response to pathogens. Many proteins in the group of common

interactors of the three osmotins are involved in recognised biological processes for

plant disease resistance and innate immunisation response. Hence, this group of


proteins can serve as testable targets for further studies on mechanism of osmotins in

plant response to biotic stress. Thus, the resulted protein interactors of the three

osmotin provide an informative information for testing binding targets of the osmotins

for elucidation of mechanisms underlying osmotin functions in regulating plant

responses to abiotic and biotic stresses and for exploiting the use of the osmotins as

therapeutic reagents.

6.4.4 Possible mechanisms underlying TlOsm, OsOlp1_A, and OsOlp1_I

functions

The functions and mechanisms by which osmotin regulates plant stress response

have not been well-elucidated partially due to the lack of information in interaction of

osmotin with plant protein. Interactions of the three osmotins with the Arabidopsis

proteins by BiFC analysis reported here present, for the first time, the physical

interactions of the osmotins with plant proteins in plants. Arabidopsis proteins selected

for validating in planta interaction with TlOsm, OsOlp1_A, and OsOlp1_I were

on the basis of their well-characterised roles in plant stress adaptation and within

different stress-responsive pathways (Figure 6.11). The validated interactions in planta

between TlOsm, OsOlp1_A, and OsOlp1_I with Arabidopsis stress-responsive

genes serve as firm evidence for elucidating the mechanisms by which TlOsm and

OsOlp_A regulate plant tolerance to cold, drought and salinity stresses.

In this study, TlOsm and OsOlp1_A were evidenced to interact with

AtCPK4 and AtCPK5 both on the chip and in planta, while OsOlp1_I

significantly interact with AtCPK4 and AtCPK5 on the chip but only interacted with

AtCPK5 in plants (Figure 6.8 & 6.9). The interactions of TlOsm with AtCPK4 and

AtCPK5, which have been known for functions in plant stress signalling pathway,

demonstrate the functions of target osmotins in stress signalling pathways. In addition,

TlOsm and OsOlp1_A both conferred tolerance to cold, drought, and salinity

stresses in transgenic rice and interacted with AtCPK4 in living plants. AtCPK4 was

demonstrated to regulate ABA signal transduction in plant response to drought and

salinity stresses (Zhu et al., 2007). This suggests that interacting with AtCPK4 is

essential to transmit abiotic stress signals to acquire sufficient stress adaptation.

AtCPK5 has been demonstrated a positive regulator of plant signal transduction upon

pathogenic infection (Dubiella et al., 2013). All TlOsm, OsOlp1_A, OsOlp1_I

interacted with AtCPK5 in planta, suggesting their involvement in plant signalling


defense to pathogens. Lack of interaction with AtCPK4 of OsOlp1_I probably

results in the failure to transduce abiotic stress signals that further leads to its

insufficient regulation of plant stress response, as compare to its allele OsOlp1_A.

Similarly, AtMS1 is involved in biosynthesis of compounds beneficial for plant

adaptation (its protein interaction network in Figure 6.11 C). Interactions of TlOsm

and OsOlp1_A with AtMS1 would contribute additional effects on their ability to

facilitate plant tolerance to abiotic stress. Hence, without interacting with AtMS1 of

OsOlp1_I would further limit OsOlp1_I functions in enhancing plant tolerance to

cold, drought, and salinity stresses. Moreover, in agreement with the results derived

from interaction of osmotins and Arabidopsis proteins on the chip, in N. benthamiana

plants, only TlOsm was found to interact with AtALDH7B4 (Figure 6.9). TlOsm

but not OsOlp1_A interacting with ALDH7B4 at least partially demonstrating to

the higher level of enhanced tolerance to drought and cold stress as demonstrated in

TlOsm rice plants over the OsOlp1_A plants. Failure to interact with key proteins

in stress responsive pathways explains for the failure to promote transgenic rice

tolerance to cold, drought and salinity stresses of OsOlp1_I.

Patade et al. (2013) showed that some stress-responsive genes including CBF1

(transcription factor), P5CS (osmotic adjustment), APX (antioxidant defense) were

activated in cold tolerant tomato expressing tobacco osmotin. This indicated that

osmotin should be an upstream modulator of transcription factor in the stress signal

transduction process. Choi et al. (2013) demonstrated that pepper osmotin

(CaOSM1) regulated hypersensitive cell death response and oxidative burst

signalling during infection of Xanthomonas campestris. Both CPK4 and CPK5 were

proven to regulate ROS signalling but CPK5 was likely specific for response to

pathogen stimuli (Gao et al., 2013; Dubiella et al., 2013). Interactions of TlOsm and

OsOlp1_A with both AtCPK4 and AtCPK5 suggested that these two osmotins

function in ROS signalling. OsOlp1_I interacted with AtCPK5 but not AtCPK4

suggested its function in signalling upon pathogenic stimuli. Zhu et al. (2007)

demonstrated that AtCPK4 regulated drought and salinity stress response through

ABA signal transduction and worked upstream of several ABA transcription factors.

The gene showed functions in regulating stomatal movement, osmotic adjustment and

lipid peroxidation inhibition that further lead to enhanced Arabidopsis plant tolerance

to drought and salt stresses. Considering the physiological changes in rice plants


expressing TlOsm and OsOlp1_A, functions for TlOsm and OsOlp1_A were

also associated with stomatal closure, osmotic adjustment and lipid peroxidation

inhibition. Besides, TlOsm and OsOlp1_A showed interacting with AtMS1, which

is involved in plant response to chemical and within a biosynthesis pathways. Only

TlOsm (not OsOlp1_A) interacted with AtALDH7B4, a protein functions in

detoxification of aldehydes generated upon plant stress, which protects plants against

lipid peroxidation and oxidative stress (Kotchoni et al., 2006). Regarding localisation

of the proteins, TlOsm localises to the plasma membrane while AtCPK4 and

AtALDH7B4 are cytoplasmic proteins (Kotchoni et al., 2006; Zhu et al., 2007), and

AtMS1 is annotated as cytoplasmic or chloroplast protein. Thus, TlOsm is likely an

upstream regulator of these three proteins. Regarding the physiological differences of

rice plants expressing TlOsm or OsOlp1_A in comparison with OsOlp1_I, WT or

NT, and VC (Chapter 5), the mechanisms underlying TlOsm and OsOlp1_A

functions cold, drought, and salinity stress responses could be suggested. TlOsm

would transmit the stress signal by interacting with CPK4 homolog that further

activates ABA signal transduction leading to downstream adaptive response such as

stomatal closure, osmotic adjustment, and antioxidative defense response. Besides, it

would interact with rice MS1 homolog to regulate biosynthesis of compounds

beneficial for protecting rice plants from chemical toxicity. On the other hand, it would

interact with ALDH7B4 homolog that further mediates detoxification of aldehydes

generated by osmotic stress to prevent oxidation and lipid peroxidation. OsOlp1_A

would function in a similar way when interacting with CPK4 and MS1 homologs.

However, lack of interaction with ALDH7B4 homolog would be the reasons for less

efficiency in protect membrane damage leading to higher electrolyte leakage in

OsOlp1_A plant as compared to TlOsm plants (Figure 5.4). Without interactions with

CPK4, MS1, and ALDH7B4 homologs of OsOlp1_I would lead to failure to

transmit the stress signals and regulate other detoxification processes that result in

failure in improving rice plants to cold, drought, and salinity stress of OsOlp1_I.

In conclusion, research in this chapter has indicated that osmotin from T.

loliiformis, TlOsm, has more potential binding partners than osmotins from O. sativa.

In addition, OsOlp1_A from drought tolerant cultivar has two more binding partners

than OsOlp1_I from drought sensitive cultivar. The results are in agreement with the

hypothesis that protein with more functional binding sites interact with more proteins.


The Arabidopsis protein interactors of TlOsm, OsOlp1_A and OsOlp1_I are

involved in the diverse biological processes and pathways of development and

adaptation. These interactors and pathways provide the testable targets for further

studies in exploiting osmotins for biotechnological applications in GMO crops, the

food industry and pharmaceuticals. The in planta experiments validated interactions

between the three osmotins and stress-responsive Arabidopsis proteins demonstrated

the functions of TlOsm and OsOlp1_A in stress signal transduction, adaptation, and

additional oxidative-stress detoxification for TlOsm. Shortage of in planta interaction

with the key stress-responsive components of OsOlp1_I provides evidence for its

limited functions in abiotic stress response, as compared with its allele, the

OsOlp1_A. These results provide evidence on the physical interactions of osmotins

with numbers of stress-responsive proteins in plants and contribute to present

knowledge and understanding insights into mechanisms of osmotin in regulation of

plant stress response. Moreover, the gene manipulation method and the N.

benthamiana transient expression system used in this study can be applied as an

alternative method for recombinant osmotin production.

Chapter 7: General Discussion 197

Chapter 7: General Discussion

Abiotic stresses such as drought, salinity, and extreme temperature are massive

challenges hindering the capacity of agriculture to meet the food demands of an

increasing global population. To feed the growing population we will need to produce

approximately 60% more food to meet the demands in 2050; this is the equivalent to

a 2.4% yield growth rate per annum for all crops. Currently, crop yield has an estimated

growth rate of 1.6%, 1.0%, 0.9%, and 1.3% for maize, rice, wheat, and soybean,

respectively (Ray et al., 2013). By looking at what causes the great levels of crop loss

we may be able to increase production. Approximately 50% yield loss of major food

crops are caused by abiotic stresses (Huang et al., 2012). Hence, besides high yielding,

future crops must be equipped with stress-adaptive traits to cope with adverse

conditions. To ensure global food security, the development of stress-adaptive crops

represents a key goal in constant supplying improved crop cultivars for commercial

cultivation. Genetic engineering high yielding crop cultivars with stress-adaptive traits

is considered a promising approach for developing such crops (Cominelli et al., 2013;

Oliver, 2014). Thus, characterisation of the key components controlling stress-

adaptive traits to be used in genetic engineering is in crucial need for the development

of resilient crops. Moreover, seeking genes from stress-tolerant species for engineering

into crops displays great promise as an effective strategy for introducing new stress-

adaptive traits into yield-improved crop cultivars (Mittler and Blumwald, 2010).

In this project, an osmotin gene from resurrection plant T. loliiformis (TlOsm)

was characterised and functionally analysed for abiotic stress response in various

systems, in comparison with two osmotin genes (OsOlp1_A and OsOlp1_I) identified

from drought-tolerant and –sensitive cultivars of stress-sensitive species O. sativa. The

common and specific characteristics of TlOsm were identified. Its involvement in plant

abiotic stress responses was analysed in T. loliiformis as well as in transgenic N.

tabacum and O. sativa. Its roles in enhancing plant tolerance to stress were validated

by comparative assessment transgenic rice expressing TlOsm, OsOlp1_A, OsOlp1_I,

and corresponding controls under cold, drought, and salinity stresses. The interactive

protein partners of the three osmotins were identified and pathways involving osmotin

interactors were also determined. Interactions between TlOsm, OsOlp1_A, or

198 Chapter 7: General Discussion

OsOlp1_I, with some stress-responsive proteins were validated in living N.

benthamiana plants. The study indicates the role of TlOsm in plant response to multiple

abiotic stresses and its additional effects over osmotins from sensitive species, O.

sativa. The study highlights potential applications of TlOsm for engineering crops with

improved tolerance to multiple stresses such as cold, drought, and salinity. The study

also deepens our understanding the functions and molecular mechanisms of osmotins

in regulating plant stress response and provides evidence, for the first time, the

physical interactions of osmotins with plant proteins in planta.

7.1 TlOsm has more functional efficacy in regulation of plant stress response

than rice osmotins

Resurrection plants have evolved unique stress-tolerant mechanisms that enable

them rapidly respond to stress, effectively protecting cellular components during

stress, whilst allowing rapid recovery to full metabolic functions within 48 – 72 h of

watering (Peters et al., 2007). Proteomic analyses on these plants during dehydration

have shown the increased abundance of many proteins functioning in antioxidance,

energy metabolism, and macromolecule protection (Dinakar and Bartels, 2013; Ingle

et al., 2007; Jiang et al., 2007). In addition, enzymatic activities of many proteins

related to antioxidant synthesis, sugar metabolism, and chaperones were found

increased during dehydration in various resurrection plants (Petersen et al., 2012;

Rohrig et al., 2006; Whithaker et al., 2001). In these studies, the increased abundance

and enzymatic activities and maintained phosphorylation activities of stress-

responsive proteins positively correlated with the accumulation of sugar metabolites,

antioxidants and other cellular protective compounds. Perhaps, proteins of resurrection

plants have evolved additional functions that enable them to more effectively mitigate

stress. Similar molecular, biochemical, physiological, and structural changes for early

response to water deficit, for promoting survival mechanisms during desiccation, and

for rapid recovering upon rehydration with minimal damage have been reported in T.

loliiformis (Karbaschi et al., 2016; Williams et al., 2015). Thus, we hypothesised that

stress-responsive proteins from T. loliiformis evolve additional functions than their

respective counterparts of sensitive species.

Comparative bioinformatics analysis of functional binding residues of TlOsm

and rice osmotins from drought-tolerant vs. -sensitive cultivars (OsOlp1_A vs.

OsOlp1_I) indicated that TlOsm contains additional glucan-binding and


phosphorylation sites as well as unique sites with enzymatic functions in sugar

metabolism. The tolerant cultivar OsOlp1_A contains three more glucan-binding

sites than its sensitive counterpart OsOlp1_I. Binding and hydrolysing glucan

molecules are essential for the antifungal activities of an osmotin (Liu et al., 2010;

Mani et al., 2012). The glucan-hydrolytic functions of osmotin in plant abiotic stress

response are not clear though glucan-hydrolytic products have been suggested to be

used for development of organelle and cell membrane and for osmotic adjustment

(Dway and Smille, 1971; Satoh et al., 1976). Eight, five, and two glucan-binding

residues were predicted for TlOsm, OsOlp1_A, and OlOlp1_I, respectively

(Table 3.2). Moreover, osmotin has been proven to activate MAP kinase signalling

pathway (Narasimhan et al., 2005; Narasimhan et al., 2001). In plants,

phosphorylation reactions play the central signalling role that translates environmental

stimuli into cellular response. These reactions are common in stress signal transducers

such as the MAP kinases and calcium-dependent protein kinases and are performed by

phosphorylation sites (Mohanta and Sinha, 2016; Sinha et al., 2011; Wurzinger et al.,

2011). Phosphorylation reactions are maintained in resurrection plants during

dehydration and are believed to be essential for protecting their cells from damaged by

stress (Dinakar and Bartels, 2013; Rohrig et al., 2006). TlOsm, OsOlp1_A, and

OlOlp1_I all contain the potential phosphorylation residues but the number of

residues is higher in TlOsm (64 residues) than in either rice osmotin (15 residues for

both). In addition to these sites, TlOsm possesses 4 functional sites for sugar

metabolism, neither rice osmotin contains a similar site. Soluble sugar metabolism is

a key pathway in plant sensing and response to abiotic stress (Rosa et al. 2009). The

accumulation of remarkably high soluble sugars during desiccation is a unique feature

of desiccation tolerant plants (Dinakar and Bartels, 2013; Gaff and Oliver, 2013).

Therefore, we speculated that TlOsm is more effective in regulating plant response

to stresses. This assumption was validated in rice plants expressing these osmotins.

Investigating the response of transgenic rice expressing TlOsm, OsOlp1_A, or

OsOlp1_I upon exposure to cold, drought, and salinity stresses proved that levels of

rice stress tolerance positively correlate with the number of functional sites of the

osmotin that plants expressing. The highest levels of enhanced stress tolerance were

found in TlOsm plants, following by OsOlp1_A plants and lowest in OsOlp1_I plants.

Since OsOlp1_I did not confer stress tolerance in transgenic rice (Chapter 5), here the


higher functional efficacy in regulating plant response to stresses of the osmotins from

tolerant and sensitive species is compared between TlOsm and OsOlp1_A.

OsOlp1_A was isolated from a drought tolerant rice cultivar. Similar to TlOsm,

OsOlp1_A was induced by drought (personal communication with Raveendran,

TNAU). When exposure to cold and drought stresses, transgenic OsOlp1_A plants

showed lower levels of tolerance than TlOsm plants in both physiological and

agronomic traits. The lower tolerance levels of OsOlp1_A plant were demonstrated by

lower growth rate, tillering capacity, dry biomass, survival rate, and grain yield; which

were associated with less ability to retain water, maintain membrane integrity and

photosynthesis efficiency. When exposure to salinity stress, TlOsm plants displayed

better water retention than OsOlp1_A plants (Figure 5.3). Thus, there might be

common functional features between TlOsm and OsOlp1_A that made both

TlOsm and OsOlp1_A conferred tolerance to these stresses. There might be unique

features for TlOsm that made TlOsm plants performed better than OsOlp1_A plants

under cold, drought, and salinity stresses.

Protein interactions regulate various cellular functions and provide basis for

understanding molecular mechanisms of protein functions (Hu et al. 2005). Several

interactions of tobacco osmotin with fungal and mammalian proteins have been

demonstrated (Ibeas et al. 2000; Narasimhan et al. 2005; Narasimhan et al. 2001; Yun

et al. 1997). These interactions have provided useful information for elucidation of

mechanisms underlying osmotin toxicity to fungi and its function in activating AMP

cascade in mammalian cells. To date, information on plant proteins interacting with

osmotins and evidence of osmotin interacting with other proteins in living plant cells

is still missing in the literature. For understanding insights into osmotin functions in

regulating plant response to stress, plant proteins interacting with TlOsm,

OsOlp1_A, and OlOlp1_I were identified and some interacting complexes in

living plants were also determined. To understand the functions underlying the

enhanced effects of TlOsm to improve rice stress tolerance, the potential interactive

protein partners of TlOsm and OsOlp1_A were compared. TlOsm had 28 more

interactive protein partners than OsOlp1_A (267 vs. 239) and the two osmotins share

236 common interactors. Thus, understanding the different interactors of the two

osmotins would provide the key insight into functional efficacy of TlOsm over

OsOlp1_A. Among the different interactors, 21 proteins were found unique


interactors of TlOsm, not interacted with either of rice osmotins. All the 21 proteins

were found involved in three biological processes of plant response to abiotic stresses,

to chemicals, and to endogenous stimuli (Figure 6.5). This suggests that TlOsm

potentially interact with more stress-responsive proteins than OsOlp1_A. Among

these 21 TlOsm interactors, AtALDH7B4 had been demonstrated to enhanced

Arabidopsis plants tolerant to drought and salinity by protecting plants from damages

of lipid peroxidation and oxidation and effective aldehyde detoxification (Kotchoni et

al. 2006). AtALDH7B4 interacted with only TlOsm in living N. benthamiana, not

with OsOlp1_A. Thus, TlOsm interacting with AtALDH7B4 homologs probably

activates the system that mitigates damages caused by lipid peroxidation and

oxidation. This interaction ultimately contributes to its additional effects on enhanced

plants tolerant to cold, drought and salinity stresses.

It is possible that osmotin protein from tolerant species T. loliiformis has evolved

with more functional binding sites than osmotin proteins from sensitive species O.

sativa. These extra functional binding sites, including the extra number of glucan-

binding and phosphorylation residues and unique enzymatic residues functioning in

sugar metabolism, would enable TlOsm interact with more stress-responsive proteins

when plants exposed to stresses. As consequence of the interactions, more stress-

responsive processes and pathways would be activated. These activations would result

in more effective mitigation of cellular damages and enhanced physiological and

morphological responses for adaptation. Thus, proteomic evolution of TlOsm would

provide it additional functions that enhance TlOsm efficacy of regulating plant

response to stresses.

7.2 TlOsm is a multi-functional protein playing a role in plant response to

stresses

Previous studies on osmotins have indicated their multi-functional roles in plant

response to both abiotic and biotic stresses (Husani and Rafiqi 2012; Kumar et al.

2015; Viktorova et al. 2012). Analyses of transgenic plants expressing various osmotin

genes from diverse plant species (Table 1.1) have emphasised their potential for use in

genetic engineering of crops with enhanced tolerance to multiple stress factors. This is

the first time an osmotin from a resurrection plant has been characterised. In agreement

with the functional roles of other osmotins from previous studies, results in this study


demonstrated that TlOsm play multi-functional role in plants response to stresses. In

addition, novel characteristics of TlOsm was identified.

