love good hope€¦ · have done incredible things to raise money for the Charity. Mike Hammond...
Transcript of love good hope€¦ · have done incredible things to raise money for the Charity. Mike Hammond...
© 2018 Good Hope Hospital Charity is a working name of University Hospitals Birmingham Charity, a company limited by guarantee in England (No.10004003) and a charity registered in England and Wales (No.1165716).
Registered Office: 5th Floor Nuffield House, Queen Elizabeth Hospital, Birmingham B15 2TH
Issue 3good hopeloveThe Good Hope Hospital Charity Newsletter
GHHCharity @GHHCharity goodhopehospital.org.uk
Find out how you can join our events and
support patients at the hospital!
Join the Charity in celebrating the 75th anniversary of Good Hope Hospital
Hello and welcome to the third edition of Love Good Hope, the official newsletter of Good Hope Hospital Charity. This edition is packed with news from the Charity and updates on where your money has been spent, alongside incredible stories from fundraisers who have done amazing things to support staff and patients at the hospital.This year marks the 75th Anniversary of Good Hope Hospital and there are plenty of ways that you can get involved to mark this momentous year. Read on to find out how Good Hope Hospital has changed over its history, and read about an inspirational person who worked at the hospital for an amazing 55 years and has since volunteered at the hospital.
The coming months bring with them a whole range of events that you can get involved in to raise money to support patients, staff and families at Good Hope. From taking part in the Birmingham Triathlon to jumping from a plane on one of the special Charity skydiving days or pulling on your
trainers for the Great Midlands Fun Run, there’s no limit to the challenges you can take part in for your local hospital.
The Charity always loves to hear from you. If you’re on social media make sure you’re following our accounts, just search @GHHospCharity on Facebook and Twitter to find out more. If you want to get in touch with us, please call the Charity main office on 0121 371 4852, email [email protected] or go to heft.org.uk.
Good Hope Hospital Charity relies on the support of people like you, without whose hard work it would not be possible for the Charity to go ‘over and above’ for patients at the hospital. I look forward to continuing to hear more inspirational stories from people who have done incredible things to raise money for the Charity.
Mike HammondChief Executive, Good Hope HospitalCharity
2 GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 GHHCharity @GHHCharity
Together with your help we raise money to provide world-class facilities for
patients and their families at Good Hope Hospital that
go ‘over and above’ what the NHS can provide. We spend your generous donations on
refurbishing patient and family areas, providing
‘added extras’ that help make patients more comfortable and
entertained at the hospital, and providing toys and games for children, making trips to Good Hope easier for them
and their parents.
Good Hope Hospital Charity launches Children’s AppealTurn to page six to learn about the Charity’s new appeal which will brighten up the children’s areas at the hospital, making Good Hope a more welcoming place for children and their families.
Charity Champs do amazing things to raise moneyPages eight and nine are full of incredible stories of just some of the fundraisers who have brought in money to help support patients at Good Hope. Read on to learn more and get inspired for your own fundraising events!
Staff Superstars go ‘over and above’Good Hope Hospital is lucky to have lots of staff members who are prepared to go ‘over and above’ for the patients that they treat. Learn more on page ten about some wonderful members of staff at Good Hope who have taken on challenges for the Charity.
Good Hope Hospital turns 75Turn to page four to find out more about the history of Good Hope Hospital as we celebrate its 75th birthday! There are lots of ways for you to get involved in celebrating this landmark anniversary that will help to support patients and staff at the hospital.
What we do at
Good Hope Hospital Charity
Dates for your diary
Some of these events may have passed but
you can keep up to date with what’s happening by visiting heft.org.uk/events
these
GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 3GHHCharity @GHHCharity
BBirrmmiinnghham CCiityyy Centtrree • 66 MMMayyGood Hope Hospital Charity is delighted to once again offer places for the Simplyhealth Great Birmingham 10K. Beginning in the city centre, the route goes to Digbeth, across to Cannon Hill Park and the iconic Edgbaston Stadium before returning to the city for the big finish.
SSSiggn upp forr yoyoour ppllaace attt heeftt..orrg.uuk/evvenennts anndd coonntttaact [email protected] ttoo recceieiivvee yoour freeeee ffunddrraaisiinggg ppaccckkk!
Sunrise Snowdon14 April, Snowdonia National ParkTake on a new, exciting challenge this spring and climb Mount
Snowdon, at night! The coach will be departing from Birmingham
City Centre at 10pm, arriving at Snowdon at approximately
2am, ready to scale the mountain to watch the sunrise from the
summit. This really is a once in a lifetime opportunity and one not
to be missed! It is essential that you have an appropriate level
of physical fitness on the day of the event and that you have all
necessary kit, including the compulsory head torch. A place is
£55 and the minimum sponsorship is £150, which can be raised
for any ward or department within the hospital.
If you miss the April Snowdon, or would rather climb during the day
then join the hospital charity on 15 September. A place is £45 with a
minimum sponsorship of £100.
For more information contact [email protected]
and for the kit list or to book either of these events, go to heft.org.uk/events
Join Good Hope Hospital Charity for its first
swimming event! Great North Swim is the
UK’s biggest open-water swimming event
in the beautiful Lake District location of Lake
Windermere. The event takes place over three
days and you can choose which day and time
to do your swim. The swim is one mile and
takes on average 45 minutes. Charity places
are free with a minimum of
£250 in sponsorship.
For more information contact
or go to heft.org.uk/events to book.
Great North Swim8–10 June,
Lake Windermere
WW
Great Midlands Fun Run Sutton ColdfIeld | 3 JuneThis run is the perfect way to start the running season, taking place in Sutton Coldfield and attracting visitors from all over the West Midlands. This fun run is 8.5 miles and courses through Europe’s largest urban
park, Sutton Park. Run, jog or walk this ‘challenging but fun’ route! For more information please contact [email protected]
GGGGrGGGGGGGGG
unnn uon C
rus i ru
t u
Munn
lnnnnuunuuuunnu
Co
uC
uuC
unoolooCooo ststg vcv
cod cdnndd
ctinin
y tct
ong
GOOGHGHGHGHGHGHHCHCHCHCHChhhhha iiritty @GHHCharity
Wiggle Forest Ranger Sportive Sunday 21 October
Uttoxeter Racecourse, Staffordshire
Join the hospital charity for an epic cycle
around the beautiful Midlands countryside.
Take on a variety of distances ranging from
44 to 86 miles. The course will take you
through the most scenic parts of East
Staffordshire and Leicestershire counties,
also encapsulating the most enticing cycling roads around
The National Forest.
Enter at ukcyclingevents.co.uk and email
[email protected] to receive your free fundraising pack!
e
4 GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3
2018 marks 75 years of Sutton Coldfield’s local hospital, Good Hope, and whilst the location and buildings have changed, the dedication of the staff has remained constant. Here are
just some of the amazing things the staff have to say about the hospital.
75th anniversary
GHHCharity @GHHCharity
Name: Maggie Coleman
Job role: Matron in Maternity Services and currently Interim Associate Head of Midwifery.
Time in role: 34 years, started in 1984 as a Registered Midwife but trained as a Registered Nurse in 1980 at East Birmingham Hospital, which is now Birmingham Heartlands Hospital.
What does working at Good Hope Hospital mean to you? Good Hope Hospital is my local hospital and I love being part of the Good Hope family, it runs through my veins and I am proud to serve the local population. I am passionate about ensuring that Good Hope Hospital is the maternity service of choice for local women and their families by providing them with safe and responsive maternity care.
Name: Mark Chambers
Job role: Manager of the Haematology & Oncology Day Unit based in the Sheldon block.
Time in role: I have worked at Good Hope Hospital since 2004 - in various departments and at various levels. I have worked as an HCA, Staff Nurse and Charge Nurse.
What does working at Good Hope Hospital mean to you? Working at Good Hope means a lot to me, I live nearby and feel that I am helping to provide a service to the local community and wider catchment area. I have made many friends within the hospital and always feel a great sense of camaraderie. To think that my local hospital community has such great services is a very rewarding part of the
job. I always want to see Good Hope doing well, and have fundraised along with many of my colleagues to help to improve our services, most recently by expanding our chemotherapy area to create a supportive treatment area.
Name: Bernie Dooner
Job role: Midwifery Support Worker in Antenatal Clinic
Time in role: I have worked at Good Hope Hospital for 35 years
What does working at Good Hope Hospital mean to you? Good Hope has been a major part of my life, all for the better. I have made wonderful friends over the years. I have loved and enjoyed all aspects of my role from being a Nursing support worker to becoming a Midwifery support worker. Good Hope has allowed me to touch people’s lives and make a lasting difference. I will forever be grateful to the hospital for giving me that opportunity.
Name: Adell Brazier
Job role: Ward manager of ward 11, Elderly Care
Time in role: I have worked at Good Hope Hospital for four years, and before that I was a
student nurse at Good Hope.
