Medical Genetics "Genetics" Fields: Heredity and its variation. Subfields: - "Human Genetics”:...
-
Upload
gyles-phelps -
Category
Documents
-
view
241 -
download
2
Transcript of Medical Genetics "Genetics" Fields: Heredity and its variation. Subfields: - "Human Genetics”:...
In the Name of AllahThe Most Merciful, The Most Beneficient
Medical Genetics
"Genetics" Fields:
Heredity and its variation.
Subfields:
- "Human Genetics”: denotes the science of heredity and
its variationin human.
- ”Medical Genetics”: deals with human genetic variations
of medical relevance / significance .
Medical Geneticssubgroups
Molecular and biochemical genetics -
the study of the structure and function of individual genes.
Cytogenetics - the study of the
structure of chromosomes.
Population genetics - the study of genetics
of populations.
.Genetic epidemiology -
the study of epidemiology of genetic disease.
Immunogenetics - the study of the genetics of the
immunesystem
Clinical Genetics- concerned with
Clinical manifestationOf genetic diseases
A brief History of Genetics
Historical
* Engravings (around 6,000 years) -Showed pedigree documenting the transmission of certain characteristics of some animals.*Aristotle and Hippocrates
-Human characteristics determined by the semen (utilising the menstrual blood as a culture medium and uterus as an incubator).
-Semen was thought to be produced by the whole body and hence it was explained that 'baldheaded fathers’ had 'baldheaded' sons. * 17th century -‘Sperm' and 'ovum' were recognised by Dutch scientists and it was explained that female could also transmit characteristics to her offspring.
(Contd)
Historical (Conti.)
* 18th and 19th centuries -There was a revival of interest in heredity and it was shown that several traits such as extra digits (polydactyly) were inherited in different ways.
* 19th century
-Joseph Adams published "A treatise on the Supposed Hereditary Properties" and indicated
different mechanisms of inheritance.
-This book was intended as a basis for genetic counselling.
* In 1865, Gregor Mendel
- An Austrian Monk, published his results
of breeding experiments on Garden Peas.
- His work can be considered as the discovery
of `genes' (traits) and how they are inherited.
- He put forward patterns of inheritance of various
characteristics and single gene disorders.
-These are known as ‘Mendels Laws of Inheritance.
Historical (Conti.)
* Mendel showed that some characteristics were: -"dominant" (e.g.tall height), - others were "recessive“ (e.g. short height). -each characteristic was controlled by a pair of "factors". * In 1909, a Danish botanist, Johannsen, named the hereditary factors as ‘genes’. - two identical genes was referred to as `homozygous', - two different genes for the same characteristic, were called `heterozygous'.
Historical (Conti.)
Historical (Conti.)
Multiple forms of the same gene that occupy the same loci
and give rise to different forms of the same characteristics
are referred to as allelomorphs"or alleles
Alleles
Homozygous Heterozygous
* The 20th century ( development of genetics):
- Mendels Laws were independently rediscovered by three workers:
- Hugo De Vries ( in Holland) - Carl Correns (in Germany) and - Erich Von Tschermakin (in Austria).
Historical (Conti.)
* In 1902 :
- Archibald Garrod and William Bateson (fathers of Medical Genetics), discovered `Alkaptonuria'
and recognized it as an inherited disorder involving chemical processes.
- Garrod called it an "Inborn Errors of Metabolism”
- Todate several thousand of such disorders have been identified.
Historical (Conti.)
* In 1903 : - Sutton and Boveri proposed that ‘chromosomes’ carry the hereditary factors. Chromosomes( Chroma=color; soma=body) were recognised as thread like structures, (so called because of their affinity for certain stains).
* In 1906 : - Bateson contributed the term "Genetics" for this new science. * In 1941: - Beadle and Tatum formulated the "one gene - one protein" theory. * In 1956 : - The correct number of chromosomes was established as 46.
Historical (Conti.)
Historical (Conti.)
* By late 1950's : - Excellent techniques for the study of chromosomes were developed. * In 1953: - James Watson and Francis Crick ( in Britain) described the structure of the genetic material i.e. DNA, and were awarded Nobel prize in 1962. * Mid 1970's : -The field of Medical Genetics has been transformed and significant new discoveries about the genes, their expression and genetic diseases have been made.
Historical (Conti.)
* The 'Human Genome Project‘: - An International project, to map the entire human genome, was initiated in 1990 to be completed by the year 2005( however, it was completed in 2003). * To-date: - extensive information has been gained about chromosomes, gene mapping, gene sequencing, functions and genetic disorders.
The genetic knowledge is increasing exponentially and has extensive
applications in clinical medicine
* During the last three decades:
- a decrease in frequency of infectious diseases.
- improved nutrition, antibiotics and immunization.
- almost one third of the patients in paediatric suffer from genetic defects.
It has become essential for all medical
personnel's to have a clear knowledge
of human and medical genetics.
Mendels Laws of Inheritance
Three Laws of Inheritance:
i) The Law of Unit Inheritance.
i) The Law of Segregation.
iii) The Law of Independent Assortment.
The Law of Unit Inheritance
The characteristics (traits i.e. genes) do not blend
( mix), but are inherited as units, which might not
be expressed in the first generation off-springs,
but may appear unaltered in later generations.
First Generation Second Generation TT t t Tt Tt
Tt Tt Tt Tt TT Tt Tt ttAll tall in the first generation 75% Tall and 25% short in 2nd (As t is recessive & does not appear) generation.( T= Tall, dominant gene; t = Short, recessive gene)
The Law of Segregation- The two members of a single trait (gene) i.e. alleles, are never found in the same gamete, but always segregate and pass to different gametes Gamete
Zygote
- The failure of two alleles to segregate due to chromosome Gamete
non-disjunction give rise to genetic defects(e.g. in Down’s syndrome)
The Law of Independent Assortment
* Members of different gene pairs assort to the gametes independently of one another i.e. random recombination of maternal and paternal chromosomes occur in gametes.
Maternal Paternal Crossing-over Gametes
The exceptions to Law of Independent Assortment (not recognised by Mendel) are closely "linked“ genes on the same chromosome, which do not assort independently.
Maternal Paternal Crossing-over Gametes
The Genetic Material
What is the Genetic Material?
Proteins ?RNA?DNA?
( Smooth &Virulent)- due to polysaccharide capsule
(Non-Virulent)Due to absence
of polysaccharidecapsule
(Non-Virulent)
What is the Transforming Factor?
(Non-Virulent)
(Non-Virulent) (Virulent)
Transformation
Griffith’s ExperimentIn live animal
Of rough to smooth form
Griffith’s Experiment
Conducted in 1928 On a bacteria that produces pneumonia:- R(Rough) strains were non-virulent(did not produce disease)- S(Smooth) strains were virulent (produced disease) - Heated R and S strains were both non-virulent
_The experiment:- R injected in rats No disease- Heated R injected in rats No disease- S injected in rats Disease (Rat Died)- Heated S injected in rats No disease- Heated S + live R injected in rats Disease (Rat Died) Some substance in heated S transformed the R to S
What was the Transforming Principle?
Experiment of Avery, Macleod and McCarty (1944)
(Culture) In culture
Growth of S colonies
What is the Transforming Factor?
No colonies
Smooth colonies
The Transforming Principle
Experiment of Avery, Macleod and McCarty (1944)
1. Took extract from virulent(S) cells + R cells S Colonies As the bacteria was destroyed, but DNA was not.
2. Treated the extract with: (a) Proteases---------Mixed with R cells S Colonies
(b) Ribonuclease----Mixed with R cells S Colonies
(c) DNase------------Mixed with R cells No Colonies of S Concluded that the transforming principle in the extract was DNA
(Mixing)
These and many other experiments provedthat DNA is the carrier of genetic
informationin all living organisms except RNA viruseswhich have RNA as the carrier of genetic
information
Genetic Material in the Living Cells *All living organisms are made
up of cells.
* Cells contain a nucleus surrounded by a nuclear membrane in eukaryotic cells, and a nuclear region in the
prokaryotic cells.
*Chromatin is made up of DNA and proteins (mainly histones(basic) and non-histone
(acidic) proteins.
Genetic material…contd•The study of chromosomes, their structure and
their inheritance is known as Cytogenetics.•Each species has a characteristic number of
chromosomes and this is known as karyotype.•Prior to 1950's it was believed that humans had
48 chromosomes but in 1956 it was confirmed that each human cell has 46 chromosomes (Tjio
and Levan, 1956).•The genes are situated on the chromosomes in
a linear order. Each gene has a precise position or locus.
Chromatin
Chromosomes(Metaphase)
Chromosomes
*One member of each chromosome pair is derived from each parent .
*Somatic cells have diploid complement of chromosomes i.e. 46.
*Germ cells (Gametes: sperm and ova) have haploid complement i.e 23.
*The chromosomes of dividing cells are most readily analyzed at the `metaphase' or
prometaphase stage of mitosis .
The Normal Human Chromosomes*Normal human cells contain 23
pairs of homologous chromosomes:
-22 pairs of autosomes (numbered as 1-22 in
decreasing order of size) -1 pair of sex chromosomes.*Autosomes are the same in
males and females*Sex chromosomes are: - XX in females
-XY in males . *Both X are homologous. Y is
much smaller than X and has only a few genes.
q
p
Chromosome Structure
*At the metaphase stage each chromosome consists of two
chromatids joined at the centromere or primary
constriction•The centromere divides
chromosomes into short (p i.e. petit) and long (q e.g. g=grand) arms. The tip of each
chromosome is called telomere.•The exact function of the
centromere is not clear, but it is known to be responsible for the movement of the chromosomes
at cell division.
p
q
Centromere
Telomere
Chromosomes … contd
•In a non-dividing cell the nucleus is filled with a thread-like material known as
"chromatin."
