LISTERIA MONOCYTOGENES

Hin-chung Wong

Soochow University

________________________________________________________________ 1. INTRODUCTION 2. TAXONOMY 2.1. Taxonomy and General Characteristics 2.2. DNA fingerprinting and Ribotyping

2.3. Pulsed-field gel electrophoresis 2.4. Variable-number tandem-repeats analysis

2.5. Serotyping 2.6. Lineages

3. ECOLOGY AND OCCURRENCE IN FOODS 3.1. Environment 3.2. In Food Systems 4. SURVIVAL OF L. MONCYTOGENES IN FOOD 4.1. Dairy Products 4.2. Meat and Meat Products 4.3. Vegetables 5. ISOLATION AND ENUMERATION 5.1. Enrichment Procedures 5.2. Isolation Procedures 5.3. Confirmation of Listeria species 5.4. Direct Plating for Isolation and Enumeration 5.5. Rapid Detection of L. monocytogenes 5.5.1. Fluorescent Immunoassay and Flow Cytometry 5.5.2. Electrical Method 5.5.3. Enzyme-linked Immunosorbent Assay 5.5.4. Nucleic Acid Probe Hybridization Assays 5.5.5. Polymerase chain reaction

5.5.6. Real-time PCR 6. CONTROL OF L. MONOCYTOGENES 6.1. Temperature

1

6.2. Acidity and organic acid 6.3. Sodium Chloride 6.4. Carbon Dioxide and Decreased Oxygen Levels 6.5. Irradiation 6.6. Chlorine 6.7. Nitrate and Nitrite 6.8. Bacteriocin 6.9. Other Additives

6.10. Combined factors 7. PATHOGENICITY AND TOXIN PRODUCTION 7.1. Forms of Human Listeriosis 7.2. Characteristics of Virulent L. monocytogenes 7.3. Invasiveness and Intracellular Growth 7.4. Hemolysins of L. monocytogenes 7.4.1. Production of Listeriolysin 7.4.2. Purification of Listeriolysin 7.4.3. Characteristics of Listeriolysin 7.4.4. Toxicity of Listeriolysin 7.4.5. Function of Listeriolysin 7.4.6. Molecular Study of Listeriolysin 7.4.7. The CAMP Factor 7.5. Expression of virulence factors 8. CONCLUSIONS

9. REFERENCES _______________________________________________________________

2

1. INTRODUCTION Listeria is not a new organism. It was probably first seen in tissue sections from patients as early as 1891 and was first isolated in 1911 from rabbit liver in Sweden (Wehr, 1987). Listeria monocytogenes was first described in detail in 1926 causing a spontaneous epidemic of infection among laboratory animals. The generic name was chosen in honor of the surgeon Lord Lister (McLauchlin, 1987). The first report of listeriosis in humans was by Nyfeldt in 1929. This bacterium has been extensively used in studies on experimental infections in animals, contributed significantly to the understanding of intracellular pathogenicity of bacteria and cell-mediated immune system. However, the isolation techniques were not always successful in the past. As the technique of isolation and detection improved, and a number of outbreaks occurred over the world, L. monocytogenes has become a new interest of study. Today's concern with Listeria is due to an increased awareness of the organism's ability to cause food-borne disease and the isolation of Listeria from foods (Schlech et al., 1983). Food-borne outbreaks implicating Listeria as the causative agent have been relatively few (Table 1, 2) (McLauchlin, 1987; Wehr, 1987). A case of listeriosis associated with the consumption of a soft cheese produced in England was reported. Phage-typing of 68 isolates of L. monocytogenes from cheese samples and the factory showed that 97% were indistinguishable from the strain isolated from the patient's cerebrospinal fluid and stool (McLauchlin et al., 1990).

3

In contrast to these epidemics, human listeriosis typically occurs sporadically. Due to the changes in agricultural practices, listeriosis in animals has increased, and also due to the use of untreated human sewage sludge and animal slurry on agricultural land, listeriosis in human also has increased. In 1985, McLauchlin estimated that 0.3 case per 105 of the total population, and one case of perinatal listeriosis per 20,000 births in United Kingdom (Fig. 1) (McLauchlin, 1987). Cases of adult and perinatal listeriosis also increased in the maritime provinces of Canada (Schlech et al., 1983).

The Food and Drug Administration has determined that there is zero tolerance (<1 organism per 25 g of sample) for Listeria species in food. There have been several recent recalls of products containing Listeria species; these have generally consisted of dairy products, notably cheese and ice cream (Butman et al., 1988). 2. TAXONOMY 2.1. Taxonomy and General Characteristics The Genus Listeria contains eight species: L. monocytogenes, L. ivanovii, L.innocua, L. welshimeri, L. seeligeri, L. murrayi, L. grayi and L. denitrificans (Seeliger and Jones, 1984). On the basis of numerical taxonomic, serological,

4

and DNA/DNA hybridization studies, a very close relationship was shown between L. grayi and L. murrayi, and they were, respectively, 3-29% and 1-9% related to other reference strains of Listeria (Rocourt et al., 1982). The taxonomic position of these two species is controversial. It is generally agreed that L. denitrificans is not a member of the Genus Listeria. Listeria spp. are regular short rods, 0.4-0.5 μm in diameter and 0.5-2 μm in length. In older or rough cultures, filaments of 6-20 μm or more in length may develop. They are Gram-positive, no capsule, no spores, aerobic and facultatively anaerobic, and motile by a few peritrichous flagella when cultured at 20-25 C. The colonies appear bluish gray by normal illumination and a characteristic blue-green sheen is produced by obliquely transmitted light. Optimum growth temperature is between 30 and 37 C and limits of growth 1-45 C. Minimum growth temperature of L. monocytogenes, determined by using a flooding technique, in a plate-type continuous temperature gradient incubator, was 1.1 C. The growth of non-hemolytic Listeria was unobservable at 1.7 C (Junttila et al., 1988), and did not survive heating at 60 C for 30 min (Seeliger and Jones, 1984). General biochemical characteristics are: catalase positive, oxidase negative, cytochromes produced. Fermentative metabolism of glucose results in the production of mainly L(+)-lactic acid. Acid but no gas produced from a number of other sugars, Methyl red positive, Voges-Proskauer positive. Exogenous citrate is not utilized. Organic growth factors are required. Indole is not produced. Esculin and sodium hippurate are hydrolyzed. Urea is not hydrolyzed. Gelatin, casein and milk are not hydrolyzed (Table 3) (Seeliger and Jones, 1984). Aerobically, all species grow on glucose, forming lactic acid and/or acetic acid, and maltose and lactose support growth of some strains, but sucrose did not support growth of any strain tested. Anaerobically, only hexoses and pentoses supported growth, and only lactic acid was formed (Pine et al., 1989).

5

Listeria strains are reported to be sensitive to ampicillin, carbenicillin, cephaloridine, chloramphenicol, erythromycin, furazolidone, methicillin, neomycin, novobiocin, oleandomycin, ticarcillin, azlocillin; less sensitive to chlortetracycline, oxytetracycline, tetracycline, gentamicin, kanamycin, nitrofurantoin, pencillin G, streptomycin. Strains are resistant to colistin sulfate,

6

nalidixic acid, polymyxin B and sulfonamides (Seeliger and Jones, 1984). A cryptic plasmid has been demonstrated in L. ivanovii (Seeliger and Jones, 1984). Bacteriocins are produced by a high proportion of strains examined. The bacteriocins do not inhibit Gram-negative bacteria but are active against staphylococci and bacilli (Seeliger and Jones, 1984). Antibiotic susceptibility of foodborne L. monocytogenes strains were examined by using the automated VITEK2 system. Clinical breakpoints for Listeria susceptibility testing are defined according to the Clinical and Laboratory Standard Institute (CLSI), in the present study the CLSI criteria for staphylococci were applied. Among the 120 tested strains, 14 (11.7%) displayed resistance to at least one antibiotic. In particular, resistance to one antibiotic was more common than multiple resistance, i.e., 10 (8.3%) isolates were resistant to one antibiotic, 3 (2.5%) to two antibiotics and one (0.8%) to five antibiotics. Resistance to clindamycin was the most common, followed by linezolid, ciprofloxacin, ampicillin and rifampicin, trimethoprim/sulphamethoxazole and, finally, vancomycin and tetracycline. This study shows that L. monocytogenes strains from food and food-processing environments are susceptible to the antibiotics commonly used in veterinary and human listeriosis treatment (Table 4) (Conter et al., 2009).

7

2.2. DNA fingerprinting and Ribotyping DNA fingerprinting and ribotyping can be used to discriminate strains of L. monocytogenes isolated from foods or from clinical specimens (Baloga and Harlander, 1991; Nocera et al., 1990; Wesley and Ashton, 1991). DNA fingerprints were done by digesting the cellular DNA with restriction enzymes (BamHI, HindIII, HaeIII, HhaI, EcoRI, and PstI) followed by agarose gel electrophoresis. Ribotyping was performed by Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from E. coli 16S and 23S rRNA. The most discriminating enzyme for ribotyping of strains was EcoRI, which divided the 28 strains of L. monocytogenes into 6 ribotype groups. DNA fingerprinting and ribotyping differentiated L. monocytogenes from other Listeria species (Baloga and Harlander, 1991). 2.3. Pulsed-field gel electrophoresis PFGE and other subtyping methos were used to analysis 44 human isolates from apparently sporadic cases of infection in the Lombardy region and in the Province of Florence, Italy, in the years 1996 to 2007. Based on the results of the different subtyping methods, 10 occasions were detected when strains of L. monocytogenes with the same subtype were isolated from more than one listeriosis case. A total of 28 (66.7%) of 44 isolates were attributed to molecular subtype clusters (Fig. 2) (Mammina et al., 2009).

8

2.4. Variable-number tandem-repeats analysis Variable-number tandem-repeats analysis or multiple-locus variable-number tandem-repeats analysis (MLVA) method for genotyping has proven to be a fast and reliable typing tool in several bacterial species. The information provided by two fully sequenced L. monocytogenes strains was used to develop a MLVA assay coupled with high-resolution capillary electrophoresis and compared it to pulsed-field gel electrophoresis (PFGE) (Lindstedt et al., 2008). In this method, the flanking sequences for each of the VNTR loci in the sequenced strains were aligned and primers were designed. The amplified products were separated by capillary electrophoresis apparatus and the peaks was assigned to a distinct allele number and statistically analyzed. 2.5. Serotyping Serological studies of L. monocytogenes began in the 1930's. Paterson succeeded in recognizing serologically different O and H antigen patterns. A modern serotyping scheme of L. monocytogenes was published by Seeliger and Hohne (Seeliger and H:ohne, 1979). O-antigens are prepared from smooth cultures incubated on 1% glucose tryptose agar for 24 h at 37C. The harvested cells are suspended in PBS (pH 7.2) and boiled to destroy the H-antigens. Then phenol is added to a final concentration of 0.5%. Ultrasonic treatment avoids spontaneous agglutination. H-antigens are prepared by adding equal amounts of 0.6% formolised saline to highly motile cultures in phosphate-buffered 1% glucose tryptose broth after 24-48 h incubation at 22-24C. Motility should be cheeked by hanging drop preparations. Cultures showing rough form should not be used. Sometimes it may be advisable to use H-antigens grown on the surface of semi-solid agar medium. Antisera against O- and H-antigens are produced by rabbit. Before immunisation is started the animal ought to be tested for the possible presence of Listeria agglutinins. Rabbits with serum titers against Listeria of 1:80 and above should not be used for the production of Listeria antisera. The antisera are preserved in small aliquots in the deep-freeze without preservative.

9

Factor sera may be produced with strains selected and recommended by Seeliger and Donker-Voet which are available from the National Collection of Type Cultures London, The ATCC, Rockville, Md, USA, and the Listeria Culture Collection of the Institute for Hygiene and Microbiology, Wurzburg, Germany (Table 5). The procedures for obtaining factor sera by adsorption test is outlined on Tables 6, 7 and 8 (Seeliger and H:ohne, 1979).

10

11

Distribution of serotypes throughout the world is not uniform. In the U.S.A. and Canada serotype 4b prevails at a proportion of 65% to 80% of all strains. In the Eastern European countries, in West Africa, in Central Germany, Finland and Sweden serotype 1/2a is most frequently found, while in Western Europe, particularly in France and in the Netherlands serotypes 1/2a and 4b are being isolated in about the same proportion. In West Germany serotype 1/2a prevailed until 1958. Since then a definite shift toward serotype 4b has been noted which in some outbreaks prevailed. The serogrouping of L. monocytogenes isolates can be determined by a multiplex PCR targeting ORF2819, ORF2110, lmo0737, and lmo1118. Specifically, ORF2819 primers recognize serovars 1=2b, 3b, 4b, 4d, and 4e; ORF2110 primers further separate serovar 4b complex (4b, 4d, 4e) from serovars 1/2b and 3b; lmo0737 primers identify serovars 1/2a, 3a, 1/2c, and 3c strains; and lmo1118 further distinguish serovars 1/2c and 3c from 1/2a and 3a. The lmo1134 primers with specificity for all L. monocytogenes strains except

12

serovars 4a and 4c (Table 9)(Doumith et al., 2004).

2.6. Lineages A total of 133 L. monocytogenes isolates were characterized by ribotyping and allelic analysis of the virulence genes hly, actA, and inlA to uncover linkages between independent phylogenetic and specific virulence markers. PCR-restriction fragment length polymorphisms revealed 8 hly, 11 inl4, and 2 actA alleles (Fig. 3). The combination of these virulence gene alleles and ribotype patterns separated L. monocytogenes into three distinct lineages (Table 10). While distinct hly and inlA alleles were generally found to cluster into these three lineages, actA alleles segregated independently. The clinical history of the L. monocytogenes strains showed evidence for differences in pathogenic potential among the three lineages. Lineage I contains all strains isolated during epidemic outbreaks of listeriosis, while no human isolates were found in lineage III. Animal isolates were found in all three lineages. We found evidence that isolates from lineages I and III have a higher plaquing efficiency than lineage II strains in a cell culture assay. Strains from lineage III also seem to form larger plaques than strains from lineage II. A distinctive ribotype fragment and unique 16S rRNA gene sequences furthermore suggest that lineage III might represent a L. monocytogenes subspecies. None of the 20 human isolates available but 11% of our animal isolates were grouped in this lineage, indicating that strains in this lineage might have reduced virulence for humans (Wiedmann et al., 1997c).