What does working at Good Hope Hospital mean to you? Working at Good Hope means a lot to me, I enjoy caring for the most vulnerable members of society and providing the best care possible. Good Hope Hospital has been a huge part of my life for over four years and I love it!
Name: Sue Bailey
Job role: Maternity Medical Records Manager
Time in role: I started working at Good Hope Hospital in 1978 on work experience and then signed a permanent contract in Maternity on 1 September 1979 and have been here ever since!
What does working at Good Hope Hospital mean to you? I work with a fantastic team in Maternity at Good Hope, who are all very caring and compassionate to their patients and the people they work with. We are like one large family and I cannot imagine ever wanting to work anywhere else. I feel very honoured and lucky to work in the NHS and here at Good Hope Hospital.
Show your support this year! This year the Charity is asking staff,
patients, friends, family and members of the Sutton Coldfield community
to help in any way they can to celebrate Good Hope Hospital’s
75th anniversary.
Can you raise £75 to celebrate Good Hope Hospital’s 75 years?
Whip up a storm and hold a delicious bake sale at work, school, or in your community group! How
about a sponsored silence, a car wash, or a sponsored dog walk? The Charity always loves to hear about your unique fundraising
ideas! Get in touch with Fundraising Manager, Laura Power at
[email protected] to receive a fundraising registration form.
Visit us on social media as below
d hil h20188 mmarks 75 y
nd
year!!!!
nenened a
ent nurse
d i
GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 5GHHCharity @GHHCharity
VVeerraaa ‘‘HHHHHHHHoollllyyy’’ HHHoooooolllllleeeyyyGoGoododd HHoppope e HoHoospspspitititalalal’s’s’s ‘‘‘‘‘guguguuuuararardididiananan aaangngngelelel’’’
HeHeHeHelllllll o o oo HoHHoHHolllllly!y!y! SSSSoooo hohohohow w ww didididid ddd yoyoyoyoouuuuubebebebeb cooc meme aaa nnnururursesesese????IIIIIIII jojojojoojojoojojojooojoojooj ininininnnnininnnninninededededededeedededeeddeddddeeeed tttttttttttttttthehehehehehehehheheheeheehe SSSSSSSSSSSSSSt t ttt t ttttttt JoJoJoJoJoJoJJoJooJoJoJoJJoJJooooJohnhnhnhnhnhnhnhnhnhnhnhnhnhnhhnhnnhnnhnh ’s’s’s’s’sss’ss’ssssssss AAAAAAAAAAAAAAAAAAAAAmbmbmbmbmmbmbmbmbmbmbmmmbmbmbmbmbmbmbbbmmbmmmmbm ululuuuulululululululululuuluu anananananananannananannannannannncccnncececececcecececececececcecceccceeccce
BrBrBrBrBrBrBrrBrrrrigigigigigigigigigggigiggggggggadadadadadadaddadadadaddaaddaaddddee e eeeee eee e e ee agagagagagagagaggggagagagagagaagagagedededededededeededdedddedeededd 111111111111111111111 asasasasasasasasasasssasass aaaaaaaaaaaaaaaa nnnnnnnnnnnnnnnnurururururrrurururururururururururrsisisisisisisisisisississsisisisisingngngngnggngngngngngngngnggngngnggg cccccccccccccccccccccccccccccadaddadadadadadadadadadadadadadaaddadeeteteteteteteteteteteteteeteeet,,,,,,
IIIIIII aaalalalalalllala rerererereeeerererreadadadadadadadadadddaddadaaaaaaa y y y y y y yyy y yyyyyy knknknknknknknknnknknkknknnnknkneweweweweweweweweweeewewwewww ttttttttttttttttthahahahahahahahahhahhahahahahaahaat ttttt ttttttttt II I IIIIII lolololololooollololololooololooveveveveveveveveveveveveveveeevvevvevevvvvveeveveddddddddddddddddd totototootototototototototototototooooooooooo cccccccccccccccccararaararararararararararaaarrrarre e eee e e eeeeeeeeee eee
fofofoffofofofofofor r r rrrrrrrr r r pepepepepepeepepeeepepepeeeppeeep opooopopopopopopopopooopoopopoooo leleleleleleeeleeleleele aaaaaaaaaaaandndndndndndndndndndnddndndnddndnddn ttttttttttthehehehehehhhehehehehheeheehehhheheheehey y yyyy yy y y yyy yyyyy tatatatatatatataatatttatatatatatattaauguugugugugugugugugugugugugggghthththththththththhhthhhhtththtththhht mmmmmmmmmmmmmmmmmmmmmmmmmmmmmme eeee e e eeeee e eeeee hthththththththththhthththththtt e e eee eee eeeeeeeeeeee
skskskskskskskkkkskskkkkkks iiiiiilililililillll slslslslssllslslslsls IIIIIIIIIIII nnnnnnnnnnnnneeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee dededededededededededededeeedeeeeed d d d ddd dddd d ddd totototototototototottoototottt tttttttttttttrarararararararaaraaraaraaininininininininininniinn aaaaaaaaaaaaaaaaaasssssssssssssssss a a aaa aa aaaaaaaaaa nnnnnnnnnnnnnnnnnnnnnnunununununuuuuuunuuuunununuunursrsrsrsrsrsrsrsrsrssrsrsrsssrrsrseeeeee ee eeeee e eeeeeee
whwhwhwhwhwhwhwhwhwhwhwwwhwwhwwwww enenenenennenenenenennenen IIIIIIIIIIII wwwwwwwwwwwwwwwwwwwasasassasssassasasasassasasasasaaaasass oooooooooooooooldldlldldldldldldldlddddlddererererererererrrerrereeeerrr.. . . IIIIIIIII hhhhhhhhhhhhhhhhhh dadadadadadadadadadadadadadaadadadaaaaaaaa tttttttttttttto o o o o oo ooooo oooooo llllllllleleleleleeleleelelleleleeell avavavavavavavavavavavaavavavvvaava eeeeeeeeeeeeeeeeeeeeee
scscscscscscsccsccscsccscccs hohohohohhohohohoohhooooooohhhhhooolooooollolololooloolololoooo aaaaaaaaaaat tt t t ttttttt 141414144141441414444144141444 tttttttttto o o o oo ooo oooo sususususususususuusuuuususuuususususuppppppppppppppppppppppppppppppppppppppppppororororororoorororrroroooororooo t ttt ttttt ttttt mymymymymymymymymymymymymymmmymymyyyyy ffffffffffffffamamamamammamamamamamamammamamamamaa ilililililililililililililiilly,y,y,y,y,y,y,y,y,y,yyyy,y,y,y,y ssssssssssssssoo oo o o ooo oooo o ooo
IIIIIIIII totototototototottootoookokokokokokokokokokkokokokkookoooo aaaaaaaaaaaa jjjjjjjjjjjjjjjjjjjjjoboboboboobobobobobobboobobbobobo iiiiiiiiiiinn nnnnn nn nnnnnn n a aa a a a a a aaaaaaaa babababbababbbabababbbbbabababaaababbakekekekekekekekekekekekekekekkkeekkekkeekkeek ryryryryryyryryyryryryyyyyyryy iiiiiiiiiiiiiiinnnnnnn nnnnnnnnnnnn AAAAAAAAAAAAAsAsAsAsAsAsAsAsAsAsAsAAsAsAsAsAsssAssssAsAsAssAA tototototottototottotototottotoooonn nnnnnn n nnnnnnnnnnn ananananananananaanannannnannd ddd d ddd d ddddddddd
coccccccococococococococococcocooooccoooooooonnnntntntntntntnttnntntnttnntntnnnnnnnnnnnnn inininininnininnnniniininnueueueueueueueeueeeueueueueuueuuued d d d d d d dd ddddd d ddddd tototototototototototototootototoooot ggggggggggggggggggggggggoo o oooo o o ooo ooooo o o o o oo totototoototototototototoototototototototo ttttttttttttttttheheheheheheheheheheheheheeheeheeheeheeheeeee ccccccccccccccccccccccaadadaaadadaaaaaaaaaaadaddadaddddddadadadddddddddddddddeteetetteteteteteteeteteeeeteeeeteeeeetettee ss s ss s ss sss ss ssssss inininininininininnnninininnnnninnnnn tttttttttttttttttttttthehehhehehehehehhehehehhehehehehehehehehehheheehhhhehehhhhhhehhheehhhhehhheheeheeee
eveevevevevveveeevevvevvvveeevvenenenenenneneeenenennnenenenenennenenenenenennneennenennneeeenininininnininiininnnniingsgsgsgsgsgsgsgsgsgsgsgssgsggs tttttttttttto o o o ooooo oo oooooooooo ccococococococccococococcoccoococ ntnntntntntntnttnnttntnn inininininninininnninnnninueueueueueueueueueueuueueueuueue mmmmmmmmmmmmmmmmmmmmmmmyyy y y y y y yyyyyyyyyyyyyyyyyyyyyyyyy trtrtrtrtrtrtrtrtrtrrtttrttrrtrtrraaiaiaiaiaiaiaiaiaiaiaiaaiaiaiaaaaia ninininininininininnnnniinnnnnninniingngngngngggggngggggngngngngggngggggngngngnggg;;;;; ; ; ;;;; ; itititititittitittitittttittttttitttttti
wawwawawawawawwwawawwwawaaawwaawwwwawaaawawwwassssssssssssssssssss aanananananananaanananannn eeeeeeeeeeeeeeeeexhxhxhxhxhxhxhxhxhxhxhxhxhxxhxxxx auauauauauaaauauauauuauaauauaaaaua ststststsststststststtstsststts ininiinininnininiinniniiiini g g g ggggg g g gggggg bububbububuububbbubbububububuuuuuuuuuuuuttt t ttt ttttttttt rerererereererererereeereeeeeeeeeeeeeeeeeeewawawawawawawawawawawwawwwawwwawawwawawaaw rdrdrdrdrdrdrdrdrdrdrddrdrdrddrrdrdrrdrdrddrdrdiniiininininininininininininininnininininninnnnnnnnnnnnininnggggggggggggggggggggggggggggggg
titititititittttititimememememememememmmmmmmmmmemememememmemememememememmmmmmmmemmmm .....
