Ligand-DependentPlatelet-DerivedGrowthFactorReceptor ......Apr 14, 2009 · sunitinib, using a...

Ligand-Dependent Platelet-Derived Growth Factor Receptor

(PDGFR)-A Activation Sensitizes Rare Lung Cancer and

Sarcoma Cells to PDGFR Kinase Inhibitors

Ultan McDermott,1

Rachel Y. Ames,1

A. John Iafrate,2

Shyamala Maheswaran,1

Hannah Stubbs,2

Patricia Greninger,1

Kaitlin McCutcheon,1

Randy Milano,1

Angela Tam,1

Diana Y. Lee,1

Laury Lucien,1

Brian W. Brannigan,1

Lindsey E. Ulkus,1

Xiao-Jun Ma,3

Mark G. Erlander,3

Daniel A. Haber,1

Sreenath V. Sharma,1

and Jeffrey Settleman1

1Center for Molecular Therapeutics, Massachusetts General Hospital Cancer Center and Harvard Medical School, Charlestown,Massachusetts; 2Molecular Diagnostics Laboratory, Department of Pathology, Massachusetts General Hospital andHarvard Medical School, Boston, Massachusetts; and 3AviaraDx, Inc., Carlsbad, California

Abstract

Platelet-derived growth factor (PDGF) receptors (PDGFR) andtheir ligands play critical roles in several human malignan-cies. Sunitinib is a clinically approved multitargeted tyrosinekinase inhibitor that inhibits vascular endothelial growthfactor receptor, c-KIT, and PDGFR, and has shown clinicalactivity in various solid tumors. Activation of PDGFRsignaling has been described in gastrointestinal stromaltumors (PDGFRA mutations) as well as in chronic myeloidleukemia (BCR-PDGFRA translocation), and sunitinib canyield clinical benefit in both settings. However, the discoveryof PDGFR activating mutations or gene rearrangements inother tumor types could reveal additional patient populationswho might benefit from treatment with anti-PDGFR therapies,such as sunitinib. Using a high-throughput cancer cell linescreening platform, we found that only 2 of 637 tested humantumor-derived cell lines show significant sensitivity to single-agent sunitinib exposure. These two cell lines [a non–small-cell lung cancer (NSCLC) and a rhabdomyosarcoma] showedexpression of highly phosphorylated PDGFRA. In the suniti-nib-sensitive adenosquamous NSCLC cell line, PDGFRAexpression was associated with focal PFGRA gene amplifica-tion, which was similarly detected in a small fraction ofsquamous cell NSCLC primary tumor specimens. Moreover, inthis NSCLC cell line, focal amplification of the gene encodingthe PDGFR ligand PDGFC was also detected, and silencingPDGFRA or PDGFC expression by RNA interference inhibitedproliferation. A similar codependency on PDGFRA and PDGFCwas observed in the sunitinib-sensitive rhabdomyosarcomacell line. These findings suggest that, in addition togastrointestinal stromal tumors, rare tumors that showPDGFC-mediated PDGFRA activation may also be clinicallyresponsive to pharmacologic PDGFRA or PDGFC inhibition.[Cancer Res 2009;69(9):OF1–10]

Introduction

Sunitinib is a multitargeted tyrosine kinase inhibitor thatpotently inhibits vascular endothelial growth factor (VEGF),platelet-derived growth factor (PDGF), and c-KIT receptor kinases(1). In renal cell carcinoma, sunitinib showed superiority overstandard IFN-a therapy (2); sunitinib is now recommended forpreviously untreated patients with advanced renal cell carcinoma.Sunitinib is also approved for treatment of imatinib-refractorygastrointestinal stromal tumors (GIST), many of which harboractivating c-KIT or PDGF receptor (PDGFR) kinase domainmutations (3). A recent phase II clinical study has revealed efficacyof single-agent sunitinib in advanced non–small-cell lung cancer(NSCLC) patients (4). Accumulating evidence indicates thatinhibition of VEGF signaling using various antiangiogenic agentscan suppress tumor growth and improve patient survival (2, 5, 6);however, it is unclear from studies involving multikinase inhibitors,such as sunitinib, as to the relative contribution of VEGF receptorinhibition in suppressing tumor growth.

The PDGFR/PDGF system includes two receptors (PDGFRA andPDGFRB) and four ligands (PDGFA, PDGFB, PDGFC, and PDGFD;ref. 7). Ligand binding induces receptor dimerization, enablingautophosphorylation of specific tyrosine residues and subsequentrecruitment of a variety of signal transduction molecules (8).PDGFR regulates normal cellular growth and differentiation (9),and expression of activated PDGFR promotes oncogenic transfor-mation (10), suggesting that activating mutations or generearrangements could play a role in human tumorigenesis.Numerous in vitro and in vivo studies showed that inhibition ofPDGFRA signaling disrupts cancer cell survival in the subset ofGISTs with activating PDGFRA mutations (11, 12). In a recent studyof 150 NSCLC patient samples, activated PDGFRA was detected in13% of cases (13), suggesting that a subset of these patients mightbenefit from therapies directed against PDGFRA. Moreover,PDGFRA overexpression has been observed in metastatic versusnonmetastatic medulloblastoma patient samples, and disruptingPDGFRA function inhibited the metastatic potential of medullo-blastoma cells in vitro (14).

We recently reported the development of a high-throughputplatform for profiling a large panel of human cancer cell lines withmolecularly targeted inhibitors to identify subsets with significantsensitivity (15). That analysis revealed several examples ofgenotype-associated sensitivities to selective kinase inhibitors,showing the utility of this strategy to reveal cell autonomoustumor cell responses to anticancer agents. Here, we describe theprofiling of 637 cancer cell lines for sensitivity to single-agent

Note: Supplementary data for this article are available at Cancer Research Online(http://cancerres.aacrjournals.org/).