TlOsm was previously isolated from T. loliiformis drought-induced cDNA

library, suggesting its involvement in plant response to drought. Sequence analysis of

TlOsm indicated it an osmotin with all conserved characteristics, with closest

relationship to osmotins of monocots, but including a non-homologous sequence of 50

AA at its C-terminus. Structural-to-functional predictions of TlOsm, in comparison

with two rice osmotins, proposed the multi-functional nature of TlOsm and its novel

characteristics. Functional predictions indicate two types of TlOsm binding sites

(glucan-binding and phosphorylation sites) in common with other osmotins and one

type of binding sites (sites with enzymatic functions in sugar metabolism) unique to

TlOsm. TlOsm contains three types of potential functional activities in different

biological processes of plant response to abiotic and biotic stresses, suggesting the

multiple functions of TlOsm in both abiotic and biotic defense response of plants.

Gene activated by stress stimuli are likely involved in the response to those

stresses. Profiling the transcriptional expression of TlOsm in native T. loliiformis

plants during development and during cold, drought, heat, and salinity stresses

indicated the involvement of TlOsm in plant response to cold, drought, and salinity

stresses (Figure 3.6). TlOsm was activated in both root and shoot of T. loliiformis

plants at noticeably high levels at very early stage of cold, drought, and salinity

stresses. The remarkable activation of TlOsm upon various stresses suggested its role

in multi-stress response of T. loliiformis.

The multi-functional roles in plant stress response of osmotins has been

demonstrated and transgenic plants expressing osmotin have exhibited enhanced

tolerance to cold, drought, salinity stresses and resistant to bacterial and fungal

infections (summarized with reference in Table 1.1). In transgenic osmotin plants,

osmotins have shown function in activating various molecular, chemical, and

physiological changes that ultimately resulted in morphological changes for

adaptation. The roles of TlOsm in plant response to multiple abiotic stress were also

validated in transgenic rice in comparision with the rice osmotins (Chapter 5).

Analyses of physiological and agronomic traits of transgenic rice expressing TlOsm,

OsOlp1_A, OlOlp1_I and controls subjected to cold, drought, and salinity stresses

proved the roles of TlOsm and OsOlp1_A in enhancing rice plants tolerance to

these stresses. Across two generations (T0 and T1) of transgenic rice plants and


regardless the developmental stages (seedling and reproductive stages) when stresses

applied, TlOsm and OsOlp1_A plants showed enhanced shoot growth rate (Figure 5.1),

tiller number (Figure 5.2), dried biomass (Table 5.2 & 5.3), survival rate (Figure 5.10),

and grain yield (Table 5.4). The enhanced stress tolerance of TlOsm and OsOlp1_A

rice plants was accompanied with the abilities to greater retain leaf water content

(Figure 5.3), to better maintain cell integrity (Figure 5.4), and to more effective

regulate photosynthesis-related activities (Figure 5.5-5.7). These physiological

changes were similar to those of other transgenic osmotin plants (refer to Section

5.4.1). All the tested plants were generated from the same genetic background of rice

cultivar Nipponbare. The physiological and agronomic traits associated with rice stress

tolerance were exhibited in TlOsm and OsOlp1_A plants. Thus, the tolerance to cold,

drought, and salinity stresses of TlOsm and OsOlp1_A rice plants must be the

consequence of TlOsm and OsOlp1_A expression. These results demonstrate the

functions of TlOsm (and OsOlp1_A) in rice response to multiple stresses including

cold, drought, and salinity.

TlOsm was demonstrated to interact with various Arabidopsis proteins, which

are involved in diverse biological processes and pathways for plant signalling, abiotic

stress response, plant-pathogen interaction, biosynthesis, and metabolism (Figure 6.5,

Table 6.4, Table 6.5, Table 6.6, Appendix E-Table 2&3). Interacting with significant

numbers of proteins in the conserved and fundamental pathways in plant development

and adaptation such as fructose and mannose metabolism, glycolysis, and pentose

phosphate pathways displays different functions of TlOsm. In planta, TlOsm was

proven to interact with four stress-responsive proteins in signalling, biosynthesis, and

detoxification pathways. The involvements of TlOsm interactors in diverse biological

processes and pathways reflect the multiple functions of TlOsm.

7.3 TlOsm (and OsOlp1_A) likely contribute to plant stress response through

signal transduction

In plants, efficacy of stress responses depend on early signal perception and rapid

signal transduction that activate the appropriate cellular responses such as gene

transcriptional reprogram, hormonal alteration, and production of protective

compounds that subsequently result in adaptation (Huang et al., 2012; Mishra et al.,

2016; Zhu 2016). The characteristics of TlOsm revealed from this research suggest

its contribution to plant stress response through signal transduction.


Studies have shown that genes activated early are involved in stress signal

sensing and transduction while those with delayed activation are involved in later

adaptive responses (Agarwal et al., 2013; Zhu, 2016). Transcriptional expression of

TlOsm upon major abiotic stresses indicated its early activation in cold, drought, and

salinity stresses (Figure 3.6 E-J). TlOsm was activated at highest levels in both root

and shoot within 1-3 h upon cold stress, at 80-60% of leaf RWC in in drought stress,

and at 1-6 h upon salinity stress exposure. In addition, the plasma membrane is a

sensory site and a location for many proteins functioning in environmental signal

interpretation and triggering cellular responses (Tan et al., 2008). TlOsm was

localised to the plasma membrane (Figure 3.10) regardless of stress condition (Figure

3.11). Early activation of TlOsm and its plasma membrane localisation suggest its

functions in stress signalling pathways.

Previous studies on plant stress response have indicated some common signal

transduction pathways shared by cold, drought and salinity stress responses that

subsequently regulate the expression of similar gene sets and result in similar adaptive

response of plants to more than one stress (Fujii and Zhu, 2012; Huang et al., 2012;

Mishra et al., 2016; Xiong and Zhu, 2002). These shared signalling pathways facilitate

plant adaptive responses and protect them from multiple environmental stresses.

Hence, single gene functioning in multiple stress response is likely involved in the

shared signalling pathways. TlOsm was activated by cold, drought, and salinity stresses

in T. loliiformis and thus involved in these stress responses of T. loliiformis. The

enhanced cold, drought, and salinity stress tolerance of transgenic rice plants was

achieved by expressing either TlOsm or OsOlp1_A. Therefore, it is likely that TlOsm

(and OsOlp1_A) facilitate plant stress response via signalling pathways.

The functions in stress signalling pathways of TlOsm and OsOlp1_A were

strongly confirmed by their interactions with AtCPK4 and AtCPK5 in N.

benthamiana plants (Figure 6.6 & 6.7). CPK4 and CPK5 are the members of well-

known plant stress signal transducers, the calcium-dependent protein kinase family.

CPK4 and CPK5 have been demonstrated to regulate plant defense through generation

of ROS signalling by phosphorylating NADPH oxidase/ RBOH (Gao et al., 2013;

Kobayashi et al., 2007). AtCPK4 was proven to function in plant abiotic stress response

by up-stream modulating abscisic acid signal transduction via phosphorylating ABF1

and ABF4 transcription factors (Zhu et al., 2007). Similarly, AtCPK5 was proven to


regulate immune signalling by functioning in rapid cell-to-cell propagation and

mediating phyto-hormone defense response to plant pathogens (Dubiella et al., 2013).

The two interactive partners of TlOsm and OsOlp1_A are within the identified signal

transduction pathways indicating the function of TlOsm and OsOlp1_A in stress

signal transducing. It is not know the mode of action for AtCPK4 or AtCPK5 with

TlOsm or OsOlp1_A, possibly via phosphorylation, because both TlOsm and

OsOlp1_A contain potential phosphorylation sites and phosphorylation is typical

reaction of calcium-dependent protein kinase for decoding stress signals (Mohanta and

Sinha, 2016). It is clear that interacting with CPK4 is required for TlOsm and

OsOlp1_A to activate plant adaptive response to cold, drought, and salinity stresses.

Lacking of interaction with CPK4, at least, partially contributed to the failure to enhance

rice tolerance to cold, drought, and salinity stress of OsOlp1_I.

Besides, AtCPK4 and AtCPK5, TlOsm was shown to interact with AtMS1

and AtALDH7B4 in planta. It is not known from the experiments that TlOsm is

upstream or downstream of the CPK4 and CPK5 in the signalling network, as well

as of the AtMS1 and AtALDH7B4. Here, the subcellular localisation of the

interactive proteins should be considered in the interpretation. AtCPK4 was

demonstrated a cytoplasmic protein (Dammann et al., 2003); while AtCPK5 is a

plasma membrane protein (Lu and Hrabak, 2013). AtALDH7B4 was proven a

cytoplasmic enzyme by Kotchoni et al (2006) and AtMS1 was annotated a

cytoplasmic protein. TlOsm is a plasma membrane protein. Among four proteins

validated to interact with TlOsm in living plants, three of them are cytoplasmic

proteins. This evidence together with early activation of TlOsm upon cold, drought,

and salinity stress, it is likely that TlOsm is an upstream regulator of AtCPK4,

AtMS1, and AtALDH7B4.

The mechanics by which TlOsm mediates plant response to cold, drought, and

salinity stresses remain to be further detailed, due to the protein-protein interaction

network of TlOsm was not fully validated in planta. However, based on the existing

evidences, we can speculate a plausible mechanism underlying TlOsm functions. (1)

Interaction with AtCPK4 homolog is required for TlOsm and OsOlp1_A to transduce

stress signals that further activate down-stream ABA signalling and abiotic stress

responses such as osmotic adjustment, stomatal regulation, and membrane protection. (2)

Interaction with AtMS1 homolog is probably necessary for TlOsm and OsOlp1_A to


regulate biosynthesis of compounds beneficial for salinity stress tolerance. (3) Interaction

with AtALDH7B4 homolog promotes TlOsm functions in enhanced aldehyde

detoxification, reduced lipid peroxidation, and increased ROS scavenge. This interaction

at least partially contributed to additional effects of TlOsm over OsOlp1_A in enhanced

rice tolerance to cold, drought, and salinity stresses. (4) AtCPK5 is required for signal

transduction upon pathogen infection (Dubiella et al., 2013), interaction of the osmotins

with AtCPK5 (or its homologs) might facilitate pathogenic signal transduction but might

not be necessary for abiotic stress response. This point is evidenced by the interaction of

OsOlp1_I and AtCPK5 occurred in planta but OsOlp1_I did not confer tolerant to

cold, drought, and salinity stresses in transgenic rice.

7.4 TlOsm has potential for use in improving crop tolerance to multiple abiotic

stresses

In field conditions, plants are exposed to multiple abiotic and biotic stresses,

either simultaneously or successively. The survival and reproduction of plants exposed

to stresses depend on the rapid perception of stress and signal transduction to switch

on adaptive responses (Mishra et al., 2016). Various studies have indicated significant

overlaps in signalling pathways involved in abiotic and biotic stress responses

(AbuQamar et al., 2009; Atkinson and Urwin, 2012; Huang et al., 2012; Mishra et al.,

2016). Thus, key components conserved in these overlapping pathways may play a

crucial role in eliciting plant adaptive responses to different stresses. Engineering crops

with the master regulator in stress signalling pathways has been considered as an

effective strategy for developing crops with broad spectrum of tolerance (Bhatnagar-

Mathur et al., 2008; Cominelli et al., 2013; Mittler and Blumwald, 2010). TlOsm has

exhibited the characteristics of a key modulator in regulating plant tolerant to multiple

stresses throughout this research. These characteristics are described as its early

transcriptional activation under different stresses and its plasma membrane localisation

(Chapter 3), the diversity of biological processes and pathways that TlOsm interactive

protein partners are involved in (Chapter 6), and especially the sufficient enhanced

tolerance to cold, drought, and salinity stress of transgenic rice constitutively

expressing TlOsm (Chapter 5). The results demonstrate the potential of TlOsm for uses

in genetic engineering plants with enhanced tolerance to multi-stress factors. It should

be noticed that osmotin gene from drought-tolerant rice cultivar (OsOlp1_A) can also

be used for develop multi-stress tolerant crop with less efficacy than TlOsm.


7.5 Concluding remarks

To meet the food demands of an increasing population and to mitigate the effects

of changing climate on agricultural production, the development of stress-adaptive

crops is in crucial need. The combination of stress-adaptive traits from naturally

tolerant species into elite crop cultivars is desired and represents a key goal for genetic

engineering. Thus, identification of key components regulating stress-adaptive traits

in tolerant species is required for introduce new stress-adaptive traits into crop species.

In this project, molecular and functional characteristics of an osmotin from desiccation

tolerant plant T. loliiformis were analysed and shown potential for use in crop

improvement with multiple stress tolerant traits.

For effective utilisation of T. loliiformis genetic resource in improving crop

tolerance to stresses, a deep understanding of molecular basis and functional efficacy

of genes controlling stress tolerant traits in this species is needed. This research

presents the identification of conserved and novel characteristics of TlOsm through the

comparative analyses of TlOsm with osmotin genes from stress sensitive species, O.

saliva. The analyses were made through investigation of potential functional sites of

the osmotin proteins based on structural-to-functional predictions, identification of

their interactive protein partners and pathways, and assessment of transgenic rice

expressing each osmotin gene for enhanced abiotic stress tolerance. The results suggest

the evolved characteristics of TlOsm for more functional efficacy in regulating plant

tolerant to stresses. These characteristics were demonstrated by extra functional

binding sites in TlOsm protein structure that enable the protein interact with more

stress-responsive genes. These characteristics were validated by additional effects of

TlOsm over rice osmotins, the OsOlp1_A and OsOlp1_I, in enhanced transgenic

rice tolerance to cold, drought, and salinity stresses. Results from evaluation of

transgenic rice expressing the osmotins under cold, drought and salinity stress indicate

the functional role of TlOsm and OsOlp1_A in enhanced rice tolerant to stresses

and that the tolerant traits pass on the next generation. Importantly, the results provide

molecular basis for speculating the mechanisms by which TlOsm and OsOlp1_A

mediate plant response to osmotic stresses. The results highlight the values of T.

loliiformis genetic resource for searching stress-responsive genes for combining into

crops.


In conclusion, the results highlight the additional effects on enhanced plant stress

tolerance of osmotin from tolerant species over those from sensitive species. The

results indicate the potential of TlOsm for use in genetic engineering of crops with

improved tolerance to multiple abiotic stresses including cold, drought, and salinity.

Through the analyses of TlOsm protein structure and its interactive protein partners,

TlOsm also showed potential functions in regulating plant response to biotic stress.

Further research should investigate if TlOsm plays role in biotic stress response of

plants. The contributions of glucan-binding sites to osmotin functions in plant response

to abiotic stress need to be further detailed, probably by point mutation of binding sites.

To dissect the functions of TlOsm in regulating sugar metabolism, analysis of sugar

metabolites in transgenic TlOsm plants should be carried out. In addition, some

TlOsm protein interactors involved in the pathways related to human diseases should

be interesting targets for further testing to exploit this protein as a therapeutic agent.

Appendices 209

Appendices

Appendix A

Chapter 2 supplementary figures

Appendix A-Figure 1. Maps of vectors used as templates for amplification of Gus-reporter

gene (A), OsOlp1_A (B), OsOlp1_I (C) and TlOsm (D).

A

pCambia 2301- TlOsm

10518 bp

CDS 2

CDS 3

CDS 4

Tl Osm

Misc Feature 1

Misc Feature 2

Misc Feature 3

Misc Feature 4

Misc Feature 5

Misc Feature 6

Misc Feature 7

Promoter P 1

Promoter P 2

Promoter P 3

Rep Origin 1Rep Origin 2

BstEII (947)

ApaLI (5382)

ApaLI (5880)

NcoI (360)

NcoI (822)

NcoI (8648)

13ABRIKP OsOSM IR64 pMK-RQ

3022 bp

KanR

OsOSM IR64

Col E1 origin

ApaLI (1592)

AvaI (524)

NcoI (2330)

PstI (879)

PstI (2717)

D C

B

13ABRILP OsOSM Apo pMK-RQ

3022 bp

KanR

OsOSM Apo

Col E1 origin

AvaI (524)

NcoI (2330)

ApaLI (1043)

ApaLI (1592)

PstI (879)

PstI (2717)

210 Appendices

Appendix A-Figure 2. Maps of vectors used to generate the pEAQ-436 destination vector.

The pL436 (A) was used as template to amplify the fragment from AttR1 to the end of 2x IgG

binding domain with the addition of AgeI restriction site before AttR1 and the KDEL and StuI

restriction site after the 2x IgG binding domain; the pEAQ-HT was served as the backbone for

the insertion of the amplicon from (A) within the AgeI and StuI sites.

pEAQ-HT

10003 bp

P19

NPTIII

TrfA

NPTII

enhancer region

HISx6

HISx6

C1

C3

35S promoter

CaMV 35S promoter

ColE1

OriV 35S terminator

Nos Terminator

CPMV RNA-2 3'UTR

CPMV RNA-2 5'UTR

LB

RB

AgeI (1296)

StuI (1356)

pYL436 (AY737283)

12607 bpccdB

TMV U1 omega sequence

attR1-CmR-ccdB-attR2 GATEWAY cassette

9x myc tag

6x HIS tag

protease 3C cleav age site

2x IgG binding domain

Nos terminator

Cm(R)

SpecR

duplicated CaMV 35S promoter

attR1

attR2

ClaI (7415)

NcoI (1761)

NcoI (11619)

ApaLI (2360)

ApaLI (8362)

ApaLI (8860)

ApaLI (9952)

A

B

Appendices 211

Appendix B

Chapter 3 supplementary data

Appendix B-Figure 1. Differences in glucan binding residues for TlOsm, OsOlp1_A,

and OsOlp1_I by structural to functional prediction. A. Structure of OsOlp1_A with five

binding residues D135, G136, S183, A225, and T132; B. Structure of OlOlp1_I with two

binding residues D135 and T232; C. Structure of TlOsm with eight binding residues E117,

F128, D130, D135, A221, Y226, A229, and T236.

212 Appendices

Appendix B-Figure 2. Sugar binding residues unique for TlOsm by structural to

functional prediction.