WhWhWhWhhhhhhhhhhhhhaaaatatataaaa wwasass GGGGooooooo ddd HoHoHoH pepepepeeeeeeeeeeeeeeee HHHooososoo pipipippppppppppppppppppppppppppppppppppp tatatatallll lililikekekeee whwhwhwheeeenn yyououu ssstatatartrtrtededed wwworororkikik ngngng ttheheheh reee????ThThThThThhThThThTThThhThTTThTThe e e eeeee e eeeee hohohohohohohhohohohohohhhohoohohhhohhhh spspspspspspspsppspspspspsssps itititititititittitittitallalaalalalalalalaalallaallll wwwwwwwwwwwwwwwwwwwasasasasasasasasasasasasaasassasasassaaass jjjjjjjjjjjjususususususuususssusssusu t t t t t t tt t ttttttt a a aa a a aa aaaaa aaaaaaa hohohohhohohohohohohhhhohohohohhoohooh ususususususussususususususussususuuuu e e ee eee eee e eeee whwhwhwhwhwhwhwhwhwhwwhwhwhwhwhwhhwwwhwwheneneneneneneneneneneneneneneneeenn
IIIIIIIIII ststststststttsttssssstarararararraaarararaaa teteteteteteteteeeteteeeeeeett dddddddddddddddd ininininininininininininin tttttttttttttttthehehehehehehhehehehehehehehehheee 444444444444444444444440s00s0s0s0s0s0s0s0s0s0s0s0s0sss000ssssss,,,,,,, thththththththththhththhthththhhhherererererererererereererrereerereerereeereeeeeeeeeeeeeeeeee wewwewewewewewewewewewwewwewewewwwererererererererererererererererrereree
ononononnonnonnononooonono lylylyylylylylyylylyylyyyyylylyy eeeeeeeeeeeeeeeeeeeeeeeeeigigigiggggigigigigiggiigiiiigiggggggghthththththththtththhh wwwwwwwwwwwwwwwwwwwwwwwwararararararararaaraaaarrararraarara dsddsdsdsdsdsdsdsdsdsdsddsdsddsddsdsdsds aaaaaaaaaaaaaaaandndndndndndddndnddnddndnnddnddnddd iiiiiiiiiiiiiit t t t t t ttttt t ttttttt wawawawawawawawawawawwawawawaaawawaasssssssssssssssss momommomomomomomomomomommmoommomomomomommooom stststststststststststtststststststssttstttststtlylylyylylylyylylylyyyllyylylylylyyy
usususususususssuussuusedededededededdededededededded aaaaaaaaaaaaaaaaasssss ss sssssss aaaaaaaaaaaaaaaaaaa cococococococococococccccocccoococooonvnvnvnvnvnvnvvvvvvnvvnvvnvnvvvalaalalalallalalaaalaaaaaaaaaaa eseseseseseseseseseseseseeeessee cececececececececececeecececeeceeeencncncncncncncnncnncncncccncnce e e e ee e eee e eeeeeeee hohohohohohoohohoohohooooohohhhoomememememememememememememememmememmemmem ffffffffffffffffffffffffffffffffororororororoororororororoorooroooooroooo
ppepepepepeppepepepeeppep opoopopopopopopopoppoopopoopopopopoo leleleleleleleeeelelee wwwwwwwwwwwwwwwwwwhohohohhohohohohohohohohohohhohoohhohohohooo hhhhhhhhhhhhhhhhhhhhhhhhhhhhadadadadadadadadadaddadaddadddddddddaddadadd hhhhhhhhhhhhhadadadaddadadadadadadaaadadadaaada ooooooooooooooopepepepepepeepepepepepeepepepepeepepepp rararararararararararararaarrrrrratitiititititiititititititittt onononononoooononnonoononononooonononoonsss ss s sssss
anananananananananananaa ddddddddddddddd wewewwweweweweweweewewwewweerererererererereeeeereeerrreee rrrrrrrrrrrrecececeeeecececcececeececececcceccccovovovovovoovovovooovvoovvoovvoovovo erereererererreererrrerererree ininininininninininnininiinnninininngg.g.g.g.g.g.g.g.g.g.gggggg MMMMMMMMMMMMMMMMMananananananananananannaaaanaa y y y y y y y y yy yy fofofofofofofofofoofofofofooooffo tttttttttttthehehehehehehehehehehehheheheheheeeeeeeeeeeeheeee
papapapapapapaapapapapapapatititititititiiitit eneneneeeenenenenenenennneneenee tststtstststststststststsst wwwwwwwwwwwwwwwwwwwwwwwwerererereerererereeererereeree ee ee e eeeeeeeeeeeeee sosososososososoooosssosssoldldldldlddddldldddddddieieieeieieieieieeieeieiersrsrsrsrsrsrssrsrsrsrssrr aaaaaaaaasss s ss sss thththththththhthtththththtthtthttht ee e ee e e eeeeee eeeeee wawwawawawawawawawawawwwawwawaaawawwawawawaawawwwwawawwarrrrrr rrrrrrrrr rrrrrrrrrrrrr
hahahahahahahahaaahaaaadddddddddddddddd nonononononnoononoononnoot tttt tt tttt ttttt loloololololooooololoooooll ngngngngngngngngngngngnggngnggg fffffffffffffffinininininininininninnnnnnnnisisisisisissississisissssheheheheheeheheheheheheheeheheeehehhhhhhhhhhh d dd d dd dddd dddddddd sosososososososooosoososoossso pppppppppppppppppppppppeoeoeoeoeoeooooeooeoeoeoeoeoeooeeeoeeoeooeoplplplplplplplplplpllllplpllplplplpppplplppppplppppplpppp eeeeeeeeeeeeeeeee eeeeeee e ee eee e eeee hhhhahahhahhahahaahahahahhahhhahahahaahhaah ddddddddddddddddddddd
aaaaaaaaaa vavavavavavavavavvvvav riririrririiiiririetetetetetetettetetettty y y yy y y yyyy ofofofooofofofofofofofofofofooffooooo iiiiiiiiiinjnjnjnjnjnjnjnjnjnjnnjnnnjnjnjjjururuururururururururrruururururieieieieeeieieieeieiieiies s s s sss s ssss anananananananananannna dddddddddddddddddddddddddd ilililililllilillillllilillllnlnlnlnlnlnlnlnlnlnnlnlnlnllnneseseseseseseseseseessesessseeseeeesseseseseseseesesesesesesssseseseseeseees s.s.s.s.sss.s.sss.sss.ss WWWWWWWWWWWWWWWWWWWWe e e e ee eeee eeeeee
eveveevevevvevvevvevenenenenenennennennneentututuutututututututututututuualalalalalaalalaaalalaalalllllylyyylylyyylyylylylylyyyy ooooooooooooooooooooututututututututuutututtuuutu grggrgrgrgrgrrrrrgrrrggggg ewewewewewewewewewewewwwewwewwww tttttttttttttheheheheheheheheheheheehehehehee hhhhhhhhhhhhhhhhhhhhhhouououououoououououuououuououoouuuuuseseseseseseeeseeeseseeeseessee aaaaaaaaaaaaaandndndndndndndndndddndndndndndndnddndddd
mmmomomomomomooommomoomoooveveveveveveeveveeveeveveeeeddddddddddddddd tototototototootoootoooooototooo wwwwwwwwwwwwwwwwwwwhahahahhahahahahahahahahaahhhahhhaahahhhahaat tt ttttttttttt isisisisisissississisiisi ttttttttttttttheheheheeheheheheheheeeeeheheeeh cccccccccccccccccccccurururururuurururururuuuuuuuu rererererererererereeereereeeeeeentntntntntntntntntnnntntnntnnnn ssssssssssssssssitititititititititiititititte e e eeeeeeeeeeeeeeee ofofofofofofofofofoofofofofoofooof
GoGoGoGoGoGoGoGoGooGoGoGoooGGGGGG oodododododdodododddodoodooodd HHHHHHHHHHHHHHHopopopopopopopopopopopopopopoopopopppooooo eeeeeeeeeeeeeeeeeee HoHHoHoHoHoHoHoooHoHoHoHoHoHHHHoHoHospspspspspspspsppspspsspppssspspspppppppppititititiiitititititiiitiitalalalalallalallalala .........
