1

RESEARCH ARTICLE

MAPKs Influence Pollen Tube growth by Controlling the Formation of Phosphatidylinositol 4,5-bisphosphate in an Apical Plasma Membrane Domain

Franziska Hempel1, Irene Stenzel1, Mareike Heilmann1, Praveen Krishnamoorthy1, Wilhelm Menzel1, Ralph Golbik2, Stefan Helm3, Dirk Dobritzsch3 Sacha Baginsky3 Justin Lee4, Wolfgang Hoehenwarter5,Ingo Heilmann1*

1 Department of Cellular Biochemistry, Institute of Biochemistry and Biotechnology, Martin-Luther-University Halle-Wittenberg, 06120 Halle (Saale), Germany 2 Department of Microbial Biotechnology, Institute of Biochemistry and Biotechnology, Martin-Luther-University Halle-Wittenberg, 06120 Halle (Saale), Germany 3 Department of Plant Biochemistry, Institute of Biochemistry and Biotechnology, Martin-Luther-University Halle-Wittenberg, 06120 Halle (Saale), Germany 4 Department of Stress and Developmental Biology, Leibniz Institute of Plant Biochemistry, 06120 Halle (Saale), Germany 5 Proteome Analytics, Leibniz Institute of Plant Biochemistry, 06120 Halle (Saale), Germany *Corresponding Author: Ingo Heilmann (ingo.heilmann@biochemtech.uni-halle.de)

Short title: MPK6-mediated phosphorylation of PIP5K6

One-sentence summary: The production of regulatory membrane phospholipids required for polar tip growth of pollen tubes is controlled by mitogen-activated protein kinases.

The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Ingo Heilmann (ingo.heilmann@biochemtech.uni-halle.de).

Abstract An apical plasma membrane domain enriched in the regulatory phospholipid phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) is critical for polar tip growth of pollen tubes. How the biosynthesis of PtdIns(4,5)P2 by phosphatidylinositol 4-phosphate 5-kinases (PI4P 5-kinases) is controlled by upstream signaling is currently unknown. The pollen-expressed PI4P 5-kinase PIP5K6 is required for clathrin-mediated endocytosis and polar tip growth in pollen tubes. Here, we identify PIP5K6 as a target of the pollen-expressed mitogen-activated protein kinase MPK6 and characterize the regulatory effects. Based on an untargeted mass spectrometry approach, phosphorylation of purified recombinant PIP5K6 by pollen tube extracts could be attributed to MPK6. Recombinant MPK6 phosphorylated residues T590 and T597 in the variable insert of the catalytic domain of PIP5K6, and this modification inhibited PIP5K6 activity in vitro. PIP5K6 interacted with MPK6 in yeast two-hybrid tests, immuno-pull-down assays, and by bimolecular fluorescence complementation (BiFC) at the apical plasma membrane of pollen tubes. In vivo, MPK6 expression resulted in reduced plasma membrane association of a fluorescent PtdIns(4,5)P2 reporter and decreased endocytosis without impairing membrane association of PIP5K6. Effects of PIP5K6 expression on pollen tube growth and cell morphology were attenuated by coexpression of MPK6 in a phosphosite-dependent manner. Our data indicate that MPK6 controls PtdIns(4,5)P2 production and membrane trafficking in pollen tubes, possibly contributing to directional growth.

Plant Cell Advance Publication. Published on November 22, 2017, doi:10.1105/tpc.17.00543

©2017 American Society of Plant Biologists. All Rights Reserved

2

Introduction Pollen tubes serve as models for the study of polar tip growth and cellular polarization (Kost, 2008;

Ischebeck et al., 2010a; Rounds and Bezanilla, 2013; Franciosini et al., 2016). Tip-growing cells can

attain length/width ratios exceeding 1000 (Kost, 2008; Riquelme, 2013; Rounds and Bezanilla, 2013)

and share structural features and regulatory mechanisms that have been conserved in evolution (Kost,

2008; Ischebeck et al., 2010a; Rounds and Bezanilla, 2013). The apical expansion of a cell requires

the transport of membrane and cell wall material by directional vesicle trafficking to the growing apex,

and the retrieval of unloaded vesicles (Thole and Nielsen, 2008; Moscatelli and Idilli, 2009; Ischebeck

et al., 2010a; Hepler and Winship, 2015; Franciosini et al., 2016). The polarized expansion of pollen

tubes and some other cell types is furthermore responsive to exogenous cues (Duan et al., 2010;

Kessler and Grossniklaus, 2011; Lindner et al., 2012; Dresselhaus and Franklin-Tong, 2013;

Higashiyama and Takeuchi, 2015; Dresselhaus et al., 2016). For instance, pollen tubes grow towards

the ovules within flowers of a compatible genotype to achieve fertilization, guided by cues emitted by

the female organs (Dresselhaus and Franklin-Tong, 2013; Higashiyama and Takeuchi, 2015;

Dresselhaus et al., 2016). So far, it is unclear how the perception of exogenous cues controls the

machinery for apical cell expansion of pollen tubes.

The apical cell expansion of tip-growing cells is regulated in part by phosphoinositides, such as

phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), which occupies an apical plasma membrane

domain in pollen tubes (Kost et al., 1999; Ischebeck et al., 2008; Sousa et al., 2008; Ischebeck et al.,

2010b; Zhao et al., 2010; Ischebeck et al., 2011; Stenzel et al., 2012) as well as root hairs (Vincent et

al., 2005; Preuss et al., 2006; Kusano et al., 2008; Stenzel et al., 2008; Ghosh et al., 2015) and fungal

hyphae (Mähs et al., 2012). PtdIns(4,5)P2 acts as a ligand to target proteins, which are regulated in

their biochemical activity or subcellular localization by the protein–lipid interaction (Hammond and Balla,

2015; Heilmann, 2016; Gerth et al., 2017). Arabidopsis plants displaying T-DNA- or RNAi-mediated

underexpression of the pollen-specific PI4P 5-kinase isoforms PIP5K4 and PIP5K5 (Ischebeck et al.,

2008; Sousa et al., 2008), PIP5K6 (Zhao et al., 2010), or PIP5K10 and PIP5K11 (Ischebeck et al.,

2011) display substantially reduced rates of pollen germination and pollen tube expansion. Therefore,

the PtdIns(4,5)P2 domain in the apical plasma membrane of pollen tubes is thought to be essential for

polar cell expansion (Kost et al., 1999; Vincent et al., 2005; Ischebeck et al., 2008; Sousa et al., 2008;

Ischebeck et al., 2010b; Zhao et al., 2010; Ischebeck et al., 2011). A critical role of PtdIns(4,5)P2 in the

control of apical secretion of cell wall material and directional cell expansion of pollen tubes was

previously described mainly based on the effects of overexpressing PI4P 5-kinases (Ischebeck et al.,

3

2008; Sousa et al., 2008; Ischebeck et al., 2010b; Zhao et al., 2010; Stenzel et al., 2012). In these

studies, the overproduction of PtdIns(4,5)P2 resulted in increased apical deposition of pectin and

characteristic morphological defects, including pollen tube tip branching and protoplast trapping, which

have previously been summarized as "secretion phenotypes" (Ischebeck et al., 2010b). It is evident

that correct amounts of PtdIns(4,5)P2 are important for the control of apical cell expansion of pollen

tubes and that PtdIns(4,5)P2 production must be tightly controlled. However, it is unknown how the

biosynthesis of PtdIns(4,5)P2 or other phosphoinositides is regulated by upstream signaling pathways.

As PI4P 5-kinases in the apical plasma membrane of pollen tubes generate the PtdIns(4,5)P2

membrane domain important for cell expansion, we examined whether these enzymes are candidates

for regulation. Our working hypothesis was that PI4P 5-kinases in the pollen tube are regulated by

phosphorylation, as has previously been found for the PI4P 5-kinase Mss4p for Saccharomyces

cerevisiae (Audhya and Emr, 2003), and for PI4P 5-kinases from Schizosaccharomyces pombe and

human, which display decreased catalytic activity in vitro when phosphorylated (Vancurova et al., 1999;

Park et al., 2001). Information of posttranslational control of the plant phosphoinositide system is

scarce. The Arabidopsis PI4P 5-kinase, PIP5K1, can be phosphorylated in vitro by mammalian protein

kinase A (PKA) (Westergren et al., 2001). However, the relevant phosphosites or regulatory

consequences of this phosphorylation have not been determined, and endogenous protein kinases

acting upstream of PI4P 5-kinases remain unknown in plants. While a role for protein phosphorylation

in the control of phosphoinositide biosynthesis in pollen tubes has not been reported, protein kinases

are required for the regulation of pollen tube growth (Higashiyama and Takeuchi, 2015). For instance,

Arabidopsis plants carrying lesions in the genes encoding the mitogen-activated protein kinases

(MAPKs) MPK3 and MPK6 display pollen tube guidance defects (Guan et al., 2014), suggesting that a

MAPK-cascade is involved in the transduction of exogenous guidance cues in pollen tubes

(Higashiyama and Takeuchi, 2015). While these findings indicate a role for MAPKs in the control of

pollen tube growth, it is currently unclear how MAPK-mediated protein phosphorylation might be linked

to the machinery for apical cell expansion.

Here, we demonstrate that the pollen-expressed PI4P 5-kinases AtPIP5K6 from Arabidopsis and

NtPIP5K6 from Nicotiana tabacum (tobacco) are phosphorylated by protein kinase activities in pollen

tube extracts. We identify MPK6 and its tobacco homolog, SALICYLIC ACID INDUCED PROTEIN

KINASE (SIPK), as protein kinases that bind and phosphorylate PIP5K6 homologs from Arabidopsis

and tobacco, respectively. Phosphorylation by the MAPKs inhibits PI4P 5-kinase activity in vitro. In vivo,

expression of AtMPK6 reduces the plasma membrane association of a fluorescent reporter for

PtdIns(4,5)P2, inhibits endocytosis, and modulates pollen tube growth. The data demonstrate an

4

unexpected regulatory link between MAPKs and the apical production of PtdIns(4,5)P2 required for

pollen tube expansion.

Results AtPIP5K6 and NtPIP5K6 are phosphorylated by MAPKs from tobacco pollen tube extracts The PI4P 5-kinase AtPIP5K6 and its tobacco homolog NtPIP5K6 have reported roles in the control of

membrane trafficking in pollen tubes (Zhao et al., 2010; Stenzel et al., 2012). To test for phosphorylation

of these enzymes, purified recombinant AtPIP5K6 or NtPIP5K6 were incubated in the presence of γ-

[33P]ATP with extracts obtained from germinated tobacco pollen tubes (Figure 1 A). Both AtPIP5K6 and

NtPIP5K6 were radiolabeled by the incubation (Figure 1 A). For AtPIP5K6, a time course of increasing

incorporation of the radiolabel is shown (Figure 1 A, left panels). Controls without added recombinant

enzyme or without added pollen tube extract did not result in a radiolabeled band (Figure 1 A, right

panels). The data indicate that the pollen tube extract contained protein kinase activities capable of

phosphorylating recombinant AtPIP5K6 and NtPIP5K6 in vitro. Relevant protein kinases from pollen

tube extracts were identified by a non-targeted in-gel kinase assay. Protein extracts of pollen tubes

were electrophoresed on SDS-PAGE gels containing purified recombinant AtPIP5K6 protein embedded

in the gel matrix. Negative controls were performed without added recombinant AtPIP5K6 in the gels.

After renaturing and washing, the gels were incubated with γ-[33P]ATP to assess the in-gel protein

kinase activity against the supplied AtPIP5K6 substrate (Figure 1 B). In the absence of AtPIP5K6 in the

gel, there was no phosphorylation signal with the PKA control, and only weak phosphorylation signals

resulted from the application of the pollen tube extract (Figure 1 B, left panel), which presumably

represent kinase autophosphorylation. By contrast, the presence of recombinant AtPIP5K6 protein in

the gels yielded radiolabeled signals with the PKA positive control as well as enhanced signals with the

pollen tube extract (Figure 1 B, right panel), indicating phosphorylation of the substrate protein,

AtPIP5K6, or possibly enhanced autophosphorylation. In-gel kinase assays performed in parallel with

added AtPIP5K6 protein but without radiolabel were excised in the range of observed bands, the

proteins were reextracted, subjected to tryptic digestion and analyzed by liquid chromatography high

definition multi-parallel collision-induced dissociation mass spectrometry (Nano-LC-HD-MSE) to identify

protein kinase candidates. The underlying mass spectrometry data have been deposited into the

ProteomeXchange Consortium with the dataset identifier PXD006067. Tryptic peptides identified by the

analysis were annotated according to the Arabidopsis genome database. Among the 260 detected

proteins, four candidates for relevant protein kinases represented MAPK sequences (Figure 1 C). The

candidate MPK6 was selected for further analysis, because the encoding gene displays an expression

5

pattern similar to AtPIP5K6 and is highly expressed in pollen according to expression patterns available

in publicly accessible databases (Winter et al., 2007).

