Materials and Methods

Mice and fetal liver chimerizations

Foxj1 -/- (1), BXSB/MpJ, MRL/MpJ-CD95lpr/lpr (MRL/lpr), C57BL/6 (Jackson

Laboratory, Bar Harbor, ME), and Rag-2 -/- (Taconic, Germantown, NY) mice were

maintained under specific pathogen-free conditions at the Washington University

School of Medicine. Fetal liver chimerization was performed in a manner similar to

prior studies (2). Briefly, fetal livers of embryos of ages E12.5-14.5 (from Foxj1 +/- x

+/- matings) were genotyped by PCR (1) and +/+ and/or -/- livers were used to

reconstitute 6 Gy-irradiated Rag-2 -/- animals. Recipients were then maintained on

trimethoprim/sulfamethoxazole-supplemented water for approximately 28 days before

analyses approximately 4-6 weeks post-chimerization. Foxj1 -/- fetal liver cells

reconstituted irradiated recipients with a similar efficiency as their Foxj1 +/+

counterparts, as judged by the presence of IgM+ peripheral blood lymphocytes (96%

(48/50) versus 92% (44/48), respectively, 3). As Foxj1 -/- chimeras became moribund,

they were euthanized for humane reasons. All experiments were performed in

compliance with the relevant laws and institutional guidelines, as overseen by the

Animal Studies Committee of the Washington University School of Medicine.

Flow cytometry

Flow cytometric analyses were performed on a FACSCalibur System (BD

Biosciences, San Diego, California) using splenocytes cleared of red blood cells by

osmotic lysis or lymph node cells. Antibodies used included: FITC-16A (anti-

CD45RB), APC-53-7.3 (anti-CD5), FITC-7D4 (anti-CD25), PE-IM7 (anti-CD44), PE-

MEL-14 (anti-CD62L), CyChrome-RA3-6B2 (anti-CD45R/B220), PE-R6-60.2 (anti-

IgM), and CyChrome-RM4-4 (anti-CD4; BD Pharmingen, San Diego, CA). Where

indicated, cell sorting was performed by the High Speed Cell Sorter Core Facility of the

Siteman Cancer Center, Washington University School of Medicine, St. Louis, MO.

Lymphocyte cultures and in vitro differentiation

Naive-enriched B cells were purified from C57BL/6 spleens by negative

selection against CD43 (Miltenyi Biotec, Auburn, CA, 4). For bulk CD4+ Th cell

analyses, splenocytes were cleared of erythrocytes by osmotic lysis, and CD4+ cells

purified by positive magnetic bead selection (Miltenyi Biotec). For naive-enriched

CD4+ Th cell analyses, lymph node cells from cervical, axillary, brachial, inguinal, and

popliteal nodes were first cleared of CD8+, MHC II+ and CD44+ cells by negative

magnetic bead selection (Miltenyi Biotec), followed by positive CD4+ magnetic

selection. In general, cells were then incubated in complete RPMI medium

supplemented with 10% fetal calf serum (BioWhittaker, Walkersville, MD), 10 mM

HEPES, 1 mM sodium pyruvate, 2 mM glutamine, 50 µM β-mercaptoethanol, and 100

U penicillin/streptomycin (Sigma-Aldrich Chemical Co., St. Louis, MO) in 96-well U-

bottom plates pre-coated with anti-CD3 (145-2C11, Pharmingen) at the concentrations

indicated at 5 x 104 cells/well. Where indicated, 1 µg/mL soluble anti-CD28 (37.51,

Pharmingen) and/or 100 U/mL recombinant human IL-2 (PeproTech, Inc, Rocky Hill,

NJ) were added. For Th-neutral primary stimulation, Th cells were incubated in 12-well

tissue culture plates at 0.5 x 106 cells/mL with 1 µg/mL plate-bound anti-CD3 and 1