Table 1. Difference in potential phosphorylation sites for TlOsm, OsOlp1_A, and OsOlp1_I

Type of residues

Serine site Threonine site Tyrosine site

TlOsm

(33 Ser, 22 Thr, 9

Tyr)

18, 24, 26, 30, 43, 44, 47,

52, 62, 66, 69, 72, 82, 91,

99, 123, 132, 175, 187,

194, 200, 212, 215, 227,

235, 253, 256, 259, 262,

263, 264, 297, 235

28, 36, 53, 64, 79,

83, 87, 94, 114, 119,

157, 208, 234, 236,

238, 244, 245, 249,

254, 255, 273, 286

35, 137, 197,

214, 226,

228, 230,

246, 276

OsOlp1_A

(12 Ser, 2 Thr, 1

Tyr)

47, 63, 128, 132, 142,

177, 183, 201, 207, 208,

211, 228

127, 204 210

OsOlp1_I

(11 Ser, 3 Thr, 1

Tyr)

47, 63, 128, 132, 177,

183, 201, 207, 208, 211,

228

127, 144, 204 210

Appendices 213

Appendix C

Chapter 4 supplementary information

Media and solutions for rice callus induction and transformation

N6 Stock Solution 1: Macronutrients (20x concentrated)

Ingredients

Quantity (g) per 1 L

stock

Quantity (mg) per 1 L

N6

KNO3 56.6 2,830

(NH4)2SO4 9.26 463

MgSO4.7H2O 3.7 185

KH2PO4 8 400

CaCl2.2H2O 3.32 166

N6 Stock Solution 2: Micronutrients (100x concentrated)

Ingredients


stock

Quantity (mg) per 1 L N6

KI 80 0.8

H3PO3 160 1.6

MnSO4.4H2O 440 4.4

ZnSO4.7H2O 150 1.5

Na2MoO4.2H2O 25 0.25

N6 Stock Solution 3: Vitamins (1000 x concentrated)

Ingredients

Quantity (mg) per 100ml

stock

Quantity (mg) per 1L

N6

Nicotinic Acid 50 0.5

Pyrodoxin-HCl 50 0.5

Myo-Inositol 1,000 10

Thiamine-HCl 50 0.5

Glycine 100 1

214 Appendices

N6 Stock Solution 4: Fe-EDTA (100 x concentrated)

Ingredients


stock

Quantity (mg) per 1L

N6

Na2EDTA.2H2O 3,725 37.25

FeSO4.7H2O 2,785 27.85

N6 basal medium and vitamins from stock solutions

Ingredients Quantity per 1 L N6

N6 stock solution 1 50 ml




Appendices 215

Appendix D


Appendix D – Table 1. Plant height before and after stress treatments at seedling stage

Treatment Plants Plant height (cm) at

day 0

Plant height (cm) at

day 18

Unstressed set 1 OsOlp1_A 12.59 ± 0.92 27.92 ± 1.69

Unstressed set 1 OsOlp1_I 12.58 ± 1.02 28.14 ± 1.75

Unstressed set 1 TlOsm 12.17 ± 0.70 24.56 ± 1.57

Unstressed set 1 VC 12.81 ± 0.93 28.30 ± 1.65

Unstressed set 1 WT 12.95 ± 0.73 28.79 ± 1.52

Drought OsOlp1_A 12.84 ± 0.46 22.34 ± 0.76

Drought OsOlp1_I 12.73 ± 0.46 20.79 ± 0.84

Drought TlOsm 12.56 ± 0.41 22.76 ± 0.84

Drought VC 12.72 ± 0.53 20.20 ± 0.78

Drought WT 12.86 ± 0.44 20.28 ± 0.71

Salinity OsOlp1_A 13.15 ± 0.48 23.10 ± 0.68

Salinity OsOlp1_I 12.85 ± 0.50 20.58 ± 0.65

Salinity TlOsm 12.29 ± 0.39 22.11 ± 0.65

Salinity VC 12.82 ± 0.46 19.22 ± 0.58

Salinity WT 12.88 ± 0.49 18.66 ± 0.60

Treatment Plants Plant height (cm) at

day 0

Plant height (cm) at

day 25

Unstressed set 2 OsOlp1_A 13.00 ± 0.29 29.46 ± 0.98

Unstressed set 2 OsOlp1_I 13.02 ± 0.30 29.57 ± 0.76

Unstressed set 2 TlOsm 12.60 ± 0.24 26.56 ± 0.78

Unstressed set 2 VC 13.01 ± 0.33 29.45 ± 1.35

Unstressed set 2 WT 13.44 ± 0.34 29.25 ± 1.31

Cold OsOlp1_A 13.07 ± 0.56 16.96 ± 0.35

Cold OsOlp1_I 13.08 ± 0.47 15.47 ± 0.27

Cold TlOsm 12.53 ± 0.40 16.97 ± 0.29

Cold VC 13.12 ± 0.52 15.47 ± 0.33

Cold WT 12.95 ± 0.49 15.18 ± 0.28

Data are expressed as mean ± SE of 135 plants in set 1 and 120 plants in set 2

216 Appendices

Appendix D – Table 2. Plant height before and after stress treatments at reproductive

stage

Treatment Plants Plant height (cm)

at day 0

Plant height (cm)

at day 18

Unstressed NT 22.50 ± 0.42 33.75 ± 0.65

Unstressed OsOlp1_A 21.74 ± 0.33 31.74 ± 0.32

Unstressed OsOlp1_I 22.52 ± 0.36 34.34 ± 0.59

Unstressed TlOsm 21.29 ± 0.39 30.75 ± 0.37

Unstressed VC 22.12 ± 0.36 33.99 ± 0.68

Drought NT 22.86 ± 0.36 28.17 ± 0.34

Drought OsOlp1_A 21.92 ± 0.31 28.59 ± 0.32

Drought OsOlp1_I 22.43 ± 0.40 28.25 ± 0.36

Drought TlOsm 20.90 ± 0.33 28.95 ± 0.31

Drought VC 22.42 ± 0.41 27.91 ± 0.39

Salinity NT 22.60 ± 0.38 28.82 ± 0.40

Salinity OsOlp1_A 20.06 ± 0.34 30.17 ± 0.29

Salinity OsOlp1_I 22.45 ± 0.34 29.63 ± 0.32

Salinity TlOsm 21.67 ± 0.35 29.76 ± 0.34

Salinity VC 22.88 ± 0.42 28.37 ± 0.32

Data are expressed as mean ± SE of 30 plants

Appendices 217

Appendix E


Appendix E-Table 1. Description of Arabidopsis proteins interacting with TlOsm,

OsOlp1_A, and OsOlp1_I on the chip

TAIR-ID Description Interacting with

# of

hits

OsOlp1_A OsOlp1_I TlOsm

AT1G01080 RNA-binding (RRM/RBD/RNP

motifs) family protein X X X 3

AT1G04340 HR-like lesion-inducing protein-like

protein X 1

AT1G04420 NAD(P)-linked oxidoreductase

superfamily protein X X X 3

AT1G04550 AUX/IAA transcriptional regulator

family protein (IAA12) X X X 3

AT1G05010 Ethylene-forming enzyme (EFE) X X X 3

AT1G05410 CDPK adapter, putative (DUF1423) X X X 3

AT1G07140 Pleckstrin homology (PH) domain

superfamily protein (SIRANBP) X X X 3

AT1G07750 RmlC-like cupins superfamily protein X X X 3

AT1G07890 Ascorbate peroxidase 1(APX1) X X X 3

AT1G09630 Ras-related protein RABA2a X X X 3

AT1G10230

E3 ubiquitin ligase SCF complex

subunit SKP1/ASK1 family

protein(SK18) X X X 3

AT1G10700 Phosphoribosyl pyrophosphate (PRPP)

synthase 3(PRS3) X X X 3

AT1G11860 Glycine cleavage T-protein family X X X 3

AT1G12310 Probable calcium-binding protein

CML13 X X X 3

AT1G13280 Allene oxide cyclase 4 (AOC4) X X X 3

AT1G14030 Rubisco methyltransferase family

protein (LSMT-L) X X X 3

AT1G14950 Polyketide cyclase/dehydrase and lipid

transport superfamily protein X 1

AT1G15750 Transducin family protein / WD-40

repeat family protein (TPL) X X X 3

AT1G15930

Ribosomal protein

L7Ae/L30e/S12e/Gadd45 family

protein X X X 3

AT1G16030 Heat shock protein 70B (Hsp70b) X X X 3

AT1G18080 Transducin/WD40 repeat-like

superfamily protein (ATARCA) X X X 3

AT1G19570 Dehydroascorbate reductase (DHAR1) X X X 3

AT1G20510 4-coumarate--CoA ligase-like 5 X X X 3

AT1G20950 Phosphofructokinase family protein X X X 3

218 Appendices


# of

hits


AT1G23800 Aldehyde dehydrogenase 2B7

(ALDH2B7) X X X 3

AT1G26640 Isopentenyl phosphate kinase (IPK) X X X 3

AT1G27500 Tetratricopeptide repeat (TPR)-like

superfamily protein (KLCR3) X X X 3

AT1G30070 SGS domain-containing protein X 1

AT1G35160 GF14 protein phi chain (GF14 PHI) X X X 3

AT1G35460 Basic helix-loop-helix (bHLH) DNA-

binding superfamily protein (FBH1) X X X 3

AT1G36390 Co-chaperone GrpE family protein X X X 3

AT1G43670 Inositol monophosphatase family

protein (FBP) X X X 3

AT1G43690 Ubiquitin interaction motif-containing

protein X 1

AT1G47420 succinate dehydrogenase 5 (SDH5) X X X 3

AT1G48630 Receptor for activated C kinase 1B

(RACK1B_AT) X X X 3

AT1G49570 Peroxidase 10 X X X 3

AT1G49820 S-methyl-5-thioribose kinase (MTK) X X X 3

AT1G50170 Sirohydrochlorin ferrochelatase B

(SIRB) X X X 3



AT1G54100 Aldehyde dehydrogenase family 7

member B4 (ALDH7B4) X 1

AT1G57770 FAD/NAD(P)-binding oxidoreductase

family protein X X X 3

AT1G60250 B-box zinc finger family protein

(BBX26) X 1

AT1G62820 Probable calcium-binding protein

CML14 X X X 3

AT1G65870 Disease resistance-responsive (dirigent-

like protein) family protein X X X 3

AT1G66240 Histone-lysine N-methyltransferase

ATX1 X 1

AT1G66270 Beta-glucosidase BGLU21 X X X 3

AT1G68760 Nudix hydrolase 1 (NUDX1) X X X 3

AT1G70570 Anthranilate phosphoribosyltransferase X 1

AT1G70830 MLP-like protein 28 (MLP28) X 1

AT1G70890 MLP-like protein 43 (MLP43) X X X 3

AT1G71440 Tubulin folding cofactor E / Pfifferling

(Wurzinger et al.) X X X 3

AT1G71697 Choline kinase 1 (CK1) X X X 3


repeat family protein X X X 3


repeat family protein (SMU1) X X X 3

AT1G74040 2-isopropylmalate synthase 1 (IMS1) X X 2

Appendices 219


# of

hits


AT1G74230 Glycine-rich RNA-binding protein

5(GR-RBP5) X X X 3

AT1G75270 Dehydroascorbate reductase 2

(DHAR2) X X X 3

AT1G76040 Calcium-dependent protein kinase 29

(CPK29) X X 2

AT1G76790 Indole glucosinolate O-

methyltransferrase 5 (IGMT5) X X X 3

AT1G77120 Alcohol dehydrogenase 1 (ADH1) X X X 3

AT1G77520 O-methyltransferase family protein X X X 3

AT1G78300 General regulatory factor 2 (GRF2) X X X 3

AT1G78680 Gamma-glutamyl hydrolase 2 (GGH2) X X 2

AT1G79070 SNARE-associated protein-like protein X X X 3

AT1G79250 AGC kinase 1.7 (AGC1.7) X X X 3

AT1G79550 Phosphoglycerate kinase (PGK) X X 2

AT1G79650 Rad23 UV excision repair protein

family (RAD23B) X X X 3

AT2G02990 Ribonuclease 1 (RNS1) X X X 3

AT2G03310 Transmembrane protein X X X 3

AT2G04880 Zinc-dependent activator protein-1

(ZAP1) X X X 3

AT2G05710 Aconitase 3(ACO3) X X 2

AT2G17190 Ubiquitin receptor protein (DSK2A) X 1

AT2g17290 Calcium-dependent protein kinase

family protein (CPK6) X X X 3

AT2G17560 High mobility group B4 (HMGB4) X 1

AT2G17700 ACT-like protein tyrosine kinase

family protein (STY8) X X 2

AT2G17870 Cold shock domain protein 3 (CSP3) X X X 3

AT2G19780 Leucine-rich repeat (LRR) family

protein X X X 3

AT2G20630 PP2C induced by AVRRPM1 (PIA1) X X X 3

AT2G20690 Lumazine-binding family protein X X X 3



AT2G22480 Phosphofructokinase 5 (PFK5) X X X 3

AT2G22910 N-acetyl-l-glutamate synthase 1

(NAGS1) X X X 3

AT2G23660 LOB domain-containing protein 10

(LBD10) X X X 3

AT2G24200 Cytosol aminopeptidase family protein

(LAP1) X X X 3

AT2G25080 Glutathione peroxidase 1 (GPX1) X X X 3

AT2G26840 MutS2 X X X 3

AT2G27860 UDP-D-apiose/UDP-D-xylose synthase

1 (AXS1) X X 2


repeat family protein X X X 3

220 Appendices


# of

hits


AT2G30410 Tubulin folding cofactor A (KIESEL)

(KIS) X X X 3

AT2G31390 PfkB-like carbohydrate kinase family

protein X X X 3

AT2G35320 Eyes absent-like protein (EYA) X X X 3

AT2G35380 Peroxidase 20 X X 2

AT2G35500 Shikimate kinase like 2 (SKL2) X X X 3

AT2G38270 CAX-interacting protein 2 (CXIP2) X X X 3

AT2G38380 Peroxidase 22 X X X 3

AT2G38860 Class I glutamine amidotransferase-like

superfamily protein (YLS5) X X X 3

AT2G42120 DNA polymerase delta small subunit X X X 3

AT2G42540 Cold-regulated 15a (COR15A) X X X 3

AT2G43750 O-acetylserine (thiol) lyase B (OASB) X X X 3

AT2G43790 MAP kinase 6 (MPK6) X X 2

AT2G43980 Inositol 1,3,4-trisphosphate 5/6-kinase

4 (ITPK4) X X X 3

AT2G44050

6,7-dimethyl-8-ribityllumazine

synthase / DMRL synthase / lumazine

synthase / riboflavin synthase (COS1) X X X 3

AT2G44530 Ribose-phosphate pyrophosphokinase 5 X X X 3

AT2G45240 Methionine aminopeptidase 1A

(MAP1A) X X X 3

AT2G45770 Signal recognition particle receptor

protein, chloroplast (FTSY) (CPFTSY) X X X 3

AT2G46170 Reticulon-like protein B5 X 1

AT2G46370 Auxin-responsive GH3 family protein

(JAR1) X X X 3



AT3G01680 Sieve element occlusion amino-

terminus protein (SEOR1) X X X 3



family (RAD23C) X X X 3

AT3G02900 Low-density receptor-like protein X X X 3

AT3G03780 Methionine synthase 2 (MS2) X X X 3

AT3G04650 FAD/NAD(P)-binding oxidoreductase X X X 3

AT3G05020 Acyl carrier protein 1 (ACP1) X X X 3

AT3G05190

D-aminoacid aminotransferase-like

PLP-dependent enzymes superfamily

protein X 1

Appendices 221


# of

hits

OsOlp1_A OsOlp1_I TlOsm AT3G06050 peroxiredoxin IIF (PRXIIF) X X X 3

AT3G06110 MAPK phosphatase 2 (MKP2) X X X 3

AT3G06650 ATP-citrate lyase B-1 (ACLB-1) X X X 3

AT3G07800 Thymidine kinase (TK1a) X X X 3

AT3G09390 Metallothionein 2A (MT2A) X 1

AT3G10230 Lycopene cyclase (LYC) X X 2

AT3G10540 3-phosphoinositide-dependent protein

kinase X X X 3

AT3G10700 Galacturonic acid kinase (GalAK) X X X 3

AT3G11200 Alfin-like 2 (AL2) X X X 3

AT3G11930 Adenine nucleotide alpha hydrolases-

like superfamily protein X X X 3

AT3G12110 Actin-11 (ACT11) X X X 3

AT3G12290 Amino acid dehydrogenase family

protein X X X 3

AT3G14940 Phosphoenolpyruvate carboxylase 3

(PPC3) X X X 3

AT3G15010 RNA-binding (RRM/RBD/RNP

motifs) family protein X X X 3

AT3G15890 PTI1-like tyrosine-protein kinase X 1

AT3G16670 Pollen Ole e 1 allergen and extensin

family protein X X X 3

AT3G16910 Acyl-activating enzyme 7 (AAE7) X X X 3

AT3G18680 Amino acid kinase family protein X X X 3

AT3G18780 Actin 2 (ACT2) X 1

AT3G19100 Protein kinase superfamily protein X X X 3


AT3G21510 Histidine-containing

phosphotransmitter 1 (AHP1) X X X 3

AT3G22740 Homocysteine S-methyltransferase 3

(HMT3) X X X 3



AT3G24530 AAA-type ATPase family protein /

ankyrin repeat family protein X X X 3

AT3g25150

Nuclear transport factor 2 (NTF2)

family protein with RNA binding

(RRM-RBD-RNP motifs) domain-

containing protein X X X 3

AT3G25770 Allene oxide cyclase 2 (AOC2) X X X 3


binding superfamily protein (ICE1) X X X 3

AT3G27850 Ribosomal protein L12-C (RPL12-C) X X X 3

222 Appendices


# of

hits


AT3G28500 60S acidic ribosomal protein P2-3 X X X 3



AT3G42790

Alfin1-like family of nuclear-localized

PHD (plant homeodomain) domain

containing proteins, AL3 X X X 3

AT3G44860 Farnesoic acid carboxyl-O-

methyltransferase (FAMT) X X X 3

AT3G45010 Serine carboxypeptidase-like 48

(Scpl48) X X X 3

AT3G46010 Actin depolymerizing factor 1 (ADF1) X X X 3

AT3G48000 Aldehyde dehydrogenase 2B4

(ALDH2B4) X X X 3

AT3G51130 Transmembrane protein (UPF0183) X X X 3

AT3G51780 BCL-2-associated athanogene 4

(BAG4) X X X 3

AT3G52155 Phosphoglycerate mutase family

protein X X X 3


like superfamily protein X X X 3

AT3G54050 High cyclic electron flow 1 (HCEF1) X X 2

AT3G54600 Class I glutamine amidotransferase-like

superfamily protein (DJ1F) X X X 3

AT3G54900 CAX interacting protein 1 (CXIP1) X X X 3

AT3G55120 Chalcone-flavanone isomerase family

protein (TT5) X X X 3

AT3G58470 Nucleic acid binding /

methyltransferase X X X 3


AT3G61540 Alpha/beta-Hydrolases superfamily

protein X X X 3

AT3G61830 Auxin response factor 18 (ARF18) X X X 3

AT3G63260 Protein kinase superfamily protein

(ATMRK1) X X X 3

AT3G63480 ATP binding microtubule motor family

protein X X X 3

AT4G00220 Lateral organ boundaries (LOB)

domain family protein (JLO) X X X 3

AT4G02640 bZIP transcription factor family protein

(BZO2H1) X X X 3

AT4G04830 Methionine sulfoxide reductase B5

(MSRB5) X X X 3

AT4G08390 Stromal ascorbate peroxidase (SAPX) X X X 3


binding superfamily protein (FBH2) X X X 3


(CPK4) X X X 3

Appendices 223


# of

hits


AT4G09620 Mitochondrial transcription termination

factor family protein X X X 3

AT4G10240 B-box zinc finger family protein

(Bbx23) X X X 3

AT4G10250 HSP20-like chaperones superfamily

protein (ATHSP22.0) X X X 3





AT4G11320 Papain family cysteine protease X X X 3

AT4G13200 Hypothetical protein X X X 3



AT4G13930 Serine hydroxymethyltransferase 4

(SHM4) X X X 3

AT4G17510 Ubiquitin C-terminal hydrolase 3

(UCH3) X X X 3

AT4G20780 Calcium-binding protein CML42 X X 2

AT4G21470 Riboflavin kinase/FMN hydrolase

(FMN/FHY) X X X 3

AT4G23170 Receptor-like protein kinase-related

family protein (EP1) X X 2


(CDPK6) X X X 3

AT4G23670 Polyketide cyclase/dehydrase and lipid

transport superfamily protein X X X 3

AT4G24690

Ubiquitin-associated (UBA)/TS-N

domain-containing protein /

octicosapeptide/Phox/Bemp1 (PB1)

domain-containing protein (NBR1) X X 2

AT4G25050 Acyl carrier protein 4 (ACP4) X X X 3

AT4G26070 MAP kinase/ ERK kinase 1 (MEK1) X X X 3

AT4G26220 S-adenosyl-L-methionine-dependent

methyltransferases superfamily protein X 1

AT4G26270 Phosphofructokinase 3 (PFK3) X X 2


like superfamily protein (PHOS34) X X X 3

AT4G27700 Rhodanese/Cell cycle control

phosphatase superfamily protein X X X 3

AT4G28660 Photosystem II reaction center PSB28

protein (PSB28) X X X 3


protein X X X 3

AT4G29530 Pyridoxal phosphate phosphatase-

related protein X X X 3

224 Appendices


# of

hits


AT4G29720 Polyamine oxidase 5 (PAO5) X 1


superfamily protein (VIP3) X X X 3

AT4G30910 Cytosol aminopeptidase family protein X X X 3

AT4G31720 TBP-associated factor II 15 (TAFII15) X X X 3

AT4G32590 2Fe-2S ferredoxin-like superfamily

protein; X X X 3


AT4G33090 Aminopeptidase M1 (APM1) X X X 3

AT4G33680

Pyridoxal phosphate (PLP)-dependent

transferases superfamily protein

(AGD2) X X X 3

AT4G34050

S-adenosyl-L-methionine-dependent

methyltransferases superfamily protein

(CCoAOMT1) X X 2

AT4G35220 Cyclase family protein (CYCLASE2) X X X 3

AT4G35310 Calmodulin-domain protein kinase 5

(CPK5) X X X 3

AT4G36910 Cystathionine beta-synthase (CBS)