•Before cell division, the chromatin multiplies (replicates), loses the relatively homogenous appearances and condenses to form rod like
structures.
•"Genes",
are units of genetic information present on the DNA.
Mitosis
The Cell Cycle
G2
G1
SGo
Each species has a characteristic gene map i.e. the chromosomal location of the genes, and
it is the same in all normal individuals of each species
• Chromosomes are classified (analysed) accordig to:
•1. Shape and •2. Staining
1. Morphologically (shape)
According to the position of the centromere as:
(i) metacentric,
(ii) sub-metacentric,
(iii) acrocentric,
(iv) telocentric (with centromere at one end.
This occurs in other species, but not in man).
Classification Of Chromosomes
MetacentricChromosomes
Sub-MetacentricChromosomes
Centromere
Telomeresp
q
* Acrocentric chromosomes (13, 14, 15, 21 and
22) have a small mass of chromatin known
as satellite attached to their short arm by
narrow stalks (secondary constrict).
* The stakes contain genes for 18S and 28S rRNA.
Satellite
Stalk
Staining Methods for cytogeneticanalysis of chromosomes
•There are several staining methods for cytogenetic analysis of chromosomes.
•Each stain produces specific banding patterns known as "Chromosome Banding "
-G banding , - Q banding ,
-R banding , -C banding.
•The pattern is specific for each chromosome, and is the characteristics utilized to identify each chromosome.
Staining Methods for Cytogenetic Analysis
G Banding:Treat with trypsin and then with Geimsa Stain.
R Banding:Heat and then treat with Geimsa Stain.
Q Banding:Treat with Quinicrine dye giving rise to
Fluorescent bands.
C Banding:Staining of the Centromere.
The G-Banding Pattern of
Chromosomes
DNA packing in the Chromosomes
Composition of Nucleosomes
DNA Histones
2( H2A,H2B,H3,H4)
The Genetic material-Deoxyribonucleic acid (DNA)
-Double strandof polynucleotide.-Coiled around each other forming double helix.-Strands are anti- Parallel.-Sugar phosphate backbone is outside & bases are inside.-A=T and G=C.-A/T=1 andG/C=1 (Cargaff Ratio)
5’
3’
3’
5’
Nitrogenous bases in DNA and RNA
Purines
Pyrimidines
Detailed view of DNA Structure
The Central Dogma
Replication-in nucleus
Transcription-in nucleus
Translation-in cytoplasm on ribosomes
DNA Replication -Replications occurs before cell division. During S Phase of cell cycle.-Entire DNA content
is doubled.-Replication is Semi-conservative.-Requires: -DNA polymerases -dNTPs(N=A,T,C,G) -RNA primer -Mg++ -DNA ligases - Primase - Helicase - SS DNA binding proteins
Major Steps in DNA Replication
Leading strand,continuous
Lagging strand
Transcription
Steps in transcription
Initiation
Elongation
•Binding of RNA polymerase causes opening of the DNA
strand and synthesis of the RNA
•RNA polymerase continues synthesis of RNA complementary
to DNA till termination site
Elongation -contd
Termination
Steps in transcription (contd)
•Rho factor binds to the termination site and when RNA polymerase
reaches this site, termination occurs
Translation
On ribosomes
Ribosomes- free and attached to endoplasmic reticulum
Codons on mRNA
Structure of tRNA
Steps in Translation
ii. Elongation
i. Initiation
iii. Termination
Polysomes
Mitochondrial DNA
•In the human mitochondria the chromosomes are present as 10 circular double helices of DNA.
•They are self replicative.•Contain: 16,596 bp, genes for 22 tRNAs and 2 types of
ribosomal RNA required for mitochondrial protein synthesis.
•They also have genes for 13 polypeptides, involved in cellular oxidative phosphorylation.
•Both strands of DNA are transcribed and translated.
Mitochondrial DNA
•The genes on mitochondrial DNA have no introns.
•The codon recognition pattern for several amino acids is different from the nuclear DNA.
•Mitochondria are transmitted in the egg from a mother to all of her children. Thus mitochondrial
DNA is only maternally derived.
The Cell Cycle
Mitosis
G1
S
G2
Go
The Cell Cycle
•The cell cycle consists of 2 phases : Mitosis and Interphase.
•Mitosis (cell division) is the shortest phase.•Interphase The period between successive mitosis.•The G1, S and G2 phase constitute interphase .•In a typical growing cell this lasts 16-24 hours and
mitosis lasts 1-2 hours.•Some cells e.g. neurons and RBCs, do not divide
and enter the Go phase. Other cells may enter Go but eventually return to continue through the cell
cycle. (Contd..)
The Cell Cycle (Contd..)
•Immediately after mitosis, the cell enters G1 (Gap 1) phase, where there is no DNA synthesis. Some cells spend a few hours others up to years in this phase. At this phase
cells perform metabolic functions.
•S phase - the phase of DNA synthesis .
Each chromosome in G1 phase double, and forms two chromatids joined together. By the end of S phase the DNA content of cells is
doubled.
The Cell Cycle (Contd..)
•G2 phase - The chromatin condenses and forms chromosomes. Each chromosome consists of two identical sister chromatids. During this period the DNA synthesis is restricted, RNA and protein synthesis occur and cell enlarges, eventually doubling its total mass before
next mitosis.
Cell Division
Cell Division
- Occurs in Somatic cells.
- Division by which the body
grows, differentiates and repairs. - Results in two identical daughter Diploid cells with genes identical to parent cells. - Chromosomes are first doubled, followed by cell division in which the number in each cell is halved (diploid).
Mitosis: Meiosis:
- Occur in cells of germ line.
- Only once in generation. - Results in the formation of
haploid, reproductive cell (gametes: ova and sperms). - Chromosomes duplicates followed by 2 cell divisions resulting in cells with half the number of chromosomes (haploid).
Mitosis•At conception the human zygote consists of a
single cell. This undergoes rapid cell division leading ultimately to the mature human adult body. Each adult human being has
approximately 1x1014 cells in the body.
•In most organs and tissues e.g. bone marrow, skin etc. cells continue to divide
throughout life.
•This process of somatic cell division during which the nucleus divides to produce two
identical daughter cells is known as Mitosis.
Mitosis (contd..)
*Each chromosomes divides into two daughter chromatids, one of which
segregates into each daughter cells.
-The number of chromosomes per cell remains unchanged.
- Mitosis lasts 1-2 hours.
- It occurs in five distinct stages:
Prophase, prometaphase, metaphase, anaphase and telophase.
Phases of Mitosis:
Prophase: The chromosome condenses and mitotic spindle begins to form. Two centrioles form in each cell from which microtubules radiate as the centrioles move towards
opposite poles of the cell.
Prometaphase: The nuclear membrane begins to disintegrate and chromosome spread around the cells. Each chromosome becomes attached at its centromere to a microtubule of the mitotic spindle by a specialised structure called
Kinetochores.
Phases of Mitosis (Contd..):
•Metaphase: The Chromosomes are maximally contracted and most easily visible. The Chromosomes become oriented along the equatorial plain and each chromosome is attached to the centriole by a microtubule
forming the mature spindle.•Anaphase: The centromere of each
chromosome divides longitudinally and the two daughter chromatids separate to opposite poles
of the cell.
Telophase: The chromatids separate completely
and a new nuclear membrane is formed around
each set of chromosomes. The cytoplasm
separates (cytokinesis) to form two daughter
cells.
Phases of Mitosis (Contd..):
Mitotic Cell Cycle:
•The type of cell division by which the diploid cells of the germline give rise to haploid gamets, i.e. oocytes
and sperms.•The process involves two successive meiotic
divisions:•Meiosis I: This is the reduction division and the
chromosome number is reduced from diploid to haploid.
•Meiosis II - follows Meiosis I without an intervening stage of DNA replication. The chromosomes disjoin, and one chromatid of each chromosome
passes to each daughter cell.
Meoisis:
•Meiosis I:This stage has: Prophase I, Prometaphase I,
Metaphase I, Anaphase I & Telophase I, just like mitosis.
•Meiosis II: has :
Metaphase II and telophase II and results in formation of ova in
female and sperms in males.
Meoisis:
Meiotic
Cell Cycle:
- Reduction of chromosome number from diploid to haploid, the essential step in the formation of gametes.
- Segregation of alleles, at either meiosis I or meiosis II, in accordance with Mendel’s First Law.
- Shuffling of the genetic material by random assortment.
- Additional shuffling of genetic material by crossing-over mechanism substantially increasing genetic variation.
Genetic Consequence of Meiosis
Gametogenesis:
There are differences in female and males gametogenesis
.1Oogenesis: Mature ova develops from oogonia by a complex series of
intermediate steps:•During the first few months of embryonic life:
Oogonia originate from primodial germ cells
by a process involving 20-30 mitotic divisions. •At completion of embryogenesis at 3 months of intra-
uterine life :
The oogonia mature to primary oocytes which start to undergo meiosis.
Gametogenesis:
•At birth, all primary oocytes have entered dictyotene, a phase of maturation arrest at which they remain resuspended until meiosis is completed at the time of
ovulation. •At the time of ovulation, a single secondary oocyte is
formed. Most of the cytoplasm is received by the daughter cell from the 1st meiotic division consists largely
of a nucleus known as a polar body.•Meiosis II then commences during which fertilization can
occur. A second polar body is formed.
Gametogenesis:
2 .Spermatogenesis: Rapid process - average duration of 60-65 days.
•At puberty, spermatogonia (which have already undergone 30 mitotic divisions) begin to mature into
primary spermatocytes.•These enter meiosis 1 and emerge as haploid secondary
spermatocytes.•These undergo second meiotic division to form
spermatids, which change to mature spermatozoa
- Increase or decrease in the amount of gene products (proteins).- Decrease in the amount of one protein.- Defective function of the protein.
- Increased function.- Decreased or complete loss of function.