Requests for reprints: Jeffrey Settleman, Center for Molecular Therapeutics,Massachusetts General Hospital Cancer Center and Harvard Medical School, 149 13thStreet, Charlestown, MA 02129. Phone: 617-724-9556; Fax: 617-726-7808; E-mail:[email protected].

I2009 American Association for Cancer Research.doi:10.1158/0008-5472.CAN-08-4327

www.aacrjournals.org OF1 Cancer Res 2009; 69: (9). May 1, 2009

Research Article

Published Online First on April 14, 2009 as 10.1158/0008-5472.CAN-08-4327

Research. on May 8, 2021. © 2009 American Association for Cancercancerres.aacrjournals.org Downloaded from

Published OnlineFirst April 14, 2009; DOI: 10.1158/0008-5472.CAN-08-4327

http://cancerres.aacrjournals.org/

sunitinib, using a monoculture format that precludes anycontribution of drug effects on angiogenesis. Our studies revealedthat the majority of tested cell lines are highly refractory tosunitinib. Of the two cell lines showing sunitinib sensitivity, bothwere found to express high levels of PDGFRA and PDGFC mRNAand phosphorylated PDGFRA protein. ShRNA knockdown ofPDGFRA was as effective as sunitinib in decreasing cellproliferation in both cell lines, and targeting the PDGFC ligandalone was similarly effective.

Our findings suggest that whereas antiangiogenesis activityprobably accounts for the majority of the clinical benefit associatedwith sunitinib treatment in solid tumors, in rare cases, beyondPDGFRA-mutant GISTs, activated PDGFRA may be the criticaltarget, and that selective PDGFRA inhibitors may be useful in theclinical management of a subset of tumors that exhibit PDGFRAactivation. Moreover, in tumors with evidence of PDGFC ligandoverexpression, neutralizing antibodies may be an equally effectivetherapeutic modality.

Materials and Methods

Human cancer cell lines and cell viability assays. Human cancer cell

lines were obtained from commercial vendors and were maintained and

tested for viability using an automated platform, as previously described(15). Cells were treated for 72 h with 1 Amol/L sunitinib and then assayed

for cytostatic or cytotoxic responses. We elected to use this concentration

based on steady-state plasma concentrations of f0.2 Amol/L at clinically

recommended doses of sunitinib in patients and based on the experimentaltime points addressed in the studies.

Protein detection. Immunodetection of proteins following SDS-PAGE

was done using standard protocols. Equal protein loading was assessed

using a h-tubulin antibody (Sigma). Akt, extracellular signal–regulatedkinase 1/2 (Erk1/2), phospho-Erk1/2 (T202/Y204), PDGFRA, phospho-

PDGFRA (Y720), phospho-PDGFRA (Y754), signal transducer and activator

of transcription 3 (STAT3), and phospho-STAT3 (S727) antibodies werefrom Cell Signaling Technology. The phospho-Akt (S473) antibody was from

BioSource International. All antibodies were used at 1:1,000 dilution, except

h-tubulin (1:10,000).

Kinase inhibitors. Sunitinib was obtained from MGH pharmacy.Sorafenib and imatinib were purchased from American Custom Chemicals

Corporation. The in vitro kinase specificity profile of all three compounds is

listed in Supplementary Table S1.

Fluorescence in situ hybridization. Fluorescence in situ hybridization(FISH) was done as described previously (16). Probes for PDGFRA and

c-KIT were derived from BAC clones RP11-58C6 (PDGFRA) and RP11-977G3

(c-KIT) and purchased from Invitrogen.

DNA sequencing. Genomic DNA was isolated using the Gentrapurification system. PDGFRA, PDGFRB , and c-KIT coding sequences were

amplified from genomic DNA by PCR. PCR products were purified and

subjected to bidirectional sequencing by using BigDye v1.1 (AppliedBiosystems) in combination with an ABI3100 sequencer (Applied Bio-

systems). Primers used for sequencing are listed in Supplementary Table S2.

Electropherograms were analyzed by using Sequence Navigator software

(Applied Biosystems). All mutations were confirmed by at least twoindependent PCR amplifications.

Cell cycle analysis. Cells were pulsed with 10 Amol/L bromodeoxyur-

idine (BrdUrd) for 1 to 2 h before collection, centrifuged, and fixed in ice-

cold 70% ethanol. Cells were washed with PBS/0.5% bovine serum albumin(BSA) and incubated in denaturing solution (2 mol/L HCl) for 20 min at

room temperature. After a further wash with PBS/0.5% BSA, the cells were

resuspended in 0.1 mol/L sodium borate for 2 min at room temperature.After an additional wash, cells were suspended with anti-BrdUrd

monoclonal antibody for 20 min (1:500; Becton Dickinson). Cells were

washed in PBS/0.5% BSA and the pellet was resuspended in FITC-

conjugated antimouse IgG (1:50; Vector Laboratories) for 20 min. After an

additional wash in PBS/0.5% BSA, cells were stained with 10 Ag/mLpropidium iodide (Sigma) and treated with RNase A (Sigma) before two-

dimensional fluorescence-activated cell sorting analysis using CellQuest

software (Becton Dickinson).

SNP and gene expression analyses. Gene copy numbers weredetermined as previously described using the GeneChip Human Mapping

250K. The array was then scanned on the GeneChip Scanner 3000 7G and

analyzed using GTYPE version 4.0 with the Dynamic Model Mapping

Algorithm and the GeneChip Human Mapping 500K Set library files(Mapping 250K_Nsp).

