Molecular Analysis of Monogenoidean Parasites in some...

Molecular Analysis of Monogenoidean Parasites in some Cyprinids

A THESIS SUBMITTED TO

UNIVERSITY OF LUCKNOW

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

ZOOLOGY

BY RITIKA RAJ SHRIVASTAVA M.Sc.

Department of Zoology University of Lucknow

Lucknow-226007 2013

CERTIFICATE

This is certified that RITIKA RAJ

SHRIVASTAVA has worked under my supervision and

guidance for the award of the degree of DOCTOR OF

PHILOSOPHY IN ZOOLOGY. The work incorporated

in the thesis entitled “MOLECULAR ANALYSIS OF

MONOGENOIDEAN PARASITES IN SOME

CYPRINIDS” has been carried out in the

DEPARTMENT OF ZOOLOGY, UNIVERSITY OF

LUCKNOW, LUCKNOW.

Prof. Madhu Tripathi Prof. Nirupama Agrawal Head Supervisor Department of Zoology, Department of Zoology, University of Lucknow, University of Lucknow, Lucknow Lucknow

CONTENTS

Acknowledgements

Introduction 1-3

A Brief History of Work Done 4-5

Materials and Methods 6-15

Chapter –I Dactylogyrus Deising, 1850 16-41

1. D. longiacus Gusev, 1976 2. D. subtilis Gusev, 1976 3. D. sp.1 4. D. sp.2 5. D. sp.3 6. D. sp.4 7. D. sp.5 8. Molecular Phylogenetics

Chapter –II Dactylogyroides Gusev, 1976 42-63

1. D. tripathii (Tripathi, 1959) Gusev, 1963 2. D. longicirrus (Tripathi, 1959) Gusev, 1976 3. D. mahecoli (Gusev, 1976) Agrawal et al., 2002 4. D. dorsali (Gusev, 1976) Agrawal et al., 2002 5. Molecular Phylogenetics

Chapter-III Esomocleidus n. g. 64-86

1. E. esomi (Gusev, 1963) n. comb. 2. E. chakrabartii (Gusev, 1976) n. comb.

3. E. lucknowensis n. sp.

4. Molecular Phylogenetics

CHAPTER- IV Molecular analysis of 14 Dactylogyrids,

included in Chapters I, II and III 87-96

References 97-111

Summary 112-118

Acknowledgements

A research work not only involves coordinated and guided

job between a scholar and the guide, but it is also a result of

teamwork where many backstage persons play vital roles. Likewise,

my research work too carries a strong guidance, support, coordination

and untiring efforts from all concerned persons of my life.

First and foremost, I express my deepest and sincere thanks

and gratitude towards my supervisor and mentor Prof. Nirupama

Agrawal, Former Head, Department of Zoology, University of

Lucknow, a hardworking and dedicated lady and a tough task master

with a humane heart. She not only took pains in facilitating and

monitoring my research work but also keen interest in research work

and allowed me to go through her laboratory and rich personal

library. She provided the much needed constant guidance,

constructive criticism towards improving my work and developing a

broader perspective to my thesis.

I gratefully acknowledge the help received from Prof. K.C.

Pandey of the Department of Zoology, University of Lucknow and

Prof. G.G. Agarwal, Department of Statistics, University of

Lucknow, during the course of my research work.

Laboratory facilities provided by Head Department of

Zoology,University of Lucknow are also acknowledged. Further,

help received from Dr. Monisha Banerjee of the Department of

Zoology, her students and Dr. A.M. Saxena is also acknowledged.

I also undertake the opportunity to express my thanks to

Dr. M.K. Upadhyay, Scientist 'C', Biotech Park, Lucknow, for

helping in 1analysis part of my research and to Mr. L.K. Gupta, a

friend of mine, working at Zydus Cadila Healthcare, for lending his

scientific and technical support.

Thanks are also due to my labmates Saroj Rajvanshi, Amrin

Ali and Shailendra Ray and seniors Dr. Amita Devak, Dr. Priyanka

Tripathi, Dr. B.K.Gupta and Dr. K.K. Singh.

Words will fail to show my gratitude for overwhelming

response, utmost care, moral support and pains, taken by my family

members including my mother, father, brother, uncles, aunts, my

relatives, my in-laws, my friends, hostel inmates who stood beside me

all these years.

My husband Mr. Abhishek Sinha, Judge, U.P. Judicial

Services gave me much needed space and time and stood steadfastly

with me through thick and thin during the last phase of my work.

For this, I will remain obliged to him ever.

INTRODUCTION

The Cypriniformes is an order of teleosts and includes carps,

minnows and loaches (about 4000 species). Furthermore, thousands of

species of freshwater fishes still remain to be described, most of them in

tropics (Lundberg et al., 2000). They are distributed throughout Africa

(except Madagascar), Asia, Europe and North America. They are the

most diverse in Asia, but are entirely absent from Australia and South

America. India is one of the mega biodiversity countries in the world and

occupies ninth position in terms of freshwater mega biodiversity. In India

itself there are 2,500 species of fishes of which 930 are freshwater.

Cypriniformes is of considerable economic significance in India.

Fish represents a major group of organisms serving as hosts for

many adult platyhelminth parasites (Sukontason et al., 1999; Wongsawad

et al., 2004; Kue–A-Pai and Wiwanikit., 2005). The Monogenoidea is one

of the largest groups of parasitic flatworms (Platyhelminthes), possessing

simplest life cycle among parasitic Platyhelminthes. They have no

intermediate hosts and are mainly found on skin or gills of fishes

(Bychowsky, 1957; Malmberg and Fernholm, 1989). They are obligate

parasites of aquatic and semi-aquatic organisms (Bychowsky, 1957).

They attach to hosts using hooks, anchors, clamps and a variety of other

specialized structures. Most species are oviparous but a few are

viviparous.

In recent times, molecular techniques (that utilize genetic markers

in nuclear and mitochondria DNA) are used in taxonomy and

phylogenetics of species and have emerged as valuable supplementary

tools in providing authentic and unambiguous identification of taxa. The

gene segment of eukaryotic rDNA contains highly conserved, 18S, 5.8S,

1

and 28S tracts and forms a tandem repetitive cluster to highly variable,

transcribed and non-transcribed or intergenic spacer regions. rDNA is

used to resolve taxonomic issues of helminth parasites (Powers et al.,

1997; Gasser and Newton, 2000; Winchell et al., 1999, 2001, 2002, 2004;

Lockyer et al., 2003 and Andrea et al., 2007). Advantage of using this

region is that the tandem repeated copies provide a large number of target

sequences for PCR amplification (Jousson et al., 1998). Since it is easy to

amplify them even from small quantities of DNA, and because of having

a high degree of variation between closely related species, these markers

are extensively used for taxonomic studies (Hancock et al., 2001). There

is increasing evidence that the 28S rDNA gene sequences add useful and

often significant resolution to molecular systematic estimates of

phylogeny, particularly for older, deep branching lineages. 28S rDNA

markers have been used to detect species boundaries (Kaukas and

Rollinson, 1997).

The present work investigates the morphology of monogenoidean

parasites found on few commonly available cypriniformes fishes and also

the molecular phylogeny of these parasites using 28S rDNA. Species

belonging to two genera were examined for the monogenoidean infection

i.e. Puntius Hamilton, 1882 and Esomus Swainson, 1839, which are

popular larvivorous fish to the consumers of North-India, Eastern India

and North-East as well. They are small fishes, can easily be maintained

the laboratory aquaria for a long period. Their habitat is rivers, streams,

and ponds in plains and submontane regions. They are used in fish

aquarium trade. They are highly valuable source of macro and

micronutrients that play an important role to provide essential nutrients

for the people. Vitamins and minerals are found to be much more in small

fishes than in large fish. Esomus are rich in iron and calcium respectively.

2

The thesis has been divided in four chapters. Chapter I includes

record of seven species of Dactylogyrus and its molecular phylogenetics.

Chaptor II has record of four species of Dactylogyroides and molecular

phylogenetic study whereas Chaptor III consists of study of three species

of the newly proposed genus Esomocleidus n.g. and their molecular

phylogeny. Finally in Chapter IV combined molecular analysis of all the

14 species included in Chapter I, II, and III is summarized. Five species

of the genus Dactylogyrus included in Chapter I have been given

numbers 1-5 because they are part of an unpublished data of one of my

senior lab mates. Sequence of Dactylogyroides longicirrus is from

GENBANK. The Molecular analysis of these monogenoideans was a

daunting task, as very closely related species occur on the same hosts. To

further strengthen the identification with this useful tool, my Ph.D.

supervisor Prof. Nirupama Agrawal of the Department of Zoology,

therefore, suggested me to undertake the work “Molecular Analysis of

Monogenoidean Parasites in some Cyprinids”.

3

A BRIEF HISTORY OF WORK DONE

Our knowledge of molecular biology of monogenoideans is

currently lagging behind to that of other groups of helminthes. This group

has number of interesting characteristics making them suitable models for

molecular study. In early nineties, with innovation of molecular markers,

the genetic characterization of monogenoideans started. Partial small

subunit (SSU) ribosomal RNA (rRNA) genes of Dictyocotyle coeliaca,

Diclidophora merlangi and Anaplodiscus cirrusspiralis were first

determined by Baverstock et al. (1991) and their sequences were

subsequently used in phylogenetic analysis of numerous platyhelminths.

This work now encompasses a wide range of techniques and target

regions of the genome. Molecular investigation of monogenoideans

began with the PCR amplification of 18S rRNA gene of Gyrodactylus

salaris. Its sequence was used to examine the phylogenetic relationship of

this species with other platyhelminths (Cunningham et al., 1995).

The valuable contributions in this field from abroad are those of

Cunningham (1997), Littlewood et al. (1998), Jousson et al. (1998),

Cable et al. (1999), Zardoya and Doadrio (1999), Zardoya et al. (1999a &

b), Winchell et al. (1999, 2001, 2002, 2004), Gasser and Newton (2000),

Mollaret et al. (2000), Bentz et al. (2001), Bruno et al. (2001), Desdevises

(2001, 2002), Sicard et al. (2001), Chisholm et al. (2001), Matejusova et

al. (2001a & b, 2004), Verneau et al. (2002), Lockyer et al. (2003),

Simkova et al. (2002, 2003, 2004, 2006), Zietara and Lumme (2003),

Matejusova and Cunningham (2004), Whittington et al. (2004), ,

Waeschenbach et al. (2007), Andrea et al. (2007), Wu et al. (2007),

Mendlova et al. (2010, 2012), Poisot et al. (2011), Hahn et al. (2011).

Indian workers are Tandon (2007), Singh and Chaudhary (2010, 2011),

Chaudhary and Singh (2012a, b, c & d),Verma et al. (2012), Chaudhary

4

et al. (2013), Chiary et al. (2013), Rajvanshi and Agrawal (2013) and

Agrawal and Ali (2013).

Identification of monogenoideans was done using “An

Encyclopaedia of Indian Monogenoidea” (Pandey & Agrawal, 2008),

which includes taxonomical work done till 2008. Later contributions are

those of Agrawal et al. (2008), Tripathi et al. (2009a & b, 2012), Agrawal

et al. (2010a & b), Saxena et al. (2010), Upadhyay et al. (2011), Ali et al.

(2012), Rajvanshi and Agrawal (2011, 2012) and Porwal et al. (2012).

5

MATERIALS AND METHODS

Collection of parasites

Fish were collected from different sites of U.P., India (Table 1) with

the help of local fishermen, transferred to laboratory and maintained in

small glass aquaria. They were dissected as per requirement. Parasites

were gently scrapped from the gills and then transferred to small droplets

of water onto slides, flattened under clean coverslips and examined under

a phase contrast microscope (Olympus CX 41 U-DA 4E 03365 Japan).

Some specimens were mounted unstained in glycerin by sealing the

margins with a nail enamel (semi-permanent slides). Permanent

preparations were also made, stained with Aceto-alum carmine and

Gomori’s Trichrome, dehydrated in ascending grades of alcohol of 70%,

90% and 100%, and mounted in Canada Balsam.

Drawings were made from live, semi permanent as well as

permanent preparations, using a drawing tube attached to phase contrast

microscope. Measurements (in micrometers) were made using a

calibrated micrometer.

The taxonomy of monogenoideans follows “An Encyclopaedia of

Indian Monogenoidea” (Pandey & Agrawal, 2008) and those of fish

follow “Fishbase” (Froese and Pauly, 2007). A list of parasites recovered

from their respective hosts and accession numbers of sequences (analyzed

in present study and retrieved from NCBI) is included in Table 2.

DNA Isolation and Amplification

Identified specimens of monogenoidean were fixed in either 95 or 100%

ethanol for extraction of genomic DNA. The genomic DNA was isolated

6

by using DNeasy Tissue Kit, Qiagen, Hilden, Germany (procedure given

in flow chart).

Flow Chart for DNA Extraction Tissue + 200µl ATL Buffer

↓ Add 20 µl Proteinase K,

Mix thoroughly by vortexing (Incubate 20 min at 56º C)

↓ Add 200 µl AL Buffer,

Mix thoroughly by vortexing ↓

Add 200 µl Ethanol, Mix thoroughly by vortexing

↓ Pipet the mixture into spin coloum placed in a 2ml collection tube,

Centrifuge at 8000 rpm for 1 min ↓

Discard flow-through and collection tube ↓

Place the column in a new 2ml collection tube ↓

Add 500µl AW1 Buffer, Centrifuge at 8000rpm for 1 min

↓ Discard flow-through and collection tube

↓ Place the column in a new 2ml collection tub

↓ Add 500µl AW2 Buffer,

Centrifuge at 14000rpm for 1 min ↓

Discard flow-through and collection tube ↓

Place the column in a new 2ml microcentrifuge tube ↓

Pipet 80 µl AE Buffer directly onto the membrane ↓

Incubate at room temperature for 1 min, Centrifuge for 1 min at 8000 rpm to elute (store at -20°C)

7

DNA amplification

The 28S rDNA region was amplified with the universal primers.

Sequences of the primer both reverse and forward are as follows:-

Forward- 5’ ACCCGCTGAATTTAAGCAT 3’

Reverse- 5’ CTCTTCAGAGTACTTTTCAAC 3’

Fig. 1 :- rDNA showing regions of 18S, ITS and 28S

(Source: Current Biology)

8

Composition of reaction mixture for PCR

Each amplification reaction was performed in a final volume of 25 ml

containing:

Components Quantity

1 Taq buffer 2.5 µl

2 DNTPs 1 µl

3 Forward 1 µl

4 Reverse 1 µl

5 Taq polymerase 0.5 µl

6 MgCl2 1 µl

7 Genomic DNA 5 µl

8 MilliQ 13 µl

Steps and conditions for PCR

S.No. Step Temperature Time

1 Initial Denaturation 95º 5min X 1 Cycle

2 Denaturation 95 º 30sec 35

X cycle 3 Annealing 55 º 40 sec

4 Extension 72 º 30 sec

5 Final Extension 72 º 7min X 1 Cycle

6 Hold 4 º

PCR products were examined on 1.5% Agarose–TAE gels, stained

with Ethidium Bromide and visualized in Gel Doc. Gel pictures are given

in the following pages (Fig. A-F).

