LOHITH PATURU - COnnecting REpositories · 2019. 5. 4. · LOHITH PATURU Growth and gas-phase...
Transcript of LOHITH PATURU - COnnecting REpositories · 2019. 5. 4. · LOHITH PATURU Growth and gas-phase...
LOHITH PATURU
Growth and gas-phase dependent transcription analysis of
fermentation pathway in Caloramator celer
MASTER OF SCIENCE THESIS
Subject approved by Department Council On 4th April, 2012 Examiners: Professor Matti Karp Ph.D. Alessandro Ciranna
ii
ABSTRACT TAMPERE UNIVERSITY OF TECHNOLOGY
Master’s Degree Program in Science and Bioengineering
PATURU, LOHITH: Growth and gas-phase dependent transcription analysis of
fermentation pathway in Caloramator celer.
Master of Science Thesis, 58 pages, 5 appendix pages
March 2015
Major: Biotechnology
Examiners: Professor Matti Karp, Ph.D. Alessandro Ciranna
Keywords: Hydrogen, gene expression, Hydrogenase, RT-PCR, transcription
Caloramator celer strain JW/YL-NZ35, formerly known as Thermobrachium celere is a
unique alkalithermophilic organism that has the potential to solve energy problems in
the future because of its hydrogen production mechanism. However in order to use this
organism in industrial scale, more intrinsic understanding of the genetic and metabolic
functioning of the organism is needed. The aim of this work is to undertake a
transcriptional analysis of the growth and gas phase dependant fermentation pathway in
this organism. This is done in order to better understand the genetic factors involved in
hydrogen production and to monitor the pattern of gene expression in different
physiological states of the cell. This transcription analysis was done using a Real time
quantitative PCR that uses a fluorescence molecule for real time detection. This is a
very sensitive process that gives reliable results. Two different housekeeping genes recA
and polC were used as normalizing factors in order to calculate the relative gene
expression and 2-ΔΔC
T method was used for this purpose. Through this analysis, the
interdependence of formate, acetate and ethanol pathways with each other, and their
combined effects on hydrogen production was studied. It was seen that formate and
ethanol pathway is in direct competition with both the hydrogenases. Downregulation of
hydrogenase genes because of ethanol and formate pathways was seen. It was also
found that the cultures grown in artificially stressed gas phase media had a widespread
downregultaion of its genes. The soluble metabolite was measured and it was correlated
with the transcription data. Decrease of pH and increase of hydrogen partial pressure
were the leading cause for the downregulation of mbhL and hydA hydrogenase genes.
Increase in hydrogen partial pressure also led to increased ethanol production and adhE
gene upregulation.
iii
PREFACE This thesis work has been conducted by Department of Chemistry and Bioengineering
of Tampere University of Technology, Tampere, Finland.
Past four years has been one of the best periods in my life. The calmness of Finnish
atmosphere helped me greatly in my study. So, I cannot start without thanking Tampere
University of Technology and Finnish education system for providing a place of study
without any Tuition fees. I will always remember the high quality educational
environment and flexibility offered in course structure. Secondly, I would like to thank
my Professor Matti Karp for providing me with the opportunity for thesis work in his
lab and for his constant encouragement and support in my academic endeavors. And
finally I am very grateful to my supervisor Alessandro Ciranna for his continued
guidance in experiments, patient teaching, result analysis and thesis writing.
I dedicate this work to my parents, who have always been a strong pillar of moral and
emotional support in completing my thesis.
Tampere,
Lohith Paturu
iv
TABLE OF CONTENTS
ABSTRACT ...................................................................................................................... ii
PREFACE ........................................................................................................................ iii
LIST OF TERMS AND ABBREVIATIONS ................................................................... v
1. INTRODUCTION .................................................................................................... 1
2. Theoritical background ............................................................................................. 4
Caloramator celer ............................................................................................. 4 2.1
2.1.1 A brief description of C. celer ............................................................. 4
2.1.2 Genetic analysis of C. celer ................................................................. 5
2.1.3 Metabolic pathway of C. celer ............................................................. 5
Overview of transcription ............................................................................... 11 2.2
Transcriptional analysis .................................................................................. 13 2.3
2.3.1 Real time PCR ................................................................................... 13
2.3.2 Reverse transcription PCR ................................................................. 15
2.3.3 Limiting factors to transcriptional analysis ....................................... 16
Housekeeping genes as normalization factor .................................................. 17 2.4
2.4.1 polC (DNA polymerase III gene) as housekeeping gene .................. 18
2.4.2 recA as housekeeping gene ................................................................ 21
2-ΔΔC
T method of normalization ...................................................................... 22 2.5
3. Materials and methods ............................................................................................ 25
Materials Used ................................................................................................ 25 3.1
Medium and culture ........................................................................................ 25 3.2
Primer preparation ........................................................................................... 26 3.3
3.3.1 Optimal annealing temperature and primer efficiency ...................... 28
RNA extraction ............................................................................................... 28 3.4
Preparation for RT PCR and qPCR ................................................................. 29 3.5
4. RESULTS ............................................................................................................... 30
Primer efficiency and optimum annealing temperature .................................. 30 4.1
RT PCR from total RNA ................................................................................. 31 4.2
Growth plot of C. celer for both growth and gas phase experiment ............... 31 4.3
Relative gene expression in growth phase experiment of C. celer ................. 33 4.4
Product distribution in growth phase experiment of C. celer ......................... 36 4.5
Relative gene expression in gas phase experiment of C. celer ....................... 38 4.6
Product distribution in gas phase experiment of C. celer ............................... 41 4.7
5. Discussion ............................................................................................................... 44
Statistical significance of the results ............................................................... 44 5.1
Growth dependent transcriptional analysis of fermentative pathway ............. 45 5.2
Gas dependent transcriptional analysis of fermentative pathway ................... 46 5.3
6. conclusion ............................................................................................................... 49
References ....................................................................................................................... 50
v
LIST OF TERMS AND ABBREVIATIONS
dNTP deoxyribonucleotide
DNA Deoxyribonucleic acid
RNA Ribonucleic acid
ssDNA Single stranded DNA
dsDNA Double stranded DNA
kDa Kilodalton
FTIR Fourier transform infrared spectroscopy
mRNA Messenger RNA
PCR Polymerase chain reaction
qPCR Quantitative polymerase chain reaction
RT PCR Reverse transcription polymerase chain reaction
cDNA Complementary DNA
UV Ultra violet
ATP Adenosine triphosphate
ADP Adenosine diphosphate
PFL Pyruvate formate lyase
PFLae Pyruvate formate lyase activating enzyme
FNOR NADH:ferredoxin oxidoreductase
ADH Alcohol dehydrogenase
ACK Acetate kinase
CoA Coenzyme A
PTA Phosphotransacetylase
PFOR Pyruvate oxidoreductase
Fd H2ase Ferredoxin-dependent NiFe hydrogenase
NADH H2ase NADH-dependent FeFe hydrogenase
O.D Optical density
GC Gas chromatography
HPLC High performance liquid chromatography
INTRODUCTION 1
1. INTRODUCTION
Regulation of a gene is of prime importance to all organisms. Our understanding of
genetics has indeed come a long way since the Darwinian era. At that time when the
idea of gene was still not conceived, scientists held to the notion that traits were passed
on from parents to off springs in an entirely random manner by an unexplained
mechanism. Then it was Gregor Johann Mendel who laid the foundation for modern
genetics. His laws of inheritance gave a mathematical background for the hereditary
phenomenon. Though he was not able to apply his laws to all systems, they were only a
start. In the year 1902 Theodor Boveri and Walter Sutton in accordance with Mendelian
laws proposed that chromosomes were responsible for carrying hereditary information
in life forms [1, 2].
It was through Avery–MacLeod–McCarty experiment that was conducted in
1944 that proved that DNA was that genetic material [3]. Subsequently the double
helical structure of the DNA was later revealed by Watson and Crick that ushered in a
new era for genetics. With the structure of DNA deciphered, the template was used to
explain a number of phenomenons. However this model was not sufficient in explaining
the protein production and various other regulatory principles. To answer this, the now
followed central dogma model was explained whose core idea was that the information
stored in the DNA was transferred to another nucleic acid called RNA through a process
called transcription. This RNA was then used as the template to produce a protein
through the process called translation. As a result of this, a central system of Replication
- Transcription – Translation was formed.
Within a few years, different types of RNA like ribosomal, messenger, transfer
etc. were discovered. Their structure was deciphered and its subunits plotted. The role
and relation of these RNA with each other was studied over the past 40 years. A series
of well researched data gave a clear understanding of how these RNA functioned in
order to produce a protein. In the year 1968 Nirenberg and Gobind Khorana gave the
triplet codons of all twenty amino acid in terms of nucleotides for which they received
the Nobel Prize [4]. During the course of time it was apparent that the transcription and
the translation models between prokaryotes and eukaryotes had obvious deviations from
each other. Both of these had a series of gene regulatory mechanisms with the
INTRODUCTION 2
eukaryotic system having developed a more complex mechanism of gene regulation and
post translational modification system. With this knowledge genetic engineering and
metabolic engineering gained importance which has facilitated various breakthroughs in
the field of medicine, agriculture and in manufacturing of organic components.
Biological applications aside, there is a growing sense of urgency for tackling
the global energy problem. Our extensive dependency on fossil fuels has already cost
the planet with accelerated global warming. Even though alternative energy sources like
solar and wind have been known for decades, they could not be implemented on a
popular scale because of their limiting cost factor. This energy problem can only be
solved by a combination of multiple sustainable energy systems. Hydrogen has the
potential to provide an energy solution because of its clean nature and high calorific
value. Despite hydrogen being the most abundant element in Earth, its large scale use
for energy generation is hampered because of difficulty in finding sufficient hydrogen in
gaseous form. About 40% of global hydrogen production is from natural gas, 30% from
oil sources, 18% from coal and only 1% from biomass [5].
As far as biological processes are concerned, there are photosynthetic and
fermentative methods of hydrogen production. Of this, hydrogen production through
dark fermentation is much simpler and also has higher hydrogen production rate than
photosynthetic method [6]. Our organism of interest Caloramator celer is an
alkalithermophilic organism which has many distinct advantages over its fellow
biohydrogen producers. It’s simple metabolic pathway coupled with its thermophilic
nature makes it one of the most efficient producers of hydrogen. However there is still a
long way to go before a large scale industrial output is feasible. Moreover, hydrogen
partial pressure in the gas phase is one of the core limiting factors of hydrogen
production by this bacteria. Therefore in order to improve upon the organism, metabolic
and genetic engineering has to be employed. Through metabolic engineering, pathways
that are problematic to hydrogen production can be blocked. Genetic engineering can
also be employed to block pathways or introduce new ones.
However in order to do this, sound knowledge regarding the functioning of the
pathways and the genetic elements involved is needed. Transcriptional analysis of the
growth stage of the organism takes us one step closer to this understanding.
Transcriptional analysis is basically the monitoring of levels of gene expression by the
organism. The expression of different genes under different physiological conditions
and stresses helps us in engineering a suitable complex. This research work aims to
INTRODUCTION 3
understand the workings of this bacterium through transcription analysis. Moreover in
order to better understand the role of hydrogen partial pressure in inhibiting hydrogen
production, transcriptional analysis is done to monitor changes from a genetic
standpoint. With better understanding of the pathways, the bacteria can be guided with
characteristics such as resistance to pH drop, more tolerance to hydrogen partial
pressure, resistance to toxic end products and capability to use a desired energy source
instead of glucose.
4
2. THEORETICAL BACKGROUND
Caloramator celer 2.1
2.1.1 A brief description of Caloramator celer
Caloramator celer strain JW/YL-NZ35, formerly known as Thermobrachium celere
(equivalent to ATCC 700318 and DSM 8682) [7], is a Gram-positive, strictly anaerobic
and alkalithermophilic bacterium isolated from New Zealand in the Ohinemutu hot
spring sediments region. C. celer has one of the lowest doubling times reported to be
near 10 minutes [8, 9] when grown at a suitable optimal growth temperature of 67°C
and an optimal pH of 8.2 at 67°C. C. celer’s metabolic pathway goes through dark
fermentation during which C6 sugars are converted to acetate, ethanol, formate,
butyrate, hydrogen, and CO2 as principal metabolites in which acetate occupies a major
chunk of 78% of total aqueous metabolite composition during optimal hydrogen
production [10]. It is also capable of producing significant quantities of ethanol and
formate in modified growth conditions. A number of studies have shown the capability
of C. celer to have excellent hydrogen production yield because of its thermophilic
nature. The hydrogen producing characteristic was verified both in a mixed microbial
community [11] and in pure culture [9, 10]. An increased yield of ethanol and formate
can hamper the hydrogen production efficiency of C. celer as it taps into the reservoir of
reduced cofactor pools (reduced ferredoxin and NADH) which will otherwise be used
for hydrogen production by the hydrogenases. Therefore, when hydrogen is the desired
end product, the accumulation of ethanol and formate has to be controlled [14]. To
achieve this end metabolic and genetic engineering can be employed to manipulate the
metabolic pathway. Transcriptional analysis of the genes involved in the pathway can
shed more light regarding the level of expression of various genes during different
stages of growth of the cell.