- Decrease or increase in the amount of genetic material- Abnormal genetic maerial
Mutations in the: * Genome,
* Chromosome or * Gene
Genetic Disorders
Genetic Disease
Genetic Diseases
Classification of Genetic Diseases
Single GeneDisorders
Chromosomal Disorders
Multifactorial Disorders
Acquired Somatic Genetic Diseases
MitochondrialDisorders
Single Gene Disorders
• Caused by mutation in or around a gene.• Can lead to critical errors in the genetic information.• Exhibit characteristic pedigree pattern of inheritance (Mendelian Inheritance)• Occur at a variable frequency in different population•Over 7,000 single gene disorders have been identified.• May be: - Autosomal - Sex linked
Chromosomal Disorders
• Result from defect in the number (i.e. Numerical disorders) or structure (i.e. Structural disorders) of chromosomes.• The first chromosomal disorder was Trisomy 21 (Downs syndrome) and was recognised in 1959.• These disorders are quite common and affect about 1/800 liveborn infants.• Account for almost half of all spontaneous first-trimester abortions.• Do not follow a Pedigree pattern of inheritance.
Multifactorial Disorders
• Result from interaction between environmental and genetic factors.• Often polygenic in nature, no single error in the genetic information.• Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals.•Tend to cluster in families.• Do not show characteristic pedigree pattern of inheritance.
Multifactorial Disorders
Congenital malformations Common disorders
of adult life.
* The defective gene is present on the mitochondrial chromosomes.* Effect generally energy metabolism.* Effect those tissues more which require constant supply of energy e.g muscles.* Shows maternal inheritance: -effected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.
Mitochondrial Disorders
Acquired Somatic Genetic Diseases
• Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell.• These somatic mutations account for 1. A large proportion of malignancy and 2. possibly involved in events such as 'senescence' and the 'ageing process'.
Single Gene Disorders
May be: - Autosomal - Sex linked: Y- linked , holanderic, hemizygote X- linked , dominant or recessive
Modes of Inheritance of Single gene Disorders
Sex Linked
X LinkedDominantRecessive
Autosomal
Y Linked
Recessive DominantNormal
homozygousHeterozygous
Abnormalhomozygous
Normal
Abnormal
- This is the inheritance of the gene present on the Autosomes.- Both sexes have equal chance of inheriting the disorder. - Two types:
Autosomal dominant inheritance, if the gene is dominant.Autosomal recessive inheritance, if the gene is recessive.
Autosomal Inheritance
Normalhomozygous
HeterozygousAbnormal
homozygous
- Autosomal dominant inheritance, if the gene is dominant.
- The trait (characteristic, disease) appears in every generation.
- The trait is transmitted by an affected person to half the children.
- Unaffected persons do not transmit the trait to their children.
- The occurrence and transmission of the trait is not affected by sex.
Autosomal Dominant Inheritance
Normal male
Normal female
Disease male
Disease female
Examples of Autosomal dominant disorders
DisorderApproximate Frequency/1000
Familial hypercholesterolemia 2
Von Willebrand disease 1
Adult polycystic kidney disease 1
Huntington disease 0.5
Myotonic dystrophy 0.2
Acute intermittent porphyria Rare
Dominant blindness 0.1Dominant deafness 0.1
- AD.
- Expressed in heterozygotes and homozygotes.
- Uroporphyrinogen synthetase deficiency.
- Increased urinary excretion of 5-amino levulinic acid and porphobilinogen (diagnostic ) .
- Characterized by neurological symptoms that include severe abdominal pain, peripheral neuropathy and psychosis.
Acute Intermittent Porphyria
D d
D DD dD
d dD dd
Affected Mother
Affected
Father
D d
d dD dd
d
dD dd
Affected
Mother
Normal
Father
Punnet Square
50% Normal50% Affected
25% Normal75% Affected
- The trait (characteristic, disease) is recessive.
- The trait expresses itself only in homozygous state.
- Unaffected persons (heterozygotes) may have affected
childrens (if the other parent is heterozygote) .
- The parents of the affected child maybe consanguineous.
- Males and female are equally affected.
Autosomal Recessive Inheritance
Punnett square showing autosomal recessive inheritance:
(1) Both Parents Heterozygous:
25% offspring affected Homozygous”
Female 50% Trait “Heterozygous normal but carrier”
25% Normal
Contd.
Aa
AAAAa
aAaaa
(2) One Parent Heterozygous:
Male
Female 50% Off springs normal but carrier “Heterozygous”
50% Normal
_________________________________________________________________________(3) If one Parent Homozygous:
Male
100% of springs carriers.
Female
Aa
AAAAa
AAAAa
AA
aAaAa
aAaAa
Family tree of an Autosomal recessive disorderSickle cell disease (SS)
A family with sickle cell disease -Phenotype
AA AS SS
Hb Electrophoresis
DiseaseApproximate Frequency/100
0
Cystic fibrosis 0.5
Recessive Mental retardation
0.5
Congenital deafness 0.2
Phenyketonuria 0.1
Sickle cell anaemia 0.1-5
-Thalassaemia 0.1-5
Recessive blindness 0.1
Spinal muscular atrophy 0.1
Mucopolysaccharidosis 0.1
Examples of Autosomal Recessive Disorders
- Most frequent autosomal recessive (AR) disorder (1 in 200
births in Caucasians)
- Expressed only in homozygotes.
- Heterozygote carriers are normal phenotypically
- If both parents are heterozygote to abnormal gene than there is 1 in 4 (25%) chance of having child with cystic fibrosis (homozygous).
- If one parent has cystic fibrosis (homo) while the other parent is normal, then all childrens will be carriers of the abnormal gene.
Cystic fibrosis
- This is the inheritance of a gene present on the sex chromosomes.
- The Inheritance Pattern is different from the
autosomal inheritance.
- Inheritance is different in the males and females.
Sex – Linked Inheritance
Sex – linked inheritance
X-Linked
Dominant
Recessive
Y- Linked
- The gene is on the Y chromosomes.
- Shows Holandric inheritance. i.e.
The gene is passed from fathers to sons only.
- Daughters are not affected.
e.g. Hairy ears in India.
- Male are Hemizygous, the condition exhibits itself whether dominant or recessive.
male
Female
-
XY*
XXXXY*
XXXXY*
Y – Linked Inheritance
- The gene is present on the X - chromosome.
- The inheritance follows specific pattern.
- Males have one X chromosome, and are hemizygous.
- Females have 2 X chromosomes, they may be
homozygous or heterozygous.
- These disorders may be : recessive or dominant.
X – Linked Inheritance
- The incidence of the X-linked disease is higher in male than in female.
- The trait is passed from an affected man through all his daughters to half their sons.
- The trait is never transmitted directly from father to sons.
- An affected women has affected sons and carrier daughters.
(1) Normal female, affected male
Ova
All daughters carriers “not affected, All sons are normal
XX
X*X*XX*X
YXYXY
X – Linked Recessive Inheritance
(2) Carrier female, normal male:
Ova
50% sons affected,
50% daughters carriers,
Sperm
(3) Homozygous female, normal male:- All daughters carriers.- All sons affected.
X*X
XXX*XX
YX * YXY
- Albinism (Ocular).- Angiokeratoma (Fabry’s disease).- Chronic granulomutous disease.- Ectodermal dysphasia (anhidrotic).- Fragile X syndrome.- Hemophilia A and B.- Ichthyosis (steroid sulphatase deficiency).- Lesch–Nyhan syndrome.- Menkes’s syndrome.- Mucopoly Sacchuridosis 11 (Hunter’s syndrome)- Muscular dystrophy (Duchenne and Beeker’s).- G-6-PD- Retinitis pigmentosa.
X - Linked Recessive Disorders
- X – linked recessive disease.
- Due to deficiency of hypoxanthine guanine phosphoriboyl transferase - Purine salvage pathway is impaired.
- Symptoms include:
- Self mutilation tendency.
- Mental retardation.
- Cerebral palsy.
- Uric aciduria.
- Gout and kidney stones.
Lesch – Nyhan Syndrome
- X – linked recessive disease.
- Expressed in males, very rare in females
(homozygotes) [ 1 in 10,000 male births ].
- In this abnormality, the blood fails to clot due to
abnormality of antihemophilic globulin.
- Clinical features include severe arthritis.
The Hemophilias
X-Linked Dominant Disorders
- The gene is on X Chromosome and is dominant.
- The trait occurs at the same frequency in both males and females.
- Hemizygous male and heterozygous females express the disease.
** Punnett square showing X – linked dominant type of Inheritance:
(1) Affected male and normal female:
OVA
All daughters affected, all sons normal.
Sperm
(2) Affected female (heterozygous) and normal male:
OVA
50% sons and 50% daughters are affected. 50% of either sex normal.
Sperm
Contd.
XX
X*X*XX*X
YXYXY
X*X
XXX*XX
YX*YXY
(3) Affected female (homozygous) and normal male:
OVA
All children affected..
Sperm
X*X*
XX*XXX*
YX*YX*Y
- These defects result from defects in the chromosomes.
- Two groups:
* Structural defects– defects in structure of chromosome.
* Numerical defects– Increase or decrease in number of chromosomes
- These defects are quite common (7 in 1000 live births).
- Chromosomal defects do not obey specific pattern of inheritance.
- These defects account for over half of all spontaneous abortions in first trimester.