9

Fig A-F: Gel Pictures

PCR Products of Monogenoidean Parasites

M= DNA Marker (100 bp ladder)

M 1 2 3 1 M 2 3 4 5

Fig. A- Lane 1 Dactylogyrus longiacus Fig. B- Lane 1 Dactylogyrus sp. 1

Lane 3 Dactylogyrus subtilis Lane 5 Dactylogyrus sp. 2

M 1 2 3 4 1 M 2 3

Fig C- Lane 4 Dactylogyrus sp. 4 Fig D- Lane 1 Dactylogyrus sp.5

Lane 3 Dactylogyrus sp.3

10

1 2 3 4 M 5 6 1 2 M 3 4 5

Fig. E- Lane 1 Dactylogyroides tripathii Fig. F- Lane 1 Esomocleiodus esomi

Lane 4 Dactylogyroides dorsali Lane 3 Esomocleiodus chakrabarthi

Lane 6 Dactylogyroides mahecoli Lane 5 Esomocleiodus lucknowensis

11

Sequencing of Purified DNA

Amplified products were purified by a PCR clean up kit and

sequenced by Xcelris Labs Limited, Ahemadabad. The concentration of

the purified DNA was determined and was subjected to automated DNA

sequencing on ABI3730xl Genetic Analyzer (Applied Biosystems, USA).

Sequencing was carried out using BigDye® Terminator v3.1 Cycle

sequencing kit.

Cycle Sequencing

Cycle sequencing was performed following the instructions

supplied along with BigDye® Terminator v3.1 Cycle Sequencing Kit.

The reaction was carried out in a final reaction volume of 20µl having

10ng of PCR product with ABI ready reaction mix and sequencing buffer

and carried out in thin wall PCR tube. The cycling protocol was designed

for 25 cycles with the thermal ramp rate of 1ºC per second. After the

cycling, the extension products were purified and mixed well in 10 µl of

Hi-Di formamide. The contents were mixed on shaker for 30 minutes at

300 g. Eluted PCR products were placed in a sample plate and covered

with the septa. Sample plate was heated at 95ºC for 5 min, snap chilled

and loaded into autosampler of the instrument.

Sequence Analysis For sequence analysis various bioinformatics tools detailed below

were used. All obtained 13 sequences were submitted in GENBANK.

BLAST (Basic Local Alignment SearchTool)

BLAST is one of the most widely used bioinformatics programs

because it addresses a fundamental problem and the heuristic algorithm it

12

uses is much faster than calculating an optimal alignment. BLAST, is

an algorithm for comparing primary biological sequence information. A

BLAST search enables to compare a query sequence with database of

sequences. Different types of BLASTs are available according to the

query sequences. BLAST program was designed by Altschul et al., 1990.

CLUSTAL W

Clustal is a widely used multiple sequence alignment computer

program. Clustal W (Chenna, 2003) is a general purpose multiple

sequence alignment program for DNA or proteins.It produces

biologically meaningful multiple sequence alignments of divergent

sequences. It calculates the best match for the selected sequences, and

lines them up so that the identities, similarities and differences can be

seen.

MEGA 5

MEGA, Molecular Evolutionary Genetics Analysis, is used for

making dendrograms, or phylogenetic trees using nucleotide or protein

sequences. It is developed by Tamura et al., 2011. MEGA is an integrated

tool for conducting sequence alignment, inferring phylogenetic trees,

mining web-based databases, estimating rates of molecular evolution,

inferring ancestral sequences, and testing evolutionary hypotheses.

13

Table 1:- Collection sites of different fish hosts

S.N. Collection Site Geographical Coordinates

1. Lucknow 26.85° N, 80.92° E

2. Sitapur 27.57° N, 80.68° E

3. Sultanpur 26.27° N, 82.07° E

4. Barabanki 27°.92° N, 80.20° E

5. Pilibhit 28.55° N, 80.10° E

6. Tanakpur 29.08° N, 80.11° E

7. Unnao 26.53° N, 80.50° E

14

Table 2:- List of hosts, parasites, sequence length (bp) and their

accession number

S.N. Name of fish Name of parasites Sequence

Length(bp)

GenBank

Number

1. Puntius

sophore

Dactylogyroides tripathii

(Tripathi, 1959, Yamaguti,1963)

Gusev 1963

368 JX960645

Dactylogyroides longicirrus

(Tripathi, 1959) Gusev, 1976

(Retrieved from GenBank)

301 GU903482

Dactylogyrus longiacus

Gusev,1976

377 JX947854

Dactylogyrus subtilis Gusev,1976 371 JX947851

Dactylogyrus sp.1 359 JX947853

2. Puntius chola Dactylogyroides mahecoli

(Gussev,1976) Agrawal et al.,

2002

381 JX960644

Dactylogyroides dorsali

(Gussev,1976) Agrawal et al.,

2002

364 JX960643


3. Puntius ticto Dactylogyrus sp.3 357 JX947855



4. Esomus

danricus

Esomocleidus chakrabartii

(Gusev, 1976)

337 KC962224

Esomocleidus esomi (Gusev,

1963)

367 KC962226

Esomocleidus lucknowensis 358 KC962225

15

Dactylogyrus longiacus Gusev, 1976

(Plate. 1)

Host- Puntius sophore Hamilton, 1882

Type Locality- River Gomti

Infection site- Gills

No. of host examined-12

Body elongate 275 (250-320; n=12); maximum width 80 (75-95;

n=12). Cephalic region well developed and divided into four lobes. Two

pairs of eye spots, posterior pair larger. Intestinal caeca confluent

posterior to testis. Pharynx spherical 16(14-22; n=12) in diameter.

Copulatory complex consists of copulatory tube and accessory piece.

Copulatory tube 72 (65-90; n=12) long, comprising a coil with a swollen

base. Accessory piece complex, consist of three distal pincers and a broad

basal flap. Vaginal apparatus sclerotised, opening into seminal receptacle

through a vaginal tube. Ovary oval, 19 (18-22; n=12) long, 21 (15-26;

n=12) wide. Vitelline follicles dense, throughout body, except gonadal

region. Testis single, 28 (24-30; n=12) long, 16 (14-22; n=12) wide.

Single prostatic reservoir opens at the base of copulatory complex. Vas

deferens arises from the anterior end of testis, runs anteriorly to loop left

intestinal caecum, dilating to form spindle- shaped seminal vesicle which

in turn opens at the base of copulatory tube. Haptor 35 (32-45; n=12)

long, 50 (45- 65; n=12) wide. Dorsal anchor inner length 36 (32-38;

n=12), outer length 27 (25-30; n=12), recurved point 13 (12-15; n=12).

Ventral anchors absent. Dorsal connecting bar 14 (12-16; n=12). Hooks

seven pairs, similar, hook pair 4, 5and 6, 12-18 (n=12), hook pairs 1, 2, 3

and 7, 18- 21 (n=12).

16

Remarks:- Gusev (1976) described D. longiacus from P.stigma (now

known as P.sophore) from the water bodies near Lucknow. The

description was based on hard parts only. Agrawal et al. (2003)

redescribed the species in detail and have added structure of soft parts and

variations in sclerotised structures. It is therefore briefly recorded here.

17

Dactylogyrus longiacus Whole- mount (ventral view)

(Plate. 1)

18

Dactylogyrus subtilis Gusev, 1976

(Plate. 2)



Infection site - Gills





posterior to testis. Pharynx spherical 23 (18-26; n=10) in diameter.

Copulatory complex consist of copulatory tube and accessory piece,

copulatory tube 29 (27-34; n=10) with swollen base; accessory piece

forms two pincers. Prostatic reservoir not observed. Ovary oval 43 (42-

48; n=10) long, 32 (30-36; n=10) wide.Vitelline follicles dense,

throughout body except gonadal region. Testis single, 31 (30-37; n=10)

long,14(12-22; n=10) wide, vas deferense arises from the anterior end of

testis and dilating to form a seminal vesicle, opens at the base of

copulatory complex. Haptor 55 (45-58; n=10) long, 72 (70-95; n=10)

wide. Dorsal anchor inner length 25 (23-28; n=10), outer length 20 (18-

25; n=10), recurved point 10 (9-12; n=10). Dorsal connecting bar, 19 (18-

22; n=10) long. Ventral bar stick shaped, 13(10-15) long. Hooks seven

pairs, similar, hook pairs 1, 2, 4, 5 and 7, 14- 20 (n=10), hook pair 3, 23-

28 (n=10), hook pairs 6, 14-19 (n=10).

Remarks:- This species was described by Gusev (1976) from P. stigma

(now known as P. sophore), from a water bodies near Lucknow. Its

19

description was only based on hard parts. Agrawal et al. (2003)

redescribed the species, adding information on soft parts and some

differences in sclerotised structures. It is briefly recorded in the present

work.

20

Dactylogyrus subtilis Whole-mount (dorsal view)

(Plate. 2)

21

Dactylogyrus sp.1

(Plate. 3)





Body elongate 430 (350-550; n=12); maximum width 130 (110-

150; n=12). Cephalic region well developed and divided into four lobes.

Two pairs of eye spots, posterior pair larger. Intestinal caeca confluent

posterior to testis. Pharynx spherical 22 (20-26; n=12) in diameter.


copulatory tube 62 (50-70; n=12) with swollen base; accessory piece 25

(24-28; n=12) long. Ovary oval 55 (54-60; n=12) long, 35 (29-49; n=12)

wide. Vitelline follicles dense, throughout body except gonadal region.

Testis single, 48 (45- 80; n=12) long, 16 (16-22; n=12) wide, vas

deferense arises from the anterior end of testis, dilates to form seminal

vesicle which in turn opens at the base of copulatory complex. Single

prostatic reservoir opens at the base of copulatory Haptor 85 (75-95;

n=12) long, 100 (95-125; n=12) wide. Dorsal anchor inner length 45 (40-

58; n=12), outer length 42 (35-50; n=12), recurved point 9 (8-9; n=12).

Dorsal bar 20 (18-22; n=12). Hooks seven pairs, similar, hook pairs 1, 5

and 7, 18- 22 (n=12), hook pair 2, 3, 23-24 (n=12), hook pairs 4, 6, 12-17

(n=12) long.

Remarks:-The present species was earlier described in detail by Tripathi

(unpublished work) from P. sophore from river Gomti, Lucknow. It is

therefore briefly recorded here. 22

Dactylogyrus sp.1 Whole-mount (dorsal view).

(Plate. 3)

23

Dactylogyrus sp.2

(Plate. 4)

Host- Puntius chola Hamilton, 1882






pairs of eye spots. Intestinal caeca confluent posterior to testis. Pharynx

spherical, 15 (12-26; n=8) in diameter. Copulatory complex consist of

copulatory tube and accessory piece, copulatory tube 40 (32-42; n=8)

long. Vaginal apparatus sclerotised, opening into seminal receptacle

through a vaginal tube. Ovary oval, 28 (25-35; n=8) long, 22 (20-22;

n=10) wide. Vitelline follicles dense, throughtout body, except gonadal

region. Testis single, 31 (29-37;n=10) long,17 (16-22;n=10) wide, vas

deferense arises from the anterior end of testis, dilates to form seminal

vesicle which in turn opens at the base of copulatory complex. Single

prostatic reservoir opens at the base of copulatory complex. Haptor 85

(72-90; n=8) long, 98 (95-115; n=8) wide. Dorsal anchor inner length 39

(36-50; n=10), outer length 28 (25-32; n=8), recurved point 10 (8-12;

n=8), dorsal bar 19 (17-20). Hooks seven pairs, similar, hook pairs 1, 2, 3

and 5, 18- 25 (n=10), hook pair 4, 29-34 (n=10), hook pairs 6 and 7, 16-

19 (n=10).

Remarks: This species was earlier described by Tripathi (unpublished

work) from P. chola from river Gomti, Lucknow, in detail. It is briefly

recorded in the present work.

24

Dactylogyrus sp.2 Whole-mount (ventral view) (Plate. 4)

25

Dactylogyrus sp. 3

(Plate. 5)

Host- Puntius ticto Hamilton, 1882







spherical 22 (17-26; n=15) in diameter. Copulatory complex consist of


with swollen base; accessory peice 25 (24-28; n=15) long. Vaginal

apparatus sclerotised, opening into seminal receptacle through a vaginal

tube. Ovary oval, 40 (38-45; n=15) long, 24 (20-28; n=15) wide. Vitelline

follicles dense, throughtout body, except gonadal region. Testis single, 31

(29-37; n=15) long, 16 (16-22; n=15) wide, vas deferens arises from the

anterior end of testis, single seminal vesicle opens at the base of

copulatory complex. Prostatic reservoirs two, opens at the base of



32; n=15), recurved point 9 (8-9; n=15). Dorsal bar 22 (20-25; n=15)

long. Hooks seven pairs, similar, hook pairs 1, 2, 3, 18- 25 (n=10), hook

pairs 6 and 7, 10-12 (n=10), hook pair 4, 5, 6, (14-18; n=10).

Remarks:- The present species was earlier described in detail by Tripathi

(unpublished work) from P. ticto from river Gomti, Lucknow. It is

therefore briefly recorded here. It is therefore briefly recorded here.

26

Dactylogyrus sp.3 Whole-mount (ventral view)

(Plate. 5)

27

Dactylogyrus sp. 4

(Plate. 6)








spherical 20 (17-26; n=8) in diameter. Copulatory complex consist of


with swollen base; accessory peice 25 (24-28; n=8) long. Vaginal

apparatus sclerotised, opening into seminal receptacle through a vaginal

tube. Ovary round to oval, 35 (32-42; n=8) long, 30 (20-38; n=8) wide.

Vitelline follicles dense, throughtout body, except gonadal region. Testis

single, 33 (29-38;n=8) long,17 (16-22; n=8) wide, vas deferens arises

from the anterior end of testis, single seminal vesicle opens at the base of




38; n=8), recurved point 9 (8-9; n=8). Dorsal bar 12 (11-15; n=8) long,

Similar hooks; hook pairs 1, 2, 3 and 7, 11-14 (n=8), hook pair 2 and bar

Hooks seven 6, 15-16 (n=8), hook pairs 4, 17-19 (n=8).

Remarks:-This species was earlier described in detail by Tripathi

(unpublished work) from P. ticto from river Gomti, Lucknow. It is briefly


28

Dactylogyrus sp.4 Whole-mount (dorsal view)

(Plate. 6)

29

Dactylogyrus sp.5

(Plate. 7)








posterior to testis. Pharynx spherical, 25 (17-30; n=10) in diameter.


copulatory tube 52 (45-64; n=10) with swollen base; accessory piece 24

(24-28; n=10) long. Vaginal apparatus sclerotized, opening into seminal

receptacle through a vaginal tube. Ovary oval, 56 (42-62; n=10) long, 32

(28-40; n=10) wide. Vitelline follicles dense, upto haptoral region. Testis

single, 31 (25-37; n=10) long, 18 (16-22; n=10) wide, vas deferens arises

from the anterior end of testis, single seminal vesicle opens at the base of




35; n=10), recurved point 10 (8-12; n=10), dorsal bar 18 (16-20) long.