In terms of hydrogen production C. celer has a number of advantages when
compared to other mesophilic counterparts because of its high temperature and high pH
functioning. As a result of this contamination by hydrogen consuming methanogens and
other growth competing organisms can be minimised [16] and the cost of sterilization of
bio reactors can be reduced [11]. It was also found that thermophilic hydrogen produc-
ing bacteria in general had more H2 yield when compared to its mesophilic counterparts
since conversion of carbon sources into hydrogen is thermodynamically favourable
which leads to higher efficiency at higher temperatures [17]. This can also indicate a
selective hydrogen evolution by these species [11].
5
2.1.2 Genetic analysis of C. celer
The genome of C. celer was sequenced with Illumina HiSeq 2000 in order to obtain
Paired end scripts from both long and as well as short fragment libraries. Also in order
to get longer single end reads 454 sequencing was done. MIRA [18, 21] was used for
the assembly of genome followed by scaffolding and contig extension using SSPACE
[19, 21]. Annotation was done using RAST server [20, 21] followed by intermittent
BLAST analysis. The total size of the genome assembly is 2,644,756 bp, organized in
56 scaffolds and 162 contigs. On the basis of annotation the G-C content of the genome
is 31.3%. A total of 2,381 protein-coding sequences including 151 RNAs are present in
the genome. Enzymes involved in the regeneration of NAD+
and oxidized ferredoxin
through proton reduction were found to be coded by three operons [21].
It was also found that the subunits of Fe-Fe hydrogenases had 47% to 67%
identity with Thermoanaerobacter tengcongensis [21, 22] and the subunits of Ni-Fe
hydrogenase show 30 to 54% identity to Pyrococcus furiosus [21, 23]. The primers
needed for the transcriptional analysis in this organism were designed with reference to
this draft genome.
2.1.3 Metabolic pathway of C. celer
2.1.3.1 Dark Fermentation
Dark fermentation is the process of anaerobic digestion of organic matter to bio
hydrogen. Unlike photoremediation, dark fermentation does need the presence of light
and it has been shown to have high hydrogen production rates when compared to
photosynthetic methods [6]. It is an acidogenic process in which organic acids like
acetate and formate are produced along with alcohols and gases like H2 and CO2 as end
products [14]. There are various bacteria with a characteristic potential for hydrogen
production ranging mesophilic to thermophilic bacteria. A wide arsenal of organic
compounds like glucose, simple carbohydrates or complex polymers like starch and
cellulose can be used to process dark fermentation. In recent times studies have been
done to study the viability of using organic wastes and sludge for bio hydrogen
production [5]. Hydrogen production by using cheap and largely abundant agro-
industrial residues as substrate can offer distinct benefits in environmental and
economic facets as shown in Figure 2.1 [24 - 27].
6
Figure 2.1. An economically viable model of hydrogen production by dark fermentation
as adapted from [28].
Hydrogen produced through dark fermentation requires either facultative or
strict anaerobes and in our case C. celer is strictly anaerobic. The metabolic pathway of
this bacterium governs the production of acetate, formate, ethanol, hydrogen and CO2
can be promoted or inhibited depending on the desired end product. An important
enzyme of the metabolic pathway without which the biohydrogen process is not
possible, is Hydrogenase. Presently three types Hydrogenases are involved in the
hydrogen production process; nitrogenase, Fe-Fe hydrogenase, and NiFe hydrogenase.
[28]. C. celer has only two types of hydrogen involved in its pathway; Ferredoxin-
dependent NiFe hydrogenase and NADH-dependent FeFe hydrogenase. [21] These two
hydrogenases are in active competition with ethanol and formate pathway because of
their shared need for reduced cofactors as shown in Figure 2.2. Pyruvate formate lyase,
acetate kinase and alcohol dehydrogenase are the enzymes responsible for the
Organic
wastes
Agricultural
products Biomass
Pretreatment Fermentation
(Metabolically
engineered organisms)
Gas
separation
CO2
H2
7
production of formate, acetate and ethanol repectively. High substrate volumes need to
be converted to hydrogen if an economically and environmentally sustainable hydrogen
production process has to be developed.
Figure 2.2. The metabolic pathway of C. celer described in this diagram. The genes
involved are shown here and the active competition from formate and ethanol pathways
with hydrogenase enzymes for the reservoir of reduced cofactor pools is illustrated
[14].
8
2.1.3.2 FeFe – Hydrogenases
Hydrogenases are metallo-enzymes that facilitate hydrogen production in organisms
[29, 30]. Both FeFe and NiFe hydrogenases have catalytic bi-nuclear metal centers in
which a tholiage bridge facilitates the connection of one nickel with one iron or two iron
with each other [30]. FTIR spectroscopy has shown that FeFe Hydrogenase from
Desulfovibrio desulfuricans has Fe(CO)x unit in the active site where iron atoms also
bind CN- ligands as seen in Figure 2.3. [12, 13, 33].
Figure 2.3. Structure of the FeFe-hydrogenase and a depiction of the H-cluster in its
active oxidized state [30].
In all [FeFe]-hydrogenases, a classical [4Fe–4S] cluster is linked through a
cysteine ligand with the dinuclear Fe center, leading to the formation of H-cluster, as
shown in Fig. 2.3.[30]. In addition the cysteine ligand that manages the [4Fe–4S] sub
cluster is also the only protein ligand to the binuclear sub cluster. It has also been
established through infrared spectroscopic studies that one CO and one CN ligand is
connected to each Fe atom which then connects to another Fe atom through extra CO
ligand bridging [31 - 33]. Accessory ferredoxin like clusters ([4Fe–4S] and [2Fe–2S])
that act as electron transport centers by connecting the active site to the protein surface
are also contained in the hydrogenase [30].
A complex post translational process is responsible for the formation of a
functional hydrogenase protein. The process involves the formation of dithiolate, CO
and CN bridging ligands, fabrication of di-Fe active site and its addition into the protein
containing [4Fe-4S] element of the H-cluster and finally the assembly of the
supplementary [Fe-S] domains [30]. The [FeFe]- hydrogenase polypeptide has to
include the H-cluster and the accessory [Fe–S] clusters in order to be active after its
9
synthesis. During this assemble it is imperative that [4Fe-4S] element of the H cluster
be assembled before the inclusion of di-Iron sub cluster into the hydrogenase [34].
When compared to NiFe hydrogenases, FeFe hydrogenases have superior efficiency in
the production of molecular hydrogen [35].
2.1.3.3 NiFe – Hydrogenases
NiFe hydrogenases are probably the most widely found and they contain a NiFe active
site. They are more oxygen tolerant when compared to that of the FeFe counterparts
[15]. They are mainly found in prokaryotes and lesser eukaryotes. The smaller subunit
is 28.8 kDA while the larger subunit is 62.5kDA when the [NiFe]-hydrogenase from
Desulfovibrio vulgaris was studied [36]. The Fe-S cluster is also present in NiFe hydro-
genases at a distance of 12 Å from the active site [43] and it coordinates the connection
of nickel active site to the exterior of the protein complex as shown in Fig. 2.4 [15].
Figure 2.4. The structure of Ni Fe hydrogenase consists of two subunits; large and
small subunit. The metallo cluster active site is present in the large subunit, surrounded
by three 4S domains from small subunit [15].
10
2.1.3.4 Limiting factors of hydrogen production in C. celer
When aiming for an industrial scale application of biohydrogen production importance
has to be given to intrinsic factors that affect the bioprocess. Hydrogen partial pressure
in the gas phase is one of the core limiting factors of hydrogen production. In both
mesophiles and thermophiles, it has been noticed that with increased H2 production
rates, the concentration of H2 in the headspace and the liquid space also increases
rapidly and as a result the reaction becomes thermodynamically unfavourable [37- 39,
10]. Following the metabolic pathway shifts towards the production of unfavourable end
products [40, 9]. In addition to this a low hydrogen partial pressure is very crucial for
the oxidation of NADH to NAD+ which can ensure a higher H2 production [41, 9].
pH is another limiting factor that can affect the efficiency of hydrogen
production [42]. It has been observed in C. celer that during its prolonged dark
fermentation there is an accumulation of volatile fatty acids which results in the drop of
pH much below the optimal range [10].
Dark fermentation by C. celer is an acidogenic process which produces organic
acids that are toxic to the bacterium. The cellular metabolism is impaired due to the
inhibitory effects of the organic acids [44, 14]. The nonpolar undissociated form can
release protons in the cytoplasm and increases the cellular upkeep energy [45, 14],
whereas, the polar dissociated form increases the ionic strength of the medium and
causes cell lysis [46] polar dissociated form. In addition to this the presence of increased
concentrations alcohols like ethanol and butanol can denture biological molecules and
exert pressure on the cell membrane [44, 14]. These compounds at subinhibitory
concentrations can alter the distribution of carbon and electron flow [14].
Another limiting factor to hydrogen production in C. celer is related to the
pathway concerned with ethanol and formate production. An increased yield of ethanol
and formate can hamper the hydrogen production efficiency of C. celer as it taps into
the reservoir of reduced cofactor pools (reduced ferredoxin and NADH) which will
otherwise be used for hydrogen production by the hydrogenases. Therefore, when
hydrogen is the desired end product, the accumulation of ethanol and formate has to be
controlled [14]. To achieve his end metabolic and genetic engineering can be employed
to manipulate the metabolic pathway. Transcriptional analysis of the genes involved in
the pathway can shed more light regarding the level of expression of various genes
during different stages of growth of the cell.
11
Overview of transcription 2.2
Transcription is the process in which a segment of DNA is copied into RNA to initiate
the gene expression process. RNA polymerase is the principal enzyme that runs this
process. During the transcription process the DNA sequence is read by the RNAP which
produces a single stranded primary transcript or mRNA [47]. In case of prokaryotes
there are three important steps to this process; initiation, elongation and termination.
Bacterial transcription as shown in Figure 2.5, starts with the initiation process
when the RNA polymerase starts analyzing the promoter of a gene and binds to it [48].
RNA polymerase is a core enzyme consisting of five subunits. For a successful
initiation the core enzyme has to be associated with the sigma factor to form a
holoenzyme that helps in finding the correct -35 and -10 base pairs downstream of
promoter sequences [49]. A number of base pairs leading from the -10 region are
broken when the RNAP/promoter complex goes through a conformational change in
order to form a bubble in which the two DNA strands have been split apart. This bubble
is called the open complex and is usually 17 base pairs long. By using one DNA strand
as a template the RNA synthesis is started by adding complementary base pairs to the
template [47].
In the elongation phase more nucleotides are added to the expanding RNA chain
as the RNA polymerase continues unzipping the DNA double helix as it moves along
the template. As this process continues the open complex also moves. The average
speed of this transcription is 40bp per second. 5' tail end of the growing RNA chain is
separated from the base paired DNA template strand. After the initial 8bp are
synthesized, the sigma unit detaches while the core enzyme synthesizes the RNA china
alone [48].
This process of elongation continues until the RNAP encounters a code for
termination. In prokaryotes there are two types of transcription termination; Rho
independent and Rho dependent termination. This Rho independent termination also
called the intrinsic termination takes place when the synthesized RNA transcript forms a
hair pin loop that is G-C rich. However, as for Rho dependent termination as the name
implies, is dependent on a particular protein called Rho factor. This Rho factor binds to
the end of the newly synthesized RNA transcript and slides along its entire length until
it reaches the open complex, where it cause the termination of transcription process
[47]. This newly synthesized mRNA then undergoes translation in order to produce the
proteins. Therefore when the gene expression is more, there is more mRNA
concentration and when the gene expression is less there is less mRNA concentration.
Using real time qPCR and RT PCR, the concentration of the mRNA can be determined
during a particular growth which in turn lets us know the level of gene expression at
different time points of bacterial growth stage.
12
Figure 2.5. The process of transcription beginning from the initiation phase to its end
at the termination phase is shown. The mRNA produced here is translated to synthesize
the corresponding protein [47].
