ARTICLE

miR-195 regulates SIRT1-mediated changes in diabeticretinopathy

Rokhsana Mortuza & Biao Feng & Subrata Chakrabarti

Received: 20 November 2013 /Accepted: 31 January 2014 /Published online: 26 February 2014# Springer-Verlag Berlin Heidelberg 2014

AbstractAims/hypothesis Endothelial cell (EC) damage is a key mech-anism causing retinal microvascular injury in diabetes. SeveralmicroRNAs (miRNAs) have been found to regulate sirtuin 1(SIRT1, which is involved in regulation of the cell cycle,survival and metabolism) in various tissues and disease states,but no studies have been conducted on the role of miRNA inregulation of SIRT1 in diabetic retinopathy. Here we investi-gated the effect of miRNA-195 (miR-195), a SIRT1-targetingmiRNA, on the development of diabetes-induced changes inECs and retina.Methods The level of miR-195 was measured in human reti-nal and dermal microvascular ECs (HRECs, HMECs) follow-ing exposure to 25 mmol/l glucose (high glucose, HG) and5 mmol/l glucose (normal glucose, NG). SIRT1 and fibronec-tin levels were examined following transfection with miR-195mimic or antagomir or forced expression of SIRT1. Retinaltissues from diabetic rats were similarly studied followingintravitreal injection of an miR-195 antagomir or mimic. Insitu hybridisation was used to localise retinal miR-195.Results HG caused increased miR-195 levels and decreasedSIRT1 expression (compared with NG) in both HRECs andHMECs. Transfection with miR-195 antagomir and forcedexpression of SIRT1 prevented such changes, whereas trans-fection with miR-195 mimic produced HG-like effects. Aluciferase assay confirmed the binding of miR-195 to the 3′untranslated region of SIRT1. miR-195 expression was

upregulated in retinas of diabetic rats and intravitreal injectionof miR-195 antagomir ameliorated levels of SIRT1.Conclusions/interpretation These studies identified a novelmechanism whereby miR-195 regulates SIRT1-mediated tis-sue damage in diabetic retinopathy.

Keywords Diabetic retinopathy .Endothelial cell .miR-195 .

SIRT1

AbbreviationsEC Endothelial cellECM Extracellular matrixFN FibronectinHG High glucose (25 mmol/l D-glucose)HEK Human embryonic kidneyHMEC Human dermal microvascular ECHREC Human retinal microvascular ECmiR microRNAmiRNA microRNAMnSOD Manganese superoxide dismutaseNG Normal glucose (5 mmol/l D-glucose)OSM Osmotic control (25 mmol/l L-glucose)siRNA Small interfering RNASIRT1 Sirtuin 1; silent information regulator protein 1STZ Streptozotocin3′UTR 3′ Untranslated regionVEGF Vascular endothelial growth factor

Introduction

Diabetic retinopathy is a growing problem worldwide and hasno specific medical treatment. In diabetic retinopathy theendothelial cells (ECs) of retinal microvessels undergo a seriesof changes in response to hyperglycaemia, resulting in activa-tion of several transcription factors [1–5]. Such processes lead

Electronic supplementary material The online version of this article(doi:10.1007/s00125-014-3197-9) contains peer-reviewed but uneditedsupplementary material, which is available to authorised users.

R. Mortuza :B. Feng : S. Chakrabarti (*)Department of Pathology, Schulich School of Medicine andDentistry, Western University, DSB – 4033, London,ON, Canada N6A 5C1e-mail: subrata.chakrabarti@lhsc.on.ca

Diabetologia (2014) 57:1037–1046DOI 10.1007/s00125-014-3197-9

to alteration in the expression of various genes, resulting instructural and functional damage [6]. Glucose-induced oxida-tive stress-mediated increased production of extracellular ma-trix (ECM) proteins, such as fibronectin (FN), is a majorcharacteristic feature of diabetic retinopathy. Glucose-induced increased FN synthesis in ECs and diabetes-inducedaugmented FN production in the retina have been demonstratedpreviously [7–14]. It is of interest to know that FN upregulationis a common finding in ageing of endothelium and tissue[15–19].

SIRT1, the longevity gene, is reported to play a crucial rolein regulating cell cycle, survival, metabolism and develop-ment across species [20–25]. We have demonstrated thatglucose-induced increased oxidative stress causes rapid age-ing in ECs and retinas in diabetes [26]. Such processes aremediated through alteration of sirtuins (silent informationregulator proteins; SIRTs), a family of NAD+-dependent classIII histone deacetylases. Furthermore, transcriptional co-activator p300 regulates such pathways by modifying bothSIRT1 (the leading enzyme in the SIRT family) and forkheadboxO transcription factor and altering the antioxidant levels inECs [26]. However, other post-transcriptional means of regu-lating SIRT1 also hold tremendous potential.

With the discovery of microRNAs (miRNAs), research onSIRT1 regulation has progressed and several miRNAs have beenfound to regulate SIRT1 in various tissues and disease conditions[27]. miRNAs are highly conserved, small (19–24 nucleotides),non-coding RNAs that regulate gene expression at the post-transcriptional level by binding with the 3′ untranslated region(3′UTR) of a specific mRNA, causing its degradation or transla-tional repression [27–29]. Over one-third of genes are estimatedto be regulated by miRNAs and miRNAs may play a role inmany biological processes including the development of meta-bolic diseases such as diabetes [27–35].

Although some research has been conducted on miRNA-mediated regulation of SIRT1 in various physiological andpathological conditions [25], no studies have been conductedon such regulation in diabetic retinopathy. In this study weinvestigated the role of a specific miRNA, miR-195, in regu-lating SIRT1 in diabetic retinopathy. Circulating levels of miR-195 are increased in individuals with hypertension, metabolicsyndrome and glucose intolerance [36]. Similar increases havebeen observed in the kidney and liver in animal models ofdiabetes [37, 38]. In cardiomyocytes, miR-195 was found toinhibit SIRT1 and thus promote palmitate-induced apoptosis[39]. miR-195 dysregulation has been associated with severalother diseases, with upregulation occurring in cancers, hyper-trophic cardiomyopathy and pre-eclampsia [40, 41]. In line withthese reports, our previous microarray analysis [42] showedmiR-195 upregulation in ECs exposed to glucose and in theretinas of diabetic rats. As SIRT1 is a possible target ofmiR-195 (www.mirbase.org, www.microrna.org), weexplored this relationship further in diabetic retinopathy.