13

14

Lineage of strains can be determined by the sequence analysis of partial actA gene by PCR using the primers Line a (5'TGAAGAGGTAAATGCTTC GGACTT3') and Line b (5'GCATTTCTTGAGTGTTTTCCTGTT3')(Fig. 4) (Jiang et al., 2008; Wiedmann et al., 1997b).

15

3. ECOLOGY AND OCCURRENCE IN FOODS 3.1. Environment L. monocytogenes is commonly found in the environment. It is naturally saprophytic and in close association with soil, with highest populations in mud and moist soil. Plant matters are also important in the life cycle of environmental listeriae and is suggested as a common source for many infection. It is also recovered from silage, sewage, and waters from the environment (Brackett, 1988). A lot of domestic and wild animals were shown to be reservoirs of L. monocytogenes and involved in the distribution of this bacterium in the environment (Brackett, 1988), also A definite epidemiological relationship of silage and listeriosis of sheep was documented (Gray, 1960). L. monocytogenes occurs in sewage, and the sewage sludge cake is widely used as an agricultural fertilizer in some country, e.g. Iraq (Al-Ghazali and Al-Azawi, 1990), so sewage is a carrier of this pathogen. A dramatic decrease in numbers of listerias after each of the activation and digestion stage during sewage treatment was noticed in cold months, nevertheless, the organisms were able to survive these treatments and were present in the final effluent and even in low numbers in the sewage sludge cake. Sufficient dewatering and exposing the sewage sludge to sun for no less than 8 weeks is recommended to obtain listeria-free products (Al-Ghazali and Al-Azawi, 1988; Al-Ghazali and Al-Azawi, 1990). 3.2. In Food Systems It is only within the past few years that L. monocytogenes has fully become established as a foodborne pathognen. Surveys are being done to determine the extent to which L. monocytogenes is present in various kinds of foods (Table 10a). This organism is commonly isolated from raw meat, it was recovered from 66% of the tissues sample from an inoculated cow (Johnson et al., 1988). Since milk products have been involved in listeriosis outbreak (Fleming et al., 1985), dairy products have received the most scrutiny (Brackett, 1988). Raw milk, pasteurized milk, ice cream, and various kinds of cheese have been shown to be contaminated to some extent. Various kinds of raw meat, poultry and sausage

16

usually have high incidence of L. monocytogenes. Fruits and vegetables are believed to get this bacterium from soil and manure of animals. Seafood especially shellfish may also be contaminated and at least one outbreak of listeriosis has been linked to shellfish and raw fish (Brackett, 1988). From fresh produce a number of Listeria spp. were also isolated (Heisick et al., 1989b).

64% of the L. monocytogenes isolated from chicken were serotype 1/2b, while 18% were 1/2c (Bailey et al., 1989). The majority of the isolates from

17

turkey parts and beef steaks were serotype 1, and those from chicken and pork samples were serotype 4 and others (Wong et al., 1990). Six serotypes of L. monocytogenes (1/2, 3a, 3b, 3c, 4b, 4d) were isolated from the chickens sampled in U.K. (Pini and Gilbert, 1988b). The L. monocytogenes isolates from fresh produce were identified as predominantly serotype 1a (?), factor 1 (Heisick et al., 1989b). Serotype 1a is common in the environment of the production facility of dairy products and serotype 4 is more often isolated from finished dairy products (Heisick et al., 1989b). Only serotype 1/2 and 4b were isolated from cheese sampled in U.K. (Pini and Gilbert, 1988b). In China, 1275 batches of aquatic products imported from 29 countries were examined and found that 36 batches from 8 countries were contaminated by Listeria (2.8%), with L. monocytogenes accounting for 2.6% (33/1275) and L. innocua for 0.2% (3/1275). Of the 23 selected L. monocytogenes isolates (from the 33 identified), 15 (65.2%) were of serovar 4b complex (4b, 4d, or 4e), three (13.0%) of 1/2a or 3a, four (17.4%) of 1/2b or 3b, and one (4.4%) of 1/2c or 3c. Notably, four of the 23 isolates belonged to epidemic clone I (ECI) and another four were associated with epidemic clone II (ECII), two highly clonal 4b clusters responsible for most of the documented listeriosis outbreaks. In the multilocus sequence typing scheme based on the concatenated genes gyrB-dapE-hisJ-sigB-ribC-purM-betL-gap-tuf, serovar 4b complex isolates from imported aquatic products exhibited significant genetic diversity. While the four ECI isolates were genetically related to those from Chinese diseased animals, both lacking one proline-rich repeat of ActA, the four ECII isolates were located between 1/2b or 3b strains. As the L. monocytogenes isolates from imported aquatic products possessed a nearly complete set of major infection-related genes, they demonstrated virulence potential in mouse model (Chen et al., 2009). Occurrence of L. monocytogenes in the Irish dairy farm environment and in particular the milking facility was studied. Two hundred ninety-eight environmental samples were collected from 16 farms in the southern region of Ireland. A number of farms within the group supply raw milk to the unpasteurized milk cheese industry. The samples taken included cow feces, milk, silage, soil, water, etc. Presumptive L. monocytogenes isolates were purified and confirmed by PCR targeting the hly gene. Overall, 19% of the samples (57 of 298) were positive for L. monocytogenes. These were serotyped using conventional and PCR methods; serotypes 1/2a, 1/2b, and 4b made up

18

78% of the typeable isolates. A correlation was found between the level of hygiene standards on the farm and the occurrence of L. monocytogenes. There was little difference in the occurrence of L. monocytogenes between farms supplying milk to the unpasteurized milk cheese industry and those supplying milk for processing (Fox et al., 2009). Dairy herds in a New York State dairy farm was examined for three years. Fecal samples were collected every 6 months from all lactating cows. Approximately 20 environmental samples were obtained every 3 months. Bulk tank milk samples and in-line milk filter samples were obtained weekly. Samples from milking equipment and the milking parlor environment were obtained in May 2007. Fifty-one of 715 fecal samples (7.1%) and 22 of 303 environmental samples (7.3%) were positive for L. monocytogenes. A total of 73 of 108 in-line milk filter samples (67.6%) and 34 of 172 bulk tank milk samples (19.7%) were positive for L. monocytogenes. Listeria monocytogenes was isolated from 6 of 40 (15%) sampling sites in the milking parlor and milking equipment. In-line milk filter samples had a greater proportion of L. monocytogenes than did bulk tank milk samples (P<0.05) and samples from other sources (P<0.05). The proportion of L. monocytogenes-positive samples was greater among bulk tank milk samples than among fecal or environmental samples (P<0.05). Environmental samples were also examined (Table 11) (Latorre et al., 2009b).

19

Analysis of 60 isolates by pulsed-field gel electrophoresis (PFGE) yielded 23 PFGE types after digestion with AscI and ApaI endonucleases. Three PFGE types of L. monocytogenes were repeatedly found in longitudinally collected samples from bulk tank milk and in-line milk filters (Fig. 5) (Latorre et al., 2009a).

20

Since Listeria is widespread in the environment and in domestic animals, it is very unlikely that the food industry can totally avoid contact with this bacterium, so what we do is to minimize or eliminate L. monocytogenes from foods supply. 4. SURVIVAL OF L. MONCYTOGENES IN FOOD SYSTEMS

21

4.1. Dairy Products The ability of L. monocytogenes to survive in skim milk during spray drying and to persist in nonfat dry milk during storage was examined. A reduction of about 1 to 1.5 log L. monocytogenes/g occurred during the spray drying process, irrespective of whether the milk was concentrated or not before spray drying. The organism progressively died during storage (Doyle, 1988). Survival of L. monocytogenes in cheese has been studied intensively. If L. monocytogenes is present in milk, it can grow during the initial stage of cheese manufacturing until the pH of the cheese is reduced to 5.0 or below. L. monocytogenes was still recovered from about half of the cottage cheese sample during the storage period (Ryser et al., 1985). In case of blue cheese and camembert cheese (with growth of Penicillium during ripening), this pathogen survived more successfully as the pH of the cheese increased during the late stage of fermentation (Papageorgiou and Marth, 1989; Ryser and Marth, 1987a). The survival of L. monocytogenes during cheese making is strain dependent and also depends on the types of cheese, water content, temperature of ripening, pH, preservatives (sorbic acid, propionate, lactic acid, acetic acid), etc. (Fig. 6, 7, 8) (Ryser and Marth, 1987b; Ryser and Marth, 1988; Yousef and Marth, 1988).

22

23

Survival of L. monocytogenes in fermented milk depends on the species of lactic acid bacteria used, e.g. S. thermophilus (4-37 wk), S. lactis (2-13 wk), S. cremoris (4-13 wk), Lactobacillus bulgaricus (3 d - 1 wk) (Schaack and Marth, 1988a). During the fermentation of skim milk and yogurt by mesophilic or thermophilic lactic acid bacteria, L. monocytogenes is inhibited by the inoculum size and strains of lactic acid bacteria. When incubated with L. bulgaricus, L. monocytogenes was inhibited between 9 and 15 h of incubation (Fig. 9) (Schaack and Marth, 1988b; Schaack and Marth, 1988c). This may be due to the rapid decrease of pH in case of L. bulgaricus fermentation. Decrease of pH to below 5 is detrimental to L. monocytogenes.

24

Doubling times of L. monocytogenes at 10C were reduced by up to 3 h when grown in milk preincubated with Pseudomonas spp. Three strains of P. fluorescens showed more stimulation of the growth rate of L. monocytogenes. It suggested that the presence of the pseudomonads may enhance growth of L. monocytogenes in milk (Marshall and Schmidt, 1988). Since cooling systems are widely used in dairy industry, presence of L. monocytogenes in milk cooling systems may pose a hazard, especially in sweet water systems that might contain a small amount of milk. Growth of L. monocytogenes in a simulated milk cooling systems was observed (Petran and Zottola, 1988). 4.2. Meat and Meat Products When a mixture of L. monocytogenes was inoculated to the surface of processed meat products at 4.4C, it survived but did not grow on summer sausage, grew only slightly on cooked roast beef, grew well on some wiener products but not on others, grew well on ham, bologna, and bratwurst, and grew exceptionally well on sliced chicken and turkey. The organism generally grew well on meats near or above pH 6 (Glass and Doyle, 1989a). It suggests that it is important to avoid post-processing contamination of this bacterium. But in ground beef or liver during storage at 4 or 25 C, the L. monocytogenes population remained unchanged for 30 days (CHEN and Shelef, 1992). When chicken breasts were inoculated with L. monocytogenes and cooked to one of five different cooking temperatures and packed, this pathogen increased in all of the samples, except those cooked to 82.2 C (Harrison and Carpenter, 1989). L. monocytogenes could grow at 32.2 C in sausage batter during the fermentation period if the lactic starter culture was not added (Glass and Doyle, 1989a). L. monocytogenes was able to survive during a 21-day fermentation of sausage with levels of nitrite and salt commonly used in the meat industry today (120 ppm NaNO2 and 3.0% NaCl) (Junttila et al., 1989). Souse is a fully cooked, ready-to-eat gelled pork product. There is a zero-tolerance policy for L. monocytogenes in ready-to-eat meat products. The

25

effectiveness of three different souse formulations (pH 4.3, 4.7, and 5.1) for controlling the growth of L. monocytogenes at two refrigerated storage temperatures (5 and 10 C) was evaluated. All products were vacuum packaged. Uninoculated product was prepared as the control, and other products were artificially surface contaminated with a three-strain cocktail of L. monocytogenes (106 CFU/ cm2). Souse did not support the growth of L. monocytogenes regardless of product formulation or storage temperature. At 5C, D-values for products with pH values of 4.7 and 5.1 were not different, but survival of L. monocytogenes in product with a lower pH (4.3) was decreased compared with survival in products with higher pH values (P < 0.05). Survival of L. monocytogenes was not impacted by storage temperatures (P > 0.05) (Fig. 10) (Kim et al., 2009).

4.3. Vegetables The ability of L. monocytogenes to survive and grow on ready to serve lettuce was examined (Steinbruegge et al., 1988). Behavior of L. monocytogenes was variable. In most trials, numbers increased by several log cycles during 14-day of storage, but in several trials growth never occurred or did not persit for 14 days. Lettuce juice held at 5C was also able to support growth of L. monocytogenes. 5. ISOLATION AND ENUMERATION

26

The concentration of L. monocytogenes in food is low, therefore, the isolation methods have necessarily employed enrichment in one or two stages before isolation on solid media. A number of procedures combining various enrichment and selection media have been tried. It is nearly impossible for one procedure to detect all the existing L. monocytogenes in food samples (Pini and Gilbert, 1988a). It is difficult to enumerate this bacterium directly on agar media or by most-probable-number method (Lovett, 1988). 5.1. Enrichment Procedures Cold enrichment was used to select psychrophilic Listeria, a period of weeks to months was required. Antibiotics have been used in enrichment formulation to provide more rapid enhancement of the Listeria spp. Rodriguez et al. used three complicated scheme, three enrichment media, and an isolation medium. The enrichment media contained nalidixic acid, and trypan blue. The isolation agar contained Ferric ammonium citrate, nalidixic acid, acriflavin, and esculin to highlight the Listeria colonies (Rodriguez et al., 1984). Doyle and Schoeni took advantage of the microaerophilic nature of L. monocytogenes to provide a selective enrichment culture for the organism. The selective broth consisted of polymyxin B, acriflavine, nalidixic acid as the selective reagents. The culture was incubated 24 h at 37 C in an atmosphere composed of 5% O2, 10% CO2, and 85% N2 (Doyle and Schoeni, 1986). The FDA method employs a single enrichment in a selective medium of trypticase soy broth with yeast extract, acriflavin, nalidixic acid, and cycloheximide. The sample in enrichment broth will be incubated at 30C for 2 days. At 24 h and 2 days, streak the culture onto modified McBride's agar and onto lithium chloride-phenylethanol-moxalactam (LPM) agar (Lovett and Hitchins, 1989). The USDA method is mainly based upon the Lee and McClain method (Lee and McClain, 1986). The sample is first enriched in the Listeria enrichment broth (UVM, Univ. of Vermont Medium) for 20-24 h at 30 C, and then transfer to the secondary enrichment in Fraser broth at 35C for 24-48 h. The UVM contains esculin, naladixic acid, and acriflavin and the Fraser broth contains of

