Life@Home September 2012

plus… mudroom makeovers • dealing with hell strips • mom caves • easy bedroom makeovers • custom furniture by Greg Pattison …and more!

A TIMES UNION PUBLICATIONseptember 2012

Meets in Troy

EastWest

Be a style-savvy surfer.{ {

my connection. my friends. my place.

Connect with us online for exclusive deals and offers.

Boscov’s | BOSE | The Cheesecake Factory | Crazy 8 | Charming CharlieL.L. Bean | Macy’s | P.F. Changs China Bistro | Sears | Sephora | Regal Cinema

WOLF ROAD & CENTRAL AVENUE | ALBANY | 518.459.9020

facebook.com/ShopColonieCenter | twitter.com/ColonieCenterNY | ShopAtColonieCenter.com

Colonie Center

Tour two custom designed homesfeaturing green and sustainable buildingtechniques, technologies and products.

Learning Lab Topics to include:

Solar

Energy efficiency

Window selection

Building envelope

Sustainable landscape

Product selectionfor healthy living

And more

FEATURED GREEN HOME BUILDERS:Ethos Homes, Ballston SpaStewart Construction, Burnt Hills

October13 & 1411:00 am - 5:00 pmPresented by

For tickets, Learning LabSchedule and locationof homes go towww.crbra.comor call 518-690-0766.

PublisherGeorge Hearst III

EditorialJanet Reynolds, Executive EditorBrianna Snyder, Associate EditorRebecca Haynes, Contributing Editor

DesignTony Pallone, Design DirectorColleen Ingerto, Emily Jahn, Rebecca Isenhart, Designers

Contributing WritersJohn Adamian, Steve Barnes, Caroline Barrett, Melissa Fiorenza, Laurie Lynn Fischer, Laurie Freehafer, Alison Grieveson, Alistair Highet, Suzanne Kawola, Jayne Keedle, Kim Messenger, Merci Miglino, Lee Nelson, Jennifer E. O’Brien, Colleen Plimpton, Lucianna Samu, Cari Scribner

Contributing PhotographersPaul Barrett, Valerie DeLaCruz, Jacquelyn Aronson Falk, Alistair Highet, Rebecca Isenhart, Krishna Hill, Emily Jahn, Suzanne Kawola, Brian Michaud, Colleen Plimpton, Mark Samu

SalesKathleen Hallion, Vice President, AdvertisingTom Eason, Manager, Display Advertising Craig Eustace, Retail Sales Manager Jeff Kiley, Magazine Advertising Manager

CirculationDan Denault, Home Delivery Manager

BusinessRay Koupal, Chief Financial Officer

TimesUnion.comPaul Block, Executive Producer

life@home is published monthly. If you are interested in receiving home delivery of life@home magazine, please call (518) 454-5768 or email [email protected]. For advertising information, please call (518) 454-5358.

life@home is published by Capital Newspapers and Times Union 645 Albany Shaker Rd, Albany, NY 12212 518.454.5694

The entire contents of this magazine are copyright 2012 by Capital Newspapers. No portion may be reproduced in any means without written permission of the publisher.

Capital Newspapers is a wholly owned subsidiary of The Hearst Corporation.

GOSUP!Stand-Up Paddling

Kayaks & Accessories

518-843-3232Hours: 10-5 daily, Saturday & Sunday 10-6

or by appointmentAll Major Credit Cards Accepted • Gift Certificates

Lay-A-Way Available

Text ADKKAYAKto 72727

IT’S A SCHONBEK. A PROMISE MADE LONG AGO.Since 1870, Schonbek chandeliers have brought life to light. A heritage of premium quality and timeless style ensures

that every original Schonbek chandelier will be a cherished object today, and for generations to come.

MILANO and other illuminating designs available for viewing at the showrooms below and Schonbek.comSchonbek® is a member of the Swarovski Company.©

2012

Schonbek

WorldwideLighting,Inc.

SARATOGA | 60West Avenue | 518.886.0446SCHENECTADY | 152 Erie Boulevard | 518.381.9231ALBANY | 35 Industrial Park Road | 518.489.8451www.Wolberg.com

STORE HOURS: Monday, Tuesday, Thursday & Friday 10-8 • Wednesday 10-6 · Saturday 10-5 · Sunday 12-4158 Railroad Avenue, Colonie (Behind Target at old Northway Mall) 453-6100

ASK ABOUT OUR

FREE3 YEAR PARTS & LABORAPPLIANCE PROTECTION PLAN*

ASK ABOUT OUROUR

Rated A+ by

Since 1981

The smarter way to buy appliances!

TV & APPLIANCE

EVENT

Service DiscountANYSERVICE

Cocca’sAPPLIANCES · HOME ELECTRONICS

With this coupon at point of purchase.Now thru 8/31/12. Does not apply to prior sales.

$30OFFFREE Local Delivery

ANY TV or APPLIANCEOVER $299

Cocca’sAPPLIANCES · HOME ELECTRONICS

With this coupon at point of purchase.Now thru 8/31/12. Does not apply to prior sales.

*FREE 3 Year Parts & Labor Appliance Protection Plan from date of purchase/delivery. Excludes TVs and microwaves. See store for full details.

timesunion.com/lifeathome 7

:home:

19 GAZEBO, TAKE ME AWAY!The glories of this backyard structure

21 WINDOW SHOPPINGMust-have goodies for the home

27 EAST MEETS WESTTwo arty architects make a hip home

32 DESIGN DEFINEDWho are the trendsetters walking among us?

34 MUDROOM MAKEOVERGo from mudroom to mod room with this 12-step program

38 MASTERING THE BEDROOMHow to transform your most private space into a personal sanctuary — no paintbrush required!

42 THROUGH THE LOOKING GLASSSometimes curtains don’t have to be functional

46 STEPPING INTO DESIGN!Sabrina Soto tackles home décor one layer at a time

48 A ROOM OF HER OWNMaking a mom cave for comfort, crafts or quiet

52 TEN WAYS TO USE ...Vodka. No, not in cocktails!

54 TREE PICTURESCustom furniture maker Greg Pattison tells his tale following a wood’s grain

60 HAPPY TRAILS!Stay at “green” hotels!

63 REFURNISHED LIVINGSchool’s back in session

64 GOING TO HELL (STRIPS)What to do with tricky curbside spots?

66 DESIGN CLASSICSThe Gedy Cucciolo toilet brush

content

KNOCK KNOCK:� Greg Pattison’s gorgeous woodwork. Read the story on page 54. Photo by Krishna Hill.

http://issuu.com/action/page?page=19




































CapitalRegionSpecialSurgery.com

��

��

Appointments available in 48 hours 1220 New Scotland Road, Slingerlands, NY (518) 439-4326

� ��

��

��

��

��

��


:life:

SWEET TREATS:� The family that desserts together says “mmm” together. Read the story on page 70. Photo by Suzanne Kawola.

Cover photo by Mark Samu.

69 HOUSE BLENDAll washed up

70 FAMILY STYLEChef Art Riley Jr. has the life he wants

75 THE VINEYARDWine illuminations from Madrid and Scotland

77 ’SHROOM ROOMSZehr and sons’ mushroom farm grows mushrooms for all

81 BERRY GOODMarking the close of a long, hot summer

85 FIVE THINGSGreta Killmer’s favorite things

86 PHOTO FINISHHomemade mini-people at the Nelson-Dufel home

content

“Perhaps home is not a place but simply an irrevocable condition.”

— James Baldwin




















10 life@home

talk back

Mudroom MakeoverLaurie Fischer I was surprised at how my house corresponds with feng shui’s five-element theory. North equates with water, and my north-

facing laundry room is blue — a water color. West equates with metal and my west-oriented kitchen is full of stainless-steel appliances. The element for east is wood. That’s where we keep our woodpile. See Laurie’s story on page 34.

Mom CavesLee Nelson I’ve always believed women need a place in their home to reflect, relax, create or just get away from the “I want this” or “Where is my ... ?”

I love the fact that women are making their mom caves from rooms that families don’t usually use, such as that formal dining room used twice a year. Move aside that table or make it your desk. Paint it your favorite color. You go, girl. See Lee’s story on page 48.

Room RedoJayne Keedle I learned of two new items that weren’t available back in my renter days that I think are really cool and incredibly practical. The first: a canopy that

you can hang from the ceiling to create the look of a four-poster bed. This is particularly useful if you don’t have the money or ceiling height for a four-poster. The second item: wall decals that stick on and peel off without doing any damage — surely God’s gift to parents of fickle children. For Jayne’s story, turn to page 38.

Locavore: Zehr’s Mushrooms“I’ll certainly be more appreciative of the process.”Jennifer E. O’Brien There is so much more to growing mushrooms

than I would have ever imagined. The next time a shiitake or oyster graces my plate, I’ll certainly be more appreciative of the process. See Jennifer’s story on page 77.

Living Green: Eco-HotelsCari Scribner I was literally stunned by how many hotel amenities I’ve taken for granted over the years. I thought using towels more than

once, recycling plastics and turning off all the lights and air conditioning in the room when we went out were sufficient. I never considered actively looking for accommodations with eco-healthy practices. Many of us consider vacation a time to be spoiled, but that doesn’t mean wasting water and energy, and adding to overloaded landfills. I plan to inquire about green practices at hotels in the future, and advocate for small changes that will really add up! See Cari’s story on page 60.

Garden Path: Hell StripsColleen Plimpton Probably what I learned was the pedestrian (ha ha) but logical fact that the level of the soil in a hell strip needs to be dug

down below street and sidewalk level, so as not to wash when rains come. See Colleen’s story on page 64.

Do garter snakes scare you? What do you do about snakes in your yard?MJ: I stopped going in yards at about eleven years old because of garter snakes, true story!

Julie: I freak the hell out. Can’t even say the word! Picked one up by accident as a 5-year-old, it was coiled (my stomach just turned typing this), I thought it was a belt belonging to my brother. Apparently I froze as my

brother came running toward me and killed the offender. It might not have been a garter based upon the coiling affect. I sure as hell am not Googling it!! Traumatized for life. One of the reasons I love every season BUT summer!

Denise: Being a gardener, I have to live with them, but they do startle me when I come across them. I enjoyed a scene last week where a robin was trying to catch a 2-foot-long garter snake going

through the grass. We have lots of them but we let them do their thing because they are great for the gardens.

What’s the best room in your house? Why is it your favorite?Merci: My bedroom sans snoring husband.

Emily: I love my combo living room, dining room, kitchen. I love that I can interact with guests while cooking, or just enjoy having the TV on while doing dishes. It’s cozy and it keeps me neat!

The story behind the story from our contributors

We asked, you answered

www.facebook.com/lifeathomemagazine

join the conversation!

Like us on

Facebook

and you could

win a prize.

win!










http://www.facebook.com/lifeathomemagazine

http://www.facebook.com/lifeathomemagazine

783-0778Monday -Wednesday 10am-6pm, Thursday 10am-8pm,

Friday & Saturday 10am-4pm

9C Johnson Road • Latham

Comfortex FactoryOutlet Store

www.comfortexfactoryoutlet.com

Design your ownWindow Fashions!Enjoy the experience of designing your own Cellular, Roman or Roller Shade.You, along with a Comfortex Design Consultant, choose from the PERSONA paletteof beautiful solid Colors, rich Textures, dazzling Patterns, and variety of Borders.

Sold at Comfortex ~ Designed by You

www.PersonaShades.com

Roller & Roman Shades

12 life@home

facebook.com/lifeathomemagazine

storiEs

photos

rEcipEs

MorE oFEvErything

Co

mp

ute

r m

ou

se il

lust

rati

on

© Ir

ina

Iglin

a/D

ream

stim

e.c

om

. He

adb

oar

d p

ho

to b

y E

mily

Jah

n. G

oat

ch

ee

se p

ho

to: ©

iSto

ckp

ho

to.c

om

/on

eb

lue

ligh

t. B

edro

om

pho

to b

y B

rian

Mic

haud

.check us out online @timesunion.com/lifeathome

on the web

READ mORE stories, including what’s new in headboards, the best uses for goat cheese, and how to give your room that Wow factor.

GET mORE recipes, like regal rice and asparagus, mussels & ale with andouille and smoky green chili salsa from chef Art Riley Jr., after first reading the story on page 70.

SEE mORE photos from our stories, like our @home feature.

house thingsRead all about filling

your house with the right things, in our blog by

Times Union Magazines editors Janet Reynolds

and Brianna Snyder.

refurnished Living

Explore the “greener” side of the design and decorating industries

with Refurnished Living columnist

Alison Grieveson.

Facebook We want to hear from

you! Join us on Facebook to add your two cents to our discussions, give us your ideas for inclusion

in upcoming stories, and enter to win contests.



timesunion.com/lifeathome

Expert Tree Removal andTree Care Services for theGreater Capital District AreaWe have over 30 years’ experience in tree care and are fully

equipped for any residential or commercial tree work, including

large-tree removal, stump grinding and removal of trees in tight

spaces. Our company is fully insured, has a strong customer referral

business is available for 24-hour emergency service.

A-Plus Trees ‘R Us Services include:

• Tree Removal— expert, orderly and safe procedures; bucket

work and tree-climbers

• Pruning, Cutting and Trimming— to remove hazards and keep

trees healthy

• Stump Grinding and Wood Chips—seasoned and split,

available year ‘round

A -Plus Trees ‘R Us service is fast, friendly —

and priced to meet your budget.

We will meet or beat any

competitor’s price.

For a free estimate, call518-894-TREE (8733)We’ll go out on a limb for you.

www.aplustreesrus.com

editor’s note

As I write this, the days are long, hot and humid. Autumn and its cool, crisp days seem — happily

— far, far away.And yet, when September arrives, I

am somehow always ready to embrace the shorter days and increasingly brisk air. Come September the sky takes on a distinct color echoed only by its sis-ter month, October, for its azure clarity. (My husband, a September baby, and I, an October Libra, have a longstanding argument about which month’s sky is better.) A deep breath brings cleans-ing purity and Mother Nature puts on a display of riotous colors.