We investigated whether miR-195 alteration occurs in dia-betic retinopathy, and whether such alterations cause ageing ofECs in hyperglycaemia. Microvascular ECs are the majortarget of glucose-mediated damage in the retina, hence weexamined human retinal and dermal microvascular ECs(HRECs and HMECs) to characterise glucose-inducedmiR-195-mediated regulation of SIRT1 and downstreamcellular changes. We further expanded the study toinvestigate retinas in streptozotocin (STZ)-induced ani-mal models of type 1 diabetes [42, 43].

Methods

Cell culture HRECs were obtained from Olaf (Worcester,MA, USA) and HMECs were obtained from Lonza(Walkersville, MD, USA). Cells were grown in EC basalmedium 2 (EBM-2; Lonza) and the trypan blue dye exclusiontest was used to examine cell viability as previously described[42–44]. The cells were passaged in six-well plates (Corning,Acton, MA, USA) and treated with normal glucose (NG;5 mmol/l D-glucose) or high glucose (HG; 25 mmol/lD-glucose), or with osmotic control (OSM; 25 mmol/lL-glucose), for 72 h. Human embryonic kidney 293A(HEK293A) cells were obtained from ATCC (Manassas,VA, USA) and were used as previously described [42–44].Reagents were obtained from Sigma (Sigma, Oakville, ON,Canada) unless specified otherwise. All experiments wereconducted in six to ten replicates.

mRNA extraction and quantitative analysis TRIZOL(Invitrogen, Burlington, ON, Canada) was used to isolateRNA [42–44]. Real-time RT-PCR was performed using a HighCapacity cDNAReverse Transcription kit (AppliedBiosystems,Foster City, CA, USA) and a Qiagen One Step RT-PCR kit withcustom-made SIRT1 and FN1 primers and LightCycler (RocheDiagnostics, Laval, QC, Canada) as described [26, 43]. The datawere normalised to 18S RNA [26, 43].

miRNA extraction and analysis As described [42, 43], amirVana miRNA isolation kit (Ambion, Austin, TX, USA)was used to extract miRNAs from cells and tissues. Real-timeRT-PCR was conducted with a reaction volume of 20 μl asdescribed [42, 43].

Transfection with miRNA mimic or antagomir ECs weretransfected with miRIDIAN microRNA-195 mimic orantagomir (20 nmol/l) (Dharmacon, Chicago, IL, USA) usingLipofectamine2000 (Invitrogen). Scrambled controls wereused in parallel [42, 43].

Adenoviral forced expression of SIRT1 and SIRT1 gene si-lencing SIRT1 adenovirus (devoid of 3′UTR) and null vector

1038 Diabetologia (2014) 57:1037–1046

were obtained from ABM (Richmond, BC, Canada) andamplified in HEK293A cells. ECs were transduced with theadenovirus (with or without glucose) and samples were col-lected after 72 h of treatment. To silence SIRT1, transfectionwith small interfering RNA (siRNA) was performed asdescribed by us earlier [26].

Luciferase reporter assay for targeting SIRT1-3′UTR Theluciferase vector including 3′UTR of SIRT1 (1,080 bp) con-taining the SIRT1-miR-195 response elements (wt-Luc-SIRT1) and the mutant (mu-Luc-SIRT1) were purchased fromNorClone Biotech (London, ON, Canada). Plasmid DNA(wt-Luc-SIRT1 or mu-Luc-SIRT1, β-galactosidase controlvector) and miR-195 mimic or scrambled oligonucleotidewere co-transfected in HRECs for 48 h. Luciferase activitywas measured using the Dual-Light ChemiluminescentReporter Gene Assay System (Applied Biosystems) andSpectraMax M5 (Molecular Devices, Sunnyvale, CA, USA)and normalised by measuring β-galactosidase activity.

Manganese superoxide dismutase, fibronectin ELISA andSIRT1 enzyme activity assay Manganese superoxidedismutase (MnSOD) and fibronectin (FN) ELISAs were per-formed using commercially available kits [26, 43]. Asdescribed earlier [26], SIRT1 enzyme activity was measuredaccording to the manufacturer instructions (Sigma).

Animal experiments Animal experiments were conducted fol-lowing guidelines specified by the Canadian Council of AnimalCare. Protocols were approved by the Western UniversityAnimal Care and Veterinary Service. The investigations werein accordance with NIH publication no. 85-23, revised 1996.

Male Sprague–Dawley rats (∼175 g, 6 weeks old) wereobtained (Charles River, Wilmington, MA, USA). Diabeteswas induced by a single intraperitoneal injection ofstreptozotocin (STZ) (65 mg/kg, in citrate buffer, pH 5.6).Control rats received an identical volume of citrate buffer.Diabetes was determined as a blood glucose level of>20 mmol/l on three successive days (Abbott Diabetes Care,Alameda, CA, USA). The rats were fed on a standard diet withfree access to water and were monitored daily [42, 43]. Agroup of diabetic rats (n=7/group) received weekly intravit-real injections of 1.5 μg miR-195 mimic or antagomir inlipofectamine reagent in one eye. The other eye receivedscrambled control. The rats were killed 1 week after the fourthinjection. Retinal tissues were collected, snap frozen andstored at −80°C until further analysis.

To assess intravitreal miRNA penetration efficiencyDY547 (red fluorescent dye)-tagged miRNA scramble trans-fection control (Dharmacon) was injected intravitreally. At 2,4, 8 and 24 h following injection, the rats were killed andretinal tissues were collected and snap frozen. DY547-taggedRNA has previously been shown to penetrate into the retina

following intravitreal injection [45]. Slides from the samesections were counterstained with haematoxylin and eosin(H&E) for orientation.

In situ hybridisation As described earlier [43, 46], 5′ and 3′double DIG-labelled custom-made mercury LNA miRNAdetection probes (Exiqon, Vedbaek, Denmark) were used todetect miR-195 expression using an in situ hybridisation(ISH) kit (Biochain Institute, Hayward, CA, USA) in retinaltissue sections. Scrambled probe and no-probe were used ascontrols.

Immunohistochemistry IgG staining was performed on frozenretinal sections using anti-rat IgG (eBioscience, San Diego,CA, USA) with haematoxylin counterstain as described [42,43]. Quantification was performed in a masked fashion usingan arbitrary scale: 0=no extravascular stain of retina; 1=mildextravascular stain; 2=moderate extravascular stain;3=marked extravascular stain.