13
Transcriptional analysis 2.3
The mRNA from the transcription process has to be quantified in order to know the
level of gene expression. In order to aid us in this process we make use of a variety of
PCR techniques; qPCR and RT PCR.
2.3.1 Real time PCR
The real-time polymerase chain reaction (real-time PCR) which is a modified version of
normal PCR was first introduced by Higuchi in 1992 and has since been extensively
used in real time analysis [50, 51]. Real-time PCR uses a sensitive Fluorescent
technology which allows it to precisely quantify target nucleic acids even if the initial
concentration is very low. The amount of initial concentration determines speed at
which the amplified target reaches a threshold detection level. Since its introduction
real-time PCR has been extensively used various multi-disciplinary fields. Its
applications cover quantifying viral load in patients [53], genotyping [52, 54, 55], and
determining gene copy number in cancerous tissues [56, 57]. However, the most
common use for this technology ¨ is to study the gene expression levels at specific time
points by combining it with a procedure called reverse transcription [58].
Real-time PCR uses fluorescence-based technology to measure the quantity of
amplicon produced during each cycle of amplification. Instead of measuring the
quantity of amplicon at the end of the cycle Real-time PCR can find the amount of
amplicon produced at the exponential phase of the PCR cycle itself [59]. The
accumulating product in the PCR is labeled and monitored in real time through a
fluorescently tagged substrate. Therefore in contrast to conventional PCR, real time
PCR has many advantages like increased speed, no need for Post PCR agarose gel
electrophoresis for detection of any amplification and higher sensitivity [60, 61].
SYBR® Green is a nonspecific fluorescent asymmetrical cyanine dye [62]. The
emission maxima for SYBR Green 1 is around that of fluorescein (around 520 nm). The
SYBR Green family of dyes follows the principle according to which they go through a
1000-fold increase in their fluorescence output [63] when they bind upon a dsDNA as
shown in Fig. 2.6. As a result of this as the amount of dsDNA magnifies in the reaction
mix, there will also be an increase in the fluorescent output that is detected by the
machine as seen in Fig. 2.7 [59]. This can also prove to be problematic in unprepared
scenarios as they do differentiate between different dsDNA strands. Therefore
precautions have to be undertaken to prevent any contamination that can challenge the
validity of the test [60].
14
Figure 2.6. SYBR green during the process of qPCR amplification in which the dots
denote the SYBR green that is unattached to the minor groove of the dsDNA and there-
fore is unexcited to emit fluorescence. This dye attaches only to the minor groove of a
dsDNA and then gives a 1000 fold increase in fluorescence which is shown as stars in
this image[59].
Figure 2.7. The real time PCR along with the optical design for the detection of fluo-
rescence, which contains an emission filter based system in which the measurement
takes place from a micro-titration plate.[59].
15
2.3.2 Reverse transcription PCR
The process of RNA to DNA transcription is called reverse transcription. Here a RNA-
dependent DNA polymerase enzyme called reverse transcriptase is used to convert the
RNA template into a cDNA which is then used as a template and amplified in a PCR.
Reverse trancriptase enzyme was discovered from retro viruses which uses it for its
replication [67]. Since the discovery of this process a number of uses have been
attributed to this. Transcripts of practically any gene can be detected now [64], tolerance
to RNA degradation [65], cancer detection in which the mRNA transcripts can be used
as specific bio-markers [66]. RNA is less stable than DNA because of its susceptibility
to RNases and its ubiquitous nature. Purified RNA is also vulnerable to impromptu
degradation in solution [59]. Therefore the mRNA obtained from the RNA extraction
process can be reverse transcribed to its complementary dsDNA which can be stored for
a longer time without degradation.
Practically, there are many variations of reverse-transcription but in all; the
prime step is the conversion of mRNA into a cDNA template through a reaction
catalyzed by reverse-transcriptase as shown in (Fig .2.8). A DNA structure known as an
oligodeoxynucleotide primer is essentially hybridized to a complementary mRNA that
allows the RT enzyme to extend the primer and synthesize a complementary DNA
strand. This oligodeoxynucleotide primer sequence can be engineered to bind to a
specific target gene through a synthetic antisense oligonucleotide or to all of the mRNA
in a sample through a universal primer. Either oligo (dT) primers or random hexamers
can be used. However oligo (dT) primers are not suitable for bacterial mRNA because
of absence of a stable poly A+ tail. Therefore in our case random hexamers are used to
convert bacterial mRNA to cDNA [59] which requires that prior to the RT reaction,
rRNA is completely removed from total RNA.
There are several reverse-transcriptase enzymes that are obtained from
retroviruses [67] of which the most common are encoded by the avian myeloblastosis
virus (AMV) and murine leukemia virus (MMLV). These RT enzymes have a special
property called RNase H which monitors the RNA-DNA complex that arises during the
reverse transcription reaction and then degrades the RNA. In order to circumvent this
reverse transcriptases are genetically designed to lack RNase H activity. A one step RT-
PCR process where, all the reagents and enzymes are added in a single vial is preferred
as it reduces experimental variation.
16
Figure 2.8. Steps involved in the RT PCR process is shown here. mRNA is the gray line
and DNA is black. Taq is a type of thermostable DNA polymerase and RT is the reverse
transcriptase enzyme [59].
2.3.3 Limiting factors to transcriptional analysis
Optimal primer design is very important in real time PCR in order to get reliable results.
A Successful run for RT-PCR needs to have a primer with the ability to amplify a short
product (<300 bp), that is explicit to the mRNA. A successful design requires the
sequence of the interested genomic DNA and also the direct alignment with the cDNA
coding sequence. During the design phase of primers care should be taken to eliminate
the possibility of primer dimer structures because of the complementary sequence
between the two primers or with the same [59]. The annealing temperature of the two
primers should be matched. They should either flank a large intron or mount a small
intron. An equal GC content between the two primers should be maintained. Once
designed and run in a real time PCR the efficiency of these primers should be high and
in an acceptable range to each other so the gene expression data can be compared with
each other. The result can also be hampered if the primer concentrations are not
optimally used. This can lead to the production of nonspecific products like primer
17
dimers. It is always desirable to use those concentrations that give the lowest CT values
[59].
Another limiting factor to the experimental validity of the real time PCR results
is through DNA contamination. As we know about the extreme sensitivity of real time
PCR setup because of its use of fluorescent mechanism for detection, even a very small
amount of DNA presence can give a significant amplified signal at later stages [68]. As
the gene is intrinsic to the genomic DNA, with its specific primer the gene in the DNA
will get amplified whether it is expressed or not, which could give false expression in
samples [69]. In order to avoid this, an effective Dnase treatment procedure has to be
undertaken after the RNA extraction process. An RNase free DNase should be used for
the process. RT- control samples should be used after the RT PCR procedure in order to
verify DNA contamination. Any amplification from the RT- control samples before the
35th
cycle can be deemed as contamination by genomic DNA. The DNase has to be
denatured by heat treatment after its use, so that there is no interference after the RT
PCR process.
Similar to DNA contamination RNase contamination is also a crucial factor. As
analysis of gene expression is the desired goal accurate initial concentrations of mRNA
is very crucial to be maintained [68]. Contamination by RNase can lead to degradation
of RNA which will represent a lower gene expression level than normal. RNases or
ribonuleases are type nuclease that degrades RNA. Most organisms produce this as
means of protection against viruses. They are very widespread and not as easily
denatured as a DNase [70]. Special protocol is followed for RNase removal and all
reagents and materials used has to be certified RNase free. And the RNA samples have
to be stored at -80°C to avoid RNA degradation. Therefore it is imperative that the RT
PCR process be initiated at the earliest.
Housekeeping genes as normalization factor 2.4
Housekeeping genes are constitutive in their function and are ubiquitously expressed in
all the cells of an organism under normal physiological conditions [71]. They are
responsible for the maintenance of basic cellular functions in a cell. The nature of gene
expression studies especially those that rely on qPCR to provide supplementary analysis
may run the risk of garnering insufficient data quality [72] because of variance in
between samples, efficiency of reverse transcription, extraction of mRNA and finally in
the PCR itself [73]. The technique of real-time RT-PCR has to be monitored at various
stages because of problems or errors associated with RNA isolation procedure, sample
storage, poorly selected primers, and inappropriate statistical backing [74]. It had
18
already been observed in multiple instances that even though uniform weight and
volume in sample collection was achieved, there was no guarantee for presence of
identical amount of matrix for the reaction setup [60]. This dilemma is further amplified
when possibility of errors in pipetting and transferring of samples. To circumvent these
issues a normalizing factor is needed in order to monitor the true level of expression of
genes [60] and proper design of the experiment and use of replicates to give credibility
to the data.
A reference gene can be used as a normalizing factor. However, a reliable
reference gene has to meet several criteria [75, 60] like maintaining an uniform
expression level by being unaffected by experimental factors and different physiological
states of the organism, to have identical threshold value with the gene of interest, while
also having the ability to show variability during differences in technology and
protocols so that the object of research can also take in to account any variation in the
quantity of genetic material (60). Housekeeping genes seem to qualify for these strict
criteria because of their inherent function. It is also generally accepted that use two
different housekeeping genes is important in order to avoid large errors associated with
a single gene and also to increase the accuracy and resolution of the results (76).
During the selection of housekeeping genes for the target organism, the genome
of the organism needs to be analyzed so that the sequence and structure of the interested
genes be recognized for primer design to amplify the actual amount of mRNA both in-
dividually and in samples (77). Primers should also be designed for each possible varia-
tion of mRNA present in the bacterium while also neglecting fragment that contain gene
polymorphism. The amplified product should also be tested to see if it is of specific
size.
2.4.1 polC (DNA polymerase III gene) as housekeeping gene
DNA polymerase is an integral part of DNA replication process that helps to build DNA
strand by assembling nucleotides. During the process of replication the DNA
polymerase enzyme reads the old strand and creates new sister strands to match the
existing ones. To add a copy of original DNA into the daughter cells during cell
division, DNA polymerase is needed. When synthesizing new DNA, the new strand
elongates only in the 5'-3' direction because DNA polymerase can add nucleotides only
to the 3' end of the strand. No known DNA polymerase is capable of de novo synthesis
of new chain.
There are a number of families of DNA polymerase (I to V) with varying
domain structures [Figure 2.10], of which our gene is of DNA polymerase C family
19
(polC). Family C polymerases are the most common in prokaryotes and they form a
holoenzyme complex as shown in Figure 2.9. The holoenzyme consists of three
assemblies; the clamp-loading complex, pol III core unit and the beta sliding clamp
processivity factor. The pol III core consists of three subunits α, θ, and δ, whose
functions are polymerase activity, stabilization factor for δ and exonuleolytic proof
reader. In order to permit for the processing of both lagging and leading strand, the
holoenzyme contains two cores [78] along with duplicate beta sliding clamp [79].
Figure 2.9. A schematic diagram showing the clamp loading complex of Taq
polymerase III along with all the subunits involved. The holoenzyme contains two cores
along with duplicate beta sliding clamp. In the Figure 1 denotes single-stranded
template DNA entering the Taq polymerase III which is guided by the fingers domain;
polymerase active site is shown as 2; while the thumb domain comes into contact with
the DNA minor groove as it exits the polymerase active site; 4 represents the elongated
fingers domain which contacts the ds region of the DNA; and finally the binding site for
the DNA sliding clamp is represented by 5. [87, 88]
20
Figure 2.10. Figure showing the domain structure of the three different classes of
family C DNA polymerases. In class I depiction, the dnaE protein is α subunit and dnaQ
protein is ε subunit of DNA polymerase III holoenzyme. The class II family consists of a
3’ to 5’ exonuclease domain. The two proteins coded by dnaE1 and dnaE2 in the class
III family can pursue trans splicing to form a functional DNA polC. [80]
The primary function of DNA polymerases is to manufacture an exact copy of
the genome during the cell division process. Apart from this polymerization process,
they are also found to be involved in the control of cell cycle [89- 91]. DNA repair is
perhaps the next vital function of these enzymes. As the genome of the cell is repeatedly
exposed to environmental and mutagenic factors, damage to DNA can occur through
ways such as modification of DNA bases, destruction of strands, and backbone
alterations. As a result of these unfavourable mutations the transcription process can be
21
disrupted thereby affecting the cellular functions. In order to avoid this DNA
polymerases involve in multiple repair mechanisms [91, 92]. These functions stress the
importance of DNA polymerase in a cellular system. As a result of their vital functions
and their need for constant maintenance of genetic material, they act as housekeeping
genes. A DNA polymerase gene is usually ubiquitously expressed in all physiological
conditions of the cell.