27

esculin, naladixic acid and lithium chloride. Blacken or darkened tubes resulting from esculin hydrolysis in the Fraser broth are to be streaked on MOX agar for isolation (McClain and Lee, 1988). Tubes that remain the original straw color are negative for L. monocytogenes (Fraser and Sperber, 1988). MOX (Modified Oxford Medium) is a highly L. monocytogenes selective medium containing ferric ammonium citrate, lithium chloride, 1% colistin soln. and Moxalactam (McClain and Lee, personal communication). Moxalactam, the broad-range cephalosporin antibiotic, proved to be highly useful, controlling not only the gram-negative bacteria but also most of the other gram-positives. The minimum inhibitory concentrations of four antibiotics used in Listeria selective agara were determined and ceftazidime, cefotetan, latamoxef and fosfomycin are recommended for Listeria selective agars (Curtis et al., 1989). 5.2. Isolation Procedures The first selective agar medium used in the isolation of L. monocytogenes is McBride's agar which contains phenyl ethanol agar, glycine anhydride, lithium chloride, and sheep blood (McBride and Girard, 1960). Modified McBride's agar is also widely used with the sheep blood replaced by cycloheximide. A number of selective agars have been formulated (Bannerman and Bille, 1988; Buchanan et al., 1989; Lee and McClain, 1986; Loessner et al., 1988; Pucci et al., 1988), nevertheless, the LPM and MOX agars are widely accepted now. The use of a stereomicroscope with a light source illuminating the plate at an incident angle of 45o can be useful in determining typical Listeria colonies which appear to be blue to blue-gray color. A new selective medium was formulated by Al-Zoreky and Sandine. This medium contains the esculin, selective agents (acriflavin, ceftazidime, and moxalactam) plus agar base. Recognition of Listeria colonies is evident by black discoloration of the medium due to esculin hydrolysis without need for special illuminating equipment. A number of formulations have been compared for isolation of L. monocytogenes (Bannerman and Bille, 1988; Doyle and Schoeni, 1987; Hao et al., 1987; Loessner et al., 1988). Among these media, the Modified Vogel

28

Johnson Agar (MVJ) and the LPM are superior in detection of L. monocytogenes in various kinds of food (Buchanan et al., 1989). MVJ agar was considered more easy to use (Buchanan et al., 1989). But LPM inhibits 50 non-listeriae, and MVJ inhibits all but one yeast. LPM agar was the best overall since Scott A was inhibited by MVJ (Loessner et al., 1988). Crawford et al. showed that the heat-injured cells of L. monocytogenes were unable to multiply either during cold storage of milk or in the FDA or USDA systems (Crawford et al., 1989). Thus L. monocytogenes cells recovered in finished pasteurized milk products by these detection methods probably represent uninjured environmental contaminations. Six chromogenic media similar to Agar Listeria according to Ottaviani and Agosti (ALOA) were compared using PALCAM agar for inclusivity and exclusivity (Fig. 11). Additionally, the ability of chromogenic agars to facilitate growth of stressed L. monocytogenes strains and mixed cultures with competitive non-Listeria strains was estimated. Finally, the detection and enumeration of L. monocytogenes were peroformed in artificially inoculated and naturally contaminated food samples. The results of this study indicated that chromogenic media are a good supplementation to PALCAM agar. A single application is not advisable, as the specificity of chromogenic agars is frequently insufficient (50.0-88.9%), particularly in food samples with a complex microflora (Table 12) (Stessl et al., 2009).

29

5.3. Confirmation of Listeria species According to the USDA procedures, black colonies from MOX agar is streaked onto Horse blood overlay medium. Colonies with β-hemolysis, Gram positive, short rods, with tumbling motility proceed with biochemical indentification (Table 13). It is also easy to observe grey to blue colonies under fluorescent light on LPM agar. CAMP test is usually done to differentiate different Listeria species.

30

Serology can be used epidemiologically to support the classification of the isolate. Pathogenicity is sometimes used to confirm the classification of the L. monocytogenes. However, some Listeria species (L. ivanovii, L. denitrificans) are also mouse pathogens, usually no pathogenic for man. Intraperitoneal injection of 109 Listeria cells/18-20 g mouse followed by a week of observation for death is the method most often used. Recently, Stelma et al. described an immunocompromised mouse model that uses carrageenan to inactivate the mouse macrophages before i.p. injection of the bacterial suspension. Pathogenic L. monocytogenes shows 5 or more log reductions in LD50 values when mice are immunocompromised, whereas nonpathogenic species show relatively little change in LD50 values (Stelma, Jr. et al., 1987). Because the hemolysis produced by L. monocytogenes on blood agar is frequently difficult to interpret, a microplate technique was developed (Rodriguez et al., 1986). Pretreatment of erythrocytes with crude exosubstances of R. equi, Pseudomonas fluorescens, Acinetobacter calcoaceticus, and S. aureus enhanced the hemolytic activity of all hemolytic Listeria strains. This microplate method can be used instead of the CAMP test (Rodriguez et al., 1986). 5.4. Direct Plating for Isolation and Enumeration Since Listeria usually occurs in low density in food, probably less than 100/g of food, it is very difficult to identify by direct plating especially in samples with heavy contamination of other bacteria. A number of selective agars have been evaluated as media for direct plating. Various densities of L. monocytogenes cells, injured or not, were inoculated into different types of foods, homogenized and enumerated by direct plate counting on this agar. LPM was most suitable for analyzing cheese and cabbage, Gum base-nalidixic acid-tryptone-soya medium was most suitable for analyzing milk and chocolate ice cream mix (Fig. 12) (Cassiday et al., 1989; Golden et al., 1988a; Golden et al., 1988b).

31

A overlay thin layer of blood agar on these selective media could be useful in direct enumeration of hemolytic Listeria (Blanco et al., 1989). 5.5. Rapid Detection of L. monocytogenes 5.5.1. Fluorescent Immunoassay and Flow Cytometry

32

A fluorescent antibody (FA) procedure was developed in 1960 for the detection of L. monocytogenes, and this method is successful in detecting this pathogen in cerebrospinal fluid, human tissue, blood, and vaginal swabs, since in most of these clinical specimens, Listeria exists in pure culture (Donnelly et al., 1988). Distinct disadvantages were noted with this procedure, which included: non-specific cross-reactivity of Listeria antiserum with streptococci, micrococci, and staphylococci; difficulty in visual resolution of Listeria from contaminants on the basis of morphology and fluorescence intensity; and finally, the time-consuming and subjective nature of visual microscopic analysis (Donnelly et al., 1988). The fluorescent-labelled bacteria can be identified by a modified method, the Flow Cytometry (FCM). After enrichment by Listeria Enrichment broth, cells are disrupted and collected, reacted with Listeria O antiserum, then with fluorescein isothiocyanate (FITC)-labelled goat anti-rabbit immunoglobulins. Propidium iodide (PI, labelling DNA) is added. A laser beam cytometer is used to measure the size by light scatter and relative DNA content. Only cells that fell into both the DNA gating region and the Listeria scatter region are analyzed for immunofluorescence. This method yielded a 5.86% false positive rate and a 0.53% false negative rate when compared with culture procedures (Donnelly et al., 1988; Donnelly and Baigent, 1986). It is not very practical due to high equipment cost. 5.5.2. Electrical Method Growth of L. monocytogenes and other bacteria is in some Listeria selective media was detected by monitoring the capacitanc signal with a Bactometer. Profiles of different bacteria grown on an AC medium (one of the Listeria agars) are different (Fig. 13). Some Bacillus speciec were able to grow in the AC medium. Adding moxolactam (5 mg/l) and nalidixic acid (50 mg/l) to the AC medium would inhibit the growth of Bacillus spp. (Phillips and Griffiths, 1989). This method needs more evaluation.

33

5.5.3. Enzyme-linked Immunosorbent Assay The cultured Listeria cells were boiled and immunized BALB/c mice. The splenocytes were fused with mouse myeloma cells and screened for positive-reacting clones. Fifteen murine monoclonal antibodies (MABs) which react specifically with a protein antigen found in all species of Listeria were developed and characterized. The genus-specific antigen was identified as a heat-stable protein with a molecular weight in the range of 30,000 to 38,000 (under both reducing and nonreducing conditions), depending on the species of Listeria tested. In L. monocytogenes, L. innocua, L. ivanovii, and L. seeligeri the antigen has a molecular weight of approximately 30,000 to 34,000. In L. grayi and L. murrayi it has a molecular weight of approximately 35,000 to 38,000 (Butman et al., 1988). An ELISA method based on two of these MABs was developed by Organon Teknika and known as Listeria-Tek. Samples are enriched by the USDA enrichment procedures (2 days) and screened by this ELISA method (Fig. 14) and finally confirmed by the Micro-ID kit. This method detected 68% of the 44 vegetable samples in a evaluation of methods, but detected 100% of the milk samples. However, this method gave 22 false-positive results among 309 samples (Table 14, 15, Fig. 15) (Heisick et al., 1989a).

34

35

Immunomagnetic separation (IMS) has been shown to be a very effective tool for the separation and isolation of specific cells from heterogeneous cell suspensions, especially for the isolation of specific cells from blood, or more

36

likely after some hours of resuscitation or preenrichment in nonselective or slightly selective media, substantial time can be saved. There is increasing number of IMS described. IMS with immunomagnetic beads was used to isolate strains of L. monocytogenes both from pure cultures and from heterogeneous suspensions. The monoclonal antibodies used recognized all six strains of serotype 4 but only one of three strains of serotype 1. Less than 100 bacteria per ml in pure cultures and less than 200 bacteria per ml in enriched foods could be detected (Skjerve et al., 1990). Methodology Immunomagnetic beads, 2.8 μm in diam, with covalently linked sheep anti-mouse IgG antibodies (Dynal A/S, Oslo, Norway) are coated with monoclonal antiserum by incubating at room temperature for 3 h. Such beads are added to bacterial cultures (samples) and incubated with slow shaking at room temperature for 10 min (up to 1 h). A Eppendorf type magnetic particle concentrator (Dynal A/S) is used to trap the beads. The traped beads are washed in PBS with 0.1% bovine serum albumin and transferred to agar medium. Another approach is to establish a ELISA to identified the trapped beads. Coating procedure, incubation time, and number of immunomagnetic beads influenced the sensitivity of the isolation method. 5.5.4. Nucleic Acid Probe Hybridization Assays The L. monocytogenes DNA was cloned in pUC18 and a clone (pRF106) containing the presumptive β-hemolysin gene was selected and a fragment of about 500 bp was used as a gene probe. The cells in the colonies were lysed by microwaves in the presence of sodium hydroxide, and only the DNA from the β-hemolytic (CAMP-positive) strains of L. monocytogenes hybridized with this probe (Datta et al., 1987). From this 500 bp sequence, several synthetic oligonucleotides were evaluated as gene probe and AD07 (TGA CAG CGT GTG TAG TAG CA) was selected to detect L. monocytogenes (27). However, these oligonucleotides were shown to in the upstream of the iap (ivasion-associated protein) gene that encodes a major extracellular protein (p60) (Kuhn and Goebel, 1989) and not associated with any hemolytic genes (Ko:hler et al., 1990). A 650-bp HindIII fragment located within the listeriolysin gene and a

37

synthetic oligonucleotide (TCG TCC ATC TAT TTG GCA GG) were also used as probes which were specific for L. monocytogenes at high stringency (Datta et al., 1990). The gene of L. monocytogenes that encodes p60 was cloned in E. coli. The deduced amino acid sequence of p60 contained a putative N-terminal signal sequence of 27 amino acids and an extended repeat region consisting of 19 threonine-asparagine units. Hybridization with the entire iap gene revealed the presence of homologous sequences in most other Listeria species. In contrast, a 400-bp internal iap probe which contained the whole repeated region hybridized only with genomic DNA from L. monocytogenes (Ko:hler et al., 1990). Flamm et al. also cloned a gene msp (major secreted polypeptide, 60 kDa) which is specific only in L. monocytogenes strains and the possibility of using this gene as a probe were also discussed. DNA sequence related to msp was not detected in any other Listeria species or in strains of Bacillus spp. and Streptococcus spp. when standard stringent DNA hybridization conditions were used (Flamm et al., 1989). Under nonstringent conditions, related sequences were detected in L. ivanovii, L. seeligeri, and L. innocua, and immunoblot analysis indicated that these strains secreted polypeptides of about 60 kDa that were immunologically related to the msp gene product. This msp gene product was shown to have hemolytic activity and immunologically distinct from listeriolysin O. It may be a lipase or protease that can lyse erythrocytes (Flamm et al., 1989). A gene encoding a delayed-hypersensitivity-inducing protein from a virulent L. monocytogenes serotype 1/2a strain has been cloned and sequenced. The plasmid pLM10 containing a 1.1 kb of insert ecodes this factor was used as a probe. This probe hybridized only the pathogenic species, L. monocytogenes (except serotype 4a) and L. ivanovii. Positive results were obtained with all L. monocytogenes strains of serogroups 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4d, 4ab, and 7. Of L. monocytogenes serotype 4b strains, a single strain showed no hybridization. All strains of the rarely occurring serogroup 4a were negative for hybridization. This probe could be a useful marker in the detection of virulent Listeria strains (Notermans et al., 1989). A gene probe was developed by Gene-Trak. Unique sequences of the 16S rRNA of L. monocytogenes ATCC 15313 were synthesized and labelled by

38

using 32P (Klinger et al., 1988; Klinger and Johnson, 1988). The vast majority of rRNA is highly conserved and uniform (i.e., nearly identical) throughout all bacteria; however, small unique regions exist and can serve as excellent specific targets. Additionally, rRNA is present in great abundance, providing increased assay sensitivity. The labeled probes hybridized with all of the 139 Listeria strains tested, representing the seven recognized species; 16 serotypes were included. All 73 non-Listeria organisms tested were negative in the assay. This method has been modified by using dipstick assay and horseradish peroxidase color reaction instead of radioactive probe (Fig. 16) (Parsons, 1988). In a comparative test, this Gene-Trak system gave 98% and 45% to the positive milk and vegetable samples, respectively (Heisick et al., 1989a).