SA-βGAL staining, phase-contrast and fluorescencemicroscopy Cells or frozen retinal sections were stained withSA-βGAL staining kit (Abcam, Cambridge, MA, USA).Retinal slides were counterstained with H&E for orientation.From each specimen, positive (blue) cells were photographedusing a phase-contrast inverted microscope [26]. The numberof cells per 10 microscopic fields was counted at ×20 magni-fication and presented as a percentage of the total number ofcells [26]. Tissue slides were quantified based on stainingintensity at ×60 magnification as described [47]. Frozen reti-nal sections were examined by fluorescence microscopy usinga TRITC filter at ×20 magnification.

Western blot Western blot analysis was conducted accordingto the standard protocol [10] using SIRT1 and β-actin anti-body (Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Statistical analysis Data are expressed as means ± SEM,normalised to controls (n≥6). Statistical significance wasanalysed by one- or two-way ANOVA followed by Tukey’sHSD post hoc correction and the two-tailed Student’s t test asappropriate (PASW Statistics 18; IBM, Markham, ON,Canada). A p value of <0.05 was considered statisticallysignificant.

Results

Initial screening of Sirt1-targeting miRNAs in diabeticretina In the initial screening of Sirt1-targeting miRNAs,using our previously published array data of retinal tissuesof normal and diabetic animals [42], we found that miR-195expression was increased almost threefold in the retinal tissues

Diabetologia (2014) 57:1037–1046 1039

of the diabetic animals (electronic supplementary material[ESM] Table 1). Other Sirt1-targeting miRNAs, such asmiR-34a, miR-138, miR-9, were reduced and miR-217,miR-199a, miR-200a and miR-132 expression levels wereunchanged (ESM Table 1). On the basis of our initial findingswe further investigated the role of miR-195.

HG causes upregulation of miR-195 and downregulation ofSIRT1 in HRECs Based on the hypothesis that glucose-induced SIRT1 downregulation is mediated by miR195, weexamined HRECs that had been exposed to 5 and 25 mmol/lD-glucose (NG and HG, respectively) for 72 h. These concen-trations were based on our previous dose-dependent analysisof SIRT1 mRNA and protein expression [26]. We confirmedthat SIRT1 mRNA level and SIRT1 enzyme activity inHRECs were reduced following incubation with HG (com-pared with NG) but were unchanged after incubation with25 mmol/l L-glucose (OSM; Fig. 1a, c). We then extractedmiRNA from these cells. Quantitative real-time RT-PCR analy-sis of the ECs incubated in HG confirmed that there wassignificant upregulation of miR-195 compared with ECs

incubated in NG. No effects were seen following incubationwith 25 mmol/l of L-glucose (Fig. 1b).

Glucose-induced SIRT1 reduction in ECs is mediated bymiR-195 We then proceeded to explore the functional signifi-cance of such glucose-induced miR-195 upregulation withrespect to SIRT1 expression. To find a cause–effect relation-ship, we transfected cells in HG with miR-195 antagomir.Transfection efficiencies were assessed by measuringmiR-195 expression and there was a substantial reduction inintracellular miR-195 expression compared with scrambledmiRNA transfection (Fig. 1b). This reduction could be attrib-uted to degradation of the miRNA following binding withantagomir [48]. Additionally, irreversible binding of antagomirwith the miRNAmay further prevent amplification. Such trans-fection effectively rescued glucose-induced SIRT1 downregu-lation. No such effect was seen with scrambled miRNA(Fig. 1a, c). On the other hand, transfection of the HRECs inNG with miR-195 mimic downregulated SIRT1 mRNA pro-duction and enzyme activity, mimicking the effects of HG(Fig. 1a–c). Furthermore, SIRT1 protein and enzyme analysis

f

00.20.40.60.81.01.2

Vector Scramble(100nM)

miR-195(20nM)

miR-195(100nM)

SIRT1 mut +miR-195 (100nM)

SIRT1 mut

Luci

fera

se/β

-gal

act

ivity

(fol

d ch

ange

)

*

*

miR-195 3'ccuCGUCGUGUCGGUUAUAACc5'|||| | :: ||||||

Human SIRT1-3’ UTR 5'uuuuCAGCUCUUUUUAUAUUGu 3‘ (mRNA)3’AAAAGTCGAGAAAAATATAACA 5’ (DNA)

Mutated SIRT1-3’ UTR 3’AAAAGTCGAGAAAAAcTggTtA 5’ (DNA)

Seed sequence

g

*

00.20.40.60.81.01.2

NG HG HG +Scramble

HG + 195(A)

MnS

OD

leve

ls(f

old

chan

ge)

β-Actin

SIRT1

NG HG NG HG+ 195(A) + 195

†

a

**

†

00.20.40.60.81.01.2

NG OSM NG +Scramble

NG + 195 HG HG +Scramble

HG +195(A)

SIR

T1/

18S

(fol

d ch

ange

)

**

†

00.51.01.52.02.53.03.5

NG OSM NG +Scramble

NG + 195 NG +195(A)

HG HG +Scramble

HG +195(A)

miR

-195

/U6

(fol

d ch

ange

)

*

c

b

d e

00.20.40.60.81.01.2

NG HG +195(A)

NG + 195 HG

SIR

T1

enzy

me

activ

ity(f

old

chan

ge)

**

†

Fig. 1 miR-195 regulates SIRT1 in HRECs in hyperglycaemia. (a) SIRT1mRNA and (b) miR-195 expression in HRECs following exposure to HGand NG and transfection with miR-195 mimic and antagomir. (c) SIRT1enzyme activity and (d) protein levels in HRECs following transfectionwith miR-195 mimic and antagomir. (b) Efficiency of transfection withmiR-195 antagomir and mimic, compared with scrambled control, inHRECs. miRNA levels are expressed as a ratio to RNU6B (U6); mRNAlevels are expressed as a ratio to 18S. All data are normalised to 5 mmol/lglucose. *p<0.05 vs NG; †p<0.05 vs HG. n=6. (e) Alignment of SIRT1-3′UTR (andmutated SIRT1-3′UTR) sequencewithmaturemiR-195 based onbioinformatics predictions (www.microrna.org, www.mirbase.org). The 5′end of the mature miR-195 is the seed sequence and has perfect

complementarity with six nucleotides of the 3′UTR of SIRT1. In themutated sequence (lower-case) such complementarity was lost. (f)Luciferase reporter assay in HRECs, showing dose-dependent binding ofSIRT1-3′UTR with miR-195. Mutated SIRT1-3′UTR abrogated theinhibitory effects of miR-195. Relative luciferase activity was expressedas luminescence units, normalised forβ-galactosidase expression. *p<0.05vs vector or mutated SIRT1-3′UTR, n=6. (g) Cellular MnSOD levels withmiR-195 antagomir transfection in HG. *p<0.05 vs NG; †p<0.05 vs HG,n=6. Scramble, scrambled miRNA; 195, miR-195 mimic, 195(A),miR-195 antagomir; Vector, SIRT1-3′UTR luciferase plasmid +β-galactosidase plasmid; SIRT1 mut, mutated SIRT1-3′UTR luciferaseplasmid + β-galactosidase plasmid

1040 Diabetologia (2014) 57:1037–1046

showed that glucose-induced reduced SIRT1 enzyme activityin the ECs was prevented by miR-195 antagomir transfection(Fig. 1c, d). Transfection of HRECs in NG with miR-195mimic caused effects similar to HG by reducing SIRT1 levelsin these cells (Fig. 1c, d).