For gene expression studies, RNA was extracted using the Qiagen RNA

easy kit (P/N 74106) and amplified and biotin labeled with the Arcturus

RiboAmp RNA Amplification Kit using biotinylated ribonucleotides (Perkin-Elmer PN Biotin-11-UTP, NEL543001EA/Biotin-11-CTP, NEL542001EA)

during in vitro transcription. Labeled aRNA was hybridized to Affymetric

GeneChip Human X3P (GPL1352) using protocols described within theAffymetrix GeneChip Expression Analysis Technical Manual (PN701021 Rev.

3). Data were acquired using the Affymetrix GeneChip 3000 Scanner with

autoloader and 7G upgrade. GCOS ver 1.4 software was used to run the

scanner and analyze the data. The expression value for each gene wascalculated using Affymetrix GeneChip software and data were analyzed

using dChip software4 (17). Probe sets were filtered using two criteria: (a)

coefficient of variation between 0.5 and 1,000 and (b) P call rate in arrays

z20%.Quantitative PCR. Total RNA was isolated and purified from cells using

STAT-60 (Tel-Test, Inc.). cDNA was transcribed from 2 Ag of total RNA using

the AffinityScript Multi Temperature cDNA Synthesis kit (Stratagene).Quantitative PCR was done using the QuantiTect SYBR Green PCR kit

(Qiagen) and with an ABI PRISM 7000 real-time cycler (Applied Biosystems).

Quantification was based on standard curves for each primer set from a

serial dilution of the NCI-H1703 cell line cDNA. All samples were analyzedin triplicate. Primers sequences were GAPDH F, GAGTCAACG-

GATTTGGTCGT; GAPDH R, TTGATTTTGGAGGGATCTCG; PDGFRA

F, AAATTGTGTCCACCGTGATCT; PDGFRA R, AGGCCAAAGTCACA-

GATCTTC; PDGFC F, AACGGAGTACAAGATCCTCAGC; and PDGFC R,CCATCACTGGGTTCCTCAAC.

RNA interference studies. ShRNAs targeting sequences within the genes

encoding either PDGFRA (n = 10) or its ligand PDGFC (n = 5) wereexpressed from the pLKO.1 lentiviral vector (Supplementary Table S3). NCI-

H1703 and A-204 cells were infected in the presence of polybrene (8 Ag/mL).

A cell line showing sunitinib-insensitivity (A549) was used to determine

infection efficiency based on puromycin resistance and to confirmspecificity. Protein lysates and RNA were collected 48 h postinfection, and

cell numbers were determined 72 h postinfection.

PDGFC neutralizing antibody experiments. Cells were seeded in

1% fetal bovine serum medium and treated the following day with 5 to20 ng/mL of an anti-PDGFC neutralizing antibody (R&D Systems, Inc.).

Normal goat IgG at 20 ng/mL concentration was used as a control. Cells

were fixed and stained 5 d after treatment, and cell viability was measured

as previously described (15).

Results

Rare human cancer cell lines are sensitive to single-agentsunitinib treatment. Using an automated platform to examinedrug sensitivity in cancer cell lines (15), we tested the sunitinibsensitivity of 637 established human cancer cell lines derived froma wide variety of solid tumor types (Supplementary Fig. S1; ref. 1).Cells were treated for 72 hours with 1 Amol/L sunitinib and thenassayed for cytostatic or cytotoxic responses. Whereas the vastmajority of tested cell lines were largely refractory to treatment,two cell lines (A-204 rhabdomyosarcoma and NCI-H1703 NSCLC)

4 http://biosun1.harvard.edu/complab/dchip/

Cancer Research

Cancer Res 2009; 69: (9). May 1, 2009 OF2 www.aacrjournals.org




displayed significant sunitinib sensitivity, as indicated by a >50%reduction in cell number (Fig. 1A). We note that cell lines derivedfrom GISTs, which show clinical sunitinib sensitivity, reflectinginhibition of mutationally activated PDGFR or c-KIT kinases, were

absent from the panel of tested lines. A few additional lines showeda relatively weaker response to sunitinib.The sunitinib-sensitive NSCLC-derived cell line harbors

focal PDGFRA gene amplification. Among 103 NSCLC cell lines

Figure 1. A, pie chart representation of the sensitivity of 637 human cancer cell lines to treatment with 1 Amol/L sunitinib. The drug effect was calculated as thefraction of untreated cells present after 72 h of treatment. The color scheme corresponds to the relative inhibitory effect of treatment, with ratios reflecting the number ofcells remaining following exposure to inhibitor. Details about the most sensitive cell lines identified are shown in the chart, and the cell lines are shown in order ofdecreasing sensitivity (top to bottom). B, pie chart representation of the sensitivity of the 103 NSCLC cell lines to 1 Amol/L sunitinib. Copy number data were generatedfrom 250K Nsp SNP array profiles (or FISH, as indicated by asterisk).

Table 1. Elevated PDGFRA copy number in a subset of NSCLC cell lines

Chromosome Gene NCI-H1693 NCI-H1703 NCI-H2085 NCI-H23 NCI-H661

4 PDGFRA 4.88 4.36 3.72 3.28 3.614 KIT 4.88 1.98 3.77 2.98 3.624 PDGFC 1.75 5.93 1.94 1.07 1.74

5 PDGFRB 2.56 2.29 2.03 1.63 1.9111 PDGFD 2.33 1.68 2.33 1.57 2.15

22 PDGFB 1.54 2.34 1.87 1.73 1.99

NOTE: Copy numbers >3 are in boldface. Data were derived from Affymetrix Nsp 250K SNP array data from 88 NSCLC cell lines.

