Gene, 156 (1995) 85-88 1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50

GENE 08792

85

An enhanced broad-host-range vector for Gram-negative bacteria: avoiding tetracycline phototoxicity during the growth of photosynthetic bacteria

(Plasmid; pRK404; pRK415; Rhodobacter sphaeroides; multiple cloning site(s); subcloning; dihydrofolate reductase; trimethoprim)

Michael W. Mather, Lisa M. McReynolds and Chang-An Yu

Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK 74078, USA

Received by R.E. Yasbin: 19 October 1994; Revised/Accepted: 6 December/9 December 1994; Received at publishers: 19 January 1995

SUMMARY

A mobilizable, broad-host-range (bhr) plasmid was derived from the widely used IncP1 vector pRK415. The new vector, pRKD418, contains an additional resistance gene and an enlarged multiple cloning site (MCS) region. The optimal growth of pRK415-containing bacteria under photosynthetic conditions generally requires the use of optical filters to protect the selective antibiotic tetracycline (Tc) from photooxidation with the resulting production of toxic photoproducts; pRK415 is not stably maintained in the absence of selective pressure. The addition of a trimethoprim- resistant dihydrofolate reductase-encoding gene provided for optimal photosynthetic growth in the presence of a selective antibiotic without any special apparatus. The presence of an antibiotic marker not found in commonly used cloning vectors in many cases facilitates the subcloning of inserts into the bhr plasmid. The new MCS region provides further cloning flexibility with at least sixteen available restriction sites. Easily constructed derivative plasmids, exemplified by pRKD418KmE, provide a convenient screening procedure for the detection of recombinants during subcloning.

INTRODUCTION

The mobilizable broad-host-range (bhr) vectors pRK404 and pRK415 (Ditta et al., 1985; Keen et al., 1988) are widely used to introduce cloned DNA into a

Correspondence to: Dr. M.W. Mather, Department of Biochemistry and Molecular Biology, Oklahoma Agricultural Experiment Station, Oklahoma State University, 246 Noble Research Center, Stillwater, OK 74078, USA. Tel. (1-405) 744-9336; Fax (1-405) 744-7799; e-mail: mmather@bmb-fs 1.biochem.okstate.edu

Abbreviations: A, absorbance (1 cm); Ap, anapicillin; bhr, broad-host range; bp, base pair(s); dhfr, dihydrofolate reductase-encoding gene; kb, kilobase(s) or 1000 bp; Km, kanamycin; MCS, multiple cloning site(s); nt, nucleotide(s); ori/oriV, origin(s) of DNA replication; oriT, origin of transfer; PCR, polymerase chain reaction; PolIk, Klenow (large) frag- ment of E. coil DNA polymerase I; R, resistance/resistant; R., Rhodobacter; Rs, Rhodobacter sphaeroides; Tc, tetracycline; Tp, tri- methoprim; [], denotes plasmid-carrier state.

broad range of Gram- bacterial species, including non-sulfur purple photosynthetic bacteria such as Rhodobacter sphaeroides (Rs). However, the relatively small number of restriction enzyme sites available for cloning and the use of tetracycline (Tc) as the selective antibiotic place some limitations on this usage. Tc is required for stable inheritance of the plasmids, but is sub- ject to photooxidation, yielding products inhibitory to the growth of Rs and other bacteria (Hasan and Khan, 1986; Martin et al., 1987; Davis et al., 1988). As a possible alternative selectable marker, we introduced the trimeth- oprim-resistant (TpR), dihydrofolate reductase-encoding gene (dhfr) from R388 (Ward and Grinstead, 1982) into a pRK415-based plasmid used for enzyme production in Rs. It was found that the photosynthetic growth rate in the presence of Tp without a filter was the same as that with Tc plus a filter (M.W.M., unpublished results). Here

SSD1 0378-1119(95)00074-7

86

we report the subsequent construction of a flexible bhr vector, pRKD418, which contains an enhanced MCS region, as well as the Tp r marker.