I love all the seasons — yes, even win-ter to an extent. It’s why I live where I do. While February’s snow and sleet can seem never-ending, I enjoy the inevitable nesting that comes with being forced in-doors.

September is the harbinger of that

cold weather to come, but with none of winter’s annoyances. It is still a time to play outdoors and enjoy the last colors of asters and mums. The gar-den has echoes of its summer bounty and the porch is still a place for eat-ing breakfast, albeit while wearing a fleece some mornings.

And September is a month of prepa-ration. We turn our minds and bodies to our interiors, gathering wood, put-ting up vegetables to enjoy in hearty soups and casseroles, and prepping for the long indoors to come. It’s a peace-ful time, that time before the storms of winter. Here’s hoping you enjoy Sep-tember’s many splendors, too. @

September’s Splendor

We specialize inGroup Outings

Twitter: @thunderhartgolfFacebook: @thunderhartgolf

W

TwFace

Senior Days18 Holes of Golf

with a Cart Only $26Monday - Thursday Only

Check Out Our Amazing Golf Getaway Packages!

Only 30 minutes from Albanyy 3 yyyyyyyyyyy 3 y518.634.7816 • thunderhartgolf.com

Stay & Play$199ppWeekend

$Weeken

$99ppMid-week enenendWeWeWeWeWeWeekekekekekenMid-d-weweweekek18 Holes of Golf with Cart,

Free Same-Day Replay. Accommodations,Breakfast & Dinner

Check Out Our Amazing Golf Getaway Packages!

Ph

oto

by

Kri

shn

a H

Ill.

Most SupportiveMattress For AllYou Do In Bed.TM

GetComfortable

NEW GEL SERIES

FREE DELIVERY

REMOVALOF OLDBEDDING

SET-UP

Home of the Lifetime Nursery GuaranteeVisit hewitts.com for more information

Rt. 50, Glenville 399-1703Rt. 9, Clifton Park 371-0126

Rt. 7, Latham 785-7701Rt. 20, Westmere 456-7954

Rt. 9, Saratoga 580-1205Rt. 4, East Greenbush 283-2159

Feura Bush Rd., Glenmont 439-8169Quaker Rd., Queensbury 792-3638

Photo by Peter Bowden

HEWITT’Sf

Savor September


ART AND ARCHITECTURE:� Hand-painted walls in Troy. Read the story on page 27. Photo by Mark Samu.

furnishings | gadgets | décorpages 17 - 66



essay

by lee nelson

Gazebo Take Me Away!

Pho

to: ©

iSto

ckp

hoto

.co

m/k

evin

mill

er.

About 10 feet beyond our dining room and through the sliding back doors, a quaint, screened-in gazebo invites me in morning, noon and night. It’s not much to look at,

really. It’s just some fading cedar wood, eight walls, screens and a simple door. But inside, my oasis of calm awaits me and takes me away from all that bugs me — including the bugs.

When we moved into this rental house in November 2010, the deck and gazebo didn’t have much appeal because it was starting to get cold, and we couldn’t use either one of them much. But since then, my boyfriend and I have personalized the small space during the spring, summer and fall months to be a place we can work, play, talk, listen to music, chat with friends, eat or just about anything else. We’ve even considered putting an air mattress out there for some urban camping. That might just have to wait until next summer.

The first stop was finding comfy seating to make the space as welcoming as possible. I happened upon a new all-weather wicker chair with thick cushions from Target at my local thrift shop. The big box retail store donates a lot of its extra mer-chandise to the Salvation Army, and I was the lucky one with the right spot for it. I got it for $50. At home I searched Target’s online store and found a matching loveseat for $225. A promo-tional code gave me another 30 percent off. What a deal!

Next purchase was a soft brown indoor-outdoor carpet I could cut to fit on the oddly-shaped floor. At the same store, I discov-ered four big outdoor pillows for on sale for $8 apiece. Their sea blue, brown and tan stripes added just the right dash of color and comfort to make the seating even more appealing.

An old stereo cabinet with a glass door for $7 from another thrift store soon housed our CD/radio purchase for $5. This place was looking good. I added a few end tables from my for-mer house, a lamp and pillar candles in tall glass vases so the

wind couldn’t blow out the flame. Tom, my boyfriend, was an electrician’s apprentice before he

became a teacher. So his skills at extending electricity from the house to the gazebo came in handy so we could plug in the lamp and stereo. He also installed a ceiling fan and light.

We have spent so many nights out in the gazebo talking, planning our future, sharing some wine and enjoying

each other’s company. We also have used it as our outside of-fice. We bring out our laptops to finish work or just browse Facebook. I have written some of my best stories within those screened walls.

I’ve called many a friend or family member to chat inside the comfort of this sanctuary. We’ve eaten meals there, read the newspaper, given foot massages, hulled strawberries, played games, listened to St. Louis Cardinals baseball games, cried and laughed. We’ve planned vacations there, we’ve fought off wasp attacks, and we’ve changed our grandson’s diapers. We’ve even projected movies onto a big white board that we designed to fit snugly over the top of one of the screens inside. Bill Murray’s What About Bob is even funnier outside than on a television.

When we eventually buy a home together, the gazebo is where most of my memories will be focused. I’ll remember how good I felt when the cool night breezes wafted through the screens. I’ll reminisce about the sweet kisses we shared through some of the toughest times in our lives while blending two families. I’ll also remember that the neighbors could have been listening and watching to everything we were doing. Our backyard faces 10 other backyards.

Hopefully, our next place will be more private. But for now, this eight-sided structure will have to do for our haven from life’s stresses. @

Call for aFREE DVD

Protect Your HomeWith The MostADVANCED GUTTER SYSTEM AVAILABLE

Custom-Installed ByFACTORY-TRAINED GUTTER PRO

PROFESSIONALS

518-464-4705 | 1-800-886-5883 | Visit us at www.GutterProNY.com

Installing Seamless Gutters At The Lowest Prices Since 1985SEAMLESS GUTTER & SUPPLY CO.

STOP CLEANINGYOUR GUTTERS!CHANGE THIS TO THIS

End this dangerous and

costly problem forever.

Now...you can give yourself

and your home a new lease on

life. NO MORE CLIMBING

LADDERS. No more water

spilling over and ruining

your walls, soffit & fascia.

END GUTTERCLEANINGONCEAND FOR ALL!

Senior Citizen’s Discount

InstantFactory Rebate$300 OFFYour GutterPro Order!


window shopping

shop smart shop local

photos by krishna hill

Each month, Window Shopping highlights interesting and unique items available at area stores. This month’s items can be found in Troy.

EARTHy CERAmIC ACCENTS are handmade by craftsman Thomas Diem in Ashbourne, Ireland. Vases ($32-52), available at The Counties of Ireland.

continued on page 22

22 life@home

window shopping

This 1. Trinity Door Knocker ($65) announces Irish pride to every guest who enters your home. Available at The Counties of Ireland.

Replace clutter with class by 2. adding this set of four antique glass bathroom containers

($24) to your powder room. Available at Linden & Ashby.

"Capture the Moments" 3. swinging camera clock ($56) gently reminds that it's always a good time to enjoy life. Admire it at Truly Rhe.

This 4. heart-shaped wall hanging ($30), made from recycled oil cans, is charmingly rustic and environmentally friendly, too. Available at Truly Rhe.

This 5. French Settee ($850) is upholstered in lovely

continued from page 21

➋

➏

➊

➎


SHOPS FEATURED:�

The Counties of Ireland77 Third Street, Troythecountiesofireland.com

Truly Rhe1 Broadway, Troytrulyrhe.com

Linden & Ashby 205 River Street, Troylindenandashby.com

Artcentric Gallery/HOmE266 River Street, Troyartcentricgallery.com

vintage fabric. Find it at Artcentric Gallery/HOmE.

A 6. working vintage movie projector ($50) makes a great conversation piece. Available at Linden & Ashby.

Eccentric 7. Candle Sticks ($400) are handmade in Manhattan from vintage salt and pepper shakers. See for yourself at Truly Rhe.

Luxurious silk stripes draw the 8. eye to this French Bagere Chair and Ottoman ($550). A Round

Starfish Pillow ($28) adds a nautical feel. Find them both at Artcentric Gallery/HOmE.

➑

➍

➐

➌


24 life@home

window shopping

Check out this months’s favorite picks from our local and national bloggers. Then head online to timesunion.com/lifeathome to satisfy your design and décor itch 24/7. Who knows what you’ll find!

ourbloggers shop

Here in the Northeast, we love the cozy warmth of a fireplace. A nice contemporary twist is the RED (Rectangular European Design) gas fireplace by Heat’n’Glo, available at Best Fire in Albany. This elongated shape is a clean, fresh look and offers 21 variations of stone and glass media options, LED accent lighting, porcelain or granite refractory liners and surrounds so you can customize your own design. With choices like these, you can light a really cool fire. Best Fire, 160 Central Ave, Albany. 869-9600.

Home Décor@518by valerie delacruz


Anthropologie, that too-cool-for-school, hipster fashion haven, is rightfully adored for its good taste. Shoes, accessories and furniture at the Philadelphia-based (Urban Outfitters-owned) retail chain appear regularly on the feet and in the living rooms of trend-watchers, and with good reason. This chair is just one example of Anthropologie's vintage/found aesthetic; the "overdyed terai chair" is embroidered in a kantha style, the same that’s commonly used in India and Bangladesh to make saris. The faux-folk feel is warm, lovely, and soft. This is all-cotton padding on an indoors-only frame. They come in turquoise (pictured), gold, purple and orange; $198 at Anthropologie.com.

House Thingsby brianna snyder


SHOP J.JILL AT CROSSGATES MALL(on the upper level near Forever 21)

closertake a

look

© 2012 J.JILL

Comfort is...

an afternoon without interruptions

THE INNOVATORS OF COMFORT™

GET UP TO $1,500 OFF*Stressless® product when you buy any

Stressless® Home Seating!

August 31 - October 28

GET UP TO $1,500 OFF* Stressless® product when you buy any

Stressless® or Ekornes home seating.THE MORE YOU BUY, THE

MORE YOU SAVE: 2-3 seats = $750 credit, 4-5 seats = $1,150

credit, 6+ seats = $1,500 credit.

Creditmaybeapplied to anyStressless® or Ekornesaccessoryor use

it towards additional seats. The choice is yours. See sales assoicate

for complete details.Learn more here.

Stressless® is proudly endorsed by the American Chiropractic Association.

1758A Rte 9, Parkwood Plaza, Clifton Park • 518-694-8452

Hours: Mon. to Fri. 10-9, Sat. 10-8, Sun. 12-5

www.Mooradians.com


@home with

by brianna snyder | photos by mark samu

East Meets Westtwo arty architects make a hip home

Barbara Nelson and Tim Dufel may live in Troy, but their home has a distinct California vibe. “I was raised for the most part in Palo Alto,”

Nelson says. “I have a real love for color and that kind of Latin influence. The most modest (Califor-nia) neighborhood is just full of flowers.”

Those breezy echoes of the West Coast spirit are everywhere in Nelson and Dufel’s home, though Nel-son’s been on the East Coast since 1975, when she arrived to attend RPI. Art inspired by the couple’s two daughters, 17-year-old Helen and 20-year-old Kelly, and their friends decorates walls and corners of the home, and sits well with Nelson’s easygoing nature and good taste. Nelson and Dufel met in col-lege where they both majored in architecture. Art-ists, engineers and architects both, the house as it is today is a product of their hard work, hip sensibili-ties and planning.

When they bought their home in 1995, it was about 80 years old, with an all-pink kitchen and 1950s “gizmos,” as Nelson refers to them. Built in 1913, the house had been owned by just one family until Nelson and Dufel purchased it.


28 life@home

@home with

It took nine years for them to draft and settle on schematic plans for remodeling. Nelson gives much of the credit to her husband, how-ever, who she says has an attention for detail so honed that “it can drive me crazy,” she says affectionately.

At the top of their list for trans-formation was the kitchen, which they gradually transformed into a near-industrial-size and -quality cooking space — with a huge oven and stovetop — for Dufel, who loves to cook. (Helen bakes too — carrot cakes, in fact, which are locally in high demand; Nelson points to a stuffed carrot hanging on the wall, a nod to Helen’s famous confection.) They also expanded the kitchen

space, building onto the back of the house and leaving intact the exposed brick from what was once the home’s exterior. The effect? Sit-ting at the kitchen table feels very much like sitting in a screened-in porch. Big, bright windows make up the walls of all three sides of the extension, which they’ve only just recently finished this past year.

Nelson works at RPI’s campus planning and facilities design de-partment and participates in the Alley Action Project, a Troy-based public project to bring art to the community. Throughout Troy, you’ll notice murals, which have been painted by commissioned artists, children and neighbors. Dufel, who


“I HAVE A REAL LOVE for color and that kind of Latin influence. The most modest (California) neighborhood is just full of flowers.”

30 life@home

@home with

BARBARA NELSON NAmED HER BEAGLE “BUZZ,” after Buzz Lightyear. Because beagles have a reputation for running away, Nelson says, they expected Buzz to go “to infinity and beyond.” (But, she says, Buzz never runs anywhere.)

“ThanksWarren Tire!”

On the outside,we’re Goodyearblue and gold...

Visit us at www.warrentiresvc.comfor Spring Specials & Coupons

For more photos, visit timesunion.com/lifeathome.

worked for years in building and construction, now works on tugboats, traveling all the way down to Virginia and up to the Great Lakes and Canada.