Hooks seven pairs, similar, hook pairs 1, 2, 3, 4 and 7, 18- 20 (n=10),

hook pair 5 and 6, 14-16 (n=10).

Remarks:- The present species was earlier described in detail by Tripathi



30

Dactylogyrus sp.5 Whole –mount (dorsal view).

(Plate. 7)

31

Molecular Phylogenetics

Nucleotide Sequence Analysis

Average of all the seven Dactylogyrus species nucleotide

sequences had total of 338 positions, in the final data set (Detailed

species wise compositions included in Table 1). It revealed the fewest

Cytosine (22.7%). The degree of bias depends upon the codon

composition i.e. 25.4% Cytosine in the first position, 20.7% in second

position and 21.8% in third position. The first position rich in Guanines

was 27.1%, the second position rich in Thymine was 29.0% and third

position rich in Adenines was 30.2%.

Average Evolutionary Divergence over all Sequence Pairs is 2.98.

Estimated results showed minimum 0.17 distance between Dactylogyrus

sp.1 and Dactylogyrus sp.3 where maximum distance 4.90 was shown

between Dactylogyrus subtilis and Dactylogyrus sp.5 (Table 2).

Substitution pattern rates were estimated under Kimura 2-

parameter model (Kimura 1980). Substitution Matrix showed estimated

values between 11.13 (minimum) - 14.33 (maximum) and each entry

showed the probability of substitution (r) from one base to another base

(Table 3). The transition/transversion rate ratios are k1 = 1.806 (purines)

and k2 = 2.288 (pyrimidines). The overall transition/transversion bias is R

= 1.018, where R = [A*G*k1 + T*C*k2]/[(A+G)*(T+C)].

In Codon Based Z- Test of Selection, the values of P less than

0.05 were considered significant at 5% level (Table 4). The variance of

the difference was computed using bootstrap method (1000 replicates). In

Tajima Test of Neutrality, number of segregating sites (ps) was 1.000000,

32

nucleotide diversity 0.677656 and the Tajima Test statistic calculated (D)

3.884346 (Table 5).

Phylogeny

The phylogenetic reconstructions (Figs. 1&2), inferred from

analysis of 28S rDNA sequences showed great resolution for the species

of the monogenoideans. 28S rDNA sequences were aligned using Clustal

W (Thompson et al. 1994). All seven Dactylogyrus species under study

and two Onchobdella bopeleti Paperna, 1968 (Accession no. HQ010033)

and Onchobdella aframae Bilong Bilong Euzet, 1995 (Accessesion no.

HQ010034) (Ancyrocephaline monogenoideans), recovered from

GENBANK for phylogenetic reconstruction, revealed clear differences in

nucleotide sequences among different species. BLAST analysis showed

unique feature of the sequences. They had 92% (minimum) - 93%

(maximum) similarity for D. subtilis, 91%- 93% for D. longiacus, 90%-

91% for Dactylogyrus sp.1, 89%- 91% for Dactylogyrussp.2, 90- 92%

for Dactylogyrus sp.3, 90- 92% for Dactylogyrussp.4, 88- 92% for

Dactylogyrus sp. 5, with the sequences of species of genus Dactylogyrus

available at NCBI.

For phylogenetic analysis, the phylogenetic trees were computed

with Neighbor- Joining (NJ) method and Minimum Evolution (ME)

method. The evolutionary distances were computed using p-distance

method and are in the units of the number of base differences per site.

Codon position included were 1st+2nd+3rd+Noncoding. Gaps and missing

data were eliminated. The ME tree was constructed using close-neighbor-

interchange (CNI) algorithm. Branch lengths are generally not obtained

for each topology; the sequences at each node are inferred to be those that

require the least number of changes to give each of two immediately

33

descendant sequences (Dopazo, 1994). Bootstrap values were included to

test the reliability of inferred trees (Felsentein, 1985) and the estimation

of evolutionary divergence between sequences was computed. The

phylogenies were tested with 1000 bootstrap replicates. Bootstrap values,

indicating the robustness of the internal nodes were set at 1000

replications. Above mentioned two methods- Neighbor- Joining (NJ) and

Minimum Evolution (ME) gave trees with similar topology and

approximately similar bootstrapped values. These trees showed three

groups of parasites, first group included three species Dactylogyrus sp 1,

Dactylogyrus sp 3 and Dactylogyrus sp.4 having bootstrap value 89%,

second group included two species Dactylogyrus sp.2, Dactylogyrus sp.5

having bootstrap value between 51% to 55% , third group included two

species Dactylogyrus subtilis, Dactylogyrus longiacus having bootstrap

value 67%-68% .

Discussion

Family Dactylogyridae (Dactylogyrinae: Dactylogyroidae)

represented a highly diversified group (Gibson et al. 1996; Timofeeva et

al. 1997). Phylogenetic analysis using morphological characters had been

performed previously by Kritsky and Boeger (1989) to resolve the

phylogenetic relationships among families and subfamilies of

Dactylogyridae. Traditional study was based, to a large extent, on the

morphology of the sclerotized components of the haptoral parts.

Within the Monogenoidea, sequences of ribosomal subunits were

widely used to infer phylogenetic relationships at the level of families and

subfamilies (Simkova et al. 2003; Plaisance et al. 2005) or also to

investigate evolutionary associations between parasites and their hosts

(Desdevises et al. 2002; Simkova et al. 2004).

34

The present study provided the first insight data on 28S genes of

seven species of Dactylogyrus occurring on fish Puntius in India, an

important genus of freshwater food and ornamental fish belonging to the

family Cyprinidae. All parasites of Puntius are strictly specialists, none

being generalist. The main process of Dactylogyrus diversification

corresponded to sympatric speciation, correlated to strict host specificity.

Although distribution of some species might overlap, their reproductive

organs kept them apart (Shrivastava et al. 2012).

PCR technology and DNA sequencing techniques permitted

identification of species easier, as 28S gene was highly conserved. In

total, 338 bp sequences of 28S rDNA gene were taken for 7 species of

Dactylogyrus from family Dactylogyridae (also see Simkova et al. 2002,

Chowdhary and Singh, 2012). On the basis of nucleotide sequence

variation analysis, it was aptly clear that values of A T G C contents

(Table 1) of parasites having similarity formed distinct groups.

Phylogenetic analysis further highlighted that Dactylogyrus species under

study are similar and clustered together. Within these seven Dactylogyrus

species, three lineages were observed. The tree obtained from the p-

distance with bootstrap proportions (BP) supported the monophyly of

Dactylogyrus. The first lineage (Fig.1&2) was composed of two sister

subgroups. The first associated two species Dactylogyrus sp.1 and

Dactylogyrus sp.3. The second one associated only one species

Dactylogyrus sp.4. The second lineage (Fig.1&2) is composed of two

species, Dactylogyrus sp 2 and Dactylogyrus sp.5. The third lineage

(Fig.1&2) is also composed of two species, Dactylogyrus subtilis and

Dactylogyrus longiacus. It therefore proved the concept of monophyly in

Dactylogyrus (also supported by Simkova et al. 2004). Dactylogyrus

sp.1, Dactylogyrus sp.3, Dactylogyrus sp.4 belonging to first lineage did

35

not occur on the same species of fish but one on P. sophore and two on P.

ticto. Dactylogyrus sp.2 and Dactylogyrus sp.5 belonging to second

lineage occurred on P. chola and P. ticto respectively and Dactylogyrus

subtilis and Dactylogyrus longiacus belonged to third lineage on P.

sophore. The results showed significant relationship in phylogenetic

attribute of Dactylogyrus species under study. On the basis of NJ and ME

trees we can say that the first group in which D. subtilis and D. longiacus

evolved first (Also supported by evolution of host species P. sophore, as

observed by Pallavi et al. 2012). Group second composed of

Dactylogyrus sp.1. Dactylogyrus sp.3, Dactylogyrus sp.4 came next. Of

these, Dactylogyrus sp.1 was on P. sophore and two other infected P.

ticto. Third group consisting of Dactylogyrus sp.2 and Dactylogyrus sp.5

were found on P. chola and P.ticto respectively. According to Pallavi et

al. 2012, P. ticto evolved after P. chola. In our opinion probably the third

group evolved from second group as a result speciation of parasite

species. Moreover, the present analysis suggested the independent

secondary colonization of Dactylogyrus sp. 2 and Dactylogyrus sp. 5 on

their respective hosts. In conclusion, the phylogeny inferred from the

partial 28S rDNA supported the hypothesis that colonization of

Dactylogyrus parasites followed the pattern of diversification of their host

species.

36

Table 1:- Computed Nucleotide Composition

Domain: Data T(U) C A G Total T-1 C-1 A-1 G-1 Pos #1 T-2 C-2 A-2 G-2 Pos #2 T-3 C-3 A-3 G-3 Pos #3

Dactylogyrus

subtilis 21.6 21.6 25.9 31.0 371.0 19 24.2 27.4 29.8 124.0 23 23.4 21.8 32.3 124.0 24 17.1 28.5 30.9 123.0

Dactylogyrus

longiacus 24.8 21.3 26.1 27.8 371.0 26 26.6 21.8 25.8 124.0 28 18.5 25.0 28.2 124.0 20 18.7 31.7 29.3 123.0

Dactylogyrus

sp.1 24.2 21.7 26.7 27.3 359.0 22 25.8 26.7 25.8 120.0 33 18.3 20.8 28.3 120.0 18 21.0 32.8 27.7 119.0

Dactylogyrus

sp. 2 27.2 26.9 22.8 23.1 368.0 25 27.6 22.0 25.2 123.0 33 26.8 18.7 22.0 123.0 24 26.2 27.9 22.1 122.0

Dactylogyrus

sp.3 24.9 20.4 26.6 28.0 357.0 24 23.5 26.1 26.9 119.0 29 16.8 22.7 31.9 119.0 23 21.0 31.1 25.2 119.0

Dactylogyrus

sp.4 24.1 21.1 25.8 29.1 361.0 24 24.8 22.3 28.9 121.0 26 17.5 22.5 34.2 120.0 23 20.8 32.5 24.2 120.0

Dactylogyrus

sp.5 27.1 25.9 24.1 22.9 340.0 25 25.4 21.9 27.2 114.0 32 23.7 23.7 21.1 114.0 24 28.6 26.8 20.5 112.0

Avg. 24.8 22.7 25.4 27.1 361.0 23 25.4 24.0 27.1 120.7 29 20.7 22.2 28.3 120.6 22 21.8 30.2 25.8 119.7

37

Table 2:- Pairwise Distance (Maximum Composite Likelihood)

Dactylogyrus subtilis

Dactylogyrus longiacus 2.66

Dactylogyrus sp.1 3.61 3.25

Dactylogyrus sp.2 3.54 3.15 3.61

Dactylogyrus sp.3 3.29 2.56 0.17 4.58

Dactylogyrus sp.4 3.23 2.79 0.28 3.59 0.17 Dactylogyrus sp.5 4.90 2.89 3.49 2.79 4.48 3.50

Overall distance- 2.98

Table 3:- Maximum Composite Likelihood Subtitution Matrix

(Tamura Nei Model) Maximum Composite Likelihood Estimate of the Pattern of Nucleotide

Substitution

A T C G

A - 6.26 5.8 11.77

T 6.16 - 13.28 6.52

C 6.16 14.33 - 6.52

G 11.13 6.26 5.8 -

38

Table 4:- Codon Based Z- Test of Selection

Dactylogyrus subtilis 1.03 -0.78 -2.99 -1.28 -0.40 1.21

Dactylogyrus longiacus 0.30 0.35 0.68 0.23 0.65 0.62

Dactylogyrus sp.1 0.44 0.73 -1.45 0.34 0.96 -0.37

Dactylogyrus sp.2 0.00 0.50 0.15 -0.89 0.60 0.74

Dactylogyrus sp.3 0.20 0.82 0.74 0.38 -0.33 -0.31

Dactylogyrus sp.4 0.69 0.52 0.34 0.55 0.74 -0.12

Dactylogyrus sp.5 0.23 0.54 0.71 0.46 0.76 0.90

Table 5:- Tajima Test of Neutrality

M S ps Θ Π D

7 338 1.000000 0.408163 0.677656 3.884346

Abbreviations: m = number of sequences, S = Number of segregating

sites, ps = S/m, Θ = ps/a1, π = nucleotide diversity, and D is the Tajima

test statistic.

39

Fig:- 1 Phylogenetic analysis by Neighbor-Joining Method

Neighbor Joining Distance Tree with distance estimated by p-distance

method. Score derived from interior branch test analysis with 1000

replications respectively are shown above the branches.

40

Fig:-2 Phylogenetic analysis by Minimum Evolution Method

Minimum Evolution Distance Tree with distance estimated by p-distance



41

Dactylogyroides tripathii (Tripathi, 1959) Gusev, 1963

(Plate. 8)





Body elongate 310 (240-430; n=10) long; maximum width 80 (75-


Two pairs of eye spots. Intestinal caeca confluent posterior to testis.

Pharynx spherical 21 (17-27; n=10) in diameter. Copulatory complex

consist of copulatory tube and accessory piece. Copulatory tube 29 (27-

31; n=10) long, comma shaped, with a swollen base; accessory piece 26

(26-28; n=10) long. Vaginal apparatus sclerotised, opening into seminal


(30-35; n=10) wide. Vitelline follicles dense, throughtout body, except

gonadal region. Testis single, 43 (40-48; n=10) long 18 (16-20; n=10)

wide. Vas deferens arises from the anterior end of testis and forms two

seminal vesicles, which in turn opens at the base of copulatory complex.

Single prostatic reservoir opens at the base of copulatory complex.

Haptor 44 (40-52; n=10) long, 84 (75-95; n=10) wide. Dorsal anchor

inner length 41(38-45; n=10), outer length 40 (38-45), inner root 9 (8-10;

n=10), outer root 5 (5-7; n=10) recurved point 9 (8-9; n=10). Ventral

anchors absent. 'V' shaped dorsal connecting bar present. It is divided into

two parts, each 30 (29-32; n=10) long, ventral bar wide U- shaped 35 (32-

42

38; n=10) and a median groove present. Hooks seven pairs; hook pairs 1,

2 and 3, 17-22 (n=10), hook pairs 5, 6 and 7, 16-19 (n=10), hook pair 4,

27-33 (n=10).

Remarks:- This species was described by Gusev (1963) from a water

bodies near Lucknow. Agrawal et al. (2002) redescribed the species,

adding information on soft parts and some differences in sclerotised

structures. It is briefly recorded in the present work.

43

Dactylogyroides tripathii Whole- mount (dorsal view)

(Plate. 8)

44

Dactylogyroides longicirrus (Tripathi, 1959) Gusev, 1976

(Plate. 9)





Body elongate 340 (280-430; n=10) long; maximum width 125

(90-185; n=10). Cephalic region well developed and divided into four

lobes. Two pairs of eye spots. Intestinal caeca confluent posterior to

testis. Pharynx spherical 20 (17-27; n=10) in diameter. Copulatory

complex consist of copulatory tube and accessory piece, copulatory tube

29 (27-32; n=10) long with swollen base; accessory piece 26 (24-29;

n=10) long. Vaginal apparatus sclerotised, opening into seminal


(30-35; n=10) wide. Vitelline follicles dense, throughtout body, except

gonadal region. Testis single, 41 (39-45; n=10) long, 20 (17-22; n=10)





inner length 75 (72-78; n=10), outer length 75 (70-80; n=10), recurved

point 9 (8-9; n=10). Ventral anchors absent. 'V' shaped dorsal connecting

bar present. It is divided into two parts, each 30 (30-34; n=10) long,

ventral bar wide U-shaped 32 (32-38; n=10) and a median groove present.