EXPERIMENTAL AND DISCUSSION

(a) Features of the bhr vector pRKD418 The construction of pRKD418 and the useful inter-

mediate pRKD418KmE is outlined in Fig. 1. Plasmid pRKD418 contains a MCS modified from the 'super- polylinker' vector pSL1180 (Brosius, 1989) that provides several new cloning sites (ApaLI, BgllI, ClaI, HpaI, MluI, NsiI, PinAI, ScaI, and XhoI), as well as all the sites avail- able in pRK415. The sequence of the MCS was verified by nt sequencing (Fig. 2). Note that the HpaI and ScaI sites introduce the ability to directly clone blunt-end frag- ments. The Tpr-dhfr gene was inserted near one end of the MCS, but is transcribed away from the MCS. The Tp R marker is not found on commonly used cloning vec- tors, including those that carry a Tc R marker, for example, pBR322 (Bolivar et al., 1977). Hence, Tp R can consis-

Fig. 1. Plasmid construction strategy and maps. (A) pRKD8. The plas- mid pSL8DEN contains the R388 Tpr-dhfr gene (Ward and Grinstead, 1982) and the bulk of the MCS from pSLll80 (Brosius, 1989) in a 1200-bp HindlII-EcoRI fragment. This 1200-bp HindlII-EcoRI frag- ment was excised from pSL8DEN and ligated between the HindlII and EcoRI sites of pRK415. The desired recombinant, pRKD8, in which the pRK415 MCS is replaced by the 1200-bp HindlII-EcoRI fragment, was obtained by selecting Tp R and Tc R transformants. (B) pRKD418KmE and pRKD418. The remaining steps of the construction remove the EcoRI site present downstream from the Tp R marker and replace the BbuI (SphI) site in the MCS with an EcoRI site; the BbuI site is not available for cloning in pRK415 derivatives since there is a site in the vector outside the MCS. The Km R cassette from pUC4K (Vieira and Messing, 1983) was used as a selectable marker to mobilize the EcoRI site, first by insertion as a blunt-ended fragment into the blunted BbuI site of pSLll80 (Brosius, 1989); this procedure regener- ated the EcoRI sites at each end of the Km R resistance cassette. The EcoRI site-bearing Km R cassette was then transferred as a BgllI-XbaI fragment into pRKD8AE (produced by filling-in the EcoRI site of pRKD8 with Pollk). Selection for Tp, Tc and Km resistance yielded the desired recombinant plasmid pRKD4t8KmE. Excision of the Km R cassette with EcoRI then produced pRKD418, initially verified by screening for Km-sensitive transformants. Standard molecular genetic procedures were followed (Sambrook et al., 1989) during this construc- tion, unless otherwise noted. Restriction endonucleases and DNA modi- fying enzymes were purchased from Life Technologies (Gaithersburg, MD, USA), Promega (Madison, WI, USA), New England Biolabs (Beverly, MA, USA) and U.S. Biochemical (Cleveland, OH, USA), and used according to the manufacturer's instructions. The R388 Tp r dhfr gene was obtained from pSUP5TP (Rott et al., 1993) by excision of the 880-bp ApaLI-EcoRI restriction fragment. In this figure, the plasmid representations are not drawn to scale, and only selected restriction sites are indicated. B, BamHI; Bg, BgllI; D, DraI; E, EcoRI; H, HindlII; Hp, HpaI; K, KpnI; M, MluI; N, NsiI; Nc, NcoI; P, PstI; PA, PinAI; Sc, Scal; Ss, SstI; X, XbaI; Xh, XhoI; Xm, XmnI.

A K 8 X

Xm

~ a e s ) m

E Hi/~llll Hi~ll

[ transfot~laUon (select TpRTc R)

B9 XK ~,ll.+p N E B

on~

pRKDe i 11.7 k~ tetR Xm teL4

B BB9 X~ K PjA Hp N

x., PM

g: Xm

X

\ B,, Bgt, / XI~I ~al Phosphatase

~ation transformation

Xm ~BO E BH BExK

I EcoRI ligation trar~formation (select TpRT R) s~een for Y~n s

9gEX KpA Xm B HPNp M

Xm

87

AatII Bsu36I Apal MunI RcaI BssHI I CIaZ DraI ApSLX Ncol SalI Smal ~am~II BclI .~glZI PvuI EcoRV Eco47II I I i F I f I l I i I 1 I I i t I I I