µg/mL soluble anti-CD28. For Th1 conditions, cultures were supplemented with

recombinant murine IL-12 10 ng/mL (PeproTech) and 10 µg/mL anti-IL-4 (11B11,

Pharmingen); for Th2 conditions, cultures were supplemented with 10 ng/mL

recombinant murine IL-4 (PeproTech), 10 µg/mL anti-IFN-γ (XMG1.2) and 10 µg/mL

anti-IL-12 (C17.8, Pharmingen). On day 3-4, T cells were expanded in complete

medium containing 100 U/mL IL-2, and restimulated on day 6 with 1 µg/mL plate-

bound anti-CD3. Where indicated, anti-IL-2 (SB46, Pharmingen) was added at 10

µg/mL; and phosphorothiate antisense or missense oligonucleotides against RELA,

which result in the specific knock-down of this NF-κB subunit, were added at 10 µM

(3, 5). Culture supernatants were assayed for IL-2, IL-4, IL-5, IL-6, IL-10, and/or IFN-γ

by ELISA (Pharmingen) after 72 hours for primary stimulations, or 20 hours for

secondary stimulations.

T cell proliferation assays

Proliferation was assessed by 5-bromo-2’-deoxy-uridine incorporation (BrdU

Labeling and Detection Kit III, Roche Molecular Biochemicals, Mannheim, Germany)

on day 3 of T cell stimulation after 4-5 hours of cell labeling. For autologous mixed

lymphocyte reactions, CD4 cells were stimulated under Th-neutral conditions, followed

by expansion in IL-2, as above. Antigen-presenting cells were prepared from Rag-2 -/-

chimera splenocytes, irradiated by 30 Gy, and combined with day 6 primarily-

stimulated T cells at a 1:1 ratio in complete medium, 5 x 104 cells per well in a 96-well

flat-bottom plate. Where indicated, concanavalin A (Calbiochem) was supplemented at

5 µg/mL. Proliferation was assessed by BrdU incorporation as above on day 3.

RNA transcript analysis

For RNA analyses, RNA was prepared from cells at the times indicated in the

text with the RNeasy® Mini Kit (Qiagen, Inc., Valencia, CA), and first-strand cDNA

synthesized using oligo(dT) primers and SuperScript™ II reverse transcriptase

(Invitrogen Corp., Carlsbad, CA). Samples were then subjected to real-time PCR

analysis on an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems,

Foster City, CA) under standard conditions with specificity reinforced via the

dissociation protocol. Foxj1-specific primers included 5’-

CACGGACAACTTCTGCTACTTCC and 5’-AGGACAGGTTGTGGCGGAT. T-bet,

GATA-3 (6), cyclinD1 (7), GADD45β (8) and cytokine-specific (9) primers have been

previously described. Relative mRNA abundance of each transcript was normalized

against tubulin (10), calculated as 2(Ct[tubulin] – Ct[gene]), where Ct represents the threshold

cycle for each transcript.

Luciferase assays and constructs

Reporter assays utilized pNFAT-luc (a 3X NF-AT reporter; Stratagene, La Jolla,

CA), 2X NF-κB-luc (11), T-box-luc (a T-box transcription factor reporter, 12), and

pRL-CMV (Renilla luciferase control reporter, Promega, Madison, WI). IκBβ-luc was

constructed by PCR from C57BL/6 genomic DNA, using primers 5’-

GGGGTACCAGAACTTGACATCGGACCCTTACATTTC and 5’-

GAAGATCTGCTCCAGTGCTTCCGCCCTATCG, which produced a ~598 bp

fragment corresponding to the IκBβ promoter (13), flanked by KpnI and BglII

restriction sites. The amplicon was cloned into the KpnI-BglII sites of TK-luc (12) and

then confirmed by routine sequencing (3). Of note, this fragment contains a single

sequence TGTGGTGC at b.p. 503-509 that resembles the in vitro-defined Foxj1

consensus binding site TGTNNTGT (14). For studies in the M12 murine B cell

lymphoma (4), 107 cells in 400 µL complete RPMI medium were electroporated in a 0.4

cm cuvette at 280 mV, 975 µF in the presence of 10 µg luciferase reporter, 40 ng pRL-

CMV, and 10 µg pCDNA3 (Invitrogen Corp., Carlsbad, CA) or pCDNA3-Foxj1

expression plasmid (15), and then returned to cell culture medium. After four hours,

reporter activity was determined by the Dual-Luciferase® Reporter Assay System

(Promega), and relative activity determined after normalization for Renilla luciferase.