Hooks seven pairs; hook pairs 1, 2, 3 and 5, 22- 25 (n=10), hook pairs 6

and 7, 16-19 (n=10), hook pair 4, 29-34 (n=10) long.

45

Remarks:- Gusev (1976) described D. longicirrus from the water bodies

near Lucknow. Agrawal et al. (2002) redescribed the species in detail. It

is therefore briefly recorded here.

46

Dactylogyroides longicirrus Whole-mount (ventral view) (Plate. 9)

47

Dactylogyroides mahecoli Gusev, 1976

(Plate.10)





Body elongate 380 (280-445; n=10) long; maximum width 110

(90-125; n=10). Cephalic region well developed and divided into four

lobes. Two pairs of eye spots. Intestinal caeca confluent posterior to

testis. Pharynx spherical 22 (17-30; n=10) in diameter. Copulatory

complex consist of copulatory tube and accessory piece, copulatory tube

27(24-32; n=10) long with swollen base; accessory piece 23 (26-29;

n=10) long. Vaginal apparatus sclerotised, opening into seminal


(30-42; n=10) wide. Vitelline follicles dense, throughout body except

gonadal region. Testis single, 42 (39-58; n=10) long, 18 (17-22; n=10)





inner length 42 (35-46; n=10), outer length 38 (34-42; n=10), recurved

point 8 (8-9; n=10). Ventral anchors absent. 'V' shaped dorsal connecting

bar present. It is divided into two parts, each 32 (30-34; n=10) long,

ventral bar wide U-shaped 29 (26-38; n=10) long and a median groove

present. Hooks seven pairs; hook pairs 1, 2, 3, 20- 24 (n=10), hook pairs

6 and 7, 16-20 (n=10), hook pair 4, 26-32 (n=10) long.

48

Remarks:- Gusev (1976) described from the water bodies near

Lucknow. Agrawal et al. (2002) redescribed the species in detail. It is

therefore briefly recorded here.

49

Dactylogyroides mahecoli Whole-mount (dorsal view)

(Plate. 10)

50

Dactylogyroides dorsali Gusev, 1976

(Plate.11)





Body elongate 320 (280-425; n=10) long; maximum width 95 (80-


Two pairs of eye spots. Intestinal caeca confluent posterior to testis.

Pharynx spherical 19 (17-26; n=10) in diameter. Copulatory complex

consist of copulatory tube and accessory piece, copulatory tube 29 (27-

34; n=10) long with swollen base; accessory piece 26 (24-28; n=10) long.

Vaginal apparatus sclerotised, opening into seminal receptacle through a

vaginal tube. Ovary oval, 44 (42-48; n=10) long, 21 (20-22; n=10) wide.

Vitelline follicles dense, throughtout body, except gonadal region. Testis

single, 34 (29-37; n=10) long, 18 (16-22; n=10) wide. Vas deferens arises

from the anterior end of testis and forms two seminal vesicles, which in

turn opens at the base of copulatory complex. Single prostatic reservoir

opens at the base of copulatory complex. Haptor 42 (40-52; n=10) long,

115 (95-135; n=10) wide. Dorsal anchor inner length 43 (36-52; n=10),

outer length 36 (32-40; n=10), recurved point 9 (8-9; n=10). Ventral

anchors absent. 'V' shaped dorsal connecting bar present. It is divided into

two parts, each 29 (28-32; n=10) each, ventral bar wide U-shaped 35 (32-

40; n=10) and a median groove present. Hooks seven pairs; hook pairs 1,

2, 3 and 5, 18- 25 (n=10), hook pair 4, 29-34 (n=10), hook pairs 6 and 7,

16-19 (n=10) long.

51

Remarks:- Gusev (1976) described from the water bodies near



52

Dactylogyroides dorsali Whole-mount (ventral view)

(Plate. 11)

53



Average of all the four Dactylogyroides species nucleotide

sequences had total of 254 positions, in the final data set (Detailed

species wise compositions included in Table 1). It revealed the fewest

Cytosine (22.8%). The degree of bias depends upon the codon

composition i.e. 23.7% Cytosine in the first position, 23.1% in second

position and 21.6 % in third position. The first position rich in Adenine

was 26.6 %, the second position rich in Thymine was 28.0 % and third

position was also rich in Thymine 27 %.

Average Evolutionary Divergence over all Sequence Pairs is 9.51.

Estimated results showed minimum 5.54 distance between

Dactylogyroides dorsali and Dactylogyroides longicirrus where

maximum distance 11.65 was shown between Dactylogyroides mahecoli

and Dactylogyroides longicirrus (Table 2).

Substitution matrix estimated between minimum7.08 to maximum

38.25 and each entry shows the probability of substitution (r) from one

base (row) to another base (column) (Table 3). The transition/transversion

rate ratios are k1 = 3.351 (purines) and k2 = 17.047 (pyrimidines). The

overall transition/transversion bias is R = 4.924, where R = [A*G*k1 +

T*C*k2]/[(A+G)*(T+C)]. In estimation of substitution pattern disparity,

the probability of rejecting the null hypothesis that sequences have

evolved with the same pattern of substitution, as judged from the extent

of differences in base composition biases between sequences (Disparity

Index test). A Monte Carlo test (1000 replicates) was used to estimate the

P-values, which are shown below the diagonal. P-values smaller than

0.05 are considered significant.

54

In Codon Based Z- Test of Selection, the values of P less than 0.05

were considered significant at 5% level (Table 4). The variance of the

difference was computed using bootstrap method (1000 replicates). In



4.269047 (Table 5).

Phylogeny

The phylogenetic reconstructions (Figs. 1&2), inferred from



W (Thompson et al., 1994). All four Dactylogyroides species under study

and two Ligophorus chabaudi Euzet and Suriano, 1977 (Accession no.

JN996834) and Ligophorus vanbenedenii (Parona & Perugia, 1890)

Johnston & Teigs, 1922 (Accession no. JN996802) (Ancyrocephaline

monogenoideans), recovered from GENBANK for phylogenetic

reconstruction, revealed clear differences in nucleotide sequences among

different species. Sequence analysis was conducted using the nucleotide

BLAST program in the NCBI database (National Center for

Biotechnology Information, NIH, Bethesda, Maryland, USA) for

similarity and nucleotide length (Tatusova and Madden, 1999). We also

calculated the fractional GC contents of the nucleic acid sequences. The

length of 28S partial rDNA sequence of D.tripathii, D.longicirrus,

D.mahecoli and D.dorsali were 368, 301, 381 and 364 bases respectively.

They had 92% (minimum) - 93% (maximum) similarity for D.tripathii,

91%- 93% for D.longicirrus, 90%- 91% for D.mahecoli, 89%- 91% for

D.dorsali, with the sequences of other available at NCBI in BLAST

search. GC content of these four sequences were between 49.2% - 50.8%.

55

For phylogenetic analysis, the phylogenetic trees were computed

with Neighbor- Joining (NJ) method and Minimum Evolution (ME)

method. The evolutionary distances were computed using p-distance

method and are in the units of the number of base differences per site.

Codon position included were 1st+2nd+3rd+Noncoding. Gaps and missing

data were eliminated. The ME tree was constructed using close-neighbor-

interchange (CNI) algorithm. Branch lengths are generally not obtained

for each topology; the sequences at each node are inferred to be those that

require the least number of changes to give each of two immediately

descendant sequences (Dopazo, 1994). Bootstrap values were included to

test the reliability of inferred trees (Felsentein, 1985) and the estimation

of evolutionary divergence between sequences was computed. The





approximately similar bootstrapped values. These trees showed two

monohyletic groups of parasites and forming two subclade, first subclade

included two species Dactylogyroides tripathii and Dactylogyroides

mahecoli and having bootstrap value 51-53%, second also included two

species Dactylogyroides longicirrus and Dactylogyroides dorsali having

bootstrap value between 53% to 57% .

Discussion

Traditional study was based, to a large extent, on the morphology

of the sclerotized components of the haptoral parts. In recent times,

molecular techniques are being increasingly used in taxonomy and

phylogenetic species and have emerged as valuable supplementary tools

in providing authentic and unambiguous identification of species. 28S

56

rDNA markers have been used to detect species boundaries (Kaukas and

Rollinson, 1997).

Phylogenetic relationships based on morphological characters and

molecules are mostly concordant (Bernardi and Crane 2005: Ward et al.

2005). From our data, we observed genetic variation among species in

parasitic Platyhelminthes. The each variation is very variable based on

each gene among species. We think that these differences in the

nucleotide length, GC percentage, nucleotide differences, and number of

gaps of gene can be attributed largely to varying numbers of repeat, copy

numbers, deletions, alignment gaps, and base substitutions and additions.

Base substitutions and additions are characterized by very high C content

which can, at time represent pure poly C structures. In addition this may

be a consequence of mutations in the lineage.

Genus Dactylogyroides showed close similarity with the genus

Dactylogyrus of the same subfamily Dactylogyrinae. Only difference lies

with the structure of bar. Dactylogyroides possess ‘V’ shaped bar in two

parts. Only five species of this genus are so far reported in India four on

two species of fish Puntius and one on fish Osteobrama cotio (not

included in the present study).

Two subclade were formed in this study. Those Dactylogyroides

species which were found in same subclade do not parasitize the same

fish species. The result from the phylogenetic analyses did not indicate

that Dactylogyroides species coexisting on the same host evolve by intra-

host speciation, which was inferred to be an important process of parasite

diversification in cyprinid fish species (Simkova et al., 2004). We

compared gene sequences by NJ and ME analysis for phylogenetic

analysis, and then we acquired the same tree pattern.

57

The molecular phylogenetic analyses showed that Dactylogyroides

from different Puntius species clustered together. The two species D.

tripathii and D.mahecoli, in the first cluster showed that on the basis of

nucleotide composition shows similarity at an average of T position and

T-1 and G-1 position. Molecular phylogeny shows similarity between D.

tripathii and D. mahecoli having bootstrap value 51-53% in ME and NJ

methods. These observations are further supported by similarity in the

structure of taxonomically important sclerotised structures like haptoral

armature and copulatory complex, although they infect two different

species of the host (Agrawal et al., 2002). It seems most likely that the

two species co-speciated, infecting two different host species of the same

host genus. Similarly, the second cluster of D. longicirrus and D. dorsali,

have different nucleotide composition, as supported by ME tree

(bootstrap value 57). It is worthwhile to mention here that these species

are morphologically quite distinct as well (Gusev, 1976, Agrawal et al.,

2002).

58

Table 1- Compute Nucleotide composition

Domain: Data

T(U) C A G Total T-1 C-1 A-1 G-1 Pos #1 T-2 C-2 A-2 G-2 Pos #2 T-3 C-3 A-3 G-3 Pos #3 Dactylogyroides

tripathii 24.7 22.6 26.1 26.6 368.0 22 19.5 30.1 28.5 123.0 25 26.0 21.1 27.6 123.0 27 22.1 27.0

23.8 122.0 Dactylogyroides

longicirrus 30.7 20.2 22.6 26.5 257.0 31 24.1 21.8 23.0 87.0 34 17.4 22.1 26.7 86.0 27 19.0 23.8


mahecoli 24.7 19.6 27.4 28.3 368.0 22 20.3 29.3 28.5 123.0 27 20.3 23.6 29.3 123.0 25 18.0 29.5


dorsali 27.1 28.2 22.2 22.5 365.0 25 31.1 23.8 19.7 122.0 26 27.0 20.5 26.2 122.0 30 26.4 22.3

21.5 121.0

Avg. 26.5 22.8 24.7 25.9 339.5 25 23.7 26.6 25.1 113.8 28 23.1 21.8 27.5 113.5 27 21.6 25.8

25.2 112.3

59


Dactylogyroides tripathii

Dactylogyroides longicirrus 8.91

Dactylogyroides mahecoli 9.08 11.65 Dactylogyroides dorsali 11.35 5.54 10.50

Overall Distance- 9.51

Table 3:- Maximum Composite Likelihood Substitution Matrix

(Tamura Nei Model)

Maximum Composite Likelihood Estimate of the Pattern of Nucleotide

Substitution

A T C G

A - 2.24 1.82 7.08

T 2.11 - 31.01 2.11

C 2.11 38.25 - 2.11

G 7.08 2.24 1.82 -

60


Dactylogyroides tripathii -0.60 0.99 -1.25

Dactylogyroides longicirrus 0.55 0.57 -0.21

Dactylogyroides mahecoli 0.33 0.57 -1.82

Dactylogyroides dorsali 0.21 0.83 0.07


Table. Results from Tajima's Neutrality Test [1]

m S ps Θ Π D

4 250 0.984252 0.536865 0.755249 4.269047



test statistic.

61





62

Fig:- 2 Phylogenetic analysis by Minimum Evolution Method




63

Esomocleidus esomi (Gusev, 1963) n. comb.

(Plate. 12 & 13)

Syn - Ancyrocephalus esomi Gusev, 1963

Type host- Esomus danricus Hamilton, 1822

Type locality- Nugegoda, Sri Lanka


No. of host examined- 15

Redescription

Body elongate 170 (165-172; n= 15) long; greatest width 37 (32-

40; n= 15). Tegument annulated, a membranous covering is thrown out

all around the body margin, when parasite is relaxed or in dead condition.

Cephalic lobes well developed; head organs conspicuous, three pairs.

Eyes four, anterior pair larger, lens present at posterior pair. Pharynx oval

13 (12-14; n= 15) long, 14 (13-15; n= 15) wide. Testis oval 20 (19-22; n=

15) long, 15 (14-18; n= 15) wide; seminal vesicle two, dilation of vas

deferens; prostatic reservoir not seen. Copulatory complex consists of

copulatory tube and accessory piece, copulatory tube 10 (9-11; n= 15),

with broad base 6 (7-9; n= 15), forked-shaped, having thickened wall;

accessory piece 8 (7-9; n= 15) long, tri-radiate shaped. Ovary oval, 31

(29-33; n= 15) long, 17 (16-18; n= 15) wide. Vagina 3 (2-3; n= 15)

lightly sclerolized, thin tube-like, anterior or parallel to copulatory

complex, opening into balloon-shaped seminal receptacle. Vitelline

follicles dense, throughot body, except gonadal region. Haptor

subtrapezoidal 50 (49-52; n= 15) long, 22 (21-24; n= 15) wide. Hooks 14;

64

dissimilar, hook pair 1, 8, 8-9 (n= 15); hook pair 2, 9, 9-10 (n= 15);

hook pair 3, 11, 10-11 (n= 15); hook pair 4, 12, 12-13 (n= 15); hook pair

5, 11, 11-12 (n= 15); hook pair 6, 11, 11-12 (n= 15) and hook pair 7, 7-8

(n= 15) long. Dorsal anchor 17 (16-18; n= 15) long, outer root well

developed, 4 (4-5; n= 15) long, inner root well developed, 7 (7-8; n= 15)

long, evenly curved shaft. Ventral anchor 14 (13-15; n= 15) long, roots

feebly developed, inner root 3 (3-4; n= 15) long, shaft slightly curved,

point 3 (3-4; n= 15) long. Dorsal bar 16 (15-18; n= 15) long, narrow, rod-

shaped, usually arched posteriorly. Ventral bar 19 (19-20; n= 15) long,

bent downwards, with elongate antero-medial projection, 7 (7-8; n= 15).