Chromosomal disorders
Chromosomal Disorders
Increase or decrease in the number of chromosomes
Change in the structure of chromosomes
Numerical Structural
Euploidy Aneuploidy
Euploidy
Increase in the totalset of chromosomes
e.g 3N or 4N
Increase or decrease in one or more chromosomes.
e.g 2N+1, 2N-1
Aneuploidy
-Triploidy (69 chromosomes)found in cases of
spontaneous abortions
-Trisomy (46+1) chromosomes(Down Syndrome)
-Monosomy (46-1) chromosomes(Turner Syndrome)
Non-Disjunction
Triploidy (69, XXY)
Structural Abnormalities
Duplication
Translocation
IsochromosomesInversion
Insertion
Ring Chromosomes
The Philadelphia Chromosome*
* Mutation found in all cases of chronic myeloid leukemia* The ABL & BCR fuse due to translocation and form an oncogene
* Effect generally energy metabolism.* Effect more those tissues which require constant supply of energy e.g muscles.* Shows maternal inheritance: -affected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.
Mitochondrial Disorders
Mitochondrial Disorders
Lebers hereditary optic neuropathy
Mitochondrial Inheritance
- Affected females transmit the disease to all their children.- Affected males have normal children.- Males cannot transmit the disease as the cytoplasm is inherited only from the mother, and mitochondria are present in the cytoplasm.
Multifactorial Disorders
• Result from interaction between environmental and genetic factors.• Often polygenic in nature, no single error in the genetic information.• Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals.•Tend to cluster in families.• Do not show characteristic pedigree pattern of inheritance.
Multifactorial Disorders
Congenital malformations Common disorders
of adult life.
Acquired Somatic Genetic Diseases
• Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell.• These somatic mutations account for a large proportion of malignancy and are possibly also involved in events such as 'senescence' and the 'ageing process'.
Examples of Genetic Diseases
A.Single-gene Disorders- Adenosine deaminase deficiency
- Alpha-1-antitypsin deficiency - Cystic fibrosis - Duchenne muscular dystrophy - Familial hypercholesterolemia - Fragile X-syndrome - Hemophilia A and B - G-6-PD deficiency - Phenylketonuria - Sickle cell anaemia - Thalassaemia
B. Examples of Numerical ChromosomalAberrations
Karyotype Example
92 ,XXYYTetraploidy
69 ,XXYTriploidy
47 ,XX+21Trisomy 21(Down Syndrome)
47,XX+18Trisomy 18
47 ,XX+13Trisomy 13
47,XXYKlienfelter Syndrome
47,XXXTrisomy X
45 ,XTurners Syndrome
* Examples of significant genetic disorders: (Chromosomal disorder):
DisorderDefectIncidence
– Down Syndrome
– Trisomy 18– Trisomy 13– Klinefelter
Syndrome– XXX Syndrome– XYY Syndrome
Trisomy 21
Trisomy 18
Trisomy 13
47 ,XXY
45 ,X
47 ,XXX
47 ,XYY
–1/800–1/25000–1/1000) Males(–1/5000
)Females(
–1/1000 )Females(–1/1000) Males(
C. Multifactorial Disorders (i) Congenital malformation - Cleft lip and cleft palate - Congenital heart disease - Neural tube defects(ii) Adult onset disease - Cancer (some) - Coronary artery disease - Diabetes mellitus
DisorderIncidence
Cleft lip/ Cleft palate1/250 – 1/600
Congenital heart disease
1/125 – 1/250
Neural tube defects1/100 – 1/500
Coronary heart disease1/15 – Variable
Diabetes mellitus1/10 – 1/20
Cancervariable
Examples of Multifactorial disorder
D.Mitochondrial Disorders
Lebers hereditary optic neuropathy
E. Acquired somatic genetic disorders
Some forms of cancer
Genotype-Phenotype correlations
Genotype
- The genetic constitution (genes on the pair of homologous chromosomes).
- The alleles present at one locus. e.g..
(a) TT or Tt or tt i.e genes for height.
Where T is the “tall” gene and t is the gene for “short” height
(b) A A, A S, or S S
Where A is for HbA and S for HbS.
PhenotypeThe observed biochemical, physiological and morphological characteristics of an individual as determined by his/her genotype and the environment in which it is expressed. e.g.
Genotype Phenotype TT or Tt Tall tt Short AA HbA (normal)
Hetero A S HbAS SS HbS (SCA)
( Homo = Identical , Hetero = different) Dominant
* Hetero Recessive
Genotype – Phenotype relationship
Genotype (i.e. genetic make up) determines phenotype (i.e. appearance etc.), though environmental factors may modify the phenotypic expression:
e.g. TT (Proper nutrition) Tall TT (Poor nutrition) Stunted growth
and poor development.
- The Genotype determines the phenotype, but is affected by presence of Recessive or Dominant Gene, e.g. (Conti..)
e.g:(i) As T is dominant, it is expressed in Homozygotes and Heterozygotes, but t is recessive and is expressed only in Homozygotes.
TT and Tt tall tt short
(ii) s is recessive, it is expressed only in Homozygotes while Heterozygotes are carriers but normal:
A A HbA – Normal A S HbAS – Normal S S HbS – Abnormal “Sickle cell
anemia”
- Genotype differ in the degree of their expression of: Clinical severity, onset age, or both.(Variable expressivity).
- Expression of abnormal genotype maybe modified by: Other genetic loci, environmental factors or both
- Reduced Penetrance: in some heterozygous individuals with a dominant disorder, the presence of the mutation is reduced.
- Non-Penetrance: when a heterozygous individuals with a dominant disorder has no features of the disorder.
- “Pleiotropy” – multiple phenotypic effects of a single basic gene defect on multiple organs (genetic heterogeneity) e.g Tuberous sclerosis(AD) : learning disability, epilepsy, facial rash.
- New Mutations: A sudden appearance of a dominant disorder in the offspring with normal parents.
- Codominance: When two allelic traits are both expressed equally in a heterozygote e.g ABO blood groups.
- Pseudodominance: If a homozygous for AR mutation marries a carrier for the same mutation, their children have 1 in 2 chance of being affected (homo). This pattern is like dominant inheritance.
Genetic Polymorphism
Mutations Mutations
Genetic diversity among individuals Genetic diversity among individuals
Over generations, the influx of new nucleotide variations has ensured a high
degree of genetic diversity and individuality.
Over generations, the influx of new nucleotide variations has ensured a high
degree of genetic diversity and individuality.
Deleterious mutations not deleterious mutation
Disease May effect phenotype
Genetic Variation* Genetic Variation*
Some mutations in the gene(coding sequence)
Variant protein
Altered structure and
Altered properties
Some mutation in the gene DNA (coding sequence)
Variant protein ,but not critical for the function
Some mutations in DNA (non-coding regions)
Normal properties
No effect on proteins structure
*Polymorphisms are common, particularly in non-coding regions of DNA
Genetic Polymorphism* Genetic Polymorphism*
Many genetic loci are characterised by a number of relatively common alleles, thus producing many phenotypes in normal
population
Alleles that occur at a frequency of > 1% are said
to be polymorphic variants
Alleles that occur at a frequency of < 1% are said
to be rare variants
If there are two or more alleles(several forms of the same genes occupy the same locus) and
the rarest occurs at a frequency of more than 1%
then this loci will be considered polymorphic.
Wild type Alleles
Gene polymorphisme.g. Gene for hair colour
If there are two or more alleles(several forms of the same genes occupy the same locus) and
the rarest occurs at a frequency of more than 1%
then this loci will be considered polymorphic.
Types of Polymorphisms (Defined by the method of detection)
Types of Polymorphisms (Defined by the method of detection)
DNA Polymorphism
- Restriction Fragment Length Polymorphism (RFLPs):- Inherited variations in DNA sequence, - Results in gain or loss of a site recognised by restriction endonuclease
- Variable number of tandem repeats (VNTRs): - Variations in the number of short, repeated nucleotide sequences (eg GC) between restriction sites - VNTRs are extremely polymorphic - Valuable in forensic medicine
Detected by altered DNA sequences
Protein Polymorphism
Altered physical features
Chromosome heteromorphisms
Contd…..
Types of Polymorphisms (Defined by the method of detection)
Contd…
Types of Polymorphisms (Defined by the method of detection)
Contd…
- Enzyme variant: altered enzyme activity, electrophoretic mobility, thermostability or other physical properties e.g.G-6-PD deficiency.
- Antigenic variants: altered antigenic properties e.g. ABO blood groups.
Protein Polymorphism
Altered physical features
Chromosome heteromorphisms
Contd…..Detected by:
ElectrophoresisAltered activity,
Altered physical properties
- Several proteins exist in two or more relatively
common,
genetically distinct , structurally
different & functionally identical.- The causes of polymorphic forms:
Mutation in or around gene
- Examples :
ABO Blood groups, Transferrin, Hb, 1 antitrypsin.
Protein Polymorphism
Not all variant proteins have clinical consequences
Not all variant proteins have clinical consequences
Types of Polymorphisms (Defined by the method of detection)
Contd…
Types of Polymorphisms (Defined by the method of detection)
Contd…
Altered physical features e.g. polydacytyly, gagantism, dwarfs, hair on ears, baldness.
Altered physical features
Chromosome heteromorphisms
Detected by:Physical appearence
Types of Polymorphisms (Defined by the method of detection)
Contd…
Types of Polymorphisms (Defined by the method of detection)
Contd…
Heritable differences in chromosomal appearances from one person to another, e.g.
Variations in the size of the Y chromosome long arm. Variation in the size of the centromere . Variation in satellite size and structure. The occurrence of fragile sites.
Chromosome heteromorphismsDetected by:
Cytogenetic studiesFISH
Genetic diversity among individuals Genetic diversity among individuals
Chromosome heteromorphisms
• Generally, the karyotype of normal persons of the same sex are quite similar.
•Occasional variants are seen on staining. These are called
heteromorphisms.
•These reflect difference in amount or type of DNA sequence at a particular location along a chromosome.
• Almost 25% are silent mutation with no effect on protein structure.
• Most mutations alter amino acid sequence but do not have phenotypic effect (e.g. ABO blood groups).