WWhWhhW y y y y y isisis GGoooooddd HoHoHopepepe ssso o o spspspececece iaiaiall tototo yoyoyooooy u,u,u,u, aaaandndnndn wwhyhyhy dddidididd yyyououou ssstatatay y yy onono aaaftftfterere yoyoyoourururur rrreteete irirememmenenent?t?t?FoFoFoFoFoFoFoFoFoFFForr r rrrrrrrrrrrrr mememememeeememememmemmemmemmmmeeeem , , ,,,, , , GoGoGGoGoGoGoGoGoGGoGoGGGooGoGooododododododoodododododododdodoododd HHHHHHHHHHHHHHHopooopopopoppopopopoppopopoppopopopope e ee ee eeeeeee e eeee isisissisisisisisisisissiisiss hhhhhhhhhhhhhhhhhhomomomomomomomomomooomomomomomomomomoomomomo e.ee.e.e.e.e.e.eeeeee.eeeee TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTThehehehehehhehehehehehhhhehehhehheehhehhh
hohohohohohohohoohooospspspspspspspsspsppititititittitittttttii aalaalalalalalaaaallallaaa aaaaaaaaaaaaaaaalllllllllllllllllllllllllllllloowowowowowowowowowowwwwwowwwedededededddededededededeede mmmmmmmmmmmmmmmmmmmmmme eeeee e eeeeeeeeeeee totototototootototootootoooootot pppppppppppppppppppppppppurururururuururururuuurrrrrursusususususussususuususususuus e eeeeeeeeeeeeeeeeeee mymymymymymymymymymmymymmyymymymyy
cacacacacacacacacacac rerrerereeerererereerereererererererererereereereereere aaaaaaaaaaaaasssssssssss s ssss s sss a aa a aaaaaaaaaaaaa nununununununununununuuunuuuunursrsrrsssssssrrssrsrsrsrsse,e,e,ee,e,e,e,e,e,ee,e aaaaaaaaaaaaaaaaaaandndndndnddndndndndnddndndndndndnndnn gggggggggggggggggggavavavavavavavavavavvavavvavvaave e e e e ee eeeeeeeeeeee eeee memememememmememmemememmmemee tttttttttttttttttthhhheheheheheheeheheheheheheeeheehe
susuususuusuuusususs ppppppppppppppppppppppppppppppppppppororororororororororoororoortt tt t tt ttt t ttt aaaananananannaaanananaannnananannnnnaa ddddddddddddddddd trtrtrtrtrtrtrtrtrtrtttrrraiaiaiaiaiaiiaiaiaiaiaaaaaaiiiininninininininininininnininnininningngnngngngngngngngnnngnggngggnggg IIIIIIIIII nnnnnnnnnnnnnnnnnnnnnneeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeededededededededededdededdedeedededdddd ddddddddddddddddddd tototototototoototooototoooto
pprprprprprprprprpp acacacacacacacaccaccacccccctitititititttititttt sesesesesesesesesesesesesesseee tttttttttttheheheheheheheeeeeheheheheheheheheheeheee ppppppppppppppppppppppppppppppppppprororororororoorooorororoorroroofefefefefefefefefefefefefefeff ssssssssssssssssssssssssssssioioioioioioiooioioiooioioioioi nnnnnnnnnnnnnnnn fofofofofofofofofofofofofofooooor r r r rrr rrrrrr sosososososososoososososssossososssssssooo mmmmmmmmmmmmmmmmmmananananananaanannanananananaaanaanannny y yy y yyy yyyy yyy yyyyyyyyyyyyyyyyy
yeyeyeyeyeyeyeyyeeyeyy arararararararararaaars.s.s.s.s.ss.sssss.ss. IIIIIIII wwwwwwwwwwwwwwwwwwwwasasasasaasassssasasassssasasassasasasaas sssssssssssssssssssssssadadadadadadadadadadaaddadada ttttttttttto o o ooooooo o ooooooo rerererrererererereeererererereerr tititititititittttitititiiit rererererrererereerereerrrereer ,,,,,,,, bububububububububbbuububbububutt t tttt ttttttttt atatatatatatatattatattatattaattttaaaa 6666666666666666666666555555555555555555555
iitititititttitttttitit wwwwwwwwwwwwwwwasasasasasasassassassas ttttttttttiiiimimimimimimmmimimmimimimimmmeeeeeeeeeeeeeee fofofofofofofofofoofofoofooooor r rrr r rrr rrr mememememememememememememememememememememememmmmmm tttttttttttttttoooooooooooooo hahahahahahahahahahahaahaaahaaaaaaandndndndndndndndndndnnddndndndnddddnn iiiiiiiiiiiiiiiiin nn n nnn nnnn mymymymymymymymymymyymmmymmym
ununununununununununnifififffififififififororoorororoooooorororrrrm m m mmmmm mm mmmmmmmm ananananananannnnananannnndddddddddddddd alalalalalaaaaalalaaaalaa lolololololoolololololow w wwwwwww ww www w w otototoototototooootototooototototooooooototoooooototoothehehehehehehehehhhehhehehehehehehersrsrsrsrsrsrsrssrsrsrsrss tttttttttttttto o o ooo o oooooo dededededededededededededededededdddddd vevevevevvveevevevevevevvvvevevevevvevveeveeveeev loloolololololololololloooooopp pp p pppp ppppp p ppppppppp
aasasasasssasasasa IIIIIIIIIIII hhhhhhhhhadadadddadaddadaddaadddddad. . . .. HoHoHoHoHoHoHoHoHoHooHooHoweweweweweweweweweweweweweeweeweeeewewweeweevevevevevevevevevevvevevevevvvvvvvvevv r,r,r,r,r,r,r,r,rr,r,r,, ttttttttttttttthehehehehehehhehehehehhehhehehehhe hhhhhhhhhhhhhhhosososososoososoosososososossssosssssssspipipipipppipipipipippipppipipipppppppppp tatatatatataatatatatatatatatataaallllllllllll hahahahahahahahahahahhahahahahahahaahhaddddddddddddddddddddddddddd
bebebebebebebebebeebeeneneeneennenenenenne mmmmmmmmmmmmmmmmmyyy y y y y y yyyyyy llilllillilillilllifefefefefeefefefefeefefefeeefff sssssssssssssssssssooooooooooooooooooo IIIII II I I III I wawawawawawawawawawawawwawawwwwww ntntntntntntntntnttntnttnntntn ededededededededeedededdeddededdeede tttttttttttttto o oo o ooooooo oo ooo gigigggigigigiggigigiigggiggiggggiggg veveveveeveveveveveveeveveeeveee
baababababababababbbbbb ckckckckckckckckckckckccckk iiiiiiiiiinnnnnnnnnnnnn ananaannannananannanaaaa yy y yyy yyyyyyy yyyy wwwawawawawawawawwawawwawawwwwwwwwawaaww y y yy y yy y y yyyyyy IIIIIIIIIIII cococococococococoococococoococcocc ululululululululuuuuululululuuluu d.d.d.d.d.dd.ddddddd.d.ddddd AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAftfftftftftftfftftftftfttftftfff ererererererererereererrereree mmmmmmmmmmmmmmy y y y y y yyyyyyyyyy
VVGG
ToToToToToo ccccceele ebebbbbrarateteeee GGGGGooooooooddddddd HoHoHHHHoH pepepee HHHosososospipipip tatatataaaaal’l’l’l’sssss ss 75757575thththth aaannnnnnnnn ivivivererere sasasaryryry, , , wewewewe mememememeet t aa vevev ryry ssspepepecicicialalala lladada y,y, kkkknonononownwnwnwn aaaas s s s GoGoGoGoodododod HHHHopopopoppe e e e HoHoHoHospspspsps ititititalalalall’s’s’s’s ‘g‘g‘g‘gg‘guuau rddiaian n ananangegegegel’l’l’l’, , , VeVeVeVerararara ‘‘‘HooHoHollllllllyy’y’y’ HHHHHololleleleeey.y. HHHHololo lylyyy,, 878787, , , hahahaas s swowowowooorkkeded aaaat t t GoGoGoooodododod HHHHopopopopee e e HoHoHoHospspspspititititaaaaallalal ffffororororrrrr oooovevevever rrr 50505050 yyyyeaeaeaearsrsrsrs,,, firfirfirfirstststst aaaas sss aa a a nunun rsrse e e ee ananannd dd afafafafteteteter r r r rerereretitititiriririringngngng iiiin nnn 191999999595955, , aaa a vovolluluuntntnteeeeeeeer.r.r.r. SSSShehehe hhhhasasasas tititittirereleesssslylyly fffunununndrdrdrdraiaiaiaisesesesedddd totototo pppprorororovivivividddddededede oooooveveveveeeeer anananannd ddd ababababbbovoovovo eee e fofofofor r r ththththeeepapapapap tienentstss aaaandndndnd sssstatataaffffffff aaaatt t ththththe ee hohohoospssppppititttalalalal.