Egg round to oval, filament at one end, large 52 (50-54; n= 15) long,

filament small 3 (3-4; n=15).

Remarks:- The original description of Ancyrocephalus esomi is brief and

lacks whole mount drawing. Further, Gusev (1963) overlooked certain

important morphological features; Gusev (1963) stated the intestinal

caeca to be confluent in Ancyrocephalus esomi. However, in the genus

Ancyrocephalus, the intestinal caeca are separate. In specimens, under

study, however, the intestinal caeca are confluent. Gusev (1963) also

overlooked vaginal armature, annulations on body margin, projection in

ventral bar, seminal vesicle, (two in present worm) and gonads, as well as

the whole mount drawings were also not given. Esomocleidus gen. n.

(Monogenoidea: Dactylogyridae) is, therefore, proposed to include three

species, collected from the gills of Indian pencil fish, Esomus danricus

(Hamilton, 1822) (Cyprindae); Esomocleidus esomi (Gusev, 1963) n.

comb. (syn. Ancyrocephalus esomi Gusev, 1963), Esomocleidus

chakrabarti (Gusev, 1976) n. comb. (syn. Ancyrocephalus chakrabarti

Gusev, 1976) and Esomocleidus lucknowensis n. sp. The new genus is

characterized by body annulations/serrations, a shield-like or tube-like

65

vagina located parallel or anterior to the copulatory complex and an

elongate antero-medial projection of the ventral bar. The present species

differs from E. chakrabarti (Gusev, 1963) n. comb. and E. lucknowensis

n.sp., described in the following pages, by tube-like vagina, tri-radiate

accessory piece, larger eggs and structure and shape of hooks.

Generic Diagnosis of Esomocleidus n.g.

Body abrasive or textured, comprising body proper (cephalic region,

trunk and peduncle) and haptor. Tegument annulated. Head organs 2 to 3

pairs. Eye spots 2 pairs, anterior larger than posterior. Eye lens present at

posterior pair. Mouth subterminal. Pharynx comprising muscular and

glandular bulb. Oesophagus short to non-existent. Intestinal caeca two,

confluent, posterior to gonads, lacking diverticula. Gonads inter-caecal,

overlapping, lying near posterior region of body. Vas deferns looping left

intestinal caecum. Two seminal vesicle, both dilation of vas deferens.

Prostatic reservoirs generally present. Copulatory complex comprising

copulatory tube & accessory piece. Copulatory tube sickle-shaped,

tubular; accessory piece tetra-radiate or tri-radiate. Vagina sclerotised

shield-like or tube-like, parallel or anterior to copulatory complex.

Seminal receptacle balloon-shaped, pre-ovarian. Vaginal pore sub-

marginal, ventral. Vitelline follicles in trunk, absent from regions of

reproductive organs. Haptor expands to form two lateral wings,

sometimes appearing wedge-like with dorsal, ventral anchor/bar

complexes. Seven pairs of dissimilar hooks with ancyrocephaline

distribution, hook thumb erect, proximal region slightly inflated. Eggs

round to oval, with filament at one end. Parasites of gills of Indian

pencilfish (Cyprinidae: Rasborinae).

Etymology: The generic name reflects the genus of fishes that serve as

hosts for species of the genus + the Greek word Kleidos (= key).

66

Esomocleidus esomi Whole-mount (ventral view). (Plate. 12)

67

1.Ventral anchor; 2. Dorsal anchor ; 3.Dorsal bar ; 4.Ventral bar; 5. Copulatory complex; 6.Vagina and seminal receptacle ; 7.Hook pairs 1-7 ; 8.Egg.

(Plate. 13)

68

Esomocleidus chakrabartii (Gusev, 1976) n.comb.

(Plate. 14 &15)

Syn.- Ancyrocephalus chakrabartii Gusev, 1976

Type host- Esomus danricus (Hamilton, 1822)

Type locality- Water bodies of Lucknow



Redescription

Body elongate 150 (140-165; n= 15) long; greatest width 41

(39-44; n= 15). Tegument annulated, margin serrated. Cephalic lobes well

developed; head organs conspicuous, two pairs. Eyes four, anterior pair

larger, lens present at posterior pair. A distinct neck present. Pharynx oval

14 (12-14; n= 15) long, 13 (13-15; n= 15) wide. Testis oval 16 µm (15-

17; n= 15) long, 12 (11-13; n= 15) wide; seminal vesicle two, dilation of

vas deferens; prostatic reservoir three, balloon-shaped, opening at base of

copulatory tube. Copulatory complex consists of copulatory tube and

accessory piece, copulatory tube 25 (23-28; n= 15) sickle-shaped, with

broad base 11 (9-14; n= 15) having thickened wall; accessory piece 28

(27-30; n= 15) long, tetra-radiate. Ovary ovate, 28 (27-29; n= 15) long,

19 (18-20; n= 15) wide. Vaginal apparatus 11 (10-12; n= 15) highly

sclerotised, perforated, shield-like, anterior or parallel to copulatory

complex, opening into balloon-shaped seminal receptacle. Vitelline

follicles dense, throughout body, except gonadal region. Haptor sub-

trapezoidal 55 (51-60; n= 15) long, 27 (25-28; n= 15) wide. Hooks 14;

dissimilar, hook pairs 1, 2, 3 & 5, 18-20 (n= 15), hook pair 4, 21-22 (n=

15), hook pair 6, 12-13 (n= 15), hook pair 7, 14-15 (n= 15) long. Dorsal

69

anchor 19 (18-20; n= 15) long, outer root well developed, 5 (5-6; n= 15)

long, inner root well developed, 8 (7-9; n= 15) long, evenly curved shaft.

Ventral anchor 26 (26-27; n= 15) long, outer roots feebly developed,

inner root well developed, 9 (8-9; n= 15) long, shaft slightly curved, point

8 (7-9; n= 15) long. Dorsal bar 21 (20-22; n= 15) long, narrow, rod-

shaped, usually arched posteriorly. Ventral bar 18 (18-19; n= 15) long,

bent downwards, with elongate antero-medial projection, 8 (8-10; n= 15).

Egg round to oval, filament at one end, large 40 (38-42; n= 15) long,

filament small 3 (2-4; n=15).

Remarks:- The original description of Ancyrocephalus chakrabarti

includes diagrammatic figures and misinterpreted structures. Gusev

(1976) stated the intestinal caeca to be confluent in Ancyrocephalus

chakrabarti but in the generic diagnosis of Ancyrocephalus indicates the

intestinal caeca to be separate. In the present specimens, the intestinal

caeca are confluent. He overlooked vaginal armature but we have

observed perforated shield-like vagina in the present specimens. He also

missed the prostatic reservoirs, (three in present specimen), seminal

vesicle, (two in present worm) and gonads. Ancyrocephalus chakrabarti

is transferred under the new genus Esomocleidus as E. chakrabarti

n.comb. The present species significantly differs from E. esomi (Gusev,

1963) n. comb. and E. lucknowensis n.sp. by having perforated shield-like

vaginal apparatus, tetra-radiate accessory piece and sickle-shaped

copulatory tube.

70

Esomocleidus chakrabartii Whole-mount (ventral view).

(Plate. 14)

71

1. Copulatory complex; 2. Dorsal bar; 3. Ventral bar; 4. Dorsal anchor; 5. Ventral anchor; 6. Vagina; 7. Hook pairs; 8. Egg.

(Plate. 15)

72

Esomocleidus lucknowensis n.sp.

(Plate. 16 & 17)

Type host- Esomus danricus (Hamilton, 1822)

Type locality- River Sai, Lucknow



Body elongate 120 (112-125; n= 12) long; greatest width 22 (20-

25; n= 12).Tegument annulated. Cephalic lobes well developed; head

organs conspicuous, two pairs. Eyes four, anterior pair larger, lens present

at posterior pair. Pharynx oval 10 (10-11; n= 12) long, 8 (7-9; n= 12)

wide. Testis oval 14 (12-15; n= 12) long, 10 (10-12; n= 12) wide; seminal

vesicle two, dilation of vas deferens. Copulatory complex consists of

copulatory tube and accessory piece, copulatory tube 11 (10-11; n= 12)

having thickened wall; accessory piece funnel-shaped, 6 (5-6; n= 12)

long, bi-radiate. Ovary ovate, 22 (20-22; n= 12) long, 15 (14-16; n= 12)

wide. Vaginal apparatus 4 (4-5; n= 12) non sclerotised, muscular, tubular,

anterior or parallel to copulatory complex, opening into balloon-shaped

seminal receptacle. Vitelline follicles dense, throughtout body, except

gonadal region. Haptor wedge shaped, 47 (46-48; n= 12) long, 22 (21-23;

n= 12) wide. Hooks 14; dissimilar, hook pairs 1, 3, 20-21 (n= 12), hook

pairs 2, 5, 22-23 (n= 12); hook pair 4, 24-25 (n= 12), hook pair 6, 17-18

(n= 12) and hook pair 7, 19-20 (n= 12) long. Dorsal anchor 16 (15-16; n=

12) long, outer root well developed, 4 (4-5; n= 12) long, inner root well

developed, 7 (7-8; n= 12) long, evenly curved shaft. Ventral anchor 25

(24-25; n= 12) long, outer root feebly developed, inner root 9 (8-9; n= 12)

long, shaft slightly curved, point 8 (7-9; n= 12) long. Dorsal bar 19 (18-

19; n= 12) long, thick, rod-shaped, slightly bent downwards. Ventral bar

73

18 (18-19; n= 12) long, bent downwards, with elongate antero-medial

projection, 1 µm (1-2; n= 12). Egg round to oval, filament at one end,

large 42 (42-44; n= 12) long, filament small 2 (2-3; n=12).

Remarks:- This species differs from E. esomi (Gusev, 1963) n. comb.

and E. chakrabarti (Gusev, 1963) n. comb. by having as projection in

ventral bar, shape of dorsal bar, muscular vaginal apparatus and shape

and size of hooks.

74

Esomocleidus lucknowensis n. sp. Whole-mount (ventral view). (Plate. 16)

75

1.Ventral anchor; 2. Dorsal anchor ; 3. Copulatory complex ; 4.Vagina and seminal receptacle; 5. Ventral bar; 6. Dorsal bar ; 7.

Hook pairs 1-7; 8. Egg. (Plate. 17)

76



Average of all the four nucleotide sequences in which three

sequences of genus Esomocleidus and one for Ancyrocephalus paradox

had total of 337 positions, in the final data set (Detailed species wise

compositions included in Table 1). It revealed the fewest Adenine

(23.3%). The degree of bias depends upon the codon composition i.e.

24.3% Adenine in the first position , 24.1% in second position and 21.5%

in the third position. The first position rich in Thymine was 26%, the

second position rich in Cytosine was 26.2% and third position rich in

Guanine was 26.9%. Average of nucleotide sequences of three species of

Esomocleidus (E.chakrabartii, E.esomi and E.lucknowensis) at first,

second and third position are similar with each other but differ with

A.paradoxus.

Average Evolutionary Divergence over all sequence pairs is 0.77.

Estimated results showed minimum 0.72 distance between E.esomi and

E.lucknowensis where maximum distance 0.82 was shown between

E.esomi and Ancyrocephalus paradox (Table 2). Substitution pattern and

rates were estimated under Kimura (1980) 2-parameter model.

Substitution Matrix showed estimated values between 20.14 (minimum) –

22.8 (maximum) and each entry showed the probability of substitution (r)

from one base to another base (Table 3). The transition/transversion rate

ratios are k1 = 12.101 (purines) and k2 = 11.16 (pyrimidines). The overall

transition/transversion bias is R = 5.799, where R = [A*G*k1 +

T*C*k2]/[(A+G)*(T+C)].

77






5.828348 (Table 5).

Phylogeny

The phylogenetic reconstructions (Figs. 1&2) inferred from



W. All three Esomocleidus species and one Ancyrocephalus species

under study and one Dactylogyrus sp.1, recovered from GENBANK for

phylogenetic reconstruction, revealed clear differences in nucleotide

sequences among different species. For phylogenetic analysis, the

phylogenetic trees were computed with Neighbor- Joining method and

Minimum Evolution method. The evolutionary distances were computed

using p-distance method and are in the units of the number of base

differences per site. Codon position included were

1st+2nd+3rd+Noncoding. Gaps and missing data were eliminated.

Minimum Evolution was also based on p-distance method. The ME tree

was searched using close-neighbor- interchange (CNI) algorithm. Branch

lengths are generally not obtained for each topology; the sequences at

each node are inferred to be those that require the least number of

changes to give each of two immediately descendant sequences (Dopazo,

1994). Bootstrap values were included to test the reliability of inferred

trees (Felsentein, 1985) and the estimation of evolutionary divergence

between sequences was computed. The phylogenies were tested with

78

1000 bootstrap replicates. Bootstrap values, indicating the robustness of

the internal nodes were set at 1000 replications. Above mentioned two

methods- Neighbor- Joining (NJ) and Minimum Evolution (ME) gave

trees with similar topology and approximately similar bootstrapped

values. These trees showed two groups of parasites, first group included

two species Esomocleidus chakrabarti and Ancyrocephalus paradoxus

having bootstrap value 53% -60% and the second group included two

species Esomocleidus esomi and Esomocleidus lucknowensis having

bootstrap value between 93% to 94% .

Discussion

Twelve species of the genus Esomus are found only in the Asian

countries. Distribution of these fish in Asian countries include India,

Pakistan, Nepal, Bangladesh, Afghanistan, Srilanka and Myanmar. Gusev

(1963) have reported two species from the gills of pencil fish, i.e.

Ancyrocephalus esomi Gusev, 1963 at Nugegoda, Sri Lanka and A.

chakrabartii Gusev, 1976 at Lucknow, Uttar Pradesh. For the present

study, pencil fish from aquarium stores at Lucknow and river Sai, near

Lucknow district were examined and three species of dactylogyrids were

found from the gills of Esomus danricus (Hamilton, 1822), these are

Esomocleidus esomi (Gusev, 1976) n.comb. Syn. Ancyrocephalus esomi

Gusev, 1976; Esomocleidus chakrabartii (Gusev, 1976) n.comb. Syn.