In parallel, we conducted similar experiments in HMECs toexamine whether these changes are unique to HRECs oruniversal to other microvascular ECs. Similar effects wereseen, confirming the changes observed in HRECs(ESM Fig. 1a–d).

miR-195 binds to 3′UTR of SIRT1 mRNA To examine directbinding of miR-195 with 3′UTR of the SIRT1 mRNA, weperformed luciferase assays in HRECs. We co-transfectedmiR-195 mimic with luciferase reporter plasmids havingcloned miR-195 binding sites for SIRT1-3′UTR or mutatedSIRT1-3′UTR. SIRT1-3′UTR luciferase activity was signifi-cantly repressed with such miR-195 overexpression. Thisrepression was, however, not seen with mutated SIRT1-3′UTR (Fig. 1e, f and ESM Fig. 2). These results confirmedbinding of miR-195 with 3′UTR of SIRT1 mRNA.

miR-195 antagomir prevents HG-induced reduction of SIRT1-regulated antioxidant levels To investigate glucose-induceddownstream functional alterations of miR-195 increase inECs, we measured intracellular antioxidant levels. In previousstudies we have established such SIRT1 mediated changes in

the ECs [26]. Analysis of SIRT1-regulated antioxidantMnSOD revealed upregulation of this enzyme with miR-195inhibition (Fig. 1g). Likewise, HMECs showed similarresponses to miR-195 inhibition in HG (ESM Fig. 1g)

miR-195 antagomir averts FN upregulation in ECs Increasedproduction of the ECMprotein FN is a characteristic feature ofdiabetic retinopathy [7–14]. Hence we examined FN1mRNAand FN protein level in ECs. miR-195 antagomir transfection(not scrambled controls) attenuated HG-induced increasedFN1 mRNA and protein levels in ECs (Fig. 2a, b). Moreover,knockdown of SIRT1 with siRNA in NG resulted in aglucose-like effect in which there was an increase in FN1mRNA and FN protein levels, confirming such regula-tion (Fig. 2c and ESM Fig. 3a, b). Such an effect wasnot seen with scrambled siRNA treatment (Fig. 2c andESM Fig. 3a, b).

SIRT1 forced expression prevents FN upregulation in ECs Wewanted to see whether forced expression of SIRT1 wouldprevent FN upregulation in ECs in hyperglycaemia. Wetransfected HRECs with SIRT1 adenovirus and analysed thecells with real-time RT-PCR (data not shown). SIRT1 enzymeactivity was increased following the transfection in HG-treated ECs compared with empty vector controls (Fig. 2d).Such increased activity normalised the HG-induced FN1 up-regulation in these cells (Fig. 2e). In parallel, we conducted

d

*

e*

a*

b

*

00.51.01.52.02.53.03.5

NG HG HG +Scramble

HG + 195(A)

FW1/

18S

(fol

d ch

ange

)FW1/

18S

(fol

d ch

ange

)FW1/

18S

(fol

d ch

ange

)

00.51.01.52.02.5

NG HG+Scramble

HG + 195(A)

FN

leve

l(f

old

chan

ge)

0

1.0

2.0

3.0

4.0

NG HG + nullvector

HG + Ad-SIRT1

00.20.40.60.81.01.2

NG HG HG + nullvector

HG + Ad-SIRT1

SIR

T1

enzy

me

activ

ity(f

old

chan

ge) †

†

†

†

00.51.01.52.02.53.0

NG NG + nullvector

NG + Ad-SIRT1

NG +Scramble

NG + 195 NG + 195 +Ad-SIRT1

FN

/18S

(fol

d ch

ange

)

f

00.51.01.52.02.53.0

NG NG +Scramble

NG + SIRT1siRNA

c*

*

†

Fig. 2 SIRT1 forced expression prevents glucose-induced FN1 upregu-lation in HRECs. (a) FN1 mRNA and (b) FN protein levels in HRECsfollowing miR-195 transfection in HG. (c) FN1 mRNA levels followingSIRT1 knockdown with siRNA in NG in the HRECs. (d) SIRT1 enzymeactivity following adenoviral forced overexpression of SIRT1 (Ad-SIRT1)in the HRECs, to confirm transfection efficiency at the functional level.

(e) FN1 mRNA levels in HG following Ad-SIRT1 transfection. (f) FN1mRNA levels in NG following transfection with miR-195 mimic and Ad-SIRT1. mRNA levels are expressed as a ratio to 18S, normalised to NG.All data are normalised to controls. *p<0.05 vs NG, †p<0.05 vs HG,n=6. 195, miR-195 mimic, 195(A), miR-195 antagomir; Scramble,scrambled miRNA

Diabetologia (2014) 57:1037–1046 1041

similar experiments in HMECs and the findings were in linewith those observed in HRECs (ESM Fig. 4a–d).

We conducted an additional experiment to see whether theeffects of miR-195 were reversible. We observed that adeno-viral overexpression of SIRT1 (plasmid lacking the bindingsite of miR-195) reversed the miR-195 mimic-induced upreg-ulation of FN1 mRNA levels in NG (Fig. 2f ). Such findingsshow that the detrimental effects of miR-195 are reversible,and confirm the miR-195-mediated regulation of SIRT1 anddownstream changes in these ECs.

miR-195 is overexpressed in the retina in diabetes We thenmoved to a well-established animal model to determinewhether the mechanisms seen in ECs are indeed involved inthe development of retinal microangiopathy. We used STZ-induced diabetic rats demonstrating hyperglycaemia (serumglucose of diabetic rats 20.2±1.9 mmol/l vs controls5.3±0.7 mmol/l, p<0.001) and reduced body weight (diabeticrats 299.0±59.2 g vs controls 460.8±13.2 g, p<0.001). Real-time RT-PCR analysis of retinal tissues of these rats after1 month of uncontrolled diabetes showed significant upregu-lation of miR-195 (Fig. 3a). It is interesting to note that we hadpreviously shown in this model that diabetes causes increasedexpression of ECM protein and vasoactive factor at the sametime point [42, 43]. Such a notion was further confirmed by

using in situ hybridisation and LNA probes. In the retinas ofdiabetic animals, miR-195 was overexpressed in the cells ofinner and outer nuclear layers, ganglion cell layers and ECs ofthe microvessels (Fig. 3b).