rerererereereeerererererererereerereereerreeetititittitittititttititittitttttiitt rereeererererrereeereeerrereererererereeeeererer memmememmemememememememmemmmmemmemememmmmmmmmmemmm ntntntntntntnntntntntntntntntntntntnnntntntntnntntntnntn IIIIIIIIIIIII sssssssssssssssssssssssssseteteteteteteteteteeeteteetteteteteteteteteee
upupupuupupupupupupupupupupupupupuppupuu aaaaaaaaaaaaaaaa bbbbbbbbbbbbbbbbbbbbbbrararararararararararararaaraararaar ncncncncncncncncncncnncncncncnccnccccccnchhhhhhhhhhhhhhhhhhhh
ofofofofofofofoffoffofofofofofofoo tttttttttttttttttttthehehehehehehehehehehehheheeheheheee NNNNNNNNNNNNNNNNNNNNNNNHSHSHSHSHSHSHSHSSHSHSHSHSHSSHSHSHSH
ReReReReReReReReReReReRReReRReReeReRee ittitiititititititittiiiitiit rererererererereererereeererereererrrrrrr mememememememememeemememeeememememememmem ntntntnntntntntntntntntntntnttntntnttn
FeFeFeFeFeFeFeFeFeFeFeFeFeFeFeFeFeFFellllllllllllllllllllllllowowowowowowowowowowowowowowoowooowoowowwshshshshshshshshshhshhshhshshshshipipipipipipipipipipiipipiipppipipipip, ,,, , ,
whwhwhwhwhwhwhwwhwhwhwhwhwhwhwhwhhhwhhererererereererererererreereee e e e e e e eeeeeeee eeee e rerererererererererereeeeerereerereeereetittitititititititititittitittttt rererererererererererererererereeseeseseseseeseseseseseseseseseeee
fffrffrfrffrfrfrfrfrfrfrfrfrffrfrrf omomomoomomomomomomomomomoomomommmm tttttttttttthehehehehehehehehehehehehehehehehhee hhhhhhhhhhhhhhhhhhhososososososssososooosososoososoosoossssssspipipipipipipipipipipppipippipipppp tatatatatatatatatatataatatattaataaallllllllllll
cococococococococococococcococococcoululululuulululululululuululululuu ddddddddddddddddddddddddd spspspspspspspspspspspspsppspsppsspeneeneneneeneneneneeeneneneeneneneeneeee dddddddddddddddddddddddddd tititititiititititititititittittitiimemmememememmmmmemememmmemememmmmmmmmemmememeeemememe tttttttttttttttttttttttogogogogogogogogogoggogogogogogogggoggoogetetetetetetetetetettetetetetetteteteetethehehehehhhehehhehhehehhehehhehehhhhhh r r r rrr rrrrr r
ananananananananananananannanaana dd d d dd d dd d dddddd mmammamamamaaamaamamammmamamamaamammmmmainninininininninniniinininiinnntatatatatatatatatatatatatttaaaat ininininnininininininininininninnn tttttttttttttttthohohohohohohohohohohohohohohohoohhohohohoooooooooooseseseseseseseseseseseseseeseeeseeseseee iiiiiiiiiiiiiiimpmpmpmpmpmpmpmpmpmpmpmpmpmmpmpmpppmppppppororororoorororoororoooororororooooooo tatatatatatatatatatatataataantntntntntntntntntnntnntnnntnnnnnnnnnnn
frffrfrfrfrfrfrfrfrfrfrrfrfrfrf ieieieieieiiieieieieieieeieendndndndndndndndndndndndndnddnddnddshshshshshshshshshshshshshshhhshhshipipippipipipippipipippipppppipipippippsss s s s sssss ssss whwhwhwhwhwhwhwhwhwhwhwwhwhhhwhwhwhwwhwhw ilililililililililli ststststststtstsstststststststtstssttst rrrrrrrrrrrrrrrraiaiaiaaiaiaiaiaiaiaiaiaiaiaaaaaaaaa sisisisisisisisisisisisisisissiisisis ngngngngngngngngngngngngggggngngngngnggngggggg
fufufufufufufufufufufufufufufufuuuuuuuundndndndndndndndnddndndndndndndndddddnddndss s s s s s ss sss s s s ss fofofofofofofofofofofofoffofoffooff rrrrrr r rrrrr rr spspspspspsppspspspspsppspspspssspspssssppececececececeececececececccececeece iaiaiaaiaiiaiaiaiaiaiaiaiaiaaaaaiaiiaaaaalililiililililiiiilliliiiiliststststststststststststsststsststtstst fffffffffffffffacacacacacacacacacacacacacacaacca ililiililililiiliiliillii ititititititititittitittttttitititttieieieieieieieieieieeeeeeieeieieei s s s ssss s ss ss sssssss
ananaanananannanannananannanndddd d d dddd ddd ddddddddd eqeqeqeqeqeqeqeqeqeqeeqeqqqeqeqqeqeqee uiuiuiuuiuiuiuiuiuuiuiiuiuuiuuiuuuuu pmpmpmpmpmpmpmpmpmpmpmpmppmpmpmpmmpppppmpppmmpmmp enenenenenenennnenenenenenennenennee ttt.t.t.ttt.tt.tt.t.t.tttt.tttt
HoHoHoH llllll y,yy,y yyyouououu hhavavaveeee bebebebeenene nononomim nannononoomimimim nann teteed dd fofofor,r,r, aandndndd wwonononn, , , mammam nynnyy aaawawawaww rdrdrrds s fofofor r yoourd fofoffor yoyoyooururur cocooontntnnntriribububuuutititiononono to o ththhhe ee e hohoh spspitii alalaa .lWhWhWhatata wwwwouououooo lddld yyyououououou sssayayayayay wwwwwasasasa tttheheheh prprp ououo dedeeststst mommenenennnt tt ofoffo yyyouououour r cacaarereeererer???OfOfOfOfOfOfOfOfOfOfOfOfOfOfOOfOOfOOOOOfOOOOOOOOOOOOOO ccccccccccccccccccccccouououououououououououououououuououououuooo rsrsrsrsrsrsrsrsrsrsrrsrsrssrsrsse,e,e,ee,e,e,e,e,e,e,e,ee,e,e,e,eeee, IIIIIIIIIIIIIIIIIIIII wwwwwwwwwwwwwwwwwasasasassasasasasasssasasasaasssa aaaaaaaaaaaaalwlwlwlwlwlwwwlwwwwwlwwwwlwwwwwaaaaayayayayayayayayayayayyaayaayaaaaaaayyyayaaya s sss ss sss ssss s ssssss exexexexexexexexexexxxxxxxxexxeexexexeexxexexexexxtrtrtrtrtrtrtrtrtrtrtrtrtrttrtrttrtrtrrtrtt ememememememememememememememmemmemmmmmemememmemmme eleeeleleleleeeleleleleleelelleee y y yyyyyy y yyyyyyyyyyyyyyyyyyyyy
prprprprprprprprprprprppprprprprprprprprppppp ouououououououououuouououououououoououououuoudddddddddddddddddddddd tototototototototototootoototoootot bbbbbbbbbbbbbbbbbbbbbe eee e eee eee e e ee eeeeeee aaaaaaaaaaaaaaaaaaaaa nununnunnunununununununuunununnunununnn rsrsrsrsrsrsrsrssssrsrsrsrssssrse,e,e,ee,e,e,e,e,ee,e,ee,ee,e iiiiiiiiiiiitt ttt tt tt t ttt ttt hahahahahahahahahahahahahahaahahas s s ss ss s ss sss s ssss alalalaalalaalalalalalalaalaalllalaalalwawawawawawawawawawawwawawawawwawww ysysysysysysysysysysysysysysysysysysysyyy
bebebebebebebebebebebebebebebebeebebebb enenenenenenenenenenenenneennnnnennennnnnnnn aaaaaaaaaaaaaaaaaaa wwwwwwwwwwwwwwwwwweleleleleleelelellelelellelleeeeee l-lll-l-l-llll---l rerererererereeerererereeerererererereereerereerereespspspspspspspspspspspsppspspssppecececececececececececececececccececcecceccececcceeccteteteteteteteteteteteteeeteetetteeed ddddd d dd ddddddddd d d d d dddd dd dd dddd ddddd prprprprprprprprprprprprpppppppppprpppp ofofofofofofofoofofofofofooooooffoofeseseeseseseseeseseeeeseseseseseessse sisisissisisisisisisissisiiisisisionononononononononnononononnnonnnnonooon, ,,,,,,, ,,, , ,
esesesesseseseseseseseseseseseesesesssesesspepepepepepepepepepeeepepepepepeeppeppp ciciciciciciciciciciccciiccicicc alalalalalalaalalalaalaalalaaaa lylylylylylyylylylylylylyyyyylylyyyyy ttttttttttttttttttrerererererererererererererererreaatatatatatatataataatatatataata inininininininnnnininininniini g g g g gg ggggg gg ggg gggggg iniininininininininininnnininnjujujujujujujujujuuujujujuujujjjuuuuuurererererererererererererereedddddddddddddddddddddd sososososososososososososssssososssoososoososoldldldldddddddldldldldlddddieieieieieieeieeieieieeeieeeeeeeersrsrsrsrsrsrsrsrsrsrsrsrsrssr