39

Digoxigenin-labeled non-radioactive probes were developed (Kim et al., 1991; Wong et al., 1992). A chromogen-labeled DNA probe was developed (Peterkin et al., 1991). Preparation of chromogen labeled probe Horse-radish peroxidase (HRP) was conjugated to polyethyleneimine, and the mixture was concentrated about fourfold by dialysis against polyethylene glycol 8000. HRP-polyethyleneimine was mixed with probe DNA and freshly denatured by heating at 100C for 10 min, followed by rapid chilling on ice. The volume of the HRP-polyethyleneimine-single-stranded DNA probe mixture was made up to 30 μl with 5 mM sodium phosphate, pH 6.8, and 5% glutaraldehyde (6 μl) added. After incubation at 37C for 10 min, 36 μl of this probe was added directly to the hybridization solution at the end of prehybridization. Non-radioactive RNA probe targeted on the listeriolysin O gene was developed (Wong et al., 1992). 5.5.5. Polymerase Chain Reaction PCR have been applied in the detection of L. monocytogenes. The targets of amplification are listeriolysin O gene (Bessesen et al., 1990; Border et al., 1990; Deneer and Boychuk, 1991; Furrer et al., 1991; Niederhauser et al., 1992; Thomas et al., 1991; Wong et al., 1992), iap gene (Niederhauser et al., 1992), Dth18-gene (Wernars et al., 1991), and 16S RNA (Border et al., 1990). Enrichment cultures were usually obtained and cell lysed for the PCR analysis (Niederhauser et al., 1992; Thomas et al., 1991). The detection limit in dilutions of pure cultures was usually about 1-10 CFU. But in food samples, the detection limit showed a large variation (Wernars et al., 1991). 5.5.6. Real-time PCR

Method coupling International Standard Organization (ISO) enrichment to a real-time PCR with internal amplification control (IAC), in a duplex format,

40

without additional DNA purification, was developed for the detection of L. monocytogenes. The performance was tested on different plant products. Limit of detection (LOD) was about 1 CFU in 25 g after enrichment, except for soybean sprouts (Badosa et al., 2009). 6. CONTROL OF L. MONOCYTOGENES Control of L. monocytogenes is difficult due to its: (1) widespread presence in the environment, (2) intrinsic physiological resistance, (3) ability to adapt to external stresses and (4) ability to grow at a wide range of temperatures. Among the factors that affect the growth of Listeria monocytogenes are temperature, pH, atmosphere, irradiation and food additives. 6.1. Temperature Optimum growth temperature between 30 and 37 C. Temperature limits of growth 1-45 C. Generation times in different foods ranged from 1.2 to 1.7 days at 4 C, 5.0 to 7.2 h at 13 C, and 0.65 to 0.69 h at 35 C. The D71.7C values computed for milk samples ranged from 0.9 to 2.7 sec (Bradshaw et al., 1987; Bradshaw et al., 1985). D62C values in milk ranged between 0.1-0.4 min (Donnelly et al., 1987). Heat resistance of L. monocytogenes in various kinds of foods has been reviewed by Mackey and Bratchell (Fig. 17, Table 16, 17) (Mackey and Bratchell, 1989) and concluded that cooking food to an internal temperature of 70C for 2 min is adequate to ensure destruction of this pathogen. In case of sausage such as beaker sausage (made from uncooked meat), heating to an internal temperature of 62.8C inactivated listeriae to undetectable levels (Glass and Doyle, 1989a). But when an initial population of 5x106 L. monocytogenes/ml was heated at 72, 82, or 92 C in a milk medium using test-tube method, consistent survival of a population of 102-103 cells/ml after 30 min was observed (Donnelly et al., 1987).

41

42

Heat resistance of L. monocytogenes did not differ significantly between pH 5.5 and 9.0 (Bradshaw et al., 1985). The induction of increased thermotolerance by sublethal heat shock (42-52C) was generally not significant for L. monocytogenes; nevertheless, the increase was significant for Salmonella typhimurium (Bunning et al., 1990). 6.2. Acidity and organic acids The minimum pH at which L. monocytogenes can grow is yet to be defined. Growth occurs between pH 6 and 9 (Seeliger and Jones, 1984). In trytic soy broth supplemented with 0.6% yeast extract, all four strains of tested L. monocytogenes grew at pH 4.5 and above. L. monocytogenes population declined at pH below 5 in a model broth system (Parish and Higgins, 1989). L. monocytogenes grew well in cabbage juice at initial pH 5.0 to 6.1, and could reduce the pH to 4.14 before complete inactivation occurred (Golden et al., 1988b). The organism is quite resistant to alkaline pH and can grow in liquid media at pH 9.6 (Doyle, 1988). Lowering of pH from 5.6 to 4.0 in clarified cabbage juice increased the rate of thermal inactivation (Fig. 18) (Beuchat et al., 1986).

43

Lactic acid (LA; 5%, vol/vol) and sodium lauryl sulfate (SLS; 0.5%, wt/vol) were evaluated individually or as a mixture (LASLS) for control of L. monocytogenes on frankfurters (Fig. 19) (Byelashov et al., 2008).

44

6.3. Sodium Chloride L. monocytogenes is quite tolerant to NaCl, being capable of growing in 10% NaCl and surviving for 1 year in 16% (Doyle, 1988). Growth of Listeria occurs in complex media such as nutrient broth supplemented with up to 10% NaCl and some strains have been reported to remain viable after 1 year in 16% NaCl at pH 6.0 (Seeliger and Jones, 1984). Lowering of temperature enhanced resistance to salt, the organism survived more than 100 days in 10.5-30% NaCl at 4C. But it was affected by the constituent of food, it could grow in cabbage juice with 2% NaCl but not in the presence of 5% NaCl (Conner et al., 1986). It grew in heat-sterilized unclarified cabbage juice containing less than 5% NaCl and tryptic phosphate broth containing less than 10% NaCl (Beuchat et al., 1986). The effect of sodium chloride and pH in combination with different temperatures on the growth of microorganisms is better assessed by gradient plate method (McClure et al., 1989). Gradient plate is made up of three nutrient agar layers each contained H2SO4, NaOH or NaCl. It is sprayed with an aqueous solution of 2-(p-iodophenyl)-3-(p-nitrophenyl)-5-phenyl tetrazolium chloride for easy detection of the bacterial growth. The growth of bacteria is scanned by a Densitometer and 3-dimensional images are analyzed (Fig. 20) (McClure et al., 1989).

45

6.4. Carbon Dioxide and Decreased Oxygen Levels L. monocytogenes is microaerophilic, and is enhanced under decreased oxygen concentrations and with supplementation with carbon dioxide. 6.5. Irradiation The survival of L. monocytogenes preinoculated into ice cream and mozzarella cheese prior to gamma-irradiation treatment was also determined. Samples were maintained at -78 C during irradiation, and the calculated D10 values were 1.4 kGy for mozzarella cheese and 2.0 kGy for ice cream (Fig. 21) (Hashisaka et al., 1989). In another study, the D10 values on poultry meat were 0.417-0.553 kGy depending on strain and plating medium used, suggesting the injury by irradiation occurred. Lower values were obtained in phosphate- buffered saline (Patterson, 1989).

46

6.6. Chlorine Chlorine is a common antimicrobial agent used in food industry. In one study, chlorine concentrations less than about 50 ppm showed no antimicrobial effect but exposure to 50 ppm or greater free residue chlorine resulted in no viable cells (Brackett, 1987). Cells were treated in phosphate buffer containing the chlorine and were neutralized with 0.01 M sodium thiosulfate before counting on the TSA agar (Brackett, 1987). In another study, L. monocytogenes decreased rapidly in the presence of 0.5-10 ppm during the first 30 s followed by a slower decrease during the rest of the exposure time (El-Kest and Marth, 1988a). Cells were more resistant to chlorine when they were: (a) harvested from a 24-rather than 48-h-old culture, (b) grown in tryptose broth rather than on a slant of

47

tryptose agar, and (c) washed and resuspended using a 20 rather than 0.312 mM phosphate buffer solution. Presence of organic matter such as peptone caused a large and rapid loss of available chlorine, but glucose or lactose had no effect. The D-values of L. monocytogenes to different concentrations of available chlorine is shown in Fig. 22 (El-Kest and Marth, 1988a). Effect of chlorine is also affected by the pH, temperature and strain. Large numbers of L. monocytogenes strain Scott A survived at 25 than at 35 or 5 C. The higher the pH values, in the range of 5 to 9, the greater were the numbers of survivors of L. monocytogenes and V7 was less resistant to chlorine than strain California (El-Kest and Marth, 1988b).

Scanning electron microscopy was done to evaluate the attachment characteristics of L. monocytogenes on stainless steel. L. monocytogenes was found to produce a fibrous-like material similar in appearance to acidic polysaccharide fibrils produced by Pseudomonas sp., which appeared to be removed by the sanitizer solutions (chlorine or quaternary ammonium) (Mustapha and Liewen, 1989). 6.7. Nitrate and Nitrite

48

Some kind of smoke products were more effective to L. monocytogenes (Messina et al., 1988) and levels of nitrite and nitrate with best bacteriostatic effect on Listeria (200-1000 ppm) are no longer permitted in food (Junttila et al., 1989). 6.8. Bacteriocin Also deferred antagonism and well diffusion assays (Fig. 23), seven among fourteen bacteriocin-producing strains were inhibitory to L. monocytogenes, namely Lactobacillus sp., Lactococcus lactis (2 strains, nisin), Leuconostoc sp., Pediococcus acidilactici (Pediocin PA-1), P. pentosaceus (2 strains, Pediocin A) (Harris et al., 1989). The bacteriocin PA-1 from P. acidilactici PAC1.0 was inhibitory to L. monocytogenes over the pH range 5.5 to 7.0 and at both 4 and 32 C. Inhibition was also demonstrated in several food systems including dressed cottage cheese, half-and-half cream, and cheese sauce (Pucci et al., 1988). Nisin (16 IU/ml) was found to have an initial inhibitory effect on growth of L. monocytogenes (Doyle, 1988).

49

Bacteriocin produced by lactic acid bacteria can be used to control L. monocytogenes in food. When meat was inoculated with L. monocytogenes, the bacteriocin from Pediococcus acidilactici reduced the number of attached bacteria in 2 min by 0.5 to 2.2 log cycles depending upon bacteriocin concentration (Nielsen et al., 1990). Presence of P. acidilactici or pediocin AcH also inhibited the growth of L. monocytogenes in wiener exudates (Yousef et al., 1991). 6.9. Other Additives Some other chemical agents have been tested to inhibit L. monocytogenes. The action of sorbic acid is affected by temperature and pH. At pH 5.6 and 4 C, the bacterium was inactivated by 0.25 or 0.3% of potassium sorbate, while at higher temperature (21 or 35C) appreciable growth occurred. At 13 C and pH 5.0, concentrations of 0.2-0.3% potassium sorbate completely inhibited the growth (El-Shenawy and Marth, 1988a). Similar effect occurred in case of sodium benzoate inactivation (El-Shenawy and Marth, 1988b). In a milk system (pH 6.4), phenolic compounds were more effective than potassium sorbate (Payne et al., 1989). The minimum inhibitory concentrations (MIC) determined by using agar dilution technique were: tertiary butylhydroquinone (TBHQ) 64 ppm, butylated hydrozyanisole (BHA) 128 ppm, butylated hydroxxytoluene (BHT) >512 ppm. The most effective FDA approved food antimicrobial was propyl paraben with MIC of 512 ppm (Payne et al., 1989). 6.10. Combined factors Simulated dynamic model (Fig. 24) of the stomach and small intestine was used to assay the survival of L. monocytogenes during storage (82 days, 4 C) in vacuum packages of inoculated bologna and salami slices (Barmpalia-Davis et al., 2008).

50

7. PATHOGENICITY AND TOXIN PRODUCTION Under the right circumstances, anyone can become infected with L. monocytogenes, but many persons will remain symptomless. Some may develop lethal diseases, such as pregnant, newborns, infants and adults with a compromised immune system (Marth, 1988) such as AIDS (Schlech, 1988). Listeria resistance in mice is determined by autosomal dorminant determinant. 7.1. Forms of Human Listeriosis Listeriosis of Women during Pregnancy Symptoms like fever, chills, headache, backache, and discolored urine, pharyngitis, diarrhea, and pyelitis (inflammation of the pelvis of the kidney). The "flu-like" symptoms just described are the expression of Listeria bacteremia. Infection of pregnant woman leads to infection of the fetus through transplacental route or during delivery, and cause damage to the embryo resulting in abortion or stillbirth. The women may carry L. monocytogenes in the genital tract for some time (Marth, 1988). Listeriosis of the Newborn Baby infected by L. monocytogenes from mother, develops variable symptoms, including respiratory distress, heart failure, cyanosis, refusal to drink, vomiting, convulsions, soft whipering, small cutaneous granulomas (listeriomas) in the posterior pharyngeal wall, leukocytosis, numerous organs develop nodules, etc.

51

Two of eight had neurodevelopmental handicap after recovery (Marth, 1988). Meningitic and Meningoencephalitic Listeriosis Usually occurrs in newborns and in older persons, usually fulminant (comes on suddenly with great severity), with fatality rate about 70%. Cutaneous Listeriosis Primary skin lesions caused by direct contact with the infected animal tissue, so usually occurs in farmers and veterinarians. Form skin nodules. Septicemic Listeriosis with Pharyngitis and Mononucleosis Symptoms include fever, severe pharyngitis, and a leukocytosis accompanied by mononucleosis. Sometimes it turns into the meningitic form of the disease. Oculoglandular Listeriosis Conjunctivities sometimes accompany the septicemic form described above, or occur independenly, and may also turn to meningitis. Granulomatosis Septica and Pneumonic Listeriosis Take a septic course with various clinical manifestations, may develop symptoms of pneumonia or acute or subacute endocarditis. Cervicoglandular Listeriosis Uncommon form, cervical and submandibular lymphadenopathy, may accompany the septicemic form. Additional Forms of Listeriosis Focal infections result in arthritis, osteomyelitis, spinal or brain abscesses, peritonitis, and cholecystitis. 7.2. Characteristics of Virulent Listeria monocytogenes Serotype Virulent Listeria tend to cluster in subgroups 1 and 4, as well as 7, and serotypes 1 and 4 cause most invasive human infections. Outbreaks have been associated with serotype 4b (Table 18) (McLauchlin, 1987). However, environmental strains of L. monocytogenes serotype 4 isolates that appeared to

52

be avirulent when injected into mice.