Diabetes-induced SIRT1 downregulation in the retina andits downstream effects are mediated by miR-195. To establishthe functional consequence of miR-195 upregulation in the ratretina, we investigated retinal SIRT1 mRNA and SIRT1enzyme levels, as a target of miR-195. Diabetes-inducedmiR-195 upregulation was associated with Sirt1 mRNAdownregulation (Fig. 4c). Simultaneously SIRT1 protein andenzyme level was also reduced in the retina in diabetic rats(Fig. 4d, e). To find a cause–effect relationship, we adminis-tered an intravitreal injection of miR-195 antagomir. Thepenetration efficiency of the drug delivery was confirmed byDY547-tagged miRNA injection, which demonstrated effec-tive transfection of the miRNA in rat retinal layers andmicrovessels 2 h after the injection (Fig. 4a). Intraretinaldelivery efficiency, assessed by measuring miR-195 expres-sion in the retina, showed reduction in retinal miR-195expression (Fig. 4b). Such intravitreal injection of miR-195normalised diabetes-induced SIRT1 reduction in the retinas ofthe treated rats (Fig. 4c–e). We further measured antioxidantlevel in the retinas and found that diabetes-induced reductionin retinal MnSOD levels were ameliorated by miR-195antagomir injection (Fig. 4f ). No such effect was seen follow-ing injection of scrambled oligonucleotides or vehicle(Fig. 4f ). In addition, injection of miR-195 mimic in controlrats caused effects similar to those seen in diabetes, withreduced Sirt1 mRNA and MnSOD levels (Fig. 4c, f ).

We expanded the study to examine the downstream effectsof miR-195-mediated increased oxidative stress and measuredthe level of FN protein in the rat retinal tissue. We observedthat the diabetes-induced upregulated FN protein levels in theretina were reduced by intravitreal injection of miR-195antagomir. Retinal tissue of rats treated with scrambledmiRNA did not show such effects (Fig. 5a).

We then investigated permeability changes and measuredIgG extravasation from the retinal vasculature using IgGimmunostaining. We found that diabetes-induced increasedvascular permeability was reduced by intravitreal injectionof the miR-195 antagomir (Fig. 5b). No extravascular IgGwas seen in the control rats (score=0). Diabetic rats demon-strated a score of 2 or 3, indicating increased extravasation ofIgG. Scores of 0 or 1 were noted in the eyes of diabetic ratsinjected with the miR-195 antagomir, indicating that suchtreatment prevented the diabetes-induced increased vascularpermeability.

miR-195 antagomir prevents SIRT1-mediated EC senescencein hyperglycaemia As SIRT1 is an ageing-associated mole-cule and we have previously shown that the changes in dia-betes are comparable with those associated with accelerated

a

b

01.02.03.04.05.06.07.0

Control Diabetic

miR

-195

/U6

(fol

d ch

ange

)

*

Control Diabetic Diabetic

MiR-195 probe Scramble probeMiR-195 probe

Fig. 3 miR-195 is overexpressed in the retina in diabetes. (a) miR-195expression in the retina of control and diabetic rats. miRNA levels areexpressed as a ratio of RNU6B (U6), normalised to control.*p<0.05 vscontrol, n=7 eyes/treatment. (b) LNA-ISH analysis of retinal tissues ofcontrol and diabetic rats (n=7 eyes/treatment). Blue chromogen showsmiR-195 in the cells of the inner nuclear layers (thin arrow), outer nuclearlayers (thick arrow), ganglion cell layers (arrowhead) and endothelialcells of the microvessels (arrow, inset). Diabetic rat retina stained withscrambled miRNA probe lacking such stain confirmed specificity of themiR-195 probe. Insets show enlarged view of the retinal capillaries. Scalebar, 50 μm for all micrographs. ALK Phos was used as chromogen (blue)with no counterstain in LNA-ISH

1042 Diabetologia (2014) 57:1037–1046

ageing [26], we investigated additional downstream alter-ations of miR-195 increase and SIRT1 downregulation inECs and retina. We stained the cells with SA-βGAL (a lyso-somal enzyme that accumulates in senescent cells), anestablished marker for assessing cellular senescence [26,47]. Transfection with miR-195 antagomir (but not scrambledmiRNA) prevented HG-induced EC ageing, as demonstratedby reduced βGAL positivity (Fig. 6a, b and ESM Fig. 1e, f ).Furthermore, HRECs transfected with miR-195 mimic in NGshowed cellular changes similar to those caused by HG(Fig. 6a, b). In contrast, adenoviral forced overexpression ofSIRT1 in HG ameliorated such effects in the ECs(Fig. 6a, b and ESM Fig. 4e, f ).

We expanded the study and investigated miR-195-mediated cellular changes at a later passage [26]. miR-195antagomir transfection in HRECs at passage 3 showed reduc-tion of cellular senescence along with increasedMnSOD levelwith such treatment (ESM Fig. 3c–e). In parallel, retinaltissues stained with SA-βGAL showed increased positivityin the diabetic rats. Such positivity was significantly reducedin the retina following intravitreal injection of miR-195antagomir, especially in the ECs of the microvessels(Fig. 6c). Scrambled miRNA-treated diabetic rats lacked suchimprovement (Fig. 6c).

