Methods in molecular biology II

By:KHURAM AZIZ

Hybridization of nucleid acids

After isolation of the gene from the DNA,we could ask

• location of the gene on a chromosome • position of the gene on a chromosome• if the gene is mutated• if the similar gene is in other organisms

We could ask these questions by using Watson-Crick base pairing

Hybridization of nucleid acids

Doublestrand DNA

High temperatureHigh pH

Temperature decrease,

Decreasing The pH Level

Denaturation - double-stranded deoxyribonucleotic acid unwinds and separates into single-stranded strands through the breaking of hydrogen bonding between the bases

DNA pair by hydrogen bonds to a complementary sequence, forming a double - stranded polynucleotide

Nucleic acid hybridization Fundamental tool in molecular biology which takes advantage of the ability

of individual single-stranded nucleic acid molecules to form double-stranded molecules (that is, to hybridize)

For this to happen, the interacting ss molecules must have a sufficiently high degree of sequence similarity

Standard nuclei acid hybridization assays involve using of labeled nucleic acid probe to identify related DNA or RNA molecules (with a significantly high degree of sequence similarity) within a complex mixture of unlabeled nucleic acid molecules, the target nucleic acid

Principles of nucleic acid hybridization

• Specificity of the interaction between probe and target comes from base complementarity , because both populations are treated in such a way to ensure that all the nucleic acids sequence present are single stranded (ssDNA)

• Thus, if either the probe or the target is initially double-stranded, the individual strands must be separated – denatured (heating or alkaline treatment)

• After mixing single strands of probe with single strands of target, strands with complementary base sequences are allowed to reassociate (reanneal)

Hybridization of nucleid acidswas used for prenatal diagnosis

normal globin sickle-cell globin

normal protein mutated protein

protein

patients

Southern blotting

• The DNA probe is detected by its radioactivity. DNA probes detected by chemical or fluorescence methods are also widely used (A) A mixture of either single-stranded RNA molecules (Northern blotting) or the double-stranded DNA molecules created by restriction nuclease treatment (Southern blotting) is separated according to length by electrophoresis. (B) A sheet of either nitrocellulose paper or nylon paper is laid over the gel, and the separated RNA or DNA fragments are transferred to the sheet by blotting. (C) The nitrocellulose sheet is carefully peeled off the gel. (D) The sheet containing the bound nucleic acids is placed in a sealed plastic bag together with a buffered salt solution containing a radioactively labeled DNA probe. The paper sheet is exposed to a labeled DNA probe for a prolonged period under conditions favoring hybridization. (E) The sheet is removed from the bag and washed thoroughly, so that only probe molecules that have hybridized to the RNA or DNA immobilized on the paper remain attached. After autoradiography, the DNA that has hybridized to the labeled probe shows up as bands on the autoradiograph. For Southern blotting, the strands of the double-stranded DNA molecules on the paper must be separated before the hybridization process; this is done by exposing the DNA to alkaline denaturing conditions after the gel has been run

Southern blotting

Fluorescence labeling of probes

• Direct labeling – a nucleotide containing an attached labeled group is incorporated. Often such systems involve incorporation of modified nucleotides containing a fluorophore, a chemical group which can fluorescence when exposed to light of a ceratin wavelenght

•

DNA microarray (=DNA Chip)Any cells expresses, at any one time, many hundreds or even thousands of genes. Some of products are expressed at high level (e.g. actin) while others may only be expressed in a few copies.

Expresion of different sets of genes

Trying to identify these differences is important field of research.