Activated PDGFRA Sensitizes Cancer Cells to Kinase Inhibition





tested, significant sunitinib sensitivity was observed only in theadenosquamous NCI-H1703 line (Fig. 1B). SNP array data availablefor 88 of these lines revealed that NCI-H1703 cells harbor focalPDGFRA gene amplification (Fig. 1B). This was confirmed byinterphase FISH analysis (Supplementary Fig. S2A). There was noevidence of either c-KIT or PDGFRB genomic amplification orprotein expression in these cells (data not shown). Sequenceanalysis of the entire coding sequence of PDGFRA, PDGFRB , andc-KIT in this cell line revealed a single mutation in exon 9 ofPDGFRA (S478P), within the extracellular domain, which would notbe expected to result in PDGFR activation.

The SNP array data revealed similarly elevated PDGFRA genecopy number in four other NSCLC cell lines (NCI-H1693, NCI-H2085, NCI-H23, and NCI-H661); however, these lines weresunitinib insensitive (Table 1; Fig. 2A). FISH analyses of these celllines confirmed PDGFRA amplification (Supplementary Fig. S3).However, analysis of the transcriptional expression profile oftyrosine kinase signaling pathway–associated genes in the 90NSCLC cell line panel revealed that only NCI-H1703 showedsignificant expression of PDGFRA mRNA (Supplementary Fig. S4).Furthermore, when the gene expression profile of NCI-H1703 cellswas compared with the other 89 NSCLC cell lines for the most

Figure 2. A, SNP array analysis ofchromosome 4 for the five NSCLC celllines exhibiting elevated PDGFRA copynumber shows increased PDGFC ligandcopy number (5.93) in NCI-H1703 cells.The blue tracing indicates the degree ofamplification of each SNP in the array.The red line underlying the blue tracingindicates copy number of 2. B, PDGFRAand PDGF ligand mRNA expression in90 NSCLC cell lines. NCI-H1703 isindicated by red lettering. Probe sets forligand PDGFB are excluded following afilter based on P call rate in arrays <20%.C, relative PDGFRA mRNA expressionlevels in NSCLC and rhabdomyosarcomacell lines as determined by quantitativereverse transcription-PCR.

Cancer Research





significant up-regulated and down-regulated mRNA transcripts, themost highly expressed mRNA in NCI-H1703 cells corresponded toPDGFRA ( fold change of 213; Table 2). When we focused on thoseprobes involved in PDGFR signaling, none of the other four NSCLCcell lines with increased PDGFRA copy number displayed increasedPDGFRA mRNA expression (Fig. 2B). The observed increase inPDGFRA mRNA expression in the NCI-H1703 cells was confirmedby quantitative PCR (Fig. 2C).

Sunitinib dose-response curves for the NCI-H1703 cell line versusa panel of NSCLC cell lines with normal (Fig. 3A) or increasedPDGFRA gene copy number (Fig. 3B) confirmed the uniquesensitivity in NCI-H1703 cells. Moreover, expression of phosphor-ylated and total PDGFRA protein was only detected in NCI-H1703cells (Fig. 3A and B), and PDGFRA protein was not detected in anyof the sunitinib-insensitive cell lines. In fact, when we extended thispanel to include an additional 26 NSCLC sunitinib-insensitive celllines, we were unable to detect expression of PDGFRA in any otherlines (Supplementary Fig. S5). Therefore, the increased transcrip-tional expression of PDGFRA in NCI-H1703 results in increasedPDGFRA protein and is associated with elevated phospho-PDGFRA, which potentially mediates sensitivity to sunitinib.

To assess PDGFRA amplification in clinical NSCLC cases, weanalyzed 143 NSCLC primary tumor specimens by FISH anddetected 3 of 81 (3.7%) cases of focal PDGFRA amplification insquamous cell carcinomas (Supplementary Fig. S2B). PDGFRAamplification was not detected in any of 62 adenocarcinoma casesanalyzed. Thus, focal PDGFRA gene amplification arises atrelatively low frequency in NSCLC and may be more common inthe squamous cell setting.

Inhibition of PDGFRA activation in NCI-H1703 cells disruptsdownstream signaling. Treatment of NCI-H1703 cells withsunitinib for 6 hours resulted in complete inhibition of PDGFRAprotein phosphorylation as well as that of Akt, a PDGFR effector(Fig. 3C). Sunitinib had no effect on such signaling in the sunitinib-insensitive cell lines (data not shown). To verify that PDGFRA-dependent signaling was indeed the basis for the observedsunitinib sensitivity of NCI-H1703 cells, we treated the cells withtwo additional PDGFRA kinase inhibitors, sorafenib and imatinib.Both compounds exhibited a similar activity to that of sunitinib(Fig. 3C), whereas none of the sunitinib-insensitive NSCLC celllines displayed sensitivity to either agent (data not shown).Furthermore, like sunitinib, both compounds suppressed Aktsignaling in NCI-H1703 cells (Fig. 3C). Together, these findingssuggest that the NCI-H1703 NSCLC cells are dependent onactivated PDGFRA signaling.

To investigate the underlying mechanism for the ability ofsunitinib to reduce cell number in NCI-H1703 cells, we examinedPARP cleavage, an indicator of apoptosis, and cell cycle profile.There was no evidence of PARP cleavage following treatment with1 Amol/L sunitinib at 24, 48, or 72 hours in this cell line (data notshown), whereas cell cycle analysis confirmed a significant S-phasearrest at each of these time points (Supplementary Fig. S6),consistent with a cytostatic response to drug exposure.PDGFRA activation is associated with sensitivity to sunitinib

in a rhabdomyosarcoma cell line. As described above, in theinitial screen of 637 cell lines for sunitinib sensitivity, arhabdomyosarcoma cell line, A-204, was the most highly drug-sensitive line detected (Fig. 1A). To determine whether the

Table 2. The most highly up-regulated and down-regulated mRNAs in the NCI-H1703 cell line compared with all of the NSCLCcell lines