family protein (LEJ2) X X X 3

AT4G37000 Accelerated cell death 2 (ACD2) X X X 3

AT4G38960 B-box type zinc finger family protein

(BBX19) X 1

AT4G39660 Alanine:glyoxylate aminotransferase 2

(AGT2) X X X 3

AT4G40010 SNF1-related protein kinase 2.7

(SNRK2.7) X X X 3

AT5G02500 Heat shock cognate protein 70-1

(HSC70-1) X X X 3

AT5G05270 Chalcone-flavanone isomerase family

protein (CHIL) X X X 3

AT5G05610 Alfin-like 1 (AL1) X X X 3

AT5G06110 DNAJ and myb-like DNA-binding

domain-containing protein X X X 3

AT5G06730 Peroxidase superfamily protein X 1

AT5G08400

Structural maintenance of

chromosomes-like protein, putative

(DUF3531) X X X 3

AT5G09810 Actin 7 (ACT7) X X X 3

AT5G10300 Methyl esterase 5 (MES5) X X X 3

AT5G10450 G-box regulating factor 6 (GRF6) X X X 3

AT5G10540 Zincin-like metalloproteases family

protein X X X 3

Appendices 225


# of

hits


AT5G10830 S-adenosyl-L-methionine-dependent

methyltransferases superfamily protein X X X 3

AT5G11170 DEAD/DEAH box RNA helicase

family protein (UAP56a) X 1

AT5G11680 Classical AGP protein X X X 3

AT5G13120 Peptidyl-prolyl cis-trans isomerase

CYP20-2, cyclophilin 20-2 (Pnsl5) X X X 3

AT5G13280 Aspartate kinase 1 (AK-LYS1) X X X 3

AT5G13520 Peptidase M1 family protein X X X 3

AT5G13930 Chalcone and stilbene synthase family

protein (TT4) X 1

AT5G14130 Peroxidase superfamily protein,

peroxidase 55 X X X 3


AT5G16450

Ribonuclease E inhibitor

RraA/Dimethylmenaquinone

methyltransferase X X X 3

AT5G17920 Cobalamin-independent synthase

family protein (ATMS1) X X 2

AT5G20070 Nudix hydrolase homolog 19

(NUDX19) X X X 3

AT5G20810 SAUR-like auxin-responsive protein

family X X 2

AT5G23140 Nuclear-encoded CLP protease P7

(NCLPP7) X X X 3

AT5G23580 Calmodulin-like domain protein kinase

9 (CDPK9) X 1

AT5G24490 30S ribosomal protein X X X 3

AT5G27560 DUF1995 domain protein, putative

(DUF1995) X X X 3


protein (SOS4) X X X 3


family (RAD23D) X X X 3




AT5G39790 Protein targeting to starch (PTST) X X X 3

AT5G40850 Urophorphyrin methylase 1 (UPM1) X X 2

AT5G41600 VIRB2-interacting protein 3 (BTI3) X 1

AT5G42020 Heat shock protein 70 (Hsp 70) family

protein (BIP2) X X 2

AT5G42070 Hypothetical protein X X 2

AT5G42810 Inositol-pentakisphosphate 2-kinase 1

(IPK1) X X X 3

226 Appendices


# of

hits


AT5G43600 Ureidoglycolate amidohydrolase

(UAH) X X X 3

AT5G45070 Phloem protein 2-A8 (PP2-A8) X X X 3

AT5G45080 Phloem protein 2-A6 (PP2-A6) X X X 3

AT5G47030 ATPase, F1 complex, delta/epsilon

subunit X X 2


AT5G47840 Adenosine monophosphate kinase

(AMK2) X X X 3

AT5G48485

Bifunctional inhibitor/lipid-transfer

protein/seed storage 2S albumin

superfamily protein (DIR1) X X X 3

AT5G49650 Xylulose kinase-2 (XK-2) X X X 3

AT5G58110 Chaperone binding / ATPase activator X X X 3


protein (Mik) X X X 3

AT5G59500 Protein C-terminal S-isoprenylcysteine

carboxyl O-methyltransferase X X X 3

AT5G60160 Zn-dependent exopeptidases


AT5G60790 ABC transporter family protein

(ABCF1) X X X 3

AT5G61760 Inositol polyphosphate kinase 2 beta

(IPK2BETA) X X X 3

AT5G62930 SGNH hydrolase-type esterase


AT5G63310 Nucleoside diphosphate kinase 2

(NDPK2) X X X 3

AT5G63650 SNF1-related protein kinase 2.5

(SNRK2.5) X X X 3

AT5G64380 Inositol monophosphatase family

protein X X X 3

AT5G65020 Annexin 2 (ANNAT2) X X X 3


AT5G65620 Zincin-like metalloproteases family

protein X X X 3

Total 239 237 267

Appendices 227

Appendix E-Table 2. Significant GO terms for Arabidopsis proteins interacting with

TlOsm, OsOlp1_A, and OsOlp1_I on the chip

GO term Description Input Background p-value FDR

GO:0050896 response to stimulus 87 4057 1.1e-21 1e-18

GO:0006950 response to stress 59 2320 1.2e-17 5.6e-15

GO:0042221 response to chemical stimulus 48 2085 7.8e-13 2.4e-10

GO:0009987 cellular process 137 11684 4.3e-12 9.9e-10

GO:0006519 cellular amino acid and derivative

metabolic process 26 682 8.5e-12 1.6e-09

GO:0034641 cellular nitrogen compound metabolic

process 21 506 2.2e-10 3.3e-08

GO:0008152 metabolic process 122 10614 8.6e-10 1.1e-07

GO:0044271 cellular nitrogen compound

biosynthetic process 18 394 1e-09 1.2e-07

GO:0044237 cellular metabolic process 106 8722 1.2e-09 1.2e-07

GO:0016053 organic acid biosynthetic process 18 417 2.4e-09 2e-07

GO:0046394 carboxylic acid biosynthetic process 18 417 2.4e-09 2e-07

GO:0009628 response to abiotic stimulus 33 1471 8.2e-09 5.3e-07

GO:0006725 cellular aromatic compound metabolic

process 17 399 8.2e-09 5.3e-07

GO:0042180 cellular ketone metabolic process 25 882 7.9e-09 5.3e-07

GO:0051716 cellular response to stimulus 24 840 1.4e-08 8.3e-07

GO:0043436 oxoacid metabolic process 24 859 2.1e-08 1.1e-06

GO:0006082 organic acid metabolic process 24 860 2.1e-08 1.1e-06

GO:0019752 carboxylic acid metabolic process 24 859 2.1e-08 1.1e-06

GO:0019438 aromatic compound biosynthetic

process 13 237 3e-08 1.4e-06

GO:0010033 response to organic substance 30 1342 4.4e-08 1.9e-06

GO:0008652 cellular amino acid biosynthetic

process 12 202 4.5e-08 1.9e-06

GO:0070887 cellular response to chemical stimulus 17 452 4.7e-08 1.9e-06

GO:0005996 monosaccharide metabolic process 11 168 6.5e-08 2.6e-06

GO:0007242 intracellular signalling cascade 20 659 9.1e-08 3.5e-06

GO:0009698 Phenylpropanoid metabolic process 11 175 9.6e-08 3.5e-06

GO:0006575 cellular amino acid derivative

metabolic process 14 315 1.1e-07 3.7e-06

GO:0009699 Phenylpropanoid biosynthetic process 10 141 1.3e-07 4.1e-06

GO:0044238 primary metabolic process 102 8995 1.3e-07 4.1e-06

GO:0006066 alcohol metabolic process 13 270 1.3e-07 4.1e-06

GO:0009309 amine biosynthetic process 12 229 1.6e-07 5e-06

GO:0010035 response to inorganic substance 13 279 1.8e-07 5.3e-06

GO:0042398 cellular amino acid derivative

biosynthetic process 12 233 2e-07 5.6e-06

228 Appendices


GO:0009719 response to endogenous stimulus 24 1068 9.8e-07 2.7e-05

GO:0006979 response to oxidative stress 13 332 1.2e-06 3.2e-05

GO:0044262 cellular carbohydrate metabolic

process 14 417 2.6e-06 6.9e-05

GO:0009266 response to temperature stimulus 15 485 3.1e-06 7.8e-05

GO:0006520 cellular amino acid metabolic process 14 430 3.7e-06 9.2e-05

GO:0044106 cellular amine metabolic process 14 438 4.6e-06 0.00011

GO:0019318 hexose metabolic process 8 126 5.2e-06 0.00012

GO:0046686 response to cadmium ion 9 178 7.7e-06 0.00018

GO:0006970 response to osmotic stress 13 408 1e-05 0.00023

GO:0009755 hormone-mediated signalling pathway 11 321 2.6e-05 0.00056

GO:0032870 cellular response to hormone stimulus 11 321 2.6e-05 0.00056

GO:0009308 amine metabolic process 14 521 3e-05 0.00062

GO:0009409 response to cold 11 328 3.2e-05 0.00063

GO:0009725 response to hormone stimulus 20 982 3.2e-05 0.00063

GO:0044249 cellular biosynthetic process 59 4925 3.4e-05 0.00066

GO:0019748 secondary metabolic process 13 489 6.4e-05 0.0012

GO:0010038 response to metal ion 9 238 6.9e-05 0.0013

GO:0006096 glycolysis 5 57 7.7e-05 0.0014

GO:0009651 response to salt stress 11 366 8.2e-05 0.0015

GO:0009058 biosynthetic process 59 5118 0.0001 0.0018

GO:0009611 response to wounding 8 197 0.00011 0.0019

GO:0046483 heterocycle metabolic process 12 460 0.00014 0.0024

GO:0006952 defense response 16 766 0.00015 0.0025

GO:0007165 signal transduction 21 1228 0.00022 0.0036

GO:0009607 response to biotic stimulus 14 638 0.00024 0.0038

GO:0006007 glucose catabolic process 5 83 0.0004 0.0063

GO:0000096 sulfur amino acid metabolic process 5 84 0.00042 0.0063

GO:0019320 hexose catabolic process 5 84 0.00042 0.0063

GO:0046365 monosaccharide catabolic process 5 84 0.00042 0.0063

GO:0006006 glucose metabolic process 5 86 0.00047 0.0069

GO:0042440 pigment metabolic process 6 134 0.00048 0.007

GO:0046164 alcohol catabolic process 5 89 0.00054 0.0077

GO:0009066 aspartate family amino acid metabolic

process 5 90 0.00057 0.008

GO:0006633 fatty acid biosynthetic process 6 140 0.0006 0.0083

GO:0032787 monocarboxylic acid metabolic

process 10 408 0.00081 0.011

GO:0009605 response to external stimulus 10 429 0.0012 0.016

GO:0006091 generation of precursor metabolites

and energy 8 285 0.0012 0.016

Appendices 229


GO:0009408 response to heat 6 161 0.0012 0.016

GO:0006631 fatty acid metabolic process 7 225 0.0013 0.017

GO:0051707 response to other organism 12 599 0.0014 0.018

GO:0046148 pigment biosynthetic process 5 112 0.0015 0.018

GO:0005975 carbohydrate metabolic process 15 866 0.0016 0.019

GO:0044272 sulfur compound biosynthetic process 5 115 0.0016 0.02

GO:0051186 cofactor metabolic process 8 308 0.0019 0.023

GO:0044275 cellular carbohydrate catabolic

process 5 125 0.0023 0.027

GO:0016052 carbohydrate catabolic process 5 128 0.0025 0.03

GO:0051704 multi-organism process 13 776 0.0041 0.048

GO:0003824 catalytic activity 138 9638 9e-20 2.4e-17

GO:0016740 transferase activity 69 3321 3.3e-16 4.5e-14

GO:0016301 kinase activity 44 1641 5.5e-14 4.9e-12

GO:0016772 transferase activity, transferring

phosphorus-containing groups 47 1887 9.2e-14 6.2e-12

GO:0019200 carbohydrate kinase activity 9 53 5.3e-10 2.9e-08

GO:0045309 protein phosphorylated amino acid

binding 7 23 1.4e-09 5.3e-08

GO:0051219 phosphoprotein binding 7 23 1.4e-09 5.3e-08

GO:0016773 phosphotransferase activity, alcohol

group as acceptor 29 1154 6.4e-09 2.2e-07

GO:0016209 antioxidant activity 11 150 2.2e-08 5.4e-07

GO:0008168 methyltransferase activity 14 273 2e-08 5.4e-07

GO:0016741 transferase activity, transferring one-

carbon groups 14 275 2.1e-08 5.4e-07

GO:0008443 phosphofructokinase activity 5 12 9.5e-08 2.1e-06

GO:0004177 aminopeptidase activity 5 14 1.8e-07 3.7e-06

GO:0016684 oxidoreductase activity, acting on

peroxide as acceptor 9 127 5.6e-07 1e-05

GO:0004601 peroxidase activity 9 127 5.6e-07 1e-05

GO:0004683 calmodulin-dependent protein kinase

activity 6 42 1.1e-06 1.8e-05

GO:0008238 exopeptidase activity 7 104 1.4e-05 0.00022

GO:0008171 O-methyltransferase activity 5 45 2.7e-05 0.0004

GO:0008237 metallopeptidase activity 6 90 6.2e-05 0.00088

GO:0020037 heme binding 5 97 0.00079 0.011

GO:0016491 oxidoreductase activity 22 1463 0.00087 0.011

GO:0070011 peptidase activity, acting on L-amino

acid peptides 12 579 0.0011 0.013

GO:0008757 S-adenosylmethionine-dependent

methyltransferase activity 5 109 0.0013 0.015

GO:0008233 peptidase activity 12 646 0.0026 0.029

230 Appendices


GO:0046906 tetrapyrrole binding 5 136 0.0033 0.034

GO:0016853 isomerase activity 7 265 0.0033 0.034

GO:0005622 intracellular 149 9671 2e-25 4.7e-23

GO:0005737 cytoplasm 121 6822 2.2e-24 2.6e-22

GO:0044424 intracellular part 143 9302 7.1e-24 5.6e-22

GO:0044444 cytoplasmic part 105 6289 1.4e-18 8.5e-17

GO:0044464 cell part 176 15217 3.5e-17 1.4e-15

GO:0005623 cell 176 15217 3.5e-17 1.4e-15

GO:0005829 cytosol 32 912 2.5e-13 8.3e-12

GO:0043231 intracellular membrane-bounded

organelle 102 7615 1.1e-11 3.1e-10

GO:0043227 membrane-bounded organelle 102 7622 1.2e-11 3.1e-10

GO:0043229 intracellular organelle 106 8149 2.1e-11 4.6e-10

GO:0043226 organelle 106 8155 2.2e-11 4.6e-10

GO:0009536 plastid 53 2965 4.6e-10 9e-09

GO:0009507 chloroplast 50 2740 8e-10 1.5e-08

GO:0009570 chloroplast stroma 12 249 3.9e-07 6.5e-06

GO:0009532 plastid stroma 13 322 8.6e-07 1.4e-05

GO:0044435 plastid part 20 867 5.6e-06 8.2e-05

GO:0044434 chloroplast part 18 746 9.2e-06 0.00013

GO:0005886 plasma membrane 25 1456 5.3e-05 0.00069

GO:0019898 extrinsic to membrane 5 104 0.0011 0.012

GO:0005634 nucleus 33 2621 0.001 0.012

GO:0044422 organelle part 32 2562 0.0014 0.015

GO:0044446 intracellular organelle part 32 2561 0.0014 0.015

Appendices 231

Appendix E-Table 3. Biological pathways involving Arabidopsis proteins interacting with TlOsm, OsOlp1_A, and OsOlp1_I on the chip

Pathway name Database Background # P-value

Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

Fructose and mannose metabolism

KEGG

PATHWAY 62 0.001807659 0.030085886 8 6 1 1

Glycolysis / Gluconeogenesis

KEGG

PATHWAY 113 0.002229822 0.034706772 11 9 1 1

Pentose phosphate pathway

KEGG

PATHWAY 54 0.003376058 0.044337143 7 5 1 1

benzoate biosynthesis II (CoA-independent,

non-beta-oxidative) BioCyc 6 0.005177588 0.057639239 3 2 1

alkane oxidation BioCyc 6 0.005177588 0.057639239 3 2 1

Riboflavin metabolism

KEGG

PATHWAY 9 0.00592447 0.064514323 3 1 2

Superpathway of lysine, threonine and

methionine biosynthesis II BioCyc 24 0.00665369 0.068200322 5 4 1

fatty acid alpha-oxidation I BioCyc 7 0.007168357 0.069884258 3 2 1

Flavonoid biosynthesis

KEGG

PATHWAY 21 0.007924232 0.07136007 4 2 1 1

ethanol degradation II BioCyc 16 0.008811526 0.075114605 4 3 1

glycolysis I (from glucose 6-phosphate) BioCyc 35 0.006901122 0.076117908 6 5 1

glycolysis II (from fructose 6-phosphate) BioCyc 36 0.007775099 0.082289863 6 5 1