The home’s décor centers on the couple’s passions: art, ar-chitecture and boating. Funky, swirly patterns painted by close family friends cover partial and whole walls, and pictures of old tugboats hang in clusters in the living room. A noteworthy omission from the family’s living room is a TV. In place of tele-vision is a big pull-down screen, onto which movies are pro-jected. It’s like an in-house drive-in, perfect for a family that has frequent dinner parties and get-togethers.

What do they plan to work on next? “Construction threw the basement into upheaval,” Nelson says. That’ll be the next proj-ect. For now, though, “I’m doing nothing,” Nelson says. “I’m just going to work on keeping it clean and enjoying it.” @

32 life@home

design: defined

by lucianna samu | photo by mark samu

It’s hard for me to measure if I’m spending enough time keeping up with trends. I attend all the important design-related events. My magazine subscriptions are all current,

each issue picked over repeatedly and riddled with color-cod-ed sticky notes to designate the greatest of great ideas. I keep one computer up and running, around the clock, to receive the latest breaking design updates from the blogosphere, and one DVR is set to tape all design-related programming. And even though I never actually have time to watch anything on the 90-percent-full DVR my husband so dutifully monitors for me, I feel it still counts somehow that I mean to.

The good news about a trend is that by simply stealing an idea, we can accomplish an instantaneously “hot,” “new,” “hip,” or “cur-rent” look without the need of much thought or planning. Another upside is that we are afforded an easy design cover for decisions that might otherwise be deemed unconventional or risky. After all, it’s on trend — everyone is using this color, that material.

As a trend follower, I can trace the origins, and even the how or why of a trend. Take turquoise, for instance, which photo-graphs particularly well and looks crisp and sharp on a com-puter screen. Any trends rooted in classic design — I’m thinking now of the classic white kitchen — will only appear trendy by virtue of some specific mix of materials: white cabinets + black granite counters = perfect on-trend kitchen.

The title of trendsetter is something someone cannot claim for him or herself. Tastemaker perhaps, but trendsetter?

That’s big. That’s not to say trendsetters aren’t walking among us. After

all, who can say who first dreamed up the idea of hanging gigan-tic letters on the wall? Probably a busy mother in Kansas, with a crafty kid who decided to draw his initials on the living room wall. I can imagine Mrs. Kansas now, cutting up shirt boxes to fashion gigantic dimensional letters to conceal her child’s magic marker artwork before Dad gets home for dinner. Creative solutions for design dilemmas or budgeting constraints are the spark for every enduring trend, always fueled by others in a similar circumstance who can appreciate a truly great idea when they see one.

I fancy myself more of a trendspotter. Although I do have some admirers who would encourage me to claim trendset-ting status, I’m happy enough to trust my instincts and simply predict the next hot-new-beautiful-essential before it hits the pages of the magazines that litter my office. My predictions are always rooted in a design idea that begins to gnaw at me to try. These things start as a yearning, perhaps for a specific color

or texture. Often it’s a longing for some elusive quality I can’t quite articulate but rather feel, a lacing of some such thing that I begin to believe remains unanswered.

What is it then that my annoyingly sensitive design sensibili-ties are telling me are sure to take my best design ideas to new heights? Heading up the list is wallpaper.

This is not an easy disclosure for someone whose career is rooted in color and paint. I’ve tried to ignore my desire for color-ful abstract prints, retro scenes of cowboys and Indians, mono-chromatic hunt scenes or a neon floral print. Stripes and plaids and linear graphics — all of which are achievable through paint techniques — are not the wall-covering experience I’m after. Nor will a textured wall suit the particular bee I have in my bonnet.

Only wallpaper will satisfy. The more old-fashioned-looking the better, perhaps even a collage that appears as though it’s been revealed by removing layer upon layer of wallpaper — that’s the feeling I’m after, and for whatever reason, I suspect others may be, too.

Pale floors, bleached and worn, are another fixation. Images of a hardwood floor that has little shine and some imperfection, with a quality to suggest a waxed surface, is the flooring inces-santly dancing in my head. I have found a few random-width natural hickory hardwoods that could fit the bill, and a spalted maple or white oak. Where these floors might be installed re-mains unknown, but for certain these are the floors of my imme-diate future. Finely detailed laundry rooms, tile that resembles natural wood, irreverent combinations of blue accented with purple, and, finally, a bold and brazen mix of yellows round out the design initiatives I’m longing to put to the test. Where or when I can’t say just now but soon. And it remains entirely pos-sible my design visions could become the next trend, captured as a six-page spread in the anniversary issue of life@home. @

Trendspotting

“ThanksWarren Tire!”

Corner Rts. 9 & 146Clifton Park

371-3343M-F 7:00-6:00SAT. 7:30-5:00

75 Saratoga Ave.Waterford

233-1480M-F 7:30-5:30Sat. 7:30-5:00

Route 7Latham

785-6377M-F 7:30-5:30Sat. 7:30-5:00

1860 Central Ave.Colonie

464-0516M-F 7:30-5:30Sat. 7:30-5:00

608 Columbia Tnpk.East Greenbush477-7635M-F 7:30-5:30Sat. 7:30-5:00

203 No. Comrie Ave.Johnstown762-8315M-F 7:30-5:30Sat. 7:30-5:00

But on the inside ,Warren Tire is

“green.”

Werecycle• oil • tires • metal• antifreeze • batteries

Member elite NYS “SHARP”program since 1990

Doesn’t itmake sensetodobusinesswithan

environmentally-consciouscompanywhereyou

“neverpaymore for thebest.”

Visit ournew improvedwebsite andWarrenTire “AdvantageCalculator.”www.warrentiresvc.com

34 life@home

mudroom mania

by laurie lynn fischer | photos by rebecca isenhart

go from mudroom to mod room with this 12-step program

My husband calls it the LZ, or landing zone. Backpacks and sports gear bury a long bench that’s supposed to be for sitting. Shoes mill about as though it were intermission.

My dream mudroom is simple and airy, with large windows, easy-clean slate floors and mats, a boot rack, a chair and a freestanding coat rack with three baskets on the bottom — his, hers and extra. It belongs to Alan Wilson and Diana Dietrich of Rensselaerville.

Want a mudroom that’s more like theirs and less like mine? Here are 12 tips from Capital Region design experts and hom-eowners to help you make this entryway clean and efficient.

1. PlanWhat passes in and out of your house? Must it live in the mud-room? Ask. Then find versatile storage to meet your house-hold’s changing needs, advises interior designer Karen Conway, principal of Conway Creations. “No matter how pretty or funky the piece may be, if it doesn’t work for your stuff, it won’t help create a functioning mudroom,” she cautions.

2. Stow the ShoeS“Shoes can be put into a container,” Norizsan says. “If you have a bench, you can put an open tray underneath for shoes.” Boot trays are ideal for wet and dirty footwear, Norizsan says. They come in copper, metal and wood, says Nancy Smith, an interior designer with Saratoga Signature Interiors.

3. have a SeatChanging footwear? Why not sit and store? “A bench where you can store boots and things when they’re not needed is re-ally nice,” Smith says.

4. air it outAs their name suggests, mudrooms must accommodate soggy things. “There should be a container for wet items and a sepa-rate area for hanging them to dry, like a coat rack, where air can circulate around them and they’re accessible whenever they’re needed,” Norizsan says.


Mudroom Makeover

bãÉêáÅÜ p~äÉë C pÉêîáÅÉI fåÅKNUT s~äÉåíáåÉ oÇK ïïïKbãÉêáÅÜp~äÉëKÅçã

`Ü~êäíçåL_~ääëíçå i~âÉ I kv NOMNVERNUF PVVJURTQ

www.kubota.com

NewGrand L40 SeriesKubota proudly introduces eight newGrand L40models ranging from 34 to 59 HP – each with increasedpower output and PTO torque.

Innovative features like our new HST Plus hydrostatictransmission, Hydro Dual Speed (H-DS), Load Sensingsystem, Auto Throttle Advance and Response Controlmake operating a tractor as easy as driving a car.

For added versatility, theGrand L40 offers a completeline of performance-matched implements. There’seven a climate-controlled Grand Cab™ foryear-round comfort.

When you have a tractor like this, life is better thangood. Life is Grand.

©Kubota Tractor Corporation, 2007

bãÉêáÅÜ p~äÉë C pÉêîáÅÉNUT s~äÉåíáåÉ oç~Ç ïïïKbãÉêáÅÜp~äÉëKÅçã

`Ü~êäíçåL_~ääëíçå i~âÉI kv NOMNVERNUF PVVJURTQ

36 life@home

mudroom mania

3. everything you need to know, you learned in kindergartenCustom cubbies organize Margaret DePaulo’s Malta mudroom. “We get a lot of compliments on it,” the mother of three says. “It’s almost like a locker system without doors. My husband gets a cubby, and each of our kids. The bottom is open with mesh wire, so it allows shoes to air out and dry.”

4. Contain it“With today’s lifestyle, everybody’s in such a rush, they want things to be easily accessible so that they can grab and go,” says Stephanie Norizsan, an interior designer with Stickley, Audi & Co. in Albany. Visible containers should be decorative, she says.

“They could be baskets or different colored boxes,” she says. “You can put names of different family members on each one, so everything goes back into its container and it’s not spread out around the house.”

9. try Something timeleSS Space savers from yesteryear, such as freestanding hat and coat racks, still work today. Darcy Scarlata, an interior designer with Mooradian’s Furniture, remembers her grandmother-in-law’s beautiful antique hall tree. Customers request hall trees, she says.

“You can find them in any kind of style or have them made,” she says. “A lot of times, you’ll see a country look with painted pine and wrought-iron hooks. Usually, it has a mirror and you can hang garments, hats and umbrellas off of it. A lot of times the bench lifts up so you have storage inside. People could also make their own style: Buy a storage bench and a cool funky mirror to put over the top and find decorative hooks.”

2. go with the flowThe mudroom is the first room people see, says Feng Shui Mas-ter Consultant Cyndi Martin. “It’s the most used,” she says. “It sets the mood. It has to have flow. Dust and clutter pull in nega-tive Chi (energy) and hold onto it. If there’s a bathroom off your mudroom, keep the door shut.”

Martin tamed her Delmar mudroom with a wall unit. “I have twin teenagers and two dogs,” she says. “Everything has its spot.”


have a bathroom off your mudroom?Keep that door shut!

alan wilSon and Diana Dietrich’s mudroom incorporates a space-saving coat rack with organized baskets.

the dePauloS’ custom cubbies give everyone’s stuff a home.

Please call (518) 459-7799for more information

1237 Central Avenue • Albany, New York

For more than 35 years, we have been the musicschool of choice for those wanting to learn music inways that engage, transform, educate, and entertain.Innovative and custom curriculumOur innovative, supportive faculty teaches a custom curriculum thatprovides opportunities that exist nowhere else – in the classroom, onstage, with professional musicians, and more. Our classrooms andour instruments, from our many grand pianos to the smallest Orffglockenspiel, are as singular as our curriculum and our teachers.We are unique: our classically trained faculty; our commitment to sharingthe joy of making music; our dedication to our students and theirfamilies and the matchless opportunities we provide to our students.

Beginning with two and three-year-oldsWe begin with group lessons that introduce young children to the joyof music through focused, playful musical activities that stimulate, buildconfidence, and refine the ear. As our students develop more advancedmusical skills, they graduate to private piano lessons, group theory andrepertoire class, and many additional activities.We also offer adultstudents a chance to connect to music - those who’ve never had a pianolesson and those who took for years - through a recreational pianoprogram that has been honed for more than 35 years.

Making a lasting differenceStudies show that well-paced music study begun at a young age makesa developmental difference that can be seen and measured for years.As teachers and parents, we know that a love of musicmakes a qualitative difference in life that is just as real,and even more important.

THEMUSIC STUDIOEducating, Engaging,Transforming

www.The-Music-Studio.comfacebook.com / themusicstudiotms

10. adaPt itFor “a more traditional look” in her Selkirk home, Conway con-verted an antique dresser, replacing drawers with shelves and willow baskets.

“It’s better organized than having a giant junk drawer in the dresser and easier to take objects in and out,” Conway says. “I love using vintage pieces, but make sure all rough edges are sanded down a bit and any nail heads are fully hammered in so clothing doesn’t get snagged.”

11. floor it Mudroom floors should be easy to clean, Smith says. “Every-body wants a place that their children can enter and not be tracking mud all over the place,” she says. “Frequently a mud room is also the dog entrance. I have a rug there that I can throw in the washing machine.”

Conway recommends camouflage. “Light-colored flooring looks wonderful in photographs, but no one has time to keep it looking that way,” she says. “You don’t have to color-match mud, but darker earth tones will make all the daily grime that tracks in less conspicuous.”

Building new or renovating? Consider radiant in-floor heat-ing, Conway says. “We have radiant heating in our mudroom, and have often laid out wet mittens and snowsuits to dry,” she says. “Many households now have a ‘no shoe’ policy and it’s a wonderful treat to take your shoes off on a warm surface.”

12. vaCuum itNature abhors a vacuum. Not your mudroom. Easy vacuum-cleaner access is important.

“If you happen to be blessed with an internal vacuum sys-tem, you can just sweep it right in and away it goes,” Smith says. “That to me would be heaven.” @

the dePauloS’ solution to mud and pet hair is to keep an easy-to-clean throw rug at their entrance.

If there’s one room in the house you spend the most time in and the least time looking at, it’s the bedroom. Lying in the dark with your eyes closed, who cares if the room

could use a makeover?Unlike the public spaces in your home, where

pride may dictate redecoration every once in a while, bedrooms are often neglected. You buy the standard bedroom set, put all the furniture against the wall, and declare yourself done. But really, when you think about it, this is your most personal space. Shouldn’t it reflect your personality?

Here are a few ideas to help you transform the master bedroom — no paintbrush required!