**

00.20.40.60.81.01.2

Control Co + Vehicle Co +Scramble

Co + 195 Diabetic Di + Vehicle Di +Scramble

Di + 195(A)

†

MnS

OD

leve

l(f

old

chan

ge)

β-Actin

SIRT1

Co Di + 195(A) Di0

0.5

1.0

1.5

Control Diabetic Co +195

Di + 195(A)

* *

0

0.5

1.0

1.5

Control Diabetic Diabetic +195(A)

*

††

Sirt1/

18S

(fol

d ch

ange

)

SIR

T1

enzy

me

activ

ity(f

old

chan

ge)

RFP-miRNA Vehicle control

02468

1012

Control Di +Scramble

Di + 195(A)

Co +Scramble

Co + 195

*

*

†miR

-195

/U6

(fol

d ch

ange

)

a

c

f

d e

b

Fig. 4 miR-195 antagomir treatment can ameliorate diabetes-inducedreduction in antioxidant levels in rat retinal tissues. (a) Fluorescencemicroscopy images of rat retinas following intravitreal injection of redfluorescent dye (DY547)-tagged miRNA and vehicle demonstrating pen-etration, n=3 eyes/timepoint. Arrows show various layers of rat retina.Inset shows an enlarged view of retinal microvessels. Scale bar, 100 μmfor both micrographs. (b) Retinal miR-195 expression following intravit-real injection of miR-195 antagomir to assess efficiency of intravitrealdelivery. miRNA levels are expressed as a ratio of RNU6B (U6)

normalised to control. (c) Sirt1 mRNA levels in the rat retinas followingintravitreal injection of miR-195 antagomir. mRNA levels are expressedas a ratio to 18S normalised to control. (d) SIRT1 protein level and (e)enzyme activity following injection of miR-195 antagomir. (f) MnSODlevels in the retinal tissues of the control and diabetic rats followinginjection of miR-195 mimic or antagomir. *p<0.05 vs control (Co),†p<0.05 vs diabetic (Di) or Di+Scramble. n=7 eyes/treatment. 195,miR-195 mimic; 195(A), miR-195 antagomir; Scramble, scrambledmiRNA

Diabetic +195(A)Diabetic + Scramble Control

*

0.00.20.40.60.81.01.21.41.61.8

Control Diabetic Di+Scramble Di+195(A)

FN

leve

l(f

old

chan

ge)

†

a

b

Fig. 5 miR-195 antagomir prevents diabetes-induced increase in FN pro-tein and vascular leakage in rat retina. (a) FN protein levels in rat retinaltissues following intravitreal injection of miR-195 antagomir. (b) Immuno-histochemical staining of the rat retinas following miR-195 antagomirtreatment. Brown chromogen indicates IgG extravasation (haematoxylincounterstain). Arrow shows diffuse staining in the retina of the diabetic rat.Inset shows magnified images of retinal microvessels. Scale bar, 50 μm forall micrographs. *p<0.05 vs control; †p<0.05 vs diabetic or diabetic +scramble. Data were normalised to controls. n=7 eyes/treatment. 195(A),miR-195 antagomir; Scramble, scrambled miRNA

Diabetologia (2014) 57:1037–1046 1043

Discussion

In this study we have demonstrated a novel role for miR-195 inregulating hyperglycaemia-induced changes in microvessels indiabetic retinopathy. UsingmiR-195 antagomir transfection, wehave shown that diabetes-induced SIRT1 downregulation, andsubsequent functional consequences, can be prevented by de-creasing the availability of miR-195. We further verified thein vitro findings in vivo, by injecting miR-195 antagomirintravitreally in an STZ-induced rat model of type 1 diabetes;such treatment prevented SIRT1 reduction in these tissuesfollowing 1 month of uncontrolled hyperglycaemia, and nor-malised FN proteins level in diabetes. The role of miR-195-regulated, SIRT1-mediated FN regulation and ageing-likechanges in glucose-induced ECs and retina of diabetic animalshas not been reported earlier.

In diabetes, overproduction of superoxides by the mito-chondrial electron transport chain in the ECs causes DNAdamage, activation of several transcription factors and alter-ation of the expression of multiple genes [6, 9–11, 49]. Wehave demonstrated that glucose-induced SIRT1-mediateddownregulation of MnSOD causes ageing-like changes inECs and retina in diabetes [26]. Such changes are also regu-lated by transcriptional co-activator and histone acetyl

transferase p300 [26]. In this study, we characterised anotherlevel of regulation of glucose-induced SIRT1 downregulationand its downstream effects through alteration of miR-195.

Several lines of evidence have recently been presented todemonstrate that miRNAs play a significant role in a largenumber of cellular processes [27–34]. Adding to such data, wehave previously shown that miR-200b and miR-146a play animportant role in diabetic retinopathy through modulation ofvascular endothelial growth factor (VEGF) and FN, respec-tively [42, 43]. Here we described the role of miR-195 incausing SIRT1 downregulation in ECs, which also mediatesageing-like changes, vascular permeability and FN upregula-tion in diabetes. We investigated the mechanisms at multiplelevels of complexity. After the initial identification ofmiR-195 upregulation in the human retinal capillary ECs,we used miR-195 antagomir and mimic to identify itsin vitro biological significance. We further observed similarchanges in human dermal microvascular ECs (ESM Figs 1and 4). We also demonstrated similar alterations, and exam-ined the functional significance of the mechanism, in anestablished animal model of diabetic retinopathy.

Several changes seen in chronic diabetic complications aresimilar to those associated with the normal ageing process[7–19]. However, such changes are accelerated in diabetes and

a b

NG

HG

HG + Scramble

HG + 195(A)

NG + 195 OSM

HG + Null vector HG + Ad-SIRT1 Diabetic + 195(A)

Diabetic + Scramble Control

c

0

NG HGHG +

Scr

amble

HG + 1

95(A

)NG +

195

OSMHG +

null

vecto

rHG +

Ad-SIRT1

1

2

3

4

5

6

SA

β-g

al p

ositi

vity

(%

)

** *

†

01122334

Control Diabetic +Scramble

Diabetic +195(A)

SA

β-g

al p

ositi

vity

(%

)

*

††

Fig. 6 miR-195 inhibition halts glucose-induced SIRT1-mediated cellu-lar senescence in HRECs. (a) Senescence-associated SA-βGAL stainingof HRECs in HG and NG following treatment with miR-195 mimic andmiR-195 antagomir and with Ad-SIRT1 transfection. Arrow indicatespositive cell (blue). (b) Quantification of SA-βGAL positivity, n=10images/treatment. Scale bar, 100 μm for all micrographs. Inset showsmagnified image showing cytoplasmic SA-βGAL positivity. *p<0.05 vs

NG; †p<0.05 vs HG. (c) SA-βGAL staining of rat retinal sectionsfollowing intravitreal injection of miR-195 antagomir, n=10 images.Arrow shows retinal inner nuclear layers. No counterstain. Inset showsmagnified images of retinal microvessels. Scale bar, 50 μm for allmicrographs. *p<0.05 vs control; †p<0.05 vs diabetic or diabetic +scramble. 195, miR-195 mimic; 195(A), miR-195 antagomir; Scramble,scrambled miRNA; Ad-SIRT, adenoviral forced SIRT1 expression