Phage Type Lysogenic phages are present in all species of Listeria and phage typing of L. monocytogenes within virulent serogroups has been useful in determining strains of Listeria that have been responsible for epidemic disease, hoverever, no information exists concerning the comparative virulence of different phage types of the same serotype that would suggest a role for phage in promoting virulence (Schlech, 1988). Plasmid Type Plasmids have been sought in strains of L. monocytogenes causing epidemic disease, large outbreaks of epidemic disease have been attributed to nonplasmid-bearing strains (Schlech, 1988). Biotype The avirulent isolates L. greyii and L. murrayei can be distinguished by nitrate reduction and a positive mannitol test. Beta-hemolysis and a negative D-xylose acidification test distinguish L. monocytogenes from organisms which are avirulent, such as L. welshimeri or L. innocua, and those that have some capability for virulence, such as L. seeligeri and L. ivanovii. Xylose acidification and CAMP phenomenon occur in virulent L. monocytogenes. However, the specificity of these two tests is relatively low (Schlech, 1988).

53

Hemolysins Hemolysins of L. monocytogenes are clearly markers for virulence. However, they have a variable expression within individual pathogenic strains. Hemolytic organisms tend to have smooth colonial morphology (Schlech, 1988). The cytopathogenicity of L. monocytogenes can be determined by a plaque assay with mouse L cells. L. monocytogenes was grown overnight to stationary phase at 30°C and inoculated onto the cell monolayer at approximately 3x104 CFU per well. Results were reported as average plaque diameter and as plaquing efficiency (CFU/PFU). Plaque sizes were measured for all plaques formed in at least two wells (Wiedmann et al., 1997a). 7.3. Invasiveness and Intracellular Growth of L. monocytogenes L. monocytogenes is an invasive bacterial pathogen capable of multiplying inside many host cells, including macrophages, enterocytes and hepatocytes (Berche et al., 1988). Phagocytosis also occurs in non-professional phagocytes such as enterocyte-like Caco-2 cells (human colon carcinonma cell line (Gaillard et al., 1987). This pathogen is ingested with food and penetrates through the intestine. The bacteria invasion of the host tissues during infection starts by rapid phagocytosis of the bacteria in an iron-deprived environment, which stimulates hemolysin secretion. The directed phagocytosis inhibited by cytochalasin D was only observed with the pathogenic species (L. monocytogenes, L. ivanovii), but not in other avirulent Listeria spp. (Fig. 25, 26) (Gaillard et al., 1987). This clearly indicates that a specific interaction between invasive bacteria and enterocytes. Recognition structures expressed on the cellular membranes are probably conserved in many tissues of the host (Berche et al., 1988). Listeriolysin O is a promoting factor of bacterial growth in vivo. After being internalized at the same rate as that of its hemolytic revertant strain, a nonhemolytic mutant from L. monocytogenes failed to replicate significantly within Caco-2 cell (Fig. 27). Electron microscopic study demonstrated that bacteria from the nonhemolyitc mutant remained inside phagosomes during cellular infection, whereas hemolytic bacteria from L. monocytogenes were released free within the cytoplasm (Fig. 28). This indicates that disruption of vacuole membranes by listeriolysin O-producing strains of L. monocytogenes might be a key mechanism allowing bacteria to escape from phagosomes and to

54

multiply unrestricted within cell cytoplasm (Gaillard et al., 1987).

55

56

During bacterial dissemination inside the host tissues, bacteria are visible inside hepatocytes surrounding infectious foci and are capable of gaining access to target-organs, including the placenta, central nervous system or skin. This suggests that bacteria cross endothelial cells of capillaries and that the process of intracellular multiplication also occurs in various tissues. L. monocytogenes is capable of growing inside non-immune phagocytes. That even macrophages might be the site of bacterial growth explains the difficulty encountered by the immune system in eliminating the bacteria (Berche et al., 1988). An extracellular protein (p60, 60 kDa) is involved in intracellular uptake of L. monocytogenes by mammalian cells. It does not seem to be associated with the intracellular survival, since p60 teated mutant can penetrate and survived in the cell (Kuhn and Goebel, 1989). Mutants impaired in the synthesis of this protein lost the capability of invading nonprofessional phagocytic mouse fibroblast cells. The p60 mutants formed abnormal long cell chains which disaggregated to normal-sized single bacteria upon treatment with partially purified p60. These disaggregated bacterial cells were able to invade mouse fibroblast cells. Physical disruption of the cell chains by ultrasonication produced similar single cells which were noninvasive (Fig. 29) (Kuhn and Goebel, 1989).

57

Cell envelope fragments and purified ribosomes fractions combined with the adjuvant dimethyldioctadecylammonium bromide (DDA) could protect mice against lethal Listeria infection. The cell envelope proteins (antigens) involved in such protection are named as delayed hypersensitivity-inducing proteins. A purified 20,400 Mol. Wt. was purified and it is believed that more than one antigens are involved in such protection (Antonissen et al., 1986). 7.4. Hemolysins of L. monocytogenes Hemolytic and lipolytic antigens were purified in the early 1970's. The hemolysin purified by acid precipitation and repeated chromatographies was a protein of molecular weight 171,000 (Jenkins and Watson, 1971). These hemolytic and lipolytic antigens were toxic to mouse macrophage monolayers (Watson and Lavizzo, 1973). This hemolysin could increase the plasma

58

β-glucuronidase levels when intraperitoneal injected into mice, and it caused increased plasma levels of ornithine carbamyltransferase after intravenous injection (Kingdon and Sword, 1970). Streptolysin S (SLS) is a bacteriocin-like haemolytic and cytotoxic virulence factor that plays a key role in the virulence of Group A Streptococcus (GAS), the causative agent of pharyngitis, impetigo, necrotizing fasciitis and streptococcal toxic shock syndrome. Although it has long been thought that SLS and related peptides are produced by GAS and related streptococci only, there is evidence to suggest that a number of the most notorious Gram-positive pathogenic bacteria, including L. monocytogenes, Clostridium botulinum and Staphylococcus aureus, produce related peptides (Fig. 30). The distribution of the L. monocytogenes cluster is particularly noteworthy in that it is found exclusively among a subset of lineage I strains; i.e., those responsible for the majority of outbreaks of listeriosis. Expression of these genes results in the production of a haemolytic and cytotoxic factor, designated Listeriolysin S, which contributes to virulence of the pathogen as assessed by murine- and human polymorphonuclear neutrophil-based studies (Cotter et al., 2008).

59

7.4.1 Production of Listeriolysin The listeriolysin O is similar to other sulfhydryl-activated hemolysin such as streptolysin O, pneumolysin, alveolysin, perfringolysin O (Geoffroy et al., 1987). It is produced by virulent L. monocytogenes and also by L. ivanovii and L. seeligeri and these two species are also pathogenic, mostly in animals (Leimeister-W:achter and Chakraborty, 1989; Vazquez-Boland et al., 1989). The listeriolysin O from L. ivanovii shows good homology to the deduced amino acid sequence of the listeriolysin O from L. monocytogenes. In culture supernatants of L. ivanovii a sphingomyelinase and a lecithinase activity could be detected, both enzymatic activities together contributing to the pronounced hemolysis caused by L. ivanovii (Kreft et al., 1989). It has been postulated that the intracellular environment imposes stress conditions similar to heat shock on invading bacteria. The intracellular environment (low pH, presence of H2O2 and other oxidating agents) may impose a stress on the bacterial cells to which the bacteria may react by inducing stress proteins, e.g., heat shock proteins. Listeriolysin was still very efficiently synthesized in one L. monocytogenes strain even intracellularly and induced under heat shock conditions in another strain. Listeriolysin appears to be the only major extracellular protein synthesized under heat shock conditions; other heat shock proteins remain cell associated (Sokolovic and Goebel, 1989). 7.4.2. Purification of Listeriolysin Bacteria were grown for 18 h at 37 C in Chelex-treated medium, which allowed a remarkably greater hemolysin production. The supernatant fluid was concentrated by ultrafiltration. The crude concentrate was passed through thiopropyl-Sepharose 6B column (thio-disulfide exchange affinity chromatography), and further purified by three gel filtrations (Sephacryl S-200, Bio-Gel P-100, Fractogel HW-50). A single polypeptide chain of MW 60,000, visualized as one sharp band by SDS-PAGE, was obtained (Geoffroy et al., 1987). The purification of such SH-cytolysins could be achieved by a further gel filtration with a reducing agent (dithiothreitol) in the eluent (Vazquez-Boland et al., 1989). Listeriolysin O associated with the rabbit erythrocyte membrane was also

60

purified, and the monomer was estimated to be 55,000 to 60,000 by SDS-PAGE. This hemolysin in form of oligomers embeds within the lipid bilayer generated generated large transmembrane pores (Parrisius et al., 1986). The thiol-activated hemolysin (cytolysin) of 61 kDa produced by L. ivanovii was also purified and it is also named as ivanolysin O (Vazquez-Boland et al., 1989). 7.4.3. Characteristics of Listeriolysin The purified hemolysin displayed the usual properties of the SH-activated cytolysins. Activity was inhibited by cholesterol. Epicholesterol is a very weak inhibitor, while dehydroepiandrosterone (lack aliphatic side chain) was inactive. Activity is totally inhibited by HgCl2 or p-chloromercuribenzoate. The mercurial inhibition is reversed by dithiothreitol or cysteine (Geoffroy et al., 1987). Activity will loose after treatment with cholesterol for 30 min at 37 C. This toxin exhibits a narrow pH range of activity, with optimum at pH 5.5, and no activity at pH 7.0. Hemolytic activity will restore after returning the pH from 7.0 to 5.5 (Geoffroy et al., 1987). This toxin is antigenically related to streptolysin O, the pure toxin gave a single immunoprecipitate line by gel diffusion versus horse anti-streptolysin serum (Geoffroy et al., 1987). 7.4.4. Toxicity of Listeriolysin The purified toxin is cytolytic at very low doses; and 30-40 molecules of listeriolysin O is needed to lyse a single erythrocyte (Geoffroy et al., 1987). The LD50 of determined by i.v. injection into mice is about 0.8 μg per mouse. Toxin administered in PBS at pH 5.5-6.8, the mice died within 1 to 2 min, while at pH 7.2, the mice died after a delay of 30 to 60 min, but the LD50 remains unchanged. Toxin injected intradermally into mouse will induce rapid inflammatory, but no mortality was observed up to 5 μg of toxin (Geoffroy et al., 1987). 7.4.5. Function of Listiolysin

61

A nonhemolytic mutant was generated by inserting a single copy of transposon Tn917 in the structural gene of listeriolysin O (hlyA) and these mutant were avirulent in the mouse (Cossart et al., 1989). Two of these nonhemolytic strains were rapidly destroyed within 48 h of infection. In contrast, the complemented strain (hlyA::Tn917, pLis4) harboring the hlyA gene on plasmid pLis4 replicated in spleen and liver, inducing visible abscesses and early mortality in mice (Cossart et al., 1989). In another paper, Tn916-induced nonhemolytic mutants of L. monocytogenes are avirulent. When these mutants and hemolytic virulent strain were incubated with macrophages, both strains were capable of becoming internalized. The hemolytic strain multiplied rapidly and the non-hemolytic strains were unable to multiply intracellularly (Kuhn et al., 1988). The uptake of nonhemolytic mutants and other hemolytic virulent strains had similar uptake rate by the nonprofessional phagocytes, the mouse embryonic fibroblast cell line 3T6 (Kuhn et al., 1988). 7.4.6. Molecular Study of Listeriolysin By immunoblotting with an antiserum raised against purified listeriolysin O, Cossart et al. detected the presence of a truncated protein of 52 kD in culture supernatants of a Tn1545-induced nonhemolytic mutant of L. monocytogenes (Mengaud et al., 1987). The region of insertion of the transposon (in a open reading frame, ORF) has been cloned and sequenced and the deduced amino acid sequence of this open reading frame revealed that listeriolysin O is homologous to streptolysin O and pneumolysin, although homologies were not detectable at the DNA level (Mengaud et al., 1987; Mengaud et al., 1988). So it is why some toxins are immunologically cross-reactive and not hybridize at stringent condition at the DNA level. Chromosomal DNA of L. monocytogenes, digested with MboI, had been cloned in the BamHI site of the cosmid vector pHC79. After transformation of E. coli HB101, hemolytic clones were obtained on ampicillin-blood agar plates. By further selections, pCL102 was obtained and it contained an 8.5 kb insert DNA. Hemolytic activity could be detected and the production of listeriolysin O was detected by Western blot analysis of the extracts, using an antiserum (Mengaud et al., 1988). Sequence of 400 bp in the open reading frame of listeriolysin O next to the insert transposon DNA (Mengaud et al., 1987) was used as a probe to identify the location of the listeriolysin O gene in the pCL102 (Mengaud et

62

al., 1988). The insert was subcloned into linerarized replicative forms of M13mp18, M13mp19, and M13mp21 and transformed into competent E. coli TG1 cells. The nucleotide sequence was determined by the dideoxy chain terminator method. The first ATG in this ORF is preceded, 10 nucleotides upstream, by a hexanucleotide (AAGGAG) complementary to the 3' end of the 16S RNA of L. monocytogenes which might be the ribosome binding site (Shine-Dalgarno) for the listeriolysin O gene (Mengaud et al., 1988). The hlyA (encodes listeriolysin O) gene was also cloned in E. coli DH5α by screening a gene library of about 4-10 kb L. monocytogenes DNA in pUC18 vector (Leimeister-W:achter and Chakraborty, 1989). The protein encoded by the ORF starting at the ATG is 529 amino acid long (586,000). Its amino-terminal sequence presents all the characteristics of signal sequences of gram-positive bacteria, as follows: the first residues are hydrophilic and positively charged, followed by about 20 hydrophobic residues. The putative cleavage site by the signal peptidase lies probably after lysine 25, as the sequence starting at residue 26 is homologous to the amino-terminal sequence of the SH-dependent hemolysin secreted by L. ivanovii. Consequently, the secreted listeriolysin O (without the signal sequence) would contain 504 amino acids and have a molecular mass of 558,000 (Mengaud et al., 1988). The analysis of a non-hemolytic variants revealed the presence of a deletion of 300 bp and a transposon insertion located 1.6 kb and 200 bp upstream of the hlyA gene, respectively, and suggests that at least two elements at these upstream position are required for the expression of the hlyA gene (Leimeister-W:achter et al., 1989). In fact, two ORFs are located adjacent to the hlyA region, ORF D located 304 bp downstream from hlyA, and ORF U located 224 bp upstream from and in opposite direction to hlyA. Promoter mapping performed by both primer extension with reverse transcriptase mapping and S1 nuclease mapping with RNAs extracted from cells. The three ORFs are independently transcribed. The hlyA is transcribed from two promoters separated by 10 bp (P1 hlyA and P2 hlyA). ORF U is transcribed in the opposite direction from an adjacent promoter (Fig. 31). The four promoter sequences have -10 regions related to the E. coli consensus sequence, but only one of them (P1 hlyA) has a -35 region similar to the E. coli consensus sequence. These two

63

promoter regions are separated by a palindrome sequence TTAACAA/ TA/TTGTTAA. This palindrome was also found upstream from the ORF D promoter, suggesting that all three genes are similarly regulated (Fig. 32) (Mengaud et al., 1989).