38 life@home

interiors

SteP 1: room to BreatheClutter is the enemy of tranquility, so give yourself some

space by clearing the closet. Closet organizing systems can help but you can also stash seasonal clothes under the bed or in space bags. Once the closet is clear, you might find room for the laundry hamper or a chest of drawers, which will make your bed-room more spacious.

It may be a bed-room but some pas-sions are best kept under wraps. When it comes to clutter, professional organiz-er Neil Bindelglass of Saratoga Home Stag-ing says hobbies are the enemy. Put yarn in a decorative basket, file scrapbook materials

away in a drawer, use shelves for books, and a rack for maga-zines. You want these items to be handy but they shouldn’t take over the room.

The same goes for collectibles. Use these sparingly as accent pieces and, if you swap them out from time to time, each item will be displayed prominently and you’ll be able to enjoy them all.

“Less is more,” stresses Bindelglass. “Any house I walk into has three to four pieces too many in any room. Not every space needs to be filled with a little piece of something — and occa-sional furniture is dangerous.”

SteP 2: rearrange the furnitureBeds are where designers say people make their biggest

mistakes. Too often, beds are wedged against a wall with the side facing the door. If you want good Feng Shui, the foot of the bed should be the first thing people see upon entering the room.

“It’s more welcoming to walk in facing the bed than walk-ing into the side of the bed,” says designer Chris Liberty of East Elm Interiors in Saratoga Springs. To really revamp a room, consider placing the bed so it comes out at an angle

from the corner opposite the door.Julianne Bendick of Jewels Interiors in Clifton Park always

begins by removing as many items of furniture as possible and adding them back slowly, piece by piece. Do this and you might find that one bedside table looks better than two or that an ottoman can stand alone.

by jayne keedle | illustrations by emily jahn

mastering the Bedroomhow to transform your most private space into a personal sanctuary — no paintbrush required!


www.hearforyou.infoHudson

822-9777Amsterdam620-4267

Coxsackie595-4135

Mayfield620-4611

Rotterdam631-4188

Cobleskill868-7322

Saratoga618-4805

Albany708-6123

Troy595-4277

*Not a hearing test. For amplification purposes only.

IT’s HERE!The Communication Device

that Hearing Aid Users Have Wanted!

• Enables Hands-Free cellphone conversations• Enhances one-on-one conversations in noisy environments• Is ideal for listening in meetings or group settings• Streams audio from TVs and MP3 players directly to wirelesshearing aids in three different ways:

• Wireless Bluetooth connection• Audio Out Connector Cable• By Playing it in front of a speaker

Make an appointment today for a demonstration of theSurflink Mobile with Audibel Wireless Hearing Aids

Only at

COUPON

15% OFFThis Amazing Communication SystemWith Range and Audibel P2 Hearing aids

10% OFFwith Start wireless hearing aids.

Expires 9/15/12

THIS LITTLE DEVICE:

40 life@home

interiors

There are two items that, once removed, designers say should stay out of the bedroom. Unless you live in a studio apartment, your bedroom shouldn’t double as an office or a gym, so relo-cate the computer and exercise equipment.

“The bedroom is supposed to be a sanctuary, a place where you don’t have something hanging over your head, like that spreadsheet you didn’t finish or the 20 minutes you didn’t do on the treadmill,” Liberty says.

As you add items, consider introducing furniture from else-where in the house. An old lamp from the attic or a spare chair from the dining room might be perfect for the bedroom. Don’t be afraid to take a nontraditional approach to night-stands, either.

Liberty has a repainted dry bar on one side of her bed for storage and an end table on the other but, as her partner-in-design Shelly Walker says, you could use anything from a large drum to a big stack of coffee table books as a nightstand.

“Introducing uncommon elements into the bedroom is great,” says Lisa Santy of Pizazz Interior Design in Round Lake, adding that she scours salvage stores for unique but useful bedroom furniture.

SteP 3: make the BedAs the largest piece of furniture in the room, the bed is a

dominant feature, but that’s good, because bedding is the easiest thing to change and the colors you choose can anchor the room.

If you’re in the market for new bedding, a down comforter offers a really luxurious feel. If you want to change the color scheme without spending too much money, a duvet cover can give an old comforter new life. Then again, chang-ing the colors can be as simple as changing the sheets — all you have to do is fold the comforter down and swap out pillows as needed.

For Walker, there’s no such thing as too many throw pillows. Liberty, meanwhile, limits her-self to three decorative pillows and two shams. The one thing they both agree on is that noth-ing makes a bed look more inviting and lush than pillows.

Designers suggest mixing and matching sizes, shapes, colors and textures to add interest and vari-ety. “I like to mix patterns within the same color family,” says Santy, who personally limits the num-ber of pillows to six. “The colors don’t have to match but just provide a tint of variation. Adding pillows to the bed also adds

dimension to the room.” If you’re tired of your old bed frame, all you need is a little

ingenuity to restyle it. An older bed, for instance, is typically lower to the ground than a contemporary one, but to update it, “a bed riser is a cheap fix,” says Bendick.

When it comes to headboards, your only limit is your imagi-nation. “You could use anything to make a headboard: wall hangings that are beefy or hefty, an old door, or shutters,” says Liberty. “Those are things that could be mounted to the wall or to the bed.”

Fabric is another way to create a dramatic backdrop. From a curtain rod mounted on the wall at the head of the bed, you can drape sheers, hang a panel or valance and add curtains that you can tie back, or display a favorite quilt.

Feeling ambitious? “You can create your own headboard us-ing foam over a piece of plywood, upholster it with fabric and

attach it to the wall,” says designer Terry Kral of Window Wear Etc. in Schenectady.

SteP 4: Create an illuSion If money and time are tight, replacing

worn carpeting or installing a picture win-dow probably isn’t an option, but there are ways to accentuate the positive. A well-placed area rug can hide problem areas, change a color scheme, warm up a wood floor, or redirect the eye if you place it so that it emerges from under the bed at

an angle.“Position furniture so that focal points,

such as large windows or French doors, can be appreciated. Don’t use large furniture in

small rooms, and don’t block natural light,” ad-vises Santy.

Even if your bedroom windows are small, make them a focal point by using curtain rods that are

wider than the window frame. Put up a valance and curtains that hang lower than the window sill and you’ve created the il-lusion of a large picture window. For a light and airy feel, drape


sheer scarves from curtain rods with decorative ends, which you can change at will.

Lighting sets the mood, but in the bedroom you want lay-ered lighting: bright lights for practical reasons, lights to read by, and lights that give off a warm, relaxing glow. Dimmer switches are ideal, but they often won’t work with energy-efficient light bulbs.

Lamps, however, are relatively inexpensive and there are lots of styles from contemporary to traditional that can really change the look of a room. If you’re feeling crafty, try adding trim, crystals or beads to personalize an existing lampshade.

SteP 5: get PerSonal If you can’t get personal in the privacy of your own bedroom,

where can you? Just because bedroom sets tend to come stan-dard with a chest of drawers, a six-drawer dresser, two bedside tables and small nondescript lamps doesn’t mean you can’t break the mold. Your dresser probably has a mirror attached but there are only a couple of screws keeping it on.

“Instead of putting up the standard mirror that may come with it, try putting a wonderful large decorative mirror there instead,” says Bendick. She also suggests hanging a piece of art over the dresser and using an antique-style full-length standing mirror to make a statement.

If you’re living with inherited furniture, refinishing an old dresser is one way to make it your own. East Elm Interiors sug-gests repainting furniture, perhaps with a faux finish to give it that shabby chic look. But if you hate to paint, changing the hardware is a quick and easy way to bring grandma’s dresser into the 21st century.

Finally, why not dream big? If you’ve always wanted a four-poster bed or fantasize about sleeping under the kind of can-

opy you’d find in a tropical paradise, it’s not hard to make this dream come true.

You can buy a canopy that hangs from the ceiling. All you have to do is run the fabric through rings above the four corners of the bed and tie it back like a curtain to create the illusion of a four-poster bed. Alternatively, you can put curtain rods on the ceiling above either side of the bed and drape fabric or scarves to create a canopy of your own design.

At the end of the day, it’s your bedroom. Why not indulge your fantasies? @

Children’s rooms are places where you can truly let your imagination run wild. There’s just one problem: Kids have very short attention spans. The second you’ve fin-ished creating the perfect room for Dora the Explorer or SpongeBob, your child has moved on to dinosaurs or Barbie, or Justin Bieber and Lady Gaga. So how do you keep up and keep your kid happy?

Pick a color that you and your child can live with for 1. a while. It can be bright and bold, but pick one that a kid can grow into (lime green, blue, or soft purple can carry most kids from kindergarten to the teen-age years.)

If your kid is crazy about race cars, Disney charac-2. ters, or My Little Pony, by all means go all out — but do it with decals. You can order decals online and when the fad fades away, all you have to do is peel them off.

Cork boards encourage your child to be creative 3. with collages and they come in sizes big enough to fill a wall. Unlike pictures held up with thumb tacks, pop idol posters pinned to cork boards won’t dam-age the wall.

Reversible comforters allow you to change the color 4. scheme instantly, but buying inexpensive themed sheets and pillow cases and folding down the com-forter to show them off is another way to transform the room. Add throw pillows to accent the colors.

Lava lamps never seem to go out of style, but if you 5. want to change the lighting inexpensively, themed nightlights are easily replaced.


42 life@home

problem: solved

after

Before

Sign up for our e-newsletter atstuyvesantplaza.com

Come in to see thelatest fall styles foryou and your home.

COME SHOP WHERE STYLE MATTERS,FASHION FLATTERS, AND THE EXCITEMENT

IS DOOR TO DOOR. FOLLOW OURSIDEWALKS AND YOU’LL DISCOVER

62 SENSATIONAL SPOTS TO SHOP ANDDINE. SO WHAT ARE YOU WAITING FOR?

ON WESTERN AVENUE WHERE THE NORTHWAY BEGINS.

is in The Air!Fall

facebook.com/StuyvesantPlaza

ProBlem: The curtains on the back door and surrounding windows of this Half Moon house were dated and the color a little dark.

Solution: Because this sliding door is used frequently throughout the summer — there’s a patio and pool out back — its dressing needed to be stylish and fashionable, without getting in the way.

“We had to be very careful about sizing and what we were going to drape it with,” says Mary Korzinski of Custom De-sign Associates. “That’s why we came up with slender (ver-tical) panels.”

They also installed nonworking Roman shades over the doors, Korzinski says, “really more to dress the window and enhance the view than to gear toward privacy.”

Korzinski says the treatment they replaced was “very ’90s,” with rosettes anchoring the top swooshes of curtain, which Korzinski says distracted from the windows’ architecture. The new treatment is a soft gray — very popular right now — to add a neutral tone to the gold-trimmed room.

“The grays seems to really enhance the goldens that so many people already have existing in their house,” says Korzinski. “It gives it that cloudy look. It just softens the room.”

toP tiP: “Sometimes it is just about the pretty!,” Korzinski says. “A beautiful frame for a lovely view. Look pretty and stay out of the way of traffic!” @

by brianna snyder | “after” photo by emily jahn

through the looking glasssometimes curtains don’t have to be functional

MAKE YOUR MISSION STATEMENT.

Handcrafted furniture, lovingly made in the USA for over 100 years—to last for generations.151 Wolf Road, Albany, NY 518.458.1846 Complimentary Interior Design Service stickleyaudi.com

the right Shelf in the right place can serve as more than just a storage area. This simple unit features canted, or angled, shelves that are just right for showing off a collection of vintage records.

46 life@home

home design

by janet reynolds

Stepping into designsabrina soto tackles home décor one layer at a time

Ask many people to describe their “perfect” living or family room, and many can tick off what their dream room would look like without thinking twice. Actually

recreating that room in real life, however, is a much tougher task for most of us. Why? Because it all seems too big. We just don’t know where to start.

HGTV host Sabrina Soto (The High/Low Project, among other shows) hopes to change that with her new book, Home Design, A Layer-by-Layer approach to Turning Your Ideas into the Home of Your Dreams.

“It’s like getting dressed in the morning,” she says of her com-mon-sense approach to interior design. “That’s what I based it off of. When people rush decorating and design, that’s when you make mistakes. You also can spend more money that way. I want-

ed to hold people’s hands through the decorating process.”The book starts, therefore, at the beginning, with “the first

layer,” understanding your space and planning the design. She advises people to sketch a floor plan, for instance, and take time to understand light exposure throughout the day in the room. She gives tips on how to discover the lines of your space and to notice any particular existing architecture, such as mold-ings, that could influence your ultimate redesign.

From here, Soto walks readers through basic color concepts, what they should know about surface treatments, how to select textiles and accents, among other layers. The book is filled with helpful photos to illustrate her many practical tips. This is a de-sign book for the masses, not the elite.

That sensibility has its roots in Soto’s childhood, she says.

Pho

to c

our

tesy

Clo

setM

aid

.

Store who gives wholesale pricing

toeveryone.

Cheeses • Can Goods • Frozen Foods • Coldcuts

Wholesalepricingon PrimeRib.(6 expertmeat cutters)

In business Since 1937, Family Owned

1631VANVRANKENAVE. SCHENECTADY374-3197/374-3198

OPEN MON.THRU SAT. 8AM-6PMNOT RESPONSIBLE FORTYPOGRAPHICAL ERRORS

Good Fr FFF dsdsdsds CCCololololdcdcdcdc

RosaceaRedness

Acne

STARTNOWfor Fall

BOTOX® • JUVÉDERM® • Radiesse® • Rosacea • SkinRejuvenationMedical LaserHair Removal, Acne&SunDamageTreatments*

Area’s best pricing! *Call for details; consult required.

FreeMedical Treatmentwith package purchase +medical grade product.

$150 Complimentary Consultation— Call 383-3300 today!