1044 Diabetologia (2014) 57:1037–1046

we have demonstrated that they are mediated by oxidativestress-induced alterations in SIRT1 [26]. Increased FN pro-duction has been demonstrated in ageing [15–19]. Further-more, augmented production of ECM proteins, such as FN, isa characteristic feature of diabetic retinopathy and is a result ofEC dysfunction induced by hyperglycaemia [7–14]. We andothers have previously demonstrated glucose-induced in-creased FN synthesis in ECs and in the retina in diabetes[7–14]. Such increased FN production can cause outside–insignalling and alteration of vasoactive factors [14, 44]. This isthe first study to demonstrate SIRT1-mediated FN regulationin diabetic retinopathy, modulated by specific miRNA. Thesefindings were further confirmed by SIRT1 forced expressionin ECs, which showed reduced FN1 expression in HG. Wehave shown that miR-195 regulates SIRT1-mediated FN al-teration, further establishing the importance of such mecha-nisms of tissue damage and suggesting a potential therapeuticrole in diabetic retinopathy.

To our knowledge, there is no previous work characterisingthe role of miR-195 in diabetic retinopathy. Our findings are inkeeping with those of previous reports in which miR-195 wasfound to prevent palmitate-induced cardiomyocyte apoptosisand was elevated in the liver and kidney of diabetic animalsand in the circulation of glucose-intolerant patients [36–40]. Itshould be noted that there are other SIRT1-targeting miRNAswhich were not investigated. In keeping with such a notion, inour array analysis, we noted that some SIRT1-targetingmiRNAs were downregulated in diabetes (ESM Table 1).The exact significance of such changes is not clear and theirbiological relevance remains to be established. Specific inves-tigations are required to establish whether such alterationsmay represent counter-regulatory mechanism(s). Neverthe-less, data from our study indicate that miR-195 may representa major miRNA, modulating SIRT1 activity in the context ofearly diabetic retinopathy.

There is an enormous amount of evidence concerning thediverse role of miRNAs in various physiological and patho-logical conditions and miRNAs been associated with manycellular processes including feedback loops for various signaltransduction pathways [27–34]. Interestingly, in a model oftumour angiogenesis miR-195 was shown to be decreased,causing upregulation of VEGF [50]. Hence, it appears thatmolecular mechanisms regarding miRNAs and VEGF regu-lation may differ between tumoral and non-tumoral angiogen-esis. It is also possible that in diabetic retinopathy additionalmechanisms, such as miR-195-mediated reduced SIRT1 caus-ing increased p300 and histone acetylation, may lead to in-creased VEGF production [10, 26]. Hence a complex interac-tion between miRNAs and other epigenetic mechanism, suchas histone acetylation, may be involved in specific proteinproduction. Other miRNAs (e.g. miR200b) have also beenshown to regulate VEGF in diabetic retinopathy [42]. Never-theless, as deregulation of miRNAs leads to a variety of

diseases, miRNAs have the potential to be used as therapeuticdrugs. RNA-based therapies are potentially advantageous dueto their specificity. Therefore, targeting specific miRNAs incombinational therapy holds the potential to prevent multiplegene expression in a multifaceted disease such as diabeticretinopathy.

Funding This study was supported by grants from the Canadian Dia-betes Association and the Heart and Stroke Foundation of Ontario.

Duality of interest The authors declare that there is no duality ofinterest associated with this manuscript.

Contribution statement RM and BF conducted the experiments. RM,BF and SC researched data, designed the study and analysed the data. RMwrote the first manuscript draft. SC reviewed and edited the manuscriptand contributed to discussion. All authors revised and approved the finalmanuscript. RM and SC are the guarantors of this work and take respon-sibility for the integrity of the study as a whole.

References

1. Khan ZA, Chakrabarti S (2003) Growth factors in proliferativediabetic retinopathy. Exp Diabesity Res 4:287–301

2. Antonetti DA, Klein R, Gardner TW (2012) Diabetic retinopathy.N Engl J Med 366:1227–1239

3. Mohamed Q, Gillies MC, Wong TY (2007) Management of diabeticretinopathy: a systematic review. JAMA 298:902–916

4. Rother KI (2007) Diabetes treatment—bridging the divide.N Engl J Med 356:1499–1501

5. Brownlee M (2001) Biochemistry and molecular cell biology ofdiabetic complications. Nature 414:813–820

6. Joussen AM, Poulaki V, Le ML et al (2004) A central role forinflammation in the pathogenesis of diabetic retinopathy. FASEB J18:1450–1452

7. Chen S, Mukherjee S, Chakraborty C, Chakrabarti S (2003) Highglucose-induced endothelin-dependent fibronectin synthesis is medi-ated via NF-kappa B and AP-1. Am J Physiol Cell Physiol 284:263–272

8. Chen S, Khan ZA, Cukiernik M, Chakrabarti S (2003)Differential activation of NF-kappa B and AP-1 in increasedfibronectin synthesis in target organs of diabetic complica-tions. Am J Physiol Endocrinol Metab 284:1089–1097

9. Kaur H, Chen S, Xin X et al (2006) Diabetes-induced extracellularmatrix protein expression is mediated by transcription coactivatorp300. Diabetes 55:3104–3111

10. Chen S, Feng B, George B et al (2010) Transcriptional coactivatorp300 regulates glucose-induced gene expression in endothelial cells.Am J Physiol Endocrinol Metab 298:127–137

11. Chiu J, Khan ZA, Farhangkhoee H, Chakrabarti S (2009) Curcuminprevents diabetes-associated abnormalities in the kidneys byinhibiting p300 and nuclear factor-kappaB. Nutrition 25:964–972

12. Xin X, Khan ZA, Chen S, Chakrabarti S (2004) Extracellular signal-regulated kinase (ERK) in glucose-induced and endothelin-mediatedfibronectin synthesis. Lab Investig 84:1451–1459

13. Roy S, Cagliero E, Lorenzi M (1996) Fibronectin overex-pression in retinal microvessels of patients with diabetes.Invest Ophthalmol Vis Sci 37:258–266

14. Khan ZA, Chan BM, Uniyal S et al (2005) EDB fibronectin andangiogenesis—a novel mechanistic pathway. Angiogenesis 8:183–196

Diabetologia (2014) 57:1037–1046 1045

15. Kumazaki T, Kobayashi M, Mitsui Y (1993) Enhanced expression offibronectin during in vivo cellular aging of human vascular endothe-lial cells and skin fibroblasts. Exp Cell Res 205:396–402