Recombinant AtPIP5K6 is phosphorylated by recombinant MPK6 in two bona fide MAPK-recognition motifs To verify phosphorylation of the PIP5K6 homologs from Arabidopsis and tobacco by MPK6 in a targeted

analysis, purified activated recombinant MPK6 was incubated with AtPIP5K6 or NtPIP5K6 in the

presence of γ-[33P]ATP (Figure 2 A). The data indicate that MPK6 is capable of phosphorylating

AtPIP5K6 and NtPIP5K6 in vitro. To test the specificity of this reaction, other recombinant PI4P 5-

kinases from Arabidopsis were also tested (Supplemental Figure 1), among which AtPIP5K6 displayed

the strongest phosphorylation signal, followed by the pollen-specific AtPIP5K5 and a weaker signal for

AtPIP5K1 (Supplemental Figure 1). Recombinant AtPIP5K6 pretreated with activated recombinant

MPK6 was subjected to tryptic digestion and the phosphorylation sites were determined as T590 and

T597 by liquid chromatography on-line with high resolution accurate-mass mass spectrometry (HR/AM

MS) at a sequence coverage of approx. 70% (Supplemental Figure 2 A). Both phosphorylation sites

represent TP (a phosphorylated threonine followed by a proline) phosphorylation motifs characteristic

of MAPKs and are located in the variable insert region of the catalytic domain of AtPIP5K6 (Figure 2 B

and Supplemental Figure 2 B). Phosphorylation of AtPIP5K6 was further verified by treating AtPIP5K6

with MPK6 and γ-[33P]ATP, followed by incubation with serine/threonine protein phosphatase 1 (PP1),

resulting in a reduction of the incorporated [33P] label to below 5% of the control (Figure 2 D).

Furthermore, T590A and T597 A alanine-substitution variants of AtPIP5K6 were generated, in which

the phosphorylation sites were eliminated. Using the variant recombinant proteins, MPK6-mediated

phosphorylation was gradually reduced in the T590A and T597A substitution variants, respectively, and

weakest in the T590A T597A double substitution variant (AtPIP5K6 AA) (Figure 2 E). Differences were

statistically significant, despite a high standard deviation of the control measurements. Residual

phosphorylation of AtPIP5K6 AA by MPK6 (Figure 2 E) was accompanied by phosphorylation of

residues which were not identified in other experiments and are not part of characteristic MAPK

phosphorylation motifs (Supplemental Figure 2 C). These phosphorylation events likely represent non-

specific modifications of the recombinant AtPIP5K6 AA protein by MPK6 in vitro. Together, the data

indicate that purified recombinant AtPIP5K6 was phosphorylated in vitro by purified recombinant MPK6

in positions T590 and T597.

Phosphorylation of AtPIP5K6 at T590 and T597 inhibits catalytic activity

6

To investigate possible effects of the MPK6-mediated phosphorylation on AtPIP5K6 activity, the

enzyme was preincubated with recombinant MPK6 and ATP for 1 h, followed by the determination of

specific PI4P 5-kinase activity. Enzyme activity was assessed according to PtdIns(4,5)P2 formation

after 30 min of incubation, thus within the linear range of product increase (Supplemental Figure 3).

Preincubation with MPK6 resulted in an approx. 60% decrease in catalytic activity of AtPIP5K6 (Figure

3 A). Importantly, incubation with MPK6 did not decrease the activity of AtPIP5K6 AA (Figure 3 A),

where both T590 and T597 were substituted with alanine and can no longer be phosphorylated in vitro

(cf. Figure 2 E). The data indicate that the phosphorylation of AtPIP5K6 in positions T590 and T597

reduced the catalytic activity of AtPIP5K6 in vitro. To further characterize the contribution of these

positions to the catalytic activity of AtPIP5K6, we tested substitution variants of AtPIP5K6 carrying either

an alanine or an aspartate in the respective positions for PI4P 5-kinase activity in vitro (Figure 3 B).

The substitution variants T590A, T590D and T597A did not display altered catalytic activity. By contrast,

the activity of the substitution variant T597D was reduced by approx. 75% (Figure 3 B), suggesting that

T597 might be a relevant residue exerting an effect on the catalytic activity of the enzyme when targeted

by the posttranslational modification or when carrying a negative charge. This notion is supported by

the conservation of this residue within a TP motif of other pollen expressed PI4P 5-kinases, such as

NtPIP5K6 or AtPIP5K5 (cf. Figure 2 C).

As the double substitution variant T590A T597A (AA) displayed enhanced catalytic activity in

vitro while the phosphomimetic T590 D T597D (DD) variant showed an intermediate effect, we

hypothesized that these phosphorylation sites may lie in a region of the PIP5K6 protein that mediates

conformational changes. This hypothesis was tested by analyzing the circular dichroism (CD) of purified

recombinant PIP5K6 variants (Figure 3 C-E). CD spectroscopy data were obtained for the far and near

UV range (Figure 3 C). The far UV data from the CD spectroscopy (Figure 3 D) indicate that the

substitution variants all retained a similar secondary structure, with no gross differences in the content

of alpha-helices or beta-sheets. By contrast, we observed changed patterns in the near UV CD spectra

(Figure 3 E), indicative of differences in the tertiary structures of some of the substitution variants.

Interestingly, T597D displayed the most deviant tertiary structure, which is striking, because only this

variant displayed reduced catalytic activity consistent with the effects of phosphorylation of T597 (cf.

Figure 3 B). The CD spectroscopy data do not indicate substantial differences in secondary or tertiary

structure between PIP5K6 AA and PIP5K6 DD (Figure 3 D, E). Overall, the CD spectroscopy data

indicate that the introduction of a negative charge especially at position 597 results in a change in the

tertiary structure of the PIP5K6 protein, with little or no effect on its secondary structure.

7

MPK6 interacts physically with AtPIP5K6 To further test the interplay between MPK6 and PIP5K6, physical interaction of the proteins was tested

by split-ubiquitin-based yeast two-hybrid analysis (Figure 4 A) using the DualMembrane system

(Johnsson and Varshavsky, 1994; Stagljar et al., 1998; Möckli et al., 2007). In these experiments,

AtPIP5K6 was immobilized as a bait protein at the endoplasmic reticulum by a C-terminally fused OST4

anchor, and the MPK6 prey protein was freely diffusible. Only upon recruitment of MPK6 to the

endoplasmic reticulum by the interaction with the bait protein will the yeast grow on the restrictive

selection media. On selective SD-LWH media, yeast cells expressing both tested proteins displayed

growth comparable to that of positive controls and substantially stronger than that of the negative

controls (Figure 4 A). Similar results were obtained for NtPIP5K6 and SIPK (Supplemental Figure 4).

The interaction was verified by immuno-pull-down experiments using purified recombinant GST-MPK6

and MPB-PIP5K6 proteins (Figure 4 B). In these experiments, immobilized GST-MPK6, but not GST

alone, could bind to MBP-PIP5K6. Furthermore, bimolecular fluorescence complementation (BiFC) was

used to verify the interaction of MPK6 and AtPIP5K6 (Figure 4 C). The coexpression of AtPIP5K6-

YFPN with MPK6-YFPC in tobacco pollen tubes resulted in the reconstitution of fluorescence at the

apical plasma membrane. No fluorescence was observed when AtPIP5K6-YFPN or MPK6-YFPC was

expressed together with YFPC or YFPN, respectively, suggesting that the reconstituted fluorescence

of the protein fusions was not a consequence of reassembling YFP halves. However, the BiFC

experiment has to be interpreted with caution, as the transient pollen tube expression system does not

permit the recommended analysis for protein integrity by immunodetection (Kudla and Bock, 2016). In

sum, the data indicate a (possibly weak) physical interaction of AtPIP5K6 with MPK6, which presumably

takes place at the apical plasma membrane of pollen tubes.

Expression of MPK6 reduces plasma membrane association of a fluorescent reporter for PtdIns(4,5)P2 To test for in vivo effects of MPK6 expression on PtdIns(4,5)P2 formation in pollen tubes, MPK6-EYFP

was coexpressed with a fluorescent probe for PtdIns(4,5)P2, Red StarPLC-PH (König et al., 2008), and

the fluorescence distribution of the probe was analyzed by confocal microscopy (Figure 5). In control

pollen tubes expressing EYFP together with Red StarPLC-PH, the PtdIns(4,5)P2-probe decorated the

apical plasma membrane in the previously reported pattern (Figure 5 A, upper panels). By contrast,

membrane association of the PtdIns(4,5)P2 probe was substantially reduced when MPK6-EYFP was

coexpressed with Red StarPLC-PH, (Figure 5 A, lower panels). The effect of MPK6-EYFP expression on

the membrane association of Red StarPLC-PH was numerically assessed (Figure 5 B and C) based on

8

fluorescence intensity profiles recorded as indicated in Figure 5 B. A decreasing plasma membrane-

associated (PM) vs. cytoplasmic (cyt) intensity ratio of Red StarPLC-PH fluorescence indicates reduced

plasma membrane association of the reporter. The PM vs. cyt intensity ratio of Red StarPLC-PH

fluorescence dropped with increasing expression of MPK6-EYFP (Figure 5 C, closed circles), whereas

the ratio remained roughly constant with increasing expression of the EYFP control (Figure 5 C, open

circles). Reduced membrane association of the PtdIns(4,5)P2-specific probe upon expression of MPK6-

EYFP is consistent with MPK6-mediated inhibition of PIP5K6 (cf. Figure 3 A) and suggests reduced

PtdIns(4,5)P2 formation in the apical plasma membrane of the pollen tubes in vivo. While this

observation cannot be directly verified by biochemical analysis of PtdIns(4,5)P2 levels in pollen tubes

transiently overexpressing PIP5K6-EYFP due to the low transformation frequency, pollen tubes of

tobacco plants, in which the expression of the endogenous MAPKs, SIPK and WIPK, is RNAi

suppressed (Seo et al., 2007), displayed elevated levels of PtdIns(4,5)P2 (Figure 5 D; please see

Supplemental Figure 5 for transcript reduction in pollen tubes from the RNAi lines). These data support

the notion that the formation of PtdIns(4,5)P2 in pollen tubes is controlled by the MAPKs.

Expression of MPK6 does not interfere with membrane association of PIP5K6 in pollen tubes One mode to regulate PI4P 5-kinase activity in animal cells is by an electrostatic switch mechanism,

where the introduction of negative charges, e.g., upon protein phosphorylation, interferes with

membrane association of the enzymes (Rao et al., 1998; Burden et al., 1999; Fairn et al., 2009).

Therefore, we analyzed next whether the coexpression of MPK6-mCherry would influence the apical

membrane association of PIP5K6-EYFP in pollen tubes (Figure 6). When PIP5K6-EYFP was

coexpressed with either an mCherry control or with MPK6-mCherry, membrane association of PIP5K6-

EYFP was not abated (Figure 6) even with higher expression levels of the coexpressed markers (Figure

6 C). The data suggest that the effects of MPK6 on PtdIns(4,5)P2 production, which were observed in

the same cell types at identical conditions (cf. Figures 5), were not mediated by displacement of PIP5K6

from the apical plasma membrane.