Visit our State-of-the-Art location! 950 Route 146, Clifton Parkwww.almedspa.com

Michael Salzman, M.D., P.C.

LOVE THE WAY YOU LOOK

CareCredit Accepted

TTTTWWll

ical T at nt ith

BeforeRoRe

ck ha edicicalck

After

Before AcAfter

Love the way you look!

“Some designers are all about luxury. I don’t want to be that person. I think of myself as the girl next door who happens to know about design.”

Soto says she grew up in a modest home that her mother, a decorator, made shine through clever strategies. “My mom instilled in me that you should always be proud of your home,” she says. “It doesn’t have to be expensive.

When I became a pro designer, I never wanted to be that girl who bought the best of best,” she adds. “That’s not how people live.”

It’s one reason why she’s thrilled to be a style expert for Target’s home lines. “That’s who I am. Even if I wear fancy shoes, which I love, I still wear a shirt from Forever 21,” she says. “I think you can splurge on a few items, but it’s all about the balance.

“It’s about a process even if you just buy a pillow. You can transform a room with two small pieces. Don’t feel like you have to do it all to make a difference. It’s not necessary.” @

Home Design, A Layer-by-Layer approach to Turning Your Ideas into the Home of Your Dreams, by Sabrina Soto, Wiley Books, 186 pages, $19.99

having weekend

guests and want to give a room an

instant upgrade? Soto advises a deep clean and reorganization. “The room

will feel fresh and new.” Maybe add new window

treatments or a few pillows to give the

room pop.

ComBine the BaSiC analogous duo of green and blue against a backdrop of white. It’s clean and easy to put together, and makes a calm, pleasing space.

Pho

to c

our

tesy

Sim

plic

ity

So

fa.

48 life@home

personal space

A Room of Her Own

Valerie DeLaCruz initially rejected the idea of turning her spare bedroom into her office. Her friend, who was stay-ing for the weekend, convinced her it was the perfect

place instead of the basement she currently occupied, which had no natural light.

“I kept thinking where would my guests stay? But I rarely had guests,” says the interior designer, singer and writer from Nisk-ayuna. (DeLaCruz writes the Home Décor @518 blog for 3 three times a week.)

After reconsidering her friend’s idea, DeLaCruz began to cre-ate her own “mom cave” a few years ago. First, she spruced up the walls with subtle off-white paint that included a hint of blue. She loves the ocean. A sand-colored carpet added to the room’s peacefulness. She also replaced the two windows with one big sheet of glass to show off the best views from her desk of the pond and thriving plants outside.

“Everybody needs a room or place of their own, particularly

women. Let’s face it. Women are the heart of the home and family and juggle so many things,” she says. “My son tells me ‘I make it nice.’ That sums it up in about everything I try to do in life.”

Men have been claiming their spaces for decades with “man caves” designed with pool tables and bars in the basement, huge flat-screen televisions and surround sound in the family rooms, and/or workshops in the garage. Now increasing num-bers of women are getting into the act as they realize they, too, need a space devoid of toys, noise and the rest of the family’s stuff. They need a space to just be themselves, to read, to cre-ate, to listen to their own music, to write or to just escape life’s stresses, DeLaCruz says.

“It is happening much more these days for women to carve out a space for themselves. I see it a lot as an interior designer but also as a woman and friend,” she says. “Everything is about making it as comfortable and nice as possible. We need that place to say ‘ahh.’ This is the time that no one is asking me for anything, and this is my haven.”

finding the SPaCe

A mom cave can be anything you dream of, says Jacquelyn Aronson Falk. When her ex-husband moved out 12 years ago,

JuSt a SPare Bedroom? Not anymore. Photo by Valerie DeLaCruz.

making a mom cave for comfort, crafts or quietby lee nelson

placeholder

HANNAFORD PLAZAWOLF RD.ALBANY • 446.0250www.oreckstore.com/albany

Oreck upright vacuums start at about 9pounds so you can easily take them allover the house. But they also generate102 mph airflow, giving you the poweryou need to clean up whatever you findwhen you get there. And they’re backedby our reputation for dependability andour Oreck Clean Home Centers, so you’llbe saying...

she decided to turn the formal dining room into a home office and respite from the world.

“Women are givers. We always put everyone first. We share every room of the house,” says Falk, the owner of Jacquelyn Arson Design in Latham.

She suggests women start by looking at their home through the eyes of someone just stepping inside. Walk around and take notice of every closet, empty corner and room. Pay at-tention to the focus of each space and how it is used each week. Find a space that you want to spend time in such as by a window or fireplace.

“A basement or garage can be seasonal for certain hobbies, but you want to find a space you will be comfortable in year-round,” Falk says. “So many houses have guest rooms, formal living rooms or dining rooms that never get used. You need a quiet spot that is relaxing. When we relax, we are more pro-ductive. It’s not being selfish.”

As you tour your home, look at how the sun warms an area during a certain part of the day or how the traffic flows past a communal area when everyone is home. Ask yourself if you could really escape from the stress and the family once you pick a spot.

“If an area is a common area such as the family room, is it possible to put up a screen or bookshelves around your own space or even camouflage it with a big plant or other barrier to give you that enclosed feeling?” Falk says.

You can also create a faux canopy that comes from the ceil-ing with a drapery rod and a beautiful swag of material, DeLa-Cruz adds. “You can even put up beaded curtains or fringe from the ’70s. When the curtain is down, it is a sign for others to keep out,” she says.

making the SPaCe your own

When Falk transformed her dining room into her home of-fice, it was already a beautiful room. She used the elaborate glass-top dining table as her desk. She added a comfy chair, leopard-print storage boxes for her files, and silver accessories to hold pens and paper.

“The room was close to everything, but we never used it,” she says, “so I just began making it a special spot for me with all the things I loved.”

She tells her clients to do a little at a time. She suggests looking through magazines for inspiration. Once you are in the space, personalize it. Paint is an easy and inexpensive way to set a mood.

Make the space personal with dishes, photos and other me-mentos that remind you of the things you love. For storage, try wicker baskets, antique jars or wooden boxes. Then warm it up with candles and a vase of fresh flowers, Falk says. If read-ing is an activity for your mom cave, find that perfect chair that lets you sink in and relax.


personal space

50 life@home

“Lighting is the real key,” DeLa-Cruz says. “Stick with lamp light-ing because overhead lighting gets harsh and doesn’t give you a cozy feeling.” Scented candles can also exude a nice ambient light or just a fresh scent even when it isn’t light-ed, she adds.

Stephen Deitcher, owner of Dei-tcher’s Design Center in Cohoes, says the critical guiding design should be entirely up to you — and no one else. “It’s a very personal choice of color, style, fixtures and function. Personal space is very important, no matter how small or elaborate,” he says. “It’s just a matter of encouraging our clients to bring out their own decorating abilities. You can even make a clos-et become a great place for what-ever your needs are.”

finding the goodS

The right furniture and accesso-ries can truly turn a mom cave into something personal and inviting. “You can start with one chair in the color and fabric you love. That differentiates it from the other spaces,” Deitcher says. “If you are an apartment dweller, you may not have the luxury of having too much extra space. A chair or an area that can be separated from the rest of the room can truly make a differ-ence in someone’s life.”

Falk loves going to places such as Michael’s Crafts or A.C. Moore stores. Craft stores have great deals on tables, pictures and unique storage containers made of glass, wood and stainless steel. The idea that you can’t find anything so-phisticated in discount stores such as Target and T.J. Maxx, she says, is wrong. “That’s just not true. I have found Ralph Lauren furniture in a Home Goods store,” she says.

Flea markets, Goodwill and con-signment shops, garage and estate sales, as well as online dis-count websites such as Overstock.com are also perfect places to discover great deals to add depth and character to a mom cave with mirrors, tables, lamps, clocks, electronic equipment such as DVD players and televisions, bookshelves, curtains and more.

“The woman’s position in the household has evolved,” Deitch-er says. “They have so many roles and demands on their time. Having some little space for themselves is good. But it’s very important that they actually capture those moments of peace and relaxation. Once they have their mom cave, they need to use it, even (if) for only a few minutes a day. @


dining room to offiCe transformation. Photos by Jacquelyn Aronson Falk.

EnergySavingPackage

ner®

Packageg

4energysavingsolutions for

$71.00amonthafter realized energy savings.

4energysavingsolutions for

$71.00amonthafter realized energy savings.

1.2.3.4.StartSavingToday!

1. Comfort ENERGY STAR® Windows – Eliminate draftsand reduce heat loss/gain2. Attic Insulation – A blanket for your home

3. Attic Air Sealing – Eliminates the cracks and crevassesthat allow air penetration4. FREE Smart Thermostat – Detects your living patternsand adjusts your heating and cooling system accordingly

StartSavingToday!

DOORS • SIDING • SUNROOMSINSULATION • BASEMENT REMODELING

DOORS • SIDING • SUNROOMSINSULATION • BASEMENT REMODELING

Call... (518)-783-3171Click... www.comfortwindows.comor Stop by! 898 Troy Schenectady Rd., Albnay

Call... (518)-783-3171Click... www.comfortwindows.comor Stop by! 898 Troy Schenectady Rd., Albany

Reduce yourenergy consumption

by up to 53%!

Reduce yourenergy consumption

by up to 53%!

comfortwindows.com/saveenergycomfortwindows.com/saveenergyTo learn more go to:To learn more go to:

Restrictions may apply see Comfort for details.

52 life@home

household tips

Coming up: Baking Soda, vinegar Got an interesting use for any of the above? E-mail your tip to [email protected] along with your first name and town. And find life@home on Facebook; your comments and tips may appear in an upcoming issue!

by melissa fiorenza

Vodka10 ways to use...

Pho

to: ©

iSto

ckp

hoto

.co

m/n

ight

_cat

.

in ruSSia, the home of vodka, the first

uses were medicinal. In Poland, vodka was

sometimes scented and used as an aftershave.

no, not in cocktails! With a little help from our spirited Facebook friends (do you follow life@home? facebook.com/lifeathomemagazine), a cookbook author, fashion site and other resources, we developed this think-outside-the-glass list of ways to put your Grey Goose to good use. Salut!

1. use it in baked goods“I put it in pie crust, in place of some of the ice water,” says Beth Lipton, author of You Made That Dessert?: Create Fabulous Treats, Even If You Can Barely Boil Water (Globe Pequot, 2009). How come? The vodka makes it easier to roll, she explains. “Then when you bake it, the alcohol burns off, so you’re left with a nice, flaky crust.” It works for sweet pies and quiches, too, she adds.

2. help blooms last longerAdd some drops of vodka to the water in your flower vase, plus a teaspoon of sugar, every couple of days to help minimize bacteria growth.

3. make your duds smell freshSpritz clothes with a little bit of the hard stuff, then let ’em hang to dry. Odors be gone — and nope, the vodka doesn’t leave its own aroma behind!

4. nix stains“Works pretty well as a stain remover in a pinch,” says Kate on Facebook.

5. get rid of sticky stuffStylist.com has just the solution for removing price tags, stickers and

other gooey stuff that you can’t get off, say, your new dishes: Saturate a sponge with vodka, press it on the sticker for about 60 seconds, then watch it come right off.

6. See clearerWear glasses? “I have used vodka or gin as an eyeglass lens cleaner,” contributes Sarah on Facebook. (We tested on our specs: clear as day!)

7. give chrome some shineLeave it to ThisOldHouse.com to relay this nifty housekeeping tip: Vodka helps take off soap scum and water spots from your fixtures. Soak a soft cloth, wipe the chrome and that’s all there is to it.

8. whip up a boozy biteHosting a get together? Here’s a twist for your candy bowl from Mary (Facebook): “Soak gummy candies in it ... yummy little treats.”

9. kill a cold soreDab vodka on your cold sore with a Q-tip to get it to dry out faster.

10. treat stings aSaPHappen to live near a jellyfish-laden beach? If you’re struck with a sting, vodka is the key to alleviation. Same goes for poison ivy, according to TheDailyGreen.com. @

sponsored by

GOING UP?Every businesswoman needs a great elevator speech.

Get your business message in front of the people who can makea difference at the next Women@Work Connect event!

*Upon arrival attendees will be asked if they would like to give their elevatorspeech. Fifteen participants will be randomly drawn from those attendees.

SEPTEMBER 185:30-7PM

Give your elevator speech for our panel of judges andwin! Top three speeches win prizes.Michelle M. Annese, Owner, Annese & Associates, Inc.Ann Hughes, News Anchor, Fox 23Theresa Marangas, Attorney, Wilson Elser Moskowitz Edelman & Dicker LLP

Don’t miss your chance to CONNECT!

Register by September 13 at:womenconnect.eventbrite.com

Questions? Call 518-454-5583

at theHilton Garden Inn

Clifton Park

FREEEVENT!

54 life@home

artisan

by laurie lynn fischer | photos by krishna hill

tree Picturescustom-furniture-maker greg pattison tells his tale following a wood’s grain

Scandinavian-trained furniture craftsman Greg Pat-tison runs his hand along the spare contours of one of his originals. “I love what they call it in Norway,”

the 56-year-old says. “They call the grain of the wood ‘the tree picture.’”

Over the past 35 years, Pattison has fashioned every-thing from boats to spiral stairways. He’s left his mark all over Troy, from the fortress-like reception counter in Architecture Plus to a carving of the Cedars of Lebanon above the altar of St. Anne Maronite Church.

Pattison specializes in modern furniture, such as chairs, blanket chests and display cases. Everything is made to order for architects and residential customers.

“I’ve never committed myself to any one particular de-sign genre, so I’m kind of free to float,” Pattison says. “Scandinavian, Shaker, Biedermeier — all have been influ-ences on me.”

Once a tavern and brothel, his historic 19th-century house on Pinewoods Avenue in Troy is loaded with his handiwork.

placeholder

Many of these creations juxtapose light and dark woods, such as quilted birch, walnut, cherry and mahogany.