For the 293-T transformed human embryonic kidney line (11), 0.1-0.2 x 106 adherent

cells in DMEM medium with 10% fetal calf serum were transfected with 10 ng pRL-

CMV, 2 µg pcDNA3 or pcDNA3-Foxj1, and the indicated amounts of NF-κB-luc using

FuGENE 6 (Roche). Twenty-four hours later, cells were stimulated with 20 ng/mL

recombinant human TNF-α (PeproTech), and 4 hours thereafter cells were analyzed via

the Dual-Luciferase assay, with relative activity determined after normalization for

Renilla. For primary T cells, assays were performed as described (16), except that we

used 2 x 107 purified CD4+ cells, 20 µg NF-κB- or NF-AT-luc and 0.4 µg of pRL-

CMV, with relative activity determined after normalization for Renilla.

Histopathology

Tissue histology was performed on buffered formalin-fixed, paraffin-imbedded

specimens with routine hematoxylin and eosin staining.

Immunoglobulin studies

Chimeric animals were assayed for serum immunoglobulin titers and/or

autoantibodies 4-6 weeks after chimerization by standard ELISA (Southern

Biotechnology Associates, Birmingham, AL) and/or immunofluorescence protocols, as

described (2, 4).

Immunohistochemistry

The retroviral pMX-Foxj1-IRES-GFP expression vector was generated by

subcloning a ~1.7 kB KpnI-XbaI fragment containing the Foxj1 coding sequence from

pCDNA3-Foxj1 into the XhoI site of pMX-IRES-GFP (17). For infection, 293-T cells

were plated at 0.1 x 106 cells per well of a 6-well tissue culture plate, each well

containing a cover slip. After growth for 16-20 hours, the cells were infected with fresh

retroviral supernatants of pMX-IRES-GFP versus pMX-Foxj1-IRES-GFP viruses

generated in the PlatE packaging line (18) by centrifugation at 1000g, 45 minutes in the

presence of 4 µg/mL polybrene (Sigma). Twenty-four hours after infection, cells were

treated with or without 20ng/mL TNF-α for 20 minutes prior to fixation in 100%

methanol (Sigma) for 5 minutes, -20°C. The cover slips were then washed thrice with

PBS, blocked with 10% normal goat serum in PBS, incubated with primary antibody at

1:100 dilution in PBS for 60 minutes in a humidified chamber, washed thrice with PBS,

incubated with PE goat anti-rabbit IgG (Southern Biotechnology) at 1:100 dilution in

PBS for 45 minutes, mounted on glass slides and visualized by fluorescence

microscopy. Nuclear versus cytoplasmic staining of NF-κB proteins was determined in

GFP-positive cells. Primary antibodies included C-20 (rabbit anti-RELA), NLS (rabbit

anti-p50), and C (rabbit anti-c-REL; Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

Western blotting

293-T cells were transfected with pCDNA versus pCDNA-Foxj1 and treated

with TNF-α as described above. After two hours, total cell lysates were resolved by

7.5% SDS-PAGE electrophoresis and blotted to nitrocellulose. Membranes were

blocked with 5% nonfat dried milk (Sigma), incubated with primary antibody at 1:200

dilution for 1 hour, washed thrice with PBS containing 0.05% Tween-20 (Sigma),

incubated with HRP-conjugated mouse anti-goat or donkey anti-rabbit IgG (Pierce,

Rockford, IL) at 1:5000 dilution for 1 hour, washed thrice with PBS-Tween, and then

developed using ECL Western Blotting Detection Reagents (Amersham Biosciences,

Piscataway, NJ) and BioMax MR film (Eastman Kodak Co., Chicago, IL). Primary

antibodies included I-19 (goat anti-actin) FL (rabbit anti-IκBα), C-20 (rabbit anti-IκBβ)

and M-364 (rabbit anti-IκBε; Santa Cruz).