Membrane trafficking is influenced by the expression of MPK6 in pollen tubes Next, we examined whether PtdIns(4,5)P2-dependent processes were influenced by MPK6 in vivo. As

PIP5K6 is required for clathrin-mediated endocytosis in pollen tubes (Zhao et al., 2010), we analyzed

the endocytosis of the membrane dye, FM 4-64, over time (Figure 7). The distribution of FM 4-64 was

imaged after 15-25 min, 35-50 min and again after 65-85 min upon dye application in control pollen

tubes expressing EYFP (Figure 7 A, upper panels) and in pollen tubes expressing MPK6-EYFP (Figure

9

7 A, lower panels). In the control pollen tubes, substantial incorporation of the dye into endomembranes

was observed after 35-50 min. By contrast, only limited incorporation was apparent after this time in

pollen tubes expressing MPK6-EYFP (Figure 7 A). Numerically, a decreasing PM vs. cyt intensity ratio

of FM 4-64 fluorescence indicates internalization of the dye into the cytoplasm. After 15-25 min of dye

application, the PM vs. cyt intensity ratios were comparable between EYFP controls and MPK6-EYFP

expressors (p<.045), whereas after 35-50 min and 65-85 min the internalization of the dye was

significantly faster (p<0.01 in both cases) in the control pollen tubes compared to the cells expressing

MPK6-EYFP (Figure 7 B). This pattern indicates reduced endocytosis of FM 4-64 in pollen tubes

expressing MPK6-EYFP. We also tested whether the expression of MPK6 would influence pollen tube

growth, which requires tip-directed membrane trafficking, and apical pectin secretion. After 10 h of

incubation, pollen tubes expressing MPK6 were slightly shorter than control pollen tubes. Furthermore,

pectin secretion according to staining of pollen tubes with ruthenium red was reduced when MPK6-

EYFP was expressed (Supplemental Figure 6). Together these data indicate that different aspects of

apical membrane trafficking are influenced by the overexpression of MPK6-EYFP, consistent with

MPK6-mediated inhibition of PIP5K6 and PtdIns(4,5)P2 production in vivo.

Coexpression with MAPKs attenuates the effects of PIP5K6 homologs from Arabidopsis or tobacco on pollen tube growth To further delineate the functional relevance of the modification of PI4P 5-kinases by MPK6 in vivo, we

scored the incidence of morphological alterations resulting from overexpressing AtPIP5K6 or NtPIP5K6

as a quantitative readout for physiological functionality of the enzymes, as was previously described

(Ischebeck et al., 2008; Ischebeck et al., 2010b; Ischebeck et al., 2011; Stenzel et al., 2012). Pollen

tubes used in our experiments displayed the morphological alterations previously found to result from

overexpression of AtPIP5K6 and NtPIP5K6 (Figure 8 A, left panel). As in previous studies (Ischebeck

et al., 2008; Ischebeck et al., 2011), the distribution of phenotypic categories was associated with the

degree of expression, as assessed by fluorescence intensity of the expressed proteins (Figure 8 A,

right panel). When pollen tubes coexpressing AtPIP5K6-EYFP with an mCherry control were scored

(Figure 8 B), normal, branched and stunted morphologies were observed for approx. 12%, 10% and

66% of fluorescing cells, respectively. Compared to these controls, coexpression of AtPIP5K6-EYFP

with MPK6-mCherry resulted in a significant shift towards weaker morphological defects, with now 22%

normal, 16% branched and only 56% stunted morphologies (p < 0.05 for the increase in normal pollen

tubes). When AtPIP5K6 AA-EYFP or AtPIP5K6 DD-EYFP were each coexpressed with either an

mCherry control or with MPK6-mCherry (Figure 8 B), the resulting patterns did not differ from one

10

another, nor from that observed upon coexpression of AtPIP5K6-EYFP with the mCherry control,

indicating that MPK6 did not exert an inhibitory influence on the function of AtPIP5K6 AA or AtPIP5K

DD in vivo. These data indicate that the phosphosites T590 and/or T597 are critical for the MPK6-

mediated regulation of PIP5K6 effects on cell morphology. When the respective experiments were

performed using the homologous tobacco enzymes NtPIP5K6 and SIPK equivalent observations were

made (Figure 8 C). Pollen tubes coexpressing NtPIP5K6-EYFP and an mCherry control displayed

normal, branched and stunted morphologies for approx. 10%, 39% and 45% of fluorescing cells,

respectively. In comparison, coexpression of NtPIP5K6-EYFP with SIPK-mCherry again resulted in a

significant shift towards weaker morphological defects, with now 39% normal, 29% branched and only

31% stunted morphologies (p < 0.01 for the increase in normal pollen tubes). In the NtPIP5K6

sequence, only one of the two residues phosphorylated in AtPIP5K6 is conserved (T651, which

corresponds to T597 of AtPIP5K6; cf. Figure 2 B). To test for functional relevance of this residue, an

NtPIP5K6 variant was generated in which T651 was substituted with alanine (NtPIP5K6 A). When

NtPIP5K6 A-EYFP was coexpressed with mCherry or SIPK-mCherry, there was no difference in the

resulting patterns, indicating that SIPK did not exert an inhibitory influence on the function of the variant

NtPIP5K6 A protein in vivo.

Effects of PIP5K6 homologs from Arabidopsis or tobacco are delimited in pollen tubes upon RNAi-suppression of intrinsic MAPK expression The in vivo effects of MAPKs on PI4P 5-kinases were further characterized in a reciprocal experiment.

For this purpose, AtPIP5K6 or NtPIP5K6 were expressed in pollen tubes of tobacco plants, in which

expression of the endogenous MAPKs, SIPK and WOUNDING-INDUCED PROTEIN KINASE (WIPK),

was suppressed by RNAi (Seo et al., 2007) (Figure 9). Pollen tubes of tobacco plants expressing an

empty control construct were used as a reference. When AtPIP5K6-EYFP or NtPIP5K6-EYFP were

expressed in pollen tubes of the control plants, for AtPIP5K6 11% of transgenic pollen tubes were

normal, 22% branched and 50% stunted (Figure 9 A), whereas for NtPIP5K6 11% of transgenic pollen

tubes were normal, 38% branched and 35% stunted. By contrast, the expression of AtPIP5K6-EYFP

or NtPIP5K6-EYFP, respectively, in either of the two independent RNAi lines resulted in significant

shifts of the phenotypic categories towards more severe phenotypes (p < 0.01 for the increases in

stunted pollen tubes in all four cases). The data indicate that RNAi suppression of endogenous MAPKs

enhanced the effects of co-overexpressing PIP5K6 in vivo, consistent with a regulatory effect of the

MAPKs on PtdIns(4,5)P2 production. Importantly, the distribution of phenotypic categories resulting

from the expression of AtPIP5K6 AA-EYFP or NtPIP5K6 A-EYFP in pollen tubes of the control plants

11

or the two RNAi lines did not differ (Figures 9 C and D), indicating that the effects of MAPK RNAi

suppression on PI4P 5-kinase function depended on the threonine residues found to be phosphorylated

by the MAPKs. Overall, the assessment of the in vivo influence of MAPKs from Arabidopsis or tobacco

on the function of AtPIP5K6 and NtPIP5K6 is consistent with the reduced PtdIns(4,5)P2 formation upon

phosphorylation of PI4P 5-kinases determined in vitro.

Discussion The present study addressed the regulation of PI4P 5-kinases, which are key enzymes of plant

phosphoinositide biosynthesis, by protein phosphorylation. Our results demonstrate that the MAPK

MPK6 i) mediates phosphorylation of PIP5K6 (Figures 1 and 2), ii) mediates a concomitant inhibition

of PtdIns(4,5)P2 formation in vitro (Figure 3), iii) interacts with AtPIP5K6 (Figure 4), iv) causes reduced

formation of PtdIns(4,5)P2 and reduced endocytosis at the apical plasma membrane in vivo (Figures 5

and 7), and v) attenuates PtdIns(4,5)P2-dependent effects on pollen tube morphologies (Figures 8 and

9).

The phosphorylation sites T590 and T597 determined in the PIP5K6 protein by MS-based

approaches and subsequent substitution experiments represent bona fide MAPK-targeted S/TP motifs.

In the course of this study, a global analysis of the Arabidopsis pollen phosphoproteome was published

(Mayank et al., 2012), and both AtPIP5K6 phosphorylation sites determined in our in vitro approach

were also identified in planta. In vivo phosphorylation of AtPIP5K6 in pollen has thus been

independently demonstrated. Based on our data, phosphorylation of the sites T590 and T597 can now

be recognized as MPK6-mediated signal transduction events limiting PtdIns(4,5)P2 production in the

apical plasma membrane of pollen tubes.

At first approximation, the inhibitory effects of phosphorylation on activity and physiological

function of PIP5K6 appear to be consistent with data on mammalian phosphoinositide kinases, which

are thought to be regulated by phosphorylation via an electrostatic switch model (Rao et al., 1998;

Burden et al., 1999; Fairn et al., 2009). In this model, the introduction of negative charges by

phosphorylation of residues at the protein –membrane interface mediates the dissociation of the protein

from the membrane and its anionic substrate lipids. However, as the membrane association of PIP5K6-

EYFP did not change in pollen tubes upon coexpression of MPK6-mCherry (Figure 6), we conclude

that the regulation of PIP5K6 by MPK6 might not involve an electrostatic switch mechanism. To

delineate the mechanistic details of PIP5K6 regulation by MPK6, further analyses will be necessary. In

the absence of structural data on plant PI4P 5-kinases, we can currently only speculate whether

phosphorylation of T590 and/or T597 in the variable insert region of the catalytic domain might exert a

12

regulatory effect on PIP5K6 by mediating conformational changes that may directly influence the

conformation of the catalytic site. The CD spectroscopy data obtained for the substitution variants of

PIP5K6 (Figure 3 C–E) indicate that the introduction of a negative charge in position(s) 590 and/or 597

results in a change in the protein’s tertiary structure. As the near UV CD spectra reflect aromatic

residues, which are concentrated mainly in the N-terminal region of PIP5K6, we speculate that

phosphorylation of PIP5K6 by MPK6 mediates a conformational change involving the NT and MORN

domains. This notion is consistent with the previous report that N-terminal domains of Arabidopsis PI4P

5-kinases of subfamily B have a role in regulating catalytic activity (Im et al., 2007; Stenzel et al., 2012),

possibly controlled by reversible phosphorylation of PIP5K6. Based on the analysis of single-

substitution-variants (Figure 3 B), a phosphorylation site relevant for such regulation might be T597.

However, our studies do not reveal the in vivo stoichiometry of singly or doubly phosphorylated

AtPIP5K6. It is possible that the two detected phosphosites are sequentially phosphorylated by MPK6

under physiological conditions. Such a scenario may explain the "compensatory" effect of the dual

phospho-mimetic substitution of PIP5K6 DD on the reduced kinase activity (Figure 3 B) or the tertiary

structure (Figure 3 E) of the single T597D substitution variant. With regard to the activity of the double

substitution variants, it should also be noted that the substitution of phosphorylation sites by charged

or uncharged residues will not always faithfully reflect the behavior of the protein when phosphorylated

or dephosphorylated (Dissmeyer and Schnittger, 2011). While we are providing evidence for regulation

of PIP5K6 by phosphorylation, the effects of this modification might, thus, be more complex. The survey

by Mayank and coworkers reports further phosphorylation sites in PIP5K6 (Mayank et al., 2012), and it

appears likely that the enzyme is targeted also by other protein kinases, which might have interplay

with the MPK6-mediated phosphorylation or include examples for regulation by an electrostatic switch

mechanism. PI4P 5-kinases and their product, PtdIns(4,5)P2, control membrane trafficking in pollen tubes

(Kost et al., 1999; Ischebeck et al., 2008; Sousa et al., 2008; Ischebeck et al., 2010b; Zhao et al., 2010;

Ischebeck et al., 2011; Stenzel et al., 2012). A main trafficking route in these cells involves the

directional delivery of secretory vesicles to their target membrane and the endocytotic retrieval of

vesicles upon cargo release (Thole and Nielsen, 2008). The reduced plasma membrane association of

the Red StarPLC-PH reporter (Figure 5) and the impaired endocytosis of FM 4-64 with expression of

MPK6-EYFP (Figure 7) are consistent with reported roles of PtdIns(4,5)P2 (Ischebeck et al., 2008;

König et al., 2008; Sousa et al., 2008; Ischebeck et al., 2013) and PIP5K6 (Zhao et al., 2010) in the

control of membrane trafficking and clathrin-mediated endocytosis. The discovery of the pollen-

expressed PI4P 5-kinases AtPIP5K6 and NtPIP5K6 as targets for regulation by MPK6 and the related

13

tobacco SIPK and/or WIPK, respectively, suggests a MAPK-dependent regulatory circuit controlling

PtdIns(4,5)P2 production and apical membrane trafficking (Ischebeck et al., 2008; Sousa et al., 2008;

Ischebeck et al., 2010b; Zhao et al., 2010). The observation that the interaction of the cytoplasmic

MPK6 with PIP5K6 may occur at the apical plasma membrane (Fiture 4 C) is consistent with the report

that in Arabidopsis a subset of MPK6 protein colocalizes with FM 4-64, indicating membrane

association (Muller et al., 2010). A regulatory function of MPK6 in apical PtdIns(4,5)P2 formation is also

consistent with reduced rates of pollen tube expansion (Supplemental Figure 6) and the manifestation

of morphological alterations observed in pollen tubes resulting from altered apical pectin secretion

(Figures 8 and 9).