Gene Chromosome Fold change LBFC UBFC

PDGFRA 4q11 213.13 148.75 340.59

PDGFRA 4q11 39.88 33.38 49.42

FLT4 : fms-related tyrosine kinase 4 5q35 8.24 6.70 10.52FGFR1 : fibroblast growth factor receptor 1 8p11 4.85 4.01 6.11

SHC1 : SHC transforming protein 1 1q21 2.89 2.57 3.27

PLCE1 : phospholipase C, epsilon 1 10q23 2.45 2.08 2.95

SEMA3C 7q21 1.71 1.52 1.94HMGA1 : high mobility group AT-hook 1 6p21 1.55 1.37 1.77

HMGA1 : high mobility group AT-hook 1 6p21 1.45 1.28 1.67

EGFR : epidermal growth factor receptor 7p12 �1.59 �1.30 �1.91

EGFR : epidermal growth factor receptor 7p12 �1.63 �1.38 �1.88VEGF : vascular endothelial growth factor 6p12 �1.89 �1.66 �2.14

MET : met proto-oncogene 7q31 �2.55 �2.20 �2.94

DDR1 : discoidin domain receptor family, member 1 6p21 �2.69 �2.33 �3.07

RGS2 : regulator of G-protein signaling 2, 24 kDa 1q31 �3.32 �2.32 �4.42MET : met proto-oncogene 7q31 �3.49 �2.76 �4.24

EGFR : epidermal growth factor receptor 7p12 �3.70 �2.93 �4.53

IRS1 : insulin receptor substrate 1 2q36 �3.93 �3.27 �4.78EPS8 : epidermal growth factor receptor pathway substrate 8 12q13 �4.91 �3.76 �6.15

IRS1 : insulin receptor substrate 1 2q36 �6.85 �5.87 �7.94

NOTE: Gene expression data were available for 90 of the NSCLC cell lines screened with sunitinib. Genes were included if the fold change was >1.2 or<1.2. All data were analyzed using the dChip software.

Abbreviations: LBFC, the lower bound of the 90% confidence intervals of fold change; UBFC, the upper bound of the 90% confidence intervals of fold

change.






observed sensitivity could be extended to other rhabdomyosarco-ma cell lines, a panel of six additional rhabdomyosarcoma lineswere tested for sunitinib sensitivity (Fig. 4A). Of the tested lines,only A-204 showed sunitinib sensitivity, and in only this cell linewas PDGFRA protein detectable (Fig. 4A, lane 1). Unlike in NCI-H1703 cells, FISH analysis did not reveal PDGFRA gene amplifica-tion in any of these lines (Fig. 4B), and DNA sequence analysis ofPDGFRA, PDGFRB , and c-KIT in A-204 cells did not reveal any

mutations. However, as in NCI-H1703 cells, we detected asubstantial (15-fold) increase in PDGFRA mRNA expression in A-204 cells (Fig. 2C). Moreover, sunitinib treatment completelyabolished Akt signaling in this line compared with a sunitinib-insensitive rhabdomyosarcoma line (Fig. 4C). In addition, treat-ment of A-204 cells with sorafenib and imatinib also disrupted Aktsignaling (Fig. 4D) and similarly inhibited proliferation (data notshown). These results suggest that rare rhabdomyosarcoma cells

Figure 3. Dose-response curves showing the effect of sunitinib on cell numbers 72 h after treatment for NCI-H1703 and a panel of NSCLC cell lines with eithernormal (A ) or increased (B ) PDGFRA copy number and immunoblots corresponding to these same cell lines showing total PDGFRA and phospho-PDGFRA levels.C, dose-response curves showing the effect of the additional PDGFR inhibitors imatinib and sorafenib on cell numbers 72 h after treatment in the NCI-H1703 cellline. Immunoblots showing the effect of treating the NCI-H1703 cell line for 6 h with the indicated concentrations of sunitinib, imatinib, and sorafenib on phosphorylationof PDGFRA and the downstream effectors STAT3 and Akt. Note that p-STAT3 levels are largely unaffected by drug treatment, whereas p-Akt levels are reduced.

Cancer Research





are dependent on activated PDGFRA signaling, associated withincreased expression of PDGFRA mRNA.Amplification of the gene encoding the PDGFRA ligand

PDGFC mediates PDGFRA activation. Gene expression profilesof 90 NSCLC cell lines using a filtered list of genes involved inPDGFR signaling revealed that NCI-H1703 was the only linedisplaying significant transcriptional up-regulation of PDGFRAtogether with the gene encoding one of its ligands, PDGFC(Fig. 2B). The increased PDGFC mRNA in NCI-H1703 cells (and inA-204 cells) was confirmed by quantitative PCR (SupplementaryFig. S7A). Only the NSCLC cell line NCI-H661 (sunitinib insensitive)showed similarly elevated PDGFC mRNA, but in the absence ofexpression of PDGFRA mRNA or protein. Further analysis of SNParray data from 88 NSCLC lines revealed a unique coamplificationof the PDGFRA (4q12) and PDGFC (4q32) genes on chromosome 4in NCI-H1703 cells, which was not observed in any of the other celllines (Fig. 2A).

ShRNA-mediated knockdown of PDGFRA and PDGFC was usedto directly assess their functional requirement in both the NCI-H1703 and A-204 cell lines (Supplementary Fig. S7B). There was noeffect of these shRNAs on a sunitinib-insensitive cell line (A549)that lacks PDGFRA expression. In contrast, knockdown of PDGFRAin NCI-H1703 and A-204 cells significantly reduced proliferation to

a similar extent as sunitinib treatment (Fig. 5A). Furthermore,knockdown of PDGFC expression also reduced proliferation inboth lines, and the observed decrease was of the same magnitudeseen following sunitinib treatment (Fig. 5A).