Ancyrocephalus chakrabarti Gusev, 1976; Esomocleidus lucknowensis

n.sp. The original description of Ancyrocephalus esomi includes

diagrammatic figures and misinterpreted structures. Gusev (1963) stated

the intestinal caeca to be confluent in Ancyrocephalus esomi but in

generic diagnosis of Ancyrocephalus, the intestinal caeca are stated to be

separate. In the E. esomi (Gusev, 1976) n.comb., the intestinal caeca are

confluent. Gusev (1976) also overlooked vaginal armature, annulations

79

on body margin, projection in ventral bar, seminal vesicle, (two in present

worm) and gonads, as well as the whole mount drawings were also not

given, but in the present study whole mount drawing and all the above

characteristic features are observed. Similarly in Esomocleidus

chakrabartii (Gusev, 1976) n.comb., Gusev (1976) overlooked vaginal

armature, which is a perforated shield-like structure. He could not

observe three prostatic reservoirs, two seminal vesicles and the gonads.

The new species Esomocleidus lucknowensis n.sp. is characterized by a

projection in ventral bar, shape of dorsal bar, muscular vaginal apparatus

and shape and size of hooks.

Describing new species solely on the basis of their morphology is

often not straightforward, and especially so for small-bodied organisms

that display few morphological features on which to rely. A good

illustration is highlighted in monogenoidean parasitic flatworms, where

the main morphological structures used for species identification, namely

the hard parts of the host attachment apparatus (haptor) and male

copulatory organ, often require expert advice to discriminate closely

related species.

Phylogenetic analysis highlighted that Esomocleidus species under

study are similar and clustered together. Within these three Esomocleidus

species, two lineages were observed. The tree obtained from the p-

distance with bootstrap proportions (BP) supported the monophyly of

Esomocleidus. The first lineage composed of two species E.chakrabartii

and A.paradoxus. The second lineage is also composed of two species

E.esomi and E. lucknowensis.

80

According to nucleotide variation analysis Ancyrocephalus

paradoxus differs from three species of Esomocleidus, proving its distinct

identity (Table 2). Esomus sp.have a widespread distribution in India

(Talwar & Jhingran, 1991; Jayaram, 1999) and in Srilankan streams.

Occurrence of similar host specific monogenoideans on their fish also

supports common origin of host and parasites in these land masses.

81

Table 1: Computed Nucleotide composition

Domain: Data

T(U) C A G Total T-1 C-1 A-1 G-1 Pos #1 T-2 C-2 A-2 G-2 Pos #2 T-3

C-3

A-3 G-3 Pos #3

Esomocleidus

chakrabarthii 23.7 21.1 26.1 29.1 337.0 27 18.6 29.2 25.7 113.0 23 20.5 28.6 27.7 112.0 21

24.1

20.5 33.9 112.0

Esomocleidus

esomi 24.0 29.7 22.6 23.7 337.0 23 27.4 24.8 24.8 113.0 25 33.0 18.8 23.2 112.0 24

28.6

24.1 23.2 112.0

Esomocleidus

lucknowensis 27.0 26.7 22.3 24.0 337.0 25 26.5 21.2 27.4 113.0 29 25.9 24.1 20.5 112.0 27

27.7

21.4 24.1 112.0

Ancyrocephalus

paradoxus 33.3 21.0 20.0 25.7 105.0 38 20.5 17.9 23.1 39.0 21 23.5 26.5 29.4 34.0 41

18.8

15.6 25.0 32.0

Avg. 25.7 25.4 23.3 25.6 279.0 26 23.8 24.3 25.7 94.5 25 26.2 24.1 24.3 92.5 26

26.1

21.6 26.9 92.0

82


Esomocleidus chakrabarthii

Esomocleidus esomi 0.77

Esomocleidus lucknowensis 0.78 0.72

Ancyrocephalus paradoxus 0.74 0.82 0.76

Overall Distance- 0.77

Table 3:- Maximum Composite Likelihood Subtitution Matrix

(Tamura Nei Model) Maximum Composite Likelihood Estimate of the Pattern of Nucleotide

Substitution

A T C G

A - 1.99 1.81 22.8

T 1.67 - 20.14 1.89

C 1.67 22.13 - 1.89

G 20.21 1.99 1.81 -

83


Esomocleidus chakrabarthii 0.43 0.53 0.36

Esomocleidus esomi 0.67 0.86 0.10

Esomocleidus lucknowensis 0.60 0.39 1.14

Ancyrocephalus paradoxus 0.72 0.92 0.26

Table 5:- Tajima's Neutrality Test Table. Results from Tajima's Neutrality Test [1]

m S ps Θ π D

4 336 0.997033 0.543836 0.845697 5.828348



test statistic.

84

Fig: 1:- Phylogenetic analysis by Neighbor-Joining Method




85

Fig:- 2 Phylogenetic analysis by Minimum Evolution Method




86


The phylogenic relationships among 14 species of monogenoidea (7

species belonging to the genus Dactylogyrus, 4 species of

Dactylogyroides and 3 species of genus Esomocleidus) were investigated

via use of partial 28S ribosomal DNA (rDNA) sequences. All 28S rDNA

sequences were aligned using Clustal W software. Length of sequences

ranged between 301- 381 bp. Sequences of Tetraonchus monenteron

Diesing, 1858 (Accession no. AJ969953) and Anoplodiscus

cirrusspiralis Roubal, Armitage & Rohde, 1983 (Accession no.

AF382060) recoverd from GENBANK (placed in an outgroup) for

phylogenetic reconstruction, revealed clear differences in nucleotide

sequences among different species. Outgroup choice is especially critical

in resolving basal relationships from molecular data because of long-

branch attraction problems (Felsentein, 1978) and uncertainty in rooting.


Average Evolutionary Divergence overall Sequence Pairs is 0.72.

Estimated results showed minimum 0.15 distance between Dactylogyrus

sp.3 & Dactylogyrus sp.2 where maximum distance 0.82 was shown

between Dactylogyroides longicirrus and Dactylogyroides tripathii

(Table 1).

Substitution pattern rates were estimated under Kimura 2-

parameter model (Kimura 1980). Substitution Matrix showed estimated

values between 9.58 (minimum) - 14.33 (maximum) and each entry

showed the probability of substitution (r) from one base to another base

.The transition/transversion rate ratios are k1 = 2.2 (purines) and k2 =

87

1.589 (pyrimidines). The overall transition/transversion bias is R =0.941,

where R = [A*G*k1 + T*C*k2]/[(A+G)*(T+C)] (Table 2).






6.409283 (Table 4).

The nucleotide sequences were analyzed by length and G + C % in

order to determine the analyzed phylogenic relationships. For

phylogenetic analysis, the phylogenetic trees were computed with

Neighbor Joining (NJ) method and Minimum Evolution (ME) method.

The evolutionary distances were computed using p-distance method and

are in the units of the number of base differences per site. Codon position

included were 1st+2nd+3rd+Noncoding. Gaps and missing data were

eliminated. Minimum Evolution was also based on p-distance method.

The ME tree was constructed using close-neighbor- interchange (CNI)

algorithm. Branch lengths are generally not obtained for each topology;

the sequences at each node are inferred to be those that require the least

number of changes to give each of two immediately descendant

sequences (Dopazo, 1994). Bootstrap values were included to test the

reliability of inferred trees (Felsentein, 1985) and the estimation of

evolutionary divergence between sequences was computed. The





88

approximately similar bootstrapped values. These trees showed two

clearly divided clades. In first clade, genus Dactylogyrus and

Dactylogyroides were included and in the second clade species of the

genus Esomocleidus were found. In first clade five subclades were found.

In first subclade, three species Dactylogyrus longiacus, Dactylogyrus

subtilis and Dactylogyroides longicirrus were found, having bootstrap

value 52-53%. In the second subclade two species Dactylogyrus sp. 2 and

Dactylogyrus.sp 5 species were included, having bootstrap value 58-60%

and in the third subclade only one species Dactylogyroides dorsali was

found. In fourth subclade Dactylogyroides mahecoli and Dactylogyroides

tripathii were found, having bootstrap value 55-60% and in fifth subclade

Dactylogyrus sp.4, Dactylogyrus sp.3, and Dactylogyrus.sp.1 lied, having

bootstrap value 100%. However, in the second clade three species of the

genus Esomocleidus were found, having bootstrap value 62-69%.

Disscussion

Molecular phylogenetic approaches has advantages over the

morphology based approach. Molecular phylogenetic studies can use

powerful methods which accommodate various well characterized

features of molecular evolution, including different rates for different

types of nucleotide substitution. These model approaches are not

available for morphological analysis.

Resolving the interrelationship of these genera is the main aim of

present study. For this comparision, 28S rDNA sequences of all the

species were analysed. We conducted conventional bootstrap analyses,

under Neighbor Joining and Minimum Evolution criteria for phylogenetic

89

analysis, and then we acquired the same tree pattern. 28S rDNA genes are

conserved to a high degree.

Dactylogyrus, Dactylogyroides and Esomocleidus are under family

Dactylogyridae. However, the genera Dactylogyrus and Dactylogyroides

belong to the dactylogyrinae subfamily and Esomocleidus to subfamily

Ancyrocephalinae. All these analyses provide moderate to very strong

support for the monophyly of these genera.

Dactylogyrus and Dactylogyroides are somewhat similar genera.

The only difference is in the shape of the bar. All Dactylogyroides have V

shaped bar. In both NJ and MP trees Dactylogyrus and Dactylogyroides

were found in the first clade.

90

Table 1 - Pairwise Distance (Maximum Composite Likelihood)

Dactylogyrus subtilis

Dactylogyrus longiacus 0.73

Dactylogyrus sp.1 0.77 0.75

Dactylogyrus sp.2 0.77 0.77 0.77

Dactylogyrus sp.3 0.75 0.71 0.15 0.79

Dactylogyrus sp.4 0.74 0.72 0.23 0.77 0.15

Dactylogyrus sp.5 0.77 0.74 0.78 0.73 0.80 0.78

Dactylogyroides tripathii 0.78 0.47 0.77 0.74 0.73 0.72 0.78

Dactylogyroides longicirrus 0.71 0.77 0.81 0.73 0.78 0.79 0.77 0.82

Dactylogyroides dorsali 0.73 0.75 0.79 0.34 0.81 0.80 0.77 0.78 0.72

Dactylogyroides mahecoli 0.23 0.79 0.75 0.75 0.75 0.73 0.75 0.76 0.69 0.73

Esomocleidus chakrabarthii 0.75 0.73 0.77 0.78 0.76 0.79 0.76 0.73 0.74 0.79 0.73

Esomocleidus lucknowensis 0.74 0.71 0.79 0.78 0.79 0.76 0.75 0.73 0.76 0.77 0.73 0.74

Esomocleidus esomi 0.74 0.75 0.77 0.77 0.76 0.74 0.76 0.75 0.77 0.78 0.77 0.70 0.70

91

Table 2 -Maximum Composite Likelihood Subtitution Matrix (Tamura Nei Model)

Maximum Composite Likelihood Estimate of the Pattern of Nucleotide Substitution

A T C G

A - 6.99 6.03 14.33

T 6.17 - 9.58 6.51

C 6.17 11.11 - 6.51

G 13.58 6.99 6.03 -

92


Dactylogyrus subtilis 0.89 -1.78 -2.29 -1.48 -1.68 1.30 -0.59 1.05 -0.73 1.17

Dactylogyrus longiacus 0.37 -0.08 0.75 0.07 0.23 0.69 -0.01 1.28 -0.53 2.02

Dactylogyrus sp.1 0.08 0.94 -1.47 0.72 0.72 -0.26 0.31 0.04 -0.29 -1.53

Dactylogyrus sp.2 0.02 0.46 0.15 -1.07 0.45 0.68 -0.43 -1.64 0.03 -2.37

Dactylogyrus sp.3 0.14 0.95 0.47 0.29 -0.45 0.09 -0.31 -0.44 -0.53 -0.62

Dactylogyrus sp.4 0.10 0.82 0.48 0.66 0.65 -0.27 -0.72 0.61 0.50 -0.39

Dactylogyrus sp.5 0.20 0.49 0.80 0.50 0.93 0.79 -0.05 -1.02 -0.20 -0.44

Dactylogyroides tripathii 0.56 0.99 0.75 0.67 0.76 0.48 0.96 -0.25 -1.59 0.66

Dactylogyroides longicirrus 0.30 0.20 0.97 0.10 0.66 0.55 0.31 0.80 -1.68 1.27

Dactylogyroides dorsali 0.47 0.60 0.77 0.98 0.59 0.62 0.85 0.11 0.10 -0.96

Dactylogyroides mahecoli 0.24 0.05 0.13 0.02 0.54 0.70 0.66 0.51 0.21 0.34

Esomocleidus chakrabarthii 0.04 0.94 1.00 0.72 0.54 0.57 0.45 0.24 0.65 0.25 0.03

Esomocleidus lucknowensis 0.20 0.75 0.15 0.24 0.34 0.57 0.05 0.15 0.59 0.39 0.03

Esomocleidus esomi 0.06 0.20 0.25 0.88 0.37 0.79 0.38 0.46 0.09 0.57 0.20

93


Results from Tajima's Neutrality Test [1]

M S ps Θ π D 14 368 1.000000 0.314452 0.760452 6.409283

Abbreviations: m = number of sequences, S = Number of segregating sites, ps = S/m, Θ = ps/a1, π = nucleotide diversity,

and D is the Tajima test statistic.

94





95

Fig:-2 Phylogenetic analysis by Minimum Evolution Method




REFERENCES

Agrawal, N., Agarawl, G.G., Tripathi, P., and Pant, R. 2008.

96

Discriminant analysis: A supportive tool for monogenoidean

taxonomy. Biosci. Trends., 2 (3), 128-132.

Agrawal, N. and Ali, A. 2013. Comparative study of Xenentocleidus

Tripathi et al., 2007, with some Dactylogyrus sp., on the

basis of in- silico analysis., RJB, 01, 03 (In Press).

Agrawal, N., Tripathi, P. and Pandey, K.C. 2010a. Record of the genus

Heteronchocleidus Bychowsky, 1957 (Monogenoidea:

Dactylogyridae) from gills of Colisa fasciata Bloch and

Schenider, 1801 from India with a note on its geographical

distribution. Pak. J. Zool., 42.

Agrawal, N., Pandey, K.C. and Tripathii, A. 2002. Remarks on Indian

species of Dactylogyroides Gusev, 1976, with description of

a new species on freshwater cyprinids of Lucknow. Indian J.

Helminth. (N.S.), 20, 15-18.

Agrawal, N., Tripathi, P., Pant, R. and Agrawal, G.G. 2010b.

Microhabitat distribution of some monogenoideans,

parasitizing the gills of Wallago attu and their seasonal

variation. J. Parasit. Dis., 34, 24-28.

Ali, A., Shrivastava, R.R. and Agrawal, N. 2012. Diversity, host

specificity, speciation and ecological equivalence in some

dactylogyrid monogenoideans, of freshwater fish. Asian Pac.

J. Trop. Biomed., 1-8.

Altschul, S., Gish, W., Miller, W., Myers, E. and Lipman, D. 1990. Basic

local alignment search tool. J. Mol.

Bio., 215 (3), 403– 410.

Andrea, W., Webster, B.L., Bray, R.A., Littlewood, D.T.J. 2007. Added

resolution among ordinal level relationships of tapeworms

97

(Platyhelminthes: Cestoda) with complete small and large

subunit nuclear ribosomal RNA genes. Mol. Phylogen. Evol.,

45, 311-325.