2.4.2 recA as housekeeping gene
Bacterial DNA recombination protein (recA) is a maintenance protein whose primary
function is DNA repair. This protein which belongs to a family of ATPases, manages
homologous recombination in order to ensure genomic integrity and diversity [81]. The
recA protein along with ATP attaches to a single stranded DNA (ssDNA) and conforms
into a helical filament. This filament later attached to a double stranded DNA (dsDNA)
and scans for presence of any homology. Once found it helps in the formation of a new
heteroduplex by exchanging complementary strand [81].
The RecA protein has multiple DNA binding sites and can therefore
independently hold either single stranded or double stranded DNA through which it can
actuate a synapsis reaction between the complementary region of single stranded DNA
and the DNA double helix [85, 86]. After this an exchange of strands among the two
DNA double helices takes place. After this a process called branching migration starts
in which an unpaired area of one single strand supersedes a paired region of the other
single strand. In this movement only the branching point is moved while the total
number of base pairs is kept constant. Unidirectional branch migration is catalysed by
the recA through which complete recombination takes place leading to the formation of
a 1000 bp long heteroduplex DNA. RecA which is a DNA-dependent ATPase contains
a binding site for ATP [81] as shown in Figure 2.11. When ATP is bound to recA, the
protein is more tightly associated with the DNA then when ADP is bound. In addition
one ADP-aluminium fluoride-Mg (ADP-Alf4-Mg) for each recA promoter is present in
all DNA bound structures.
As a result of these functions, the cell’s diversity and stability is assured. Due to
the pervasive nature of this function recA is ever present all over the cell during
multiple physiological stages. Therefore, recA is a strong example of housekeeping
gene.
22
Figure 2.11. Structure of the recA nucleoprotein filament (RecA6–(ADP-AlF4-Mg)6–
(dT)18). Here dT18 is the 18- nucleotide oligo-deoxythymidine ssDNA. The DNA
backbone is represented by the red filament in the center. The 6 different recA
promoters are coloured and numbered. The ssDNA is numbered and it starts with 5’
end. [81]
2-ΔΔCT method of normalization 2.5
In order to reliably analyze the data from qPCR, two different methods exist; absolute
quantification which determines input copy number of the transcript and relative
quantification which shows the gene expression level relative to a reference group. In
situations where an absolute copy number of the transcript is required, absolute
quantification can be used [82]. However in our case relative quantification technique is
sufficient because we are only interested in gene expression levels. In order to quantify
the gene expression level through real time PCR certain assumptions and validation
tests are required, which is provided by Applied biosystems user bulletin [82]. Using 2-
ΔΔCT method for analyzing gene expression data is already well established in previous
studies [82- 84]. Nevertheless, it is imperative that we understand the derivation of 2-
23
ΔΔC
T method along with the assumptions involved, so that we understand all the factors
involved and can use this method competently in our analysis. This derivation is
obtained through literature by Kenneth et al., 2001
The exponential amplification of PCR is shown through the given below,
( )
Where, is the number of target molecules at nth
cycle of reaction, is the initial
quantity of target molecules, is the efficiency of amplification and n denotes the
number of cycles.
( )
Here CT is the threshold number, is the threshold number of target, a constant
and denotes threshold cycle of target amplification. Now a similar equation
regarding the reference gene reaction is given below where, R is associated with the
reference gene.
( )
Now dividing by we get the following equation,
( )
( )
During real time amplification, and are influenced by the reporter dye used in the
probe, along with characteristics like fluorescence properties of the probe, its purity, and
efficiency of the probe cleavage. As result of this the constant K need not be equal to 1.
Therefore now assuming that the efficiencies of both reference and target are same,
,
( )
( )
Where, denotes the normalized quantity of
and T is the difference between
( ). Therefore after rearranging we get,
24
( )
In the final step, for any sample q is divided by for the calibrator cb.
( )
( ) ( )
Also here,
( ).
Those templates designed to be less that 150bp and for which the Mg2+
concentrations
and the primers are efficiently optimized, the efficiency is near 1. Therefore the quantity
of target, normalized to a reference and relative to a calibrator is shown as,
Amount of target = . [82]
25
3. MATERIALS AND METHODS
Materials Used 3.1
Caloramator celer strain JW/YL-NZ35, formerly known as Thermobrachium celere
(equivalent to DSMZ 8682), was obtained from the Deutsche Sammlung von
Mikroorganismen und Zellkulturen (Braunschweig, Germany) was used throughout the
study for DNA and RNA extraction to map gene expression levels. Na2S.9H2O; cystein-
HCl; KH2PO4; Na2HPO4; FeSO4.7H2O; KCl; (NH4)2SO4; NH4Cl; MgCl2.6H2O;
CaCl2.6H2O; resazurin; yeast extract; tryptone; and glucose was obtained from Sigma-
Aldrich, Germany.
Primers were ordered from Thermo scientific. Genomic DNA extraction kit
from GeneJet, Thermo Scientific, Wilmington, USA and RNA extraction from
PureLink® RNA Mini Kit (Invitrogen, Carlsbad, USA) were used. For RT PCR the
Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, Wilmington, USA) was
used. Amplification grade DNase I (Sigma, St. Louis, USA) was used for DNA
removal. 2 ml natural flat cap microcentriguge tubes (STARLAB, Hamgurg, Germany),
optical adhesive covers (Applied Biosystems, Carlsbad, USA), pipette tips topOne
(STARLAB, Hamgurg, Germany), Innova 44 incubator shaker series (Brunswick
scientific, Eppendorf, Boulevard, USA) were also used.
Medium and culture 3.2
C. celer was cultivated in a modified ATCC 2072 medium containing (g/l): Na2S.9H2O
0.13; cystein-HCl 0.13; KH2PO4 1.24; Na2HPO4 5.79; FeSO4.7H2O 0.2; KCl 1;
(NH4)2SO4 0.5; NH4Cl 0.5; MgCl2.6H2O 0.1; CaCl2.6H2O 0.11; resazurin 0.001; yeast
extract 2; tryptone 2; glucose 10. After this an additional 10 ml/l of both multi vitamin
solution and trace element solution (ATCC medium No. 2072, American Type Culture
Collection) were added to the medium. Pure N2 gas (Oy AGA Ab, Espoo, Finland) was
flushed into the medium for 20 min to make it anaerobic. It was then discharged to
serum bottles, while being flushed by pure N2 gas and then autoclaved for 15 min at
121°C. In addition to this, separate stock solutions were prepared anaerobically under
N2 atmosphere, containing glucose, MgCl2.6H2O and CaCl2.6H2O, FeSO4.7H2O,
cystein-HCl and Na2S.9H2O. vitamins were sterilized separately using a 2.2 µm sterile
syringe filter (VWR international,USA) and added anaerobically to the medium before
26
the inoculation at the required concentration. After the autoclaving of the medium, its
pH was adjusted to 8.2 at 67°C with anaerobic and sterile 3M NaOH solution. The pH
was measured with a pH330i pH meter (WTW, Weilheim, Germany) which was rigged
with a Slimtrode pH electrode (Hamilton, Bonaduz, Switzerland). Syringes (BD
plastipack, Finland) with needles (BD microlance, Finland) were used for all anaerobic
operations. For the gas phase experiment an extra step was incorporated where the
serum bottles containing the medium was purged with pure hydrogen (Oy AGA Ab,
Espoo, Finland) and CO2 (Oy AGA Ab, Espoo, Finland) respectively for approximately
15 minutes before they were inoculated.
The serum bottles were inoculated with C. celer at 5% v/v and incubated at 67°C
and 150 rpm. As for the growth phase and gas phase experiment the 0th
samples were
collected and then samples for RNA extraction procedure was also collected at specific
time points. In addition to this air samples from head space and liquid samples were
collected at specific time points for gas chromatography (GC) and high performance
liquid chromatography (HPLC). For gas chromatography a GC-2014 gas chromatograph
(Shimadzu, Kyoto, Japan) having thermal conductivity detector and a Porapak N
column (80/100 mesh) was used. In this setup N2 was used as carrier gas and the
temperatures of detector, column and injector were 110°C, 80°C and 110°C,
respectively. As for the HPLC system a LC-20AC prominence liquid chromatograph
prepped with a DGU-20A5 prominence degasser, RID-10A refractive index detector,
and a CBM-20A prominence communications bus module (Shimadzu, Kyoto, Japan). In
addition to this, the column was a 30-cm Rezex RHM Monosaccharide H+ (8%) column
(Phenomenex, Alleroed, Denmark) incubated at 40°C.
Primer preparation 3.3
All primers used in this experiment were designed the Primer express software (Applied
Biosystems, Carlsbad, USA). These primers were synthesized and obtained from
Thermo scientific. An initial 100µM mother stock of each primer was prepared by
adding the required volume of TE buffer. Then finally a 5µM stock was prepared by
dilution, which will be used for further PCR reactions.
Table 3.1. The table showing the information of all the primers tested.
Primer name Sequence (5’-3’) Gene target Putative enzyme
pfl_f GATATGATGTTTCAAGACCAGCAAAG pfl
Pyruvate-formate
lyase
pfl_r ACTTACTCTACCTAGTGACATAGCAGCAC
pflae_f GGAGGCGGAGTTACACTTTCAG
pfl-ae
Pyruvate-formate
lyase activating en-
zyme
27
pflae_r TGTGAATTCCTTCTTCCTTACACCT
por1_f ACCACTTGATCTTCCAAACCACTAC porA
Pyruvate oxidoreduc-
tase
por1_r TTCAGCAGCAACTTCAAGAATTACTC
por2_f GTTTACTCAAATACAGGTGGTCAATCA por
Pyruvate oxidoreduc-
tase
por2_r GCTCATTGCTATCATTCCAAGGT
pta_f GGTTGCTGAATTAAAGGCTCCA pta Phosphotransacetylase
pta_r GCTCCTGCTAATCTTTGAACTAACTTG
acka_f CAGGAGTTCTTGGTATTTCAGGTGTA ack Acetate kinase
acka_r AATGGAATACATCAAGTGCTAGTTGTG
hyd1_f TGCAGCAGACCTTACAATAATGGA hydA
NADH-dependent
FeFe hydrogenase
hyd1_r ACAGCAGCTTGTCATAAGTGGAAG
hyd2_f GACGCTGTGAGACAATGTGTAATG hydA
NADH-dependent
FeFe hydrogenase
hyd2_r AGGCAGGTCCTACAACTGTTTCA
mbhl_f GACAGGCGTTAGAAAACCTTCCA mbhL
Ferredoxin-dependent
NiFe hydrogenase
mbhl_r TGGTGCTTCGTGTCTTGCTGTA
mbhj_f GTATCACTAGGATCATGCCCAAGA mbhJ
Ferredoxin-dependent
NiFe hydrogenase
mbhj_r GCCATTATAGCTTCTGGTTTTGGA
adhe_f CAGTTAAAGCTGGAGCACCAAAG adhE
Alcohol dehydrogen-
ase
adhe_r GAAGAGTAGGCAGCCTTTACCATTC
bdh_f GAACAGAGGTTACAAGGGCATCAG bdh
Butanol dehydrogen-
ase
bdh_r CATTCCTGTTTCAGCAACAACTTC
polc_f TGGATGGAGTAACATCTGCAACA polC DNA polymerase
polc_r CATAGCTTCAGGGAATGCTTGA
reca_f GAAATGGGAGATGCTTTTGTAGGA recA
Bacterial DNA re-
combination protein
reca_r TTCAGGACTACCAAACATAACACCAA
28
Fnora_f TTGGTAAAAGGGTTGCTGTGATAG fnor
NADH:ferredoxin
oxidoreductase
Fnora_r CTTGCTGGCATCTCATCTTCAG
3.3.1 Optimal annealing temperature and primer efficiency
An optimal annealing temperature for each primer was determined by using a
temperature gradient method where the primers were run in the StepOne™ Plus Real-
Time PCR System (Applied Biosystems, Carlsbad, USA) in temperature ranging from
57 to 65°C. The temperature that gave the lowest Ct was selected as the optimal
temperature. Using this optimal annealing temperature, the primer efficiency for each
primer was determined using serial dilutions of quantified total genomic DNA. For all
these PCR runs Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific,
Wilmington, USA) was used. The PCR parameters are as follows: initial holding stage
at 95°C for 10 minutes, 40 cycles of 15 seconds denaturation at 95°C, 1minute
annealing and elongation at optimal temperature of each primer. In the end the primer
specificity was tested with melting curves after real time amplification and then run in
electrophoresis by 1% agarose gel (Bio Rad laboratories Inc., Finland)
RNA extraction 3.4
The cells were inoculated and grown and their concentrations were periodically
determined by using absorbance spectrophotometry at 600nm with an ultraspec 500 pro
spectrophometer (Amersham bisciences, munich, Germany). All the pipettes and
surfaces were cleaned using the RNase AWAY® solution (Molecular bioproducts,
Mexico). Half volume (500µl) of 0.1 mm glass beads (Sigma Aldrich, Germany) in a
specially allocated tube. 70% ethanol was prepared according to volume needed. At the
required time point the cells were extracted (about 1ml) and harvested and pelleted by
centrifuging at 8000xg for 1min at 4˚C. 1 ml of the TRIzol®
reagent (Invitrogen,
Carlsbad, USA) was added per 1 x 107 of bacterial cells and allowed to lyse by pipetting
up and down repetitively. The cells were not washed in any other solution before
TRIzol® treatment to avoid mRNA degradation. The TRIzol
® - cell mixture was
transferred in the tube containing the glass beads. The cells were then mechanically
disrupted in a Mini-BeadBeater-16 (BioSpec, Bartlesville, USA) with 6 cycles of 30
seconds with intervals of 60 seconds in ice between cycles. Then it was centrifuged at
14,000g for 3 min at 4˚C. After that the RNA isolation was done using a PureLink®
RNA Mini Kit (Invitrogen, Carlsbad, USA). The instuctions specified by the
manufacturer was followed for the extraction process. The concentration of the RNA
was checked using a Nanodrop 2000 spectrophotometer (Thermo scientific,
Wilmington, USA).