We also examined the activity of a neutralizing anti-PDGFCantibody to confirm the ligand knockdown findings and to assessthe potential therapeutic value of anti-PDGFC antibodies in suchtumor cells. We treated three cell lines (A549, NCI-H1703, andA-204) with a concentration range of the anti-PDGFC antibody.Whereas there was no detectable effect on the proliferation of A549cells, the antibody reduced proliferation in the NCI-H1703 andA-204 cell lines to a similar extent to that seen following sunitinibtreatment (Fig. 5B). Notably, the effect was observed in A-204 cellseven at the lowest antibody concentration, potentially reflectingrelatively higher PDGFC expression in the NCI-H1703 cells(Supplementary Fig. S7A). Combining sunitinib and the anti-PDGFC antibody did not result in any additive inhibitory effects onthese cells (data not shown). ShRNA-mediated depletion ofPDGFRA and PDGFC was used to determine the effect on PDGFRAactivation and downstream signaling in the NCI-H1703 cells(Fig. 5C). ShRNA-mediated depletion of both receptor and ligandresulted in decreased PDGFRA phosphorylation and inhibition ofAkt and Erk1/2 phosphorylation. Together, these results indicate

Figure 4. A, dose-response curves showing the effect of sunitinib on cell numbers 72 h posttreatment for several rhabdomyosarcoma cell lines. Right, immunoblotsshowing expression of phospho-PDGFRA and total PDGFRA in these lines, with h-tubulin as a loading control. B, FISH analysis of sunitinib-sensitive A-204 cellsusing PDGFRA (RP11-58C6; red ) and c-KIT probes (RP11-977G3; green ). C, immunoblots showing the effect of treating the A-204 (sunitinib-sensitive) and A673(sunitinib-resistant) cell lines for 6 h with 1 Amol/L sunitinib on phosphorylation of PDGFRA and the downstream effectors STAT3 and Akt. D, effect of treating A-204 for6 h with the PDGFR inhibitors sunitinib, imatinib, and sorafenib on phosphorylation of PDGFRA and the downstream effectors STAT3, Akt, and Erk1/2.






that both of the sunitinib-sensitive cell lines show a similardependency on increased PDGFRA and PDGFC expression forsustained proliferation.

Discussion

Our cancer cell line profiling analysis with the multikinaseinhibitor sunitinib has revealed that drug sensitivity in amonoculture context is restricted to a small number of linesexhibiting activated PDGFRA signaling. Moreover, in these cells,PDGFRA activation is coupled to critical downstream effectorssuch as Akt, and disrupting these pathways seems to mediate theinhibitory effects of sunitinib on proliferation. Previous reports ofPDGFRA activation in cancer have been largely confined to GISTs(activating PDGFRA mutations) and rare cases of idiopathichypereosinophilic syndrome (FIP1L1-PDGFRA fusion transcripts;refs. 18, 19). Our findings suggest that in additional rare cases ofNSCLC and sarcoma, PDGFRA activation may be important inmaintaining the malignant phenotype.

The clinical success of sunitinib in renal cancer has beensuggested to reflect its role as a VEGF receptor inhibitor and theconsequent effects on angiogenesis. Notably, renal cancers arehighly vascularized tumors, suggesting a potential critical require-

ment for angiogenesis in that disease setting. However, the abilityof sunitinib to target additional kinases, such as PDGFR, mightcontribute to its clinical activity in renal cancer. We note that ourcell line panel included 19 renal cancer cell lines, none of whichshowed significant sunitinib sensitivity. This suggests that PDGFRis not likely to provide a critical dependency signal in renal cancer;however, a contributing role of PDGFR inhibition in the clinicalactivity of sunitinib cannot be excluded. Whereas in a conventionalxenograft model, any observed consequence of drug treatmenton tumor growth could potentially reflect direct effects on tumorcells as well as effects on the stroma and vasculature, ourmonoculture-based platform provides a means to isolate the tumorcell–autonomous drug response.

In both of the sunitinib-sensitive cancer cell lines identified,PDGFRA activation seems to be mediated by increased expressionof the receptor as well as one of its ligands, PDGFC. This is incontrast to other models of receptor tyrosine kinase activationassociated with gene amplification, wherein ligand-independentactivation is typically postulated (20, 21). In NCI-H1703 cells,activation of the PDGFRA signaling pathways is a consequence offocal PDGFRA and PDGFC gene coamplification. To our knowledge,this is the first report in NSCLCs of overexpression of both anoncogenic receptor tyrosine kinase and its ligand, although

Figure 5. A, lentiviral-delivered shRNAs were used to target GFP (negative control), PDGFRA , and PDGFC in A549, NCI-H1703, and A-204 cells, and cellnumbers were measured 72 h postinfection. Treatment with 1 Amol/L sunitinib served as positive control. B, A549, NCI-H1703, and A-204 cells were treated with aneutralizing anti-PDGFC antibody (2.5–20 ng/mL) or normal IgG control antibody (at 20 ng/mL). Cell numbers were measured 5 d posttreatment. C, effect ofshRNA-mediated depletion of PDGFRA and PDGFC in NCI-H1703 cells on PDGFRA phosphorylation and downstream signaling 24 h (PDGFRA) and 48 h (PDGFC)postinfection.

Cancer Research





coexpression of the PDGFRA or PDGFRB receptors with theircognate ligands at higher levels than seen in adjacent normal tissuehas been reported for some gliomas and osteosarcomas (22, 23).Intriguingly, targeting PDGFC had a greater effect on proliferationin both sunitinib-sensitive cell lines than targeting PDGFRA. Thisraises the possibility that PDGFRA is not the sole critical target ofPDGFC in these cells.