Baverstock, P. R., Fielke, R., Johnson, A.M., Bray , R.A. and Beveridge,

I. 1991. Conflicting phylogenetic hypotheses for the parasitic

platyhelminths tested by partial sequencing of 18S ribosomal

RNA. Int. J. Parasitol., 21, 329-339.

Bentz, S., Leroy, S. du Preez,. L. Mariaux, J., Vaucher, C. and Verneau,

O. 2001. Origin and evolution of African Polystoma

(Monogenea: Polystomatidae) assessed by molecular

methods. Int. J. Parasitol. 31, 697–705.

Bernardi, G. and Crane, N.L. 2005. Molecular phylogeny of the humbug

damshelfishes inferred from mtDNA sequences. J. Fish Biol.,

54, 1210-1217.

Bruno, D.W., Collins, C.M., Cunningham, C.O. and MacKenzei, K.

2001. Combined morphological and molecular analysis of

Gyrodactyloides bychowskii. Dis. Aquat. Org., 45, 191-196.

Bychowsky, B.E. 1957. Monogenetic trematodes, their systematic and

phylogeny. (In Russian) Akad. Nauk. USSR., 1-509.

Cable, J., Harris, P.D., Tinsley, R.C., Lazarus, C.M. 1999. Phylogenetic

analysis of Gyrodactylus spp. (Platyhelminthes: Monogenea)

using ribosomal DNA sequences. Can. J. Zool.,

77, 1439–1449.

Chaudhary, A. and Singh, H.S. 2012a. Description of two new species of

the genus Thaparocleidus Jain, 1952 (Monogenea,

Dactylogyridae) from freshwater fish in India: morphological

and molecular phylogenetic evidence. J. Helminthol., 1-14.

98

Chaudhary, A. and Singh, H.S. 2012b. Phylogenetic position of the

monogenean, Malayanodiscoides bihamuli Lim et Furtado,

1986 inferred from sequence and secondary structure of 28S

rDNA. Zool. Pol., 57/1-4, 47-64.

Chaudhary, A. and Singh, H.S. 2012c. Phylogenetic study of nine species

of freshwater monogeneans using secondary structure and

motif prediction from India. Bioinformation, 8, 862-869.

Chaudhary, A. and Singh, H.S. 2012d. Secondary structure and

phylogenetic utility of the ribosomal large subunit (28S) in

monogeneans of the

genus Thaparocleidus and Bifurcohaptor (Monogenea:

Dactylogyridae). J. Parasit. Dis., 37, 74-83.

Chaudhary, A., Verma, C. and Singh, H.S. 2013. Ribosomal DNA as

molecular markers and their applications in identification of

fish parasites (Platyhelminthes: Monogenea) from India.

Asian Pac. J. Trop. Dis. (In press, Elsevier).

Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins,

D.G. and Thompson, J.D. 2003. Multiple sequence alignment

with the Clustal series of programs. Nucleic Acids

Res., 31 (13), 3497– 3500.

Chiary, H.R., Chaudhary, A. and Singh, H.S. 2013. Phylogenetic

analysis of the Dactylogyroides

longicirrus (Monogenea: Dactylogyridae) based on the 18S

and ITS 1 ribosomal genes. Bioinformation, 9, 250-254.

Chisholm, L.A., Morgan, J.A.T., Adlard, R.D. and Whittington, I.D.

2001. Phylogenetic analysis of the Monocotylidae

99

(Monogenea) inferred from 28S rDNA sequences. Int. J.

Parasitol., 31, 1537-1547.

Cunningham, C.O., MacGillivray, D.M. and MacKenzie, K., 1995.

Phylogenetic analysis of Gyrodactylus salaris Malmberg,

1957 based on the small subunit (18S) ribosomal RNA gene.

Mol. Biochem. Parasitol., 71, 139–142.

Cunningham, C.O. 1997. Species variation within the internal transcribed

spacer (ITS) region of Gyrodactylus (Monogenea:

Gyrodactylidae) ribosomal RNA genes. J. Parasitol., 83,

215–219.

Desdevises Y. 2001. The phylogenetic position of Furnestinia echeneis

(Monogenea, Diplectanidae) based on molecular data: a case

of morphological adaptation. Int. J. Parasitol., 31, 205–208.

Desdevises, Y., Morand S., Jousson, O. and Legendre, P. 2002. Co

evolution between Lamellodiscus (Monogenea:

Diplectanidae) and Sparidae (Teleostei): the study of a

complex host-parasite system. Evolution, 56, 2459–2471.

Dopazo, J. 1994. Estimating errors and confidence intervals for branch

lengths in phylogenetic trees by a

bootstrap approach. J. Mol. Evol., 38, 300- 304.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using

the bootstrap. Evolution, 39, 783–791.

Froese, R. and Pauly, D. 2007. Neolamprologus lelupi [Internet],

FishBase, World Wide Web Electronic Publication. Available

from: <www.fishbase.org>

100

Gasser, R.B., Newton, S.E., 2000. Genomic and genetic research on

bursate nematodes: significance, implications and prospects.

Int. J. Parasitol. 30, 509–534.

Gibson, D.I., Timofeeva, T.A. and Gerasev, P.I. 1996. A catalogue of the

nominal species of the monogenean genus Dactylogyrus

Deising, 1850 and their host genera. Syst. Parasitol. 35, 3-48.

Gusev, A.V. 1963. New species of Monogenoidea from fishes of Ceylon.

Bull. Fish. Res. Stn. Ceylon. 16, 53-93.

Gusev, A.V. 1976. Freshwater Indian Monogenoidea. Principles of

systematics, analysis of world faunas and their evolution. Indian

J. Helminth, 25-26, 1-241.

Hahn, C., Bakke, T.A., Bachmann, L., Weiss, S. and Harris, P.D. 2011.

Morphometric and molecular characterization

of Gyrodactylus teuchis Lautraite, Blanc, Thiery, Daniel &

Vigneulle, 1999 (Monogenea: Gyrodactylidae) from an

Austrian brown trout population. Parasitol. Int., 60. 480-487.

Hancock, K., Broughel, D. E. and Moura, I. N, et al. 2001.

Sequence variation in the cytochrome oxidase I,

internal transcribed spacer 1, and Ts14 diagnostic

antigen sequences of Taenia solium isolates from South and

Central America, India, and Asia. Int. J .Parasitol, 31, 1601–

1607.

Jayaram, K.C. 1999. The freshwater fish of the Indian region. Narendra

Publishing House Delhi, 1-551.

101

Jousson, O., Bartoli, P., Zaninetti, L., Pawlowski, J. 1998. Use of the ITS

rDNA for elucidation of some life cycles of Mesometridae

(Trematoda, Digenea). Int.J. Parasitol., 28, 1403- 1411.

Kaukas, A. and Rollinson, D. 1997. Interspecific variation within the

hypervariable region of the 18S ribosomal RNA gene among

species of Schistosoma Weinland, 1858 (Digenea). Syst.

Parasitol., 36, 157-160.

Kimura, M. 1980. A simple method for estimating evolutionary rate of

base substitutions through comparative studies of nucleotide

sequences. J. Mol. Evol. 16, 111–120.

Kue-A-Pai, P. and Wiwanikit, V. 2005. Contamination of the

Gnathostoma spp infective stage larvae in Fluta alba sold in

Bangkok [Online]. Internet Trop Med, 2, 3.

Littlewood, D.T.J., Rohde, K. and Clough, K.A. 1998. The phylogenetic

position of Udonella (Platyhelminthes). Int. J. Parasitol., 28,

1241-1250.

Lockyer, A.E., Olson, P.D. and Littlewood, D.T.J. 2003. Utility of

complete large and small subunit rRNA genes in resolving

the phylogeny of the Neodermata

(Platyhelminthes): implications and a review of

the cercomer theory. Biol. J. Linn. Soc. 78,

155–171.

Lundberg, J. G., M., Kottelat, G. R. Smith, M. Stiassny and T. Gill.

2000. So many fishes, so little time: an overview of recent

ichthyological discoveriesin fresh waters. Ann. Missouri Bot.

Gard., 87, 26-62.

102

Malmberg, G., and Fernholm, B. 1989. Myxinidocotyle gen. n. and

Lophocotyle Braun (Platyhelminthes, Monogenea,

Acanthocotylidae) with description of three new species from

hagfishes (Chordata , Myxinidae). Zool. Scripta, 18, 187-204.

Matejusova, I. and Cunningham, C.O. 2004. The first complete

monogenean ribosomal RNA gene operon: sequence and

secondary structure of the Gyrodactylus salaris Malmberg,

1957 large subunit ribosomal RNA gene. J. Parasitol., 90,

146-151.

Matejusova, I., Gelnar, M., Mcbeath, A.J.A., Collins, C.M. and

Cunningham, C.O. 2001a. Molecular markers for

Gyrodactylids (Gyrodactylidae: Monogenea) from five fish

families (Teleostei). Int. J. Parasitol., 31, 738–45.

Matejusova, I., Koubkova, B., D'Amelio, S. and Cunningham, C.O.

2001b. Genetic characterisation of six species of diplozoids

(Oligonchoinea: Diplozoidea). Parasitology, 123, 465-474.

Matejusova, I., Koubkova, B. and Cunningham, C.O. 2004. Identification

of European diplozoids (Diplozoidae, Monogenea) by

restriction digestion of the ribosomal RNA internal

transcribed spacer (ITS2). J. Parasitol., 90, 817-

822.

Mendlova, M., Pariselle, A., Vyskocilova, M. and Simkova, A. 2010.

Molecular phylogeny of monogeneans parasitizing African

freshwater Cichlidae inferred from LSU rDNA sequences.

Parasitol Res., 107, 1405-1413.

Mendlova, M., Desdevises, Y., Civanova, K., Pariselle, A. and Simkova,

A. 2012. Monogeneans of West African Cichlid Fish:

103

Evolution and Cophylogenetic Interactions. PLoS ONE, 7(5),

e37268.

Mollaret, I., Jamieson, B.G.M. and Justine, J.L. 2000. Phylogeny of the

Monopisthocotylea and Polyopisthocotylea (Platyhelminthes)

inferred from 28S rDNA sequences. Int. J. Parasitol. 30, 171-

185.

Pallavi, Goswami, M., Nautiyal, P., Malakar, A.K. and Nagpure, N.S.

2012. Genetic divergence and molecular phylogenetics of

Puntius spp. Based on the mitochondrial cytochrome b gene.

MDN., Early Online: 1-7.

Pandey, K.C. and Agrawal, N. 2008. An Encyclopaedia of Indian

Monogenoidea. New Delhi, Vitasta Publishing Pvt. Ltd.

Plaisance L., Littlewood, D.T.J., Olson, P.D. and Morand, S. 2005.

Molecular phylogeny of gill monogeneans (Platyhelminthes,

Monogenea, Dactylogyridae) and colonization of Indo-West

pacific butterflyfish hosts (Perciformes, Chaedontidae). Zool.

Scr. 34, 425–436.

Poisot, T., Verneau, O. and Desdevises, Y. 2011.

Morphological and Molecular Evolution are not linked

in Lamellodiscus (Plathyhelminthes, Monogenea). PLoS ONE

6(10), e26252.

Powers, T.O., Todd, T.C., Burnell, A.M., Murray, P.C.B., Fleming, C.C.,

Szalanski, A.L., Adams, B.A. and Harris, T.S. 1997. The

rDNA internal transcribed spacer region as a taxonomic

marker for nematodes. J. Nematol., 29, 441-50.

104

Porwal, S., Agrawal, N., Pandey, K.C. and Tripathi, A. 2012. Two new

species of Ancyrocephalus (s.l.) Gussev 1976

(Monogenoidea: Dactylogyridae) from the gills of mottled

loach, Acanthocobitis botia (Cypriniformes: Balitoridae)

from India. Indian J. Helminth., 72-77. (Proc. 1st National

Symposium on fish Parasites, Itanagar, March, 19-20, 2012).

Rajvanshi, S. and Agrawal, N. 2011. Could head organs be identifying

taxonomic character in monogenoids? : A case study of some

species of the genus Thaparocleidus Jain, 1952. Indian J.

Helminth. 30, 47-54.

Rajvanshi, S. and Agrawal, N. 2012. Redescription of Thaparocleidus

yogendraii Agrawal,1981 and its validity. Indian J.Helminth.

50-53. (Proc.1st National Symposium on fish Parasites,

Itanagar, March, 19-20, 2012).

Rajvanshi, S. and Agrawal, N. 2013. One known and an unknown species

of the genus Thaparocleidus Jain, 1952, infection Sperata aor

(Hamilton, 1882): Comparision with species from China, on

molecular basis. Bioinformation, 3 (in press).

Saxena, R.M., Jauhari, R.K. and Pandey, M. 2010. Seasonal demography

of trematode parasitesof fishes in relation to sex, size and

physiochemical parameters of water. J. Exp. Zool. India. 13

(2), 613-617.

Shrivastava, R.R., Agrawal G.G. and Agrawal, N. 2012. Seasonal

Variation in Monogenoid Abundance on Puntius sp. RJB,

02: 06, 186-190.

Sicard, M., Desmarais, E. and Lambert, A. 2001. Molecular

characterization of Diplozoidea populations on five

105

Cyprinidae species: consequences for host specificity.

Comptes Rendus De L Academie Des Sciences Serie III-

Sciences De La Vei- Life Sciences, 324, 709- 717.

Simkova, A., Ondrackova, M., Gelnar, M., and Morand, S. 2002.

Morphology and coexistence of congeneric ectoparasite

species: reinforcement of reproductive isolation. Biol. J.

Linn.Soc. 76, 125–135.

Simkova, A., Morand, S., Jobet, E., Gelnar, M. and Verneau, O. 2004.

Molecular phylogeny of congeneric monogenean parasites

(Dactylogyrus): a case of intrahost speciation. Evolution, 58,

1001–1018.

Simkova, A., Plaisance, L., Matejusova, I., Morand, S. and Verneau, O.

2003. Phylogenetic relationships of the Dactylogyridae

Bychowsky, 1933 (Monogenea: Dactylogyridae): the need

for the systematic revision of the Ancyrocephlinae

Bychowsky, 1937. Syst. Parasitol., 54, 1-11.

Simkova, A., Matejusova, I., Cunningham, C.O. 2006. A

molecular phylogeny of Dactylogyridae sensu Kritsky &

Boeger (1989) (Monogenea) based on the D1- D3 domains of

large subunit rDNA. Parasitology, 132, 43-53.

Singh, H.S., Chaudhary, A., 2010. Genetic characterization

of Dactylogyroides longicirrus (Tripathi, 1959) Gussev, 1976

by nuclear 28S segment of ribosomal DNA with a

morphological redescription. Sci Parasitol., 11, 119-127.

Singh, H.S., Chaudhary, A. 2011. A new record of Cornudiscoides

proximus Gussev, 1976, a Freshwater Monogenean and its

106

Phylogeny, Inferred from Partial Sequence of 28S rDNA.

Pak. J. Zool. 43, 183-189.

Sukontason, K., Piangjai, S., Muangyimpong, Y., Sukontason, K.,

Methanitikorn, R. and Chaithong, U. 1999. Prevalence of

trematode metacercariae in cyprinoid fish of Ban Pao District,

Chiang Mai Province, northern Thailand. Southeast Asian J.