Pattison gravitates toward “domestic exotics” like bird’s eye and tiger maple, apple -- which is “like cherry, but creamier” -- and mulberry, which is a “French’s Mus-tard yellow.”

Sawdust spices the air in Pattison’s backyard workshop. An oversized wooden vice from the 1700s clings like a

pileated woodpecker to the edge of a homemade work-bench. The cabinet that holds his hand tools was the first piece of furniture he ever built.

“I’ve got probably 100 hand planes for moldings,” he says. “I’ve collected this stuff over a lifetime.”

African mahogany and figured maple boards huddle in a corner, awaiting their turn in the joiner, planer, table saw, band saw, radial arm saw and sander. But Pattison doesn’t really need power equipment.


56 life@home

artisan

“People walk into my shop and assume it’s the machinery that makes you a woodworker,” the artisan says. “With a couple of hand planes and a few hand saws, I can make anything the machines can. I could be the desert island guy. It’s really know-ing how to use the tools.”

Occasionally, Pattison even mills his own wood, turning logs into planks. “It’s for fun and not profit,” he says. “It really is a back-breaking labor of love.”

When Pattison was a boy, his grandfather taught him to ma-nipulate wood. “My grandparents are really my art connection in my family,” he says. “The two of them made me feel like I wasn’t a freak for not being a lawyer.”

He comes from a long line of politicians, including the late

Senator Ned Pattison and former Troy mayor Mark Pattison. When the woodworker began his undergraduate degree a year early at the Philadelphia College of Art, he thought he’d be-come a painter, but once he took a furniture course, he discov-ered his true calling.

“It was a no-brainer,” he says. “I didn’t even have to think about it. I got a big start on life by majoring in furniture design. I had tremendous teachers.”

Pattison got a firsthand sense of Scandinavian design during his junior year abroad in Norway. “It was a fantastic year for me,” he says. “I became fluent in Norwegian. I really wanted to

“With a couple of hand planes and a few hand saws, I can make anything the machines can.”



study Scandinavian design. After I got there, I understood that it’s not just a design; it’s a lifestyle. I met my furniture guru in Copenhagen. Hans Wegener is probably my biggest furniture-design influence.”

Pattison graduated in 1976, and within a few years, the as-piring young artisan was commissioned to make doors for the New York State Capitol. He eventually moved his shop from a Lansingburgh storefront to a carriage house behind the Victo-rianized Federal-style house he and his wife, graphic and inte-rior designer Kristina Almquist, renovated in Lansingburgh. The couple, who’ve been married for 34 years, met in art school and raised two daughters.

”We’ve been very lucky that we were able to make lives for ourselves with our own hands,” he says.

The pair freelanced for two decades before Pattison returned to academia. In 1994, he obtained a masters degree in sculp-ture from SUNY Albany, amassing enough education credits to teach public school.

“It may not be with paint brushes or chisels, but curriculum development is a highly creative thing,” says Pattison, who has taught shop for the past 17 years in Guilderland, East Greenbush, South Colonie, Schalmont and Martha’s Vineyard, Massachusetts.

Pattison finds it particularly gratifying to mentor struggling middle-school students. Other teachers are sometimes amazed at how academically challenged students blossom in his hands-on classroom.

“I’m a wee bit of a crusader,” he says. “I want to pull kids back from the brink. I know I can make a difference in kids’ lives at that age.”

Pattison helped found the Maritime Academy in Alphaus, a boat-building program that offers an alternative to youngsters who aren’t thriving in traditional educational settings. Of 21 vessels the boatwright has constructed, his favorites are repli-cas of historic bateaux that were involved in local battles dur-ing the Revolutionary and French and Indian Wars. They’re still used by reenactors at the Mabey Farm Historic Site in Rotter-dam Junction.

“When you put a wooden boat in the water that you’ve built with your hands, it’s probably the beginning of an addiction,” says Pattison.

What he considers to be his finest design is also his smallest. Inspired by a melted store-bought kitchen utensil, it’s a nifty red cedar stirrer that pops into the dishwasher. He’s turned out thousands over the years.

No matter what you’re making, wood teaches patience, says Pattison. “I totally love the process,” he says. “When you finally reach the end and smell that oil when you’re putting the finish on, you reach a point on a project where all of a sudden, ‘Honey I’m not coming in for dinner.’” @

To view a slideshow of Greg Pattison’s furniture, visit Kristina Almquist’s design website at aadesigninteriors-ny.com. To arrange a consultation, call (518) 441-8161 or e-mail [email protected].


A JOBFORPROFESSIONALSTree removal can be a dangerous job when you don’thave the necessary skills and experience.

We’ve been providing acomplete line of professionaltree care services for over30 years so you can counton us to do the job right.

The Area’s BestFirewood

Great Prices

Don’t ask why we’re so low - Ask why they’re so high

ALBANY 518.489.1196

10% OFFANY

SERVICE

With this coupon. Expires 7/31/12.Must present coupon at time of

estimate. Does not include firewood.

Don’t ask why we’re so low - Ask why they’re so high

• TREE REMOVAL• TREE TRIMMING• BARK MULCH• FULLY INSURED• FREE ESTIMATES

SAME DAY SERVICE ANDEMERGENCY SERVICE

AVAILABLE

30+Years of

Experience

60 life@home

living green

by cari scribner

happy trails!

staying at “green” hotels can help your wallet and the environment

Pho

tos:

© iS

tock

pho

to.c

om

. Ho

tel,

© M

att

Kun

z; S

uitc

ase,

© C

arri

e B

ott

om

ley.

Summer is winding down and school days are upon us. But that doesn’t mean family travel will remain a distant mem-ory. Before you know it, the holidays will be upon us and

with them, the potential for longer-term travel. Along with asking about rates and how many of your children you can pile into one room, here’s another inquiry to make: “How green is your hotel?”

Earth-friendly initiatives are becoming increasingly de rigueur at various hotels, starting with asking guests to reuse their tow-els rather than toss them on the floor to be washed after the first night. A home away from home, we expect hotel rooms to be clean and well-maintained, and have amenities such as air conditioners, towels, water glasses, soap and shampoo. Just as there are many practices in our houses we can use to use less water, save energy and reduce waste, hotels can do the same, with your help.

The Green Hotels Association, based in Houston, Texas, was formed in 1993 to encourage, support and promote ecological consciousness in the hospitality industry. To date, the associa-tion has more than 200 members across the U.S., representing more than 18,500 guest rooms. Members pay dues to receive continuous updates and vendor lists for eco-friendly products and to be listed in marketing campaigns. However, anyone can contact the association with questions or for advice.

The family-owned and -operated Golden Arrow Lakeside Resort in Lake Placid has been an association member since 2005, when the Holderied family made a commitment to go-ing green.

“We’ve always been environmentally conscious, and eco-nomically, it makes sense to save money and energy wherever possible,” General Manager Jennifer Holderied says. “Any cost savings we can pass down to guests by offering better rates.”

In 2007, the family launched a recycling program in all of the 166 rooms. While 85 percent of guests sorted out their recyclables from their trash cans, Holderied looked for bins that wouldn’t take up too much space in guest rooms. Finally, she settled on paper bags that are now in every room to col-lect recyclables.

Another challenge was finding alternatives to tossing out the barely-used little bottles of shampoo and lotion. Holderied surveyed guests about installing shampoo and soap dispens-ers in the showers, which received a resounding thumbs-down. Instead, Holderied found a company that made toiletry items wrapped in recyclable paper, resulting in a 93 percent reduc-tion in waste from those products.

Switching to compact fluorescent light (CFL) bulbs could be costly, given the fact that every Golden Arrow guest room has


15 to 20 bulbs. But the family lucked out when a Boy Scout came to their lobby selling the bulbs for $1 each. They began replacing standard light bulbs as they blew out, and continue to buy a few hundred CFL bulbs a year from the very happy Boy Scouts.

Perhaps the most striking earth-friendly initiative at the Gold-en Arrow is the rooftop garden, formerly a black tar roof. Today, it’s home to a 3,000-square-foot garden of low-maintenance native plants and also chives happily harvested by their resort chef. “I can crawl out my office window and do some garden-ing,” Holderied says. “It’s also a very visible way to show our commitment to going green.”

Owners of The Desmond Hotel & Conference Center in Al-bany are also switching to more energy-efficient equipment, such as the new hot water system recently installed, replacing a 1974 version. Tyler Desmond, director of engineering, says a top priority is making the heating and cooling systems more energy-efficient for the 323 guestrooms and 22 meet-ing rooms at The Desmond.

“We now have rooftop heating and air-conditioning units that can be con-trolled room by room,” Desmond says. “When one room is empty, the heat or air-conditioning goes automatically on standby.”

The organization is also mak-ing the switch to LED lighting in guest bathrooms and confer-ence rooms, but hasn’t yet found what is needed to upgrade light fixtures in the three Desmond ball-rooms. “No one makes LED replacement lights for chandeliers, but when they do,

we’ll use them,” Desmond says. “We’re constantly on the look-out for ways to save energy.”

Many inns and bed and breakfasts also offer greener op-tions. At the Westchester House Bed & Breakfast in Sara-

toga Springs, owners Bob and Stephanie Melvin are members of the Green Hotels Association, and involve their guests in their efforts.

“We ask guests to turn off lights when they leave a room, use towels and sheets more than once, and turn down the air-con-ditioning,” Stephanie Melvin says. “People are generally agree-able, and the only item they want laundered is a wet bathmat.”

All rooms at Westchester House have ceiling fans and dou-ble hung windows with the air-conditioners placed on top.

“We encourage guests to open the bot-tom windows and let in fresh air to cool the room,” Stephanie Melvin says. “Our dining and sitting rooms don’t have air conditioning at all. We have an older building that stays cool on its own.”

The couple also puts washable water glasses, not disposable cups, in guest rooms, and asks guests to sort their bottles, cans and recyclables.

If the hotel of your choosing has incorporated smart green

practices, reward them with your repeat business. If they haven’t, speak up! And, of course, you can al-

ways add a few of the prac-tices you encounter in your

travels in your own home when you return. @

Some eco-friendly hotel optionsAccording to the Green Hotels Association, the ideal guestroom in every hotel would follow these guidelines:

No smoking.•Low-flow showerhead and faucets.•Recycling basket next to trash can.•Dispensers for all-natural, •biodegradable soap and shampoo.

Organic cotton or bamboo •bed and bath linens.Energy-management system.•Energy Star TV and appliances. •Fresh smell (not the smell of •cleaning products), which hopefully means non-toxic cleaning products.HVAC filters changed as needed.•Houseplants to help clean indoor air.•Linen program asking guests to •consider reusing towels and not having sheets changed daily. A

Green Hotels Assn. survey found 70 percent of guests are amenable to reusing sheets and bath towels.Alternatives to bleach and •ammonia products for laundry use.Recycled bathroom •paper products.Signs in bathrooms asking •guests to take barely-used bar soaps wrapped in their original packaging home to use.Ceiling fan.•Newspaper on request only.•

Sterling silver charms from $25

CROSSGATES MALL • Albany • 518.452.9170

Trusted forGenerations.

Separately managed portfolios and mutual funds.

Established 1974 • Cobleskill, NY • 800-932-3271 • famfunds.com


refurnished living

by alison grieveson

in being greenHard to believe the summer is almost

over, but with the end of this carefree, sweaty-fun season comes the ritual of back-to-school shopping (and the hilarious Staples back-to-school commercial). Don’t forget to add these eco-friendly items to your list.

Ecogear went all out when they designed this backpack ($29.99, ecogear.com) … It almost makes me want to go back to school. Almost. Here are just a few of the bag’s features:

made from recycled PET bottles•

non-toxic dyes & materials•

moisture-wicking mesh back•

MP3-player pouch•

One of the greenest water bottles around, the Klean Kanteen from Nau is made from stainless steel, food-grade silicone and sustainably harvested bamboo. $38, nau.com.

The Bento Boxed Lunch set helps you pack healthy, both for you and the planet. It’s made of recycled material and is fully recyclable. $10 -$21.99, laptoplunches.com.

The standard backpack just got a lot cuter thanks to Peace Frogs. Made from recycled PET fabric and available in a variety of fun patterns. $29.95, peacefrogs.com.

The B2P ball-point pen from Pilot is made of recycled plastic water bottles. The retractable, refillable pen is available at major office stores. $10 for a pack of 12.

Next time you order out, ask them to hold the plasticware. I found my set at Old Navy ($5), but check sistemaplastics.com for other retailers. @

Alison Grieveson is a graphic designer who enjoys exploring the “greener” side of the design and decorating industries.

for more green tips, check out www.refurnishedliving.com.

64 life@home

down the garden path

story and photos by colleen plimpton

Going to Hell (Strips)what to do with tricky curbside spots?

They go by various intriguing names: inferno band, verge, curbside landscape, tree lawn, devil belt. But most folks just call them hell strips.

They’re those traffic islands, parking-lot peninsulas, mailbox gar-dens and slivers of land along driveways or between the lawn and sidewalk. They’re chock full of compacted, infertile soil; they’re dry as dust from reflected heat, and often they are littered with trash, dog leavings, and salt from winter snowmelt. Frequently they’re not more than two feet wide, but can run the length of the front yard.

So why on earth would anyone want to plant in them? Be-cause they’re a challenge. Many gardeners seek to beautify not only their own yard but public spaces as well. Hell strips are sites that call out for the softening effects of long-lasting color and textural interest alongside careworn gray pavement.

But how do we turn a sow’s ear into a silk purse? Let’s start with the basics.