innininininninininnininini tttttttttttttttthehehehehehehehehehheheehehehehehehehheehheeeee 1111111111111119494949494944949494949494949494949444440s0s0s0s0s0s0s0s0s0s0s0s0s0s0s0s00s00s0sss0s000000000000000000000000000000000000 bbbbbbbbbbbbbbbbbbutututututuututuutututuututututt IIIIIIIIIIIIIII tttttttttttttttttttttttttthhihhihihihihihihhihhihihhihh nknknnknknknknknknknknknknnnknkkkk mmmmmmmmmmmmmmmmmy y y y yy y y y y yyy yyyyyyyy prprprprprprpprprprprprprprpprppppppp ououououuoouououououououououououuuouudedededededededededededededededdddedeeddeeeeeeeeeedddddeststsststststststststststssssstsstttttssttt
momomomomomomomomomomomomomomomomomommmommommmm mememememememememememememememmememmememeemmmmm ntntntntntntntntntntntntntttntntnnnnn wwwwwwwwwwwwwwwwwwwwwwwwwwouououououououououououououoouuouo ldldldldldldlddldldlddldlddldldllld hhhhhhhhhhhhhhhhhhhhhhavavavavavavavavavvvaaavavavavvvavavavavveee eeeeee eee e eeeeee tototottootototototototooootoootottoot bbbbbbbbbbbbbbbbbbbbbeeeeee ee eeee ee e eeee whwhwhwhwhwhwhwhwhhhwhwwhhwhwhwhwhhhhwwhhwhw eeneeeneneneneenneenneneneneneneen IIIIIIIIII
hahahhhahahahahahahahhahahahahahahahhaaah d dd d dd d d d dddddddd a aaa a aaa aaaaaaaaaaa wawawawawwwawawawaawawawawawaaawawawww rdrdrdrdrdrdrdrdrdrdrdddrddrddddddd aaaaaaaaaaaaaaaaaaaat ttt t t ttttttt ttt GoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGGoGooGooGGoGooooooodododododododododododododododododooooododoodd HHHHHHHHHHHHHHHHHHHHHHHHHHopopopopopopopopopopooppoopooopopopoppppppe ee ee e ee e eeeeee nananannananannaananananannanaannn memememememememememememememememememememememeeeeddddddddddddddddddddd
afafafafafafafaafafafafafafafaaafteteteteteteeeteteteteteteeteerr rrrrrrrrrrrrrrr memememememememememmemememmemememmeeee.... ThThThThThThThTThThThThTThTThThThThThe eeee eeee eeeeeeee VeVeVeVeVeVVVeVeVeVeVVeVeVeVVeVVVeVVeVVeVVeVeVVeerarararararaarararaararararaaaaaaaaaa HHHHHHHHHHHHHHHHHHHHHHHHololololololololollololollooloolooooooooo leleleleleelelelelelelelleeleeleeeey y y y y yyyyy y yy yyyyyy ClClCClClClClCClClClClClCCCC ininninininnnnininninininininnnnnicicicicicicicicicicicicciccccccicicicccalaalalalalalalalalalaaaalaalla
DeDeDeDeDeDeDeDeDeDeeeDeDeDeDeeDeDDeeciciciciciciciciciciciciciciiiiccc sisisisisisisisisissisissississ ononononnonononononnnnnononononono sssssssssssssssss UnUnUnUnUnUnUnUnUnUnUUnUnUnUnUnUnUU ititititititititititiitittttttitit oooooooooooooooooopepepepepepepepepepepepeeppepepeeepp neneneneneneneneneneneneneeeeneenened dddddd d d ddd dddddd dddddd ininininininininininnninninniiinnnnnn 22222222222222220000000000000000000000000000000000000000000 8888888888888888888
tototototototototoototootoootooootoootoo rrrrrrrrrrrrrrrececeeceeececececececececececececcccceccogogogogogogogoggogogogoggogogogogooggo ninninininininnnininninniininniinn sesesesesesesesseseseseeseeseseseeeese tttttttttttttttttttttttttheheheheheheheheehehehehehehehehhhehee ffffffffffffffffunununununununununununununununnnunuuu drdrdrdrdrrdrdrrdrrrdrdrdrdrdddrdrddddrrd aiaiaaiaiaiaiaiaiaiaiaiaiaaaiaaaaaaisisisisisisisisisisisissisisisingngngngngngngngngngngnggggngggnggngggggg ttttttttttttttttthahahahahahahahahahahahahaahahhahahahaaahahahaaaaahhh t t ttt t tttttttttttt
I,,II,II,I,I,II,I,I,I,I,II aaaaaaaaaaaaaaaaaaalololollooloololololololololllolol ngngngngngngngngngngngngngngngngnnngnnn wwwwwwwwwwwwwwwwititittitititititititititititiiitittithhhhhhhhhhhhhhhhhhhhhh ththththththththththththththhthhhhhtthtt e eeee e eee e eeeeee eeeee dedededededededdedededdedededededeeeedeeeedeeeeedididididididdidididididididiiiddddddddddddd caccacacacacacacacacacacacaaacaacaaacaaaac teteteteteeteteteetetetetettetedddddddddddddddd teteteteteteteteteteteteteetetteeeeteteeamamamamamamamamamamamaamamamamammmmmmammm
ofofofofofofofofffofoofoffofoffoofofooooffo vvvvvvvvvvvvvvvvvvolololololololololoololololoooo uununununununununununununnnnununuunteteteteteteteteteteteteteeteeteeererererererrererereerrerererrereereeee ssssssssssssssssss atatatatatattatatatattattatatatat ttttttttttttttthehhehehehehhehehhehehehhehehehhehehee hhhhhhhhhhhhhhhhhhhhhosososososososososososoososososososospipipipipipipipipiipipipippipippppipp tatatatatatatatatatatatatatataal,l,l,l,l,lll,l,l,l,l,ll,l,l,l, hhhhhhhhhhhhhhhhhhhadadadadadadadadadadadadadadadadaddadd
ddodododododdododododddddoddddoddodood neneneneneneneneneneenenenennene tttttttttttheheheheheheheheheheheheheheehehehheehhe ppppppppppppppppprererererererererereereereeeeeevivivivivivivvivivivvivvivvivvvvivvviouououououououououuouououououououuusss s ss s s ssssssss yeyyeyeyeyyeyeyeyeyeyyyyyy WWWWWWWWWWW iiiiiiiiii ddddddddddddddd
alalaalalaalalalalalalalalalaaa momomomomomomomomomomomomomomomomoom stststststststststtstststsstss £££££££££££££££££££££££££161616161616161616161616116161611666,00,0,0,0,00,0,00,0,000000000000000000000000000000000000000000000000000 iiiiiiiiiiiiiiiiiin n nnn nn nnn n nnnnnnn
2020202020202020202020202020202200000000707070707070707007070707070707000000000000077 wwwwwwwwwwwwwwwwwwwwwhihihihihihhihihihihihihhiihhihihhiihiiiiiichchchchchchchchchchchchchchhhchhhhhchchchchhcccch wwwwwwwwwwwwwwwwwwasasasasasasasasasasasassssss
ususususususususususuussususuusuuu edededededededededededededededededddde tttttttttttttttttto o o o o o oooooo o ooo oo pupupupupupupupuppupupupupuppupupup rcrcrcrcrcrcrcrcrcrcrcccccrcrchahahahahahaahahahhahahahahahahaahaseseseseseseesesseseeeseseseseeesesesesees aaaaaaaaaaaaaaaaaaaaaa
blblblblblblblblblblblblblblblblbbbblbbbbbbb adadadadadadadadadadadadadadadadadadada dededededededededededededdeddededeerrr rrrrrrrrrr r scscscscscscscscsscscsccscscscsccssccccanananananannnaannananannaannananneneneneeneneneneeneneneeeneneeer,r,r,r,rr,r,r,r,r,r,rr,,,, aaaaaaaaaaaaaaaaaaaaaaa
rerererererererrrerereerererereeeessususususususususususussusususuusus scscscscscscscscscscsccsccscscscititititiiitititititititittitititatatatatatatataatatattaaaattattioiooioioioioioiooiooioiooioiooiooonnnnnnnnnnnnnnnnn trtrtrtrtrtrtrtrtrtrtrtrtrtrrttttt oololoololololololoololooooololloo eeleleleleleleleleleeleeleleleleey y y y y yyyy yyyy yyyy
ananananaananananananananaananaanna d ddd d dd d d ddd ddddddddddddd a aa a aa a aa aa aaa ssspspspspspspspspspspsppssspspsspsppececececececececececececececeeeece iaiaiaiaiaiaiaiaiaaiaiaaaialililiiliiilililililiiliiseseseseeeseseseesesesesesesesss dddddddddddddddddd
chchchchchchchchchchchccchchchhcchhhhhhhaiaiaiaiaiaiaiaiaiaiiaaiaiaiaaiaiaaaa r rrr rr rrrr rr r r fofofofofofofooofofofoofoofofoooofoforrr r r rrr rrr thththththththththththhhthhththththhhththeeeeeeeeeeeeeeeeeee EEyEyEyEyEyEyEyEyEyEyEyEyEyEyEyEEyEyeeeeeeeeeeeeeeeeeeeeee
DeDeDeDeDeDeDeDDeDDeDeDeDeDeDeDeDeDeDepapapapapapapapapapapapapapapappppppppaartrtrtrtrtrtrtrttrtrttttrtrrttmememememememememememememememmemmmmmmmmmm ntntntntntntntntntntntntntntntnttt..........