64

Among various strains of L. monocytogenes tested, the gene hlyA and its 3' adjacent region appeared well-conserved, and a restriction length polymorphism was detected in the region located upstream from hlyA with no obvious correlation with the hemolytic phenotype or the serovar of the strains tested (Gormley et al., 1989). In another paper (Leimeister-W:achter and Chakraborty, 1989), all the serotypes of L. monocytogenes, the hlyA gene is present as a single-copy gene on the chromosome, regardless of the strength of the hemolytic phenotype. No differences in DNA hybridization patterns were obtained with the restriction enzymes EcoRI, SphI, BamHI, or AccI in strains with various hemolytic activities belonging to the same phenotype. Sequences within the hlyA structural gene appear to be well conserved from strain to strain, and it is suspected that the differences observed in hemolytic activity may be due to mutations that affect the expression of the gene (Leimeister-W:achter and Chakraborty, 1989). The flanking regions of hlyA were less conserved, and are somewhat serotype specific (Fig. 33, 34) (Leimeister-W:achter and Chakraborty, 1989).

65

A probe, an 651-bp HindIII fragment from this hlyA gene, only hybridized to L. monocytogenes, but not to other Listeria spp. (Mengaud et al., 1988). Under low-stringency hybridization conditions, sequences homologous to the hlyA gene and its 5' adjacent regions were detected in the hemolytic and pathogenic species L. ivanovii, and in the hemolytic but non-pathogenic species L. seeligeri (Gormley et al., 1989; Leimeister-W:achter and Chakraborty, 1989). Comparison of listeriolysin O with streptolysin O and pneumolysin Streptolysin O from Streptococcus pyogenes and pneumolysin from S. pneumoniae share homologies. These proteins have identical molecular weight, if one takes into account the secreted form of streptolysin O (471 amino acids), the pneumolysin (471 amino acids) being a nonsecreted protein. The putative

66

signal sequence of listeriolysin (25 amino acids) is shorter than that of streptolysin (33 amino acids). They have a unique cysteine located in their carboxy-terminal part, and when one aligns the two sequences at the unique cysteine, the highest homology lies in the region of this unique cysteine. Homologies between the three proteins are present along the whole sequence, but they are stronger towards the carboxy-terminal end. In particular, around the unique cysteine, an 11-amino-acid peptide is conserved in the three sequences. The three sequences can be completely aligned at the unique cysteine, if one introduces two deletions of 1 amino acid for streptolysin O and one delection of 1 amino acid for pneumolysin. The signal sequence of listeriolysin O corresponds to the N-terminal part of streptolysin O, the hydrophobic amino acids of listeriolysin O being changed for hydrophilic ones. This is the region of lowest homology (Mengaud et al., 1988). 7.4.7. The CAMP Factor The Christie-Atkins-Munch-Peterson (CAMP) test is useful in confirming species. The test is performed by streaking a β-hemolytic Staphylococcus aureus and a Rodococcus equi culture in parallel on a sheep blood agar plate, with several test culture streaked parallel to one another, but at right angles to and between the S. aureus and R. equi. Some bacteria such as group B streptococci and Listeria induce a distinct zone of complete hemolysis when grown near the diffusion zone of the β-hemolysin of S. aureus. The CAMP factor is a protein that stably binds to ceramide-containing membranes, e.g. erythrocytes, in which the membrane sphinogomyelin had been converted to ceramide by a sphingomyelinase produced (Schneewind et al., 1988). Since L. monocytogenes shows positive CAMP test with staphylococci, the listeriolysin O or another specific CAMP factor may be responsible. In contrast, L. ivanovii is CAMP positive with R. equi, a sphingomyelinase must be produced, and actually a 27 kD hemolytic sphingomyelinase C was purified (Vazquez-Boland et al., 1989). Sphingomyelinase and lecithinase activity could be detected in L. invanovii culture supernatant (Kreft et al., 1989). 7.5. Expression of virulence factors

67

L. monocytogenes genome expression during mouse infection was determined by microarray. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data showed that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. The in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence (Fig. 35) (Camejo et al., 2009).

68

The influence of food-related acid stress on the virulence capacity of L. monocytogenes was evaluated. The survival of acid-adapted and non-adapted L. monocytogenes cells during exposure to lethal concentrations of acetic acid was monitored. Also the effect of sublethal acid stress exposure on the expression levels of several virulence genes and on the capacity to invade Caco-2 cells was analyzed. Acid-adapted and non-adapted cells showed different acid tolerance response (ATR) patterns (Fig. 36). Data also demonstrate that pre-exposure to sublethal acid stress might lead to gadD2 induction. However, no correlation with the origin of the strain and with the ATR was noticed, indicating that probably other genes also could play an important role in this ATR mechanism. Additionally, our data showed that acid adaptation could influence the virulence

69

capacity by regulating the expression levels of virulence genes. Moreover, the inlA expression data strongly correlated with the results of the in vitro invasion study. These results lead to the indication that low pH and acetic acid, used in minimally processed food products, might influence the virulence potential of L. monocytogenes (Table 19, 20) (Werbrouck et al., 2009).

70

L. monocytogenes can respond rapidly to changing environmental conditions, as illustrated by its ability to transition from a saprophyte to an orally transmitted facultative intracellular pathogen. Differential associations between various alternative sigma factors and a core RNA polymerase provide a transcriptional mechanism for regulating bacterial gene expression that is crucial for survival in rapidly changing conditions. Alternative sigma factors are key components of complex L. monocytogenes regulatory networks that include multiple transcriptional regulators of stress-response and virulence genes, regulation of genes encoding other regulators, and regulation of small RNAs (Table 21, Fig. 37) (Chaturongakul et al., 2008).

71

72

8. CONCLUSIONS L. monocytogenes is a pathogenic bacterium widely distributed in the foods and environments. It has been involved in foodborne listeriosis in American and Europian countries. The number of cases is increasing (McLauchlin, 1987). Also, the incidence of this pathogen in local foods is similar to other reports (Wong et al., 1990). However, the occurrence of listeriosis in Taiwan is unknown. The following works could be done to clearify Listeria problems in this area and improve food safety: 1. Introduce identification methodology to the food industry, clinical

73

laboratories, and governmental laboratories. 2. Survey the presence of this pathogen in foods, especially in those unique Chinese foods. 3. Improve the sanitation operations in food industry with regard to this pathogen. 9. REFERENCES Al-Ghazali,M.R.,Al-Azawi,S.K. 1990. Listeria monocytogenes contamination of crops grown on soil treated with sewage sludge cake. Journal of Applied Bacteriology 69, 642-647.

Al-Ghazali,M.R.,Al-Azawi,S.K. 1988. Effects of sewage treatment on the removal of Listeria monocytogenes. Journal of Applied Bacteriology 65, 203-208.

Antonissen,A.C.J.M., Lemmens,P.J.M.R., van den Bosch,J.F., van Boven,C.P.A. 1986. Purification of a delayed hypersensitivity-inducing protein from Listeria monocytogenes. FEMS Microbiol. Lett. 34, 91-95.

Badosa,E., Chico,N., Pla,M., Pares,D., Montesinos,E. 2009. Evaluation of ISO enrichment real-time PCR methods with internal amplification control for detection of Listeria monocytogenes and Salmonella enterica in fresh fruit and vegetables. Letters in Applied Microbiology 49, 105-111.

Bailey,J.S., Fletcher,D.L., Cox,N.A. 1989. Recovery and serotype distribution of Listeria monocytogenes from broiler chickens in the Southeastern United States. Journal of Food Protection 52, 148-150.

Baloga,A.O.,Harlander,S.K. 1991. Comparison of methods for discrimination between strains of Listeria monocytogenes from epidemiological surveys. Applied and Environmental Microbiology 57, 2324-2331.

Bannerman,E.S.,Bille,J. 1988. A new selective medium for isolating Listeria spp. from heavily contaminated material. Applied and Environmental Microbiology 54, 165-167.

Barmpalia-Davis,I.M., Geornaras,I., Kendall,P.A., SOFOS,J.N. 2008. Survival of Listeria monocytogenes in a simulated dynamic gastrointestinal model during

74

storage of inoculated bologna and salami slices in vacuum packages. Journal of Food Protection 71, 2014-2023.

Berche,P., Gaillard,J.-L., Richard,S. 1988. Invasiveness and intracellular growth of Listeria monocytogenes. Infection 16(suppl.2), S145-S148.

Bessesen,M.T., Luo,Q., Rotbart,H.A., Blaser,M.J., Ellison III,R.T. 1990. Detection of Listeria monocytogenes by using the polymerase chain reaction. Applied and Environmental Microbiology 56, 2930-2932.

Beuchat,L.R., Brackett,R.E., Hao,D.Y., Conner,D.E. 1986. Growth and thermal inactivation of Listeria monocytogenes in cabbage and cabbage juice. Canadian Journal of Microbiology 32, 791-795.

Blanco,M., Fernandez-Garayzabal,J.F., Dominguez,L., Briones,V., Vazquez-Boland,J.A., Blanco,J.L., Garcia,J.A., Suarez,G. 1989. A technique for the direct identification of haemolytic-pathogenic Listeria on selective plating media. Letters in Applied Microbiology 9, 125-128.

Border,P.M., Howard,J.J., Plastow,G.S., Siggens,K.W. 1990. Detection of Listeria species and Listeria monocytogenes using polymerase chain reaction. Letters in Applied Microbiology 11, 158-162.

Brackett,R.E. 1987. Antimicrobial effect of chlorine on Listeria monocytogenes. Journal of Food Protection 50, 999-1003.

Brackett,R.E. 1988. Presence and persistence of Listeria monocytogenes in food and water. Food Techn. 42(4), 162-164.

Bradshaw,J.G., Peeler,J.T., Corwin,J.J., Hunt,J.M., Tierney,J.T., Larkin,E.P., Twedt,R.M. 1985. Thermal resistance of Listeria monocytogenes in milk. Journal of Food Protection 48, 743-745.

Bradshaw,J.G., Peeler,J.T., Corwin,J.J., Hunt,J.M., Twedt,R.M. 1987. Thermal resistance of Listeria monocytogenes in dairy products. Journal of Food Protection 50, 543-544.

Buchanan,R.L., Stahl,H.G., Bencivengo,M.M., Del Corral,F. 1989. Comparison of lithium chloride-phenylethanol-moxalactam and modified Vogel Johnson Agars for detection of Listeria spp. in retail-level meats, poultry, and seafood. Applied and Environmental Microbiology 55, 599-603.

75

Bunning,V.K., Crawford,R.G., Tierney,J.T., Peeler,J.T. 1990. Thermotolerance of Listeria monocytogenes and Salmonella typhimurium after sublethal heat shock. Applied and Environmental Microbiology 56, 3216-3219.

Butman,B.T., Plank,M.C., Durham,R.J., Mattingly,J.A. 1988. Monoclonal antibodies which identify a genus-specific Listeria antigen. Applied and Environmental Microbiology 54, 1564-1569.

Byelashov,O.A., Kendall,P.A., Belk,K.E., Scanga,J.A., SOFOS,J.N. 2008. Control of Listeria monocytogenes on vacuum-packaged frankfurters sprayed with lactic acid alone or in combination with sodium lauryl sulfate. Journal of Food Protection 71, 728-734.

Camejo,A., Buchrieser,C., Couve,E., Carvalho,F., Reis,O., Ferreira,P., Sousa,S., Cossart,P., Cabanes,D. 2009. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection. PLoS Pathog. 5, e1000449.

Cassiday,P.K., Brackett,R.E., Beuchat,L.R. 1989. Evaluation of three newly developed direct plating media to enumerate Listeria monocytogenes in foods. Applied and Environmental Microbiology 55, 1645-1648.

Chaturongakul,S., Raengpradub,S., Wiedmann,M., Boor,K.J. 2008. Modulation of stress and virulence in Listeria monocytogenes. Trends Microbiol. 16, 388-396.

Chen,J., Chen,Q., Jiang,J., Hu,H., Ye,J., Fang,W. 2009. Serovar 4b Complex Predominates Among Listeria monocytogenes Isolates from Imported Aquatic Products in China. Foodborne. Pathog. Dis.

CHEN,N.,Shelef,L.A. 1992. Relationship between water activity, salts of lactic acid, and growth of Lisateria monocytogenes in a meat model system. Journal of Food Protection 55, 574-578.

Conner,D.E., Brackett,R.E., Beuchat,L.R. 1986. Effect of temperature, sodium chloride, and pH on growth of Listeria monocytogenes in cabbage juice. Applied and Environmental Microbiology 52, 59-63.

