Microarray data analysis

Microarray data analysis

Annamaria [email protected]

Outline

Microarray analysis Pipeline Practicals: Array Express Gene Ontology with David Tool Gene Set Enrichment Analysis (GSEA)

What is a DNA microarray? A grid of DNA spots on a substrate (chip)

used to detect complementary sequences

Monitoring the expression of several thousandgenes at the same time

Hybridization on a chipProbe Array

Labeled cDNA/RNA

Hybridized Array

FluorescentStain (for the data Acquisition)

Detect

Intensity -> how much hybridization occurred for each probe

Zoom in.....

Zoom in..

Zoom in...

How does it look like?

Data flow

Chipscanning

Image Processing

Intensity files .CEL (Affymetrix).txt (Illumina-Agilent)

DATA ANALYSIS USINGOUR PIPELINE

Microarray analysis pipeline

http://microarrayanalysis.tigem.it/index_i.html

Platform supported 3’ Expression array Mouse-> MOE430A, Mouse430_2, MG_U74Av2 Human-> HG-U133A, HG-U133A_2, HG-U133_Plus_2 Whole Transcript Expression and Exon array Mouse-> Mouse Gene 1.0 ST, Mouse Exon 1.0 ST Human-> Human Gene 1.0 ST, Human Exon 1.0 ST

Agilent GE 4x44 Human and Mouse -> two color and one color

Illumina Bead Chip Human and Mouse -> WG-6, Ref-8 and HT-12

Affymetrix 3’ microarray A chip consists of a number of probesets. Probesets are intended to measure expression for a

specific mRNA Each probeset is complementary to a target

sequence which is derived from one or more mRNA sequences

Probesets consist of 25mer probe pairs selected from the target sequence: one Perfect Match (PM) and one Mismatch (MM) for each chosen target position.

Each chip has a corresponding Chip Description File (CDF) which (among other things) describes probe locations and probeset groupings on the chip.

Target sequences and Probes

Example: 1415771_at:

Description: Mus musculus nucleolin mRNA, complete cds

LocusLink: AF318184.1 (NT sequence is 2412 bp long)

Target Sequence is 129 bp long

11 probe pairs tiling the target sequencegagaagtcaaccatccaaaactctgtttgtcaaaggtctgtctgaggataccactgaagagaccttaaaagaatcatttgagggctctgttcgtgcaagaatagtcactgatcgggaaactggttctt

gagaagtcaaccatccaaaactctgtttgtcaaaggtctgtctgaggataccactgaagagaccttaaaagaatcatttgagggctctgttcgtgcaagaatagtcactgatcgggaaactggttctt










Affymetrix probeset

ctgtctgaggataccactgaagaga

ctgtctgaggattccactgaagaga

Perfect match

Mismatch

Probepair

probe pairs values

ONE probeset value

summarization

Background correction and Normalization

Compare different samples on different microarray chips

ExampleControl Tratment

Sample1- sample2 - sample3 Sample1 - sample2 - sample3

replicates replicates

Normalize all together

Differentially expressionWe want to compare two biologically different conditions through the identification of differentially expressed genes

Example

Control Tratment

Sample1- sample2 - sample3 Sample1 - sample2 - sample3

replicates replicates

T-test for each gene

Processing Microarray data(from .CEL files to gene expression)

Background correction Normalization Expression summary

Microarray Analysis Suite (MAS5)(Affimetrix proprietary method )

Robust Multy-array Average (RMA)(Irizarry (2003))

Identifying significant expressed genes in treatment versus control Bayesian t-test (Cyber-T tool) – Multiple testing correction-> False discovery rate (FDR) Paired or unpaired design?

Output is a text file (Excel) with the resulting analysis.

Microarray Pipeline - step 1upload your .CEL files

On Mac:

On Windows:

Microarray Pipeline - step 1upload your .CEL files

Microarray data analysis

Documents

Transcript of Microarray data analysis