Different stages of maturation tumor cell vs. normal cell

DNA microarray is a collection of microscopic DNA spots, commonly representing single genes, arrayed on a solid surface by covalent attachment to a chemical matrix. There are currently two platforms/types of DNA microarrays according to the differences in how the nucleid acid samples are generated and delivered to the microarrays:

1. Microarrays of pre-synthesized nucleid acids

2. Microarrays of oligonucleotides synthesized in situ

Figure 1. Glass complementary DNA (cDNA) microarray produced by using high-speed precision robot. This type of DNA microarray can bear between 10,000 - 20,000 spots (genes) on an area of 3.6 cm2. Each spot represents the product of a specific gene and is generated by depositing a few nano liters of PCR product representing that specific gene usually at concentration of 100-500 µg/ml. The diameter of each spot is also typically 50-150 µm.

Figure 2. Illustration of a DNA GeneChip (Affymetrix).

Microarrays of pre-synthesized nucleid acids

The first type of DNA microarray technology developed by Patrick Brown and his colleagues at Stanford University. Individual DNA clones or oligonucleotides are spotted at individual locations on the surface of a microscope slide, specified by precise x,y co-ordinates in a miniaturized grid. It is produced by using a robotic device.

Patrick Brown

Robotic spotting for construction of Dna micoarrays

Microarray robot Laser scanner•http://www.dnalc.org/resources/animations/dnaarray.html

Microarrays of oligonucleotides synthesized in situ

• Oligonucleotides are synthesized in situ on the substrate at defined position. Affymetrix, Inc., a California company, has adapted the process to put thousands of transistors onto a single integrated circuit to making oligonucleotides arrays – GeneChips®

about 1.6 cm2 .- size of small postage stamp

(1 million oligonucleotides per square centimeter)

The glass substrate has a covalent linker molecul terminated with a photolabile (broken down by light) protecting group at every defined array position. A series of photolitographic masks define the oligonucleotide synthesis process. Each mask has certain openings corresponding to defined array positions.

Preparing a GeneChip : http://www.dnalc.org/resources/animations/dnachip.html

The principle of DNA microarray technology is based on the fact that

complementary sequences of DNA can be used to hybridise immobilised DNA molecules. Figure ilustrates an experiment using a GeneChip probe array

cDNAs are labeled with fluorescent tags. Sample A- red Cy5 (cyanine) dyeSample B- green Cy3 (cyanine) dye

After hybridisation, the fluorescence pattern is recorded by laser scanning and the data are analyzed according to the goals of the experiment. If both green and red fluorescent dyes are used simultaneously, the laser detector can distinguish the two because they produce different wavelenghts of fluorescence emmision

Illustration of an experiment using a GeneChip

Microarray Application:

• Identifying gene’s and gene mutations of different types of diseases such as cancer.

• Identifying the expression level, or quantity of genes (mutated or not).

DNA sequencing

DNA sequencing is the process of determining the nucleotide order of a given DNA fragment. There are two methods of DNA sequencing: Chemical method –has been devised by Allan Maxam and Walter Gilbert.(Dideoxy) method was developed by Frederick Sanger and colleagues in 1977.Now it is used more frequently than Maxam-Gilbert method.

Walter Gilbert a Frederick Sanger were awarded the 1980 Nobel Prize in Chemistry.

Walter Gilbert Frederick Sanger

First step is DNA denaturation. So, we obtain single strand DNA. Labeld synthetic deoxyribonucleotide primer is hybridized to the single strand of the DNA in the next step. Then, the primer is elongated in four separate reaction mixtures containing the four normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1. A ddNTP molecule can add at the position of the corresponding normal dNTP, but when this occurs, chain elongation stops because the ddNTP lacks a 3′ hydroxyl. In time,each reaction mixture will contain a mixture of prematurely terminated chains ending at every occurrence of the ddNTP. The oligonucleotide primer is extended using a T7 DNA polymerase from the 5'- end of the primer.

"G" tube: all 4 dNTP, ddGTP and DNA polymerase"A„ tube: all 4 dNTP, ddATP and DNA polymerase"T„ tube: all 4 dNTP, ddTTP and DNA polymerase "C„ tube: all 4 dNTP, ddCTP and DNA polymerase

ddNTP <<< dNTP 1 : 100

Normal deoxyribonucleoside triphospates (dNTPs) plus one of the four dideoxyribonucleoside triphospates (ddNTPs) in a ratio of 100 to 1 is beacuse of the gradual termination of the sequencing reaction.