EMSA

For detection of NF-κB activity, the NF-κB target sequence oligo 5’-

AGTTGAGGGGACTTTCCCAGGC was incubated with its complementary sequence

for 5 minutes at 100°C in 50 mM NaCL, cooled overnight to room temperature, and

then end-labeled with 32P using polynucleotide kinase (New England Biolabs, Beverly,

MA). The labeled oligo was then incubated for 5 minutes, room temperature with

nuclear extracts derived from 293-T or BEAS-2B cells previously transfected with

pCDNA versus pCDNA-Foxj1 (19), and treated with or without TNF-α for 30-45

minutes (20). The oligo-extract mixture was then resolved on a non-denaturing 5%

acrylamide gel, which was then dried and developed by routine autoradiography.

Supershift experiments involved the pre-incubation of appropriate antibody prior to

electrophoresis: C-20, NLS, C, or a rabbit polyclonal antibody against Foxj1 (19).

Supporting Figure Legends

Figure S1. Foxj1 is downregulated by T cell stimulation. Naive CD4+ T cells were

isolated from wild-type C57BL/6 mice (left graph) and incubated in the presence (black

bars) or absence (open bars) of 1 µg/mL plate-bound anti-CD3, as well as, where

indicated, soluble anti-CD28 and/or recombinant IL-2. After 24 hours, Foxj1 expression

was determined by real-time PCR. For comparison, expression of Foxj1 is shown for

naive CD4 cells stimulated for 3 days under Th1 or Th2 conditions, as well as naive B

cells (middle graph). Also shown are expression levels for Foxj1 in naive CD4 T cells

derived from lupus-prone BXSB or MRL/lpr mice, incubated for 24 hours in the

presence (black bars) or absence (open bars) of IL-2. Shown are data based upon three

separately tested mice, with standard deviations shown, representative of two

experiments.

Figure S2. Relationship of Foxj1 expression to IκBβ. A, Foxj1 is downregulated during

T cell activation. Naive wild-type (WT) Th cells, as well as WT cells stimulated

overnight with plate-bound anti-CD3 or IL-2, were assessed for Foxj1 expression by

Western blotting. Foxj1 runs as a doublet (arrows). B, Expression of IκBβ correlates

with that of Foxj1. Naive wild-type Th cells were stimulated as in Fig. S1 and then

analyzed for IκBβ expression by real-time PCR. This expression pattern is highly

reminiscent of Foxj1 (Fig. S1). C, Foxj1 induces IκBβ gene transcription. Wild-type Th

cells were retrovirally transduced with pMX-IRES-GFP (control) or pMX-Foxj1-IRES-

GFP (Foxj1) retroviruses, sorted for GFP-positive cells, and then assessed for IκBβ

expression by real-time PCR. D, Foxj1 transactivates the IκBβ promoter. The

responsiveness of an IκBβ promoter-luciferase construct was assessed in wild-type Th

cells co-transfected with pCDNA (control) or pCDNA-Foxj1 (Foxj1) vectors.

Figure S3. Developmental lymphoid phenotype in the absence of Foxj1. Splenic

lymphoid populations were examined by flow cytometry for the cell populations

indicated, gated on the cell marker indicated (right). Numbers indicate percentage of

gated cells, representative of 5 animals tested for each genotype. Findings were similar

in lymph nodes (3).

Figure S4. Exaggerated Th2 cytokine production by Foxj1 -/- Th cells. Th2-

differentiated Th cells from Foxj1 -/- (circles) and –sufficient (squares) chimeric

animals were stimulated with the indicated amounts of plate-bound anti-CD3. After 20

hours, culture supernatants were assessed for specific cytokines by ELISA. Foxj1 -/-

Th2 cells were significantly different than their –sufficient counterparts for both

cytokines at all anti-CD3 doses above 0 µg/mL (p<0.001). Error bars indicate standard

deviations.