Flavin biosynthesis I (bacteria and plants) BioCyc 9 0.012346065 0.105886406 3 3

methionine biosynthesis II BioCyc 9 0.012346065 0.105886406 3 2 1

ascorbate glutathione cycle BioCyc 10 0.015557855 0.127946865 3 3

flavonoid biosynthesis (in equisetum) BioCyc 11 0.019195197 0.145347416 3 2 1

glycolysis IV (plant cytosol) BioCyc 33 0.020709096 0.15286884 5 4 1

Lysine biosynthesis

KEGG

PATHWAY 16 0.022081898 0.160394176 3 2 1

232 Appendices


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

Pyruvate metabolism

KEGG

PATHWAY 84 0.027680366 0.182756418 7 5 1 1

Histidine metabolism

KEGG

PATHWAY 18 0.028907404 0.187833448 3 3

Biosynthesis of amino acids

KEGG

PATHWAY 255 0.029160885 0.187833448 15 9 2 3 1

benzoate biosynthesis III (CoA-dependent,

non-beta-oxidative) BioCyc 14 0.032681584 0.201976993 3 3 1

Cadherin signalling pathway PANTHER 8 0.034603115 0.209236822 2 1 1

alpha-Linolenic acid metabolism

KEGG

PATHWAY 36 0.039294669 0.22935534 4 4

Superpathway of scopoline and esculin

biosynthesis BioCyc 6 0.04211016 0.239956538 2 2

beta-Alanine metabolism

KEGG

PATHWAY 40 0.05286024 0.276816399 2 1 1

Fatty acid degradation

KEGG

PATHWAY 41 0.056602026 0.28832729 4 3 1

Ascorbate and aldarate metabolism

KEGG

PATHWAY 41 0.056602026 0.28832729 4 3 1

Plant-pathogen interaction

KEGG

PATHWAY 167 0.061264381 0.302898309 10 7 1 1 1

Flavonoid biosynthesis BioCyc 19 0.063499324 0.30869623 3 2 1

lipid-dependent phytate biosynthesis II (via

Ins(1,3,4)P3) BioCyc 8 0.064035815 0.30869623 2 2

1D-myo-inositol hexakisphosphate

biosynthesis V (from Ins(1,3,4)P3) BioCyc 8 0.064035815 0.30869623 2 2

S-adenosyl-L-methionine cycle II BioCyc 8 0.064035815 0.30869623 2 1 1

Superpathway of lipid-dependent phytate


Appendices 233


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

Lysine degradation

KEGG

PATHWAY 26 0.065834464 0.314396972 3 2 1

Scopoletin biosynthesis BioCyc 9 0.076143099 0.342777218 2 1 1

Superpathway of cytosolic glycolysis

(plants), pyruvate dehydrogenase and TCA

cycle BioCyc 65 0.078189891 0.342777218 6 5 1

1D-myo-inositol hexakisphosphate

biosynthesis III (Spirodela polyrrhiza) BioCyc 10 0.088902506 0.36456647 2 2

Cysteine and methionine metabolism

KEGG

PATHWAY 112 0.090683373 0.36456647 7 6 1

Nicotinic acetylcholine receptor signalling

pathway PANTHER 15 0.092032736 0.36456647 2 1 1

Vitamin B6 metabolism

KEGG

PATHWAY 14 0.09279216 0.36456647 2 2

Biosynthesis of secondary metabolites

KEGG

PATHWAY 1078 0.100706063 0.382137455 44 32 4 4 4

isoleucine biosynthesis I BioCyc 11 0.102237897 0.383882929 2 1 1

Cytoskeletal regulation by Rho GTPase PANTHER 17 0.111594485 0.397437137 2 1 1

Arginine and proline metabolism

KEGG

PATHWAY 53 0.111874251 0.397591154 4 2 2

Galactose metabolism

KEGG

PATHWAY 55 0.122804217 0.414525879 4 3 1

Arachidonic acid metabolism

KEGG

PATHWAY 17 0.124246464 0.416833101 2 2

Superpathway of carotenoid biosynthesis BioCyc 13 0.130357842 0.416833101 2 1 1

Inflammation mediated by chemokine and

cytokine signalling pathway PANTHER 19 0.132177023 0.418436113 2 1 1

Selenocompound metabolism

KEGG

PATHWAY 18 0.135232671 0.42650304 2 1 1

jasmonic acid biosynthesis BioCyc 14 0.145014999 0.439225609 2 2

234 Appendices


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

UTP and CTP de novo biosynthesis BioCyc 14 0.145014999 0.439225609 2 2

lysine biosynthesis VI BioCyc 14 0.145014999 0.439225609 2 2

Phenylpropanoid biosynthesis

KEGG

PATHWAY 157 0.165525664 0.46863376 8 4 1 1 2

Ascorbate degradation PANTHER 5 0.170984761 0.475083277 1 1

Threonine biosynthesis PANTHER 5 0.170984761 0.475083277 1 1

Suberin monomers biosynthesis BioCyc 17 0.190702417 0.499880597 2 1 1

Chlorogenic acid biosynthesis I BioCyc 17 0.190702417 0.499880597 2 1 1

Valine, leucine and isoleucine degradation

KEGG

PATHWAY 45 0.201916898 0.507357707 3 2 1

tetrahydrofolate biosynthesis II BioCyc 18 0.206339756 0.514624822 2 2

pyridine nucleotide cycling (plants) BioCyc 18 0.206339756 0.514624822 2 2

Carbon fixation in photosynthetic organisms

KEGG

PATHWAY 69 0.210092915 0.520074133 4 3 1

Tryptophan metabolism

KEGG

PATHWAY 46 0.210328205 0.520074133 3 2 1

pyrimidine ribonucleotides interconversion BioCyc 19 0.222108279 0.534507078 2 2

Superpathway of pyrimidine ribonucleotides

de novo biosynthesis BioCyc 19 0.222108279 0.534507078 2 2

tetrahydrofolate salvage from 5,10-

methenyltetrahydrofolate BioCyc 5 0.228521799 0.541812616 1 1

chlorophyll a degradation II BioCyc 5 0.228521799 0.541812616 1 1

Glycine, serine and threonine metabolism

KEGG

PATHWAY 72 0.23071846 0.54525558 4 3 1

Superpathway of pyrimidine

deoxyribonucleoside salvage BioCyc 20 0.237969174 0.551000251 2 2

Superpathway of pyrimidine nucleobases

salvage BioCyc 20 0.237969174 0.551000251 2 2

Appendices 235


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

2-Oxocarboxylic acid metabolism

KEGG

PATHWAY 74 0.244737889 0.55222066 4 2 2

Lysine biosynthesis PANTHER 8 0.245706526 0.553663097 1 1

lipid-dependent phytate biosynthesis I (via

Ins(1,4,5)P3) BioCyc 6 0.261196586 0.574062471 1 1

L-ascorbate degradation V BioCyc 6 0.261196586 0.574062471 1 1

6-hydroxymethyl-dihydropterin diphosphate

biosynthesis I BioCyc 6 0.261196586 0.574062471 1 1

fatty acid beta-oxidation II (peroxisome) BioCyc 6 0.261196586 0.574062471 1 1

phosphatidylethanolamine biosynthesis II BioCyc 6 0.261196586 0.574062471 1 1

ornithine biosynthesis BioCyc 6 0.261196586 0.574062471 1 1

glycine biosynthesis BioCyc 6 0.261196586 0.574062471 1 1

glycine biosynthesis I BioCyc 6 0.261196586 0.574062471 1 1

valine biosynthesis BioCyc 6 0.261196586 0.574062471 1 1

Glycerolipid metabolism

KEGG

PATHWAY 52 0.262157573 0.574559167 3 2 1

Carbon metabolism

KEGG

PATHWAY 262 0.269106152 0.578339595 11 8 1 2

folate transformations II BioCyc 22 0.269827732 0.578339595 2 2

gluconeogenesis III BioCyc 22 0.269827732 0.578339595 2 2

Calvin-Benson-Bassham cycle BioCyc 23 0.285762125 0.592274165 2 2

Threonine biosynthesis BioCyc 7 0.292494646 0.599614025 1 1

De novo pyrimidine deoxyribonucleotide

biosynthesis PANTHER 10 0.291926253 0.599614025 1 1

chlorophyll a degradation I BioCyc 7 0.292494646 0.599614025 1 1

Superpathway of isoleucine and valine


236 Appendices


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

adenosine deoxyribonucleotides de novo


RNA degradation

KEGG

PATHWAY 111 0.321089203 0.625956429 5 4 1

Protein processing in endoplasmic reticulum

KEGG

PATHWAY 220 0.32212958 0.625956429 9 8 1

arginine biosynthesis II (acetyl cycle) BioCyc 8 0.322473687 0.625956429 1 1

arginine biosynthesis I (via L-ornithine) BioCyc 8 0.322473687 0.625956429 1 1

quercetin sulfate biosynthesis BioCyc 8 0.322473687 0.625956429 1 1

purine deoxyribonucleosides salvage BioCyc 8 0.322473687 0.625956429 1 1

leucine biosynthesis BioCyc 8 0.322473687 0.625956429 1 1

Superpathway of flavones and derivatives


pyrimidine deoxyribonucleotide

phosphorylation BioCyc 8 0.322473687 0.625956429 1 1

guanosine deoxyribonucleotides de novo


Huntington disease PANTHER 36 0.326912931 0.630930697 3 2 1

Superpathway of adenosine nucleotides de

novo biosynthesis I BioCyc 27 0.348910807 0.656061596 2 2

sucrose biosynthesis I (from photosynthesis) BioCyc 27 0.348910807 0.656061596 2 2

CMP phosphorylation BioCyc 9 0.351189006 0.656668495 1 1

glutathione redox reactions I BioCyc 9 0.351189006 0.656668495 1 1

choline biosynthesis I BioCyc 9 0.351189006 0.656668495 1 1

sporopollenin precursor biosynthesis BioCyc 9 0.351189006 0.656668495 1 1

Serine glycine biosynthesis PANTHER 13 0.356255455 0.660270583 1 1

De novo pyrimidine ribonucleotides

biosythesis PANTHER 13 0.356255455 0.660270583 1 1

Appendices 237


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

folate polyglutamylation BioCyc 10 0.378693597 0.681962529 1 1

pyrimidine deoxyribonucleotides de novo

biosynthesis II BioCyc 10 0.378693597 0.681962529 1 1

guanosine ribonucleotides de novo


gluconeogenesis I BioCyc 29 0.379826415 0.681962529 2 2

oxygenic photosynthesis BioCyc 29 0.379826415 0.681962529 2 2

Glutathione metabolism

KEGG

PATHWAY 93 0.383508512 0.687289775 4 4

Monobactam biosynthesis

KEGG

PATHWAY 14 0.389258012 0.689507606 1 1

Superpathway of pyrimidine ribonucleosides

salvage BioCyc 30 0.395056515 0.697573532 2 2


deoxyribonucleotides de novo biosynthesis BioCyc 30 0.395056515 0.697573532 2 2

Inositol phosphate metabolism

KEGG

PATHWAY 68 0.404005833 0.705564025 3 3

UDP-D-xylose biosynthesis BioCyc 11 0.405038241 0.705564025 1 1

linoleate biosynthesis I (plants) BioCyc 11 0.405038241 0.705564025 1 1

Phenylalanine metabolism

KEGG

PATHWAY 42 0.418365094 0.724275719 2 1 1

Nicotinate and nicotinamide metabolism

KEGG

PATHWAY 16 0.42814894 0.728385262 1 1

fatty acid activation BioCyc 12 0.430271603 0.728385262 1 1

pyrimidine deoxyribonucleosides salvage BioCyc 12 0.430271603 0.728385262 1 1

leucine degradation I BioCyc 12 0.430271603 0.728385262 1 1

photorespiration BioCyc 13 0.454440316 0.750406847 1 1

238 Appendices


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only


biosynthesis III BioCyc 13 0.454440316 0.750406847 1 1

Superpathway of guanosine nucleotides de

novo biosynthesis I BioCyc 13 0.454440316 0.750406847 1 1

valine degradation I BioCyc 14 0.477589064 0.769728874 1 1

methionine salvage cycle II (plants) BioCyc 14 0.477589064 0.769728874 1 1

De novo purine biosynthesis PANTHER 20 0.485504949 0.776530752 1 1

Phenylpropanoid biosynthesis BioCyc 37 0.496246916 0.785570762 2 1 1

One carbon pool by folate

KEGG

PATHWAY 20 0.498677386 0.785872482 1 1

D-sorbitol degradation I BioCyc 15 0.499760668 0.785872482 1 1

indole glucosinolate breakdown (active in

intact plant cell) BioCyc 15 0.499760668 0.785872482 1 1

Superpathway of leucine, valine, and

isoleucine biosynthesis BioCyc 15 0.499760668 0.785872482 1 1

Apoptosis signalling pathway PANTHER 21 0.501824492 0.787751755 1 1

Pentose and glucuronate interconversions

KEGG

PATHWAY 81 0.513468972 0.796991081 3 3


deoxyribonucleotides de novo biosynthesis

(E. coli) BioCyc 16 0.52099616 0.799812371 1 1



TCA cycle II (plants and fungi) BioCyc 16 0.52099616 0.799812371 1 1

methionine salvage cycle I (bacteria and

plants) BioCyc 16 0.52099616 0.799812371 1 1

TCA cycle variation V (plant) BioCyc 17 0.541334859 0.818386623 1 1

Valine, leucine and isoleucine biosynthesis

KEGG

PATHWAY 23 0.545818841 0.818386623 1 1

Appendices 239


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

Pyrimidine metabolism

KEGG

PATHWAY 116 0.546203826 0.818386623 1 1

glutamine biosynthesis III BioCyc 18 0.560814439 0.823762097 1 1

Superpathway of purine nucleotides de novo


UDP-sugars interconversion BioCyc 19 0.579471002 0.841079402 1 1

Limonene and pinene degradation

KEGG

PATHWAY 59 0.591292242 0.850063642 2 2

adenosine ribonucleotides de novo


sucrose degradation II (sucrose synthase) BioCyc 20 0.597339138 0.853834243 1 1

Cyanoamino acid metabolism

KEGG

PATHWAY 60 0.600192619 0.853936801 2 2

Stilbenoid, diarylheptanoid and gingerol

biosynthesis

KEGG

PATHWAY 61 0.608946552 0.859056852 2 1 1

Purine metabolism

KEGG

PATHWAY 158 0.610161155 0.859056852 5 5

Metabolic pathways

KEGG

PATHWAY 1912 0.621610348 0.862567677 62 48 5 4 5

Citrate cycle (TCA cycle)

KEGG

PATHWAY 63 0.626015804 0.862567677 2 1 1

Carotenoid biosynthesis

KEGG

PATHWAY 29 0.627250698 0.863561362 1 1

salvage pathways of pyrimidine

ribonucleotides BioCyc 22 0.630841327 0.864688012 1 1

Superpathway of choline biosynthesis BioCyc 22 0.630841327 0.864688012 1 1

sucrose degradation III (sucrose invertase) BioCyc 23 0.64653757 0.876475529 1 1

glutathione-mediated detoxification II BioCyc 50 0.653306645 0.878995801 2 2

glucosinolate biosynthesis from tryptophan BioCyc 24 0.661569881 0.885429116 1 1

240 Appendices


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

Phosphatidylinositol signalling system

KEGG

PATHWAY 68 0.666152615 0.887323729 2 2

Nucleotide excision repair

KEGG

PATHWAY 69 0.673751073 0.892526017 2 2

simple coumarins biosynthesis BioCyc 25 0.675966195 0.892659739 1 1

Plant hormone signal transduction

KEGG

PATHWAY 271 0.684924673 0.901611883 8 7 1

Arginine biosynthesis

KEGG

PATHWAY 35 0.694116089 0.907793402 1 1

Endocytosis

KEGG

PATHWAY 142 0.699385888 0.909959503 4 4

phospholipid biosynthesis II BioCyc 27 0.702956789 0.911782686 1 1

Superpathway of sucrose and starch

metabolism I (non-photosynthetic tissue) BioCyc 27 0.702956789 0.911782686 1 1

Circadian rhythm - plant

KEGG

PATHWAY 36 0.704033922 0.912369326 1 1

Glyoxylate and dicarboxylate metabolism

KEGG

PATHWAY 74 0.709656175 0.913424219 2 1 1

Insulin resistance

KEGG

PATHWAY 37 0.713631063 0.91708271 1 1

Mismatch repair

KEGG

PATHWAY 39 0.731904302 0.93136346 1 1

Tyrosine metabolism

KEGG

PATHWAY 40 0.740600094 0.938875383 1 1

Parkinson disease PANTHER 42 0.750090206 0.944988093 1 1

Base excision repair

KEGG

PATHWAY 43 0.76503579 0.951202043 1 1

Porphyrin and chlorophyll metabolism

KEGG

PATHWAY 48 0.800766889 0.979829731 1 1

Alanine, aspartate and glutamate metabolism

KEGG

PATHWAY 48 0.800766889 0.979829731 1 1

Appendices 241


Corrected

P-value

Total

input

Common

interactors TlOsm&

OsOlp1_A

TlOsm&

OsOlp1_I

TlOsm only

DNA replication

KEGG

PATHWAY 50 0.813492592 0.986465136 1 1

phosphatidylcholine acyl editing BioCyc 39 0.82387468 0.992072591 1 1

Amino sugar and nucleotide sugar

metabolism

KEGG

PATHWAY 135 0.828235371 0.993366595 3 2 1

Protein export

KEGG

PATHWAY 53 0.831077338 0.994335235 1 1

Basal transcription factors

KEGG

PATHWAY 55 0.841871876 0.997312632 1 1

Homologous recombination

KEGG

PATHWAY 56 0.847008356 0.998471982 1 1

Spliceosome

KEGG

PATHWAY 192 0.882517299 1 4 4

aerobic respiration III (alternative oxidase

pathway) BioCyc 52 0.900188299 1 1 1

RNA transport

KEGG

PATHWAY 169 0.920243315 1 3 3

Glycerophospholipid metabolism

KEGG

PATHWAY 86 0.943271383 1 1 1

Peroxisome

KEGG

PATHWAY 87 0.945119356 1 1 1

aerobic respiration I (cytochrome c) BioCyc 68 0.950502772 1 1 1

Starch and sucrose metabolism

KEGG

PATHWAY 196 0.989094977 1 2 2

Ubiquitin mediated proteolysis

KEGG

PATHWAY 149 0.993001023 1 1 1

Oxidative phosphorylation

KEGG

PATHWAY 162 0.99546225 1 1 1

Ribosome

KEGG

PATHWAY 355 0.999427687 1 3 3

242 Appendices

Bibliography 243

Bibliography

Abad, L.R., D'Urzo, M.P., Liu, D., Narasimhan, M.L., Reuveni, M., Zhu, J.K., Niu,

X., Singh, N.K., Hasegawa, P.M., Bressan, R.A. (1996) Antifungal activity of

tobacco osmotin has specificity and involves plasma membrane

permeabilization. Plant Sci 118, 11-23

Abdin, M.Z., Kiran, U., Alam, A. (2011) Analysis of osmotin, a PR protein as

metabolic modulator in plants. Bioinformation 5, 336-340

AbuQamar, S., Luo, H., LuLuk, K., Mickelbart, M.V., Mengiste, T. (2009) Crosstalk

between biotic and abiotic stress responses in tomato is mediated by the AIM1

transcription factor. Plant J, 1-14

Agarwal, P.K., Shukl, P.S., Gupta, K., Jha, B. (2013) Bioengineering for salinity

tolerance in plants: state of the art. Mol Biotechnol 54, 102-123

Alpert, P., Oliver, M.J. (2002) Drying without dying. In: Black, M., Pritchard, H.W.

(eds) Desciccation and survival in plants: drying without dying. CAB

Publishing, p 13-54

Annon, A., Rathore, K., Crosby, K. (2014) Overexpression of a tobacco osmotin gene

in carrot (Daucus carota L.) enhances drought tolerance. In Vitro Cell Dev

Biol_Plant 50, 299-306

Ansari, M.R., Shaheen, T., Bukhari, S.A., Husnain, T. (2015) Genetic improvement of

rice for biotic and abiotic stress tolerance. Turk J Bot 39, 911-919

Anzlovar, S., Dermastia, M. (2003) The comparative analysis of osmotins and

osmotin-like PR-5 protein. Plant Biol 5, 116-124

Ashraf, M. (2010) Inducing drought tolerance in plants: recent advances. Biotechnol

Adv 28, 169-183

Atkinson, N.J., Urwin, P.E. (2012) The interaction of plant biotic and abiotic stresses:

from genes to the field. J Exp Bot, 1-21

Babu, R.C. (2010) Breeding for drought resistance in rice: an integrated review from

physiology to genomics. Electron J Plant Breed 1(4), 1133-1141

Baena-Gonzalez, E., Sheen, J. (2008) Convergent energy and stress signalling. Trend

Plant Sci 13, 474-482

Bajji, M., Kinet, J.M., Lutts, S. (2002) The use of electrolyte leakage method for

assessing cell membrane stabiity as a water stress tolerance test in durum

wheat. Plant Growth Regul 36, 61-71

Barnabas, B., Jager, K., Feher, A. (2008) The effect of drought and heat stress on

reproductive processes in cereals. Plant Cell Environ 31, 11-38

Bars, H., Weatherley, P. (1962) A re-examination of the relative turgidity technique

for estimating water deficits in leaves. Aust J Biol Sci 15(3), 413-428

244 Bibliography

Barthaker, S., Babu, V., Bansal, K.C. (2001) Over-expression of osmotin induces

proline accumulation and confers tolerance to osmotic stress in transgenic

tobacco. J Plant Biochem Biotech 10, 31-37

Belin, C., Thomine, S. (2010) Water balance and the regulation of stomatal

movements. In: Pareek, A., Sopory, S.K., Bohnert, H.J., Govindjee (eds)

Abiotic stress adaptation in plants: physiological, molecular, and genomic

foundation. Springer Science + Business Media, p 283-305

Benjamini, Y., Hochberg, Y. (1995) Controlling the false discovery rate: A practical

and powerful approach to multiple testing. J R Stat Soc 57, 289-300

Bhatnagar-Mathur, P., Vadez, V., Sharma, K.K. (2008) Transgenic approaches for

abiotic stress tolerance in plants: retrospect and prospects. Plant Cell Rep 27,

411-424

Bhattacharya, A., Saini, U., Joshi, R., Kaur, D., Pal, A.K., Kumar, N., Gulati, A.,

Mohanpuria, P., Yadav, S.K., Kumar, S., Ahuja, P.S. (2014) Osmotin-

expressing transgenic tea plants have improved stress tolerance and are of

higher quality. Transgenic Res 23(2), 211-223

Bodner, G., Nekhforoosh, A., Kaul, H. (2015) Management of crop water under

drought: a review. Agron Sustain Dev 35, 401-442

Bolger, M.E., Weisshaar, B., Scholz, U., Stein, N., Usadel, B., Mayer, K.F.X. (2014)

Plant genome sequencing-aplications for crop improvement. Curr Opin

Biotechnol 26, 31-37

Bradford, M.M. (1976) Arapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal

Biochem 72, 248-254

Breviariao, D., Genga, A. (2013) Stress response in rice. J Rice Res 4, e104

Brodribb, T.J., Holbrook, N.M. (2003) Stomatal closure during leaf dehydration,

correlation with other leaf physiological traits. Plant Physiol 132, 2166-2173

Buchan, D.W., Ward, S.M., Lobley, A.E., Nugent, T.C., Bryson, K., Jones, D.T.