29
Preparation for RT PCR and qPCR 3.5
Before undertaking the PCR process, the sample has to undergo DNase treatment in
order to remove any contaminating DNA. For this about 2µg of total RNA is taken in
16µl of water in an RNase free PCR tube to which 2µl of 10x reaction buffer and 2µl of
amplification grade DNase I (AMP-D1 DNase kit, SIGMA, St. Louis, USA) (1 unit/µl)
was added. It was mixed gently and incubated for 15 minutes at room temperature, after
which 2µl of stop solution was added to bind calcium and magnesium ions and to
inactivate the DNase I enzyme. Finally it was heated at 70 ˚C for 10 minutes to denature
both the DNAse I and the RNA and then chilled on ice. After the DNase treatment,
about 11µl of the sample was taken from the treated tube and transferred into a new
RNase free PCR tube (RT-). The original tube was taken as RT and another new RNase
free PCR tube negative control.
Table 3.2. The reagents were added according to the order shown below
µl RT NC RT-
5x Reaction mix 4 4 4
Enzyme mix 2 2 -
RNA (total 1µg) 11 - 11
RNase free Water 3 14 5
With a Maxima First Strand cDNA Synthesis Kit (Thermo Scientific,
Wilmington, USA) the cDNA was synthesized from 1 µg of total RNA. The PCR
parameters are as follows; initial incubation at 10 min at 25˚C followed by 15 minute at
50˚C. The reaction is terminated by heating at 85˚C for 5minutes. The product of this
reaction was then used in qPCR. For all qPCR runs, Maxima SYBR Green/ROX qPCR
Master Mix (Thermo Scientific, Wilmington, USA) was used along with specific
primers, product from RT PCT, and nuclease free water for a total volume of 20µl.
30
4. RESULTS
Results are presented as different parts in this section which include the determination
of primer efficiency and optimum annealing temperature for primers, HPLC and gas
chromatography results, and relative gene expression in growth phase and gas phase of
Caloramator celer. The relative gene expression is represented through two endogenous
reference genes recA and polC and the geometric mean of these two genes is also used
for reference.
Primer efficiency and optimum annealing temperature 4.1
From Table 4.1 we can check the primer efficiency and optimal annealing temperatures
of all the primers used. The annealing temperatures of all the primers were in between
61 and 62°C. As for the primer efficiency a majority of primers had an efficiency of
more than 90%. Apart from one primer, the rest were in a 10% with each other.
Therefore, this ensures a minimum variation in the experimental results.
Table 4.1. Optimum annealing temperature and primer efficiency of primers used in
this study.
Primer (r+f) Optimum annealing temperature (°C) Primer efficiency (%)
PFL 61 94.07
PORb 61 94.5
PTA 61 89.76
ACKA 62 94.71
Hyd1 62 95
Hyd2 62 94.3
mbhL 61 92.4
mbhJ 61 91.83
PFLae 62 93.73
PORa 61 96.47
ADH1 61 88.34
ADH2 61.5 94.38
polC 61 100.44
RPOC 62 86.60
DNAA 62 97.87
Reca 62 93.82
31
Fnora 61 92
BADH 62 95.16
RT PCR from total RNA 4.2
The gel below (Fig. 4.1) shows the successful amplification of all the genes involved in
transcription process. The DNase treated purified RNA after being run in the RT PCR
was again run individually with separate primers. This gives a visual indication that the
primers function properly and that the mRNA of the genes involved in the transcription
process was successfully isolated. The controls also signify the absence of any DNA
contamination. The RNA here was isolated at the mid-log phase of the growth cycle.
A B C D E F G H I J K L M N O P
Figure 4.1. The gel below shows the successful amplification of all the genes involved
in transcription process. Where lane A to P denote 16S gDNA, 16S cDNA, pfl, pforb,
pta, adh, mbhH, pfora, adhE, fnora, acka, hyd1, hyd2, no RT control and No cDNA con-
trol.
Growth plot of C. celer for both growth and gas 4.3phase experiment
The growth plot of C. celer is shown in the figures (Fig. 4.2 and Fig 4.3) below. The
samples were taken periodically and its O.D at 600nm was checked. At suitable cell
densities the time point was noted and the extraction took place. All cultures were
grown in replicates for both the experiments and their standard deviation is also includ-
ed below.
32
Figure 4.2. Graph showing the growth plot of C. celer with time for the growth phase
experiment. The extraction for log, mid log and stationary points was done at 50th
, 150th
and 250th
minute.
Figure 4.3. Graph showing the growth plot of C. celer with time for the gas phase ex-
periment. The extraction point for control, hydrogen gas phase culture and CO2 gas
phase culture was at 130th
, 130th
and 185th
minute.
0
0.5
1
1.5
2
2.5
-50 0 50 100 150 200 250 300 350
O.D
at
60
0 n
m
Time (min)
Growth phase experiment
Culture
0
0.5
1
1.5
2
2.5
3
-30 0 30 60 90 120 150 180 210 240 270 300 330 360
O.D
(60
0 n
m)
Time (mins)
Gas phase experiment
Control
Hydrogen
Co2
33
Relative gene expression in growth phase experi-4.4ment of C. celer
Using 2-ΔΔC
T method the relative gene expressions of various genes were plotted.
Samples collected from three different time points were compared to monitor the
varying gene expression levels. Three different endogenous reference systems were
used; recA (Fig. 4.4), polC (Fig. 4.5) and geometric mean and average of polC (Fig. 4.6)
and recA. From the results (Figures 4.4, 4.5 and 4.6) we can notice mid log phase has
the most gene expression while stationary phase has down regulation of gene
expression. Gene expression results in Figures 4.4 and 4.5 follows similar pattern and
their average in Fig. 4.6 shows minimal variance. From Fig. 4.6 we can see that pfl,
pflae, pta and ack, are upregulated in log and mid log phase when compared to 0th
sample, with their mid log phase having greater upregulation. Their stationary phase is
downregulated. Genes like adhE, adh2 and fnora are upregulated in all the three growth
phases when compared to the 0th
sample, with their mid log phase having the highest
gene expression. In contrary, the genes such as porA, porB, hydA, mbhL, mbhJ and badh
have widespread downregulation in all the growth phases.
Figure 4.4. Graph showing relative gene expression in three samples that were ob-
tained during three significant growth phases. 2-ΔΔC
T method is used for the normaliza-
tion of the data. In this graph recA housekeeping gene is used as a reference gene. Neg-
ative value denotes downregulation of gene expression when compared to other genes
at that specific time. Two different replicates were used and their standard deviation
plotted.
-8
-6
-4
-2
0
2
4
6
8
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-ΔΔC
T )
Gene expression with reference to recA
0th sample
log
mid log
stationary
34
Figure 4.5. Graph showing relative gene expression in three samples that were ob-
tained during three significant growth phases. 2-ΔΔC
T method is used for the normaliza-
tion of the data. In this graph polC housekeeping gene is used as a reference gene.
Negative value denotes downregulation of gene expression when compared to other
genes at that specific time while the positive value denotes upregulation. Two different
replicates were used and their standard deviation plotted.
-8
-6
-4
-2
0
2
4
6
8
10
12
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-ΔΔC
T )
Gene expression with reference to polC
0th sample
log
mid log
stationary
35
Figure 4.6. Graph showing relative gene expression in three samples that were ob-
tained during three significant growth phases. 2-ΔΔC
T method is used for the normaliza-
tion of the data. In this graph geometric mean between polC and recA housekeeping
genes were used and their average was used for plotting. Negative value denotes down-
regulation of gene expression when compared to other genes at that specific time. Two
different replicates were used and their standard deviation plotted.
-8
-6
-4
-2
0
2
4
6
8
10
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-ΔΔC
T )
Gene expression with reference to average of polC and
recA
0th sample
log
mid log
stationary
36
Product distribution in growth phase experiment of 4.5C. celer
The metabolic products accumulated with time are given in the graphs below (Figures
4.7, 4.8), along with the yield of the individual products (Table 4.2). All the values con-
tain standard deviation from both the replicates and their variance seems to be negligi-
ble. Fig. 4.7 shows the glucose consumption and metabolite accumulation in the growth
culture. Glucose consumption is rapid between 50th
and 150th
minute of growth, and
then it slows down after that. This can also be correlated with the formate, acetate and
ethanol accumulation where, there is rapid accumulation between 50th
and 150th
minute,
after which the values are maintained. Butyrate is absent. It is also true for hydrogen as
shown in Fig. 4.8 where, after 150th
minute there is a dip in the rate of accumulation.
Figure 4.7. This graph shows the accumulation of products with time, and the
consumption of glucose with time.
-10
0
10
20
30
40
50
60
70
-50 0 50 100 150 200 250 300 350
con
cen
tra
tion
(m
M)
Time (min)
accumulation with time
Glucose
Formate
Acetate
Ethanol
Butyrate
37
Figure 4.8. This graph shows the total hydrogen per liter culture that was produced
with time.
Table 4.2. Yields of all the products formed is given below along with standard
deviation.
Product Yield Standard deviation
Formate 0.61 0.0888
Acetate 1.55 0.2543
Ethanol 0.39 0.0835
Hydrogen 3.21 0.3719
0
500
1000
1500
2000
2500
3000
-50 0 50 100 150 200 250 300
To
tal
H2/l
cu
ltu
re
Time (min)
Total H2/l culture
38
Relative gene expression in gas phase experiment of 4.6C. celer
Using 2-ΔΔC
T method the relative gene expressions of various genes were plotted.
Samples collected from both the hydrogen and CO2 gas phase replicate at specific time
points were compared to monitor the varying gene expression levels. Three different
endogenous reference systems were used; recA, polC and geometric mean and average
of polC and recA. From the results (Fig. 4.9, 4.10, 4.11) we can notice when compared
to the control the level of gene expression in both hydrogen and CO2 gas phase replicate
is very much reduced. Samples with CO2 headspace seem to have fared much worser
than samples with hydrogen headspace. The variance between polC and recA seems to
be significant; however the overall context is maintained as explained in discussion.
From Fig. 4.9 we can see that almost all genes are downregulated in both the CO2 and
hydrogen gas phase cultures with respect to the control. An exception to this is the
porA, mbhL and hyd2 genes from hydrogen gas phase culture which are upregulated.
However this is not the case for Fig. 4.10 where, all the genes from hydrogen gas phase
culture seem to be upregulated, while all the genes from CO2 gas phase culture are
downregulated. Fig. 4.11 can give better clarity to this analysis as it uses the average of
both Fig. 4.9 and 4.10. This fine-tuned data from Fig. 4.11 shows that all the genes from
both the gas phases are significantly downregulated when compared to the control.
Figure 4.9. Graph showing relative gene expression in hydrogen and CO2 head space
samples that were obtained during specific timepoints. 2-ΔΔC
T method is used for the
normalization of the data. In this graph recA housekeeping gene is used as a reference
gene. Negative value denotes downregulation of gene expression when compared to
other genes at that specific time. Two different replicates were used and their standard
deviation plotted.