Our findings also suggest that antibodies directed againstPDGFR ligands may have therapeutic potential in PDGFRA-dependent cancer. Traditionally, therapeutic antibodies have beentargeted to cell surface receptors implicated in tumor cellproliferation or maintenance, rather than against their cognateligands (24). Such antibodies typically show a more favorabletoxicity profile than small-molecule kinase inhibitors, and whenconsidered in the context of significant toxicities associated withsunitinib, our findings suggest potential clinical advantages ofantibody-mediated targeting of the PDGFC ligand in some cancers.

Our observation that the PDGFRA gene amplification in the NCI-H1703 adenosquamous NSCLC cell line was also seen in a subset ofsquamous cell NSCLC clinical samples but in none of theadenocarcinoma samples screened by FISH raises the possibilitythat this represents an oncogenic mechanism unique to thishistologic subtype. In agreement with our findings, Rikova andcolleagues (13) detected PDGFRA activation using a phospho-proteomic screen in eight NSCLC patient samples as well as in theNCI-H1703 cell line. Whereas NSCLC adenocarcinoma patients arebeing actively recruited into clinical trials of epidermal growthfactor receptor (EGFR) tyrosine kinase inhibitors (in the setting ofactivating EGFR mutations) and anaplastic lymphoma kinaseinhibitors (ALK translocations), to date, no drug-sensitizinggenotypes have been identified for squamous cell NSCLC patients(25, 26). It remains to be seen whether retrospective analyses ofsunitinib-responsive NSCLC patients will reveal enrichment forPDGFRA gene amplification or expression, and whether suchpatients’ tumors show squamous histology.

Curiously, PDGFRA expression was only detected in the NCI-H1703 NSCLC cells, despite the fact that four other cell linesshowed increased PDGFRA gene copy number. Thus, focalamplification of the PDGFRA gene may uniquely yield high levelPDGFR expression, potentially reflecting an additional genomicalteration within this locus that influences the regulatory regions of

PDGFRA gene transcription. Similarly, it remains unclear as to themolecular mechanism underlying increased PDGFRA or PDGFCmRNA expression in the A-204 cells. Sarcomas often harborchromosomal translocations giving rise to oncogenic activation,and these can affect PDGFR signaling. For example, dermatofi-brosarcoma protuberans and giant cell fibroblastomas harborchromosomal rearrangements involving chromosome 17 and 22, inwhich the collagen type Ia1 (COLIA1) gene undergoes fusion withthe gene encoding PDGFB (27). In one study of 42 cases of uterinesarcoma, 70% of tumors displayed increased PDGFRA expressioncompared with that seen in adjacent normal tissue (28). Likewise,in a study of 54 osteosarcoma patients, increased PDGFRA andPDGFRB expression was observed in tumors in more than 75%of cases (29). Notably, most Ewing sarcomas are associated witha gene fusion that produces a transcription factor (EWS/FLI-1)that promotes PDGFC mRNA expression (30). However, imatinibtherapy in this setting shows minimal clinical activity (31). In thesetumors, which are notoriously refractory to chemotherapy,targeting PDGFR signaling pathways may provide a usefulalternative therapy.

In summary, our findings show that ligand-mediated activationof PDGFRA signaling may be a critical mediator of cell proliferationin a small subset of NSCLCs and rhabdomyosarcomas and maysensitize these cancer cells to either selective small-moleculePDGFR kinase inhibitors or ligand-neutralizing antibodies. Ourfindings suggest that sunitinib as well as other PDGFR kinaseinhibitors may provide genotype-associated clinical benefit beyondthe setting of PDGFR-mutant or c-KIT-mutant GISTs.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

Received 11/17/08; revised 1/27/09; accepted 2/25/09; published OnlineFirst 4/14/09.Grant support: National Cancer Institute Specialized Program of Research

Excellence in Lung Cancer award P20 CA090578-06.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the members of the Settleman laboratory for helpful discussionthroughout the course of these studies, and Michelle Longworth for assistance withthe cell cycle analysis.



References

1. Mendel DB, Laird AD, Xin X, et al. In vivo antitumoractivity of SU11248, a novel tyrosine kinase inhibitortargeting vascular endothelial growth factor and plate-let-derived growth factor receptors: determination of apharmacokinetic/pharmacodynamic relationship. ClinCancer Res 2003;9:327–37.2. Motzer RJ, Hutson TE, Tomczak P, et al. Sunitinibversus interferon a in metastatic renal-cell carcinoma. NEngl J Med 2007;356:115–24.3. Demetri GD, van Oosterom AT, Garrett CR, et al.Efficacy and safety of sunitinib in patients withadvanced gastrointestinal stromal tumour after failureof imatinib: a randomised controlled trial. Lancet 2006;368:1329–38.4. Socinski MA, Novello S, Brahmer JR, et al. Multicenter,phase II trial of sunitinib in previously treated, advancednon–small-cell lung cancer. J Clin Oncol 2008;26:650–6.5. Hurwitz H, Fehrenbacher L, Novotny W, et al.Bevacizumab plus irinotecan, fluorouracil, and leuco-vorin for metastatic colorectal cancer. N Engl J Med2004;350:2335–42.

6. Sandler A, Gray R, Perry MC, et al. Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer. N Engl J Med 2006;355:2542–50.7. Andrae J, Gallini R, Betsholtz C. Role of platelet-derived growth factors in physiology and medicine.Genes Dev 2008;22:1276–312.8. Valius M, Kazlauskas A. Phospholipase C-g1 andphosphatidylinositol 3 kinase are the downstreammediators of the PDGF receptor’s mitogenic signal. Cell1993;73:321–34.9. Ross R, Raines EW, Bowen-Pope DF. The biology ofplatelet-derived growth factor. Cell 1986;46:155–69.10. Gazit A, Igarashi H, Chiu IM, et al. Expression of thenormal human sis/PDGF-2 coding sequence inducescellular transformation. Cell 1984;39:89–97.11. Heinrich MC, Corless CL, Demetri GD, et al. Kinasemutations and imatinib response in patients withmetastatic gastrointestinal stromal tumor. J Clin Oncol2003;21:4342–9.12. Corless CL, Schroeder A, Griffith D, et al. PDGFRAmutations in gastrointestinal stromal tumors: frequency,spectrum and in vitro sensitivity to imatinib. J ClinOncol 2005;23:5357–64.