(2010) Protein annotation and modelling servers at University College London.

Nucleic Acids Res 38:W565-W568. Available at

http://bioinf.cs.ucl.ac.uk/psipred/?memsatsvm=1 (accessed on 22 August 2013)

Campo, S., Baldrich, P., Messeguer, J., Lalanne, E., Coca, M., Segundo, B.S. (2014)

Overexpression of a Calcium-dependent protein kinase confers salt and

drought tolerance in rice by preventing membrane lipid peroxidation. Plant

Physiol 165, 688-704

Campos, M.D.A., Silva, M.S., Magalhaes, C.P., Ribeiro, S.G., Sarto, R.P., Vieira,

E.A., Sa, M.F.G. (2008) Expression in Escherichi coli, purification, refolding,

and antifungal activity of an osmotin from Solanum nigrum. Microb Cell Fact

7, 7-17

Cha-um, S., Trakulyingcharonen, T., Smitamana, P., Kirdmanee, C. (2009) Salt

tolerance in two rice cutivar differing salt tolerant abilities in responses to iso-

osmotic stress. Aust J Crop Sci 3, 221-230

Chaves, M.M., Maroco, J.P., Pereira, J.S. (2003) Understanding plant responses to

drought - from genes to the whole plant. Funct Plant Biol 30, 239-264

http://bioinf.cs.ucl.ac.uk/psipred/?memsatsvm=1

Bibliography 245

Chen, Y.C., Lo, Y.S., Hsu, W.C., Yang, J.M. (2007) 3D-partner: a web server to infer

interacting partners and binding models. Nucleic Acids Res 35, 561-567

Choi, D.S., Hong, J.K., Hwang, B.K. (2013) Pepper osmotin-like protein 1 (CaOSM1)

is an essential component for defense response, cell death, and oxidative burst

in plants. Planta 238, 1113-1124

Clemente, T. (2006) Nicotiana (Nicoiana tabacum, Nicotiana benthamiana). In:

Wang, K. (Ed.), Methods in Molecular Biology. Humana Press Inc, Totowa,

N.J., pp. 143-154

Cominelli, E., Conti, L., Tonelli, C., Galbiati, M. (2013) Challenges and perspectives

to improve crop drought and salinity tolerance. N Biotechnol 30(4), 355-361

Cornejo, M.J., Luth, D., Blankenship, K.M., Anderson, O.D., Blechl, A.E. (1993)

Activity of a maize ubiquitin promoter in transgenic rice. Plant Mol Biol 23,

567-581

Dammann, C., Ichida, A., Hong, B., Romannowsky, S.M., Hrabak, E.M., Harmon

A.C., Pickard, B.G., Harper, J.F. (2003) Subcellular targeting of nine calcium-

dependent protein kinase isoforms from Arabidopsis. Plant Physiol 132(4),

1840-1848

D'Angei, S., Altamura, M.M. (2007) Osmotin induces cold protection in olive trees by

affecting programmed cell death and cytoskeleton organization. Planta 225,

1147-1163

Das, M., Chauhan, H., Chibba, A., Mohd, Q., Haq, R., Khurana, P. (2011) High-

efficiency transformation and selective tolerance against biotic and abiotic in

mulberry, Morus indica cv. K2, by constitutive and inducible expression of

tobacco osmotin. Transgenic Res 20, 231-246

Das, P., Nutan, K., Singla-Pareek, S., Pareek, A. (2015) Understanding salinity

responses and adopting 'omics-based' approaches to generate salinity tolerant

cultivars of rice. Front Plant Sci 6, 712

Datta, K., Velazhahan, R., Oliva, N., Ona, I., Mew, T., Khush, G.S., Muthukrishnan,

S., Datta, S.K. (1999) Over-expression of the cloned rice thaumatin-like

protein (PR-5) gene in transgenic rice plants enhances environmental friendly

resistance to Rhizoctonia solani causing sheath blight disease. Theor Appl

Genet 98, 1138-1145

Dehimi, T., Niazi, A., Ebrahimi, M., Kajbaf, K., Fanaee, S., Bakhtiarizadeh, M.R.,

Ebrahimie, E. (2012) Finding the undiscovered roles of genes: an approach

using mutual ranking of coexpressed genes and prooter architecture-case study:

dual roles of thaumatin like proteins in biotic and abiotic stresses. SpringerPlus

1, 30

Deo, P.C., Tyagi, A.P., Taylor, M., Harding, R., Becker, D. (2010) Factors affecting

somatic embryogeneesis and transformation in modern plant breeding.

SPJNAS 28, 27-40

Diez, P., Dasilva, N., Gonzalez-Gonzalez, M., Matarraz, S., Casado-Vela, J., Orfao,

A. Fuentes, M. (2012) Data analysis strategies for protein microarray.

Microarrays 1, 64-83

246 Bibliography

Dinakar, C., Bartels, D. (2013) Desiccation tolerance in resurrection plants: new

insights from transcriptome, proteome, and metabolome analysis. Front Plant

Sci 4, 1-14

Dionisio-Sese, M.L., Tobita, S. (1998) Antioxidant response of rice seedlings to

salinity stress. Plant Sci 135, 1-9

Dolferus, R., Ji, X., Richards, R.A. (2011) Abiotic stress and control of grain number

in cereals. Plant Sci 181, 331-341.

Dolferus, R., Powell, N., Ji, X., Ravash, R., Edlington, J., Oliver, S., Dongen, J.,

Shiran, B. (2013) The physiology of reproductive-stage abiotic stress tolerance

in cereals. In: Rout, G., Das, A. (Eds.), Molecular stress physiology of plants.

Springer, New Delhi, India.

Dong, H., Beer, S.V. (2000) Riboflavin induces disease resistance in plants by

activating a novel signal transduction pathway. Phytopathology 90(8), 801-811

Du, Z., Zhou, X., Ling, Y., Zhang, Z., Su, Z. (2010) agriGO: a GO analysis toolkit for

the agricultural community. Nucleic Acids Res 38, W64-W70

Dubiella, U., Seybold, H., Durian, G., Komander, E., Lassig, R., Witle, C.P., Schulze,

W.S., Romes, T. (2013) Calcium-dependent protein kinase/NADPH oxidase

activation circuits is required for rapid defense signall propagation. Proc Natl

Acad Sci USA 110, 8744-8749

Dupre, D.J., Robitaille, M., Ethier, N., Villeneuve, L.R., Manmarbahi, A.M., Hebert,

T.E. (2006) Seven transmembrane receptor core signalling complexes are

assembled prior to plasma membrane trafficking. J Biol Chem 281, 34561-

34573

Dway, M.R., Smille, R.M. (1971) B-1,3-glucan: a source of carbon and energy for

chloroplast development in Euglena racili. Aust J Biol Sci 24, 15-22

Earley, K.W., Haag, J.A., Pontes, O., Opper, K., Juehne, T., Song, K., Pikaard, C.S.

(2006) Gateway-compatiple vectors for plant functional genomics and

proteomics. Plant J 45, 616-629

Edwards, D., Batley, J. (2010) Plant genome sequencing: applications for crop

improvement. Plant Biotechnol J 8, 2-9

Emanuelsson, O., Brunak, S., Heijne, G.V., Nielsen, H. (2007) Locating proteins in

the cell using TargetP, SignalsP and related tools. Nat Protoc 2(4), 953-970.

SignalP server available at http://www.cbs.dtu.dk/services/SignalP/ and

TargetP 1.1 server available at http://www.cbs.dtu.dk/services/TargetP/

(accessed on 22 August 2013)

FAO (2016) The state of food and agriculture 2016. Climate change, agriculture and

food security. Rome, FAO

Ferreyra, M.L.F., Rius, S.P., Casati, P. (2012) Flavonoids: biosynthesis, biological

functions, and biotechnological applications. Front Plant Sci 3, Acticle

222_1-16

Freitas, C.D.T., Lopes, J.L.S., Beltramini, L.M., Oliveira, R.S.B., Oliveira, J.T.A.,

Ramos, M.V. (2011) Osmotin from Calotropis procera latex: New insights into

structure and antifungal properties. Biochim Biophys Acta 1808, 2501-2507

http://www.cbs.dtu.dk/services/SignalP/

http://www.cbs.dtu.dk/services/TargetP/

Bibliography 247

Fujii, H., Zhu, J.K. (2012) Osmotic stress signaling via protein kinases. Cell Mol Life

Sci 69, 3165-3173

Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-

Shinozaka, K., Shinozaki, K. (2006) Crosstalk between abiotic and biotic stress

responses: a current view from the points of convergence in the stress

signalling networks. Curr Opin Plant Biol 9, 436-442.

Fukao, Y. (2012) Protein-protein interactions in plants. Plant Cell Physiol 53(4),

617-625

Gaff, D.F., Oliver, M. (2013) The evolution of desiccation tolerance in angiosperm

plants: a rare yet common phenomenon. Funct Plant Biol 40, 315-328

Gao, X., Chen, X., Lin, W., Hen, S., Lu, D., Niu, Y., Li, I., Cheng, C., McCuormack,

M., Sheen, I. (2013) Bifurcation of Arabidopsis NLR immune signalling via

Ca2+ -dependent protein kinase. PlLoS Pathog 9, e1003127

Garwe, D., Thomson, J.A., Mundree, S.G. (2003) Molecular characterization of

XVSAP1, a stress-responsive gene from the resurrection plant Xerophyta

viscosa Baker. J Exp Bot 54(381), 191-201

Garwe, D., Thomson, J.A., Mundree, S.G. (2006) XVSAP1 from Xerophyta viscosa

improves osmotic-, salinity-, and high-temperature -stress tolerance in

Arabidopsis. Biotechnol J 1, 1137-1146

Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M.R., Appel, R.D.,

Bairoch, A. (2005) Protein Identification and analysis tools on the ExPASy

Server. In: Walker JM (ed) The Proteomics Protocols Handbook. Humana

Press, p pp 571-607. ExPASY translation tool available at

http://web.expasy.org/translate/. ExPASY Protscale available at

http://web.expasy.org/protscale. ExPASY Compute pI/Mw tool available at

http://web.expasy.org/compute_pi/. ExPASY ProtParam available at

http://expasy.org/tools/protparam.html. ExPASY Prosite available at

http://prosite.expasy.org/mydomains/. (Accessed on 19 August 2013)

Gay, F., Maraval, B., Roques, S., Gunata, Z., Boulanger, R., Audeber, A., Mestres, C.

(2009) Effects of salinity on yield and 2-acetyl-1-pyrroline content in the grains

of three fragraant rice cultivars (Oryza sativaa L.) in Camargue (France). Field

Crops Res 117, 154-160

Gechev, T.S., Benina, M., Obata, T., Tohge, T., Sujeeth, N., Minkov, I., Hille, J.,

Temani, M.R., Marriott, A.S., Bergstrom, E., Thomas-Oates, J., Antonio, C.,

Mueller-Roeber, B., Schippers, J.H.M., Fernie, A.R., Toneva, V. (2013)

Molecular mechanisms of desiccation tolerance in resurrection glacial relic

Haberlea rhodopensis. Cell Mol Life Sci 70, 689-709

Gelvin, S.B. (2003) Agrobacterium-mediated transformation: the biology behind the

"gene-jockeying" tool. Microb Mol Biol Rev 67, 16-37

Gerdes, S., Laerma-Ortiz, C., Frelin, O., Seaver, S.M.D., Henry, C.S., Cracy-legard,

V.D., Hanson, A.D. (2012) Plant B vitamin pathways and their

compartmentation: a guide for the perplexed. J Exp Bot

Gill, S.S., Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in

abiotic stress tolerance in crop plants. Plant physiol Biochem 48, 909-930

http://web.expasy.org/translate/

http://web.expasy.org/protscale

http://web.expasy.org/compute_pi/

http://expasy.org/tools/protparam.html

http://prosite.expasy.org/mydomains/

248 Bibliography

Goel, D., Singh, A.K., Yadav, V., Babbar, S.B. (2010) Overexpression of osmotin

gene confers tolerance to salt and drought stresses in transgenic tomato

(Solanum lycopersicum L.) Protoplasma 245, 133-141

Goff, S.A. (1999) Rice as a model for cereal genomics. Curr Opin Plant Biol 2, 86-89

Gonzalez, L., Gonzalez-Vilar, L. (2001) Determination of relative water content. In:

Roger M (ed) Handbook of plant ecophysiology techniques. Kluwer Academic

Publisher, Netherlands, p 207-21

Gosal, S., Wani, S.H., Kan, M.S. (2009) Biotechnology and drought tolerance. J Crop

Improv 23, 19-54

Grover, A., Minhas, D. (2000) Towards production of abiotic stress tolerant transgenic

rice plants: issues, progress and future research needs. Pro. Indian natu Sci

Acad (PINSA) B66, 13-32

Guo, J., Xu, X., Li, W., Zhu, W., Zhu, H., Liu, Z., Luan, X., Dai, Z., Liu, G., Zhang,

Z., Zeng, R., Tang, G., Fu, X., Wang, S., Zhang, G. (2016) Overcoming inter-

subspecific hybrid sterility in rice by developing indica-compatiple japonica

lines. Sci Rep 6, 26878

Halford, N.G., Curtis, T.Y., Chen, Z., Huang, J. (2015) Effects of abiotic stress and

crop management on cereal grain composition: implications for food quality

and safety. J Exp Bot 66, 1145-1156

Halpin, C. (2005) Gene stacking in transgenic plants-the chellenge for 21st century

plant biotechnology. Plant Biotechnol J 3, 141-155

Hansen, G., Wright, M.S. (1999) Recent advances in the transformation of plants.

Trend Plant Sci 4, 226-231

Hasanuzzamman, M., Nahar, K., Alam, M.M., Roychowdhury, R., Fujita, M. (2013)

Physiological, biochemical, and molecular mechanisms of heat stress tolerance

in plants. Int J Mol Sci 14, 9643-9684.

Hernandez, M., Ghersi, D., Sanchez, R. (2009) SITEHOUND-web: a server for ligand

binding site identification and protein structures. Nucleic Acids Res 37, 413-

416

Hiei, Y., Komari, T. (2008) Agrobacterium-mediated transformation of rice using

immature embryos or calli induced from mature seed. Nature Protocols 3

Hoang, T.M.L., Williams, B., Khanna, H., Dale, J., Mundree, SG. (2014)

Physiological basis of salt stress tolerance in rice expressing the antiapoptotic

gene SflAP. Funct Plant Biol 41, 1168-1177

Hong, J.K., Jung, H.W., Lee, B.K., Lee, S.C., Lee, Y.K., Hwang, B.K. (2004) An

osmotin-like protein gene, CAOSM1, from pepper: differentail expression and

in situ localisation of its mRNA during pathogen infection and abiotic stress.

Physiol Mol Plant Pathol 64, 30-310

Horton, P., Park, K., Obayyashi, T., Fufita, N., Harada, H., Adams_Collier, C.J.,

Nakai, K. (2007) Wolf PSORT: protein localization predictor. Nuclic Acids Res

35, W585-W587. Available at http://wolfpsort.org/ (accessed on 22 August

2013)

http://wolfpsort.org/

Bibliography 249

Hou, Q., Bartels, D. (2014) Comparative study of the aldehyde dehydrogenase (ALDH)

gene supperfamily in the glycophyle Aranidopsis thaliana and Eutrema

halophytes. Ann Bot 10.1093/aob/mcu152, 1-15

Hu, C.D., Grinberg, A.V., Kerppola, T.K. (2005) Visualization of protein interactions

in living cells using bimolecular fluorescence complementation (BiFC)

analysis. Curr Protoc Protein Sci, 19.10.11-19.10.21

Hu, S., Xie, Z., Qian, J., Blackshaw, S., Zhu, H. (2011) Functional protein microarray

technology. Wiley Interdiscip Rev Syst Biol Med 3, 255-268

Huang, D.W., Sherman, B.T., Lempicki, R.A. (2009) Systematic and integrative

analysis of large gene lists using DAVID bioinformatics resourses. Nat

Protoc 4(1), 44-55

Huang, G.T., Ma, S.L., Bai, L.P., Zhang, L., Ma, H., Jia, P., Liu, J., Zhong, M., Guo,

Z.F. (2012) Signal transduction during cold, salt, and drought stresses in plants.

Mol Biol Rep 39, 969-987

Husaini, A.M., Abdin, M.Z. (2008a) Development of transgenic strawberry (Fragaria

x ananassa Duch.) plants tolerant to salt stress. Plant Sci 174, 446-455

Husaini, A.M., Abdin, M.Z. (2008b) Overexpression of tobacco osmotin gene leads to

salt stress tolerance in strawberry (Fragaria x ananassa Duch.) plants. Indian J

Biotechnol 7, 465-471

Husani, A.M., Rafiqi, A.M. (2012) Role of osmotin in strawbarry improvement. Plant

Mol Biol Rep 30, 1155-1164

Ibeas, D.J.Y., Lee, J.I., Narasimhan, M.A.C., Uesono, M.L., Hasegawa, P.M., Pardo,

J.M., Breassan, R.A. (1998) Osmotin, a plant antifungal protein, subverbs

signal tranduction to enhance fungal cell susceptibility. Mol Cell 1, 807-817

Ibeas, J.I., Lee, H., Damsz, B., Prasad, D.T., Pardo, J.M., Hasegawa, P.M., Pressan

R.A., Narasimhan M.L. (2000) Fungal cell wall phosphomannans facilitate the

toxic activity of a plant PR-5 prtein. Plant J 23(3), 375-383

Ingle, R.A., Schmidt, U.G., Farrant, J.M., Thomson, J.A., Mundree, S.G. (2007)

Proteomic analysis of leaf proteins during dehydration of the resurrection plant

Xeophyta viscosa. Plant Cell Environ 30, 435-446

Inoue, H., Nojima, H., Okayama, H. (1990) High efficiency transformation of

Escherichia coli with plasmids. Gene 96 (1), 23-28

Jackson, M.R., Nilsson, T., Peterson, P.A. (1990) Identification of a concensus motif

for retention of transmembrane proteins in the endomplasmic reticulum.

EMBO J 38, 3153-3162

Jagadish, K.S.V., Cairn, J.E., Kumar, A., Somayanda, I.M., Craufurd, P.Q. (2011)

Does susceptibility to heat stress confound screening for drought tolerance in

rice. Funct Plant Biol 38, 261-269

Jaggard, K.W., Qi, A., Ober, E.S. (2010) Possible changes to arable crop yields by

2050. Phil Trans R Soc B 365, 2835-2851

Jami, S.K., Anuradha, T.S., Guruprasad, L., Kirti, P.B. (2007) Molecular, biochemical

and structural characterization of osmotin-like protein from black nightshade

(Solanum nigrum). J Plant Physiol 164, 238-252

250 Bibliography

Jaroszewski, L., Li, Z., Cai, X., Webber, C., Godzik, A. (2011) FFAS: novel features

and applications. Nucleic Acids Res 39, 38-44

Jiang, G., Wang, Z., Shang, H., Yang, W., Hu, Z., Phillips, J. (2007) Proteomic

analysis of leaves from resurrection plant Boea hygrometrica in response to

dehydration and dehydration. Planta 225, 1405-1420

Jiao, X., Sherman, B.T., Huang, D.W., Stephens, R., Baseler, M.W., Lane H.C.,

Lampicki R.A. (2012) DAVID-WS: a stateful web service to facilitate

gene/protein list analysis. Application Note 28(13), 1805-1806

Johnson, E.S. (2004) Protein modification by SUMO. Annu Rev Biochem 73, 355-382

Jones, D.T., Taylor, W.R., Thomton, J.M. (1992) The rapid generation of mutation

data matrice from protein sequences. Comput Applic Biosci 8, 275-282.