16. GamaMA,Gasperi RD, Rocher AB et al (2010) Age-related vascularpathology in transgenic mice expressing presenilin 1-associated fa-milial Alzheimer’s disease mutations. Am J Pathol 176:353–368

17. Sataranatarajan K, Feliers D, Mariappan MM et al (2012) Molecularevents in matrix protein metabolism in the aging kidney. Aging Cell11:1065–1073

18. Gerrits PO, Weerd H, Want JJ et al (2010) Microvascular changes inestrogen-α sensitive brainstem structures of aging female hamsters.Neurosci Res 67:267–274

19. Sangaralingham SJ, Heublein DM, Grande JP et al (2011) UrinaryC-type natriuretic peptide excretion: a potential novel biomarker forrenal fibrosis during aging. Am J Physiol Ren Physiol 301:943–952

20. Jaliffa C, Ameqrane I, Dansault A et al (2009) Sirt1 involvement inrd10 mouse retinal degeneration. Invest Ophthalmol Vis Sci 50:3562–3572

21. Brooks CL, Gu W (2009) Opinion: how does SIRT1 affect metabo-lism, senescence and cancer? Nat Rev Cancer 9:123–128

22. Rahman S, Islam R (2011) Mammalian Sirt1: insights on its biolog-ical functions. Cell Commun Signal 9:11

23. Kubota S, Kurihara T, Ebinuma M et al (2012) Resveratrol preventslight-induced retinal degeneration via suppressing activator protein-1activation. Am J Pathol 177:1725–1731

24. Peng CH, Cherng JY, Chiou GY et al (2011) Delivery of Oct4 andSirT1 with cationic polyurethanes-short branch PEI to aged retinalpigment epithelium. Biomaterials 32:9077–9088

25. Yamakuchi M (2012) MicroRNA regulation of SIRT1. Front Physiol3:68

26. Mortuza R, Chen S, Feng B, Sen S, Chakrabarti S (2013) Highglucose induced alteration of SIRTs in endothelial cells causes rapidaging in a p300 and FOXO regulated pathway. PLoS One 8:e54514

27. Chuang JC, Jones PA (2007) Epigenetics and microRNAs.Pediatr Res 61:24–29

28. Bartel DP (2009) MicroRNAs: target recognition and regulatoryfunctions. Cell 136:215–233

29. Ørom UA, Lund AH (2010) Experimental identification ofmicroRNA targets. Gene 451:1–5

30. Villeneuve LM, Natarajan R (2010) The role of epigenetics in thepathology of diabetic complications. Am J Physiol Ren Physiol 299:14–25

31. Lorenzen J, Kumarswamy R, Dangwal S, Thum T (2012)MicroRNAs in diabetes and diabetes-associated complications.RNA Biol 9:820–827

32. Wu JH, Gao Y, Ren AJ et al (2012) Altered microRNA expressionprofiles in retinas with diabetic retinopathy. Ophthalmic Res 47:195–201

33. Kantharidis P, Wang B, Carew RM, Lan HY (2011) Diabetes com-plications: the microRNA perspective. Diabetes 60:1832–1837

34. Kovacs B, Lumayag S, Cowan C, Xu S (2011) MicroRNAs in earlydiabetic retinopathy in streptozotocin-induced diabetic rats.Invest Ophthalmol Vis Sci 52:4402–4409

35. Natarajan R, Putta S, Kato M (2012) MicroRNAs and diabeticcomplications. J Cardiovasc Transl Res 5:413–422

36. Karolina DS, Tavintharan S, Armugam A et al (2012)Circulating miRNA profiles in patients with metabolic syn-drome. J Clin Endocrinol Metab 97:2271–2276

37. Chen YQ,Wang XX, Yao XM et al (2011)MicroRNA-195 promotesapoptosis in mouse podocytes via enhanced caspase activity drivenby BCL2 insufficiency. Am J Nephrol 34:549–559

38. Herrera BM, Lockstone HE, Taylor JM et al (2010) GlobalmicroRNA expression profiles in insulin target tissues in a sponta-neous rat model of type 2 diabetes. Diabetologia 53:1099–1109

39. Zhu H, Yang Y, Wang Y et al (2011) MicroRNA-195 promotespalmitate-induced apoptosis in cardiomyocytes by down-regulatingSirt1. Cardiovasc Res 92:75–84

40. Bolmeson C, Esguerra JL, Salehi A et al (2011) Differences in islet-enriched miRNAs in healthy and glucose intolerant human subjects.Biochem Biophys Res Commun 404:16–22

41. He JF, LuoYM,WanXH, Jiang D (2011) Biogenesis ofMiRNA-195and its role in biogenesis, the cell cycle, and apoptosis.J Biochem Mol Toxicol 25:404–408

42. McArthur K, Feng B, Wu Y, Chen S, Chakrabarti S (2011)MicroRNA-200b regulates vascular endothelial growth factor-mediated alterations in diabetic retinopathy. Diabetes 60:1314–1323

43. Feng B, Chen S, McArthur K et al (2011) miR-146a-mediatedextracellular matrix protein production in chronic diabetes complica-tions. Diabetes 60:2975–2984

44. Wu Y, Feng B, Chen S, Chakrabarti S (2012) ERK5 regulatesglucose-induced increased fibronectin production in the endothelialcells and in the retina in diabetes. Invest Ophthalmol Vis Sci 53:8405–8413

45. Turchinovich A, Zoidl, Dermietzel R (2010) Non viral siRNA deliv-ery into the mouse retina in vivo. BMC Ophthalmol 10:25

46. Wang M, Tan LP, Dijkstra MK et al (2008) miRNA analysis in B cellchronic lymphocytic leukaemia: proliferation centres characterized bylow miR-150 and high BIC/miR-155 expression. J Pathol 215:13–20

47. Mimura T, Joyce NC (2006) Replication competence andsenescence in central and peripheral human corneal endothelium.Invest Ophthalmol Vis Sci 47:1387–1396

48. Jan K, Satoru K, Ravi B et al (2007) Specificity, duplex degradationand subcellular localization of antagomirs. Nucleic Acids Res 35:2885–2892

49. Giacco F, Brownlee M (2010) Oxidative stress and diabetic compli-cations. Circ Res 107:1058–1070

50. Wang R, Zhao N, Li S et al (2013) MicroRNA-195 suppressesangiogenesis and metastasis of hepatocellular carcinoma byinhibiting the expression of VEGF, VAV2, and CDC42. Hepatology58:642–653

1046 Diabetologia (2014) 57:1037–1046