The reported pollen tube guidance defect of Arabidopsis mpk6 mutants furthermore suggests

relevance for MPK6-dependent PIP5K6 regulation in signal transduction events linking extracellular

cues emitted by the ovules with the control of the secretory machinery of the pollen tubes (Dresselhaus

and Franklin-Tong, 2013; Higashiyama and Takeuchi, 2015; Dresselhaus et al., 2016). A number of

guidance signals have been reported, which are perceived at the cell surface of pollen tubes

(Dresselhaus and Franklin-Tong, 2013; Higashiyama and Takeuchi, 2015; Dresselhaus et al., 2016).

Signal transduction events mediating pollen tube guidance have been proposed to involve MAPKs,

including MPK6 (Guan et al., 2014; Higashiyama and Takeuchi, 2015), in analogy to other receptor-

dependent signaling cascades known in plants (Pitzschke et al., 2009). Our data suggest that pollen

tube guidance cues transduced via MPK6 may result in an inhibition of PtdIns(4,5)P2 formation and

reduced apical pollen tube expansion, as illustrated in the model shown in Figure 10. A topical inhibition

of secretion by extracellular guidance cues might contribute to asymmetric pollen tube growth towards

the ovules for fertilization. However, as this notion is currently not supported by experimental evidence,

it is also possible that MPK6 influences overall pollen tube growth with no links to guidance. In either

case, directional cell expansion and its responsiveness to exogenous cues are a biological

phenomenon shared by polar growing cells from various models, including plants, fungi, and possibly

even mammalian cells, and these models share all the regulatory elements investigated in our study

(Ischebeck et al., 2010a). Therefore, the proposed mode of regulation may have relevance across

eukaryotic kingdoms. Future research will aim to establish whether these proposed regulatory circuits

contribute to pollen tube growth and/or guidance in response to exogenous signals, and whether such

regulation has been conserved in evolution.

Methods Plant material

14

Experiments were performed using source material from Arabidopsis thaliana Col-0 grown under a

short-day regime (8 h light at approx. 140 μmol photons m-2 s-1, 16 h dark) or pollen from Nicotiana

tabacum (ecotype Samsun N) grown in a greenhouse. The transgenic tobacco plants carrying RNAi

constructs against SIPK and WIPK (Seo et al., 2007) were a gift from Dr. Shigemi Seo and Dr. Shinpei

Katou (National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan).

Preparation of pollen extracts Ripe pollen from tobacco flowers was harvested, solubilised and germinated in pollen growth media

(5% (w/v) sucrose, 12.5% (w/v) PEG-6000, 0.03% (w/v) casein hydrolysate, 15 mM MES-KOH pH 5.8,

1 mM CaCl2, 1 mM KCl, 0.8 mM H3BO3, 3 μM CuSO4 and 10 μg/ml rifampicin). After the germinated

pollen was separated from the growth media, the pollen tube material was frozen in liquid nitrogen and

stored at -80°C until use. For the protein extraction, ice cold protein extraction buffer containing 10

mM TRIS HCl pH 7.5, 10 mM MgCl2, 50 mM NaCl, 2.5 mM NaF, 1 mM Na3VO4, 0.1 mM EDTA, 0.1

mM DTT, PhosSTOP (Roche, Penzberg, Germany) and protease inhibitor cocktail (Sigma, Schnelldorf,

Germany) was added to the material and the cells were broken with a mini pestle. The suspension was

cleared by centrifuging at 20000 x g and 4°C for 20 min. The extract was kept on ice to prevent protein

degradation and protein kinase inactivation.

cDNA cloning

Total RNA was isolated from Arabidopsis or tobacco flowers using the TRIzol method (Chomczynski

and Mackey, 1995) and used as a template for cDNA synthesis using RevertAidTM H Minus Reverse

Transcriptase (Fermentas, St. Leon, Germany) and oligo(dT)-primers according to the manufacturer’s

recommendations. Constructs for bacterial expression: For E. coli expression, the cDNAs for AtPIP5K6

and NtPIP5K6 were cloned into the expression plasmid pMALc5g (NEB, Ipswich, MA, USA). To obtain

an amplicon that is in frame with the sequence for the N-terminal MBP-tag, AtPIP5K6 and the cDNAs

encoding the T590A/D,T597A/D and T590A/D_T597A/D variants of AtPIP5K6 were amplified with the

primer combination AtPIP5K6 NdeI for, 5'-GCCATGCCATATGATGTCGGTAGCACACGCAGATGA-3'/

AtPIP5K6 His6 SalI rev, 5'-

GCCATGCGTCGACTCAGTGGTGGTGGTGGTGGTGAGCGTCTTCAACGAAGACCC-3' and moved

as NdeI/SalI fragments into pMALc5G. The tobacco homolog NtPIP5K6 and the cDNAs for the

respective A and D variants were amplified with primer combinations previously described (Stenzel et

al., 2012) and moved as NotI/SalI fragments into pMALc5G. Constructs for yeast two-hybrid analysis:

The bait vector pBT3-C-OST4 was obtained by introducing the cDNA encoding the ER transmembrane

15

oligosaccharyl transferase4 (Ost4p) from yeast via the XbaI restriction site upstream of the multiple

cloning site of pBT3-C (DualSystems Biotech, Schlieren, Switzerland), as previously described (Möckli

et al., 2007). To clone AtPIP5K6 and NtPIP5K6 into pBT3-C-OST4, the open reading frames were

amplified with forward and reverse primers adding a SfiI restrictions sites to the 5'- and 3' ends of the cDNAs

, respectively. Additionally, the 5'- amplification primers introduced an additional cytidine base between

the SfiI-restriction site and the ATG codon. The amplicons of AtPIP5K6 or NtPIP5K6 were then cloned

via the SfiI-sites into pBT3-C-OST4, yielding pBT3-C-Ost4p-AtPIP5K6 and pBT3-C-Ost4p-NtPIP5K6.

To clone pPR3-N-MPK6 and pPR3-N-NtSIPK, the open reading frames of MPK6 and NtSIPK were

amplified with primers introducing 5'and 3' SfiI-restriction sites and moved as SfiI-fragments into pPR3-

N. Constructs for BiFC analysis: Constructs for BiFC studies (Kerppola, 2008) were based on the

plasmids pEntryA and pEntryD, which are pUC18-based, contain separate multiple cloning sites for the

insertion of promotor sequences and a gene of choice and differ by the nature of the att sites for

homologous recombination. For the BiFC analyses, expression from a Cauliflower mosaic virus 35S

promoter was chosen to enable weak expression in pollen tubes to observe interactions at close to

physiological conditions (Sun et al., 2015). The coding sequences for AtPIP5K6 and NtPIP5K6 were

amplified using the primer combinations AtPIP5K6 AscI for, 5'-

ATGCGGCGCGCCATGTCGGTAGCACACGCAGA-3'/ AtPIP5K6 XhoI rev, 5'-

ATGCCTCGAGAGCGTCTTCAACGAAGACCC-3' and NtPIP5K6 AscI for, 5'-

ATGCGGCGCGCCATGAGCAAAGAATTTAGTGG-3'/ NtPIP5K6 XhoI rev, 5'-

ATGCCTCGAGAGTGTCTTCTGCAAAAACTT-3', respectively, and moved as AscI/XhoI fragments in

reading frame with a downstream coding sequence for the N-terminal half of YFP, YFPN, yielding

pEntryA-CaMV35S::AtPIP5K6-YFPN and pEntryA-ProCaMV35S:NtPIP5K6-YFPN. The coding

sequences of MPK6 and SIPK were amplified using the primer combinations MPK6 SalI for, 5'-

ATGCGTCGACATGGACGGTGGTTCAGGTCA-3'/ MPK6 XbaI rev, 5'-

ATGCTCTAGATTGCTGATATTCTGGATTGA-3' or NtSIPK AscI for, 5'-

ATGCGGCGCGCCATGGATGGTTCTGGTCAGCA-3'/ NtSIPK XhoI rev, 5'-

ATGCCTCGAGCATATGCTGGTATTCAGGAT-3', respectively, and moved as SalI/XbaI or AscI/XhoI

fragments in frame with the downstream coding sequence for the C-terminal half of YFP (YFPc) present

in the pEntryD plasmid, yielding pEntryD-ProLat52:MPK6-YFPc and pEntryD-ProLat52:NtSIPK-YFPc.

For both BiFC partners, the YFP halves were, thus, fused at the C-termini of the fusion proteins.

Constructs for transient expression in pollen tubes - mCherry was amplified using the primer

combination mCherry-AscI-for, 5'-ATGCGGCGCGCCAATGGTGAGCAAGGGCGAGGA-3'/ mCherry-

BamHI-rev, 5'-ATGCGGATCCCTACTTGTACAGCTCGTCCAT-3', adding an AscI restriction site at the

16

5'-end of mCherry cDNA and a BamHI restriction site at the 3'-end of the mCherry sequence. Between

the AscI restriction site and the ATG of the mCherry sequence, the primer introduced an additional

adenine base to ensure cloning in frame. After restriction, the mCherry fragment was moved into

pEntryA-pLat52 as a AscI-BamHI-fragment. cDNAs for MPK6 or SIPK were amplified using primers

introducing a 5'-end SalI and a 3'-end AscI restriction site to their cDNA sequences. After digestion the

MPK6 or SIPK fragments were moved into the pEntryA-ProLat52:mCherry vector, yielding pEntryA-

ProLat52:MPK6-mCherry or pEntryA-ProLat52:SIPK-mCherry, respectively. Site-directed

mutagenesis: The site-directed exchange of bases within a DNA-sequence was conducted by

QuickChange technology (Stratagene, La Jolla, CA, USA). In this PCR-based approach, primers

containing the desired base exchange were used to amplify the DNA template. The PCR was performed

with Phusion High Fidelity Polymerase (NEB, Ipswich, MA, USA) in a 50 μl reaction according to the

manufacturer’s instructions. The following thermal cycling steps were used for amplification: 98°C for

30s as initial denaturation step, 18 cycles at 98°C for 20 s, annealing between 55 –65°C for 30 s and

72°C for 1 min/kb for the elongation of the amplicon. The following primers were used: PIPK6 T590A

for, 5'-CTGCTATCAAGGACTCTGCCGCTCCTACTTCCGGCGCTCGAAC-3'/ PIPK6 T590A rev, 5'-

GTTCGAGCGCCGGAAGTAGGAGCGGCAGAGTCCTTGATAGCAG-3'; PIPK6 T590D for, 5'-

CTGCTATCAAGGACTCTGCCGATCCTACTTCCGGCGCTCGAAC-3'/PIPK6 T590D rev, 5'-

GTTCGAGCGCCGGAAGTAGGATCGGCAGAGTCCTTGATAGCAG-3'; PIPK6 T597A for, 5'-

CTACTTCCGGCGCTCGAGCCCCTACCGGAAATTCAGA-3'/ PIPK6 T597A rev, 5'-

TCTGAATTTCCGGTAGGGGCTCGAGCGCCGGAAGTAG-3'; PIPK6 T597D for, 5'-

CTACTTCCGGCGCTCGAGACCCTACCGGAAATTCAGA-3'/ PIPK6 T597D rev, 5'-

TCTGAATTTCCGGTAGGGTCTCGAGCGCCGGAAGTAG-3'. The mixture of template and amplicon

was digested with 10 U of the methylation-dependent restriction enzyme DpnI, to degrade all DNA of

bacterial origin. After digestion, the non-methylated amplicon DNA was transformed into chemically-

competent E. coli. From the respective pEntry plasmids, amplicons were moved to the vector pLatGW

(Ischebeck et al., 2008) using gateway technology (Invitrogen, Karlsruhe, Germany). To confirm

successful cloning and to verify site-directed mutations in plasmids, DNA was sequenced using a

commercial service (GATC, Konstanz, Germany).