Kamigaki, A., Nito, K., Hikino, K., Goto-Yamada, S., Nishamura, M., Nakagawa, T.,

Mano, S. (2016) Gateway vectors for simutaneous detection of multiple

protein-protein interactions in plant cells using bimolecular fluorescence

complementation. PloSONE 11, e0160717

Karbaschi, M.R., Williams, B., Taji, A., Mundree, S.G. (2016) Tripogon loliiformis

elicits a rapid physiological and structural response to dehydration for

desiccation tolerance. Funct Plant Biol 43(7), 643-655

Kelley, L.A., Sternberg, M.J.E. (2009) Protein structure prediction on the web: a case

study using the phyre server. Nat Protoc 4, 263-271

Kerppola, T.K. (2008) Bimolecular fluorescence complementation (BiFC) analysis as

a probe of protein-protein interactions in living cells. Annu Rev Biophys 37,

465-487

Kerppola, T.K. (2009) Visualization of molecular interaction using bimolecular

fluorescence complementation analysis: characteristics of protein fragment

complementation. Chem Soc Rev 38, 2876-2886

Kerppola, T.K. (2013) Bimolecular fluorescence comblementation (BiFC) analysis of

protein interactions in live cells. Cold Spring Harbor Protocols, 727-731

Khanna, H.K., Raina, S.K. (1999) Agrobacterium-mediated transformation of indica

rice cultivars using binary and superbinary vectors. Aust J Palnt Physiol 26,

311-324

Kim, H., Mun, J., Byun, B.H., Hwang, H., Kwon, Y.M., Kim, S. (2002) Molecular

cloning and characterization of the gene encoding osmotin protein in Petunia

hybrida. Plant Sci 162, 745-752

Kim, S., Kim, D., Tai, T.H. (2012) Evaluation of rice seedling tolerance to constant

and intermittent low temperature stress. Rice Sci 19(4), 295-308

Kishor, P.B.K., Sangam, S., Amrutha, R.N., Laxmi P.S., Naidu, K.R., Rao K.R.S.S.,

Reddy, K.J., Theriappan, P., Sreenivasulu, N. (2005) Regulation of proline

biosynthesis, degradation, uptake and transport in higher plants: its

implications in plant growth and abiotic stress tolerance. Curr Sci 88(3), 424-

438

Kobayashi, K., Fukuda, M., Igarashi, D., Sunaoshi, M. (2000) Cytokinin binding

proteins from tobacco callus share homology with osmotin-like protein and an

endochitinase. Plant Cell Physiol 41, 148-157

Bibliography 251

Kobayashi, M., Ohura, I., Kawakita, K., Yokota, N., Fujiwana, M., Shimamoto, K.,

Doke, N., Yashioka, H. (2007) Calcium-dependent protein kinase regulate the

production of reactive oxigen species by potatio NADPH oxidase. Plant Cell

19, 1065-1080

Kodama, Y., Wada, M. (2009) Simutanous visuallization of two protein complexes in

a single plant cell using multicolor fluorescence complementation analysis.

Plant Mol Biol 70, 211-217

Koiwa, H., Sato, F., Yamada, Y. (1994) Characterization of accumulation of tobacco

PR-5 proteins by IEF-immunoblot analysis. Plant Cell Physiol 35, 821-827

Komada, Y., Hu, C.D. (2012) Bimolecular fluorescence complementation (BIFC): A

5-year update and future perspectives. Biotechniques 53, 285-298.

Kononowicz, A.K., Nelson, D.E., Singh, N.K., Hasegawa, P.M., Bressan, R.A. (1992)

Regulation of the osmotin gene promoter. The Plant Cell 4, 513-524

Kotchoni, S.O., Kuhns, C., Ditzer, A., Kirch, H., Bartels, D. (2006) Over-expression

of difference aldehyde dehydrogeniase genes in Arabidopsis thaliana confers

tolerence to abiotic stress and protects plants against lipid peroxidation and

oxidative stress. Plant Cell Environ 29, 1033-1048

Kreslavski, V.D., Zorina, A.A., Los, D.A., Formina, I.R., Allakhverdiev, S.I. (2013)

Molecular mechanisms of stress resistance of photosynthetic mechinery. In:

Rout, G.R., Das, A.B. (eds) Molecular stress physiology of plants. Springer,

India, p 21-51

Kreye, C., Bouman, B.A.M., Reversat, G., Fernandez, L., Cruz, C.V., Elazegui, F.,

Faronilo, J.E., Llorca, L. (2009) Biotic and abiotic causes of yield failure in

tropical aerobic rice. Field Crop Res 112, 97-106

Kryshtafovych, A., Fidelis, K. (2009) Protein structure prediction and model quality

assessment. Drug Discov Today 14, 386-392

Kumar, S.A., Kumari, P.H., Kumar, G.S., Mohanalatha, C., Kishor, P.B.K. (2015)

Osmotin: a plant sentinel and a possible agonist of mammalian adiponectin.

Front Plant Sci 6, 163

Lafitte, H.R., Ismail, A., Bennett, J. (2004) Abiotic stress tolerance in rice for Asia:

progress and future. In: The 4th International Crop Science Congress,

Brisbane, Astralia, 2004. New directions for a diverse planet. p 1-17

Lafitte, R. (2002) Relationship between leaf relative water content during reproductive

stage water deficit and grain formation in rice. Field Crop Reseach 76, 165-

174

LaRosa, P.C., Chen, Z., Nelson, D.E., Singh, N.K., Hasegawa, P.M., Bressan, R.A.

(1992) Osmotin gene expression is posttranscriptionally regulated. Plant

Physiol 100, 409-415

Lee, L.Y., Fang, M.J., Kuang, L.Y., Gelvin, S.B. (2008) Vectors for multi-color

bimolecular fluorescence complementation to investigate protein-protein

interactions in living plant cells. Plant Methods 4

Lee, S.B., Kwon, H.B., Kwon, S.J., Park, S.C., Jeong, M.J., Han, S.E., Byun, M.O.,

Daniel, H. (2003) Accumulation of trehalose within transgenic chloroplasts

confers drought tolerance. Mol Breed 11, 1-13

252 Bibliography

Lehner, A., Chopera, D.R., Peters, S.W., Keller, F., Mundree, S.G., Thomson, J.A.,

Farrant, J.M. (2008) Protection mechanisms in the resurrection plant

Xerophyta viscosa: cloning. expression, characterisation and the role of

XvINO1, a gene coding for a myo-inositol 1-phosphate synthase. Funct Plant

Biol 35, 26-39

Liu, D., Narasimhan, M.L., Xu, Y., Raghothama, K.G. (1995) Fine structure and

function of the osmotin gene promoter. Plant Mol Biol 29, 1015-1026

Liu, D., Raghothama, K.G., Hasegawa, P.M., Bressan, R.A. (1994) Osmotin

overexpression in potato delays development of disease symtoms. Proc Natl

Acad Sci USA 91, 1888-1892

Liu, J.J., Sturrock, R. Ekramoddoullah, A.K.M. (2010) The superfamily of thaumatin-

like proteins: its origin, evolution, and expression towards biological function.

Plant Cell Rep 29, 419-436

Lobell, D.B., Burke, M.B., Tabaldi, C., Madtranfrea, M.B., Falcon, W.P., Naylor, R.L.

(2008) Prioritizing climate change adaptation needs for food security in 2030.

Science 139, 607-610

Londo, J.P., Chiang, Y., Hung, K., Chiang, T., Schaal, B.A. (2006) Phylogeography

of Asian wild rice, Oryza rufipogon, reveals multiple independent

domestications of cultivated rice, Oryza sativa. PNAS 103, 9578-9583

Lu, S.X., Hrabak, E.M. (2013) The myristoylated amino-terminus of an Arabidopsis

calcium-dependent protein kinase mediates plasma membrane localization.

Plant Mol Biol 82(3), 267-278

Lynch, J.P. (2013) Steep, cheap, and deep: an ideotype to optimize water and N

acquisition by maize root systems. Anna Bot 112, 347-357

Manavalan, L.P., Nguyen, H.T. (2012) Dought tolerance in crops: physiology to

genomics. In: Shabala S (ed) Plant stress physiology. CABI, Wallingford, UK,

p 1-23

Mani, T., Manjula, S. (2010) Cloning and characterization of two osmotin isoforms

from Peper colubrinum. Biologia Plantarum 54, 377-380

Mani, T., Sivakumar, K.C., Manjula, S. (2012) Expression and functional analysis of

two osmotin (PR5) isoforms with differential antifungal activity from Piper

colubrinum: prediction of structure-function relationship by bioinformatics

approach. Mol Biotechnol 52, 251-261

Manickavelu, A., Nadarajan, N., Ganesh, S.K., Gnanamalar, R.P., Babu, R.C. (2006)

Drought tolerance in rice: mophological and molecular genetic consideration.

Plant Growth Regul 50, 121-138

Mansour, M.M.F. (2013) Plasma membrane permiability as an indicator of salt

tolerance in plants. Biologia Plantarum 57(1), 1-10

Masutomi, Y., Takahashi, K., Hasegawa, H., Mutsuoka, Y. (2009) Impact essessment

of climate change on rice production in Asia in comprehensive consideration

of process/parameter uncertainty in general circulation models. Agric Ecosyst

Environ 131, 281-291

Mervine, S.M., Yost, E.A., Sabo, J.L., Hynes, T.R., Berlot, C.H. (2006) Analysis of G

protein beta gamma dimer formation in living cells using multicolor

Bibliography 253

bimolecular fluorescence complementation demonstrates preferences of beta1

for particular gamma subunits. Mol Pharmacol 70, 194-205

Miele, M., Costantini, S., Colonna, G. (2011) Structure and functional similarities

between osmotin from Nicotiana tabacum seeds and human adiponectin. PLoS

One 6(2), e16690

Min, K., Ha, S.C., Hasegawa, P.M., Bressan, R.A., Yun, D.J., Kim, K.K. (2004)

Crystal structure of osmotin, a plant antifungal protein. Proteins Struct Funct

Bioinforma 54, 170-173

Minitab 17 Statistical Software (2010). [Computer software]. State College, PA:

Minitab, Inc. (www.minitab.com)

Mirceva, G., Davcev, D. (2009) HMM based approach for classifying protein

structures. J Biosci Biotechnol 1, 37-46

Mishra, S., Kumar, S., Saha, B., Awasthi, J., Dey, M., Panda, S.K., Sahoo, L. (2016)

Crosstalk between salt, drought, and cold stress in plants: toward genetic

engineering for stress tolerance. In: Tuteja, N., Gill, S.S. (Eds.), Abiotic stress

response in plants. Wiley_VCH Verlag GmbH & Co. KGaA, pp. 55-86

Mittler, R. (2006) Abiotic stress, the field environment and stress combination. Trend

Plant Sci 11(1), 15-19

Mittler, R., Blumwald, E. (2010) Genetic engineering for modern agriculture:

challenges and perspectives. Annu Rev Plant Biol 61, 443-462

Mohanta, T.K., Sinha, A.K. (2016) Role of Calcium-dependent protein kinases during

abiotic stress tolerance. In: Tuteja N, Gill SS (eds) Abiotic stress response in

plants. First edition. Wiley-VCH Verlag GmbH & Co. KGaA, p 181-202

Mohanty, S., Wassmann, R., Nelson, A., Moya, P., Jagadish, S.V.K. (2013) Rice and

climate change: significance for food security and vulnarability. IRRI

Discussion Paper Series, Los Banos, philippines, 14 p

Moradi, F., Ismail, A. (2007) Response of photosynthesis, chlorophyll fluorescence

and ROS-Scavenging syntems to salt stress during seedling and reproductive

stages in rice. Ann Bot 99, 1161-1173

Mundree, S.G., Baker, B., Mowla, S., Peters, S., Marais, S., Willigen, C.V., Govender,

K., Maredza, A., Muyanga, S., Farrant, J.M., Thomson, J.A. (2002)

Physiological and molecular insights into drought tolerance. Afr J Biotechnol

1, 28-38.

Munns, R., Tester, M. (2008) Mechanism of salinity tolerance. Annu Rev Plant Biol

59, 651-681

Munro, S., Pelham, H.R.B. (1987) A C-terminal signal prevents secretion of luminal

ER proteins. Cell 48, 899-907

Nagarajan, S., Nagarajan, S. (2010) Abiotic tolerance and crop improvement. In:

Sopory, A., Bohnert, S., Govindjee, H. (Eds.), Abiotic stress adaptation in

plants: physiological, molecular, and genomic foundation. Springer Science,

pp. 1-11

Naheed, G., Shahbaz, M., Latif, C.A., Rha, E.S. (2007) Aliviation of the adverse

effects of salt stress on rice (Oryza sativa L) by phosphorus applied through

254 Bibliography

rooting medium: growth and gas exchange characteristics. Pak J Bot 39, 729-

737

Narasimhan, M.L., Coca, M.A., Jin, J.B., Yamochi, T., Ito, Y., Kadowaki, T., Kim,

K.K., Pardo, J.M., Damsz, B., Hasegawa, P.M., Yun, D.J., Bressan, R.A.

(2005) Osmotin is a homolog of mammalian adiponectin and controls

apoptosis in yeast through a homolog of memmalian adiponectin receptor. Mol

Cell 17, 611-621

Narasimhan, M.L., Damsz, B., Coca, M.A., Ibeas, J.I., Yun, D.J., Pardo, J.M.,

Hasegawa, P.M., Bressan, R.A. (2001) A plant defense response effector

induces microbial apoptosis. Mol Cell 8, 921-930

Naseer, M.I., Ullah, I., Narasimhan, M.L., Lee, H.Y., Bressan, R.A., Yoon, J.H., Yun

D.J., Kim, M.O. (2014) Neutro effect of osmotin against ethanol-induced

apoptotic neurodegredation in the developing rat brain. Cell Death Dis 5,

e1150

Negrao, S., Courtois, B., Ahmadi, N., Abreu, I., Saibo, N., Oliveira, M. (2011) Recent

updates on salinity stress in rice: from physiological to molecular responses.

Crit Rev Plant Sci 30, 329-377

Nelson, B.K., Cai, X., Nebenfuhr, A. (2007) A multicolared set of in vitro organelle

markers for co-localization studies in Arabidopsis and other plants. Plant J 51,

1126-1136

Nelson, D.E., Repetti, P.P., Adams, T.R., Creelman, R.A., Wu, J., Warner, D.C.,

Anstrom, D.C., Bensen, R.J., Castiglioni, P.P., Donnarummo, M.G., Hinchey,

B.S. (2007) Plant nuclear factor Y (NF-Y) B subunits confer drought tolerance

and lead to improved corn yields on water-limited acres. PNAS 104(42),

16450-5.

Newton, A.C., Johnson, S.N., Gregory, P.J. (2011) Implications of climate change for

diseases, crop yield and food security. Euphytica 197, 3-18

Ni, F., Chu, L., Shao, H., Liu, Z. (2009) Gene expression and regulation of higher

plants under soil water stress. Curr Genom 10, 269-280.

Nishimura, K., Ishikawa, S., Matsunami, E., Yamauchi, J., Homma, K., Faulkner, C.,

Oparka, K., Nagaya, T., Yokota, K., Nakagawa, T. (2015) New Gateway-

compatible vectors for a high throughput protein-protein interaction analysis

by a bimolecular fluorescence complementation (BIFC) assay in plants and

their application to a plant clathrin structure analysis. Biosci Biotechnol

Biochem 79, 1995-2006

Noori, S.A.S., Sokhansanj, A. (2008) Wheat plants containing an osmotin gene show

enhanced ability to produce roots at high NaCl concentration. Russ J Plant

Physiol 55, 256-258.

Oliver, M.J., (2014) Why we need GMO crops in agriculture. Mol Med 111(6), 492-

507

Oliver, S., Dongen, J.V., Alfred, S., Mamun, E., Zhao, X., Saini, H.S., Fernnaandes,

S.F., Blanchard, C.L., Sutton, B.G., Geigenberger, P., Dennis, E.S., Dolferus,

R. (2005) Cold-induced repression of the rice anther-specific cell all invertase

gene OSINV4 in correlated with sucrose accumulation and pollen sterility.

Plant Cell Environ 28, 1534-1551

Bibliography 255

Onishi, M., Tachi, H., Kojima, T., Shiraiwa, M., Takahara, H. (2006) Molecular

cloning and characterization of a novel salt-inducible gene encoding an acidic

isoform of PR-5 protein in soybean (Glycine max [L.] Merr.). Plant Physiol

Biochem 44, 574-580

O'Rourke, N.A., Meyer, T., Chandy, G. (2005) Protein localization studies in the age

of "omics". Curr Opin Chem Biol 9, 82-87

Pandey, S., Bhandari, H. (2007) Drought: an overview. In: Pandey, S., Bhandari, H.,

Hardy, B. (eds) Economic costs of drought and rice farmers' coping

mechanisms: a cross-country comparative analysis. International Rice

Research Institute, Los Banos (Philippine), p 11-30

Parkhi, V., Kumar, V., Sunikumar, G., Campbell, L.M., Singh, N.K., Rathore, K.S.

(2009) Expression of apoptically secreted tobacco osmotin in cotton confers

drought tolerance. Mol Breed 23, 625-639

Patade, V.Y., Khatri, D., Kumari, M., Grover, A., Gupta, S.M., Ahmed, Z. (2013) Cold

tolerance in osmotin transgenic tomato (Solanum lycopersicum L.) is

associated with modulation in transcrip abundance of stress responsive genes.