GCTGTGCACGATCC C CATGGGACGTCGACCTGAGGTAATTATAAc C CGGGCCC TATATATGGATC C AATTGCAATGATCATCATGACAGATCTGCGCGCGATCGATATCAGCGC TTTAAA

120 ] ~ Pspl406I SnaBI AccII I AseI AvrI I NdeI Eag]~ PvuII

lie o l~.'r X138 I" ~ HDSI Nael Bstl l07I SspI $tuI Nsl I Notl PstX NarI CIsZ I r I I I i I I I t i I i I I f II I I I l

TTTGCGAATTTAGCTATAGTTCTAGAGGTACCGGTTGTTAACGTTAGCCGGCTAGTATACTCCGGAATATTAATAGGCCTAGGATGCATATGGCGGCCGCCTGAGCTGGCGCCATCG

240 SunI NruI Bspl4071 XhoI SpeI Eco72I AflII

M Iu I SacII Nspl SmtI ~ SfiI ApaLI H ind I I I i l f I i J J J l J I I l I r

ATACGCGTACGT~GCGAC~GCGGACATGTACAGAGCT~GAGAAGTACTAGTC~CCA~GTGGG~CGTGCACCTTAAGCTTGGC 322

Fig. 2. Sequence and partial restriction site map of the MCS of pRKD418. The cloning sites known to be unique are underlined. In addition, ApaLI and ClaI each are present twice in the MCS region and not elsewhere in the plasmid, and thus are available for cloning when the intervening sites are not needed. (Note: all of the underlined sites were tested; however, a small number of additional cloning sites may exist, as some restriction sites in the MCS recognized by less commonly used restriction enzymes were not tested). The DNA fragment for dideoxy sequencing was generated using PCR with 24-mer 'universal' and 'reverse' M13 primers; the template was converted to single-stranded form using T7 gene 6 exonuclease prior to performing cycle sequencing reactions.

tently be used to select against such vectors when sub- cloning DNA inserts into pRKD418, eliminating any need for isolation of DNA fragments or for extensive screening. Although we have not tested the vector in species other than E. coli and Rs, pRKD418 should be a useful vehicle for conjugative transfer to a wide variety of Gram- bacteria, as the host range of the RK2 plasmid origin and the expression range of the TpR-dhfr gene are both extensive (Sasakawa and Yoshikawa, 1987; Thomas and Helinski, 1989).

A convenient screening procedure makes use of derivatives of pRKD418 marked with an antibiotic resist- ance cassette at specific sites in the MCS, such as pRKD418KmE (Fig. 1). pRKD418KmE contains the Km resistance cassette from pUC4K (Vieira and Messing, 1983) inserted in the EcoRI site. Replacement cloning, e.g., insertion of a DNA fragment between the EcoRI sites or between the BamHI site and the XbaI site of pRKD418KmE results in loss of the Km R cassette. Recombinants can then be identified by screening for Km sensitivity, as in the final step of the preparation of pRKD418 (Fig. 1).

(b) Photosynthetic growth pRKD418 was introduced into Rs 2.4.1 by conjuga-

tion. Rs and exconjugant Rs[pRKD418] cells were grown photosynthetically under optimal conditions in a supplemented Sistrom's minimal medium (Leuking et al., 1978), but in the absence of optical filters. A heavy inocu- lum and 2-h dark adaptation period were used to achieve low oxygen levels and rapid induction of the photosyn- thetic apparatus prior to placing the cultures in the light. Growth was slower in the cultures containing Tc (1 ~tg/ml) (3.1 h generation time) than it was in the presence of Tp (25~tg/ml) (2.6h per generation). Rs[pRKD418] cells selected by Tp did grow 15% more

slowly than Rs cells without a heterologous plasmid, but this growth rate differential is slightly less than the 20-40% reported for photoheterotrophic cultures of Rs[pRK415] selected by Tc with optical filters (Davis et al., 1988). Even a small reduction in the inoculum size (initial A660 of 0.1 rather than 0.15) significantly changed the growth characteristics of Tc-containing photosyn- thetic cultures. While Rs cells and Rs[pRKD418] cells grown with Tp exhibited modestly slower growth, the growth rate of the plasmid-bearing cells in the presence of Tc became much slower and quite variable, with doubling times in the range of approx. 4.5-7 h. This is consistent with a higher residual oxygen level in the cul- tures initiated with the smaller inoculum.

