TECHNICAL NOTE

Microsatellite markers for the Iberian endemic Bosca’s newt,Lissotriton boscai (Caudata, Salamandridae)

Fernando Sequeira • Alexandre Silva-Ferreira •

Susana Lopes

Received: 20 February 2012 / Accepted: 27 February 2012 / Published online: 10 March 2012

� Springer Science+Business Media B.V. 2012

Abstract The new generation Roche/454 sequencing of

DNA fragments enriched for microsatellite loci was used

to isolated microsatellite markers for the Iberian endemic

Bosca’s newt, Lissotriton boscai. Two multiplex PCR sets

were optimized in order to genotype ten polymorphic

tetranucleotide microsatellite loci. The level of genetic

diversity of these loci was assessed in 42 individuals

from three central-south populations of Portugal (Nazare,

Alcobaca and Evora). The number of alleles per locus

ranged from 11 to 20 (mean; Na = 16). Observed and

expected heterozygosities ranged from 0.50 to 1.0 and 0.55

to 0.92, respectively. We found no deviations from Hardy–

Weinberg equilibrium, nor did we find linkage disequilib-

rium between pairs of loci after Bonferroni correction. We

found no evidence for large allele dropouts or stuttering,

although null alleles were detected for loci Ltb17 and Ltb4

in Alcobaca population. These markers will be useful for

resolving fine-scale population genetic structure, especially

in contact zones between highly divergent lineages of

L. boscai.

Keywords Amphibians � 454 sequencing �Microsatellites � Lissotriton boscai � Iberian Peninsula

Introduction

The Iberian Peninsula is an important world hotspot of

biodiversity, harboring more than 30 % of European

endemic species (Myers et al. 2000; Araujo et al. 2007).

Such high level of endemism is often attributed to the high

landscape heterogeneity and a relative stability of the

climate during the Quaternary glaciations (Hewitt 1996,

2001). In last decades a large body of work drawing from

phylogeographic studies showed that Iberia was one of

the most important glacial refugia during the Pleistocene

glaciations. By consequence, organisms inhabiting Iberia

present in general highly complex patterns of genetic var-

iation when compared to those distributed in more northern

latitudes, which likely results from the multiple opportu-

nities for population’s contraction, expansion and admix-

ture (Weiss and Ferrand 2007).

The bosca’s newt, Lissotriton boscai (Lataste, 1879),

distributed throughout most of the western half of the Ibe-

rian Peninsula, is one of the most representative examples

of such complex phylogeographic patterns found in Iberia.

This morphologically uniform species exhibits deep levels

of geographically structured genetic variability (Martınez-

Solano et al. 2006). Two main highly divergent evolution-

ary lineages have been identified (lineage A, distributed in

most part of the species distribution range with exception of

the central-southwestern coastal region that is occupied by

lineage B), each containing three well-supported sub-lin-

eages. Following Martınez-Solano et al. (2006), the initial

split between the lineage A from the ancestor of lineage B

occurred at approximately 6 million years ago (Myr.), and

both were subsequently fragmented into different popu-

lation groups inferred to have diverged between 2.5 and

1.2 Myr ago. In order to deepen the knowledge about the

genetic structure of L. boscai throughout its entire

F. Sequeira (&) � A. Silva-Ferreira � S. Lopes

CIBIO/UP, Centro de Investigacao em Biodiversidade e

Recursos Geneticos da Universidade do Porto, Campus Agrario

de Vairao, Rua Padre Armando Quintas, 4485-661 Vairao,

Portugal

e-mail: fsequeira@mail.icav.up.pt

A. Silva-Ferreira

Departamento de Biologia, Faculdade de Ciencias da

Universidade do Porto, Rua do Campo Alegre s/n,

4099-002 Porto, Portugal

123

Conservation Genet Resour (2012) 4:715–717

DOI 10.1007/s12686-012-9629-2

distribution range and to perform fine-scaled analysis in

contact zones between the already known divergent

evolutionary lineages, here we report the development

of a set of polymorphic microsatellite loci for this

species.

The microsatellite loci were developed from a partial

enriched genomic library prepared from one individual of

L. boscai (voucher no. IMS1162) sampled in Caracollera,

Ciudad Real, Spain (N 388 420 18.000; W 48 280 30.40). We

extracted genomic DNA from a tail clip using EasySpin

Genomic DNA Minipreps Tissue Kit (SP-DT-250). The

same methodology applies for all samples used for geno-

typing (see below). The microsatellite library was con-

structed at the Evolutionary Genetics Core Facility (EGCF)

from Cornell University Life Sciences Core Laboratories

Center (CLC), following the protocol described by Andres

and Bogdanowicz (2011). Briefly, genomic DNA was

completely digested with a restriction enzyme (five-base

cutter). Linkers were ligated to the digested DNA and the

resulting fragments were enriched for microsatellites by

hybridization and magnetic capture of biotinylated repeat

probes of two dimers, five trimmers, and four tetramers.