-4
-3.5
-3
-2.5
-2
-1.5
-1
-0.5
0
0.5
1
1.5
pta porB pfl porA mbhL fnora ack hydA hyd2 adhE badh
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-
ΔΔC
T )
Gene expression with reference to recA
control
CO2
H2
39
Figure 4.10. Graph showing relative gene expression in hydrogen and CO2 head space
samples that were obtained during specific timepoints. 2-ΔΔC
T method is used for the
normalization of the data. In this graph polC housekeeping gene is used as a reference
gene. Negative value denotes downregulation of gene expression when compared to
other genes at that specific time while the positive values denotes upregulation of gene
expression. Two different replicates were used and their standard deviation plotted.
-3
-2.5
-2
-1.5
-1
-0.5
0
0.5
1
1.5
2
pta porB pfl porA mbhL fnora ack hydA hyd2 adhE badh
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-ΔΔC
T )
Gene expression with reference to polC
control
CO2
H2
40
Figure 4.11. Graph showing relative gene expression in hydrogen and CO2 head space
samples that were obtained during specific time points. 2-ΔΔC
T method is used for the
normalization of the data. In this graph geometric mean between polC and recA house-
keeping genes were used and their average was used for plotting. Negative value de-
notes downregulation of gene expression when compared to other genes at that specific
time. Two different replicates were used and their standard deviation plotted.
-3
-2.5
-2
-1.5
-1
-0.5
0
0.5
1
1.5
pta porB pfl porA mbhL fnora ack hydA hyd2 adhE badh
Rel
ati
ve
gen
e ex
pre
ssio
n (
2-ΔΔC
T )
Gene expression with reference to average of polC and
recA
control
CO2
H2
41
Product distribution in gas phase experiment of C. 4.7celer
The metabolic products accumulated with time are given in the graphs below (Figures
4.12, 4.13, 4.14 and 4.15). From Fig. 4.12 it is seen that the formate accumulation is
highest for the control at 17.7mM. The formate accumulation peaks at 150th
minute for
control and CO2 gas phase culture whereas, for hydrogen gasphase culture it peaks at
210th
minute. The acetate accumulation (Fig. 4.13) and glucose consumption (Fig. 4.15)
results correlate with each other and show that the control samples have higher con-
sumption and accumulation when compared to that of the hydrogen gas phase cultures.
However Fig. 4.14 shows that hydrogen gas phase cultures have highest ethanol accu-
mulation at 11.8mM, while control only has 8.4mM of ethanol accumulation. The meta-
bolic yields are given in Fig. 4.16 and it shows that hydrogen gas phase samples have
highest ethanol yield and the control has highest yields of acetate and formate. .
Figure 4.12. Graph shows the accumulation of formate with time in control, hydrogen
and CO2 head space samples.
0
2
4
6
8
10
12
14
16
18
20
-50 0 50 100 150 200 250 300 350
con
cen
tra
tion
(m
M)
Time (min)
Formate accumulation with time
Control
C02
H2
42
Figure 4.13. Graph shows the accumulation of acetate with time in control, hydrogen
and CO2 head space samples.
Figure 4.14. Graph shows the accumulation of ethanol with time in control, hydrogen
and CO2 head space samples. It seems that hydrogen heapspace sample has higher eth-
anol accumulation
0
10
20
30
40
50
60
-50 0 50 100 150 200 250 300 350
con
cen
tra
tion
(m
M)
Time (min)
Acetate accumulation with time
Control
C02
H2
0
2
4
6
8
10
12
14
-50 0 50 100 150 200 250 300 350
con
cen
tra
tion
(m
M)
Time (min)
Ethanol accumulation with time
Control
C02
H2
43
Figure 4.15. Graph shows the consumption of glucose with time in control, hydrogen
and CO2 head space samples.
Figure 4.16. Graph shows Yields of all the products formed along with the standard
deviation. As observed the yield of ethanol is more in hydrogen flushed head space
sample.
0
10
20
30
40
50
60
70
-50 0 50 100 150 200 250 300 350
con
cen
tra
tion
(m
M)
Time (min)
Glucose consumption with time
Control
C02
H2
-0.2
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
Formate Acetate Ethanol Butyrate
Metabolite yields
Control
C02
H2
44
5. DISCUSSION
Statistical significance of the results 5.1
As seen from Table 4.1 the annealing temperature and the primer efficiencies of the
primers were found to be in acceptable levels. Also Figure 4.1 shows the successful
amplification of all the genes involved in transcription process along with no
contamination from intermediary processes. The use of two replicates for each
experiment and inclusion of two different housekeeping genes as a normalizing factor
has helped in validating the significance of the results [60, 82]. Figures 4.4, 4.5 and 4.6,
which are related to the growth phase analysis experiment, shows a level of intrinsic
correlation between the two housekeeping genes. It is important to take into account that
the 2-ΔΔC
T method deduces relative gene expression through an arbitrary value by
comparing with control and reference gene [82]. Therefore the result is more coherent if
the objective is to find out if a target gene is upregulated or downregulated than the
control, rather than finding the absolute percentage of expression. For example, in the
growth phase experiment the normalized results of both recA and polC correlate with
each other in general terms of expression. When the average of these two normalizing
genes was used, a better resolution in terms of gene expression was obtained while the
standard deviation was still relevant. Figure 4.6 was used to understand the levels of
gene expression in the growth phase experiment. However, in special circumstances
(gas phase experiment) such as modified physiological conditions, the normalized
results of gene expression had to be separately studied for each house keeping gene
before combining their average for statistical relevance.
As seen from Figures 4.6 and 4.7, the recA and polC normalized relative gene
expression results from hydrogen gas phase experiment seems to vary between each
other. For this analysis the nature of the housekeeping gene has to be noted which
defines that they are ubiquitously expressed in all the cells of an organism under normal
physiological conditions [71]. However, here the cells were inoculated in an artificially
stressed medium that had high pre inoculation concentration of CO2 and H2 in the
headspace. Therefore in this case the use of two different housekeeping genes for
normalizing the relative gene expression is important in order to resolve the deviation in
analysis and give significant results.
45
Growth dependent transcriptional analysis of 5.2fermentative pathway
Figure 4.6 depicting the relative gene expression of samples collected from log, mid log
and stationary growth phase of C. celer is used for the analysis. Pyruvate formate lyase
(PFL) which produces formate from pyruvate by utilising coenzyme A (CoA) as a
substrate is encoded by pfl gene and the activating enzyme pflae. An analogy between
pfl and pflae can be seen here where they seem to be directly in proportional with each
other in terms of gene regulation [14]. Both the genes are upregulated in log and mid
log growth phase with mid log having the peak expression. From there the gene
expression for both the genes is then downregulated in the stationary phase.
Pyruvate and CoA are the limiting factors governing formate synthesis. As a
result, formate formation is aspected by ethanol, acetate and ferrredoxin dependant
hydrogen pathway [14]. Therefore, Phosphotransacetylase (PTA) and alcohol
dehydrogenase (adh) which are coded by pta and adhE respectively, are upregulated
(mid log) in tandem with pfl and pflae. Acetate which is the primary metabolite that
accounts for 78% of the aggregate soluble metabolite in the growth medium [14, 10] is
produced through PTA and acetate kinase (ACK) enzymes where, ACK is coded by ack
gene. Both pta and ack genes are upregulated equally in both log and mid log phase and
it is comparable to that of pfl and pflae. The upregulation of acetate production genes is
also comparable to that of the glucose consumption and acetate accumulation as seen in
figure 4.7 where the consumption and accumulation is dramatic in the mid log phase.
Both of these genes are then downregulated in the stationary phase. Acetyl CoA is the
end product of formate and ferredoxin dependant hydrogen pathway and used as a
substrate by PTA to carry forward the acetate production. Therefore, an increased gene
expression of pfl in the log and mid log phase ensures and abundant supply of Acetyl
CoA which in turn leads to upregulation of pta and ack.
Acetyl CoA is also the substrate needed for ethanol synthesis. Alcohol
dehydrogenase (ADH) is the enzyme involved in this process and it is coded by adhE
gene. This synthesis competes for NADH, which is also used by the NADH dependant
hydrogenase (hydA) [14]; and releases NAD+ and CoA. The adhE gene seems to be
significantly upregulated in the log and mid log phase. A good supply of acetyl CoA
ensures a continuous manufacture of ethanol and thereby ensuring steady CoA release
needed for formate and ferredoxin dependent hydrogen production. This may also be
partly responsible for upregulation of genes related to formate synthesis. However
unlike acetate and formate synthesis, adhE gene is still upregulated in the stationary
phase.
Ferredoxin-dependent NiFe hydrogenase (Fd H2ase) is one of the two enzymes
in C. celer that is responsible for hydrogen production. It is coded by mbhL and mbhJ.
46
Both of these genes seem to be partially downregulated in log and mid log phase. This
can be attributed to direct competition in acquiring CoA by the formate pathway [14].
This is also evident in the case of porA gene that codes for Pyruvate ferredoxin
oxidoreductase (PFOR) that is needed in the ferredoxin dependent hydrogen production
process. As the formate pathway competes for CoA with PFOR, its gene expression is
maintained at a minimum when compared to that of pfl. Therefore, an observation can
be made that increased upregulation of pfl leads to a downregulation of porA and mbhJ.
NADH-dependent FeFe hydrogenase (NADH H2ase) is the other hydrogenase in
C.celer, and it is coded by hydA. This gene is increasingly downregulated with time
between log, mid log and stationary phase. Competition for NADH between ADH and
NADH H2ase might be a contributing factor especially between mid-log and stationary
phase. In addition to that, as the hydrogen partial pressure in the system increases with
time, the inhibition to hydrogen production also increases, thereby leading to increased
downregulation of all the genes involved in hydrogen production process. In addition to
that a low hydrogen partial pressure is very crucial for the oxidation of NADH to NAD+
which can ensure a higher H2 production [41, 9]. As the concentration of H2 in the
headspace and the liquid space increases rapidly, the reaction becomes
thermodynamically unfavourable [37- 39, 10]. Following which the metabolic pathway
shifts towards the production of reduced end products like ethanol [40, 9]. This could
explain the reason behind the continued downregulation of hydA and mbhL hydrogenase
genes with time while the adhE gene is upregulated with time. The effect of pH on
hydrogen and other metabolites is discussed below.
Gas dependent transcriptional analysis of 5.3fermentative pathway
The cells grown in artificially stressed conditions have given interesting results in terms
of transcriptional analysis. From Figure 4.3 we can see that the culture inoculated in
hydrogen injected medium grows much slower than that of control and its mid log
extraction was at 185th
minute compared to that of control and CO2 phase which was at
130th
minute. Relative gene expression results from figure 4.8 show a severe
downregulation of majority of genes in both CO2 and hydrogen gas phase cultures when
compared to that of the control. With the help of HPLC results, an attempt was made to
correlate these with that of the relative gene expression results.
The pfl gene was downregulated in both the cultures grown at CO2 and hydrogen
gas phase when relatively compared to that of the control. The gene from hydrogen gas
phase culture was found to be more downregulated than that of the CO2 gas phase. It
was also evident in the HPLC results (Figure 4.11) which showed that the formate
47
accumulation for hydrogen gas phase culture at its point of extraction was much lower
than CO2 gas phase culture while control had the highest formate accumulation. This
trend also continues for acetate synthesis where pta and ack genes for both the gas
phase cultures were downregulated. This correlated with the HPLC results (Figures 4.13
and 4.15) which showed that acetate accumulation and glucose consumption was much
lower than control with hydrogen gas phase culture having the lowest values. Since
acetyl CoA is vital for acetate synthesis, the downregulation of genes in formate
pathway might have contributed to the reduced gene expression of pta and ack genes
which in turn affects the supply of CoA. A better explanation can also be indicated
through ethanol pathway because ADH requires acetyl CoA as substrate for ethanol
synthesis.
Ethanol synthesis in the two gas phase cultures has taken a turn for the
interesting because the HPLC results (Figure 4.14) shows that both the cultures have
higher ethanol accumulation than that of the control, with hydrogen phase culture
having the highest accumulation. This is especially true at the end of the growth phase.
Even though adhE gene is downregulated for both the gas phases at its point of
extraction, the cells in the gas phase under severe physiological stress might have
switched to ethanol pathway. Therefore as time passed from mid log phase, the acetate
pathway for the cells in gas phase culture would have been downregulated even more
because of increased gene expression of adhE gene in order to produce more ethanol.
As discussed above the increased H2 concentration in the headspace has favored the
ethanol production due to which the ethanol concentration is highest in the hydrogen
gas phase experiment [40, 9].