Structure of a dideoxynucleotide(in this example ddCTP) (in this example dCTP)

Note that the hydroxyl group which is attached to carbon 3′ in normal nucleotides is replaced by a hydrogen atom.

Structure of a nucleotide

The enzyme makes no distinction between dNTPs and ddNTPs. Each time the ddNTP is incorporated, the synthesis stop. Because a lot of DNA molecules are present in the test tube, the strand can be terminated at any G position.

"G" tube

Conventional DNA sequencing. This generally involves using a radioactively labeled nucleotide and size-fractionation of the products of the four reactions in separate wells of a polyacrylamide gel. The dried gel is submitted to autoradiography, allowing the sequence of the complementary strand to be read (from bottom to top). The bottom panel illustrates a practical example, in this case a sequence within the gene for type II neurofibromatosis.

stops DNA synthesisNewly synthetized DNA strand

What do the bands in the gel mean?

PAGE electrophoresis of the "G" reaction

The sequence of the original DNA template strand can be read directly from the resuling autoradiography.

3´- CTTACAGGAAAGAGATTCAGGATTCAGGAGGCCTACCATGAA

We wanted to know this sequence

Separation of terminated fragments is common for all nucleotides

The mixture of terminatedfragment is subjected to gel electrophoresis in parallel

An alternative to the labelling of the primer is to label the terminators instead, commonly called 'dye terminator sequencing'. The major advantage of this approach is the complete sequencing set can be performed in a single reaction, rather than the four needed with the labeled-primer approach. This is accomplished by labelling each of the dideoxynucleotide chain-terminators with a separate fluorescent dye, which fluoresces at a different wavelength. More commonly now, fragments are then size-separated in a narrow glass tube (capillary) filled with a viscous polymer instead of electrophoresis in a slab polyacrylamide gel. The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image.

The gel is placed into a DNA sequencer for electrophoresis and analysis. Each fragment is detected as it passes a laser beam at the bottom of the gel. Each type of ddNTP emits colored light of a characteristic wavelength and it is recorded as a colored band on a stimulated gel image.

DNA sequencer

The computer program interprets the raw data and outputs an electropherogram with colored peaks representing each letter in the sequence

Cappilary

Samples

Electrode

Separation of the terminated fragments according to their sizes

terminatedfragment

Automated DNA sequencers

ABI 3100 16-capillary array

ABI 310 single capillary

Capillary Electrophoresis Instrumentation

GISTs – gastrointestinal stromal tumors

mutations in genes c-kit and PDGFRA

exon 11 c-kit ,exon 12 PDGFRA –good response to imatinibexon 17 c-kit, exon 18 PDGFRA resistent to imatinib

Mutation in c-kit gene in patient with GIST

reference sequence sequence of a patient

mutation at the nucleotide level 1676T→A

mutation at the protein level V559D

Mutation in c-kit gene in patient with GIST

mutation at the nucleotide level 1669T→C

mutation at the protein level W557R

reference sequence sequence of a patient

Real Time PCR

Institute of molecular biology

Conventional PCR

endpoint PCR– detection of product after n cycles

photo of the gel – information about intensity and length of the bands

we just need a standard thermocycler

EtBr – fluorescence dye, which intercalate into DNA it fluoresces when irradiated in the UV part of the spectrum

+

-

Nowadays it is needed the more precise determination

of the amount of the nucleid acid, which input into a PCR reaction.