•Rare mutations produce severe phenotype effect or influence survival (e.g. phenylketonuria)
• In long arm of chromosome.• In chromosomes 1, 9, 16.• In short arm of acrocentric chromosomes
Protein variations
e.g
As genetic “Markers”
- To distinguish inherited forms of a gene in a family.
- Mapping gene to individual chromosomes by likage analysis.
- Presymptomatic and prenatal diagnosis of genetic disease.
- Evaluation of high and low – risk persons.
- Paternity testing and forensic applications.
- Matching of donor-recipient pairs of tissue and organ transplantation.
Uses of Polymorphism
- Polymorphic forms are produced as result of
mutation in the genetic loci.
- The advantages are possibly:
- Production of more stable forms.
- Production of such forms that give resistance
against disease:
e.g. Hb S Trait are resistance to malarial plasmodia.
- Natural selection for survival of the fittest.
Advantages of Polymorphism
Area of Significance of Polymorphism
- Blood transfusion.
- Tissue typing.
- Organ Transplantation.
- Treatment of Haemolytic disease of new born.
ABO System- First identified by Landsteiner in 1900.
- Human blood can be assigned to one of four types according to presence of two antigens, A and B, on the surface of Red Blood Cell and
the presence of two corresponding antibodies, Anti A and Anti B in the plasma.
* RBC Antigen Polymorphism:
- Useful marker for:
- Family and population studies.
- Linkage analysis.
- Different frequencies in different population.
Contd.
* Blood Group Substances:
- Blood group substances are encoded by allelic genes A and B.
- Blood group substances exhibit polymorphism.
Polymorphic System
Chromosomal Location
Common Alleles
ABO
MNSs
Xg
9 q34
4q28 – 31
Xp 22.3
A, B and O
M and N;S and s
Xga and Xg.
ABO Blood groups and Reaction with Antibodies
Group
Geno
Type
Anti AAnti BCellular Antigen
Serum AntiFrequencies
O
A
B
AB
O/O
A/A,
O/A
B/B,
O/B
A/B
-
+
-
+
-
-
+
+
NO
A
B
A + B
Anti A+B
Anti B
Anti A
Neither
45%
42%
10%
4%
Clinical Importance of Polymorphism Clinical Importance of Polymorphism
e.g.- HbS in African, Saudi
Arabia- Thalassaemia in Mediterranean region Saudi Arabia- Cystic fibrosis in Europeans
Some disease genes occur with
polymorphic frequencies
Genetic polymorphisms
may produce disease
Some polymorphisms determine antigenic
differences
e.g.On exposure to drugs or environmental factor - G-6-PD deficiency- Malignant hyperthermia.
e.g.- Blood group- HLA antigen for tissue typing.
Clinical Importance of PolymorphismContd…..
Clinical Importance of PolymorphismContd…..
e.g.DNA fingerprint of each individual differs due to polymorphic sites in many non-coding sequences
Forensic Medicine As genetic markers
e.g.Predisposing to a disease within families or populations
Genetic Linkage Genetic Linkage
The occurrence of two or more genetic loci in such close physical proximity on a
chromosome that they are more likely to assort (linked) together
Crossing over does not take place between closely situated loci – So they are said to be linked
A
B
a
b
No C
B
c
b
C c
b B
Linked Not linked
CrossingDuring meiosis
Concept of Genetic Linkage Concept of Genetic Linkage
Loci separated by crossing over
in 1% of gametes are 1
cM apart
Linkage refers to loci, not to alleles
(which occupy different
chromosomes
Measurement of genetic linkage can only take place in
family studies
Statistical method of measuring linkage is by
calculation of
lod score
Closeness of a genetic linkage is expressed in Cente Morgans (cM) or percent recombination
Unlinked loci are separated by a genetic distance of 50 cM at a given allele at one locus has a 50% of being
transmitted with either allele at an unlinked loci.
Loci close to each other, so they never separate are linked
at a genetic distance of zero
cM
Contd….
Concept of Genetic LinkageContd…..
Concept of Genetic LinkageContd…..
- Lod score is a acronym for “Logarithm of the Odds” ( Logrithm of the likelihood ratio).- Lod score of +3 or greater at recombination distance of less than 50 cM between two loci is considered to be a strong evidence of linkage (1000 : 1 odds for linkage.- Lod score of 2 or less is taken as a strong evidence there is no linkage (100: 1 odds against linkage).
Lod Score
Concept of Genetic LinkageContd…..
Concept of Genetic LinkageContd…..
This is the tendency for certain alleles at two linked loci to occur together more often than expected by chance. e.g.
Linkage disequilibrium Measure in populations, not in families
If the mutant allele at D occurs on the same chromosome as Mb more often than expected within a certain populationlinkage disequilibrium is said to exist.
Distance=5cM
Mb
D
Disease locus = DMarker = MAlleles of Marker Ma and Mb.
centi Morgan centi Morgan
It gives a rough unit of distance along the chromosome
Defines the distance between two gene loci
If two loci are IcM apart, there is a 1% change of recombination between these loci as the chromosome is
passed from parent to child
- Different chromosomes have different sizes.- Average chromosomes contain about 150 cM.- There are about 3300 cM in the whole human genome.
This corresponds to 3x109 bp.- On average IcM is about 1 million bp (1000 kb).
Markers tightly linked to a disease Markers tightly linked to a disease
- The marker linked to a disease gene, must be on the same region on the chromosome (within < 1 cM distance).
Markers that are a long distance away on the
same chromosome may not appear to be linked, because recombination between the two loci is
high
Clinical Applications of Linkage Clinical Applications of Linkage
Linkage is clinically useful as it may permit
Used in
More precise determination of the
genotype at an unidentified gene locus on the basis of readily
identified linked markers
Determination of the pattern of inheritance or specific for disease that
exhibits genetic heterogeneity
Gene mapping by determining the
recombination distance between two genes on a
chromosome
Prenatal diagnosis
Carrier detection
Presymptomatic diagnosis
Elucidation of genetic factors in multifactorial
disorders
Gene Mapping Gene Mapping
Somatic cell genetic method to show that two loci are not linked
(demonstrate synteny) or that
an unmapped loci resides on a chromosome
Family studies to
demonstrate linkage
between loci
This is the assignment of genes to specific chromosomal locations.
Mapping is done by:
Cytogenetic techniques e.g. in situ hybridization
Gene dosage studies
Indirect means of identifying location of a
gene
Importance of Gene Mapping Importance of Gene Mapping
The gene map is the anantomy of the
human genome
Analysis of heterogeneity
and segregation of human genetic
diseases
To develop optimal strategy for gene therapy by improved knowledge of
genomic organization
Provides information about
linkage
Haemoglobinopathies and Thalassaemias
Genetic Disorders
of Haemoglobin
Haemoglobinopathies and Thalassaemias
Haemoglobinopathies and Thalassaemias
- A conjugated protein consisting of iron-containing heme and protein (globin).- Globin chains are of different types: -chains and non -chains - Each molecule is a tetramer of two - and non - chains. - Each globin binds a haem in a haem binding site.
Haemoglobin binds and transports oxygen fromlungs to the tissues, while it transports CO2 from
tissues to the lungs.
- A conjugated protein consisting of iron-containing heme and protein (globin).- Globin chains are of different types: -chains and non -chains - Each molecule is a tetramer of two - and non - chains. - Each globin binds a haem in a haem binding site.
Haemoglobin binds and transports oxygen fromlungs to the tissues, while it transports CO2 from
tissues to the lungs.
Haemoglobin
Types of Hemoglobin in adultsGlobin genes Gene product Tetramers Name of Conc. in
Chromosome (globin) in RBCs haemoglobin adult16 11
, -chain 2 2 Hb A 96-97
, -chain 2 2 Hb A2 2.3-3.5
,-chain 2 2 Hb F <1.0-----------------------------------------------------------------Emberyonic Hb: , -chain 2 2 Hb-Gower II 0
, -chain 2 2 Hb-Gower I 0
, -chain 2 2 Hb-Portland 0
Chromosome 11
AG
2 1 2 1
Chromosome 16
Structure of each Globin gene
Exon 1 Intron 1 Exon 2 Intron 2 Exon 3
5’ 3’
3’
3’5’
5’
Disorders of Haemoglobin
Haemoglobinopathies(Structural disorder
of Hb)
Co-existingstructural /
biosyntheticdisorders
Thalassaemias(Biosynthetic
disorderof Hb)
Constitute a major health problem in severalpopulations of the world
(particularly those residing in malariaendemic region)
HaemoglobinopathiesHaemoglobinopathies
• Genetic structural disorder.• Due to mutation in the globin gene of haemoglobin.• Mostly autosomal recessive inheritance.• Result in haemoglobin variants with altered structure
and function.• Altered functions include:
• Reduced solubility• Reduced stability• Altered oxygen affinity- increased or decreased• Methaemoglobin formation
• Genetic structural disorder.• Due to mutation in the globin gene of haemoglobin.• Mostly autosomal recessive inheritance.• Result in haemoglobin variants with altered structure
and function.• Altered functions include:
• Reduced solubility• Reduced stability• Altered oxygen affinity- increased or decreased• Methaemoglobin formation
*Types of Mutations in Haemoglobin *Types of Mutations in Haemoglobin
• Point mutation: a change of a single nucleotide base in a DNA giving rise to altered amino acids in the polypeptide chains
(e.g. Hb S , Hb Riyadh, Hb C)
• Deletions and additions: Addition and deletion of one or more bases in the globin genes
(e.g. Hb-constant spring which is associated with mild -thalassaemia).
• Unequal crossing over: as in Hb-lepore and Hb-antilepore associated with -thalassaemias.
________________________________________________________*Most abnormal Hbs are produced by mutations in the structural genes which determine the amino acid sequence of the globin chains of the Hb molecule.
• Point mutation: a change of a single nucleotide base in a DNA giving rise to altered amino acids in the polypeptide chains
(e.g. Hb S , Hb Riyadh, Hb C)
• Deletions and additions: Addition and deletion of one or more bases in the globin genes
(e.g. Hb-constant spring which is associated with mild -thalassaemia).