Expression and purification of recombinant proteins in E. coli Recombinant PIP5K6 was expressed as a fusion to an N-terminal MBP-tag in E. coli Rosetta 2 cells

(Merck, Darmstadt, Germany). Starter cultures were incubated overnight with continuous shaking at

30°C in 2YT-medium (1.6% (w/v) peptone, 1% (w/v) yeast extract, 0.5% (w/v) NaCl) with appropriate

17

antibiotic selection and used to inoculate main cultures in baffled flasks. Cells were grown until an OD600

of 06.-0.8 and expression was induced with 0.1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG),

unless stated otherwise. The fusion proteins MBP-AtPIP5K1 and pMAL-AtPIP5K6 were best expressed

in 1 L cultures induced with 0.1 mM IPTG at 22°C for 4 h. MBP-NtPIP5K6 was expressed in 3 L cultures

at 37°C with 30 min induction. Cells were harvested by centrifugation for 20 min at 4000 x g and the

bacterial pellet was immediately frozen in liquid nitrogen and stored until use at -20°C. Cell disruption

was initiated with the addition of lysozyme (Serva, Heidelberg, Germany) to digest the bacterial cell

wall. Ultrasound was used to disrupt small volumes, while larger volumes were homogenized by a high-

pressure cell disruption FrenchTM-Press system (Gaulin, APV Homogeniser GmbH, Gatwick, UK) at

1200 bar. After both treatments, crude lysate was cleared by centrifugation at 20 000 x g for 20 min at

4°C, kept on ice until further use. Purification of the full-length fusion proteins was performed by affinity

chromatography using an MBPTrap column (GE Lifesciences, Uppsala, Sweden).

GST-MPK6 and GST were recombinantly expressed from pGEX4T1 plasmids (GE Healthcare

Europe GmbH, Freiburg, Germany) in E. coli BL21(DE) cells. Starter cultures with 50 ml of LB media

were inoculated with single colonies and grown at 30°C overnight with shaking at 180 rpm. Expression

cultures were inoculated at an OD600 of 0.1 and grown in 200 ml of LB media in Erlenmeyer flasks at

37°C with shaking at 180 rpm. Expression was induced with 0.1 mM IPTG at an OD600 of 0.6. After

induction, the cultures were shaken at 22°C and 180 rpm for 20 h. Then, 50 ml culture aliquots were

harvested by centrifugation for 10 min at 3220 x g. Bacterial pellets from 50 ml expression culture were

resuspended in 2-4 ml 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, containing protease inhibitor cocktail

(Sigma-Aldrich) and 1 mg ml−1 lysozyme (Serva Electrophoresis). After incubation on ice for 30 min,

cells were further disrupted by sonication. Cell debris was removed by centrifugation for 15 min at

20,000 x g and 4°C.

Protein amounts were estimated with the Bradford assay (Bradford, 1976) calibrated against

BSA.

In-gel protein phosphorylation The in-gel kinase assay was performed as previously described (Zhang and Klessig, 1997). In brief,

pollen tube extracts (80 µg) were loaded on a 10% SDS gel. As a substrate for the protein kinases from

the extract, 0.25 mg/ml of MBP-AtPIP5K6 was co-polymerized into the resolving gel. Higher

concentrations were not used due to limited amounts of material. A control with no protein embedded

in the gel was used as an autophosphorylation control. The catalytic subunit of protein kinase A (PKA)

from bovine heart (1 U, Sigma, Schnelldorf, Germany) was used as a positive control. After

18

electrophoresis, the gel was washed three times for 30 min with washing buffer (25 mM Tris pH 7.5,

0.5 mM DTT, 0.1 mM Na3V04, 5 mM NaF, 0.5 mg/ml (w/v) BSA, 0.1% (v/v) Triton X-100) at room

temperature with gentle agitation to remove SDS. To renature protein kinases, the gel was incubated

in renaturing buffer (25 mM Tris pH 7.5, 0.5 mM DTT, 0.1 mM Na3V04, 5 mM NaF) overnight at 4°C

with three changes of buffer. The gel was equilibrated in 25 mM Tris pH 7.5, 2 mM EGTA,12 mM MgCl2,

10 mM CaCl2, 1 mM DTT, 0.1 mM Na3VO4 and the kinase reaction was started in a volume of 30 ml by

the addition of 200 nM ATP containing 50 µCi g-[33P]-ATP (10 mCi/ml; Hartmann, Braunschweig,

Germany). The gel was incubated for 60 min with gentle agitation, then the reaction was stopped by

the addition of 5 % (w/v) trichloroacetic acid (TCA) and 1% (w/v) sodium pyrophosphate to fix proteins

in the gel and remove unbound g-[33P]-ATP for 6 h with at least five changes of buffer. The control gel

was stained with Coomassie Brilliant Blue. A prestained protein ladder was used to estimate sizes of

phosphorylated proteins. After washing, the gels were dried overnight and radiolabeled bands were

visualized using a radiosensitive imager screen (BAS MP 2040s, Fujifilm, Düsseldorf, Germany). The

extent of 33P-incorporation was quantified by phosphor imaging (BAS 1500, Fujifilm, Düsseldorf,

Germany).

In vitro protein phosphorylation Transphosphorylation was detected by monitoring the incorporation of radiolabelled γ-phosphate of γ-

[33P]-ATP into proteins. Purified recombinant PI4P 5-kinases (5-10 µg) were incubated with 15 µg of

freshly prepared pollen extract in the presence of 50 µm ATP containing 10 µCi g-[33P]-ATP (10 mCi/ml;

Hartmann, Braunschweig, Germany) in 1 x kinase buffer (10 mM Tris HCl pH 7.5, 10 mM MgCl2, 50

mM NaCl, 0.1 mM EDTA, 0.1 mM DTT and PhosSTOP) in a volume of 50 µl for 30 min. Variations to

the experiments performed with recombinant protein kinases are described below. For kinase assays

performed with recombinant, activated MPK6, the sample volume was 20 µl. For each reaction, 0.2 µg

of MPK6 was used. MPK6 was purified as described previously (Pecher et al., 2014) and obtained from

Pascal Pecher, IPB Halle, Germany. During incubation, samples were gently agitated. The reaction

was stopped with SDS sample buffer and the sample was applied to SDS-PAGE. The gel was stained

with Coomassie Brilliant Blue and dried overnight. Radiolabeled bands were visualized using a

radiosensitive imager screen (BAS MP 2040s, Fujifilm, Düsseldorf, Germany) and the extent of 33P-

incorporation was quantified by phosphor imaging (BAS 1500, Fujifilm, Düsseldorf, Germany).

19

Circular dichroism Measurements of dichroic properties of the proteins were performed on a Jasco J-810

spectropolarimeter with the following instrumental setup: 1 nm pitch, 40 accumulations, 50 nm per min

scan speed, 1 nm slit widths and 1 s response time. All experiments were carried out in buffer composed

of 20 mM Tris/HCl, 200 mM NaCl pH 7.5 supplemented with 1 mM EDTA and 10 mM maltose at a

temperature of 20°C (Peltier element). Circular dichroism spectra were recorded at a protein

concentration of 260–530 µg mL-1 (1.21–4.28 µM), using cuvettes with optical path lengths of 1 mm for

both far and near UV. Acquired protein spectra were corrected for buffer contribution using Spectra

Manager I software (Jasco). The data were converted to mean residue ellipticity (Kelly et al., 2005).

Tryptic protein digest Protein bands of interest were excised and digested with trypsin as previously described (Shevchenko

et al., 1996).

Mass spectrometry Identification of candidate protein kinases from pollen tube extracts - Protein kinase candidates in pollen

tube extracts were identified by liquid chromatography high definition multi-parallel collision-induced

dissociation MS (Nano-LC-HD-MSE) using an ACQUITY UPLC System and a coupled Synapt G2-S

(Waters, Eschborn, Germany) in resolution mode with positive ionization (Helm et al., 2014). Peptides

were analyzed in data independent acquisition (DIA) mode without pre-selection of precursor ions

(Helm et al., 2014). Glu-Fib (Glu-1-Fibrinopeptide B) was used as lock mass (m/z = 785.8426, z = 2)

and mass correction was applied to the spectra during data processing in a ProteinLynx Global Server

(PLGS 3.0, Apex3D algorithm v. 2.128.5.0, 64 bit, Waters, Eschborn, Germany). The processing

parameters were set as described (Helm et al., 2014). The intensity of precursor ions was ≥180 counts

and for fragment ions ≥15 counts to be distinguished from noise. The designation of fragment ions to

precursor ions was achieved by PLGS 3.0 based on peak form, retention time, isotope cluster and m/z

value as well as ion mobility. Further data analysis was carried out by PLGS 3.0. Then, MSE data were

searched against the modified A. thaliana database (TAIR10, ftp://ftp.arabidopsis.org) containing

common contaminants such as keratin (ftp://ftp.thegpm.org/fasta/cRAP/crap.fasta). Protein

identification required the detection of two fragment ions per peptide, and a minimum of five fragment

ions and two peptide matches. Primary digest reagent was trypsin with one missed cleavage allowed,

as previously described (Helm et al., 2014).

20

Identification of phosphopeptides - AtPIP5K6 residues phosphorylated by MPK6 were identified by

liquid chromatography on-line with high resolution accurate mass MS (HR/AM LC-MS) using an

Orbitrap Velos Pro System (Thermo Scientific, Dreireich, Germany). Proteins separated by SDS-PAGE

were subjected to in-gel tryptic digestion, and peptides were analyzed by a data-dependent acquisition

(DDA) scan strategy with inclusion list to specifically select and isolate AtPIP5K6 phosphorylated

peptides for MS/MS peptide sequencing. An inclusion list was used to identify low abundant species in

the survey scan (targeted DDA). Multi-stage activation (MSA) was applied to further fragment ion peaks

resulting from neutral loss of the phosphate moiety by dissociation of the high energy phosphate bond

to generate b- and y- fragment ion series rich in peptide sequence information. MS/MS spectra were

used to search the TAIR10 database (ftp://ftp.arabidopsis.org) amended with mutant AtPIP5K6

sequences (AtPIP5K6 T590A, AtPIP5K6 T597A and AtPIP5K6 T590A T597A) with the Mascot software

v.2.5 integrated in Proteome Discoverer v.1.4. Phosphopeptides with an ion score surpassing the

Mascot significance threshold (p < 0.05) were accepted. The phosphoRS module was used to localize

phosphorylation sites within the primary structure of the peptide.

Data availability All mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via

the PRIDE (Vizcaino et al., 2016) partner repository with the dataset identifier PXD006067.

Lipid kinase assays The catalytic activity of recombinant PI4P 5-kinases was determined based on their ability to

phosphorylate PtdIns4P in the presence of g-[33P]-ATP as previously described (Perera et al., 2005).

The extent of 33P-incorporation was quantified by phosphor imaging (BAS-MP 2040s, Fujifilm,

Düsseldorf, Germany) using BAS-1500 imager screens (Fujifilm, Düsseldorf, Germany).

Yeast two-hybrid analysis Protein–protein interactions were tested using the split-ubiquitin (Ub) membrane-based yeast two-

hybrid system (SUS) Dualmembrane Kit 3 (Dualsystems Biotech, Zürich, Switzerland) as previously

described (Johnsson and Varshavsky, 1994). Bait and prey constructs coding for AtPIP5K6 vs. MPK6

or for NtPIP5K6 vs. NtSIPK, respectively, were co-transformed in the yeast strain NMY51 (Dualsystems

Biotech, Zürich, Switzerland). The bait protein was co-transformed with a positive and a negative

control. The positive control consisted of a native Ub-half (NubI) fused to ER-localized Alg5. NubG

fused to Alg5 served as a negative control. To test for interactions, single positive yeast clones were

21

grown on SD-media lacking leucine, tryptophan and histidine (SD-LWH). For higher stringency,

selection was performed on SD-LWH plates supplemented with 10 mM 3-amino-1,2,4-triazole (3-AT)

(SD-LWHA).

Immuno-Pull-Down

Recombinant GST or GST-MPK6 proteins were immobilized on glutathione-agarose (Thermo Fisher Scientific) and incubated with purified recombinant MBP-PIP5K6 protein for 60 min at 4°C. Upon washing of the resin, GST-bound proteins were eluted with 50 mM glutathione. Interacting MBP-PIP5K6 protein was detected using a monoclonal anti-MBP antibody (New England Biolabs, Frankfurt/Main, Germany, product number E8032S). Protein input was detected using a polyclonal anti-GST antibody (GE Healthcare, Freiburg, Germany, product number 27-4577-01).

Transient expression of cDNA constructs in tobacco pollen tubes Transient expression of cDNA constructs in tobacco pollen tubes was performed by particle

bombardment as previously described (Ischebeck et al., 2008).