PCR phases

1. Exponential phase

2. linear phase3. „plateau“ phase

The real-time PCR system is based on the detection and quantitation of a fluorescent reporter

This signal increases in direct proportion to the amount of PCR product in a reaction. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template.

you need real-time thermocycler

high sensitivity and specificity

(1 cancer cell among 10 000 other cells)

Real-time PCR (qPCR) PCR

Representation of optical detection system layout

www.biorad.com

2a. excitation filters

2b. emission filters

1. halogen tungsten lamp

4. sample plate

3. intensifier

5. ccd detector 350,000 pixels

50 copy

10 copy

It is hard to differentiate between the 5-fold change on the agarose gel.

real-time PCR is able detect a 2-fold change (i.e. 10 vs. 20 copies).

Real-Time Vs Traditional PCR

PCR

Quantitation of Gene Expression

Overexpression of the receptor tyrosine kinase HER-2/neu is associated with poor prognosis in patients with breast and ovarian cancer.

Real -Time PCR Applications

Real-Time PCR Applications

Patients with non-small cell lung cancer, who has high EGFR mRNA expression has better response to gefitinib and prolonged progression-free survival.

Gefitinib- selective inhibitor of EGF receptor tyrosine kinase

Dziadziuszko, R. et al. Clin Cancer Res 2006;12:3078-3084

Copyright ©2006 American Association for Cancer Research

Quantification of viral load in clinical samples (e. g. monitoring of herpes viruses after stem cell transplantation)

Quantification of bacterial pathogens as Listeria monocytogenes and Helicobacetr pylory and many others

Array Verification

Monitoring of minimal residual disease in patients with leukaemias and solid tumors (we can monitor effects of anticancer therapy)

Genotyping (Factor V Leiden mutation as an aid to diagnosis in the evaluation of patients with suspected thrombophilia)

Detection Systems used in real-time PCR

A number of detection systems are available for real-time PCR. All are based on the generation of a fluorescent signal that is proportional to the amount of qPCR product amplified.

Band in agarose gelWeak band depicted on the upper picture

corresponds

to less fluorescence. Stronger band corresponds to

high amount of PCR product and more fluorescence

intensity.

SYBR® Green

Non-specific

Relatively inexpensive

Requires post-pcr dissociation curve analysis(Tm melting temperature is defined as the temperature at which half of the

DNA strands are in the double-helical state and half are in single state. It

dependes on the length of the molecule and the specific nucleotide

sequence composition. A higher GC content level indicates a higher melting

temperature).

Non-specific detection systems

Black line indicate product with lower melting temperature Tm (810C) than the other products Tm (89 0C)

Melting curve analysis

This peak corresponds to one band in the agarose gel.

SYBR® Green is an intercalating dye, which binds only to double strand DNA giving an increase flourescence as the amount of PCR product increases. Only bound SYBR® Green is able to flouresce.

SYBR ® Green dye

Specific detection systems

short oligonucleotide hybridise to the PCR

amplicon

hydrolysis probes (TaqMan ®, hybridization

probes, molecular beacons,ScorpionsTM)

specific

expensive

Hydrolysis Probes (TaqMan®)

Taqman system makes use of an

oligonucleotide hybridisation probe with both a reporter and a quencher dye attached. The probe is designedto bind within the amplified PCR fragment.

During the PCR, the probe is cleaved by the 5´ nuclease activity of the Taq DNA polymerase, this releases the reporter dye and generate a sequence – specific fluorescent signal that increase with each cycle.

Hydrolysis Probes (TaqMan®)

Hybridisation probes

Two probes are designed to bind adjacent to one another on the amplicon. One is labeled with a donor fluorophore at the 3´end And the other with an acceptor fluorophore at the 5´end. During the PCR amplification the probes bind to the PCR product which brings two fluorophores next to to each other. This allows energy transfer between the two fluorophores (FRET), leading to a fluorescent signal.