These gas phase experiments provided valuable insights into genes involved in
hydrogen production. It was seen that hydA was downregulated for both the gas phase
cultures in an equal manner because of the thermodynamically unfavorable process due
to increased H2 concentration [37- 39, 10], which in turn led to increased ethanol
production. However in the case of mbhL gene, it was seen that the gene was more
downregulated in the presence of hydrogen in the culture. This is because in the CO2
gas phase culture the mbhL gene was expressed equal to that of the control, while in the
H2 gas phase culture that same gene was significantly downregulated. This shows that
this gene is also sensitive to the presence of hydrogen in the system. The fnor gene
which codes for NADH:ferredoxin oxidoreductase depends on the hydrogen partial
pressure [41, 9]. The down regulation of this gene can be attributed to this aspect.
The importance of pH in the system cannot be overstated. When the pH
decreases the hydrogen production is hampered [42, 10]. Usually in prolonged
fermentation, volatile fatty acids are produced which drops the pH well below the
optimal range [10]. This may be the cause for downregulation of hydrogenase genes
over prolonged periods for both the growth phase and gas phase experiment. However,
48
as the pH decreases more, the cellular function is disrupted and other soluble metabolite
pathways are also inhibited. This may explain why the genes are downregulated in the
stationary phase. This is especially true for the CO2 gas phase experiment where, its
addition into the serum bottle might have contributed to pH drop. This drop in pH has
contributed to all its genes being downregulated.
49
6. CONCLUSION
Through this work the metabolic interdependency within the fermentative pathway of C.
celer was studied. The intricate relationship between acetate, formate and ethanol
pathways has shown the limiting factors involved in their individual synthesis and their
direct competition on hydrogen production was analyzed through transcription. Formate
and ethanol pathway competed with the hydrogen production pathway and this caused
down regulation of mbhL and hydA genes. The effect of different physiological states on
the cell was studied through the route of relative gene expression. The importance of pH
and hydrogen partial pressure was studied from a transcription point of view. It was also
found that the cultures grown in artificially stressed gas phase media had a widespread
downregulation of its genes, this valuable data can be used in future for metabolic
engineering.
In order to produce an efficient hydrogen producing system, limiting factors
have to be removed. However this study has shown that removal or suppression of
interdependent pathways can negatively affect the desired product production.
Therefore future attempts at metabolic engineering have to make sure that balance is
reached. This can be circumvented if genetic engineering is used to provide alternate
efficient pathways. More research can be undertaken to develop metabolite resistant
strains that can resist the inhibition due to the buildup of toxic metabolites. C. celer has
to undergo more work in order to make it industrially viable for hydrogen production.
Nonetheless, C. celer provides interesting new possibilities with respect to clean energy
production.
50
REFERENCES
[1] Baltzer, F. ‘Theodor Boveri’. Science, 1964. 144: 809–815.
[2] McKusick, V.A. Walter S. Sutton and the physical basis of Mendelism. Bull Hist
Med, 1960. 34: 487–497.
[3] Avery, O.T., MacLeod, C.M. & McCarty, M. Studies on the chemical nature of
the substance inducing transformation of Pneumococcal types. J. Exp. Med,
1944. 79: 137–158.
[4] Daneholt, B., & Annika, R. Advanced Information: RNA interference. The
Nobel Prize in Physiology or Medicine. Nobelprize.org. Nobel media AB 2014.
2006. [Accessed on 06.04.2013]. Available at: http://www.nobelprize.org/no-
bel_prizes/medicine/laureates/2006/advanced.html.
[5] Sinha, P., Pandey, A. An evaluative report and challenges for fermentative
biohydrogen production. Journal of Hydrogen Energy, 2011. 36: 7460–78.
[6] Das, D., Veziroğlu, T.N. Hydrogen production by biological processes: a survey
of literature. International Journal of Hydrogen Energy, 2001. 26: 13–28.
[7] Baena, S., Patel, B.K. 2009. Genus V. Caloramator Collins, Lawson, Willems,
Cordoba, Fernández-Garayzábal, Garcia, Cai, Hippe and Farrow 1994, 812VP
emend. Chrisostomos, Patel, Dwivedi and Denman 1996, 497: 834–838. In De
Vos, P., Garrity, G., Jones, D., Krieg, N.R., Ludwig, W., Rainey, F.A., Schleifer,
K.H., Whitman, W.B (ed). Bergey’s manual of systematic bacteriology, 2nd ed,
vol 3. The Firmicutes. Springer-Verlag, New York.
[8] Engle, M., Li, Y., Rainey, F., DeBlois, S., Mai, V., Reichert, A., Mayer, F.,
Messner, O., Wiegel, J. Thermobrachium celere gen. nov., sp. nov., a rapidly
growing thermophilic, alkalitolerant, and proteolytic obligate anaerobe. Int. J.
Syst. Bacteriol, 1996. 46: 1025–1033.
[9] Ciranna, A., Santala, V., Karp, M. Biohydrogen production in alkalithermophilic
conditions: Thermobrachium celere as a case study. Bioresource Technology,
2011. 102: 8714–8722.
[10] Ciranna, A., Santala, V., Karp, M. Enhancing biohydrogen production of the
alkalithermophile Thermobrachium celere. Int. Journal of Hydrogen Energy,
2012. 37: 5550–5558.
[11] Koskinen, P.E.P., Lay, C., Puhakka, J.A., Lin, P., Wu, S.Y., Orlygsson, J. High-
efficiency hydrogen production by an anaerobic, thermophilic enrichment
culture from an Icelandic hot spring. Biotechnol. Bioeng, 2008. 4: 665–678.
51
[12] Volbeda, A., Charon, M.H., Piras, C., Hatchikian, E.C., Frey, M., Fontecilla-
camps J.C. Crystal-structure of the nickel–iron hydrogenase from Desulfovibrio
gigas. Nature, 1995. 373: 580–587.
[13] Hiromoto, T., Ataka, K., Pilak, O., Vogt, S., Stagni, M.S., Meyer-Klaucke, W.,
et al. The crystal structure of C176A mutated [Fe]-hydrogenase suggests an
acyl-iron ligation in the active site iron complex. FEBS Lett, 2009. 583(3): 585–
590.
[14] Ciranna, A., Ferrari, R., Santala, V., Karp, M. Inhibitory effects of substrate and
soluble end products on biohydrogen production of the alkalithermophile
Caloramator celer: Kinetic, metabolic and transcription analyses. Int. Journal of
Hydrogen Energy, 2014. 39: 6391–6401.
[15] Shafaat, H.S., Rüdiger, O., Ogata, H., Lubitz, W. [NiFe] hydrogenases: A
common active site for hydrogen metabolism under diverse conditions.
Biochimica et Biophysica Acta, 2013. 1827: 986-1002.
[16] Chou, C.J., Jenney Jr., F.E., Michael, W.W., Adams, M.W.W., Kelly, R.M.
Hydrogenesis in hyperthermophilic microorganisms: implications for biofuels.
Metab. Eng, 2008. 10: 394–404.
[17] Kengen, S.W.M., Goorissen, H.P., Verhaart, M.R.A., Stams, A.J.M., Van Niel,
E.W.J., Claassen, P.A.M. Biological Hydrogen Production by Anaerobic
Microorganisms. In: Soetaert, W., Verdamme, E.J. (Eds.), Biofuels. John Wiley
& Sons, 2008, Chichester. 197–221.
[18] Chevreux, B., Wetter, T., Suhai, S. Genomic sequence assembly using trace
signals and additional sequence information. Computer science and biology:
proceedings of the German conference on bioinformatics (GCB), 1999,
Hannover, Germany. 45–56.
[19] Boetzer, M., Henkel, C.V., Jansen, H.J., Butler, D., Pirovano, W. Scaffolding
pre-assembled contigs using SSPACE. Bioinformatics, 2011. 27: 578–579.
[20] Aziz, R.K., Bartels, D., Best, A.A., DeJongh, M., Disz, T., Edwards, R.A.,
Formsma, K., Gerdes, S., Glass, E.M., Kubal, M., Meyer, F., Olsen, G.J., Olson,
R., Osterman, A.L., Overbeek, R.A., McNeil, L.K., Paarmann, D., Paczian, T.,
Parrello, B., Pusch, G.D., Reich, C., Stevens, R., Vassieva, O., Vonstein, V.,
Wilke, A., Zagnitko, O. The RAST server: rapid annotations using subsystems
technology. BMC Genomics, 2008. 9: 75.
[21] Ciranna, A., Larjo, A., Kivisto, A., Santala, V., Roos, C., Karp, M. Draft
genome sequence of the hydrogen and ethanol producing anaerobic
alkalithermophilic bacterium Caloramator celer. Genome Announc. 2013;
1(4):e00471e3.
[22] Soboh, B., Linder, D., Hedderich, R. A multisubunit membrane bound [NiFe]-
hydrogenase and an NADH-dependent Fe-only hydrogenase in the fermenting
bacterium Thermoanaerobacter tengcongensis. Microbiology, 2004. 150: 2451–
2463.
52
[23] Sapra, R., Verhagen, M.F., Adams, M.W. Purification and characterization of a
membrane-bound hydrogenase from the hyperthermophilic archaeon Pyrococcus
furiosus. J. Bacteriol, 2000. 182: 3423–3428.
[24] Wukovits, W., Drljo, A., Hilby, E., Friedl, A. Integration of Biohydrogen
Production with Heat and Power Generation from Biomass Residues. Chemical
Engineering Transactions, 2013. 35: 1003–1008.
[25] Guo, X.M., Trably, E., Latrille, E., Carrère, H., Steyer, J. Hydrogen production
from agricultural waste by dark fermentation: A review. International Journal of
Hydrogen Energy, 2010. 35: 10660–73.
[26] Kotsopoulos, T.A., Fotidis, I.A., Tsolakis, N., Martzopoulos, G.G. Biohydrogen
production from pig slurry in a CSTR reactor system with mixed cultures under
hyper-thermophilic temperature (70ºC). Biomass Bioenergy, 2009. 33: 1168-74.
[27] Vijayaraghavan, K., & Ahmad, D. Biohydrogen generation from palm oil mill
effluent using anaerobic contact filter. Journal of Hydrogen Energy, 2006. 31:
1284–91.
[28] Hallenbeck, P.C., & Benemann, J.R. Biological hydrogen production;
fundamentals and limiting processes. International Journal of Hydrogen Energy,
2002. 27: 1185–1193.
[29] Adams M.W. The structure and mechanism of iron-hydrogenases. Biochim
Biophys Acta, 1990. 1020: 115–45.
[30] Nicolet, Y., Fontecilla-Camps, J.C., Fontecave, M. Maturation of [FeFe]-
hydrogenases: Structures and mechanisms. International journal of Hydrogen
energy, 2010. 35: 10750–10760.
[31] Pierik, A.J., Hulstein, M., Hagen, W.R., Albracht, S.P.J. A low-spin iron with
CN and CO as intrinsic ligands forms the core of the active site in [Fe]-
hydrogenases. Eur J Biochem, 1998. 258: 572–8.
[32] Bagley, K.A., Vangarderen, C.J., Chen, M., Duin, E.C., Albracht, S.P.J.,
Woodruff, W.H. Infrared studies on the interaction of carbon-monoxide with
divalent nickel in hydrogenase from Chromatium vinosum. Biochemistry, 1994.
33: 9229–9236.
[33] Nicolet, Y., De Lacey, A.L., Vernede, X., Fernandez, V.M., Hatchikian, E.C.,
Fontecilla-Camps, J.C. Crystallographic and FTIR spectroscopic evidence of
changes in Fe coordination upon reduction of the active site of the Fe-only
hydrogenase from Desulfovibrio desulfuricans. J Am Chem Soc, 2001. 123:
1596–601.
[34] Mulder, D.W., Ortillo, D.O., Gardenghi, D.J., Naumov, A.V., Ruebush, S.S.,
Szilagyi, R.K., et al. Activation of HydAΔEFG
requires a preformed [4Fe–4S]
cluster. Biochemistry, 2009. 48: 6240–6248.
[35] Madden, C., Vaughn, M.D., Díez-Pérez, I., Brown, K.A., King, P.W., Gust, D.,
Moore, A.L., Moore, T.A. Catalytic Turnover of [FeFe]-Hydrogenase Based on
Single-Molecule Imaging. J. Am. Chem. Soc, 2012. 134: 1577–1582.
53
[36] Ogata, H., Mizoguchi, Y., Mizuno, N., Miki, K., Adachi, S., Yasuoka, N., Yagi,
T., Yamauchi, O., Hirota, S., Higuchi, Y. Structural Studies of the Carbon
Monoxide Complex of [NiFe]-hydrogenase from Desulfovibrio vulgaris
Miyazaki F: Suggestion for the Initial Activation Site for dihydrogen. Journal of
the American Chemical Society, 2002. 124: 11628–11635.