Fluorescence microscopy Pollen phenotypes were analyzed using an Axio ImagerM1 fluorescence microscope (Carl Zeiss, Jena,

Germany) and an AxioCam MRm grey scale camera. The observation of phenotypes was performed

at 20x magnification using filter set 38 high efficiency (HE) for EYFP detection and filter set 43 HE for

mCherry detection (all filters from Carl Zeiss, Jena, Germany). EYFP was excited at 514 nm and

imaged using a FT 495 nm beam splitter and a 470/40 nm band pass filter; mCherry was excited at

561 nm and imaged using a FT 570 nm beam splitter and a 550/25 nm band pass filter. Images were

taken with the corresponding software program (Axio Vision, Carl Zeiss, Jena, Germany). Localization

studies were performed using LSM780 or LSM880 laser scanning confocal microscopes (Carl Zeiss,

Jena, Germany) with a 40x magnifying objective, unless specified otherwise. EYFP was excited with

an Ar-laser at 488 nm and detected at 493-598 nm; mCherry was excited with a DPSS-laser at 561

nm and detected at 578-696 nm. Images were taken using Zen (Carl Zeiss, Jena, Germany).

Staining of Tobacco Pollen tubes To test for defects in endocytosis, FM 4-64 staining was performed on pollen tubes grown on glass

slides for 3-4 hours after bombardment. FM 4-64 dye (from a stock solution of 50 µm diluted in pollen

tube growth medium) was added to a final concentration of 2.5 µM. To test for defects in pectin

22

secretion, a stock solution of 0.01% Ruthenium red (Sigma) was added drop wise to the glass slides

containing pollen tubes 3-4 hours after bombardment.

Bimolecular fluorescence complementation BiFC experiments were performed in tobacco pollen tubes as a physiologically relevant cell type. The

constructs were transiently transformed into tobacco pollen and the cells were grown for 7-10 h until

microscopic evaluation. An mCherry fluorophore under the control of a LAT52-promotor was co-

transformed as a marker for transformed cells.

Image analysis Images were analysed using the open source Fiji image analysis software (Schindelin et al., 2012). Statistical evaluation All quantitative data were tested for statistical significance using two-tailed Student's t-tests. Confidence

intervals are given in the figure legends for each data set.

Accession Numbers AtPIP5K6, At3g07960; NtPIP5K6, JQ219669; AtMPK6, At2g43790; SIPK, NP_001312060; WIPK, NP_001313013

Supplemental Data Supplemental Figure 1. In vitro phosphorylation of pollen-expressed PI4P 5-kinase isoforms by MPK6.

Supplemental Figure 2. Sequence coverage and mass spectra of phosphopeptide identification by

HR/AM LC-MS.

Supplemental Figure 3. Reaction kinetics for purified recombinant MBP-AtPIP5K6 and MBP-NtPIP5K6.

Supplemental Figure 4. Interaction of NtPIP5K6 and SIPK.

Supplemental Figure 5. Reduced transcript levels of SIPK and WIPK in pollen tubes of tobacco plants

expressing RNAi constructs.

Supplemental Figure 6. Reduced pollen tube growth and apical pectin secretion in pollen tubes

overexpressing MPK6-EYFP.

Acknowledgments The authors would like to thank the following individuals: Dr. Shigemi Seo and Dr. Shinpei Katou (both

National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan) for the tobacco RNAi plants; Dr.

23

Pascal Pecher, Petra Majovsky and Dr. Lennart Eschen-Lippold (all Leibniz Institute of Plant

Biochemistry, Halle, Germany) for activated recombinant MPK6 protein, technical assistance, and

helpful discussion, respectively; Dr. Jennifer Lerche (Institute for Biochemistry and Biotechnology,

Martin-Luther-University Halle-Wittenberg) for helpful discussion; Prof. Dr. Sven-Erik Behrens (Institute

for Biochemistry and Biotechnology, Martin-Luther-University Halle-Wittenberg) for access to

spectroscopy equipment. Funding from the German Research Foundation (DFG, grants He3424/3-1,

He3424/6-1 and SFB648 TP10 to I.H.) is gratefully acknowledged.

Author Contributions FH, IS, MH, PK, WM, RG, SH, DD and WH performed the experiments; FH, IS, MH, PK, RG, SH, DD,

SB, WH and IH analyzed the data; FH, MH, JL and IH designed the research; IH wrote the manuscript.

References

Audhya, A., and Emr, S.D. (2003). Regulation of PI4,5P2 synthesis by nuclear-cytoplasmic shuttling of the Mss4 lipid kinase. EMBO J. 22, 4223-4236.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254.

Burden, L.M., Rao, V.D., Murray, D., Ghirlando, R., Doughman, S.D., Anderson, R.A., and Hurley, J.H. (1999). The flattened face of type II beta phosphatidylinositol phosphate kinase binds acidic phospholipid membranes. Biochemistry 38, 15141-15149.

Chomczynski, P., and Mackey, K. (1995). Short technical reports. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques 19, 942-945.

Dissmeyer, N., and Schnittger, A. (2011). The age of protein kinases. Meth Mol Biol 779, 7-52. Dresselhaus, T., and Franklin-Tong, N. (2013). Male-female crosstalk during pollen germination, tube growth

and guidance, and double fertilization. Mol. Plant 6, 1018-10136. Dresselhaus, T., Sprunck, S., and Wessel, G.M. (2016). Fertilization Mechanisms in Flowering Plants. Curr.

Biol. 26, R125-139. Duan, Q., Kita, D., Li, C., Cheung, A.Y., and Wu, H.M. (2010). FERONIA receptor-like kinase regulates RHO

GTPase signaling of root hair development. Proc. Natl. Acad. Sci. U S A 107, 17821-17826. Fairn, G.D., Ogata, K., Botelho, R.J., Stahl, P.D., Anderson, R.A., De Camilli, P., Meyer, T., Wodak, S., and

Grinstein, S. (2009). An electrostatic switch displaces phosphatidylinositol phosphate kinases from the membrane during phagocytosis. J. Cell. Biol. 187, 701-714.

Franciosini, A., Rymen, B., Shibata, M., Favero, D.S., and Sugimoto, K. (2016). Molecular networks orchestrating plant cell growth. Curr. Opin. Plant Biol. 35, 98-104.

Gerth, K., Lin, F., Menzel, W., Krishnamoorthy, P., Stenzel, I., Heilmann, M., and Heilmann, I. (2017). Guilt by Association: A Phenotype-Based View of the Plant Phosphoinositide Network. Annu. Rev. Plant Biol. 68, 349-374.

Ghosh, R., de Campos, M.K., Huang, J., Huh, S.K., Orlowski, A., Yang, Y., Tripathi, A., Nile, A., Lee, H.C., Dynowski, M., Schafer, H., Rog, T., Lete, M.G., Ahyayauch, H., Alonso, A., Vattulainen, I., Igumenova, T.I., Schaaf, G., and Bankaitis, V.A. (2015). Sec14-nodulin proteins and the patterning of phosphoinositide landmarks for developmental control of membrane morphogenesis. Mol Biol Cell 26, 1764-1781.

Guan, Y., Lu, J., Xu, J., McClure, B., and Zhang, S. (2014). Two Mitogen-Activated Protein Kinases, MPK3 and MPK6, Are Required for Funicular Guidance of Pollen Tubes in Arabidopsis. Plant Physiol. 165, 528-533.

24

Hammond, G.R., and Balla, T. (2015). Polyphosphoinositide binding domains: Key to inositol lipid biology. Biochim. Biophys. Acta 1851, 746-758.

Heilmann, I. (2016). Phosphoinositide signaling in plant development. Development 143, 2044-2055. Helm, S., Dobritzsch, D., Rodiger, A., Agne, B., and Baginsky, S. (2014). Protein identification and

quantification by data-independent acquisition and multi-parallel collision-induced dissociation mass spectrometry (MS(E)) in the chloroplast stroma proteome. Journal of proteomics 98, 79-89.

Hepler, P.K., and Winship, L.J. (2015). The pollen tube clear zone: clues to the mechanism of polarized growth. Journal of integrative plant biology 57, 79-92.

Higashiyama, T., and Takeuchi, H. (2015). The mechanism and key molecules involved in pollen tube guidance. Annu. Rev. Plant Biol. 66, 393-413.

Im, Y.J., Davis, A.J., Perera, I.Y., Johannes, E., Allen, N.S., and Boss, W.F. (2007). The N-terminal Membrane Occupation and Recognition Nexus Domain of Arabidopsis Phosphatidylinositol Phosphate Kinase 1 Regulates Enzyme Activity. J. Biol. Chem. 282, 5443-5452.

Ischebeck, T., Stenzel, I., and Heilmann, I. (2008). Type B phosphatidylinositol-4-phosphate 5-kinases mediate pollen tube growth in Nicotiana tabacum and Arabidopsis by regulating apical pectin secretion. Plant Cell 20, 3312-3330.

Ischebeck, T., Seiler, S., and Heilmann, I. (2010a). At the poles across kingdoms: phosphoinositides and polar tip growth. Protoplasma 240, 13-31.

Ischebeck, T., Vu, L.H., Jin, X., Stenzel, I., Löfke, C., and Heilmann, I. (2010b). Functional cooperativity of enzymes of phosphoinositide conversion according to synergistic effects on pectin secretion in tobacco pollen tubes. Mol. Plant 3, 870-881.

Ischebeck, T., Stenzel, I., Hempel, F., Jin, X., Mosblech, A., and Heilmann, I. (2011). Phosphatidylinositol-4,5-bisphosphate influences Nt-Rac5-mediated cell expansion in pollen tubes of Nicotiana tabacum. Plant J. 65, 453-468.

Ischebeck, T., Werner, S., Krishnamoorthy, P., Lerche, J., Meijon, M., Stenzel, I., Löfke, C., Wiessner, T., Im, Y.J., Perera, I.Y., Iven, T., Feussner, I., Busch, W., Boss, W.F., Teichmann, T., Hause, B., Persson, S., and Heilmann, I. (2013). Phosphatidylinositol 4,5-bisphosphate influences PIN polarization by controlling clathrin-mediated membrane trafficking in Arabidopsis. Plant Cell 25, 4894-4911.

Johnsson, N., and Varshavsky, A. (1994). Split ubiquitin as a sensor of protein interactions in vivo. Proc. Natl. Acad. Sci. U S A 91, 10340-10344.

Kelly, S.M., Jess, T.J., and Price, N.C. (2005). How to study proteins by circular dichroism. Biochim. Biophys. Acta 1751, 119-139.

Kerppola, T.K. (2008). Bimolecular fluorescence complementation (BiFC) analysis as a probe of protein interactions in living cells. Annu Rev Biophys 37, 465-487.

Kessler, S.A., and Grossniklaus, U. (2011). She's the boss: signaling in pollen tube reception. Curr. Opin. Plant Biol. 14, 622-627.

König, S., Ischebeck, T., Lerche, J., Stenzel, I., and Heilmann, I. (2008). Salt stress-induced association of phosphatidylinositol-4,5-bisphosphate with clathrin-coated vesicles in plants. Biochem J. 415, 387-399.

Kost, B. (2008). Spatial control of Rho (Rac-Rop) signaling in tip-growing plant cells. Trends Cell Biol. 18, 119-127.

Kost, B., Lemichez, E., Spielhofer, P., Hong, Y., Tolias, K., Carpenter, C., and Chua, N.H. (1999). Rac homologues and compartmentalized phosphatidylinositol 4, 5-bisphosphate act in a common pathway to regulate polar pollen tube growth. J. Cell. Biol. 145, 317-330.

Kudla, J., and Bock, R. (2016). Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. Plant Cell 28, 1002-1008.

Kusano, H., Testerink, C., Vermeer, J.E.M., Tsuge, T., Shimada, H., Oka, A., Munnik, T., and Aoyama, T. (2008). The Arabidopsis phosphatidylinositol phosphate 5-kinase PIP5K3 is a key regulator of root hair tip growth. Plant Cell 20, 367-380.

Lindner, H., Muller, L.M., Boisson-Dernier, A., and Grossniklaus, U. (2012). CrRLK1L receptor-like kinases: not just another brick in the wall. Curr. Opin. Plant Biol. 15, 659-669.

Mähs, A., Ischebeck, T., Heilig, Y., Stenzel, I., Hempel, F., Seiler, S., and Heilmann, I. (2012). The essential phosphoinositide kinase MSS-4 is required for polar hyphal morphogenesis, localizing to sites of growth and cell fusion in Neurospora crassa. PLoS One 7, e51454.

25

Mayank, P., Grossman, J., Wuest, S., Boisson-Dernier, A., Roschitzki, B., Nanni, P., Nuhse, T., and Grossniklaus, U. (2012). Characterization of the phosphoproteome of mature Arabidopsis pollen. Plant J. 72, 89-101.