Trop. Med. Public Health, 30, 365-70.

Talwar, P.K. and Jhingran, A.G. 1991. Inland fishes. Oxford & IBH

Publishing Company Private Limited, 1 & 2, 1-1062.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar,

S. 2011. MEGA5: Molecular Evolutionary Genetics Analysis

using Maximum Likelihood, Evolutionary Distance, and

Maximum Parsimony Methods. Mol. Biol. Evol., 28, 2731-

2739.

Tondon, V. 2007. Molecular taxonomy of trematodes

parasites- protocols to follow. Manual of the

workshop on fish parasites- taxonomy capacity building.

Andhra University, Vishakhapatnam, India, 76-86.

Tatusova, T.A., Madden, T.L. 1999. BLAST 2 sequences, a new tool for

comparing protein and nucleotide sequences. FEMS

Microbiol Lett., 177, 187-188.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994. Clustal W:

Improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, positions-specific gap

penalties and weight matrix choice. Nucleic Acids Res. 22,

4673-80.

107

Timofeeva, T.A., Gerasev, P.I. and Gibbon, D.I. 1997. A catalogue of the

nominal species of the monogenean family Dactylogyridae

Bychowsky, 1933 (excluding Dactylogyrus Diesing, 1850).

Syst. Parasitol., 38, 153–158.

Tripathi, A., Agrawal, N. and Pandey, K.C., 2009. A redescription of

Sundanonchus behuri (Agrawal & Singh, 1982) n.comb.

(Monogenoidea: Dactylogyridea: Sundanonchidae) from, the

gills of the freshwater Gangetic leaffish, Nandus nandus

(Perciformes: Nndidae) in India. Parasitol. Int., 59, 18-21.

Tripathi, A., Agrawal, N. and Srivastava, N., 2010. Monogenoidea on

exotic Indian fresh water fishes. 1. A new geographical

record of Scidicleithrum iphthimum Kritsky, Thatcher &

Boeger, 1989 (Dactylogyridae:

Ancyrocephalinae) with the first description of its

egg. Comp. Parasitol., 77(1), 83-86.

Tripath, P., Pandey, K.C. and Nirupama Agrawal. 2012. Monogenoidea

on Indian Siluriform Fishes I: On a New Species and

designation of Neotypes to Some Indian Species of the Genus

Bychowskyella Achmerow, 1952 (Monogenoidea:

Dactylogyridae). Pak. J. Zool., 4, 829-835.

Upadhyay, J., Jauhari, R.K. and Devi, N.P. 2011. Parasitic incidence in a

cyprinid fish Labeo rohita (Ham.) at river Song in Doon

valley (Uttarakhand). J Parasit Dis., 36(1), 56-60.

Verma, C., Chaudhary, A., Singh, H.S. 2012. PCR-based molecular

characterization, phylogenetic analysis and secondary

structure of the 28S rDNA of Thaparocleidus

wallagonius (Monogenea: Dactylogyridae) – the most

108

primitive species of this genus from India. Bioinformation, 8,

816-819.

Verneau, O., Bentz, S., Sinnappah, N.D., du Preez, L., Whittington, I. and

Combes, C. 2002. A view of early vertebrate evolution

inferred from the phylogeny of polystome parasites

(Monogenea: Polystomatidae). Proc. R. Soc. Lond. B. Biol

.Sci., 269, 535- 543.

Waeschenbach. A., Webster, B.L., Bray, R.A. and Littlewood D.T.J.

2007. Added resolution among ordinal level relationship of

tapeworms (Platyhelminthes: cestoda) with complete small

and large subunit nuclear ribosomal RNA genes. Mol.

Phylogen. Evol., 45, 311–325.

Ward, R.D., Zemlak, T.S., Innes, B.H., Last, P.R. and

Hebert, P.D.N. 2005. DNA Barcoding Australia’s fish

species. Philos. Trans. R. Soc .B. Biol.Sci., 360, 1847-1857.

Whittington, I. D., Deveney, M.R., Morgan, J.A.T., Chisholm, L.A. and

Adlard, R.D. 2004. A preliminary phylogenetic analysis of

the Capsalidae (Platyhelminthes: Monogenea:

Monoopisthocotylea) inferred from large subunit rDNA

sequences. Parasitology, 128, 511-519.

Wongsawad C, Rojanapaibul A. and Wongsawad P. 2004. Helminths of

vertebrates in Mae Sa stream, Chiang Mai, Thailand.

Southeast Asian J. Trop. Med. Public Health, 35:2, 140-6.

Winchell, C.J., Mallatt, J., Sullivan, J., Cameron, C.B. and Swalla, B.J.

1999. Phylogeny of the deuterostomes: A molecular analysis

of large and small subunit ribosomal RNA gene sequences.

Am. Zool., 39, 135A.

109

Winchell, C.J., Martin, A.P. and Mallatt, J. 2001. Phylogeny of living

elasmobranchs based on LSU and SSU rRNA-gene

sequences. Am. Zool., 41, 1627–1628.

Winchell, C.J., Sullivan, J., Cameron, C.B., Swalla, B.J., Mallatt, J. 2002.

Evaluating hypotheses of deuterostome phylogeny and

chordate evolution with new LSU and SSU ribosomal DNA

data. Mol. Biol. Evol., 19, 762–776.

Winchell, C.J., Martin, A.P. and Mallatt, J. 2004. Phylogeny of

elasmobranchs based on LSU and SSU ribosomal RNA

genes. Mol.Phylogenet. Evol., 31,

214–224.

Wu, X.Y., Zhu, X.Q., Xei, M.Q. and Li, A.X. 2007. The evaluation for

generic- level monophyly of Ancyrocephalinae (Monogenea,

Dactylogyridae) using ribosomal DNA sequence data. Mol.

Phylogenet. Evol., 44, 530-544.

Zardoya, R. and Doadrio, I. 1999a. Molecular evidence on the

evolutionary and biogeographical. J. Mol. Evol., 49, 227–

237.

Zardoya, R., Economidis, P.S. and Doadrio, I. 1999b. Phylogenetic

relationships of Greek Cyprinidae: molecular evidence for

atleast two origins of the Greek cyprinid fauna. Mol.

Phylogenet. Evol., 13, 122–131.

Zietara, M. S. and Lumme, J. 2003. The croosroads of molecular,

typological and biological species concepts: two new species

of Gyrodactylus Nordmann, 1832 (Monogenea:

Gyrodactylidae). Syst. Parasitol., 55, 39-52.

110

Summary

111

The thesis entitled “Molecular Analysis of Monogenoidean

Parasites in some Cyprinids” comprises work done during 2009-2013

on characterisation of monogenoideans infecting some commonly

available cypriniformes fishes of two genera Puntius Hamilton, 1882

(Puntius sophore Hamilton, 1882, Puntius chola Hamilton, 1882, Puntius

ticto Hamilton, 1882) and Esomus Swainson, 1839 (Esomus danricus

Hamilton, 1822). During this period, 14 monogenoidean species were

collected and identified. They were finally subjected to molecular

phylogenetics, using 28S rDNA.

An introduction has been given in the beginning of the thesis. It is

followed by a brief history of work done on molecular phylogenetics of

monogenoids and taxonomy of Indian worms is included. In the

following pages materials and methods is also appended. In the end of the

thesis, literature consulted for the present work is given. The thesis has

been divided into four chapters: I, II, III & IV.

Chapter I It includes records of seven species of the genus Dactylogyrus

Deising, 1850 of which five species are unknown and two are known and

their molecular phylogenetic studies.

1. Dactylogyrus longiacus Gusev, 1976

Gusev (1976) described D. longiacus from P.stigma (now

known as P.sophore) from the water bodies near Lucknow. The

description was based on hard parts only. Agrawal et al. (2003)

redescribed the species in detail and have added structure of soft

parts and variations in sclerotised structures. It is therefore briefly

recorded here.

2. D. subtilis Gusev, 1976

This species was described by Gusev (1976)

from P. stigma (now known as P. sophore), from a water bodies near

Lucknow. Its description was only based on hard parts. Agrawal et al.

(2003) redescribed the species, adding information on soft parts and some

differences in sclerotised structures. It is briefly recorded in the present

work.

3. Dactylogyrus sp.1

The present species was earlier described in detail by Tripathi

(unpublished work) from P. sophore from river Gomti, Lucknow. It is



This species was earlier described by Tripathi (unpublished

work) from P. chola from river Gomti, Lucknow, in detail. It is briefly



The present species was earlier described in detail by Tripathi




112

This species was earlier described in detail by Tripathi


briefly recorded in the present work.


The present species was earlier described in detail

by Tripathi (unpublished work) from P. ticto from river Gomti, Lucknow.

It is therefore briefly recorded here. It is therefore briefly recorded here.


Phylogenetic analysis is largely based on partial 28S

ribosomal DNA (rDNA) sequences. The present study provided the

first insight data on 28S genes of seven species of Dactylogyrus,

occurring on Puntius in India. Sequences of Onchobdella bopeleti

Paperna, 1968 (Accession no. HQ010033) and Onchobdella

aframae Bilong Bilong Euzet, 1995 (Accessesion no. HQ010034)

(Ancyrocephaline monogenoideans), recovered from GENBANK

are used as outgroup for phylogenetic reconstruction. The

phylogenetic trees were computed with Neighbor- Joining (NJ)

method and Minimum Evolution (ME) method. The evolutionary

distances were computed using p-distance method and are in the

units of number of base differences per site. The phylogenies were

tested with 1000 bootstrap replicates. The tree constructed by the

two methods- Neighbor- Joining (NJ) and Minimum Evolution

(ME) have similar topology and approximately similar

bootstrapped values.

Chapter II

113

It includes records of four species of the genus Dactylogyroides Gusev,

1976 and their molecular phylogenetic studies.

Dactylogyroides tripathii (Tripathi, 1959) Gusev, 1963

This species was described by Gusev (1963) from a water bodies near

Lucknow. Agrawal et al. (2002) redescribed the species, adding

information on soft parts and some differences in sclerotised

structures. It is briefly recorded in the present work.

2. D. longicirrus (Tripathi, 1959) Gusev, 1976

Gusev (1976) described D. longicirrus from the water bodies near



3. D. mahecoli Gusev, 1976

Gusev (1976) described D.mahecoli from the water bodies near



4. D. dorsali Gusev, 1976

Gusev (1976) described D.dorsali from the water bodies near




This chapter includes the phylogenetic relationships among four

monogenoideans belonging to genus Dactylogyroides found on two

species of freshwater cypriniformes fish Puntius as Puntius sophore and

Puntius chola in the River Gomti, India. These relationships were

investigated using partial 28S ribosomal DNA (rDNA). Phylogenetic

trees were computed with Neighbor- Joining (NJ) method and Minimum

114

115

Evolution (ME) method. The evolutionary distances were computed

using p-distance method and are in the units of number of base

differences per site. Bootstrap values were included to test the reliability

of inferred trees. The phylogenies were tested with 1000 bootstrap

replicates. Ligophorus chabaudi Euzet and Suriano, 1977 (Accession no.

JN996834) and Ligophorus vanbenedenii (Parona & Perugia, 1890)

Johnston & Teigs, 1922 (Accession no. JN996802) (Ancyrocephaline

monogenoideans), recovered from GENBANK are used as outgroup.

Chapter III

It consists of study of three species of the newly proposed genus

Esomocleidus n.g. and their molecular phylogeny.

1. Esomocleidus esomi (Gusev, 1963) n. comb.

The original description of Ancyrocephalus esomi is brief and

lacks whole mount drawing. Gusev (1963) overlooked certain important

morphological features. He stated the intestinal caeca to be confluent in

Ancyrocephalus esomi. However, in the genus Ancyrocephalus, the

intestinal caeca are separate. In specimens, under study, however, the

intestinal caeca are confluent. Gusev (1963) also overlooked vaginal

armature, annulations on body margin, projection in ventral bar, seminal

vesicle, (two in present worm) and gonads, as well as the whole mount

drawings were also not given. The new genus is characterized by body

annulations/serrations, a shield-like or tube-like vagina located parallel or

anterior to the copulatory complex and an elongate antero-medial

projection of the ventral bar. The present species differs from E.

chakrabartii (Gusev, 1963) n. comb. and E. lucknowensis n.sp. by tube-

like vagina, tri-radiate accessory piece, larger eggs and structure and

shape of hooks.

2. Esomocleidus chakrabartii (Gusev, 1976) n.comb.

The original description of Ancyrocephalus chakrabartii includes

diagrammatic figures and misinterpreted structures. Gusev (1976) stated

the intestinal caeca to be confluent in Ancyrocephalus chakrabartii but in

the generic diagnosis of Ancyrocephalus indicates the

intestinal caeca to be separate. In the present specimens, the

intestinal caeca are confluent. He overlooked vaginal armature but we

have observed perforated shield-like vagina in the present specimens. He

also missed the prostatic reservoirs, (three in present specimen), seminal

vesicle, (two in present worm) and gonads. Ancyrocephalus chakrabartii

is transferred under the new genus Esomocleidus as E. chakrabarti

n.comb. The present species significantly differs from E. esomi (Gusev,

1963) n. comb. and E. lucknowensis n.sp. by having perforated shield-like

vaginal apparatus, tetra-radiate accessory piece and sickle-shaped

copulatory tube.

3. Esomocleidus lucknowensis n.sp.

This species differs from E. esomi (Gusev, 1963) n. comb. and E.

chakrabarti (Gusev, 1963) n. comb. by having as projection in ventral

bar, shape of dorsal bar, muscular vaginal apparatus and shape and size of

hooks.


The phylogenetic analysis is based on partial 28S ribosomal DNA

(rDNA) sequences. Sequences of Dactylogyrus sp.1, recovered from

GENBANK is used as outgroup for phylogenetic reconstruction. The

phylogenetic trees were computed with Neighbor- Joining method and

Minimum Evolution method. The evolutionary distances were computed

using p-distance method and are in the units of the number of base

differences per site. The phylogenies were tested with 1000 bootstrap

replicates.

116

Chapter IV

This chapter deals with the phylogenic relationships

among 14 species of monogenoidea (7 species

belonging to the genus Dactylogyrus, 4 species of Dactylogyroides

and 3 species of genus Esomocleidus). These relationships were

investigated via use of partial 28S ribosomal DNA (rDNA)

sequences. Resolving the interrelationship of these genera is the

main aim of present study. Phylogenetic trees were computed with

Neighbor- Joining (NJ) method and Minimum Evolution (ME)

method. The evolutionary distances were computed using p-

distance method and are in the units of the number of base

differences per site. Bootstrap values were included to test the

reliability of inferred trees. The phylogenies were tested with 1000

bootstrap replicates. Sequences of Tetraonchus monenteron

Diesing, 1858 (Accession no. AJ969953) and Anoplodiscus

cirrusspiralis Roubal, Armitage & Rohde, 1983 (Accession no.

AF382060) recoverd from GENBANK (placed in an outgroup) are

used for phylogenetic reconstruction.

117

118

Publications

Molecular Analysis of Monogenoidean Parasites in some...

Documents

Transcript of Molecular Analysis of Monogenoidean Parasites in some...