yeyeyeeyeyeyeyeyeyeyeyeey arararararararararararararararrrraarrrr. ...... WeWeWeWeWeWeWeWeWeWeWeWeWWeWeWeWWe rrrrrrrrrrrraiaiaiaiaiaiaiaiaiaaiaiaiaiaa sesesesesseseseseseseeseseseseseeseeseses ddddddddddddddddddd
6 GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 GHHCharity @GHHCharity
Good Hope HospitalChildren’s AppealGood Hope Hospital Charity is launching a new £300,000 appeal to transform the children’s areas at the hospital, so visiting children feel as comfortable as possible, minimising stress
for their parents and the staff who treat them.
Each year, 30,000 children are treated at Good Hope Hospital but the areas do not reflect this, and are not as child-friendly as might be expected at a hospital that sees so many children. With your help, Good Hope Hospital Charity will renovate the children’s areas, making them much more child friendly.
Good Hope Hospital Children’s Outpatients department treats thousands of children and teenagers each year for a variety of conditions. With your support, the Charity will carry out a full refurbishment, transforming the area, including new walls and floors, with friendly decorations, comfortable chairs, a new reception area and a fully refurbished play area.
The refurbishment will continue into the treatment rooms, transforming these to be calming for young patients who may
be having their first experience at hospital. These treatment rooms are where children receive injections and tests so creating a child-friendly environment will help to decrease anxiety, helping the children and their parents.
Currently, the children’s area does not stand out from the rest of the hospital, the Charity’s appeal will
transform the department, including the entrance so that children know they are entering an area that caters for their needs.
Laura Power, Fundraising Manager at
Good Hope Hospital Charity said: “I am excited to launch this ambitious new appeal that will transform the children’s areas at the hospital. With the help of our amazing supporters, we will be able
to revitalise the department, making it child-friendly and comfortable, to the benefit of children and their families.
“A trip to the hospital can be stressful for
children, but a bright area, full of toys and activities, will take their mind off the fact that they’re in hospital, allowing them to interact with their siblings and other children as they would at home or at school.
“The renovation will not only help children’s physical and mental wellbeing, but decrease pressures on staff as happy and relaxed children can be treated more quickly than anxious children. The Charity wants to create an environment that staff can be proud to work in, complementing the excellent care that children receive at the hospital.”
None of this will be possible without your support; there are lots of ways that you can raise money to support the Children’s appeal at Good Hope Hospital. Join one of the fantastic events coming up this year or set up your own fundraising event at work or in the community. To make a donation to the Children’s appeal, please visit heft.org.uk/childrenandyoungpeople or for more information contact [email protected]
BEFORE
AFTER
An artist’s impression of the children’s areas at Good Hope after renovation
An artist’s impression of how the new children’s playroom area at Good Hope Hospital will look
GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 7GHHCharity @GHHCharity
Where your money has been spent
Thanks to your generous donations Good Hope Hospital Charity has been able to go over and above for departments throughout the hospital benefitting patients and staff.
The Charity has funded an activity trolley for the stroke ward with a selection of games, puzzles, colouring books and portable DVD players. These were requested by the ward to keep their elderly patients, and those with dementia, entertained during their time on the ward. Melissa Coley, Staff Nurse, said: “The activities have been extremely well used, particularly the DVD players. As well as being appreciated by patients, the puzzles are great for families as a way for them to positively interact with their loved ones.” Justine Davy, Head of Fundraising said: “For people who have recently had a stroke, being on the
ward and not engaging in any activities can cause distress and a low mood. These games and DVDs give patients a reason to stay active and hopeful about recovery as well as spend time with their loved ones.”
The Charity also provides ‘added extras’ for children visiting Good Hope Hospital. For many children a trip to the Children’s Outpatients Department may be their first experience in a hospital, and can be extremely daunting.. Good Hope Hospital Charity has provided a wide range of toys and sensory items that parents can use with their children to provide some comfort and distraction for them whilst awaiting their appointment. The items are also useful for siblings who may feel uninvolved or bored. As well as in the waiting room, members of staff can use the sensory toys to distract children whilst they are having blood taken or having a
minor procedure.
GOOOOGOOD HHD HD HOOPOPOPE HOSarity
,
nn
p
HHOPOPOPPEE
Laura Power, Fundraising Manager at Good Hope Hospital Charity said: “Coming to hospital can be stressful for both children and parents alike so the Charity aims to make this experience as easy as possible.”
The Medical Day Unit has also benefitted from Charity funding. The Unit exists predominantly as an elderly care outpatient facility, and thanks to support from the hospital charity, it has undergone a change of location and full refurbishment. Katie Snowden, Senior Nurse on the Unit said: “A recent expansion aided by Good Hope Hospital Charity has supported us in expanding our service to take frail elderly patients out of A&E avoiding hospital admissions and unnecessary lengthy stays in hospital, as well as making the unit more comfortable for patients.” Mike Hammond, Chief Executive of Good Hope Hospital Charity said: “Good Hope is immensely proud of its Medical Day Unit and this refurbishment will benefit the hundreds of elderly people who visit each year.”
ded od
overyeir
Asda donation brings joy to children’s radiology
Victorious boxer brings funds to Good Hope
Specsavers team go the extra mile to support children at Good Hope
The team at Asda Minworth donated a very generous £500 to the Children’s Radiology Department at Good Hope Hospital.
The cheque, presented by Community Life Champion, Denise Alder, to Rebecca Pinner will help to make the department more child-friendly, easing the stress of coming to hospital by refurbishing the play area, filling it with fun and modern toys, and decorating the walls with bright and colourful murals.
Laura Power, Fundraising Manager at Good Hope Hospital said: “Thanks to Asda Minworth for supporting the Charity through its green token system. We really value local businesses raising money for the
d
8 GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 GHHCharity @GHHCharity
community; the items purchased from this donation will bring smiles to children and families at Good Hope.”
Amateur boxer Jimmy Bates was born 35 years ago at Good Hope and was cared for at the Special Care Baby Unit. Recently, Jimmy returned to the Unit with a cheque following his success in an amateur boxing event.
Jimmy competed in the Strictly Boxing VIII event at Moseley Rugby Club and, thanks to the support of his family, friends and colleagues at Access Hardware Ltd, has raised over £3,000 to support newborns in need at Good Hope.
Jimmy said: “It was great to raise money to support a cause that is really close to my heart. I trained hard for the boxing match and it paid off as I won in around 60 seconds!”
Laura Power, Fundraising Manager at Good Hope Hospital Charity said: “It’s really special that Jimmy has returned to give something back to the unit that cared for him when he was so small. The money will help the Charity go over and above for newborns at Good Hope.”
A team from Specsavers branches in Mere Green and Sutton Coldfield has raised £3,400 to support children at Good Hope Hospital.
Staff members at the opticians raised money by taking part in the Great Midlands Fun Run and a Wolf Run, a muddy, obstacle-filled test of endurance. The money will go to support the Children’s Assessment Unit at Good Hope Hospital.
Specsavers Store Director, Tim Goodhew, visited the hospital to present the cheque to Fundraising Manager, Laura Power and Play Specialist, Amanda Brookes.
Tim said: “Lots of team members have been busy fundraising. I took on the challenge of completing the Wolf Run alongside five of my colleagues, we had a great day and it was excellent to raise so much money for an important cause.”
Laura Power said: “The Charity’s thanks go to Tim and the team from Specsavers Mere Green and Sutton Coldfield for their fundraising efforts! The money will help the Charity provide toys and activities for the Children’s Assessment Unit, entertaining the 30,000 children that are treated at Good Hope every year.”
New Hall Hotel to fundraise for Good Hope Hospital
A close shave for fundraiser
Physiotherapy patient puts on a show
Laura Cox has raised a brilliant £4,000 to be split between Good Hope Hospital’s Oncology Department and Little Princess Trust, by shaving her 15-inch long hair off.
Laura, ‘Brown Owl’ at First Streetly Brownies in Sutton Coldfield, had the ingenious idea to raffle off the opportunity to cut off her hair, saying: “I wanted to donate as much hair as possible so decided to have my whole head shaved.”
Laura chose to raise funds for Good Hope Hospital Charity in memory of her auntie Chris, who sadly passed away from cancer in 2015.
There were lots of helpers on the night from the Streetly Rainbows, Brownies and Guides, whilst the team from The Hair Room in Sutton Coldfield kindly offered to shave Laura’s head on the night.
Laura Power, Fundraising Manager said: “Thank you Laura for your incredible fundraising, I am humbled by your bravery in shaving your head! The money will support cancer patients at Good Hope, helping the Charity to provide extra comforts to help in their treatment.”
Good Hope Hospital Charity is delighted to receive the support of New Hall Hotel and Spa in Sutton Coldfield, whose team has chosen the Charity as their charity partner for 2018. The team will be fundraising throughout the year, joining the Charity in a range of activities to mark the 75th anniversary of Good Hope.
Jonathan Squire, General Manager at New Hall Hotel said: “We are looking forward to raising money for such an excellent local cause over the coming year. Many of us have personal connections to the hospital and are keen to do what we can to help!”
Laura Power, Fundraising Manager said: “It’s wonderful that local businesses are fundraising for Good Hope Hospital. I’m looking forward to working with the team throughout the coming year.”
Jean Rhema is a physiotherapy patient at Good Hope and after the care that she received, felt inspired to give something back. She held a fashion show at Sutton Coldfield Town Hall to raise money and the event was a great success! Members of the physiotherapy department event took to the catwalk themselves to support Jean’s event!
Good Hope Hospital Charity’s Laura Power said: “Well done to Jean for putting on such a fun and unique event, it’s great that she wanted to give something back to support the department that treated her!”
n
GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 9GHHCharity @GHHCharity
Staff SuperstarsEvery day we are delighted to hear from our brilliant fundraisers, who give up their time to support patients at Good Hope Hospital. Included in our wonderful charity champs are our ‘staff superstars’ who work at the hospital and go over and above to help us fund extra equipment, facilities and research on top of what the NHS is able to provide. In this issue we are saying a
to our fantastic staff superstars who have gone over and above to help improve the hospital experience for patients and families. Well done!
The first staff superstar is Head of Patient Engagement, Jamie Emery, who took on Vélo, a gruelling 100-mile bike ride to raise funds for Good Hope Hospital and the Queen Elizabeth Hospital Birmingham’s cancer units, after his wife received treatment for breast cancer.Jamie’s wife, Sarah, was diagnosed with breast cancer four years ago and after a year of difficult treatment, she made a full recovery.
“If it wasn’t for the services provided at Good Hope and the Queen Elizabeth Hospital Birmingham my wife wouldn’t be here today so Vélo
was my chance to give something back.”
Jamie raised almost £900 for the departments.
The next shout out goes to Ward 9 at Good Hope Hospital where the staff have gone over and above to raise funds for the Elderly Care wards at the hospital by holding a pub quiz at The Boot Inn.
Teams of staff members and their friends and family came along on the night where, as well as general knowledge rounds, there was a special round where teams had to make something related to the hospital out of tinfoil! The evening raised £900 for the Elderly Care Appeal.
Well done to the team of 12 members of staff at Good Hope Hospital who completed the demanding triathlon challenge to support patients with cancer.The dedicated dozen swam, ran and cycled the Birmingham Triathlon held in Sutton Park in Sutton Coldfield, taking on a full Olympic distance triathlon! The team is no stranger to exercise however; as this is the
second time they have competed in this event. The competitors consisted of staff from the hospital’s Oncology Department including nurses and pharmacy staff. Rachel Powell, Clinical Nurse Specialist said: “The triathlon was difficult but it made me think about how hard life can be for our patients with cancer, and that was really humbling.” The team raised over £2,000 for the Good Hope oncology day unit.
If you’d like to get involved in fundraising for your ward or department, or would like to find out more about our events, please head to our website at goodhopehospital.org.uk or call 0121 371 4852 to speak to one of our friendly team members!
Do you know a staff superstar? Do you want to nominate them for a shout out in the next Charity newsletter? If so please get in touch and share your story by emailing [email protected] or get in touch on Facebook or Twitter.
10 GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 GHHCharity @GHHCharity
b d th i
s this is the e e something
cctpTcittarararararraree e ee sass yiare say
Join our eventsWhether you’re a thrill-seeker, or an aspiring Edmund Hillary, Good Hope Hospital charity has the event for you, and with the wide range of events on offer, why not join us?
GOOD HOPE HOSPITAL CHARITY NEWSLETTER | ISSUE 3 11GHHCharity @GHHCharity
Join the hospital charity for the Great Midlands Fun Run on 3 June. The Great Midlands Fun Run is an eight and a half mile course which snakes through the streets of Sutton Coldfield, entering Europe’s largest urban park, Sutton Park, before returning to the City Centre. Run, walk or jog in this ‘challenging but fun’ event and raise funds for Good Hope Hospital Charity.
For more information on how to sign up go to heft.org.uk/events and email [email protected] to get your free fundraising pack!
If open-water swimming sounds like a splash then why not join the Charity for the Great North Swim, and take on a one-mile swim in the picturesque Lake Windermere?Taking place over the weekend of 8-10 June, you can choose which of the three days and at which time
you’d like to do your swim. The event is suitable for all abilities and is equivalent to approximately 64 lengths of a standard 25m pool, and on average it takes 45 minutes to complete. Soak up the landscape with a leisurely breast stroke or pick up the pace with a fast
front crawl! Please note that hospital charity places are free, but, we do ask that all charity swimmers raise a minimum of £250 in sponsorship.
To sign up for your charity place go to heft.org.uk/events or email [email protected] for more information.
Have you ever wanted to climb a mountain? Then why not do ‘summit’ amazing for Good Hope Hospital Charity and hike up Snowdon, England and Wales’ largest mountain?
On Saturday 15 September join the Charity for a day’s walking to raise funds for patients and staff in the hospital. Places costs £45 and minimum sponsorship is £100, your place includes return transport from central Birmingham, experienced guides and snacks.
To sign up go to heft.org.uk/events and contact [email protected] for more information.
Do you want a challenge, but can’t decide whether to swim, cycle or run? The Birmingham Triathlon consists of an open-water swim, a rural closed-road bike course and finishes with a run through heathland and ancient woodland, all in the beautiful Sutton Park! The event is on 24 June and is open for over 14s in the sprint, super sprint and fun distances! A place is £70 and there is no minimum sponsorship.
Purchase your place at uktriathlon.co.uk/events and contact [email protected] to receive your free fundraising pack!
If sport isn’t for you, then the Charity also offers you the opportunity to do a tandem skydive!There are several dates available including 16 June, 14 July, 18 August and 8 September. Places are £50 and minimum sponsorship is £300. If you are from a company or organisation that is interested in holding a team skydive we are able to cater for large group bookings too, great for team building, and we can allocate you your own private day. Have fun whilst raising money for a good cause with our corporate skydives.
Contact [email protected] for more information and sign up at heft.org.uk/events.
All you need to know about contacting the hospital charitiesIf you would like to get in touch with Good Hope Hospital Charity, Heartlands Hospital Charity or Solihull Hospital Charity, the names and numbers you need are included here in our handy tear-off guide:
Main office:
Tel: Charity Chief Executive - Mike Hammond 0121 371 4852
Head of Fundraising - Justine Davy 0121 371 4852
Email: [email protected]
Website: www.heft.org.uk
Good Hope Hospital CharityTel: 0121 371 4852 or 07512 141 432
Email: Fundraising Manager - Laura Power [email protected]
Website: www.goodhopehospital.org.uk
Heartlands Hospital CharityTel: 0121 371 4852 or 07407 635 081
Email: Fundraising Manager - Sian Averill [email protected]
Website: www.heartlandshospital.org.uk
Solihull Hospital CharityTel: 0121 371 4852 or 07920 756 709
Email: Fundraising Manager - Sam Howell [email protected]
Website: www.solihullhospital.org.uk
If you work at any of the three hospital sites and receive queries or donations, please give us a call on the main office number and we will come and see you. Thanks!
GHHCharity @GHHCharity goodhopehospital.org.uk