Conter,M., Paludi,D., Zanardi,E., Ghidini,S., Vergara,A., Ianieri,A. 2009. Characterization of antimicrobial resistance of foodborne Listeria monocytogenes. Internation Journal of Food Microbiology 128, 497-500.

76

Cossart,P., Vicente,M.F., Mengaud,J., Baquero,F., Perez-Diaz,J.C., Berche,P. 1989. Listeriolysin O is essential for virulence of Listeria monocytogenes: direct evidence obtained by gene complementation. Infection & Immunity 57, 3629-3636.

Cotter,P.D., Draper,L.A., Lawton,E.M., Daly,K.M., Groeger,D.S., Casey,P.G., Ross,R.P., HILL,C. 2008. Listeriolysin S, a novel peptide haemolysin associated with a subset of lineage I Listeria monocytogenes. PLoS Pathog. 4, e1000144.

Crawford,R.G., Beliveau,C.M., Peeler,J.T., Donnelly,C.W., Bunning,V.K. 1989. Comparative recovery of uninjured and heat-injured Listeria monocytogenes cells from bovine milk. Applied and Environmental Microbiology 55, 1490-1494.

Curtis,G.D.W., Nichols,W.W., Falla,T.J. 1989. Selective agents for Listeria can inhibit their growth. Letters in Applied Microbiology 8, 169-172.

Datta,A.R., Wentz,B.A., Hill,W.E. 1987. Detection of hemolytic Listeria monocytogenes by using DNA colony hybridization. Applied and Environmental Microbiology 53, 2256-2259.

Datta,A.R., Wentz,B.A., Russell,J. 1990. Cloning of the listeriolysin O gene and development of specific gene probes for Listeria monocytogenes. Applied and Environmental Microbiology 56, 3874-3877.

Deneer,H.G.,Boychuk,I. 1991. Species-specific detection of Listeria monocytogenes by DNA amplification. Applied and Environmental Microbiology 57, 606-609.

Donnelly,C.W.,Baigent,G.J. 1986. Method for flow cytometric detection of Listeria monocytogenes in milk. Applied and Environmental Microbiology 52, 689-695.

Donnelly,C.W., Baigent,G.J., Briggs,E.H. 1988. Flow cytometry for automated analysis of milk containing Listeria monocytogenes. J. Assoc. Off. Anal. Chem. 71, 655-664.

Donnelly,C.W., Briggs,E.H., Donnelly,L.S. 1987. Comparison of heat resistance of Listeria monocytogenes in milk as determined by two methods. Journal of Food Protection 50, 14-17.

Doumith,M., Buchrieser,C., Glaser,P., JACQUET,C., Martin,P. 2004.

77

Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. Journal of Clinial Microbiology 42, 3819-3822.

Doyle,M.P. 1988. Effect of environmental and processing conditions on Listeria monocytogenes. Food Techn. 42(4), 169-171.

Doyle,M.P.,Schoeni,J.L. 1986. Selective-enrichment procedure for isolation of Listeria monocytogenes from fecal and biologic specimens. Applied and Environmental Microbiology 51, 1127-1129.

Doyle,M.P.,Schoeni,J.L. 1987. Comparison of procedures for isolating Listeria monocytogenes in soft, surface-ripened cheese. Journal of Food Protection 50, 4-6.

El-Kest,S.E.,Marth,E.H. 1988a. Inactivation of Listeria monocytogenes by chlorine. Journal of Food Protection 51, 520-524.

El-Kest,S.E.,Marth,E.H. 1988b. Temperature,pH, and strain of pathogen as factors affecting inactivation of Listeria monocytogenes by chlorine. Journal of Food Protection 51, 622-625.

El-Shenawy,M.A.,Marth,E.H. 1988a. Inhibition and inactivation of Listeria monocytogenes by sorbic acid. Journal of Food Protection 51, 842-847.

El-Shenawy,M.A.,Marth,E.H. 1988b. Sodium benzoate inhibits growth of or inactivates Listeria monocytogenes. Journal of Food Protection 51, 525-530.

Flamm,R.K., Hinrichs,D.J., Thomashow,M.F. 1989. Cloning of a gene encoding a major secreted polypeptide of Listeria monocytogenes and its potential use as a species-specific probe. Applied and Environmental Microbiology 55, 2251-2256.

Fleming,D.W., Cochi,S.L., MacDonald,K.L., Brondum,J., Hayes,P.S., Plikaytis,B.D., Holmes,M.B., Audurier,A., Broome,C.V., Remgold,A.L. 1985. Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. N. Engl. J. Med. 312, 404-407.

Fox,E., O'Mahony,T., Clancy,M., Dempsey,R., O'Brien,M., Jordan,K. 2009. Listeria monocytogenes in the Irish dairy farm environment. Journal of Food Protection 72, 1450-1456.

Fraser,J.A.,Sperber,W.H. 1988. Rapid detection of Listeria spp. in food and

78

environmental samples by esculin hydrolysis. Journal of Food Protection 51, 762-765.

Furrer,B., Candrian,U., Hoefelein C, Luethy,J. 1991. Detection and identification of Listeria monocytogenes in cooked sausage products and in milk by in vitro amplification of haemolysin gene fragments. Journal of Applied Bacteriology 70, 372-379.

Gaillard,J.L., Berche,P., Mounier,J., Richard,S., Sansonetti,P. 1987. In vitro model of penetration and intracellular growth of Listeria monocytogenes in the human enterocyte-like cell line Caco-2. Infection & Immunity 55, 2822-2829.

Geoffroy,C., Gaillard,J.L., Alouf,J.E., Berche,P. 1987. Purification, characterization, and toxicity of the sulfhydryl-activated hemolysin listeriolysin O from Listeria monocytogenes. Infection & Immunity 55, 1641-1646.

Glass,K.A.,Doyle,M.P. 1989a. Fate and thermal inactivation of Listeria monocytogenes in beaker sausage and pepperoni. Journal of Food Protection 52, 226-231.

Glass,K.A.,Doyle,M.P. 1989b. Fate of Listeria monocytogenes in processed meat products during refrigerated storage. Applied and Environmental Microbiology 55, 1565-1569.

Golden,D.A., Beuchat,L.R., Brackett,R.E. 1988a. Direct plating technique for enumeration of Listeria monocytogenes in foods. J. Assoc. Off. Anal. Chem. 71, 647-650.

Golden,D.A., Beuchat,L.R., Brackett,R.E. 1988b. Evaluation of selective direct plating media for their suitability to recover uninjured, heat-injured, and freeze-injured Listeria monocytogenes from foods. Applied and Environmental Microbiology 54, 1451-1456.

Gormley,E., Mengaud,J., Cossart,P. 1989. Sequences homologous to the listeriolysin O gene region of Listeria monocytogenes are present in virulent and avirulent haemolytic species of the genus Listeria. Res. Microbiol. 140, 631-643.

Gray,M.L. 1960. Isolation of Listeria monocytogenes from oat silage. Science 132, 1767-1768.

Hao,D.Y., Beuchat,L.R., Brackett,R.E. 1987. Comparison of media and methods

79

for detecting and enumerating Listeria monocytogenes in refrigerated cabbage. Applied and Environmental Microbiology 53, 955-957.

Harris,L.J., Daeschel,M.A., Stiles,M.E., Klaenhammer,T.R. 1989. Antimicrobial activity of lactic acid bacteria against Listeria monocytogenes. Journal of Food Protection 52, 384-387.

Harrison,M.A.,Carpenter,S.L. 1989. Survival of large populations of Listeria monocytogenes on chicken breasts processed using moist heat. Journal of Food Protection 52, 376-378.

Hashisaka,A.E., Weagant,S.D., Dong,F.M. 1989. Survival of Listeria monocytogenes in Mozzarella cheese and ice cream exposed to gamma irradiation. Journal of Food Protection 52, 490-492.

Heisick,J.E., Harrell,F.M., Peterson,E.H., McLaughlin,S., Wagner,D.E., Wesley,I.V., Bryner,J. 1989a. Comparison of four procedures to detect Listeria spp. in foods. Journal of Food Protection 52, 154-157.

Heisick,J.E., Wagner,D.E., Nierman,M.L., Peeler,J.T. 1989b. Listeria spp. found on fresh market produce. Applied and Environmental Microbiology 55, 1925-1927.

Jenkins,E.M.,Watson,B.B. 1971. Extracellular antigens from Listeria monocytogenes.I. Purification and resolution of hemolytic and lipolytic antigens from culture filtrates of Listeria monocytogenes. Infection & Immunity 3, 589-594.

Jiang,L., Chen,J., Xu,J., Zhang,X., Wang,S., Zhao,H., Vongxay,K., Fang,W. 2008. Virulence characterization and genotypic analyses of Listeria monocytogenes isolates from food and processing environments in eastern China. Internation Journal of Food Microbiology 121, 53-59.

Johnson,J.L., Doyle,M.P., Cassens,R.G., Schoeni,J.L. 1988. Fate of Listeria monocytogenes in tissues of experimentally infected cattle and in hard salami. Applied and Environmental Microbiology 54, 497-501.

Junttila,J.R., Hirn,J., Hill,P., Nurmi,E. 1989. Effect of different levels of nitrite and nitrate on the survival of Listeria monocytogenes during the manufacture of fermented sausage. Journal of Food Protection 52, 158-161.

Junttila,J.R., Niemel:a,S.I., Hirn,J. 1988. Minimum growth temperatures of

80

Listeria monocytogenes and non-haemolytic Listeria. Journal of Applied Bacteriology 65, 321-327.

Kim,C., Swaminathan,B., Cassaday,P.K., Mayer,L.W., Holloway,B.P. 1991. Rapid confirmation of Listeria monocytogenes isolated from foods by a colony blot assay using a digoxigenin-labeled synthetic oligonucleotide probe. Applied and Environmental Microbiology 57, 1609-1614.

Kim,M.K., Bang,W., Drake,M.A., Hanson,D.J., Jaykus,L.A. 2009. Impact of storage temperature and product pH on the survival of Listeria monocytogenes in vacuum-packaged souse. Journal of Food Protection 72, 637-643.

Kingdon,G.C.,Sword,C.P. 1970. Biochemical and immunological effects of Listeria monocytogenes hemolysin. Infection & Immunity 1, 363-372.

Klinger,J.D., Johnson,A., Croan,D., Flynn,P., Whippie,K., Kimball,M., Lawrie,J., Curiale,M. 1988. Comparative studies of Nucleic acid hybridization assay for Listeria in foods. J. Assoc. Off. Anal. Chem. 71, 669-673.

Klinger,J.D.,Johnson,A.R. 1988. A rapid nucleic acid hybridization assay for Listeria in Foods. Food Techn. 42(7), 66-70.

Ko:hler,S., Leimeister-Wa:chter,M., Chakraborty,T., Lottspeich,F., Goebel,W. 1990. The gene coding for protein p60 of Listeria monocytogenes and its use as a specific probe for Listeria monocytogenes. Infection & Immunity 58, 1943-1950.

Kreft,J., Funke,D., Haas,A., Lottspeich,F., Goebel,W. 1989. Production, purification and characterization of hemolysins from Listeria ivanovii and Listeria monocytogenes Sv4b. FEMS Microbiol. Lett. 57, 197-202.

Kuhn,M.,Goebel,W. 1989. Identification of an extracellular protein of Listeria monocytogenes possibly involved in intracellular uptake by mammalian cells. Infection & Immunity 57, 55-61.

Kuhn,M., Kathariou,S., Goebel,W. 1988. Hemolysin supports survival but not entry of the intracellular bacterium Listeria monocytogenes. Infection & Immunity 56, 79-82.

Latorre,A.A., Van Kessel,J.A., Karns,J.S., Zurakowski,M.J., Pradhan,A.K., Zadoks,R.N., Boor,K.J., Schukken,Y.H. 2009a. Molecular ecology of Listeria monocytogenes: evidence for a reservoir in milking equipment on a dairy farm.

81

Appl. Environ Microbiol. 75, 1315-1323.

Latorre,A.A., Van Kessel,J.A., Karns,J.S., Zurakowski,M.J., Pradhan,A.K., Zadoks,R.N., Boor,K.J., Schukken,Y.H. 2009b. Molecular ecology of Listeria monocytogenes: evidence for a reservoir in milking equipment on a dairy farm. Appl. Environ Microbiol. 75, 1315-1323.

Lee,W.H.,McClain,D. 1986. Improved Listeria monocytogenes selective agar. Applied and Environmental Microbiology 52, 1215-1217.

Leimeister-W:achter,M.,Chakraborty,T. 1989. Detection of listeriolysin, the thio-dependent hemolysin in Listeria monocytogenes, Listeria ivanovii, and Listeria seeligeri. Infection & Immunity 57, 2350-2357.

Leimeister-W:achter,M., Goebel,W., Chakraborty,T. 1989. Mutations affecting hemolysin production in Listeria monocytogenes located outside the listeriolysin gene. FEMS Microbiol. Lett. 53, 23-29.

Lindstedt,B.A., Tham,W., nielsson-Tham,M.L., Vardund,T., Helmersson,S., Kapperud,G. 2008. Multiple-locus variable-number tandem-repeats analysis of Listeria monocytogenes using multicolour capillary electrophoresis and comparison with pulsed-field gel electrophoresis typing. J. Microbiol. Methods 72, 141-148.

Loessner,M.J., Bell,R.H., Jay,J.M., Shelef,L.A. 1988. Comparison of seven plating media for enumeration of Listeria spp. Applied and Environmental Microbiology 54, 3003-3007.

Lovett,J. 1988. Isolation and enumeration of Listeria monocytogenes. Food Techn. 42(4), 172-175.

Lovett,J. and Hitchins,A.D. (1989). Listeria isolation. In Bacteriological analytical manual. Supplement. p. 29.01-29.14. Washington,D.C.: Food and Drug Administration.

Mackey,B.M.,Bratchell,N. 1989. The heat resistance of Listeria monocytogenes. Letters in Applied Microbiology 9, 89-94.

Mammina,C., Manfreda,G., Aleo,A., De,C.A., Pellissier,N., Romani,C., Nicoletti,P., Pecile,P., Nastasi,A., Pontello,M.M. 2009. Molecular typing reveals frequent clustering among human isolates of Listeria monocytogenes in Italy. Journal of Food Protection 72, 876-880.