ConSider eaSementS

Most homeowners don’t actually own the hell strip in front of their houses, so be prepared to ask your local city hall if you

can dig it up and trick it out. Generally the answer is yes, but you’ll often be told that it’ll be your responsibility if plantings get salted, snowplowed or otherwise destroyed. Know also that the municipality has the right to dig the plot up at any time for any reason, such as laying cable or fixing drainage.

PrePare the Bed

Once you’ve received municipal permission to dig, be sure to call 811 to see if any buried wires are in the ground. Then you can start excavating the exhausted, bone-dry dirt.

Remove the sod, if any. Amend the soil with copious amounts of organic material to hold whatever moisture nature provides. Haul out the major rocks and other debris. Work around tree roots and then smooth the area. The top of the finished bed should be several inches below the curb and street level to allow for sheeting rainfall. Skip the bark mulch, as it will probably wash away. Consider gravel mulch instead; once corralled by edging it will behave. Do choose appropriately-sized stones; large chunky rocks will look out of place in a small space.

Changing the Quality of Your LifeWater Garden Design & Installation

Complete Landscape Design & InstallationPondless Waterfalls • Seasonal Pond Maintenance

Visit ourPond Shop:

AutumnPond Supplies

Premium Koi FishAquatic Plants

Come and stroll our 14 on-site water features...where the fish are as friendly as our pond experts.

www.ThePondPeople.net1632 Main Street, Rt 5s, Pattersonville (Rotterdam Area)

Only 20 minutes from Albany

518-887-5552

Plant the Bed

Assess light conditions and choose material accordingly. Bear in mind the height of the plantings; sightlines must re-main open so avoid plants over three feet tall. You don’t want to mow, so don’t plant grass; and you don’t want thirsty, dain-ty plants that require a lot of water or care.

Think prairie, xeriscaping, Mediterranean, and native plants. In terms of design, the secret to making a desolate patch of ground look more like a border is to use a variety of forms, textures and colors, which will visually widen the space. To minimize labor in an inhospitable area, employ hardy peren-nials and grasses.

A few rules apply: Stay away from plants to which passers-by may be allergic, such as juniper, chrysanthemum and cham-omile. Beware “messy” plants that drop fruit or flowers. And choose drought-tolerant material to save you watering chores.

Small grasses work well, such as pennisetum Hameln or Little Bunny. Consider spiky fescue, Elijah Blue and carex. None of these will encroach on the street or sidewalk. Neither will liriope, which will withstand much abuse, and comes in a variegated as well as the standard green form. In general, plants with bulbs, rhizomes, taproots, and other water-storing mechanisms are excellent choices. Daylilies, with their stocky, moisture-retaining roots, do well in unfriendly terrain, as do chives, perovskia, sal-via, nepeta, rudbeckia, asclepias, hosta and yucca. Ground cov-ers include creeping thyme, cerastium and hens & chicks.

Invest watering time the first year, to get the things off to the best start. Most of these plants will be able to withstand drought after their first year. For annual color think about marigolds, wax begonias, and alyssum, which assist in achiev-ing season-long color.

aCCeSSorize

Ornamentation is important, but don’t incorporate valuable items into your plan; remember this is a communal space. In-stead choose flea-market findings and garden hand-me-downs. If you use rocks, go large so they can’t be tossed. Oh, and con-sider a pathway so passers-by can admire your work up close.

keeP uP the maintenanCe

This very public garden is no place to slack off on weeding or deadheading. Your chores will also include tidying up if dis-carded coffee cups or other unmentionables land in your plot. Remove fallen leaves and twigs. Carefully scoop out any layer of sand or gravel that may roost in the bed after winter. Come late fall or early spring, cut back perennials to stubs to allow for healthy new growth. @

For more information, visit High Country Gardens at highcountrygardens.com.

Garden communicator Colleen Plimpton answers questions at [email protected]. Visit her website at colleenplimpton.com.

66 life@home

design classics

Bowled Over the gedy cucciolo toilet brush

Now a toilet brush is just the kind of thing that cries out for good design. It needs all the help it can get!

Luckily for us the Cucciolo Toilet Brush, designed by Makio Hasuike for Gedy in 1974, is still in production today. I actually owned one of these for years before I knew it was an important toilet brush, having been awarded the Compasso d’Oro Prize for design in 1979 and put on display in the design collection of the Museum of Modern Art.

First a few reflections on toilets. Quite when they were invented and by whom is an open question, though a toilet was discovered in the tomb of a Chi-nese king of the Han Dynasty, which dates back to 206 BC. The Romans built flushing toilets of a kind — basi-cally holes that opened onto sewers. Queen Elizabeth had a flush toilet invented for her in 1596 by her god-son, Sir John Harrington. But gener-ally speaking, flushing toilets were not in use for most people until 1840 or so. Before that was the bucket, chamber pot or outhouse.

And once you get flushing toilets, you have to keep them clean, don’t you? And the toilet brush came along quite quickly, as you can imagine. The trick has always been that you have to have it close at hand or it isn’t of any value, but you don’t want it to take up too much attention. A good toi-let brush should be effective, but otherwise it should disappear.

That’s exactly what Hasuike figured out with elegance of his design. Born in Japan, he moved to Italy in the 1960s and has

designed just about everything — furniture, lightings, clothes, and appliances. He designed the clocks and timers for the 1964 Olympic games in Tokyo. In 1982 he formed the highly success-ful Milan accessories brand MH Way. He’s just one of those guys who has it all — talent, energy, ambition and he’s practical. In

his youth, he wanted to be an artist but said that “later, reading and seeing films about artists which all died

poor … I started to doubt — why should I opt for such a tragic life?” So, a smart guy.

The Cucciolo Toilet Brush is principally informed by the awareness that our bath-rooms are not entirely private but are of-ten used by guests, and thus need to be attractive and clean-feeling. This brush has a sculptural simplicity and comes in a range of colors — avocado, pink, white, black.

The idea began with the concept of the shape of a simple dish. The lower portion

that holds the brush itself and collects the water drops is curved and easy to clean.

When the brush is in its place, the rubber bris-tles are entirely out of sight, and the brush fits

beautifully into the curve of the base, with the top of the brush covering the collection cavity entirely, so

there is nothing unsightly, and the overall shape means it is stable, not likely to be knocked over.

“I don’t like anything that is exaggerated,” Hasuike has said. “My design should be part of nature, nonviolent, no disharmony, sometimes invisible.” With this beautiful domestic item, such harmony and invisibility has been achieved, and cheaply, too. You can buy one of these almost anyplace, but thebathoutlet.com is a good place to go. They cost $35. @

by kim messenger | photos courtesy the bath outlet


BuShelS of BerrieS to celebrate the new school year. Read the story on page 81. Photo by Paul Barrett.

family | food | winepages 67 - 86

1540 Central Ave, 1st FloorSuite 2, Albany, NY 12205

(518) 869-1544www.advancedhearingaidcenters.com

SET IT &FORGET IT!

• Featuring Vivid Speech - designed for sound clarityeven in noisy settings

•Made to fit easily and comfortably

•Able to receive stereo sound direct from your TV!

• NO Neckstraps, NO Wires, NO Kidding!

Wireless Hearing Aids

We accept NYS Empire coverage, CDPHP & MVPSenior insurance. Financing options available.

Call (518) 869-1544 today for yourCOMPLIMENTARY HEARING TEST!*

*Unless administered by an Audiologist or Physician, this test is for the sole purpose of amplification only, it is not a medical test.

Receiver In Canal(RIC)

Invisible In Canal(IIC)

02799-12

©2012

NuEar

Over 100 Years of Gracious Hospital i ty®

THE OTESAGA RESORT HOTEL, 60 LAKE STREET, COOPERSTOWN NY 13326OTESAGA.COM

Enjoy delicious holiday dining plus many other memorable moments atThe Otesaga. Your Labor Day Family Weekend includes a traditionalguest room, breakfast & dinner for each guest with each night’s stay,Manager’s cocktail reception Friday evening, “Coco the Clown” for thekids, movies, an historic tour of The Otesaga, live music & dancingnightly, and other family activities.

For more information or tomake reservations, please call(800) 348-6222, (607) 544-2502or email [email protected].

GATHER YOUR FAMILY FOR A VERY SPECIAL

LABOR DAY WEEKENDCELEBRATION

Friday, August 31st through Monday, September 3rd


house blend

by merci miglino

All Washed Up

Pho

to: ©

iSto

ckp

hoto

.co

m/p

hoto

and

vid

eost

ock

.co

m.

I hate emptying the dishwasher. I hate it more than cleaning the bathrooms, washing windows or folding sheets.

I hate the water that collects on glasses and bowls and dribbles all over the floor, or flies across the room on their way to the proper cabinet soaking me in the process. I hate that there is always one item that refuses to bend to the sudsy will of the whirling brushes and never comes clean no matter how many times you throw it back to the washer wolves. Think to-mato sauce on a Tupperware bowl or yogurt and granola on a ceramic dish.

I hate that the task is so unrelenting. In the words of a friend’s mother, “I can’t believe I have to do this again.”

I know. I can hear you all from here. “In the time it takes to complain about this chore, you could have emptied three dish-washers.” My mother’s exact words, which still ring in my ears.

So what’s behind my hatred? I don’t know. I have many theories but can’t seem to find one that solves the mystery and, in doing so, offers up some wise words about home, lifestyle and the pur-suit of happiness, which, after all, is the point of this column.

My curiosity leads me to Google. On a lark, I type in I HATE EMPTYING THE DISHWASHER. It gets 571,000 hits including two Facebook pages and a third fan page called “I don’t want to empty the dishwasher so I’ll just turn it back on.” Yep. I have done that. So I “like” all three pages and start clicking through the other 570,997 links.

Next I find a book titled I Hate Everything By Matthew DiBene-detti. Emptying the dishwasher makes the author’s random list along with going bald, taking down Christmas-tree lights, and suf-fering that initial watery goo that squirts from the mustard bottle.

Here’s his manifesto on emptying the dishwasher:I hate emptying the dishwasher. I hate that I have a dishwasher, but still put dirty dishes in the sink. I hate when I’ve been told I filled the dishwasher wrong. I couldn’t have said it better. But still, no real insight into the

cause of my deep-rooted hatred. I continue Googling.

My next few hits offer suggestions on making the task less tedious, boring or stressful. One blogger suggests dump-

ing the clean silverware onto a kitchen towel, laid out near the silverware drawer, making it faster to gather up the clean knives, spoons and forks from the towel rather than the dishwasher basket. It doesn’t sound any easier to me. And it wasn’t.

Another helpful soul suggests working out while emptying the dishwasher. Carolyn Barnes of CleanMamma.com says she turned this dastardly task into a joy by toning everything from her arms to her butt. Here’s one of her toning tips:

Put one hand on the countertop for support and use the oth-er hand to remove your dishes. As you take the cups and mugs out, instead of putting them away and coming back to the dish-washer, take them all out and put them on the countertop. By staying in place near your dishwasher, you can work your legs while your hands are doing the unloading.

Sorry, Carolyn, but this will never work for me. This drags out the dishwasher horror even further and I hate working out just as much as I hate emptying the dishwasher. Combining the two sounds like a day in prison.

But Carolyn is on the right track. It seems, as is often the case, it doesn’t really matter why you hate something but rather how and what you can do about it. Otherwise your hatred of the chore, project or person brings you way down. Oh, maybe not now, but soon and for the rest of your life.

And so I abandoned my search for the cause of my dishwash-er-dumping hatred, and came to this wisdom from my search.

My advice? Make everything a game. But make it a game you like, one that you can win — every time. It should play to your natural strengths. First, of course, you have to identify your strengths, which can be a challenge. Many of us know our weaknesses, but to boldly embrace and articulate our gifts and natural talent, we get caught up in judgment, riddled with coulds, shoulds, and other people’s opinions of us.

Let all that stuff fall away. Concentrate on what you do well, what you like to do and how you can use these traits in a re-sourceful and creative way. I’ll give you an example. I am a natural-born cutter of corners. It’s sort of the positive side of laziness. Admittedly, this involves a gift for manipulating situa-tions. When it comes to the dreaded full dishwasher, I leverage this inherent ability to size up the most efficient and effective way to complete a tedious task (cut corners). Or get my hus-band to do it (manipulation).

In short, if I can find an easier, softer, faster way to do some-thing, I will. That’s my game. I have a knack for optimizing my actions. The more I hate a task, the more motivated I am to do it as quickly as possible, reducing the time I am in discomfort, so to speak. I have applied this to all the chores of life — from painting the bathroom to weeding — and from brushing my teeth to childbirth. It’s taken some practice, but today I can empty my dishwasher in less than 60 seconds.

While I still hate emptying the dishwasher, I have found a way to tolerate it. I’ll let you know when I find a way to embrace the task so much that I love it. Until then I am working on what I can do about changing the toilet paper roll, another task I abhor. All advice is welcome. @

70 life@home

chef@home

Family Style



by steve barnes | photos by suzanne kawola

chef art riley jr. has the life he wants

If it’s a Sunday afternoon during baseball season and the Yan-kees are playing, you can be confident of at least three things at the Riley home in Waterford: The game will be on the large

flat-screen TV in the kitchen-dining area, a crowd of people will be gathered for food and fellowship, and Grandma will be cheer-ing or dismayed, depending on what’s happening in the game.

“Yay! Yankees win!” shouts the 87-year-old matriarch, Virginia Riley, as she claps her hands after the Bronx Bombers escape a two-outs, full-count, bottom-of-the-ninth nail-biter with a home run. She’s sitting at a table loaded with, among other food, platters of raw oysters, a favorite treat of her son Art Riley Sr., who’s en-throned on the other side of the table and slurping back bivalves.

“Oysters are classic in our family,” says Art Jr., who’s the chef/proprietor at the family’s six-year-old Waterford eatery, McGreivey’s Restaurant. “For Father’s Day every year, 100 oys-ters is the easy gift for him,” he says. “There’s nothing I could buy him that would make him as happy as 100 oysters that I open for him.”