Enriched genomic fragments were amplified by PCR, ligated

to Roche/454 Titanium Multiplex Identifier (MID) adapters

and size fractionated in an agarose gel. Sequences were

generated on a Roche/454 sequencer (Titanium chemistry

and adapters).

We designed primers for 24 tetranucleotide microsatellite

loci using the online software Primer 3 v0.4.0 (Rozen and

Skaletsky 2000). Resulting primers (Table 1) were tested for

potential interactions with each other, including primer-dimer

and intramolecular hairpin formation using the software Au-

todimer (Vallone and Butler 2004). Of these loci, 11 reliably

amplified a product of the correct size and were subsequently

tested for polymorphism. Of those, one locus was not con-

sistently amplified in multiplex PCR; the remaining 10 were

polymorphic and were genotyped in 42 individuals collected

from three populations in central-south region of Portugal;

one representing the lineage A (Evora), and two from the

lineage B (Nazare and Alcobaca). Those loci were genotyped

using two multiplex reactions (Table 1) and the Qiagen

Multiplex PCR Master Mix 2X. For each locus, the forward

primer was 50-labelled with a fluorescent dye (VIC, PET,

FAM, or NED). PCR amplifications were performed in a

10 ll reaction volume containing 5 ll Qiagen PCR Master

Mix, 1 ll primer mix (0.025 lM forward primer, 0.25 lM

reverse primer and fluorescent dye of each primer), 3 ll

RNase-free water and & 100 ng of DNA template.

PCR cycling conditions consisted of an initial denatur-

ation at 95 �C for 15 min; followed by a touchdown pro-

gram with nine cycles of 95 �C for 30 s, 60 �C to 56 �C,

decreasing 0.5 �C in each cycle, and 72 �C for 45 s, fol-

lowed by 31 cycles of 95 �C for 45 s, 56 �C for 1 min and

72 �C for 45 s, with a final extension at 60 �C for 30 min.

Table 1 Characterization of 10 tetranucleotide microsatellite markers developed in Lissotriton boscai

Locus Primer pair sequence (50–30) Fluorescent labbeling Repeat motif Multiplex reaction GenBank accession no.

Ltb2 F: GGAGAGATTCAGCAGCAATG FAM (ATCT)15 I JQ733895

R: TGAGCCAGAAGGCAACTATC

Ltb4 F: TGGTGGTTTCAGACTCATCC FAM (ATCT)13 II JQ733896

R: CGGTTTGTGTAGGTGAAGTTG

Ltb9 F: GCACCAAGGTTTCCAATACA VIC (ATCT)20 I JQ733897

R: CGATTCTTTGATGGCACTTT

Ltb10 F: CGCAATTCGTCTCTACAAGG VIC (ATCT)13 I JQ733898

R: TCGTCCTGCAAACAAGTAGC

Ltb11 F: TTGCAGTTTTATGGGTAGAACA VIC (ATCT)15 II JQ733899

R: AAGCCTTTCCACTGAAGTTGT

Ltb12 F: TAACTGGAGTCTGTGCCAAG VIC (ATCT)14 II JQ733900

R: ACCGCTGGAATAGAACAGAG

Ltb17 F: TGAGCCAGAAGGCAACTATC NED (AGAT)15 I JQ733901

R: AAATGAAATGGCGAATAAAGA

Ltb18 F: AGAACAGGAAGACAGGTGGA NED (AGAT)17 I JQ733902

R: ATTGATTCATTGCCAAAGG

Ltb20 F: AACGTGATAGGTTGCAGGTC NED (AGAT)19 II JQ733903

R: CTAGGTATTGCCCAAATTGC

Ltb28 F: CGCAATTCGTCTCTACAAGG PET (ATCT)14 II JQ733904

R: TCGTCCTGCAAACAAGTAGC

Forward (F) and reverse (R) primer sequences, primer label, repeat motif, amplification multiplex panel, and GenBank accession numbers

716 Conservation Genet Resour (2012) 4:715–717

123

From PCR diluted product, we used 1lL in combination

with 10 ll of deionized formamide and 0.2 ll of internal

size standard (Genescan-500 LIZ, ABI). Fragment size was

determined on an ABI prism 3130XL capillary sequencer.

Fragments were scored and binned using GeneMapper v3.7

(Applied Biosystems).

The number of alleles per locus ranged from 11 to 20

(mean; Na = 16). Observed and expected heterozygosities

ranged from 0.50 to 1.0 and 0.55 to 0.92, respectively

(Table 2). The software GENEPOP on the web v3.4 (Ray-

mond and Rousset 1995) was used to calculate expected (HE)

and observed (HO) heterozygosity and to test for deviations

from Hardy–Weinberg equilibrium (HWE) and linkage

equilibrium. We used the Markov chain method with 10,000

dememorization steps and 1,000 batches of 10,000 iterations

per batch. We found deviations from HWE for Ltb17 in both

Nazare and Alcobaca populations, and for Ltb4 in Alcobaca.