Möckli, N., Deplazes, A., Hassa, P.O., Zhang, Z., Peter, M., Hottiger, M.O., Stagljar, I., and Auerbach, D. (2007). Yeast split-ubiquitin-based cytosolic screening system to detect interactions between transcriptionally active proteins. Biotechniques 42, 725-730.

Moscatelli, A., and Idilli, A.I. (2009). Pollen tube growth: a delicate equilibrium between secretory and endocytic pathways. Journal of integrative plant biology 51, 727-739.

Muller, J., Beck, M., Mettbach, U., Komis, G., Hause, G., Menzel, D., and Samaj, J. (2010). Arabidopsis MPK6 is involved in cell division plane control during early root development, and localizes to the pre-prophase band, phragmoplast, trans-Golgi network and plasma membrane. Plant J. 61, 234-248.

Park, S.J., Itoh, T., and Takenawa, T. (2001). Phosphatidylinositol 4-phosphate 5-kinase type I is regulated through phosphorylation response by extracellular stimuli. J. Biol. Chem. 276, 4781-4787.

Pecher, P., Eschen-Lippold, L., Herklotz, S., Kuhle, K., Naumann, K., Bethke, G., Uhrig, J., Weyhe, M., Scheel, D., and Lee, J. (2014). The Arabidopsis thaliana mitogen-activated protein kinases MPK3 and MPK6 target a subclass of 'VQ-motif'-containing proteins to regulate immune responses. New Phytol. 203, 592-606.

Perera, I.Y., Davis, A.J., Galanopoulou, D., Im, Y.J., and Boss, W.F. (2005). Characterization and comparative analysis of Arabidopsis phosphatidylinositol phosphate 5-kinase 10 reveals differences in Arabidopsis and human phosphatidylinositol phosphate kinases. FEBS Lett. 579, 3427-3432.

Pitzschke, A., Schikora, A., and Hirt, H. (2009). MAPK cascade signalling networks in plant defence. Curr. Opin. Plant Biol. 12, 421-426.

Preuss, M.L., Schmitz, A.J., Thole, J.M., Bonner, H.K., Otegui, M.S., and Nielsen, E. (2006). A role for the RabA4b effector protein PI-4Kbeta1 in polarized expansion of root hair cells in Arabidopsis thaliana. J. Cell. Biol. 172, 991-998.

Rao, V.D., Misra, S., Boronenkov, I.V., Anderson, R.A., and Hurley, J.H. (1998). Structure of type IIbeta phosphatidylinositol phosphate kinase: a protein kinase fold flattened for interfacial phosphorylation. Cell 94, 829-839.

Riquelme, M. (2013). Tip growth in filamentous fungi: a road trip to the apex. Annu Rev Microbiol 67, 587-609. Rounds, C.M., and Bezanilla, M. (2013). Growth mechanisms in tip-growing plant cells. Annu. Rev. Plant Biol.

64, 243-265. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden,

C., Saalfeld, S., Schmid, B., Tinevez, J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P., and Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682.

Seo, S., Katou, S., Seto, H., Gomi, K., and Ohashi, Y. (2007). The mitogen-activated protein kinases WIPK and SIPK regulate the levels of jasmonic and salicylic acids in wounded tobacco plants. Plant J. 49, 899-909.

Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Analytical chemistry 68, 850-858.

Sousa, E., Kost, B., and Malho, R. (2008). Arabidopsis Phosphatidylinositol-4-Monophosphate 5-Kinase 4 Regulates Pollen Tube Growth and Polarity by Modulating Membrane Recycling. Plant Cell 20, 3050-3064.

Stagljar, I., Korostensky, C., Johnsson, N., and te Heesen, S. (1998). A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc. Natl. Acad. Sci. U S A 95, 5187-5192.

Stenzel, I., Ischebeck, T., Quint, M., and Heilmann, I. (2012). Variable regions of PI4P 5-kinases direct PtdIns(4,5)P2 toward alternative regulatory functions in tobacco pollen tubes. Front. Plant Sci. 2, 1-14.

Stenzel, I., Ischebeck, T., König, S., Holubowska, A., Sporysz, M., Hause, B., and Heilmann, I. (2008). The type B phosphatidylinositol-4-phosphate 5-kinase 3 is essential for root hair formation in Arabidopsis thaliana. Plant Cell 20, 124-141.

Sun, J., Eklund, D.M., Montes-Rodriguez, A., and Kost, B. (2015). In vivo Rac/Rop localization as well as interaction with RhoGAP and RhoGDI in tobacco pollen tubes: analysis by low-level expression of fluorescent fusion proteins and bimolecular fluorescence complementation. Plant J. 84, 83-98.

26

Thole, J.M., and Nielsen, E. (2008). Phosphoinositides in plants: novel functions in membrane trafficking. Curr. Opin. Plant Biol. 11, 620-631.

Vancurova, I., Choi, J.H., Lin, H., Kuret, J., and Vancura, A. (1999). Regulation of phosphatidylinositol 4-phosphate 5-kinase from Schizosaccharomyces pombe by casein kinase I. J. Biol. Chem. 274, 1147-1155.

Vincent, P., Chua, M., Nogue, F., Fairbrother, A., Mekeel, H., Xu, Y., Allen, N., Bibikova, T.N., Gilroy, S., and Bankaitis, V.A. (2005). A Sec14p-nodulin domain phosphatidylinositol transfer protein polarizes membrane growth of Arabidopsis thaliana root hairs. J. Cell. Biol. 168, 801-812.

Vizcaino, J.A., Csordas, A., del-Toro, N., Dianes, J.A., Griss, J., Lavidas, I., Mayer, G., Perez-Riverol, Y., Reisinger, F., Ternent, T., Xu, Q.W., Wang, R., and Hermjakob, H. (2016). 2016 update of the PRIDE database and its related tools. Nucleic Acids Res. 44, D447-456.

Westergren, T., Dove, S.K., Sommarin, M., and Pical, C. (2001). AtPIP5K1, an Arabidopsis thaliana phosphatidylinositol phosphate kinase, synthesizes PtdIns(3,4)P(2) and PtdIns(4,5)P(2) in vitro and is inhibited by phosphorylation. Biochem J. 359, 583-589.

Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V., and Provart, N.J. (2007). An "Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale biological data sets. PLoS One 2, e718.

Zhang, S., and Klessig, D.F. (1997). Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 9, 809-824.

Zhao, Y., Yan, A., Feijo, J.A., Furutani, M., Takenawa, T., Hwang, I., Fu, Y., and Yang, Z. (2010). Phosphoinositides regulate clathrin-dependent endocytosis at the tip of pollen tubes in Arabidopsis and tobacco. Plant Cell 22, 4031-4044.

Figure 1. In vitro phosphorylation of AtPIP5K6 and NtPIP5K6 by protein kinases from tobacco pollen tubeextracts. A, Purified recombinant MBP-AtPIP5K6 or MBP-NtPIP5K6 was incubated with pollen tube extracts in thepresence of γ-[33P]ATP, proteins were separated by SDS-PAGE, and the incorporation of the radiolabel was analyzed byphospho imaging. MBP-ATPIP5K6 was analyzed in a time course experiment (left panels). NtPIP5K6 was analyzedtogether with control experiments (right panels). The presence of the recombinant proteins (arrowheads) is indicated byCoomassie Brilliant Blue-stained gels (top panels). Radiolabeled bands detected by phosphor imaging (mid panels) and aquantification of the radiolabeling signals (lower panels) are also shown. Controls included assays with no addedrecombinant protein or without added pollen extract, as indicated. Data are from a representative experiment. Theexperiments were performed three times with similar results. Plus and minus symbols indicate added and omittedcomponents, as indicated. B, C, Identification of candidate protein kinases mediating the phosphorylation of AtPIP5K6. B,To identify protein kinase candidates, protein extracts of germinated pollen tubes were electrophoresed on SDS-PAGEgels containing purified recombinant AtPIP5K6 protein as part of the gel matrix. After washing and renaturing, non-targeted in-gel protein kinase assays were performed by incubating the gels with γ-[33P]ATP and visualizing radiolabeledbands by phospho imaging. SDS-PAGE gels without added recombinant protein were used as a negative control (leftpanel); mammalian protein kinase A (PKA) was used as a positive control, as indicated. Bands observed in the range of50 kDa were excised from gels in assays performed in the absence of radiolabel, subjected to tryptic digestion andanalyzed by Nano-LC-HD-MSE. C, Mass spectrometric analysis and comparison of the identified peptides to amino acidsequences deduced from the annotated Arabidopsis genome yielded hits for MAPKs. Detailed mass spectrometric dataon the identified peptides are available online via ProteomeXchange with identifier PXD006067. The in-gel protein kinaseassays and candidate identification was performed twice. PSL, photostimulated luminescence.

Figure 2. In vitro phosphorylation of TP-motifs in the catalytic domain of AtPIP5K6 by recombinant MPK6. A,Purified recombinant MBP-fusions of Arabidopsis PI4P 5-kinase isoforms were incubated with activated recombinantMPK6 in the presence of γ-[33P]ATP, proteins were separated by SDS-PAGE, and the incorporation of the radiolabel wasanalyzed by phosphor imaging. All proteins were expressed in E. coli, and added at 5 µg of PIP5K6 and 0.2 µg of MPK6protein , respectively, when required. The presence of the recombinant proteins was tested by Coomassie Brilliant Blue(top panels). Radiolabeled bands were detected by phosphor imaging (lower panels). Controls included assays usingMBP instead of MBP-PIP5K6; omitting MPK6 protein; or using α-labeled instead of γ-labeled ATP, as indicated. Theexperiments were performed three times with similar results. Plus and minus symbols indicate added and omitted MPK6,respectively. B, C, HR/AM LC-MS analysis of tryptic peptides of MPK6-phosphorylated AtPIP5K6 revealed the presenceof two phosphorylated residues, T590 and T597, which are located in the catalytic domain of AtPIP5K6. B, Schematicrepresentation of AtPIP5K6 with the positions of T590 and T597 indicated by arrowheads. NT, N-terminal domain;MORN, membrane occupation and recognition nexus repeat-domain; Lin, linker domain; Dim, dimerization domain; Cat,catalytic domain; Var, variable insert. C, Local alignment of the sequence region of AtPIP5K6 around T590 and T597 withthe corresponding sequences of other pollen-expressed PI4P 5-kinases, as indicated. The positions of T590 and T597are indicated by arrowheads. Black, identical residues in the same position in three or more sequences; grey, residueswith similar properties in the same position in three or more sequences. D, E, Verification of phosphorylation events uponpreincubation of AtPIP5K6 with activated MPK6 and γ-[33P]ATP. D, Reduced radiolabel upon treatment ofprephosphorylated AtPIP5K6 protein with serine/threonine protein phosphatase 1 (PP1) phosphatase. Plus and minussymbols indicate added and omitted components, as indicated. E, Reduced phosphorylation of alanine substitutionvariants T590A, T597A and T590A T597A (AA) by MPK6. The experiments were performed four times. Data representmean ± SD. Letters a-c in panel E indicate categories of values that display significant differences from each other,according to Student's t-tests (for different categories all p<0.05).

Figure 3. Inhibition of AtPIP5K6 catalytic activity by MPK6-mediated phosphorylation in positions T590 and T597.A, Recombinant AtPIP5K6 or AtPIP5K6 AA protein was preincubated with recombinant activated MPK6 and subsequentlyanalyzed for catalytic activity against the lipid substrate, PtdIns4P. The reduction in catalytic activity was calculatedrelative to the activity of non-treated controls. The data represent the mean ± SD from four experiments. The asterisksindicate a significant difference from the non-treated control, according to a Student's t-test (**, p<0.01). Plus and minussymbols indicate added and omitted MPK6, respectively. B, The intrinsic catalytic activity of AtPIP5K6 variants, in whichT590 and/or T597 were substituted with either A or D, was analyzed against the lipid substrate, PtdIns4P. The datarepresent the mean ± SD from three experiments. Letters a-c indicate categories of values that display significantdifferences from each other, according to Student's t-tests (for different categories all p<0.01). C, The circular dichroism(CD) of purified recombinant PIP5K6 variants was analyzed in buffer containing 20 mM Tris-HCl, pH 7.5, 0.2 M NaCl, 1mM EDTA and 10 mM maltose, using an optical path length of 1 mm. CD spectroscopy data were obtained for the far andnear UV range. D, Far UV CD spectra indicative of protein secondary structure. E, Near UV CD spectra indicative ofprotein tertiary structure. Protein variants as indicated. Recombinant MBP was used as a control protein.