SpringerPlus 2, 117

Peng, S., Tang, Q., Zou, Y. (2009) Current status and challenges of rice production in

China. Plant Prod Sci 12(1), 3-8

Peters, S., Mundree, S.G., Thomson, J.A., Farrant, J.M., Keller, F. (2007) Protection

mechanisms in the resurrection plant Xerophyta viscosa (Baker): both sucrose

and raffinose family oligosacharides (RFOs) accumulate in leaves in response

to water deficit. J Exp Bot 58(8), 1947-1956

Petersen, J., Eriksson, S.K., Pierog, P., Colby, T., Bartels, D. (2012) The lysine-rich

motif of intrinsically disordered stress protein CDeT11-24 from Craterostgma

plantagineum is responsible for phosphatidic acid binding and protection of

enzymes from damaging effects caused by desiccation. J Exp Bot 63, 4919-

4929

Peyret, H., Lomonossoff, G.M. (2013) The pEAQ vector series: the easy and quick

way to produce recombinant proteins in plants. Plant Mol Biol 83, 51-58

Pierik, R., Testerink, C. (2014) The Art of being flexible: how to escape from shade,

salt, drought. Plant Physiol 166, 5-22

Plasnas-Iglesias, J., Marin-Lopez, M.A., Bonet, J., Garcia-Garcia, J., Oliva, B. (2013)

iLoops: a protein-protein interction prediction server based on structural

features. Bioinformatics 29, 2360-2362

Plaxton, W.C. (1996) The organisation and regulation of plants glycolysis. Annu Rev

Plant Physiol Plant Mol Biol 47, 185-214

Popescu, S.C., Popescu, G.V., Bachan, S., Zhang, Z., Gerstein, M., Snyder, M.,

Dinesh_Kumar, S.P. (2009) MAPK target networks in Arabidopsis thaliana

revealed using functional protein microarrays. Genes Dev 23, 80-92

Popescu, S.C., Popescu, G.V., Bachan, S., Zhang, Z., Seay, M., Gerstain, M., Snyder,

M., Dinesh-Kumar, S.P. (2007a) Differential binding of calmodulin-related

proteins to their targets revealed through high-density Arabidopsis protein

microarrays. PNAS 104, 4730-4735

256 Bibliography

Popescu, S.C., Snyder, M., Dinesh-Kumar, S.P. (2007b) Arabidopsis proteins

microarrays for the high-throughput identification of protein-protein

interactions. Plant Signal Behav 2(5), 416-420

Powell, N., Ji, X., Ravash, R., Edlington, J., Dolferus, R. (2012) Yield stability for

cereals in a changing climate. Funct Plant Biol 39, 539-552

Prasath, D., El-Sharkawy, L., Sherif, S., Tiwary, K.S., Jayasankar, S. (2011) Cloining

and characterization of PR5 gene from Curcuma amada and Zingiber officinale

in response to Ralstonia solanacearum infection. Plant Cell Rep 30, 1799-1809

Qin, F., Shinozaki, K., Yamaguchi-Shinozaki, K. (2011) Achievements and challenges

in understanding plant abiotic stress responses and tolerance. Plant Cell

Physiol 52, 9

Qureshi, M.I., Qadir, S., Zolla, L. (2007) Proteomics-based dissection of stress-

ressponsive pathway in plants. J Plant Physiol 164, 1239-1260

Rabbani, M.A., Maruyama, K.H.A. (2003) Monitoring expression profiles of rice

(Oryza sativa L.) genes under cold, drought and high-salinity stresses and ABA

application using both cDNA microarray and RNA gel blot analyses. Plant

Physiol 133, 1755-1767

Raghothama, K.G., Liu, D., Nelson, D.E., Hasegawa, P.M., Bressan, R.A. (1993)

Analysis of an osmotically regulated pathogenesis-related osmotin gene

promoter. Plant Mol Biol 23, 1117-1128

Rang, Z.W., Jagadish, S.V.K., Zhou, Q.M., Craufurd, P.Q., Heuer, S. (2011) Effect of

high temperature and water stress on pollen germination and spikelet fertility

in rice. Environ Exp Bot 70, 58-65

Rani, S.J., Usha, R. (2013) Transgenic plants: types, benefits, public concerns and

future. J Pharm Res 6, 879-883

Rao, V.S., Srinivas, K., Sujini, G.N., Kumar, G.N.S. (2014) Protein-protein interaction

detection: methods and analysis. Int J Proteomics 2014, e147648

Ray, D.K., Mueller, N.D., West, P.C., Foley, J.A. (2013) Yield trends are insufficient

to double global crop production by 2050. PloS One 8(6), e66428

Rodriguez, M.C.S., Edsgard, D., Hussain, S.S., Alquezar, D., Ramussen, M., Gilbert,

T., Nielson, B.H., Bartels, D., Mundy, J. (2010) Transcriptomes of the

desiccation-tolerant resurrection plant Craterostigma platagineum. Plant J 63,

212-228

Rohrig, H., Schmidt, J., Colby, T., Brautigam, A., Hufnage, P., Bartels, D. (2006)

Desiccation of the resurrection plant Craterostigma plantagium induces

dynamic changes in protein phosphorylation. Plant Cell Environ 29, 1606-

1617

Rooke, L., Byrne, D., Salgueiro, S. (2000) Marker gene expression driven by the maize

ubiquitin promoter in transgenic wheat. Ann Appl Biol 136, 167-172

Rosa, M., Prado, C., Podazza, G., Interdonato., R., Gonzalez, J.A., Hilal, M., Prado,

F.E.(2009) Soluble sugars-metabolism, sensing and abiotic stress. Plant Signal

Behav 4(5), 388-393

Bibliography 257

Roy, A., Kucukural, A., Zhang, Y. (2010) I-TASSER: a uniform platform for

automated protein structure and function prediction. Nature Protocols 5, 752-

738

Rubio, V., Shen, Y., Saijo, Y., Liu, Y., Gusmaroli, G., Danish-Kumar, S.P., Deng,

X.W. (2005) An alternative tandem affinity purification strategy applied to

Arabidopsis protein complex isolation. Plant J 41(5), 767-778

Sahoo, K.K., Tripathi, A.K., Pareek, A., Sopory, S.K., Singla-Pareek, S.L. (2011) An

improved protocol for efficient transformation and regeneration of diverse

indica rice cultivars. Plant Methods 7, 1-11

Sairam, R.K., Tyagi, A. (2004) Physiology and molecular biology of salinity stress

tolerance in plants. Curr Sci 86(3), 407-421

Sambrook, J., Russell, D. W. (2001) Molecular cloning: a laboratory manual (Vol.

2): CSHL press.

Sankar, P.D., Saleh, M.A.A.M., Selvaraj, C.I. (2011) Rice breeding for salt tolerance.

Res Biotechnol 2(2), 1-10

Sarieva, G.E., Kenzhebaeva, S.S., Lichtenthaler, H.K. (2010) Adaptation potential of

photosynthesis in wheat cultivars with a capability of leaf rooling under high

temparature conditions. Russ J Plant Physiol 57, 28-36.

Sato, F., Kitajima, S., Koyama, T., Yamada, Y. (1996) Ethyleene-induced gene

expression of Osmotin-like protein, a neutro isoform of tobacco PR-5, is

mediated by the AGCCGCC cis-sequence. Plant Cell Physiol 37, 249-255

Sato, F., Koiwa, H., Sakai, Y., Kato, N., Yamada, Y. (1995) Synthesis and secretion

of tobacco neutral PR-5 protein by transgenic tobacco and yeast. Biochem

Biophys Res Commun 211, 909-913

Satoh, S., Matsuda, K., Tamari, K. (1976) β-1,4-glucan occuring in homogenate of

Phaseolus aureus seedling: possible nascent stage of cellulose biosynthesis in

vivo. Plant Cell Physiol 17(6), 1243-1254

Schmidt, T., Haas, J., Cassarino, T.G., Schwede, T. (2009) Assessment of ligand

binding residue predictions in CASP9. Proteins 77, 138-146

Schouten, A., Roosien, J., Engelen, F.A., Jong, G.A.M., Borst-Vressen, A.W.M.,

Zilverentant, J.F., Bosch, D., Stiekema, W.J., Gommers, F.J., Schots, A.,

Bakker, J. (1996) The C-terminal KDEL sequence increases the expression

level of a single-chain antibody designed to be targeted to both the cytosol and

the secretory pathway in transgenic tobacco. Plant Mol Biol 30, 181-193

Schultz, J., Milpetz, F., Bork, P., Ponting, C.P. (1998) SMART, a simple modular

architecture research tool: identification of signaling domains. Proc Natl Acad

Sci 95(11), 5857-5864. Available at http://smart.embl-heidelberg.de (accessed

on 22 August 2013)

Shabala, S., Munns, R. (2012) Salinity stress: Physiological constraints and adaptive

mechanisms. In: Shabala, S. (ed) Plant stress physiology. CABI, Wallingford,

UK, p 59-93

Shah, S.A., Lee, H.Y., Bressan, R.A., Yun, D.J., Kim, M.O. (2014) Novel osmotin

attenuates glutamate-induced synaptic dusfunction and neutrodegeneration

http://smart.embl-heidelberg.de/

258 Bibliography

via the JNK/PI3K/Akt pathway in postnatal rat brain. Cell Death Dis 5,

e1026

Shahbaz, M., Ashraf, M. (2013) Improving salinity tolerance in cereals. Crit Rev Plant

Sci 32, 237-249

Sherman, B.T., Huang, D.W., Tan, Q., Guo, Y., Bour, S., Liu, D., Stephens, R.,

Baseler, M.W., Lane, H.C., Lempicki, R.A. (2007) DAVID knowleddgebase:

a gene-centered database integrating heterogeneous gene annotation resourses

to facilitate high-throughput gene functional analysis. BMC Bioinformatics 8,

426

Shetty, K. (2004) Role of proline-linked pentose phosphate pathway in biosynthesis of

plant phenolics for functional food and environmental applications: a review.

Process Biochem 39, 789-803

Shi, J., Habben, J.E., Archibald, R.L., Drummond, B.J., Chamberlin, M.A., Williams,

R.W., Lafitte, H.R., Weers, B.P. (2015) Overexpression of ARGOS Genes

Modifies Plant Sensitivity to Ethylene, Leading to Improved Drought

Tolerance in Both Arabidopsis and Maize. Plant Physiol 169, 266-282.

Shi, J., Gao, H., Wang, H., Lafitte, H.R., Archibald, R.L., Yang, M., Hakimi, S.M.,

Mo, H., Habben, J.E. (2017) ARGOS8 variants generated by CRISPR-Cas9

improve maize grain yield under field drought stress conditions. Plant

Biotechnol J 15(2), 207-216.

Shinozaki, K., Yamaguchi-Shinozaki, K. (2007) Gene networks involved in drought

stress response and tolerance. J Exp Bot 58, 221-227

Shylaraj, K.S., Sasidharan, N.K. (2005) VTL5: A high yielding salinity tolerant rice

variety for the coastal saline ecosystems of Kerala. J Trop Agr 42, 25-28

Singh, A.K., Ansari, M.W., Pareek, A., Singla-Pareek, S.L. (2013) Raising salinity

toleranct rice: recent progress and future perspectives. Physiol Mol Biol Plant

14(1&2), 137-154

Singh, N.K., Bracker, C.A., Hasegawa, P.M., Handa, A.K., Buckel, S., Hermodson,

M.A., Pfankoch, E., Regnier, F.E., Bressan, R.A. (1987) Characterization of

osmotin. Plant Physiol 85, 529-536

Singh, N.K., Handa, A.K., Hasegawa, P.M., Bressan, R.A. (1985) Proteins associated

with adaptation of cultured tobacco cells to NaCl. Plant Physiol 79, 126-137

Singh, N.K., Nelson, D.E., Hasegawa, P.M., Bressan, R.A. (1989) Molecular cloning

of osmotin and regulation of its expression by ABA and adaptation to low

water potential. Plant Physiol 90, 1096-1101

Singh, R.K., Redona, E., Refuerzo, L. (2010) Varietal improvement for abiotic stress

tolerance in crop plants: special reference to salinity in rice. In: Pareek, A.,

Sopory, S.K., Bohnert, H.J., Govindjee (Eds.), Abiotic Stress Adaptation in

Plant: Physiology, Molecular and Genomic Foundation. Spring Science+

Business media B. V., pp. 387-415

Sinha, A.K., Jaggi, M., Tuteja, N. (2011) Mitogen-activated protein kinase signaling

in plants under abiotic stress. Plant Signal Behav 6(2), 196-203

Steinhorst, L., Kudla, J. (2013) Calcium and reactive oxygen species rule the waves of

signalling. Plant Physiol 163, 471-485

Bibliography 259

Storey, J. (2002) A direct approach to false didcovery rates. J R Stat Soc 64, 479-498

Subramannyan, K., Arun, M., Mariashibu, T.S., Theboral, J., Rajesh, M., Singh, N.K.,

Manickavasagam, M., Ganaphat, I.A. (2012) Overexpression of tobacco

osmotin (tbosm) in soybean conferred resistance to salinity stress and fungal

infections. Planta 236, 1909-1925

Subramanyam, K., Sailaja, K.V., Subramanyam, K., Roa, D.M., Lakshmidevi, K.

(2011) Ectopic expression of an osmotin gene leads to enhanced salt tolerance

in transgenic chilli pepper (Capsicum annum L.). Plant Cell Tiss Organ Cult

105, 181-192

Supek, F., Bosnjck, M., Skunca, N., Smuc, T. (2011) REVIGO summarizes and

visuallizes long lists of gene ontology terms. Plos One 6(7), e21800

Sutandy, F.X.R., Qian, J., Chen, C.S., Zhu, H. (2013) Overview of protein

microarrays. Curr Protoc Protein Sci 27, 27.21.21-27.21.16

Swamy, B.P.M., Kumar, A. (2013) Genomics-based precision breeding approaches to

improve drought tolerance in rice. Biotechnol Adv 31, 1308-1318

Swindell, W. R. (2006) The association among gene expression responses to nine

abiotic stress treatments in Arabidopsis thaliana. Genetics 174, 1811-1824.

Tan, S., Tan, H.T., Chung, M.C.M. (2008) Membrane proteins and membrane

proteomics. Proteomics 8, 3924-3932

Tester, M., Langridge, P. (2010) Breeding technologies to increase crop production in

a changing world. Science 327, 818-822

Thomson, D., Henry, R. (1995) Single-step protocol for preparation of plant tissues

for analysis by PCR. Biotechniques 19(3), 394-397

Tommaso, P.D., Moretti, S., Xenarios, L., Orobitg, M., Montanyola, A., Chang, J.M.,

Taly, J.F., Notredame, C. (2011) T-Coffee: a web server for the multipe sequence

alignment of protein and RNA sequences using structural information and

homology extension. Nucleic Acids Res 39, W13-W17. Available at

http://www.ebi.ac.uk/Tools/msa/tcoffee/ (accessed on 23-24 August 2013)

Tripathi, A.K., Pareek, A., Sopory, S.K., Singla-Pareek, S.L. (2012) Narrowing down

the targets for yield improvement in rice under normal and abiotic stress

conditions via expression profiling of yield-related genes. Rice 5, 37

Trivedi, V.R., Choravala, M.R., Shah, G.B. (2012) Osmotin: a new adiponectin

agonist, in type II diabetes and obesity. Int J Pharm Sci Rev Res 16(1), 70-74

Tsutsumi, K., Jujioka, Y., Tsuda, M., Kawaguchi, K., Ohba, W. (2009) Visualization

of Ras-PI3K interaction in the endosome using BiFC. Cell Signal 21, 1672-

1679.

Tzfira, T., Citovsky, V. (2006) Agrobacterium-mediated genetic transformation of

plants: biology and biotechnology. Curr Opin Biotechnol 17, 147-154

Tzou, Y.M., Huang, T.S., Huggins, K.W., Chin, B.A., Sonne, A.H., Singh, N.K.

(2011) Expression of truncated tobacco osmotin in Eschirichia coli:

purification and antifungal activity. Biochehnol Lett 33, 539-543

Viktorova, J., Krasny, L., Kamlar, M., Novakova, M., Mackova, M., Macek, T. (2012)

Osmotin, a pathogenenis-related protein. Curr Protein Pept Sci 13, 672-681

http://www.ebi.ac.uk/Tools/msa/tcoffee/

260 Bibliography

Wandelt, C.I., Khan, M.R.I., Craig, S., Schroeder, H.E., Spencer, D., Higgins, T.J.V.

(1992) Vicilin with carboxy-terminal KDEL is retained in the endoplasmic

reticulum and accumulate to high levels in the leaves of transgenic plants. Plant

J 2, 181-192

Wang, Y., Frei, M. (2011) Stressed food - the impact of abiotic environmental stresses

on crop quality. Agric Ecosyst Environ 141, 271-286

Wani, S.H., Sah, S.K. (2014) Biotechnology and abiotic stress tolerance in rice. J Rice

Res 2, e105

Wass, M.N., Kelley, L.A., Sternberg, M.J.E. (2010) 3DLigandSite: predicting ligand-

binding sites using similar structures. Nucleic Acids Res 38, 469-473

Weber, R.L.M., Wiebke-Strohm, B., Bredemeier, C., Margis-Pinheiro, M., Brito,

G.G., Rechenmacher, C., Bertagnolli, P.F., Sa, M.E.L., Campo, M.A.,

Amorim, R.M.S., Beneventi, M.A., Margis, R., Grossi-de-Sa, M.F., Bodanese-

Zanettini, M.H. (2014) Expression of an osmotin-like protein from Solanum

nigrum confers drought tolerance in transgenic soybean. BMC Plant Biol 14,

343

Whithaker, A., Bochicchio, A., Vassana, C., Lindsey, G., Farrant, J. (2001) Changes

in leaf hexakinase activity and motebolic levels in response to drying in the

desiscation tolerant species Sporopolus stapfianus and Xerophyta viscosa. J

Exp Bot 52,10.1093

Williams, B., Njaci, I., Moghaddam, L., Long, H., Dickman, M.B., Zhang, X.,

Mundree, S.G., (2015) Trehalose accumulation triggers autophagy during plant

desiccation. PLoS Genet 11, e1005705

Wu, J., Mao, X., Cai, T., Luo, J., Wei, L. (2006) KOBAS server: a web-based platform

for automated annotation and pathway identification. Nucleic Acids Res 34,

W20-24

Wurzinger, B., Mair, A., Pfister, B., Teige, M. (2011) Cross-talk of calcium-dependent

protein kinase and Map kinase signalling. Plant Signal Behav 6(1), 8-12

Xie, C., Mao, X., Huang, J., Ding, Y., Wu, J., Dong, S., Kong, L., Gao, G., Li, C., Wei,

L. (2011) KOBAS 2.0: a web server for annotation and identification of

enriched pathways and diseases. Nucleic Acids Res 39, W316-322

Xiong, L., Zhu, J.K. (2002) Molecular and genetic aspects of plant responses to

osmotic stress. Plant Cell Environ 25, 131-139

Xue, Y., Zhou, F., Fu, C., Xu, Y., Yao, X. (2006) SUMOsp: a web server for

sumoylation site predition. Nucleic Acids Res 1(34), W254-7. Available at

http://sumop.biocuckoo.org (accessed on 25 August 2013)

Xue, Y., Zhou, F., Zhu, M., Ahmed, K., Chen, G., Yao, X. (2005) GPS: a

comprehensive www server for phosphorylation sites prediction. Nucleic Acids

Res 33, W184-W187. Available at http://fps.biocuckoo.oeg/online.php

(accessed on 26 August 2013)

Yang, J., Yan, R., Xu, D., Poisson, J., Zhang, Y. (2015) The I-TASSER Suit: protein

structure and function prediction. Nature Methods 12, 7-8

http://sumop.biocuckoo.org/

http://fps.biocuckoo.oeg/online.php

Bibliography 261

Yen, H., Edward, G., Grimes, H. (1994) Characterization of salt-responsive 24-

kilodaton glycoprotein in Mesembryanthemum crystallinum. Plant Physiol

105, 1179-1187

Yun, D.J., Ibeas, J.I., Lee, H., Coca, M.A., Narasimhan, M.L., Uesono, Y., Hasegawa,

P.M., Pardo, J.M., Bressan, R.A. (1998) Osmotin, a plant antifulgal protein,

subverts signal transduction to enhance fungal cell susceptibility. Mol Cell 1,

807-817

Yun, D.J., Zhao, Y., Pardo, J.M., Narasimhan, M.L., Damsz, B., Lee, H. (1997) Stress

proteins on the yeast cell surface determine resistance to osmotin, a plant

antifulgal protein. Proc Natl Acad Sci USA 94, 7082-7087

Zhang, Q., Chen, Q., Wang, S., Hong, Y., Wang, Z. (2014) Rice and cold stress:

methods for its evaluation and summary of cold tolerance-related quantitative

loci. Rice 7, 24

Zhang, Y. (2008) I-TASSER server for protein 3D structure predition. BMC

Bioinformatics 9, 40

Zhang, Y. (2009) Protein structure prediction: when is it useful? Curr Opin Struct Biol

19, 145-155

Zhang, Y., Shih, D.S. (2007) Isolation of an osmotin-like protein gene from strawberry

and analysis of the response of this gene to abiotic stresses. J Plant Physiol

184, 68-77

Zhou-Da, X., Rui-Lian, J., Qiang, G., Hai-Pan, Z., Xue-Hui, X., Hei, L., Tai-Gaing,

L., Guo-Zhen, L. (2008) Drought-tolerant gene screening in wheat using rice

microarray. Chinese J Agric Biotechnol 5, 43-48

Zhu, B., Chen, T.H.H., Li, P.H. (1995) Activation of two osmotin-like protein genes

by abiotic stimuli and fungal pathogene in transgenic potato plants. Plant

Physiol 108, 929-937

Zhu, J.K. (2016) Abiotic stress signalling and responses in plants. Cell 167, 313-324

Zhu, S., Yu, X., Wang, X., Zhao, R., Li, Y., Fan, R., Shang, Y., Du, S., Wang, X., Du,

S., Xu, Y., Zhang X., Zhang, D. (2007) Two Calsium-dependent protein

kinase, CPK4 and CPK11, regulate abscisic acid signal transduction in

Arabidopsis. The Plant Cell 19, 3019-3036

Ziemienovicz, A. (2014) Agrobacterium-mediated plant transformation: factors,

applications and recent advances. Biocatal Biotechnol 3, 95-102

Zuraida, A.R., Rahiniza, K., Zulkifli, A.S., Alizah, Z., Zamri, Z., Aziz, A. (2013)

Hygromycin as selective marker in Agrobacterium-mediated genetic

transformation of indica rice MR 219. J Trop Agric Fd Sci 41, 71-79

MOLECULAR AND FUNCTIONAL CHARACTERISATION OF AN … Thuy Trang_Le... · 2018-01-30 · Molecular...

Documents

Transcript of MOLECULAR AND FUNCTIONAL CHARACTERISATION OF AN … Thuy Trang_Le... · 2018-01-30 · Molecular...