82

Marshall,D.L.,Schmidt,R.H. 1988. Growth of Listeria monocytogenes at 10 C in milk preincubated with selected pseudomonads. Journal of Food Protection 51, 277-282.

Marth,E.H. 1988. Disease characteristics of Listeria monocytogenes. Food Techn. 42(4), 165-168.

McBride,M.E.,Girard,K.F. 1960. A selective method for the isolation of Listeria monocytogenes from mixed bacterial population. J. Lab. Clin. Med. 55, 153-157.

McClain,D.,Lee,W.H. 1988. Development of USDA-FSIS method for isolation of Listeria monocytogenes from raw meat and poultry. J. Assoc. Off. Anal. Chem.

McClure,P.J., Roberts,T.A., Oguru,P.O. 1989. Comparison of the effects of sodium chloride, pH and termperature on the growth of Listeria monocytogenes on gradient plates and in liquid medium. Letters in Applied Microbiology 9, 95-99.

McLauchlin,J. 1987. Listeria monocytogenes, recent advances in the taxonomy and epidemiology of listeriosis in humans. Journal of Applied Bacteriology 63, 1-11.

McLauchlin,J., Greenwood,M.H., Pini,P.N. 1990. The occurrence of Listeria monocytogenes in cheese from a manufacturer associated with a case of listeriosis. Internation Journal of Food Microbiology 10, 255-262.

Mengaud,J., Chenevert,J., Geoffroy,C., Gaillard,J.L., Cossart,P. 1987. Identification of the structural gene encoding the SH-activated hemolysin of Listeria monocytogenes: listeriolysin O is homologous to streptolysin O and pneumolysin. Infection & Immunity 55, 3225-3227.

Mengaud,J., Vicente,M.F., Chenevert,J., Pereira,J.M., Geoffroy,C., Gicquel-Sanzey,B., Baquero,F., Perez-Diaz,J.C., Cossart,P. 1988. Expression in Escherichia coli and sequence analysis of the listeriolysin O determinant of Listeria monocytogenes. Infection & Immunity 56, 766-772.

Mengaud,J., Vicente,M.F., Cossart,P. 1989. Transcriptional mapping and nucleotide sequence of the Listeria monocytogenes hlyA region reveal structural features that may be involved in regulation. Infection & Immunity 57,

83

3695-3701.

Messina,M.C., Ahmad,H.A., Marchello,J.A., Gerba,C.P., Paquette,M.W. 1988. The effect of liquid smoke on Listeria monocytogenes. Journal of Food Protection 51, 629-631.

Mustapha,A.,Liewen,M.B. 1989. Destruction of Listeria monocytogenes by sodium hypochlorite and quaternary ammonium sanitizers. Journal of Food Protection 52, 306-311.

Niederhauser,C., Candrian,U., Hofelein,C., Jermini,M., Buhler,H.-P., Luthy,J. 1992. Use of polymerase chain reaction for detection of Listeria monocytogenes in food. Applied and Environmental Microbiology 58, 1564-1568.

Nielsen,J.W., Dickson,J.S., Crouse,J.D. 1990. Use of a bacteriocin produced by Pediococcus acidilactici to inhibit Listeria monocytogenes associated with fresh meat. Applied and Environmental Microbiology 56, 2142-2145.

Nocera,D., Bannerman E, Rocourt,J., Jaton-Ogay,K., Bille,J. 1990. Characterization by DNA restriction endonuclease analysis of Listeria monocytogenes strains related to the Swiss epidemic of listeriosis Lausanne, Switzerland. Journal of Clinial Microbiology 28, 2259-2263.

Notermans,S., Chakraborty,T., Leimeister-W:achter,M., Dufrenne,J., Heuvelman,K.J., Maas,H., Jansen,W., Wernars,K., Guinee,P. 1989. Specific gene probe for detection of biotyped and serotyped Listeria strains. Applied and Environmental Microbiology 55, 902-906.

Papageorgiou,D.K.,Marth,E.H. 1989. Fate of Listeria monocytogenes during the manufacture and ripening of blue cheese. Journal of Food Protection 52, 459-465.

Parish,M.E.,Higgins,D.P. 1989. Survival of Listeria monocytogenes in Low pH model broth systems. Journal of Food Protection 52, 144-147.

Parrisius,J., Bhakdi,S., Roth,M., Tranum-Jensen,J., Goebel,W., Seeliger,H.P. 1986. Production of listeriolysin by beta-hemolytic strains of Listeria monocytogenes. Infection & Immunity 51, 314-319.

Parsons,G. 1988. Development of DNA probe-based commercial assays. Journal of Clinical Immunoassay 11, 152-160.

84

Patterson,M. 1989. Sensitivity of Listeria monocytogenes to irradiation on poultry meat and in phosphate-buffered saline. Letters in Applied Microbiology 8, 181-184.

Payne,K.D., Rico-Munoz,E., Davidson,P.M. 1989. The antimicrobial activity of phenolic compounds against Listeria monocytogenes and their effectiveness in a model milk system. Journal of Food Protection 52, 151-153.

Peterkin,P.I., Idziak,E.S., Sharpe,A.N. 1991. Detection of Listeria monocytogenes by direct colony hybridization on hydrophobic grid-membrane filters by using a chromogen-labeled DNA probe. Applied and Environmental Microbiology 57, 586-591.

Petran,R.,Zottola,E.A. 1988. Survival of Listeria monocytogenes in simulated milk cooling systems. Journal of Food Protection 51, 172-175.

Phillips,J.D.,Griffiths,M.W. 1989. An electrical method for detecting Listeria spp. Letters in Applied Microbiology 9, 129-132.

Pine,L., Malcolm,G.B., Brooks,J.B., Daneshvar,M.I. 1989. Physiological studies on the growth and utilization of sugars by Listeria species. Canadian Journal of Microbiology 35, 245-254.

Pini,P.N.,Gilbert,R.J. 1988a. A comparison of two procedures for the isolation of Listeria monocytogenes from raw chickens and soft cheeses. Internation Journal of Food Microbiology 7, 321-337.

Pini,P.N.,Gilbert,R.J. 1988b. The occurrence in the U.K. of Listeria species in raw chickens and soft cheeses. Internation Journal of Food Microbiology 6, 317-326.

Pucci,M.J., Vedamuthu,E.R., Kunka,B.S., Vandenbergh,P.A. 1988. Inhibition of Listeria monocytogenes by using bacteriocin PA-1 produced by Pediococcus acidilactici PAC 1.0. Applied and Environmental Microbiology 54, 2349-2353.

Rocourt,J., Grimont,F., Grimont,P.A.D., Seeliger,H.P.R. 1982. DNA relatedness among serovars of Listeria monocytogenes sensu lato. Current Microbiology 7, 383-388.

Rodriguez,L.D., Boland,J.A.V., Garayzabal,J.F.F., Tranchant,P.E., Gomez-Lucia,E., Ferri,E.F.R., Fernandez,G.S. 1986. Microplate technique to determine hemolytic activity for routine typing of Listeria strains. Journal of

85

Clinial Microbiology 24, 99-103.

Rodriguez,L.D., Fernandez,G.S., Garayzabal,J.F.F., Ferri,E.R. 1984. New methodology for the isolation of Listeria microorganisms from heavily contaminated environments. Applied and Environmental Microbiology 47, 1188-1190.

Ryser,E.T.,Marth,E.H. 1987a. Fate of Listeria monocytogenes during the manufacture and ripening of Camembert cheese. Journal of Food Protection 50, 372-378.

Ryser,E.T.,Marth,E.H. 1987b. Behavior of Listeria monocytogenes during the manufacture and ripening of Cheddar cheese. Journal of Food Protection 50, 7-13.

Ryser,E.T.,Marth,E.H. 1988. Survival of Listeria monocytogenes in cold-pack cheese food during refrigerated storage. Journal of Food Protection 51, 615-621.

Ryser,E.T., Marth,E.H., Doyle,M.P. 1985. Survival of Listeria monocytogenes during manufacture and storage of cottage cheese. Journal of Food Protection 48, 746-750.

Schaack,M.M.,Marth,E.H. 1988a. Survival of Listeria monocytogenes in refrigerated cultured milks and yogurt. Journal of Food Protection 51, 848-852.

Schaack,M.M.,Marth,E.H. 1988b. Behavior of Listeria monocytogenes in skim milk and in yogurt mix during fermentation by thermophilic lactic acid bacteria. Journal of Food Protection 51, 607-614.

Schaack,M.M.,Marth,E.H. 1988c. Behavior of Listeria monocytogenes in skim milk during fermentation with mesophilic lactic starter cultures. Journal of Food Protection 51, 600-606.

Schlech,W.F., Lavigne,P.M., Bortolussi,R.A., Allen,A.C., Haldane,E.V., Wort,A.J., Hightower,A.W., Johnson,S.E., King,S.H., Nicholls,E.S., Broome,C.V. 1983. Epidemic listeriosis--evidence for transmission by food. N. Engl. J. Med. 308, 203-206.

Schlech,W.F.I. 1988. Virulence characteristics of Listeria monocytogenes. Food Techn. 42(4), 176-178.

Schneewind,O., Friedrich,K., Lu:tticken,R. 1988. Cloning and expression of the

86

CAMP factor of group B streptococci in Escherichia coli. Infection & Immunity 56, 2174-2179.

Seeliger,H.P.R. and H:ohne,K. (1979). Serotyping of Listeria monocytogenes and related species. In Methods in microbiology. vol. 13. ( ed. Bergan,T. and Norris,J.R.), pp. 31-49. New York: Academic Press.

Seeliger,H.P.R. and Jones,D. (1984). Genus Listeria. In Bergey's manual of systematic bacteriology. pp. 1235-1245. Baltimore, U.S.A.: Williams and Wilkins.

Skjerve,E., Rorvik,L.M., Olsvik,O. 1990. Detection of Listeria monocytogenes in foods by immunomagnetic separation. Applied and Environmental Microbiology 56, 3478-3481.

Sokolovic,Z.,Goebel,W. 1989. Synthesis of listeriolysin in Listeria monocytogenes under heat shock conditions. Infection & Immunity 57, 295-298.

Steinbruegge,E.G., Maxcy,R.B., Liewen,M.B. 1988. Fate of Listeria monocytogenes on ready to serve lettuce. Journal of Food Protection 51, 596-599.

Stelma,G.N., Jr., Reyes,A.L., Peeler,J.T., Francis,D.W., Hunt,J.M., Spaulding,P.L., Johnson,C.H., Lovett,J. 1987. Pathogenicity test for Listeria monocytogenes using immunocompromised mice. Journal of Clinial Microbiology 25, 2085-2089.

Stessl,B., Luf,W., Wagner,M., Schoder,D. 2009. Performance testing of six chromogenic ALOA-type media for the detection of Listeria monocytogenes. J. Appl. Microbiol. 106, 651-659.

Thomas,E.J.G., King,R.K., Burchak,J., Gannon,V.P.J. 1991. Sensitive and specific detection of Listeria monocytogenes in milk and ground beef with the polymerase chain reaction. Applied and Environmental Microbiology 57, 2576-2580.

Vazquez-Boland,J.A., Dominguez,L., Rodriguez-Ferri,E.F., Suarez,G. 1989. Purification and characterization of two Listeria ivanovii cytolysins, a sphingomyelinase C and a thio-activated toxin (Ivanolysin O). Infection & Immunity 57, 3928-3935.

87

Watson,B.B.,Lavizzo,J.C. 1973. Extracellular antigens from Listeria monocytogenes. II. Cytotoxicity of hemolytic and lipolytic antigens of Listeria for cultured mouse macrophages. Infection & Immunity 7, 753-758.

Wehr,H.M. 1987. Listeria monocytogenes--a current dilemma. J. Assoc. Off. Anal. Chem. 70, 769-772.

Werbrouck,H., Vermeulen,A., Van,C.E., Messens,W., Herman,L., Devlieghere,F., Uyttendaele,M. 2009. Influence of acid stress on survival, expression of virulence genes and invasion capacity into Caco-2 cells of Listeria monocytogenes strains of different origins. Internation Journal of Food Microbiology 134, 140-146.

Wernars,K., Heuvelman,C.J., Chakraborty,T., Notermans,S.H.W. 1991. Use of the polymerase chain reacgion for direct detection of Listeria monocytogenes in soft cheese. Journal of Applied Bacteriology 70, 121-126.

Wesley,I.V.,Ashton,F. 1991. Restriction enzyme analysis of Listeria monocytogenes strains associated with food-borne epidemics. Applied and Environmental Microbiology 57, 969-975.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L., Batt,C.A. 1997c. Ribotypes and virulence gene polymorphisms suggest three distinct Listeria monocytogenes lineages with differences in pathogenic potential. Infection & Immunity 65, 2707-2716.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L., Batt,C.A. 1997b. Ribotypes and virulence gene polymorphisms suggest three distinct Listeria monocytogenes lineages with differences in pathogenic potential. Infection & Immunity 65, 2707-2716.

Wiedmann,M., Bruce,J.L., Keating,C., Johnson,A.E., McDonough,P.L., Batt,C.A. 1997a. Ribotypes and virulence gene polymorphisms suggest three distinct Listeria monocytogenes lineages with differences in pathogenic potential. Infection & Immunity 65, 2707-2716.

Wong,H.C., Chao,W.L., Yu,C.M. 1992. Detection of Listeria monocytogenes by non-radioactive RNA probe and polymerase chain reaction. Chinese Journal of Microbiology and Immunology 25, 101-107.

Wong,H.-C., Chao,W.-L., Lee,S.-J. 1990. Incidence and characterization of

88

Listeria monocytogenes in foods available in Taiwan. Applied and Environmental Microbiology 56, 3101-3104.

Yousef,A.E., Luchansky JB, Degnan,A.J., Doyle,M.P. 1991. Behavior of Listeria monocytogenes in wiener exudates in the presence of Pediococcus acidilactici H or pediocin AcH during storage at 4 or 25C. Applied and Environmental Microbiology 57, 1461-1467.

Yousef,A.E.,Marth,E.H. 1988. Behavior of Listeria monocytogenes during the manufacture and storage of Colby cheese. Journal of Food Protection 51, 12-15.

89