Figure 4. Physical interaction of MPK6 with AtPIP5K6. An interaction between MPK6 and AtPIP5K6 was tested bysplit-ubiquitin-based yeast two-hybrid analysis, immuno-pull-down experiments, and bimolecular fluorescencecomplementation. A, Analysis by the split-ubiquitin-based yeast two-hybrid system. The AtPIP5K6-bait protein wasexpressed as a fusion to an OST4 anchor, which attaches the protein to the cytosolic face of the endoplasmic reticulum.The MPK6 fusion was expressed as a soluble cytoplasmic protein. Interaction is indicated by yeast growth underselective (-LWH) conditions. The experiment was performed three times with similar results. B, Immuno-pull-downexperiments. Recombinant MPK6 expressed as a GST fusion or a GST control were immobilized and incubated withpurified recombinant MBP-PIP5K6 protein. Upon washing of the resin, interacting MBP-PIP5K6 protein was analyzed byimmunodetection using an anti-MBP antibody. Left panel, protein detected by anti-GST antibody; right panel, pull-down,detected by the anti-MBP-antibody. The experiment was performed three times with similar results. C, Analysis by BiFC.Fusions of AtPIP5K6 and the N-terminal half of YFP (AtPIP5K6-YFPN), and of MPK6 and the C-terminal half of YFP(MPK6-YFPC) at their respective C-termini were transiently expressed in tobacco pollen tubes. Negative controls includedthe coexpression of AtPIP5K6-YFPN with YFPC, and of YFPN with MPK6-YFPC. An mCherry marker was alwayscoexpressed as a reporter for positive transformation events. Reconstitution of YFP fluorescence indicates close physicalproximity of AtPIP5K6-YFPN and MPK6-YFPC. Scale bars, 10 µm. The experiments were performed four times withsimilar results. GST, glutathione S-transferase; -LW, media lacking leucine and tryptophan; -LWH, media lackingleucine, tryptophan and histidine; MBP, maltose-binding protein; OST4, yeast oligosaccharyl transferase 4 kDa subunit;pAI-Alg5, positive control; pDL2-Alg5, negative control.

Figure 5. Reduced plasma membrane association of the Red StarPLC-PH reporter upon coexpression with MPK6-EYFP. The effect of MPK6-EYFP expression on the apical formation of PtdIns(4,5)P2 was assessed using thePtdIns(4,5)P2-specific fluorescent reporter, Red StarPLC-PH. A, Red StarPLC-PH was coexpressed with either an EYFPcontrol (upper panels) or with MPK6-EYFP (lower panels), and fluorescence distribution was assessed by confocalmicroscopy. Dotted lines, position for collecting fluorescence intensity profiles for quantitative analysis (panels B and C).Scale bars, 10 µm. For each condition (EYFP vs. MPK6-EYFP), four independent transformations were set up tocoexpress these markers with Red StarPLC-PH. Only data from morphologically unaltered pollen tubes were included.Images are representative for 14 individual transformations from two independent experiments for each condition. B,Fluorescence intensity profiles (as indicated in A) were analyzed using the Fiji software package. Profiles shown are fromthe representative images in panel A. Bottom diagram, Peripheral regions of the Red StarPLC-PH profiles were interpretedas plasma membrane-associated fluorescence (PM), and the central regions as cytoplasmic fluorescence (cyt), asindicated. The intensity of the coexpressed EYFP or MPK6-EYFP was determined as indicated. The values were used tocalculate the ratios in panel C. C, Decreasing plasma membrane association of the Red StarPLC-PH probe with increasingexpression of MPK6-EYFP. Mean intensities for PM and cyt fluorescence of the Red StarPLC-PH probe were calculated foreach transformed cell, and the PM vs. cyt ratios of these means were plotted against the mean intensity of either EYFP orMPK6-EYFP. A decreasing PM vs. cyt ratio indicates reduced plasma membrane association of the PtdIns(4,5)P2-reporter. Open circles, EYFP control; closed circles, MPK6-EYFP. The data represent 14 individual transformation eventsobtained in two independent experiments for each condition. D, The levels of PtdIns(4,5)P2 were analyzed in pollen tubesfrom non-transformed tobacco plants, from empty vector controls, or from two independent transgenic lines (WS2 andWS3), in which SIPK and WIPK are RNAi-suppressed. Data indicate mean ± SD from four experiments. Asterisks indicatea significant change compared to the empty vector control according to a Student's t-test (*, p<0.05). AU, arbitrary units;cyt, cytoplasmic fluorescence; PM, plasma membrane-associated fluorescence.

Figure 6. Unaltered plasma membrane association of PIP5K6-EYFP upon coexpression with MPK6-mCherry. Theeffect of MPK6-EYFP expression on the apical plasma membrane localization of PIP5K6-EYFP was assessed incoexpression experiments. A, PIP5K6-EYFP was coexpressed with either an mCherry control (upper panels) or withMPK6-mCherry (lower panels), and the fluorescence distribution was assessed by confocal microscopy. Dotted lines,position for collecting fluorescence intensity profiles for quantitative analysis (panels B and C). Scale bars, 10 µm. Foreach condition (mCherry vs. MPK6-mCherry), four independent transformations were set up to coexpress these markerswith PIP5K6-EYFP. Only data from morphologically unaltered pollen tubes were included. Images are representative for16 individual transformations from two independent experiments for each condition. B, Fluorescence intensity profiles (asindicated in A) were analyzed using the Fiji software package. Profiles shown are from the representative images in panelA. Bottom diagram, Peripheral regions of the PIP5K6-EYFP profiles were interpreted as plasma membrane-associatedfluorescence (PM), and the central regions as cytoplasmic fluorescence (cyt), as indicated. The intensity of thecoexpressed mCherry or MPK6-mCherry was determined as indicated. The values were used to calculate the ratios inpanel C. C, Plasma membrane association of PIP5K6-EYFP with increasing expression of either EYFP or MPK6-EYFP.Mean intensities for PM and cyt fluorescence of PIP5K6-EYFP were calculated for each transformed cell, and the PM vs.cyt ratios of these means were plotted against the mean intensity of either mCherry or MPK6-mCherry. Open circles,mCherry control; closed circles, MPK6-mCherry. The data represent 16 individual transformation events for eachcondition, obtained in four independent experiments.

Figure 7. Reduced endocytosis of FM 4-64 upon coexpression with MPK6-EYFP. The effects of MPK6-EYFP onendocytosis were assessed by monitoring the uptake of the membrane dye, FM 4-64, over time by confocal microscopy.A, Fluorescence distribution of FM 4-64 (red) during coexpression with an EYFP control (upper panels) or with MPK6-EYFP (lower panels). For each condition (EYFP vs. MPK6-EYFP), five independent transformations were set up toanalyze the effect on FM 4-64 uptake. Only data from morphologically unaltered pollen tubes were included.Representative images are shown for three time points after dye application, 15-25 min, 35-50 min, and 65-85 min, asindicated. Intensity profiles for FM 4-64 were recorded as indicated by the dotted lines, and the mean plasma membrane-associated (PM) and mean cytoplasmic (cyt) fluorescence was calculated (as described in the diagrams in Figures 5 and6). From these values, the PM vs. cyt intensity ratios were calculated and plotted in panel B. Scale bars, 10 µm. B, Adecreasing PM vs. cyt ratio indicates progressing endocytosis and internalization of the dye. Open circles, EYFP control;closed circles, MPK6-EYFP. Data represent five independent transformation experiments for each condition and eachtime point, as follows: 15-25 min (EYFP, n=38; MPK6-EYFP, n=46), 35-50 min (EYFP, n=54; MPK6-EYFP, n=57) and 65-85 min (EYFP, n=24; MPK6-EYFP, n=26). cyt, cytoplasmic fluorescence; PM, plasma membrane-associatedfluorescence. 85? See comment above.

Figure 8. Coexpression with MAPKs attenuates the effects of PIP5K6 homologs from Arabidopsis or tobaccoon pollen tube growth and cell morphology. The effects of MAPKs on the functionality of AtPIP5K6 or NtPIP5K6were tested in vivo by coexpressing the enzymes with either mCherry controls or with the MAPKs, MPK6 or SIPK,respectively, and scoring the incidence of morphological alterations during pollen tube growth, as previously described(Ischebeck et al., 2010b). A, The overexpression of type B PI4P 5-kinases, including AtPIP5K6, in tobacco pollen tubesresults in morphological changes related to an increased apical secretion of pectin (Ischebeck et al., 2008; Ischebeck etal., 2010b). Left, Phenotypic categories observed upon expression of AtPIP5K6, as indicated. Bars, 10 µm; Right,Correlation of the categories with fluorescence intensities of the expressed proteins. Letters a–c indicate categories ofvalues that display significant differences from each other, according to pairwise Student's t-tests (for differentcategories all p<0.01). B, Distribution of phenotypes upon coexpression of AtPIP5K6-EYFP, AtPIP5K6 AA-EYFP, orAtPIP5K6DD-EYFP with either mCherry or MPK6-mCherry. C, Distribution of phenotypes upon coexpression ofNtPIP5K6-EYFP, NtPIP5K6 T651A-EYFP (NtPIP5K6 A-EYFP), or NtPIP5K6 T651D-EYFP (NtPIP5K6 D-EYFP) witheither mCherry or SIPK-mCherry. The data reflect the mean ± SD from seven (B) or six (C) experiments, eachrepresenting > 100 pollen tubes analyzed. Asterisks indicate significant changes compared to the mCherry controlexperiments according to a Student's t-test (*, p<0.05; **, p<0.01).

Figure 9. Effects of PIP5K6 homologs from Arabidopsis or tobacco are delimited in pollen tubes upon RNAi-suppression of intrinsic MAPK expression. The effects of MAPKs on the functionality of AtPIP5K6 or NtPIP5K6 werefurther tested in vivo by expressing the enzymes in pollen tubes of tobacco plants RNAi-suppressed for the endogenousMAPKs, SIPK and WIPK (Seo et al., 2007), and scoring the incidence of morphological alterations during pollen tubegrowth, as previously described (Ischebeck et al., 2010b). Three transgenic tobacco lines (Seo et al., 2007) were used, acontrol carrying an empty expression construct (white bars) and two independent RNAi-suppressed lines (WS1, lightgrey and WS2, dark grey bars). A, Distribution of phenotypes upon expression of AtPIP5K6-EYFP; B, Distribution ofphenotypes upon expression of NtPIP5K6-EYFP; C, Distribution of phenotypes upon expression of AtPIP5K6 T590AT597A-EYFP; D, Distribution of phenotypes upon expression of NtPIP5K6 T651A-EYFP. The data represent the mean ±SD from five experiments. Asterisks indicate significant changes compared to the vector control experiments accordingto a Student's t-test (*, p<0.05; **, p<0.01).

Figure 10. Model for the effects of MAPK-mediated limitation of apical PtdIns(4,5)P2 formation in pollen tubes.PtdIns(4,5)P2 is involved in the apical control of membrane trafficking, influencing apical pectin secretion and CME. Tophalf, During symmetric expansion, PIP5K6 and other PI4P 5-kinase isoforms mediate the expansion of pollen tubes at theapex. Bottom half, External guidance cues are perceived by cell surface receptors, likely initiating a MAPK cascadeinvolving MPK6. Activated MPK6 might locally transduce this signal to the machinery for apical membrane trafficking bytargeting PIP5K6. The MPK6-mediated phosphorylation of PIP5K6 might result in reduced apical expansion of the cell,possibly resulting in an asymmetric expansion and curvature towards the guidance cues. Other explanations are possible.Blue arrows, promoting influences; blue T-bars; inhibiting influences; orange arrows, simplified representation of vesiclemovement for secretion and endocytotic recycling in the expanding pollen tube tip; oval ellipses, enzymes as indicated;red circles, phosphorylation events. CME, clathrin-mediated endocytosis.

DOI 10.1105/tpc.17.00543; originally published online November 22, 2017;Plant Cell

HeilmannGolbik, Stefan Helm, Dirk Dobritzsch, Sacha Baginsky, Justin Lee, Wolfgang Hoehenwarter and Ingo

Franziska Hempel, Irene Stenzel, Mareike Heilmann, Praveen Krishnamoorthy, Wilhelm Menzel, Ralph4,5-bisphosphate in an apical plasma membrane domain

MAPKs influence pollen tube growth by controlling the formation of phosphatidylinositol

 This information is current as of March 20, 2020

 

Supplemental Data /content/suppl/2018/02/28/tpc.17.00543.DC2.html /content/suppl/2017/11/22/tpc.17.00543.DC1.html

Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists