MOLECULAR AND CELLULAR BIOLOGY, Feb. 1989, p. 739-746 Vol. 9, No. 20270-7306/89/020739-08$02.00/0Copyright © 1989, American Society for Microbiology

Negative Control Region at the 5' End of Murine Leukemia VirusLong Terminal Repeats

JAMES R. FLANAGAN,1t ARTHUR M. KRIEG,2 EDWARD E. MAX,1 AND ARIFA S. KHAN3*Laboratory ofImmunogenetics' and Laboratory of Molecular Microbiology,3 National Institute ofAllergy and Infectious

Diseases, and Cellular Immunology Section, National Institute of Arthritis and Musculoskeletal and Skin Diseases,2Bethesda, Maryland 20892

Received 15 August 1988/Accepted 11 November 1988

Using in vitro protein binding and in vivo functional studies, we have identified novel regulatory sequencesnear the 5' end of murine leukemia virus (MuLV) long terminal repeats (LTRs). These sequences are highlyconserved in all MuLV LTRs as well as in feline leukemia virus and gibbon ape leukemia virus LTRs. In thisupstream conserved region (UCR), gel retardation assays detected two overlapping but distinct binding sites(UCR-U and UCR-L) for nuclear proteins (UCRF-U and UCRF-L). Three lines of evidence suggest a negativeregulatory role for the UCR in viral transcription: (i) an inverse correlation was found between MuLVtranscripts and nuclear proteins binding the UCR in the spleens of five different mouse strains; (ii) in vivotreatnient of NFS mice with lipopolysaccharide resulted in the induction of splenic viral transcripts and theconcomitant disappearance of UCR-binding proteins; and (ii) in mouse L cells transfected with an MuLV LTRlinked to the chloramphenicol acetyltransferase (CAT) gene, cotransfected UCR oligonucleotides increasedCAT expression, presumably by competing for inhibitory trans-acting factors.

Various cis-acting and trans-acting influences govern theexpression of retroviral sequences. Proviral expression hasbeen shown to be affected by chromosomal position (1) andthe state ofDNA methylation (10). The expression of murinetype C viruses is induced by lipopolysaccharide (LPS) (9, 25,29), and transactivation of the human immunodeficiencyvirus (HIV) is stimulated by lymphokines and by otherviruses (3, 6, 26, 33). These latter effects are mediated bytrans-acting factors that interact with retroviral long terminalrepeat (LTR) sequences. In recent years, attention has beenfocused on the enhancer region of LTRs and the proteinsthat bind to them. For instance, NFKB has been shown tobind the HIV enhancer and stimulate transcription (27). Inthe case of murine leukemia viruses (MuLVs), severaldistinct factors have been shown to bind in the enhancerregion (38, 39). Considerable progress has been made inunderstanding positive regulation of retroviral transcriptionmediated by enhancers (21). Negative control elements,while clearly existing, remain poorly defined. For example,the negative regulatory function of the HIV LTR has beenassigned to a 157-base-pair (bp) segment upstream of theHIV enhancer (35), but no trans-acting factor or precisebinding site has been reported.No transcriptional regulatory sequences have been previ-

ously reported upstream of the enhancer ofMuLV LTRs. Inthe experiments described in this paper, we have examineda highly conserved region upstream of the MuLV enhancer.To analyze this region, we have studied both expression ofendogenous MuLV retroviral sequences, some of which aredefective, and expression driven by LTRs from infectiousretroviruses. Our data show the existence of a negativeregulatory sequence in this region of the MuLV LTR.

MATERIALS AND METHODSDNA fragments. Segments used as probes or competitors

in gel shift assays were derived from the LTR sequence of

* Corresponding author.t Person to whom reprint requests should be addressed.

B-34, an endogenous MuLV-related DNA (15). B-34 DNAfragments included a 117-bp PstI-HaeIII segment (nucleo-tide positions 0 to 252) (15) and 30-bp double-strandedsynthetic oligomers Rl to R6, representing consecutive andnonoverlapping sequences extending from nucleotide posi-tions 0 to 180 (see Fig. 1). In addition, other 15- to 30-bpmutant oligomers (described in Results) were used whichcontained altered bases (truncated or substituted) with re-spect to Rl (nucleotide positions 0 to 30; see Fig. 1).Complementary oligomers were synthesized on an AppliedBioSystems DNA synthesizer (model 380B). Their puritywas checked by polyacrylamide gel electrophoresis analysis,and they were sequenced by the technique of Maxam andGilbert (24). Double-stranded oligomers were made by mix-ing 20 ,ug of each of two complementary oligomers in 50 p1l of10 mM Tris (pH 7.4)-i mM EDTA-500 mM NaCl. Thismixture was heated to 90°C for 5 min, was allowed to cool toroom temperature over 2 h, and was then diluted to a finalconcentration of 10 to 100 ng/,ul and 50 mM NaCl. In a nativeacrylamide gel, more than 90% of the radiolabeled annealedoligonucleotides ran as double-stranded DNA.CAT plasmids. Plasmid pLdCAT4.5 contains a chloram-

phenicol acetyltransferase (CAT) gene under control of thepromoter-enhancer region of the H-2Ld class I major histo-compatibility gene (37). The positive control region of thispromoter is referred to as the class I regulatory element(CRE) (16). pXenoCAT was constructed to place the CATgene under control of MuLV LTR regulatory sequences. Arecombinant M13 replicative form DNA containing the PstI-SmaI LTR segment of NFS-Th-1 xenotropic MuLV provirus(15) was digested with HindlIl and SmaI, and the insert wascloned into pUC9 DNA cleaved with Hindlll and HincII. ABglII-BamHI fragment containing the CAT gene was iso-lated from pCAT3M DNA (21) and was cloned into theBamHI site downstream of the MuLV LTR.

Concatenated oligomers. Complementary oligomers with5' overhangs were annealed and concatenated for use intransfection studies. These included:

739

740 FLANAGAN ET AL.

UCR: CTGCAGTAACGCCATTTTGCAAGGCATATTGCGGTAAAACGTTCCGTAGACGTC

(5' to 3')(3' to 5')

CRE: TCGGTGAGGTCAGGGGTGGGGAAGCCCAGGGCTGGGGATTCCCCATCACTCCAGTCCCCACCCCTTCGGGTCCCGACCCCTAAGGGGTAGAGCC

Complementary oligomers were annealed as describedabove. The double-stranded oligomers were then phosphor-ylated by adding ATP (Pharmacia, Inc., Piscataway, N.J.) toa concentration of 1 mM, T4 polynucleotide kinase (NewEngland BioLabs, Inc., Beverly, Mass.) to a concentrationof 0.1 U/Il, and MgCl2 to a concentration of 10 mM andincubating for 1 h at 37°C. The mixture was then cooled toroom temperature and was concatenated by incubating withT4 DNA ligase (13 U/RIl) for 30 min. The DNA was thenextracted with phenol-chloroform and was precipitated withethanol. The average size of molecules, estimated by acryl-amide gel migration, was about 1 kilobase. The concatenatedupstream conserved region (UCR) and CRE oligomers weredesignated poly-UCR and poly-CRE, respectively.Mouse strains. Mice 2 to 4 months of age were obtained

from the following sources: NFS mice, from FrederickCancer Research Facility, Frederick, Md.; BXSB mice,from A. Steinberg, the National Institute of Arthritis andMusculoskeletal and Skin Diseases, Bethesda, Md.; NZBand DBA/2J mice, from the National Institutes of HealthAnimal Production Facilities, Bethesda, Md.; and C57BL/6mice, from Jackson Laboratory, Bar Harbor, Maine. SomeNFS mice were injected intraperitoneally with 50 ,ug ofprotein-free Salmonella typhimurium LPS (generously pro-vided by D. Morrison, University of Kansas, Kansas City,Kans.) diluted in 0.1 ml of sterile phosphate-buffered saline.

Tissues and cell lines. Livers and spleens of differentmouse strains were used to prepare nuclear protein extractsand total cellular RNAs. Murine cell lines used in the studyincluded S194, a murine myeloma-derived secretory B-cellline (11, 12); PU5_1.8, a murine macrophage line (32); andLH8, a murine T-cell line derived from C57BL/6 mice (34). Ahuman B-lymphocyte line, BHM23 (23), was also used.Mouse L cells (17) were used in transfection studies.

Nuclear protein extracts. Nuclear extracts from cell lineswere made by the method of Dignam et al. (4). Tissueextracts were made by first homogenizing the tissue inDignam buffer A with 0.1% Triton X. The nuclei were thencentrifuged for 10 min and washed with buffer A. Thereafter,the nuclei were treated as described by Dignam et al. Theresult, a 0.42 M NaCl extract of nuclei, was dialyzed againsta buffer composed of 20 mM HEPES (N-2-hydroxyethylpi-perazine-N'-2-ethanesulfonic acid [pH 7.4])-100 mM KCl-0.2 mM EDTA-0.5 mM dithiothreitol-25% glycerol. Finalprotein concentrations of extracts ranged from 1 to 9 mg ofprotein per ml.

Gel mobility shift assay. DNA fragments were radiolabeledwith [Ot-32P]dCTP and DNA polymerase I. Double-strandedoligomers were end labeled with T4 polynucleotide kinaseand [_y-32P]ATP. The assay for binding factors used S x 103cpm of probe DNA, 2 ,ug of poly(dI) poly(dC) (Pharmacia),2 ,ug of nuclear extract protein, and in some cases 10 to 80 ngof double-stranded oligomer as a competitor, all in a buffer of20 mM Tris (pH 7.4)-50 mM KCl-1 mM MgCl2-0.2 mMEDTA-5% glycerol in a total volume of 30 ,ul. This mixturewas incubated for 30 min at room temperature before beingloaded on a 4% acrylamide gel (in a buffer of 12.5 mM Tris[pH 8.31-12.5 mM borate-0.5 mM EDTA) that had beenprerun at 200 V for 1 h. The gel was run for 90 min at 140 Vand was then dried and autoradiographed.

Methylation interference. A gel shift experiment was per-formed as described above by using DNA partially methyl-ated at G residues as described by Sen and Baltimore (36).DNAs from retarded and unretarded fractions were recov-ered separately and were cleaved at methylated G residueswith piperidine. The resulting products were then run on anacrylamide sequencing gel.DNA probes and Northern (RNA) blot analysis. MCFenv

DNA consisted of a 16-bp mink cell focus-forming (MCF)MuLV env-specific oligomer, located in the 5' env region ofMCF 247 MuLV DNA (14). The mouse beta 2 microglobulin(,B2M) probe was a 0.6-kilobase cDNA provided by F.Mushinski, National Institutes of Health. The glyceralde-hyde-3-phosphate dehydrogenase probe was a rat 1.3-kilo-base cDNA obtained from M. Piechaczyk (30). Probes werepurified by centrifugation through G-25 or G-50 Sephadexcolumns (5'-3' Inc., Philadelphia, Pa.). RNAs were preparedfrom guanidinium isothiocyanate-extracted tissues by themethod of CsCl density gradient centrifugation (2). ForNorthern blot analysis, 20 ,ug of total cellular RNAs was run

on 1% agarose gels and transferred to nitrocellulose. Hybrid-ization and washing conditions were as previously described(14). Briefly, for the MCFenv DNA probe, the filters wereprehybridized overnight at 45°C in 6x SSC (lx SSC is 0.15M NaCl plus 0.015 M sodium citrate) solution containing 50mM Tris (pH 8.0)-10% dextran sulfate-1% sodium dodecylsulfate (SDS)-1 mg of denatured yeast RNA per ml (typeX-S; Sigma Chemical Co., St. Louis, Mo.)-0.05% sodiumpyrophosphate. Hybridizations were done overnight at 45°Cby the addition of MCFenv oligomer end labeled with T4polynucleotide kinase and [_y-32P]ATP (>5,000 Ci/mmol;Amersham Corp., Arlington Heights, Ill.) at a final concen-tration of 3 x 106 cpm/ml of prehybridization mix. The filterswere washed at 45°C two times, 15 min each, in 6x SSCcontaining 0.05% sodium pyrophosphate-0.1% SDS andonce for 30 min at 45°C in 1 x SSC containing 0.025% sodiumpyrophosphate-1% SDS. Northern blot hybridizations withglyceraldehyde-3-phosphate dehydrogenase and P2M DNAprobes were performed by prehybridization at 42°C in 50%formamide-5x SSC-5x Denhardt solution-0.1% SDS andhybridization overnight at 42°C in 50% formamide-5 x SSPE(1 x SSPE is 180 mM NaCl, 10 mM NaH2PO4 [pH 7.4], and1 mM EDTA [pH 7.4]-lx Denhardt solution-10% dextransulfate-0.1% SDS-106 cpm of [32P]dCTP probe per ml,labeled with a random priming kit (Pharmacia). The filterswere washed once at room temperature and once at 55°C in2x SSC-0.1% SDS for 15 min and four times at 550C in 0.2xSSC-0.1% SDS for 15 min each. Filters were stripped ofprobes by being washed in 0.1 x SSPE-0.1% SDS at 70°C for20 to 30 min in an agitating water bath and confirmed byautoradiography.

Transfection and CAT assay. Murine L cells (5 x 105) weretransfected by the calcium phosphate precipitation method(8) with either 1 ,ug of pXenoCAT or 5 ,ug of pLdCAT4.5plasmid DNA and, when present, 2.5 ,ug of the appropriatecompetitor concatenated oligomer, as detailed in Results.We found carrier DNA to be unnecessary, so it was notused. Cells were harvested 48 h after transfection, andextracts were made by freeze-thaw cycles in 0.25 M Trisbuffer (pH 7.4). The CAT assay, which has previously been

(5' to 3')(3' to 5')

MOL. CELL. BIOL.

NEGATIVE REGULATORY SEQUENCES AT 5' ENDS OF MuLV LTRs 741

described in detail (7), was done as follows. In each case, 0.5,uCi of ['4C]chloramphenicol (50 mCi/mmol; New EnglandNuclear Corp., Boston, Mass.), 180 ng of acetyl coenzyme A(Calbiochem-Behring, La Jolla, Calif.), and 50 jig of extractprotein in 150 RI of 0.25 M Tris (pH 7.4) were incubated for1 h at 37°C. The substrate and products were extracted withethyl acetate, chromatographed on thin-layer chromatogra-phy plates (J. T. Baker Chemical Co., Phillipsburg, N.J.) in95% chloroform-5% methanol, and quantitated by scintilla-tion counting after acetylated atnd unacetylated forms werelocalized with autoradiography. The fraction of total radio-activity in the acetylated product was taken as the measureof CAT activity.

RESULTS

Previous studies have established the functional proper-ties of the MuLV enhancer (21) and have identified themotifs within this sequence that represent binding sites forspecific nuclear proteins (38). In the present work, we havefocused on a sequence near the 5' end of the MuLV LTRwhich is highly conserved among various retroviruses butwhose function had not previously been studied. The posi-tion of this upstream conserved region (UCR) with respect toother regulatory sequences in the LTR of endogenous B34MuLV DNA (15) is shown in Fig. 1 (top panel).

Nuclear proteins binding to UCR. To probe for factorsbinding to UCR, we used a PstI-HaeIII DNA fragment (Fig.1) as a radiolabeled probe in the gel mobility shift analysis(Fig. 1A). The first lane shows the probe without nuclearextract, and the second lane shows the probe with nuclearextract from spleens of NFS mice. In the latter case, a lowermajor gel-retarded band (L) and an upper minor band (U)were seen. The specificity of the binding represented bybands L and U was determined by competition assays shownin the subsequent six lanes. The competitors were 30-bpdouble-stranded oligonucleotides Ri to R6, representingsuccessive nonoverlapping portions of the B34 LTR begin-ning at the PstI site. The results show that bands U and Lwere eliminated by competition with the first 30 bp (Ri) andnot by other regions of the probe fragment (R2 to R4).Furthermore, sequences residing in the enhancer region (R5and R6) did not compete for the binding. The same resultswere obtained with competitor concentrations ranging from10 to 240 ng of competitor per assay (data not shown). BandsU and L thus represent specific binding to a sequence in Ri.To confirm the specific binding of nuclear factors to Ri, thisoligomer was used as a radiolabeled probe in a gel mobilityexperiment (Fig. 1B). The results indicated competition onlyby cold Ri and not by cold R3. The factors binding to Riresulting in bands U and L were designated UCRF-U andUCRF-L, respectively, and their binding sites were desig-nated UCR-U and UCR-L, respectively. No binding ofnuclear factors was seen when radiolabeled R2 and R4 wereused as probes (data not shown). R3 demonstrated se-quence-specific binding of a nuclear factor; however, thebinding involved sequences of R3 peculiar to endogenousMuLV DNAs and not found in infectious MuLVs. Theseresults will be presented elsewhere (J. R. Flanagan andA. S. Khan, manuscript in preparation).UCR binding sites. The binding site UCR-L was deter-

mined by using NFS spleen nuclear extract in which thisfactor is predominant. UCR-L boundaries were defined bycompetition assays in which a radiolabeled PstI-HaeIIIfragment was used as a probe and a series of oligomers,shortened successively by 3-bp increments from the right or

Pst] -Ae.i H :)a

I"a

1rU 77E%H. !.\~

Ir.

Buyll1 Taol S r.'a

C T

I I -'CCAAC TATA

MURI P3L"Pi ;:IR R3 .P. ; i

NucleotidePosition 3 30 i-, Ci SL

A B

u --

L

CozetI - - 61Rl R 3 R4 PS R6 -- - R1R3

'PP D A Psil Ha,ll R

FIG. 1. Endogenous MuLV LTR fragments used in the studyand UCR nuclear binding activities. A schematic of structuralfeatures of the endogenous MuLV-related B34 LTR (15) is shown.The locations of the UCR, endogenous MuLV-specific features (15)including the 190-bp insert (INS) and 14-bp direct repeats (DR), andputative enhancer (ENH), CCAAC, and TATA sequences areindicated. The region containing the UCR and ENH is enlarged toshow the locations of oligomers Ri to R6. Previously describedMoloney MuLV protein-binding sites (38) which are conserved inB34 LTR are indicated in the enhancer. Gel mobility shift assayswere carried out with a 32P-labeled Pstl-HaeIII fragment (A) and Rioligomer (B) as probes and NFS spleen nuclear extract, withdouble-stranded oligomers (RI to R6) added (80 ng) as competitors.The presence (+) or absence (-) of extract and competitor isindicated. The first lanes of both panels A and B show the mobilityof the probe without extract, the second lanes show binding ofnuclear factors to the probe resulting in retarded UCRFs L and U,and the remaining lanes show the effect of competitors on thebinding of UCRF-L and UCRF-U.

left terminus of Ri, were used as competitors. The datashown in Fig. 2A (lanes 1 to 7) define the left- and right-handboundaries of the binding sequence to a precision of 3 bases.UCR-L was further mapped by using five mutated compet-itors. The results with these competitors corroborated thosewith the truncated competitors, in that substitutions outsidethe presumptive binding site did not prevent binding (e.g.,the oligonucleotides of lanes 9 and 10 were effective com-petitors), whereas some substitutions within the presump-tive site (cf. lane 11) prevented competitive binding. Theoligonucleotide of lane 12 was synthesized to determinewhether two substitutions that altered the MuLV sequencein the region of the UCR binding sites so as to match thesequence of the gibbon ape leukemia virus (GaLV) LTR (seebelow) would affect binding of UCRF-L; despite the altera-tion of one nucleotide within the UCR-L site, this oligonu-cleotide still competed effectively for UCRF-L binding.Another competitor was synthesized to represent the se-quence from the HIV LTR that is most similar to the UCR,a sequence that is located in the HIV negative regulatoryelement; this oligonucleotide, which includes three substitu-

VOL. 9, 1989

742 FLANAGAN ET AL.

A B

*010..n

.......UCR-_

FIG. 2. Mapping of UCR-L binding site. (A) Gel mobility shift assays with the PstI-HaeIII fragment as a radiolabeled probe and NFSspleen nuclear extract are shown. The bottom of the gel is located at the left. Competitor oligomers added to lanes 2 to 12 are indicated. Thesubstitutions within the binding site in the oligomer in lane 12 are taken from the corresponding sequence of the GaLV LTR, whereas outsidethe binding site, the bases remain identical to those of the MuLV sequence. Results of the competition assays are indicated on the right (+,competitive binding; -, no binding). The UCR-L sequence is shown; the maximum sequence involved in UCRF-L binding is underlined, andthe minimum sequence is boxed. (B) Methylation interference assay. Results for the unretarded band (left lane) and for the retarded band(right lane) are shown. Residues demonstrating interference (+) or partial interference (+/-) are indicated on the right.

tions within the UCR-L binding site, did not compete forUCRF-L binding (lane 8).The UCR-L binding site was further confirmed by a

methylation interference assay. The PstI-HaeIII fragmentwas radiolabeled at the 3' end of the noncoding strand andwas partially methylated. This fragment was used as probe ina gel shift assay; the DNA from unretarded and retardedfractions was recovered and cleaved with piperidine asdescribed previously (36). The results are shown in Fig. 2B.Methylation interference (indicated by a plus sign) was seenfor three G residues (C residues on the coding strand) in theretarded (right lane) fraction, compared with the unretarded(left lane) fraction. These nucleotides are present within theUCR-L binding site as determined by the competition exper-iments. No methylation interference was observed at the Gresidue of the coding strand (data not shown), suggestingthat close protein-DNA contact at this residue is not neces-sary for binding. This inference is consistent with the factthat substitution of this G does not prevent UCRF-L bindingas measured in the competition assay (Fig. 2A, lane 12).NFS spleen and liver nuclear extracts could not be used to

identify UCR-U because of low levels of activity of UCRF-U(Fig. 3). Murine cell lines, on the other hand, contained highlevels of UCRF-U. A novel band designated UCRF-I wasseen in one nuclear extract preparation from line S194(designated S194a) but was not found consistently in extractsmade from this cell line at a later date (S194b). The S194nuclear extract was used for determining UCR-U with thesame oligomers as described for Fig. 2A as competitors. Theresults (Fig. 4A) indicate that the UCR-U binding site has thesame left boundary as UCR-L; the UCR-U right boundaryextends further 3' (lanes 7 and 8, band U versus band L).The competition pattern with truncated oligomers was thesame for UCRF-U and UCRF-I, indicating similar bindingsites. A methylation interference assay for UCRF-U binding

was carried out as described for UCRF-L. The results (Fig.4B) show that only two of the three C residues present in theUCR-U site demonstrate interference for binding of UCRF-U. These results confirm that UCR-L and UCR-U bindingsites are overlapping but distinct.

Conservation of the UCR and its nuclear factors (UCRFs).A comparison of the UCR with other retroviral LTR se-

MURINE

TISSUES CELL LINES

- EINI'-::,

L-m

Et z x_ 00 0LUJ LUJ I_> LLu-J U ) (I tD

U)X

FIG. 3. Gel mobility shift assays of murine tissues versus celllines. 32P-PstI-HaeIII DNA was used as a probe to analyze nuclearextracts of NFS livers and spleens and murine cell lines S194,PU5_1.8, and LH8 (described in Materials and Methods). Analysisof two preparations of S194 nuclear extracts (S194a and S194b) areincluded. Three gel-retarded species (L, I, and U) which bound tothe UCR were seen.

MOL. CELL. BIOL.

NEGATIVE REGULATORY SEQUENCES AT 5' ENDS OF MuLV LTRs 743

A

Competitors

S194a

2

6

8ILIg

cAG'AACCCAAeG -%A AGC A na- A UCR-LU

S194b a-

I,-

2_..

;G--G A C -A-- C- -CC _-Ci - -

__----

A------ ----- GaLV-

FIG. 4. (A) Mapping of UCR-U. Nuclear extract from cell line S194 was used to map the binding site of UCRF-U. The results of gelmobility shift assays using a PstI-HaeIII DNA probe in the presence of various competitor oligomers are shown. S194a (lanes 1 to 8) andS194b (lanes 9 to 13) extracts were used. The format and symbols are the same as for Fig. 2A. The maximum binding sequence is underlined,and the minimum sequence is boxed. (B) Results of methylation interference assays. Results for the unretarded band (left lane) and for theretarded band (right lane) are shown. Residues demonstrating interference are indicated on the right, as described in the legend to Fig. 2B.

quences is presented in Fig. 5. Amongcomplete identity was seen within the 9-site. Sequences similar to the UCR w

analogous regions of GaLV (8-of-9-bp

U

MuLV B34 endog OCTGCAGTAA

814 endog 0

B73 endog 0

B56 endog 0

B77 endog 0

AKR MCF247 674

NFS xeno 0

AKR eco 7880

Mo eco 36 TA

GaLV SEATO 30

FeLV ST 1810 T

HIV BRU 8864GGAG

kCGCCATTTT(l

:::

.I -I

C ,

C

.1-

|- A -l

.IT A

FIG. 5. Comparative nucleotide sequence -

endogenous B34 MuLV UCR sequence is indicMuLV LTR sequences are included for compaof endogenous MuLV DNAs B14, B73, B56MCF247 (13), NFS xenotropic (15), AKR ecotrecotropic (41) MuLV proviruses; and the LTI(40), feline leukemia virus (FeLV) (28), and Hnucleotide identity; different nucleotides are slUCRF-L and UCRF-U are indicated at thepositions of the first and last bases presented ato the numbering schemes of the correspondin

the MuLV LTRs, leukemia virus (6-of-9-bp match). No exact match was found*bp UCR-U binding among human retroviral LTR sequences. The most closelyere also present in related sequence in the HIV LTR was a 6-of-9-bp matchmatch) and feline located between -261 and -253 (from the transcription

initiation site), falling within the negative regulatory ele-ment. The oligomer representing the GaLV sequence com-

peted efficiently for UCRF-L binding, whereas the HIVGCAAGGCATGAA30 oligomer did not (Fig. 3A).

Nuclear extract from the human B-cell line BHM23 con-30 tained a factor that bound to the MuLV UCR. The specificity

of this factor with respect to competition by oligomers was30 identical to that of murine UCRF-U (data not shown).30 Functional analysis of UCRF in tissues. Several laboratory

mouse strains have been shown to differ in their expression........ 0 of MuLV-related retroviral sequences (19, 20, 22). To deter-

mine whether expression correlated with UCRF activity, we- .70 analyzed endogenous MuLV RNA expression and UCRF-

.30 binding activity in the spleens of five mouse strains. MuLV

env-specific DNA probes were used in Northern analyses toG G 78 study the expression of RNAs of various MuLV classes. The

mice expressed various levels of endogenous MCF- and.G 65 xenotropic-related transcripts. Gel mobility shift assays for

T CACCC59 UCRF and the Northern blots with the MCFenv probe for

each of the five strains of mice are shown in Fig. 6A. TheA G 1839 results show an inverse relationship between expression of

MuLV RNAs and the presence of UCRF-L activity. That is,T T C A C C C T G 8892 NFS mice had a low level of expression but a high level of

analysis of UCR. The UCRF-L activity, whereas in the NZB, C57BL/6, DBA/2,cated at the top. Other and BXSB mouse strains, expression was high and UCRF-Larison, including those activity was low (NZB mice) or absent. An inverse correla-i, and B77 (15); AKR tion was also seen between expression of xenotropiclikeropic (5), and Moloney RNAs and UCRF-L activity (data not shown). No ecotropic

IV (43). Dots indicate MuLV RNAs were detected in these mouse strains (data not

hown. Binding sites of shown).

top. The nucleotide We have recently found that LPS induces a high level ofIre indicated according expression of MCF-related RNAs in NFS mice (18). In Fig.ig references. 6B, we show the relationship between LPS-induced expres-

B

C

AG

C

VOL. 9, 1989

Co-nDettior

.I.....

.1-- ---1

744 FLANAGAN ET AL.

A

MURINE SPLEENS

B

NFS SPLEENS

GEL SHIFTASSAYS

C rs X

Z L- co Z

NORTHERNBLOTS

Fr 8.4 _7.2 -.---

3.2-

Kb)

L---

Kb4 _

=.2 _

7.

3 9_-

'Kb

72MlCAPDH i O9FIG. 6. UCRF activity inversely correlates with RNA expres-

sion. (A) Gel mobility shift assays using the PstI-HaeIII fragment asprobe and nuclear extracts from spleens of five mouse strains.Northern blot analysis of total RNAs isolated from spleens of thesame mouse strains is also shown. The probe used in the latter studywas MCFenv (described in Materials and Methods). (B) Gel mobilityand Northern analyses of spleens from NFS mice injected with LPS.Mice were injected intraperitoneally with LPS and killed at 2 or 24h poststimulation. Control mice were sham-injected with saline.Similar amounts of RNAs were present in each lane (except forC57BL/6 mice) as determined by hybridizing stripped filters withP2M (A) and glyceraldehyde-3-phosphate dehydrogenase (B) DNAprobes. These results were confirmed in a duplicate experiment. U,UCRF-U; L, UCRF-L.

sion of MCF env-related RNAs and UCRF-L activity.Again, an inverse relationship is seen: a decrease in UCRF-L parallels an increase in expression of MCF RNAs.Nuclear extracts which lacked UCRF activity were found

to have binding activity to other regulatory motifs, showingthat they were not defective extracts: for example, a PvuIIfragment containing the enhancer element of MoloneyMuLV LTR was bound to an equal extent by both NFS andBXSB extracts (data not shown).

Functional analysis in cell culture. The observed correla-tion between nuclear protein binding at the UCR and lowRNA transcription suggested that the protein-UCR interac-tion might inhibit LTR-induced transcription. To investigatethis model, we tested whether LTR-driven transcription of atransfected CAT gene could be affected by cotransfectionwith UCR-containing oligonucleotides; if protein-UCR inter-action inhibits maximal activation by the LTR, then theUCR oligonucleotides might be expected to compete for thebinding proteins and relieve some of the transcriptionalinhibition. When the MuLV LTR-CAT plasmid pXenoCATwas transfected into mouse L cells along with concatenatedUCR oligonucleotides in a transient assay (see Materials andMethods), the poly-UCR increased the CAT expression by

TABLE 1. Competition transfection studies

CAT expression with competitor oligomeraDNA Expt

No competitor Poly-CRE Poly-UCR

pXenoCAT 1 0.030 0.080 0.1462 0.067 0.100 0.1673 0.078 0.054 0.1724 0.070 0.1305 0.175

Avg 0.060 0.078 0.158Ratio 1.0 1.3 2.63

pLdCAT4.5 1 0.111 0.058 0.0902 0.110 0.080 0.160

Avg 0.111 0.062 0.130Ratio 1.0 0.6 1.17

a Values are the fractions of total chloramphenicol that were acetylated asdescribed in Materials and Methods.

about 2.6-fold (Table 1). The specificity of this effect wasindicated by control experiments. The poly-UCR had nosignificant effect on expression of pLdCAT4.5, a plasmid inwhich the CAT gene is linked to the CRE from the promoter-enhancer of the H-2Ld gene. In contrast, the control poly-CRE inhibited expression of the pLdCAT4.5 plasmid (con-sistent with the positive regulatory effects of the CRE), buthad no significant effect on the pXenoCAT plasmid.

DISCUSSION

Transcription of retroviral genes is regulated by the LTR(42). Previous studies have identified positive regulatoryelements in the LTR, including enhancer, CAT box, andTATA sequences. Among retroviruses, a negative regula-tory region has been identified only in HIV LTRs, althoughthe exact sequences and trans-acting proteins involved in itsrepression are yet unknown. In this study, we have identifieda negative regulatory sequence located at the 5' end of allknown MuLV-related LTRs. In murine nuclear extracts, theUCR sequence bound at least two factors detected by gelmobility shift assay: UCRF-L, predominant in tissues, andUCRF-U, predominant in cell lines. Competition and meth-ylation interference studies showed that these two factorshave overlapping but distinct binding sites.A factor binding to the murine UCR site was also found in

a human cell line; however, no exact match to the 9-bp UCRsequence was found in known human retrovirus sequences.A 6-of-9-bp match was found in the HIV LTR. Interestingly,this sequence (-261 to -253) falls within the negativeregulatory element (-340 to -185) (35). A 30-bp oligomercontaining this 9-bp sequence from the HIV LTR, however,did not compete for binding to the human or mouse UCRFproteins; nevertheless, its similarity to the UCR sequenceand its occurrence in a region of negative regulatory functionupstream of the enhancer raise the possibility that this HIVsequence (-261 to -253) may be the target of a relatedtrans-acting factor.The occurrence of negative regulatory sequences up-

stream of the enhancer in both MuLV and HIV is of interest.Such sequences might participate in the maintenance of thequiescent state of integrated proviruses by a mechanismanalogous to the binding of the lambda repressor to itsoperator (31). We noted that infectious MuLVs also con-

MOL. CELL. BIOL.

NEGATIVE REGULATORY SEQUENCES AT 5' ENDS OF MuLV LTRs 745

tained UCR sequences in their LTR regions. The role ofnegative regulatory sequences in such replication-competentviruses might be a conditional down-modulation of expres-sion, active only under certain circumstances. That is, incells containing replicating viruses, the UCR-binding pro-teins might be at reduced levels or might be prevented fromtransmitting the negative signal by other influences, such asthe binding of other proteins directly to the UCR or displace-ment of the UCRF proteins by factors binding to nearbysequence motifs. The replication of viruses in the presenceof UCR sequences thus indicates that strong positive regu-latory influences can override the negative regulatory func-tion of the UCR. Further research will elucidate the physi-ological role and mechanism of repression mediated by theUCR.

ACKNOWLEDGMENTS

We thank Keiko Ozato, Peter Burke, and John Casik for theirgenerous sharing of materials and cell lines, Theodore Theodore forproviding the pXenoCAT DNA, and Alfred Steinberg for supplyingmouse strains. We are also grateful to Alicia Buckler-White forsynthesizing the oligomers and Charles Buckler for computer anal-ysis. We thank Carol Cronin and Brenda Marshall for editorialassistance.

LITERATURE CITED1. Barklis, E., R. C. Mulligan, and R. Jaenisch. 1986. Chromo-

somal position or virus mutation permits retrovirus expressionin embryonal carcinoma cells. Cell 47:391-399.

2. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J.Rutter. 1982. Isolation of biologically active ribonucleic acidfrom sources enriched in ribonuclease. Biochemistry 18:5292-5299.

3. Cullen, B. R. 1986. Transactivation of the human immunodefi-ciency virus occurs via a bimodal mechanism. Cell 46:973-982.

4. Dignam, J. D., P. L. Martin, B. S. Shasty, and R. G. Roeder.1983. Eukaryotic gene transcription with purified components.Methods Enzymol. 101:582-599.

5. Etzerodt, M., T. Mikkelsen, F. S. Pedersen, N. 0. Kjeldgaard,and P. Jorgensen. 1984. The nucleotide sequence of the AKVmurine leukemia virus genome. Virology 134:196-207.

6. Gendelman, H. E., W. Phelps, L. Feigenbaum, J. M. Ostrove, A.Adachi, P. M. Howley, G. Khoury, H. S. Ginsberg, and M. A.Martin. 1986. Transactivation of the human immunodeficiencyvirus long terminal repeat sequence by DNA viruses. Proc.Natl. Acad. Sci. USA 83:9759-9763.

7. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

8. Graham, F., and A. van der Eb. 1973. A new technique for theassay of infectivity of human adenovirus 5 DNA. Virology52:456-457.

9. Greenberger, J. S., S. M. Phillips, J. R. Stephenson, and S. A.Aaronson. 1975. Induction of mouse type C RNA by lipopoly-saccharide. J. Immunol. 115:317-320.

10. Harbers, K., A. Schnike, H. Stuhlmann, D. Jahner, and R.Jaenisch. 1981. DNA methylation and gene expression: endog-enous retroviral genome becomes infectious after molecularcloning. Proc. Natl. Acad. Sci. USA 78:7609-7613.

11. Horibata, K., and A. W. Harris. 1970. Mouse myelomas andlymphomas in culture. Exp. Cell Res. 60:61-77.

12. Hyman, R., P. Ralph, and S. Sankar. 1972. Cell specific antigensand immunoglobulin synthesis of murine myeloma cells andtheir variants. J. Natl. Cancer Inst. 48:173-184.

13. Kelly, M., C. A. Holland, M. L. Lung, S. K. Chattopadhyay,D. R. Lowy, and N. H. Hopkins. 1983. Nucleotide sequence ofthe 3' end of MCF 247 murine leukemia virus. J. Virol.45:291-298.

14. Khan, A. S., F. Laigret, and C. P. Rodi. 1987. Expression ofmink cell focus-forming murine leukemia virus-related tran-

scripts in AKR mice. J. Virol. 61:876-882.15. Khan, A. S., and M. A. Martin. 1983. Endogenous murine

leukemia proviral long terminal repeats contain a unique 190base pair insert. Proc. Natl. Acad. Sci. USA 80:2699-2703.

16. Kimura, A., A. Israel, 0. LeBail, and P. Kourilsky. 1985.Detailed analysis of the mouse H-2Kb promoter: enhancer-likesequences and their role in the regulation of class I geneexpression. Cell 44:261-272.

17. Kit, S., D. R. Dubbs, L. J. Piekarski, and T. C. Hsu. 1963.Deletion of thymidine kinase activity from L cells resistant tobromodeoxyuridine. Exp. Cell Res. 31:297-312.

18. Krieg, A. M., A. S. Khan, and A. D. Steinberg. 1988. Multipleendogenous xenotropic and mink cell focus-forming murineleukemia virus-related transcripts are induced by polyclonalimmune activators. J. Virol. 62:3545-3550.

19. Krieg, A. M., A. D. Steinberg, and A. S. Khan. 1988. Increasedexpression of novel full-length endogenous mink cell focus-forming-related transcripts in autoimmune strains. Virology162:274-276.

20. Laigret, F., R. Repaske, K. Boulukos, A. B. Rabson, and A. S.Khan. 1988. Potential progenitor sequences of mink cell focus-forming (MCF) murine leukemia viruses: ecotropic, xenotropic,and MCF-related viral RNAs are detected concurrently inthymus tissues of AKR mice. J. Virol. 62:376-386.

21. Laimins, L. A., P. Gruss, R. Pozzati, and G. Khoury. 1984.Characterization of enhancer elements in the long terminalrepeat of Moloney murine sarcoma virus. J. Virol. 49:183-189.

22. Levy, D. E., R. A. Lerner, and M. C. Wilson. 1985. The Gv-1locus coordinately regulates the expression of multiple endoge-nous murine retroviruses. Cell 41:289-299.

23. Max, E. E., and S. J. Korsmeyer. 1985. Human J chain gene.Structure and expression in B lymphoid cells. J. Exp. Med.161:832-849.

24. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

25. Moroni, C., and G. Schumann. 1975. Lipopolysaccharide in-duces C-type virus in short term cultures of BALB/c spleencells. Nature (London) 254:60-61.

26. Mosca, J. D., D. P. Bednarik, N. B. K. Raj, C. A. Rosen, J. G.Sodroski, W. A. Haseltine, and P. M. Pitha. 1987. Herpes sim-plex virus type I can reactivate transcription of latent humanimmunodeficiency virus. Nature (London) 325:67-70.

27. Nabel, G., and D. Baltimore. 1987. An inducible transcriptionfactor activates expression of human immunodeficiency virus inT cells. Nature (London) 326:711-713.

28. Nunberg, J. H., M. E. Williams, and M. A. Innis. 1984.Nucleotide sequences of the envelope genes of two isolates offeline leukemia virus subgroup B. J. Virol. 49:629-632.

29. Phillips, S. M., J. R. Stephenson, and S. A. Harrison. 1977.Genetic factors influencing mouse type C RNA virus inductionby naturally occurring B cell mitogens. J. Immunol. 118:662-666.

30. Piechaczyk, M., J. M. Blanchard, L. Marty, C. Dani, F. Pana-bieres, S. El Sabouty, P. Fort, and P. Jeanteur. 1984. Post-transcriptional regulation of glyceraldehyde-3-phosphate dehy-drogenase gene expression in rat tissues. Nucleic Acids Res.12:6951-963.

31. Ptashne, M. 1986. A genetic switch. Cell Press and BlackwellScientific Publications, San Francisco.

32. Ralph, P., M. A. Moore, and K. Nilsson. 1976. Lysozymesynthesis by established human and murine histiocytic lym-phoma cell lines. J. Exp. Med. 143:1528-1533.

33. Rando, R. F., P. E. Pellet, P. A. Luciw, C. A. Bohan, and A.Srinivasin. 1987. Transactivation of HIV by herpesvirus. Onco-gene 1:13-18.

34. Ricciardi-Castagnoli, P., F. Rabbiati, E. Barbardi, G. Doria, andL. Adorini. 1982. Establishment of functional, antigen specific Tcell lines by RadLV induced transformation of murine T lym-phocytes. Curr. Top. Microbiol. Immunol. 100:89-96.

35. Rosen, C. A., J. G. Sodroski, and W. A. Haseltine. 1985. Thelocation of cis-acting regulatory sequences in the human T celllymphotropic virus type III (HTLV-III/LAV) long terminal

VOL. 9, 1989

MOL. CELL. BIOL.

repeat. Cell 41:813-823.36. Sen, R., and D. Baltimore. 1986. Inducibility of kappa immuno-

globulin enhancer binding protein NFKB by a post translationalmechanism. Cell 47:921-928.

37. Silverman, T., A. Rein, B. Orrison, J. Langloss, G. Bratthauer,J. Miyazaki, and K. Ozato. 1988. Establishment of cell linesfrom somite stage mouse embryos and expression of majorhistocompatibility class I genes in these cells. J. Immunol.140:4378-4387.

38. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclearfactors interact with the 75-base-pair repeat of the Moloneymurine leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110.

39. Thornell, A., B. Hallberg, and T. Grundstrom. 1988. Differentialprotein binding in lymphocytes to a sequence in the enhancer of

the mouse retrovirus SL3-3. Mol. Cell. Biol. 8:1625-1637.40. Trainor, C. D., M. L. Scott, S. F. Josephs, K. E. Fry, and M. S.

Reitz. 1984. Nucleotide sequence of the large terminal repeat oftwo different strains of gibbon ape leukemia viruses. Virology137:201-205.

41. Van Beveren, C., E. Rands, S. K. Chattopadhyay, D. R. Lowy,and I. M. Verma. 1982. Long terminal repeat of murine retro-viral DNAs: sequence analysis, host-proviral junctions, andpreintegration site. J. Virol. 41:542-556.

42. Varmus, H. E. 1982. Form and function of retroviral proviruses.Science 216:812-820.

43. Wain-Hobson, S., P. Sonigo, 0. Danos, S. Cole, and M. Alizon.1985. Nucleic acid sequence of the AIDS virus, LAV. Cell40:9-17.

746 FLANAGAN ET AL.