MLPA – multiplex ligation probe assay

We can detect long deletions, insertions, duplications and

amplifications, known mutations and we could use this

method for quantification of mRNA

Principle: uses probes designed to hybridize adjacently to

the target sequence. After ligation, the joined probes are

amplified and quantified

example of using of MLPA: we can detect BRCA1 and

BRCA2 mutations in hereditary breast cancers

Principle of MLPA. For each specific target, a set of two probes was designed that hybridize immediately adjacent to each other on the same target strand. Both probes consist of a short (22–43 nt) target-specific sequence and a universal forward or reverse PCR primer-binding site. In addition, one of the probes contains a so-called stuffer sequence. For each probe, the stuffer part has a specific length (19–364 bp) and sequence. The long probes are M13-derived. The short probes are synthetic. After an overnight hybridization to the target DNA, the two parts of each hybridized probe are joined by a ligation reaction. Next, a PCR is carried out with a single fluorescent-labeled primer pair, which ensures that the relative yield of the PCR products is proportional to the amount of target. The fragment analysis is preferably carried out on an automated capillary sequencer. The multiple fragments can be distinguished based on different length. The peak area value of each product is used to calculate the relative quantity.

Pyrosequencing

Dideoxy DNA sequencing - 96 samples at a time ~ 30-60 kb of sequence per 3-4 hour electrophoretic run - require electrophoresisPyrosequencing – is able to monitor incorporation of each nucleotide in the growing DNA chain and to identify which nucleotide was being incorporated at each step.

DNA chains are synthesized from dNTP precursors

DNA polymerase reaction causes cleavage between the and phosphatesdNMP (containing phosphate) is incorporated into DNA , leaving behind a pyrophospate (containing and hosphate)

Unused dNTPs and excess ATP are degraded by the enzyme apyrase (included in reaction mixture). If selected dNTP is not needed it will be degaraded and no light is produce.

A) DNA polymerase synthetizes a DNA chain byusing a single-stranded DNA template and fourth Normal dNTPs. Instead of having a mixture of the four dNTPs, the individual dNTPs are provided sequentialy. When the correct dNTP is provided, the incorporation ofthe dNMP nucleotide is tracked by the simultaneous production of a pyrophosphate (Ppi) group that is used to produce light. Incorrect dNTP is degradated by the enzyme apyrase.

B) The insertion of the correct base is monitored by lightproduction in a a two-step reaction. The released Ppi is used by the enzyme ATP sulfurylase to generate ATP, which in turn drives a luciferase reaction to produce light, as detected by a charge-coupled device (CCD) camera.

" next-generation" sequencing

• High-throughput, producing thousands sequences at once

• Prize per base is lower

SOLiD™

454 pyrosequencing

DNA is break into short fragments (300-500 bp) and preparing single-stranded templates. Two different oligonucleotide adaptors are ligated to the ends of DNA fragments (adaptors provide universal priming sequences for amplification). Single stranded DNA templates are immobilized on beads and beads are separated from each other by creating an oil-water emulsion. Each droplet contains a single bead and the reagents needed for PCR. After PCR there are 10 milion copies of one DNA fragment on one bead.

biotin streptavidin

Simultaneous sequencing of the entire genome in hundreds of thousands of picoliter- Size wells

The emulsion is then broken to release the beads. The beads are deposited into picoliter wells on a slide (one bead per well) that are then layered with smaller beads that have ATP sulfurylase and luciferase attached to their surface. A fixed sequešnce of the dNTPs precursors (t, then A, then C, then G) is washed over the beads and chemiluminiscent light is emited each time a nucleotide is incorporated.

Output

• Solexa sequencig technology was developed more recently by the Illumina company

• SOLiD™ System has been developed by

the Applied Biosystem company. Also uses an emulsion-based PCR strategy

technology Read length Amount per 1 run

Price for 1 kb

Sanger 1000 bp 36 KB 10 USD

454 400-500bp 0,5GB 0.2 USD

Solid 50bp 180GB

Illumina 75bp 20GB 0.04 USD

'3rd generation' ('next-next-generation') sequencing is knocking on the door. It permit the sequencing of single DNA molecules that are not amplified any way (Helicos Bioscience company)