However, all loci were found to be in HWE and linkage

equilibrium after applying the Bonferroni correction for

multiple tests (Rice 1989) (Table 2). No evidence for large

allele dropouts, stuttering, and null alleles were detected at

the 99 % confidence level across all loci using MICRO-

CHECKER v2.2.3 (Van Oosterhout et al. 2004), with the

exception of loci Ltb17 and Ltb4 for which we inferred the

presence of null alleles in the Alcobaca population.

Acknowledgments We thank Inigo Martınez Solano and Jose

Teixeira for providing samples. We further thank the Evolutionary

Genetics Core Facility (EGCF), Cornell University Life Sciences

Core Laboratories Center (CLC), for microsatellite library construc-

tion. This work was financed through the Program Operacional

Factores de Competitividade (COMPETE), and by Fundacao para a

Ciencia e a Tecnologia (FCT), through the research Project PTDC/

BIA-BEC/105083/2008. FS is supported by a postdoctoral grant from

FCT (SFRH /BPD/ 27134 / 2006), and AS-F is supported by a

technical research grant from the aforementioned project.

References

Andres JA, Bogdanowicz SM (2011) Isolating microsatellite loci:

looking back, looking ahead. In: Orgogozo V, Rockman MV

(eds) Molecular methods for evolutionary genetics, methods in

molecular biology 772, Part 3, pp 211–232

Araujo MB, Lobo JM, Moreno JC (2007) The effectiveness of Iberian

protected areas in conserving terrestrial biodiversity. Conserv

Biol 21:1423–1432

Hewitt GM (1996) Some genetic consequences of ice ages, and their

role in divergence and speciation. Biol J Linn Soc 58:247–276

Hewitt GM (2001) Speciation, hybrid zones and phylogeography—or

seeing genes inspace and time. Mol Ecol 10:537–549

Martınez-Solano I, Teixeira J, Buckley D, Garcıa-Parıs M (2006)

Mitochondrial DNA phylogeography of Lissotriton boscai

(Caudata, Salamandridae): evidence for old, multiple refugiain

an Iberian endemic. Mol Ecol 15:3375–3388

Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J

(2000) Biodiversity hotspots for conservation priorities. Nature

403:845–853

Raymond M, Rousset F (1995) GENEPOP: population genetics

software for exact test and ecumenism. J Hered 86:248–249

Rice WR (1989) Analyzing tables of statistical tests. Evol Int J Org

Evol 43:223–225

Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users

and for biologist programmers. In: Krawetz S, Misener S (eds)

Bioinformatics methods and protocols: methods in molecular

biology. Humana Press, Totowa, pp 365–386

Vallone PM, Butler JM (2004) AutoDimer: a screening tool for

primer-dimer and hairpin structures. Biotechniques 37:226–231

van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)

MICRO-CHECKER: software for identifying and correcting

genotyping errors in microsatellite data. Mol Ecol Notes 4:

535–538

Weiss S, Ferrand N (2007) Current perspectives in phylogeography

and the significance of South European refugia in the creation and

maintenance of European biodiversity. In: Weiss S, Ferrand N

(eds) Phylogeography of Southern European Refugia. Springer,

The Netherlands, pp 341–357

Table 2 Polymorphism statistics of 10 tetranucleotide microsatellite markers in three populations of Lissotriton boscai

Locus/ID All populations (n = 42) Evora (n = 10) Nazare (n = 13) Alcobaca (n = 19)

Na Allele size range (bp) Na HO HE Na HO HE Na HO HE

Ltb2 19 200–280 9 0.67 0.82 10 0.85 0.87 10 0.84 0.85

Ltb4 17 227–331 8 0.70 0.84 8 0.62 0.80 12 0.63 0.88

Ltb9 19 103–277 4 0.50 0.55 16 0.85 0.92 10 0.84 0.79

Ltb10 11 188–256 9 0.90 0.83 8 1.0 0.75 8 0.84 0.82

Ltb11 17 150–214 9 0.80 0.85 8 0.77 0.78 12 0.79 0.89

Ltb12 17 282–366 10 0.78 0.85 10 0.62 0.85 10 0.94 0.87

Ltb17 20 112–197 10 0.80 0.87 11 0.62 0.88 7 0.35 0.80

Ltb18 19 213–293 9 0.67 0.82 11 0.83 0.88 10 0.84 0.85

Ltb20 10 185–225 4 0.56 0.64 8 0.62 0.78 7 0.84 0.83

Ltb28 11 189–257 9 0.90 0.82 8 1.0 0.75 8 0.84 0.82

Total mean 16 8.1 0.73 0.79 9.8 0.78 0.83 9.4 0.78 0.84

Number of individuals (n), Number of alleles (Na) and allele size length in base pairs (bp) for each population and across all populations;

Expected (HE) and observed (Ho) heterozygosity

Conservation Genet Resour (2012) 4:715–717 717

123