(c) Conclusions We have reported the construction of a plasmid vector,

pRKD418, that overcomes the problems associated with Tc selection during photosynthetic growth of purple photosynthetic bacteria. Useful features of the plasmid include (i) the ability to be mobilized, (ii) a MCS with 16 available cloning sites and (iii) the presence of two anti- biotic-resistance markers, Tc R and Tp R, which allows streamlined DNA cloning procedures. Additionally, aux- iliary plasmid vectors can easily be constructed that pro- vide a convenient screening method for the identification of recombinant clones. Finally, use of the vector should not be limited to photosynthetic bacteria, although we have not experimentally verified the expected bhr of the plasmid among Gram- species.

ACKNOWLEDGEMENTS

Support was provided in part by the Oklahoma Agricultural Experiment Station, Oklahoma Center for

88

the Advancement of Science and Technology (OCAST) grant HN3-008 to M.W.M., and NIH grant GM 30721 to C.-A.Y. The authors wish to thank Drs. T.J. Donohue, S. Kaplan and R.B. Gennis for providing bacterial strains and ptasmids, and Dr. U.K. Melcher for critical reading of the manuscript.

REFERENCES

Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heyneker, H.L., Boyer, H.W., Crossa, J.H. and Falkow, S.: Construction of new cloning vehicles, II. A multipurpose cloning system. Gene 2 (1977) 95-113.

Brosius, J.: Superpolylinkers in cloning and expression vectors. DNA 8 (1989) 759-777.

Davis, J., Donohue, T.J. and Kaplan, S.: Construction, characterization, and complementation of a Puf- mutant of Rhodobacter sphaeroides. J. Bacteriol. 170 (1988) 320-329.

Ditta, G., Schmidhauser, T., Yakobson, E., Lu, P., Liang, X.-W., Finlay, D., Guiney, D. and Helinski, D.R.: Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitor- ing gene expression. Plasmid 13 (1985) 149-153.

Hasan, T. and Khan, A.U.: Phototoxicity of the tetracyclines: photo- sensitized emission of singlet delta dioxygen. Proc. Natl. Acad. Sci. USA 83 (1986)4604-4606.

Keen, N.T., Tamaki, S., Kobayashi, D. and TroUinger, D.: Improved broad-host-range plasmids for DNA cloning in Gram-negative bac- teria. Gene 70 (1988) 191-197.

Leuking, D.R., Fraley, R.T. and Kaplan, S.: Intracytoplasmic membrane synthesis in synchronous cell populations of Rhodopseudomonas sphaeroides. J. Biol. Chem. 253 (1978) 451-457.

Martin Jr., J.P., Colina, K. and Logsdon, N.: Role of oxygen radicals in the phototoxicity of tetracyclines toward Escherichia coli B. J. Bacteriol. 169 (1987) 2516-2522.

Rott, M.A., Witthuhn, V.C., Schitke, B.A., Soranno, M., Ali, A. and Donohue, T.J.: Genetic evidence for the role of isocytochrome c 2 in photosynthetic growth of Rhodobacter sphaeroides Spd mutants. J. Bacteriol. 175 (1993) 358 366.

Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

Sasakawa, C. and Yoshikawa, M.: A series of Tn5 variants with various drug-resistance markers and suicide vector for transposon mutagen- esis. Gene 56 (1987) 283-288.

Thomas, C.M. and Helinski, D.R.: Vegetative replication and stable inheritance of IncP plasmids. In: Thomas, C.M. (Ed.), Promiscuous Plasmids of Gram-negative Bacteria. Academic Press, London, 1989, pp. 1-25.

Vieira, J. and Messing, J.: The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19 (1983) 254-268.

Ward, J.M. and Grinstead, J.: Physical and genetic analysis of the IncW group plasmids R388, Sa, and R7K. Plasmid 7 (1982) 239-250.