13. Rikova K, Guo A, Zeng Q, et al. Global survey ofphosphotyrosine signaling identifies oncogenic kinasesin lung cancer. Cell 2007;131:1190–203.14. MacDonald TJ, Brown KM, LaFleur B, et al.Expression profiling of medulloblastoma: PDGFRA andthe RAS/MAPK pathway as therapeutic targets formetastatic disease. Nat Genet 2001;29:143–52.15. McDermott U, Sharma SV, Dowell L, et al.Identification of genotype-correlated sensitivity toselective kinase inhibitors by using high-throughputtumor cell line profiling. Proc Natl Acad Sci U S A 2007;104:19936–41.16. McDermott U, Iafrate AJ, Gray NS, et al. Genomicalterations of anaplastic lymphoma kinase may sensitizetumors to anaplastic lymphoma kinase inhibitors.Cancer Res 2008;68:3389–95.17. Lin M, Wei LJ, Sellers WR, Lieberfarb M, Wong WH,Li C. dChipSNP: significance curve and clustering ofSNP-array-based loss-of-heterozygosity data. Bioinfor-matics 2004;20:1233–40.18. Heinrich MC, Corless CL, Duensing A, et al. PDGFRAactivating mutations in gastrointestinal stromal tumors.Science 2003;299:708–10.




Cancer Research


19. Cools J, DeAngelo DJ, Gotlib J, et al. A tyrosine kinasecreated by fusion of the PDGFRA and FIP1L1 genes as atherapeutic target of imatinib in idiopathic hyper-eosinophilic syndrome. N Engl J Med 2003;348:1201–14.20. Smolen GA, Sordella R, Muir B, et al. Amplifica-tion of MET may identify a subset of cancers withextreme sensitivity to the selective tyrosine kinaseinhibitor PHA-665752. Proc Natl Acad Sci U S A2006;103:2316–21.21. Brennan PJ, Kumagai T, Berezov A, Murali R, GreeneMI. HER2/neu: mechanisms of dimerization/oligomer-ization. Oncogene 2000;19:6093–101.22. Sulzbacher I, Traxler M, Mosberger I, Lang S, Chott A.Platelet-derived growth factor-AA and -a receptorexpression suggests an autocrine and/or paracrine loopin osteosarcoma. Mod Pathol 2000;13:632–7.23. Guha A, Dashner K, Black PM, Wagner JA, Stiles CD.

Expression of PDGF and PDGF receptors in humanastrocytoma operation specimens supports the exis-tence of an autocrine loop. Int J Cancer 1995;60:168–73.24. Adams GP, Weiner LM. Monoclonal antibody therapyof cancer. Nat Biotechnol 2005;23:1147–57.25. Sequist LV, Martins RG, Spigel D, et al. First-linegefitinib in patients with advanced non-small-cell lungcancer harboring somatic EGFR mutations. J Clin Oncol2008;26:2442–9.26. Soda M, Choi YL, Enomoto M, et al. Identification ofthe transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007;448:561–6.27. Patel KU, Szabo SS, Hernandez VS, et al. Dermatofi-brosarcoma protuberans COL1A1-PDGFB fusion isidentified in virtually all dermatofibrosarcoma protu-berans cases when investigated by newly developedmultiplex reverse transcription polymerase chain reac-

tion and fluorescence in situ hybridization assays. HumPathol 2008;39:184–93.28. Adams SF, Hickson JA, Hutto JY, Montag AG,Lengyel E, Yamada SD. PDGFR-a as a potentialtherapeutic target in uterine sarcomas. Gynecol Oncol2007;104:524–8.29. Kubo T, Piperdi S, Rosenblum J, et al. Platelet-derivedgrowth factor receptor as a prognostic marker and atherapeutic target for imatinib mesylate therapy inosteosarcoma. Cancer 2008;112:2119–29.30. Zwerner JP, May WA. PDGF-C is an EWS/FLI inducedtransforming growth factor in Ewing family tumors.Oncogene 2001;20:626–33.31. Bond M, Bernstein ML, Pappo A, et al. A phase IIstudy of imatinib mesylate in children with refractory orrelapsed solid tumors: a Children’s Oncology Groupstudy. Pediatr Blood Cancer 2008;50:254–8.




Published OnlineFirst April 14, 2009.Cancer Res Ultan McDermott, Rachel Y. Ames, A. John Iafrate, et al. Sarcoma Cells to PDGFR Kinase Inhibitors

Activation Sensitizes Rare Lung Cancer andα(PDGFR)-Ligand-Dependent Platelet-Derived Growth Factor Receptor

Updated version

10.1158/0008-5472.CAN-08-4327doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2009/04/13/0008-5472.CAN-08-4327.DC1

Access the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://cancerres.aacrjournals.org/content/early/2009/04/14/0008-5472.CAN-08-4327.citationTo request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-08-4327

http://cancerres.aacrjournals.org/content/suppl/2009/04/13/0008-5472.CAN-08-4327.DC1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/early/2009/04/14/0008-5472.CAN-08-4327.citation


Ligand-DependentPlatelet-DerivedGrowthFactorReceptor ......Apr 14, 2009 · sunitinib, using a...

Documents

Transcript of Ligand-DependentPlatelet-DerivedGrowthFactorReceptor ......Apr 14, 2009 · sunitinib, using a...