• Unequal crossing over: as in Hb-lepore and Hb-antilepore associated with -thalassaemias.
________________________________________________________*Most abnormal Hbs are produced by mutations in the structural genes which determine the amino acid sequence of the globin chains of the Hb molecule.
Geographical distribution of common Hb variantsGeographical distribution of common Hb variants
Variant Occurrence predominantly in: Hb S (6GluVal) Africa, Arabia, Black
Americans
Hb C (6Glulys) West Africa, China
Hb E (26Glulys) South East Asia
Hb D (121GluGln) Asia
Hb O (121GluVal) Turkey and Bulgury
Variant Occurrence predominantly in: Hb S (6GluVal) Africa, Arabia, Black
Americans
Hb C (6Glulys) West Africa, China
Hb E (26Glulys) South East Asia
Hb D (121GluGln) Asia
Hb O (121GluVal) Turkey and Bulgury
His Lys Tyr His
CAC AAG UAU CAC Normal
Shorter chain
His Lys Mutation
CAC AAG UAA
His Lys Tyr His
CAC AAG UAU CAC Normal
Shorter chain
His Lys Mutation
CAC AAG UAA
Other examples of Haemoglobin variants
3’
3’
Longer chains, e.g.
(Lys) (Glu)A G
2 gene AUG --- ----- UAA --------- UAA
C C(Gln) (Ser)
globin Gln LysGluSer 142
Longer chains, e.g.
(Lys) (Glu)A G
2 gene AUG --- ----- UAA --------- UAA
C C(Gln) (Ser)
globin Gln LysGluSer 142
Sickle Cell Haemoglobin
GAG GTG
RBC
Haemolysis
Sickle Cell
6
Inheritance of Sickle Cell Anaemia
AS AS
SSAAAS AS
AR
LungspO2
TissuespO2
Red cell sickling
- Sickling of the red cell during deoxygenation, as the HbS has low solubility at low O2 partial pressure and precipitates.- Chronic haemolytic anaemia due to repeated sickling in tissues and unsickling in the lungs.- Plugging of microcapillaries by rigid sickled cells leading to sickle cell crises i.e severe pain and edema. This causes significant damage to internal organs, such as heart, kidney, lungs and endocrine glands.- Repeated infections.- Frequent cerebrovascular accidents.- Hand-foot syndrome (in small,i.e.around age of 3y)- Bone deformation – bossing of the forehead.- Hepato-spleenomegaly.- Growth retardation.- Frequent blood transfusion requirements.- Psychosocial problems.
Major abnormalities & problems in SCA
Thalassaemias
Genetic disorders resulting fromdecreased biosynthesis of globin chains
of haemoglobin.
Thalassaemias• A group( not single identity) of Genetic defects.• Due to mutations in and around the globin genes.• Decreased production of one or more of the globin
chains.• Result in an imbalance in the relative amounts of the -
and non -chains. Altered /non- ratio.• A few rare Hb variants are effectively synthesized but
are highly unstable, and thus cause thalassaemias as the : chain ratio is altered.
• As a consequences of thalassaemias there is excess production of the other chains, and a decreased over all haemoglobin synthesis.
Thalassaemias• A group( not single identity) of Genetic defects.• Due to mutations in and around the globin genes.• Decreased production of one or more of the globin
chains.• Result in an imbalance in the relative amounts of the -
and non -chains. Altered /non- ratio.• A few rare Hb variants are effectively synthesized but
are highly unstable, and thus cause thalassaemias as the : chain ratio is altered.
• As a consequences of thalassaemias there is excess production of the other chains, and a decreased over all haemoglobin synthesis.
Types of Thalassaemias
- Thalassaemia* -Thalassaemia*
- Thalassaemia - Thalassaemia
- Thalassaemia * Most common
- Thalassaemia
Hb In - Thalassaemia Decreased production of - chains
- Decreased / ratio
- Thalassaemia
Normal =
Accumulation of
Point Mutation producing - Thalassaemia
Less Frequent
exon1 exon2 exon3Chromosome 16Introns
5’ 3’
2bp del
5bp del
Base Substitution
Chain TerminationDefect
Poly A signalMutation
Mutations Producing - Thalassaemia
Deletions Most frequent:
/ -/- --/ --/----/--/-thal 2hetero
-thal 1hetero
HbHDisease
Hydropsfetalis
-thal 2homo
Normal
Chromosome 16
-thalassaemia -2
• One -gene deletion.
-chain production is only about 75% of normal.
• May be homo- (- /- ) or heterozygous (- / )
• The patient usually shows a normal phenotypic appearance but there might be mild thalassaemia symptoms.
• Hypochromic-microcytic RBC’s due to partial reduction of -chain.
-thalassaemia -2
• One -gene deletion.
-chain production is only about 75% of normal.
• May be homo- (- /- ) or heterozygous (- / )
• The patient usually shows a normal phenotypic appearance but there might be mild thalassaemia symptoms.
• Hypochromic-microcytic RBC’s due to partial reduction of -chain.
-thalassaemia- 1
• Two -genes deletion- (o )thal.
• The patient synthesizes -chain but it is decreased to about 50% of normal.
• Anaemic symptoms- hypochromic microcytic anaemia.
• May be homozygous (- -/- -) or heterozygous(--/ ). If the patient is homozygous than there is no -chain synthesis, and if heterozygous then there is decreased synthesis of the -chain to half normal level.
-thalassaemia- 1
• Two -genes deletion- (o )thal.
• The patient synthesizes -chain but it is decreased to about 50% of normal.
• Anaemic symptoms- hypochromic microcytic anaemia.
• May be homozygous (- -/- -) or heterozygous(--/ ). If the patient is homozygous than there is no -chain synthesis, and if heterozygous then there is decreased synthesis of the -chain to half normal level.
Hb H Disease
• Three -gene deletion.
• The Hb present during foetal life is “Hb Bart’s” (4), while during adulthood the Hb present is “Hb H” (4).
• Some of the symptoms include: hepatosplenomegally, impairment of erythropoisis, and hypochromoc-microcytic haemolytic anaemia.
Hb H Disease
• Three -gene deletion.
• The Hb present during foetal life is “Hb Bart’s” (4), while during adulthood the Hb present is “Hb H” (4).
• Some of the symptoms include: hepatosplenomegally, impairment of erythropoisis, and hypochromoc-microcytic haemolytic anaemia.
Hydrops foetalis
• Homozygous o-thalassaemia.
• There is a complete absence of -chain (all -genes are deleted).
• The Hb produced at birth is Hb Barts (4).
• Hydrops foetalis is lethal and the baby is born dead.
• Symptoms include: Hepatosplenomegaly, severe hypochromic- microcytic anaemia.
Hydrops foetalis
• Homozygous o-thalassaemia.
• There is a complete absence of -chain (all -genes are deleted).
• The Hb produced at birth is Hb Barts (4).
• Hydrops foetalis is lethal and the baby is born dead.
• Symptoms include: Hepatosplenomegaly, severe hypochromic- microcytic anaemia.
- Thalassaemia
HbIn - Thalassaemia Decreased
production of - chains
Increased / ratio
- Thalassaemia
Normal =
Accumulation of
-Thalassaemia
• It is characterized by either no -chain synthesis (i.e. o) or decreased synthesis of -chain (+).
• Excess -chains precipitate in RBC’s causing severe ineffective erythropoiesis and haemolysis.
• The greater the -chains, the more severe the anaemia.
• Production of -chains helps to remove excess -chains and to improve the -thalassaemia. Often HbFlevel is increased.
• Majority of -thalassaemia is due to point mutation.
-Thalassaemia
• It is characterized by either no -chain synthesis (i.e. o) or decreased synthesis of -chain (+).
• Excess -chains precipitate in RBC’s causing severe ineffective erythropoiesis and haemolysis.
• The greater the -chains, the more severe the anaemia.
• Production of -chains helps to remove excess -chains and to improve the -thalassaemia. Often HbFlevel is increased.
• Majority of -thalassaemia is due to point mutation.
o-Thalassaemia
• The -chain is totally absent.• There is increase in HbF with absence of HbA.• This is combined with ineffective erythropoisis.• In majority of the cases, -gene is present but there is complete
absence of mRNA.• Characteristics of this disorder are:
• Skeletal deformities (e.g. enlargement of upper jaw, bossing of skull and tendency of bone fractures).
• Severe hypochromic- microcytic anaemia.• Survival depends on regular blood transfusion.• This leads to iron overload (iron accumulates in the blood and
tissues, causing tissue damage). • Death usually occurs in the 2nd decade of life (i.e. at age of
about 20 years) if measures are not taken to avoid iron overload by chelation therapy.
o-Thalassaemia
• The -chain is totally absent.• There is increase in HbF with absence of HbA.• This is combined with ineffective erythropoisis.• In majority of the cases, -gene is present but there is complete
absence of mRNA.• Characteristics of this disorder are:
• Skeletal deformities (e.g. enlargement of upper jaw, bossing of skull and tendency of bone fractures).
• Severe hypochromic- microcytic anaemia.• Survival depends on regular blood transfusion.• This leads to iron overload (iron accumulates in the blood and
tissues, causing tissue damage). • Death usually occurs in the 2nd decade of life (i.e. at age of
about 20 years) if measures are not taken to avoid iron overload by chelation therapy.
+-Thalassaemia
• There is a variable amount of -chain production.• There is decreased HbA level, and increased Hb A2,
level with normal or increased Hb F level (and there is an increased number of -chains in the free form).
• The -chain is present but there is decreased numbers of mRNA or there is an abnormality in the mRNA.
+-Thalassaemia
• There is a variable amount of -chain production.• There is decreased HbA level, and increased Hb A2,
level with normal or increased Hb F level (and there is an increased number of -chains in the free form).