Figure S5. Relevance of Foxj1 to NF-κB activities. A, Foxj1 inhibits NF-κB DNA

binding activity. Nuclear extracts of BEAS-2B cells stably transfected with a control or

Foxj1-expressing vector were prepared after 1 hour of TNF-α stimulation, and 10 µg of

each sample was used for gel-shift. Where indicated anti-RELA or anti-Foxj1 antisera

were added for supershift analysis. B, NF-κB target gene expression in Foxj1 -/- T cells.

Naive Th cells from Foxj1 -/- or +/+ chimeras were stimulated with plate-bound anti-

CD3 only for 24 hours, and then analyzed for the expression of IL-2, IFN-γ, cyclin D1,

and GADD45β by real-time PCR analysis. C, NF-κB hyperactivation accounts for the

hyperproliferation of Foxj1 -/- T cells. Naive T cells from Foxj1 -/- or –sufficient

chimeras were stimulated in vitro with plate-bound anti-CD3 (1 µg/mL) in the presence

or absence of missense or antisense RELA (p65) oligonucleonucleotides. On day 3,

proliferation was evaluated by BrdU incorporation, and IFN-γ secretion was evaluated

by ELISA on culture supernatants.

Figure S6. Foxj1 is a distinct quiescence pathway in T cells. Unlike lung kruppel-like

factor (LKLF) and Tob/Smad, which have no known effect on NF-κB activity (21, 22),

Foxj1 is required to suppress spontaneous NF-κB activation, at least in part via IκB

genes, and prevent the subsequent development of activated T cells and tolerance loss.

Figure S1

Figure S2

Figure S3

Figure S4

Figure S5

Figure S6

Supporting References and Notes

1. S. L. Brody, X. H. Yan, M. K. Wuerffel, S. K. Song, S. D. Shapiro, Am. J. Respir.

Cell. Mol. Biol. 23, 45 (2000).

2. S. L. Peng, A. J. Gerth, A. M. Ranger, L. H. Glimcher, Immunity 14, 13 (2001).

3. L. L., A. J. G., S. L. P., Unpublished observations.

4. S. L. Peng, S. J. Szabo, L. H. Glimcher, Proc. Natl. Acad. Sci. USA 99, 5545 (2002).

5. A. R. Khaled, E. J. Butfiloski, E. S. Sobel, J. Schiffenbauer, Clin. Immunol.

Immunopathol. 86, 170 (1998).

6. J. L. Grogan et al., Immunity 14, 205 (2001).

7. G. Schneider et al., J. Biol. Chem. 277, 43599 (2002).

8. M. Iida et al., Carcinogenesis 24, 757 (2003).

9. L. Overbergh, D. Valckx, M. Waer, C. Mathieu, Cytokine 11, 305 (1999).

10. A. J. Gerth, L. Lin, S. L. Peng, Int. Immunol. 15, 937 (2003).

11. M. Oukka et al., Mol. Cell 9, 121 (2002).

12. S. J. Szabo et al., Cell 100, 655 (2000).

13. L. M. Budde, C. Wu, C. Tilman, I. Douglas, S. Ghosh, Mol. Biol. Cell 13, 4179

(2002).

14. L. Lim, H. Zhou, R. H. Costa, Proc. Natl. Acad. Sci. USA 94, 3094 (1997).

15. S. L. Brody, B. P. Hackett, R. A. White, Genomics 45, 509 (1997).

16. J. Rengarajan et al., Immunity 12, 293 (2000).

17. M. Onishi et al., Exp. Hematol. 24, 324 (1996).

18. S. Morita, T. Kojima, T. Kitamura, Gene Ther. 7, 1063 (2000).

19. Y. You et al., Am. J. Physiol. 20, in press and available online at

ajplung.physiology.org/cgi/reprint/00170.2003v1 (2003).

20. E. Schreiber, P. Matthias, M. M. Muller, W. Schaffner, Nuc. Acids Res. 17, 6419

(1989).

21. C. T. Kuo, M. L. Veselits, J. M. Leiden, Science 277, 1986 (1997).

22. D. Tzachanis et al., Nature Immunol. 2, 1174 (2001).