[37] Yoshida, A., Nishimura, T., Kawaguchi, H., Inui, M., Yukawa, H. Enhanced
hydrogen production from glucose using ldh- and frd-inactivated Escherichia
coli strains. Appl Environ Microbiol., 2006. 73: 67–72.
[38] De Vrije, T., Mars, A.E., Budde, M.A., Lai, M.H., Dijkema, C., De Waard, P., et
al. Glycolytic pathway and hydrogen yield studies of the extreme thermophile
Caldicellulosiruptor saccharolyticus. Appl Microbiol Biotechnol., 2007. 74:
1358–1367.
[39] Willquist, K., Zeidan, A.A., van Niel, E.W.J. Physiological characteristics of the
extreme thermophile Caldicellulosiruptor saccharolyticus: an efficient hydrogen
cell factory. Microb Cell Fact., 2010. 9: 89.
[40] Levin, D.B., Pitt, L., Love, M. Biohydrogen production: prospects and
limitations to practical application. Int. J. Hydrogen Energy, 2004. 29: 173–185.
[41] Mandal, B., Nath, K., Das, D. Improvement of biohydrogen production under
decreased partial pressure of H2 by Enterobacter cloacae. Biotechnol. Lett.,
2006. 28: 831–835.
[42] Wang, J., Wan, W. Factors influencing fermentative hydrogen production: a
review. International Journal of Hydrogen Energy, 2009. 34: 799–811.
[43] Ogata, H., Lubitz, W., Higuchi, Y. [NiFe] hydrogenases: structural and
spectroscopic studies of the reaction mechanism. Dalton Trans., 2009. 37:
7577–7587.
[44] Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T. A comparative view of
metabolite and substrate stress and tolerance in microbial bioprocessing: from
biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng, 2010.
12: 307–331.
[45] Jones, D.T., Woods, D.R. Acetone-butanol fermentation revisited. Microbiol
Rev., 1986. 50: 484–524.
[46] Van Niel, E.W.J., Claassen, P.A.M., Stams, A.J.M. Substrate and product
inhibition of hydrogen production by the extreme thermophile,
Caldicellulosiruptor saccharolyticus. Biotechnol Bioeng., 2003. 81: 255–262.
[47] Mooney, R.A., Artsimovitch, I., Landick, R. Minireview: Information
Processing by RNA Polymerase: Recognition of Regulatory Signals during
RNA Chain elongation. Journal of Bacteriology, 1998. 180: 3265–3275
[48] Berg, J.M., Tymoczko, J.L., Stryer, L. Biochemistry (6th
ed.). W. H. Freeman,
2006, San Francisco. 850p.
[49] Raven, P., Johnson, G., Mason, K., Losos, J., Singer, S. Biology (9th ed.).
McGraw-Hill, 2010, New York. 278–301.
54
[50] Higuchi, R., Dollinger, G., Walsh, P.S., Griffith, R. Simultaneous amplification
and detection of specific DNA sequences. Biotechnology, 1992. 10: 413–417.
[51] Higuchi, R., Fockler, C., Dollinger, G., Watson, R. Kinetic PCR: Real time
monitoring of DNA amplification reactions. Biotechnology, 1993. 11: 1026–
1030.
[52] Alker, A.P., Mwapasa, V., Meshnick, S.R. Rapid real-time PCR genotyping of
mutations associated with sulfadoxine-pyrimethamine resistance in Plasmodium
falciparum. Antimicrob. Agents Chemother., 2004. 48: 2924–2929.
[53] Ward, C.L., Dempsey, M.H., Ring, C.J., Kempson, R.E., Zhang, L., Gor, D.,
Snowden, B.W., Tisdale, M. Design and performance testing of quantitative real
time PCR assays for Influenza A and B viral load measurement. J. Clin. Virol.,
2004. 29: 179–188.
[54] Cheng, J., Zhang, Y., Li, Q. Real-time PCR genotyping using displacing probes.
Nucl. Acids Res., 2004. 32: 54–61.
[55] Gibson, N.J. The use of real-time PCR methods in DNA sequence variation
analysis. Clin. Chim. Acta., 2006. 363: 32–47.
[56] Bi´eche, I., Olivi, M., Champ´eme, M.H., Vidaud, D., Lidereau, R., Vidaud, M.
Novel approach to quantitative polymerase chain reaction using real-time
detection: Application to the detection of gene amplification in breast cancer.
Int. J. Cancer, 1998. 78: 661–666.
[57] Koenigshoff, M., Wilhelm, J., Bohle, R.M., Pingoud, A., Hahn, M. HER-2/neu
gene copy number quantified by real-time PCR: Comparison of gene
amplification heterozygosity, and immune-histochemical status in breast cancer
tissue. Clin. Chem., 2003. 49: 219–229.
[58] Gibson, U.E., Heid, C.A., Williams, P.M. A novel method for real time
quantitative RT-PCR. Genome Res., 1996. 6: 995–1001.
[59] Gallaghar, S.R., Wiley, E.A., Fraga, D., Meulia, T., Fenster, S. Real time PCR in
Current Protocols Essential Laboratory Techniques. John Wiley and Sons, 2008,
New Jersey. 800p.
[60] Kozera, B., & Rapacz, M. Reference genes in real-time PCR. J Appl Genetics,
2013. 54: 391–406.
[61] Gachon, C., Mingam, A., Charrier, B. Real-time PCR: what relevance to plant
studies? J Exp Bot., 2004. 55: 1445–1454
[62] Bustin, S.A. Quantification of mRNA using real-time reverse transcription PCR
(RT-PCR): trends and problems. J. Mol. Endocrinol., 2002. 29: 23–39.
[63] Huggett, J., Bustin, S. Standardisation and reporting for nucleic acid
quantification. Accred Qual Assur., 2011. 16: 399–405
[64] Deepak, S., Kottapalli, K., Rakwal, R., et al. Real-Time PCR: Revolutionizing
Detection and Expression Analysis of Genes. Curr. Genomics, 2007. 8(4): 234–
51.
55
[65] Burchill, S.A., Lewis, I.J., Selby, P. Improved methods using the reverse
transcriptase polymerase chain reaction to detect tumor cells. Br. J. Cancer,
1999. 79: 971–977.
[66] Xi, L., Nicastri, D.G., El-Hefnawy, T., Hughes, S.J., Luketich, J.D., Godfrey,
T.E. Optimal markers for real-time quantitative reverse transcription PCR
detection of circulating tumor cells from melanoma, breast, colon, esophageal,
head and neck, and lung cancers. Clin. Chem., 2007. 53 (7): 1206–15.
[67] Tu, X., Das, K., Han, Q., Bauman, J.D., Clark, A.D., Hou, X., Frenkel, Y.V.,
Gaffney, B.L., Jones, R.A., Boyer, P.L., Hughes, S.H., Sarafianos, S.G., Arnold,
E. Structural basis of HIV-1 resistance to AZT by excision. Nat. Struct. Mol.
Biol., 2010. 17(10): 1202–1209.
[68] Pfaffl, M.W. Quantification strategies in real-time PCR. A-Z of quantitative
PCR. International University Line, 2004, California. 87–112
[69] Sanders, R., Mason, D.J., Foy, C.A., Huggett, J.F. Considerations for accurate
gene expression measurement by reverse transcription quantitative PCR when
analysing clinical samples. Anal Bioanal Chem., 2014. 406(26): 6471–6483.
[70] Luhtala, N., Parker, R. T2 Family ribonucleases: Ancient enzymes with diverse
roles. Trends in Biochemical Sciences, 2010. 35(5): 253.
[71] Zhu, J., He, F., Hu, S., Yu, J. On the nature of human housekeeping genes.
Trends in genetics, 2008. 24(10): 481–484.
[72] Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M.,
Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer,
C.T. The MIQE guidelines: minimum information for publication of quantitative
real-time PCR experiments. Clin Chem., 2009. 55: 611–622.
[73] Huggett, J., Dheda, K., Bustin, S., Zumla, A. Real-time RT-PCR normalisation;
strategies and considerations. Genes Immun., 2005. 6: 279–284
[74] Mallona, I., Lischewski, S., Weiss, J., Hause, B., Egea-Cortines, M. Validation
of reference genes for quantitative real-time PCR during leaf and flower
development in Petunia hybrida. BMCPlant Biol., 2010. 10:4.
[75] Chervoneva, I., Li, Y., Schulz, S., Croker, S., Wilson, C., Waldman, S.A.,
Hyslop, T. Selection of optimal reference genes for normalization in quantitative
RT-PCR. BMC Bioinforma., 2010. 11:253.
[76] Nicot, N., Hausman, J.F., Hoffmann, L., Evers, D. Housekeeping gene selection
for real-time RT-PCR normalization in potato during biotic and abiotic stress. J
Exp Bot., 2005. 56(421): 2907–2914.
[77] Andersen, C.L., Jensen, J.L., Ørntoft, T.F. Normalization of real-time
quantitative reverse transcription-PCR data: a model-based variance estimation
approach to identify genes suited for normalization, applied to bladder and colon
cancer data sets. Cancer Res., 2004. 64: 5245–5250.
[78] Banach-Orlowska, M., Fijalkowska, I.J., Schaaper, R.M., Jonczyk, P. DNA
polymerase II as a fidelity factor in chromosomal DNA synthesis in Escherichia
coli. Mol. Microbiol., 2005 58(1): 61–70.
56
[79] Olson, M.W., Dallmann, H.G., McHenry, C.S. DnaX complex of Escherichia
coli DNA polymerase III holoenzyme. The chi psi complex functions by
increasing the affinity of tau and gamma for delta.delta’ to a physiologically
relevant range. J. Biol. Chem.,1995. 270(49): 29570–29577.
[80] Huang, Y.P., Ito, J. DNA Polymerase C of the Thermophilic Bacterium Thermus
aquaticus: Classification and Phylogenetic Analysis of the Family C DNA
Polymerases. J Mol Evol., 1999. 48: 756–769.
[81] Chen, Z., Yang, H., Pavletich, N.P. Mechanism of homologous recombination
from the RecA–ssDNA/dsDNA structures. Nature, 2008. 453: 489–494.
[82] Livak, K.J., Schmittgen, T.D., Analysis of Relative Gene Expression Data Using
Real- Time Quantitative PCR and the 2-ΔΔC
T Method. Methods, 2001. 25: 402–
408.
[83] Winer, J., Jung, C.K., Shackel, I., Williams, P. M. Development and validation
of real-time quantitative reverse transcriptase-polymerase chain reaction for
monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem., 1999.
270, 41–49.
[84] Schmittgen, T.D., Zakrajsek, B.A., Mills, A.G., Gorn, V., Singer, M.J., Reed,
M.W. Quantitative reverse transcription-polymerase chain reaction to study
mRNA decay: comparison of endpoint and real-time methods. Anal. Biochem.,
2000. 285: 194–204.
[85] Savir, Y. & Tlusty, T. RecA-mediated homology search as a nearly optimal
signal detection system. Molecular Cell, 2010. 40(3): 388–96.
[86] De Vlaminck, I.,van Loenhout, M.T.J., Zweifel, L., den Blanken, J., Hooning,
K., Hage, S., Kerssemakers, J., Dekker, C. Mechanism of Homology
Recognition in DNA Recombination from Dual-Molecule Experiments.
Molecular Cell, 2012. 46(5): 616–624.
[87] Wing, R.A., Bailey, S., Steitz, T.A. Insights into the replisome from the
structure of a ternary complex of the DNA polymerase III -subunit. J Mol Biol,
2008. 382: 859–869.
[88] Lamers, M.H., & Mike O’Donnell. A consensus view of DNA binding by the C
family of replicative DNA polymerases. Proc Natl Acad Sci., 2008. 105(52):
20565–20566.
[89] D’Urso, G., Grallert, B., Nurse, P. DNA polymerase alpha, a component of the
replication initiation complex, is essential for the checkpoint coupling S phase to
mitosis in fission yeast. J. Cell Sci., 1995. 108: 3109–3118.
[90] Navas, T.A., Zhou, Z., Elledge, S.J. DNA polymerase epsilon links the DNA
replication machinery to the S phase checkpoint. Cell, 1995. 80: 29–39.
[91] Miguel, G.D., & Bebenek, K. Multiple functions of DNA polymerases. CRC
Crit Rev Plant Sci., 2007. 26(2): 105–122.
[92] Bray, C.M., West, C.E. DNA repair mechanisms in plants: crucial sensors and
effectors for the maintenance of genome integrity. New Phytol., 2005. 168: 511–
528.