• The -chain is present but there is decreased numbers of mRNA or there is an abnormality in the mRNA.
1. Mutations affecting transcription initiation2. Mutations affecting RNA splicing3. Mutations affecting translation initiation4. Non-sense Mutations.5. Mutations of polyadenylation site.
Mutations affecting the -Globin gene.
>200 -Thalmutations reported
to-date Worldwide
Chromosome 11
Clinical Classification of Thalassaemias
1. Thalassaemia major:The patient depends on blood transfusions especially if he
is homozygous.
2. Thalassaemia intermediate:• Homozygous mild +-thalassaemia. • Co-inheritance of -thalassaemia.• Heterozygous -thalassaemia.• Co-inheritance of additional -globin genes. -thalassaemia and hereditary persistence of foetal Hb• Homozygous Hb lepore• Hb H disease.
3. Thalassaemia minor (trait): o-thalassaemia trait. +-thalassaemia trait.• Hereditary persistence of foetal Hb only. -thalassaemia trait. o- and +-thalassaemia trait.
Clinical Classification of Thalassaemias
1. Thalassaemia major:The patient depends on blood transfusions especially if he
is homozygous.
2. Thalassaemia intermediate:• Homozygous mild +-thalassaemia. • Co-inheritance of -thalassaemia.• Heterozygous -thalassaemia.• Co-inheritance of additional -globin genes. -thalassaemia and hereditary persistence of foetal Hb• Homozygous Hb lepore• Hb H disease.
3. Thalassaemia minor (trait): o-thalassaemia trait. +-thalassaemia trait.• Hereditary persistence of foetal Hb only. -thalassaemia trait. o- and +-thalassaemia trait.
Hb-Lepore
• This is an abnormal Hb due to unequal crossing-over of the - and -genes to produce a polypeptide chain consisting of the - chain at its amino end and - chain at its carboxyl end.
• The -fusion(hybrid) chain is synthesized inefficiently and normal and -chain production is abolished.
• The homozygotes show thalassaemia intermediate and heterozygotes show thalassaemia trait.
• Unequal crossing-over can be explained as crossing over between similar DNA sequence that are misaligned resulting in sequences with deletions or duplications of DNA segments; a cause of a number of genetic variants.
• The adjacent and -genes differ at only 10 of their 146 a.a. residues, if mispairing occurs followed by intergenic crossing over, two hybrid genes result: one with a deletion of part of each locus (lepore gene) and one with a corresponding duplication (anti-lepore gene).
Hb-Lepore
• This is an abnormal Hb due to unequal crossing-over of the - and -genes to produce a polypeptide chain consisting of the - chain at its amino end and - chain at its carboxyl end.
• The -fusion(hybrid) chain is synthesized inefficiently and normal and -chain production is abolished.
• The homozygotes show thalassaemia intermediate and heterozygotes show thalassaemia trait.
• Unequal crossing-over can be explained as crossing over between similar DNA sequence that are misaligned resulting in sequences with deletions or duplications of DNA segments; a cause of a number of genetic variants.
• The adjacent and -genes differ at only 10 of their 146 a.a. residues, if mispairing occurs followed by intergenic crossing over, two hybrid genes result: one with a deletion of part of each locus (lepore gene) and one with a corresponding duplication (anti-lepore gene).
High Persistence of Foetal Hb (HPFH)
A group of disorders due to deletions or cross over abnormalities which affect the production of and
chains in non-deletion forms to point mutations upstream from the -globin genes.
High Persistence of Foetal Hb (HPFH)
A group of disorders due to deletions or cross over abnormalities which affect the production of and
chains in non-deletion forms to point mutations upstream from the -globin genes.
Double heterozygous indicates the presence of combinations of the following:
• Hb S + O-thalassaemia.
• Hb S + --thalasaemia.
• Hb S + -thalasaemia.
• Hb S + HbC disease
• Hb S + HbE disease
Double heterozygous indicates the presence of combinations of the following:
• Hb S + O-thalassaemia.
• Hb S + --thalasaemia.
• Hb S + -thalasaemia.
• Hb S + HbC disease
• Hb S + HbE disease
Diagnosis of Genetic Diseases
Diagnosis of Genetic Diseases
Family History*
ClinicalPresentation*
Estimation of Haematological
parameters
Estimation of Biochemical Parameters
ChromosomalAnalysis
RecombinantDNA
Technology
Determination ofEnzyme Activity
or Specific Protein
* Important for all genetic diseases
1. Family History
• Consanguinity of parents.
• Presence of other siblings with the same disorder.
• Occurrence of the disorder in other members of the family.
• Repeated abortions or still births,
• mother and fathers ages.
• Drawing punnet square helps to determine the mode of inheritance of the genetic disorders.
• Autosomal or X-linked
• Dominant or recessive
2. Clinical PresentationCertain clinical features are specific for a disease:• Chronic anaemia:
• Haemoglobinopathies• Thalassaemia• Other genetic anaemias
• Acute anaemia, under certain stressful conditions.• G-6-PD deficiency
• Hypoxia – sickle cell disease.• Dependence on blood transfusion - -thalassaemia (major)• Severe immune deficiency – ADA deficiency.• Emphysema - 1 anti-trypsin deficiency.• Hypercholesterolaemia – familial hypercholesterolaemia.• Delayed blood coagulation – Haemophilia (decrease in factor VIII or
IX).• Mental retardation – Fragile syndrome (in X chromosome) or
phenylketonuria (PKU).• Muscular weakness and degeneration – Duchenne muscular
dystrophy.
Recombinant DNA Technology( Genetic Engineering)
Recombinant DNA Technology( Genetic Engineering)
Techniques for cutting
and joining DNA
Requirements for DNA technology
Restriction endonucleases
Vectors
Probes
Other enzymese.g ligases,
Taq polymerases
Primers
NTPs
Special chemicals and equipment
DNA
• Endonucleases.• Synthesized by procaryotes. Do
not restrict host DNA.• Recognize and cut specific base
sequence of 4-6 bases in double helical DNA.
• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.
• Endonucleases.• Synthesized by procaryotes. Do
not restrict host DNA.• Recognize and cut specific base
sequence of 4-6 bases in double helical DNA.
• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.
Restriction Endonuclease
5’-GAATTC-3’3’-CTTAAG-5’
Produce either Blunt Ends or Staggered ends: Produce either Blunt Ends or Staggered ends:
Restriction Endonuclease
5’-GAATTC-3’3’-CTTAAG-5’
5’-GAA TTC-3’ 3’-CTT AAG-5’
5’-G AATTC-3’3’-CTTAA G-5’
5’-GAATTC-3’3’-CTTAAG-5’
Blunt Ends
Staggered Ends
or
• Obtaining DNA fragments of interest.• Gene mapping.• Sequencing of DNA fragments.• DNA finger printing• Recombinant DNA technology• Study of gene polymorphism.• Diagnosis of disease.• Prenatal diagnosis
• Obtaining DNA fragments of interest.• Gene mapping.• Sequencing of DNA fragments.• DNA finger printing• Recombinant DNA technology• Study of gene polymorphism.• Diagnosis of disease.• Prenatal diagnosis
Uses of Restriction Endonuclease
Sources of DNA
GenomicDNA
Synthesis of DNA
cDNA
Using DNA synthesiser
Synthesised frommRNA using reversetranscriptaseDNA extracted
from cells
cDNA Synthesis
cDNA Synthesis
mRNA
Poly A tailAAAAAAAAA
Viral reverse transcriptase
AAAAAA
TTTT
NaOH( Hydrolysis of RNA)
DNA polymerase
Hair pin loop
DNA nuclease (single-strand specific)
Double strand cDNA
dNTP
• DNA molecules.
• Can replicate in a host e.g bacterial cells or yeast.
• Can be isolated and re-injected in cells.
• Presence can be detected.
• Can be introduced into bacterial cells e.g. E. coli.
• May carry antibiotic resistance genes.
• DNA molecules.
• Can replicate in a host e.g bacterial cells or yeast.
• Can be isolated and re-injected in cells.
• Presence can be detected.
• Can be introduced into bacterial cells e.g. E. coli.
• May carry antibiotic resistance genes.
Vectors
Cloning vesicles
TypeI. Plasmid : circular, double
stranded cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.
II. Bacteriophage lambda: a bacterial virus infects bacteria.
III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.
IV. Yeast Artificial Chromosomes (YAC)
TypeI. Plasmid : circular, double
stranded cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.
II. Bacteriophage lambda: a bacterial virus infects bacteria.
III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.
IV. Yeast Artificial Chromosomes (YAC)
Types of vectors
Insert size• <5-10 kb.
• Upto 20kb.
• Upto 50kb.
•~100-1000kb.
Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to
DNA of interest. • DNA or RNA.
• cDNA.
• Labeling of probes:• 3H Radioactive• 32P
Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to
DNA of interest. • DNA or RNA.
• cDNA.
• Labeling of probes:• 3H Radioactive• 32P
Probes
Hybridization
DNA cloningDNA cloning
Recombinant DNA Technology
Polymerase chain reaction
Polymerase chain reaction
Amplification of DNA Study of DNA structureand functions
DGGEDGGE
RT PCRRT PCR
Dot blot analysisDot blot analysis
ARMSARMS
DNA sequencingDNA sequencing
OthersOthers
Principles of Molecular Cloning
Involves:
• Isolation of DNA sequence of interest.
• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.
• Growing of the bacteria under appropriate condition.
• Obtaining the pure form of DNA in large quantities for molecular analysis.
Involves:
• Isolation of DNA sequence of interest.
• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.
• Growing of the bacteria under appropriate condition.
• Obtaining the pure form of DNA in large quantities for molecular analysis.
• Method to amplify a target sequence of DNA or RNA several million folds.
• Developed by Saiki et al in 1985.
• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.
• Method to amplify a target sequence of DNA or RNA several million folds.
• Developed by Saiki et al in 1985.
• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.
Polymerase Chain Reaction (PCR)
5’ ATCAGGAATTCATGCCAAGGTTGATCGATGATCGATCGATCGATTGAT 3’ 3’AGCTAGCTAGCT 5’
DNA
Primer
Application of PCR
• Diagnosis of genetic disease by amplification of the
gene of interest, followed by detection of mutation.
• Detection of infectious agent e.g. bacteria and viruses.
• DNA sequencing.
• In forensic medicine.
Application of PCR
• Diagnosis of genetic disease by amplification of the
gene of interest, followed by detection of mutation.
• Detection of infectious agent e.g. bacteria and viruses.
• DNA sequencing.
• In forensic medicine.
1. Clinical Chemistry:• Diagnosis of disease e.g. sickle
cell anaemia by Mst II.• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening
1. Clinical Chemistry:• Diagnosis of disease e.g. sickle
cell anaemia by Mst II.• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening
Application of Recombinant DNA Technology
Southern Blotting
BglII
BglII
BamHI BglII
14.5Kb
7.0Kb12.5Kb
BamHI
1 2
L R
Pathogenesis of -Thalassaemia
Extract DNA
Treat with BglII
Electrophoresis
Visualize
Withdrawblood
Southern Blotting
2. Human Genetics• Mutations in genes causing hereditary disease e.g.
diagnosis of fibrosis Channes disease.
3. Forensic Medicine• Analysis of stains of blood, semin.
4. Virology• Detection of viral diseases e.g. hepatitis
5. Microbiology• Using specific gene probes for detection of E.coli
6. Cytology, Histology and Pathology• Used in detection of tumor.
7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon
8. Transgenic animal production
2. Human Genetics• Mutations in genes causing hereditary disease e.g.
diagnosis of fibrosis Channes disease.
3. Forensic Medicine• Analysis of stains of blood, semin.
4. Virology• Detection of viral diseases e.g. hepatitis
5. Microbiology• Using specific gene probes for detection of E.coli
6. Cytology, Histology and Pathology• Used in detection of tumor.
7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon
8. Transgenic animal production
Genetic Counselling
• Genetic disorders:• Chromosomal• Single gene• Multifactorial• Mitochondrial• Acquired somatic
• Only single disorders follow a clearly defined pedigree pattern of inheritance “Mendelian Pattern”.
• During genetic counselling it is essential to establish whether or not the disorder is Mendelian and
to calcualte the precise risk of recurrence.
Genetic Counselling for Mendelian Disorders
Essential Components of Genetic Counselling
Essential Components of Genetic Counselling
History and pedigree
construction
Clinical Examination
Confirmatorydiagnosis
Counseling
Availableoptions
Calculation ofrecurrence risk
Follow-up
- History findings- Clinical examination findings- Radiology findings- Laboratory parameter results- DNA studies results- Others
Recurrence Risk
ETHICAL PRINCIPLESETHICAL
PRINCIPLES
BeneficenceBeneficence
AutonomyAutonomy
JusticeJustice Non-MaleficenceNon-Maleficence
VeracityVeracity
FidelityFidelity
Arabic/Islamic Communities
Unique featuresStrong Religious believes
Combined family Living style
Strong link to traditions and
customs
High rate of Consanguinous
marriages
Possibility of polygamy
Large family sizeReligious
And culturalcohesion
Special views on Reproductive issues
Familyplanning
AbortionIn-vitro
fertilizationAdoption
Artificialinsemination
Fetalrights
• Pattern of transmission judged from family tree. For several diseases the family tree may be
conclusive even if accurate diagnosis is not made.
• For some diseases pedigree pattern is not helpful and only clinical diagnosis is used
• For some disorders the pattern looks complicated and the exact diagnosis cannot be made.
• More common by combination of clinical diagnosis and comparable pedigree pattern.
Establishment of Mendelian Inheritance
Premarital Screening*Man -History
-(Physical Examination) BloodSample
Genetic Screening (Laboratory)
Carrier affected Normal
No Problem from marriage from
any Women
Safe Marriage
**Women –History -(Physical examination)
BloodSample
Genetic Screening (Laboratory)
Carrier affected NormalNo Problem from
marriage from any man
Safe Marriage
Genetic Counseling(advise no marriage with carrier or affected)
Not safe Marriage
Complexities in AD Disorders
1. Late or variable onset of the disease. How old will the family members be, to be certain of not
developing the disease, e.g.• Huntington’s disease, adult onset polycystic kidney
disease, myotonic dystrophy.• For some conditions life tables have been prepared.
2. Lack of penetrance
• Penetrance: - Is the index of the proportion of individuals with the
affected gene who present the disease. - Some disorders show lack of penetrance I.e. biochemical
defect is present, but clinical features are absent, e.g.• Huntington disease – Penetrance decreases with age.• Retinoblastoma: Lack of penetrance unrelated to age.
Complexities in AD Disorders
3. Variation in Expression:
Several AD disorders show variation in clinical expression and hence the disorders cannot be ruled out unless careful examination is carried out.
Mild Moderate Severe expression
*Problems in G.C. since those who reproduce are least severely affected, but may have severely affected childrene.g. Tuberousclerosis, Myotonic dystrophy, Huntingtonsdisease.
*Disease severity may depend on sex of the transmitting parent.
“Anticipation: refers to the state that a genetic disease worsens with successive generation.
Factors underlying variability in AD disordersFactors Effect
• Genomic imprinting Phenotype varies accordingly
• Anticipation due to unstable More severe phenotype in DNA successive generation
• Mosaicism Mild or non-penetran phenotype
• Modifying alleles Influence of unaffected parent
• Somatic mutations also Variable penetrancerequired for presentation(e.g. familial cancers)
• New mutations Sudden appearance of (AD)disorder in normal parent
II. Complexities in AR Disorders• Difficult to confirm as homozygote born to phenotypically normal
(carrier) parents, who may not have an affected relative.• Horizontal transmission ( sudden appearance of a disorder in a generation)
• Diagnosis makes the mode of inheritance certain.
Risk Very lowLow
Problems with AR disorders• Genetic heterogeneity.
• Lack of penetrance and variation in expression are much less.
• If consanguinity present the risk is increased:
(a) Rare disorder increase in the number of effected children due to consanguinity
(c) Extensive consanguinity Appear like AD inheritance (pseudo AD)
Population Risk
Can be calculated from:
• Hardy Weinberg Equilibriump + q = 1 [p2 + q2 = 2pq = 1]
q2 = Abnormal homozygote p2 = Normal
2pq = Heterozygote
e.g. 2 patients of PKU in 10000 screened.
q2 = 2; q = 0.0002 = 0.014
p = 1 – q = 0.986
(hetero)2pq = 0.0276
Risk of transmitting an AR disorder in relation to disease incidences (the spouse is healthy)
Disease Gene Carrier Risk for Risk for
frequency frequency frequency offspring offspring(q2)/10000 (q) (%) =2pq(%) homo. (%) healthy
(affected sib) sib
100 10.1 18.0 9.0 3.0 50 7.1 13.2 6.6 2.2 20 4.5 8.6 4.3 1.4 10 3.3 6.2 3.1 1.0 8 2.8 5.4 2.7 0.9 6 2.4 4.7 2.3 0.78 5 2.2 4.3 2.1 0.72 4 2.0 3.9 2.0 0.65 2 1.4 2.8 1.4 0.46 1 1.0 2.0 1.0 0.33
0.5 0.71 1.4 0.7 0.23 0.1 0.32 0.64 0.32 0.110.05 0.22 0.44 0.22 0.070.01 0.10 0.2 0.10 0.03
X-Linked Disorders
• Occupy a prominent place in genetic counselling.
• >100 X-linked disorders recognised.
• Majority XR; some dominant (often lethal in hemizygous male).
• X-chromosomes inactivation (lyonns phenomenon). applies to almost all human X-chromosomes.
Recognition of X-Linkage
• No male-to-male transmission.• Affected male All daughters carriers (XR).
All daughters affected (XD).• Unaffected males never transmit disease to either sex.• A definite carrier women risk ½ sons affected.• Carrier women ½ daughters carrier (XR)
½ daughters affected (XD).
• Homozygous affected women are few affected male are much more.
These guidelines will cover most genetic counseling problems.
Mitochondrial Inheritance
• No transmission in descendents of males, affected or not.
• Both sexes may be affected.
• Females may be symptomless carriers.
• All daughters of an affected or carrier female are at risk of transmitting the disorders or of becoming affected.
• All sons may become affected, but do not transmit it to their children
Degree of Relationship to patients Proportion of gene shared
• First degree……………………………………. 1/4• Sibs (brothers & sisters)• Dizygotic twins• Parents• Child
• Second degree …….. ………………………….. 1/4 • Half sibs• Uncles, aunts• Nephew, nieces• Double first cousins
• Third degree: ……………………………………. 1/8 • First cousins• Half uncles, aunts• half nephew, nieces
Gene Chance Degree of
Relation shared of Homo.
Monozygotic twin - 1 -
Dizytotic twin 1st 1/2 1/4
Sibs 1st 1/2 1/4
Uncle-nephew (aunt-niece) 2nd 1/4 1/8
Half-sibs 2nd 1/4 1/8
Double 1st cousin 2nd 1/4 1/8
First cousin 3rd 1/8 1/16
Consanguinity
• Only relevant to genetic risks if it involves both parental lives not just one.
Consanguinity relevant Not relevant
• The rarer the disorder the higher the proportion of affected individuals from consanguineous marriages.
• Consanguinity must be seen in the context of particular community. An apparent relationship of a particular disorder is much less certain if 30% cousin marriages, compared to non-consanguineous mating.
• Extensive consanguinity (AR) appears like AD.