Virginia, baseball crisis averted, turns her attention back to the important matter of everyone getting enough food. “Mary Ann,” she calls to her daughter-in-law and Art Sr.’s wife.

“Yes, Mom?”“Come get yourself an oyster!”“I will in a minute,” says Mary Ann. “Don’t worry,” says Virginia. “I won’t eat them all.”“That’s good to know, Mom.”The open kitchen and casual dining area occupy one end of

the Rileys’ large home, which is set into a hillside and roams over 6,000 square feet on several levels. Art Sr. and Mary Ann built the home in 1993, but they’d had the plans for it for a dozen years before that, and the land is part of a former farm, now subdivided, that has been in the Riley family since 1939. Virginia lives a short way up the road.

In 1976, Art Sr. and his father bought the building that now hous-es McGreivey’s, and Art Sr. and his family lived there until building their home. Dating to 1840 or so, the historic building in the heart of the village of Waterford has been a few varieties of restaurant, a bowling alley and a hotel with a barroom boasting a then-high-tech feature of a running trough of water instead of spittoons.

More modern amenities grace the Riley home, including a Vi-king cooktop in the kitchen and a lower-level family room with ceilings and a chimney that soar to 23 feet. Some of the wood used throughout the home came from trees on the property.

“Didn’t save me any money,” says Art Sr., “but I liked the idea.”“We love our house,” says Mary Ann. “It’s our family space.

We’ll never leave. Some day I’m going to die here, and my ashes are going to be spread on the lawn.”

“Oysters are classic in our family. ... For Father’s Day every year, 100 oysters is the easy gift.”

72 life@home

chef@home

Art Jr. lived in the house for part of high school and returned five years ago, after a divorce. “Divorces suck,” harrumphs Art Sr. “Don’t ever get divorced.”

But a broken marriage led to a reunited, three-generation Ri-ley family: Art Jr. and his parents live in their house, and Art Jr. son’s, Mattingly, 14, is with them three and a half days a week, from Sunday through Wednesday morning.

“I love having my grandson here. It’s like having children again,” says Mary Ann. (Art Jr. is 41, and his sister, Karen, a pric-ing analyst who lives in Albany and competes in roller derby under the name Sin & Tonic, is 33.)

Mary Ann bakes desserts for McGreivey’s, hostesses at the res-taurant a few nights a week and works from home as a custom-er-service rep for an insurance company after a three-decade career in customer service for a phone company. Unlike his son, who has always worked in restaurants, and his wife, with more than 40 years’ experience dealing with people, Art Sr. prefers to be behind the scenes at the restaurant.

“I’m the bookkeeper, the maintenance man — anything but cooking and bartending. I’m not cut out for that,” he says.

Also present for today’s meal are Karen, a neighborhood cou-ple, Art Jr.’s girlfriend of two years, Jennifer Harney, and her daughters, Gianna Anderson, 15, and Cierra Daubney, who turns 9 this month.

As Art Jr. unveils a tray of grilled jalapeno peppers stuffed with cheese and wrapped with bacon, Gianna’s eyes follow her nose and she exclaims, “That sounds like heaven! Why am I not

eating it right now?”Cierra says, “If you could live on bacon, I think I would.”Says Gianna, “Who wouldn’t?”The girls and Mattingly have a gently teasing, sibling-like rap-

port. As the boy grills venison with his father, Cierra says, “I’ve never seen him not eat anything.”

Mattingly says, “Well, why not? It’s always worth trying new things. You never know what you’re going to like.”

Art Jr. grins. That’s his boy.Art Jr. understands that, in the abstract, a divorced 41-year-

old man living with his parents, sharing custody of his son and working in the family restaurant might seem to some like a fall-back existence. But for all of the Rileys the arrangement works, he says. They thrive on the togetherness, he loves running the restaurant, and they spend the first half of every week, when the restaurant is typically slower, with his son.

“This whole arrangement has given me an opportunity for a life I want to live, in a place I want to be, with people I want to be with,” he says. “If I were working for somebody else I don’t think any of this would be possible.”

“Honey,” says Virginia to her grandson as he puts down an-other tray of food, “aren’t you going to eat something?”

“Nana, I’ve been eating as I cook all afternoon,” Art Jr. says. “You know I like to feed people.”

“He’s very good at that,” says Virginia. “I take a little credit. He used to come home from culinary (school) and ask me to show him how to fry hush puppies.” @



Grilled Jalapeno Poppers Wrapped in Baconingredients

1 to 2 packages cream cheese, depending on •the size of your pepper, at room temperature2 to 4 tablespoons granulated garlic• • 1 /4 cup finely chopped sun- or oven-dried tomatoesChopped chives•Pinch salt•10 to 25 jalapeno peppers (larger than average •size will make them easier to stuff) • 1/2 to 1 pound thinly sliced baconToothpicks •

method

Preheat gas grill and oven broiler.

Mix each package of cream cheese with garlic, dried tomatoes, and a dash of chopped chive. Add a pinch of salt. Mix until mixture is soft and manageable.

Cut the jalapenos in half. Remove the seeds. Use something that will allow you to spread the filling onto the opening of the pepper with ease. Insert a liberal amount of filling into each jalapeno but do not overfill.

Wrap each pepper with 1/2 strip of bacon. Secure the bacon with a toothpick (best to soak the toothpicks first, to pre-vent burning on the grill).

Grill peppers skin side down, approximately 5 minutes, or until they are lightly roasted. Transfer to broiling platter and broil 5 min. until the bacon is fully cooked. Cool for 5 minutes and serve.

Marinated Grilled Vegetablesingredients

1 pound zucchini cut into • 1/2-inch diagonal slices1 pound yellow squash, cut into •1/2-inch diagonal slices3 red bell peppers, halved and seeded•3 portobello mushroom caps•3 to 4 shallots, peeled•Olive oil for brushing•Salt and pepper•

marinade

• 1/2 cup extra-virgin olive oil • 3/4 cup red or white vinegar2 anchovy fillets, minced•3 tablespoons minced garlic•1 tablespoon chopped mint•1 tablespoon chopped thyme•1 tablespoon chopped oregano •1 tablespoon chopped parsley•

method

Preheat grill. Lightly brush zucchini, yellow squash, portobello and peeled shallots with oil and grill for 5 to 10 minutes until brown and soft. Arrange on platter.

Place peppers on grill, skin-side down, and cook until peppers

are blackened and the skin is starting to blister, 8-10 minutes (peppers don’t need to be cooked on both sides). Remove peppers from grill, place in a bowl and cover with plastic wrap. Allow to cool. When cool enough to handle, remove skin and slice into 1/4 inch strips. Add to platter.

Season all vegetables with salt and pepper. Mix all marinade ingredients together. Pour evenly over the vegetables. Cover platter with plastic wrap and set aside at room temperature to marinate for several hours. Serve at room temperature.

Regal Rice and Asparagus, Mussels & Ale with Andouille and Smoky Green Chili Salsa: For these recipes and more photos, visit timesunion.com/lifeathome.

pearl grant richmansstuyvesant plaza ¤ albany ¤ 518.438.8409

kinzig design lamps

from our collection ofamerican handcrafts

Fall style, from head to toe.

Clifton Park CenterClifton Park518.371.2211

Route 30NAmsterdam518.843.4400

Shop online at alpinhaus.com.

“Affordable Fun” Can Be Yours With ALow Rate Home Loan!Whether you need a new car, want to put in a pool or add a deck,take a dream vacation this summer or pay off some credit card debt, wehave a low rate loan for you.

Our home loans offer some of the most competitive rates in the areaand flexible terms to fit your needs.

Cohoes • Corinth • Glens Falls • Hudson Falls • Troy518-654-9028 • 1-800-824-0700 • hrccu.org

Making Life Better

Call 518-654-9028, visit hrccu.org or stop by any of our fiveconvenient locations to check out our great rates!

Torrentes


the vineyard

story and photo by alistair highet

wine illuminations from madrid and scotland!

Wine moments. There are an infinite number of wines, grapes, regions, and styles out there and one’s explo-ration of the world of wine is a lifetime pursuit. Fine.

But wine moments are special — these are experiences that fill the soul. I once bottled white wine at a monastery, and I remem-ber that afternoon — the drowsy bees, sticky with wine, the sun coming through the windows of the barn, and that first glass poured into a Styrofoam cup. Magic.

There are so many others. Recently I did a little traveling to Spain, then up to Scotland, and then back to Spain, and I have three wine moments to share with you, each of them an illumination.

The first occurred during the flight from Glasgow to Madrid, which takes you lazily along the West coast of France, flat and quilted beneath you, until you see the Pyrenees in the distance and you glide over the clouds that hang above the mountains and, bang, you are in Spain. So we’re flying along and I look out the window and what do I see? The gleaming Atlantic and cut-ting into the heart of France a thick silver river. “Oh my God,” I said to my seat companion, “that is Bordeaux.”

And sure enough as we got closer, I could see where the twist-ing Gironde split and became two rivers, the Dordogne and the Garonne. The landmass in the middle was Entre-Deux-Mers. There, near the mouth of the Gironde, were Margaux and Saint Julien. Now, beneath the wing along the Dordogne were Pomerol and Saint-Emilion. It was thrilling to look down at the patch of ground and grasp why it is so magical for wine — the sea so close, moderating temperatures, the rivers doing the same, and how far south Bordeaux is, providing steady warm summers.

The second occurred at a Basque restaurant in Madrid called Orio (Fuencarral, 49_28004 Madrid Teléfono: +34 915218318, if you are interested). We popped in for tapas — a glass of white wine and white vinegary fish — and decided to stay for a proper lunch.

The view of the streets from upstairs was spectacular, as was the menu. Fresh cold oysters from France to start, then clams in a green sauce, roasted prawns, and then turbot cooked to buttery perfection in a sea of garlic and olive oil. The seafood in Spain is outrageous. More to the point, it makes you wonder why it is so hard for us to get fresh fish if they can have it in landlocked Madrid.

Anyway, the meal was accompanied by a bottle of ice cold Txako-lina. This is the white wine of the Basque country, grown on trestle vines in the rolling hills that overlook the Bay of Biscay. It is clean, acidic and almost salty, with a natural fizz and grapefruit and lemon notes. The perfect accompaniment to the rich, opulent fish, the wine cleaned the palate and danced happily with the fresh oysters.

Finally, the flight home, sad as it was, was improved by being bumped up to business class. The gods were smiling on me. This meant that I had a choice of wines to accompany my lunch and I chose a Torrentes, from Argentina. This is a wine to discover and explore. The grape is a cousin of Muscat, but its genealogy is a bit of a mystery and is not related to a Galician grape of the same name. Hints of apricots and peach, lime clarity, good acid balance, silky in the glass — a very classy wine and it certainly made hunkering down to watch Hangover ll for the second time more enjoyable.

I don’t think you can manufacture wine moments any more than you can manufacture falling in love. They happen when the stars align and there is a momentary freedom. But you can find Torrentes and Txakolina and try your luck. @

WINE TASTING

Loca Linda Torrentes, Argentina, 2011, $16.99 (one litre)I found this wine locally. Clean, bright, hints of peach, apricot, spring flowers on the nose. Crisply resolved in the glass, not remotely cloying. A really cheap and refreshing white wine for general use.

Getariako Ameztoi Txakolina, Spain, 2009, $21 White and even a bit green, what comes is the slight spritz, the jolt of grapefruit acidity, and the pleasant minerality. I would re-ally advise you to drink this with shellfish or fish that has some oily heaviness. I think that is where its unique complementarity really sings.

Stuyvesant Plazawww.evokestyle.com518.512.5240

It’s about boots.

Trade potholes, cracks, sunken areas, loose stones and dirt for asmooth, solid drive….You’ll be happy you did!

WEMAKE IT EASY:• Free detailed, written quotes• References provided with MapQuest driving directions• Better Business Bureau A+ Rating•MC/Visa accepted

ASK AROUND:We’ve probably pavedin your neighborhood!Earning our reputationfor quality since 1960.

Residential & Commercial

518.479.1400 / 518.794.0490WWW.BROWEASPHALT.COM

ATTENTION TO DETAIL • SUPERIOR QUALITY • CRAFTSMANSHIP • CUSTOMER CARE • FUNCTION

TIRED OFLOOKING AT

THAT PROBLEMDRIVEWAY?

NOW IS THE TIME TOCLEAN IT UP!

CAPITAL DISTRICT COIN DEALERSASSOCIATION

Coin & Hobby ShowCoins, Stamps, Collectibles,

Gold, Silver, Jewelry75 Tables

Sun. Sept. 9th • Sun. Oct. 7thSun. Nov. 4th • Sun. Dec. 2nd

Polish Community CenterWashington Ave. Ext. · Albany

11 am - 4 pm

www.cdcda.org

Call now to receive a free,no-obligation estimate

464-8963www.MAIDS.com

Referred for a reason.

you would recommendTHE CLEANINGSERVICETO YOUR NEIGHBOR.TO YOUR NEIGHBOR.TO YOUR NEIGHBOR.

Unless, you don’t like your neighbor.

THE CLEANINGSERVICETHE CLEANINGSERVICE

New customers only. Not valid with other offers.*

AND SAVE A FEW BUCKS.ACT NOW TO RECEIVE $25OFF YOUR FIRST CLEAN.*

Save yourself from cleaning the toilet.


locavore

by jennifer e. o’brienphotos by krishna hill

’Shroom Roomszehr and sons’ mushroom farm grows mushrooms for all


78 life@home

locavore

If six years ago you had told Jeremy and Doreen Zehr they would soon make their living selling mushrooms, they prob-ably would not have believed you. The couple, owners of

Zehr and Sons’ Mushroom Farm in Columbia County, moved to the area from Pennsylvania in 2006.

They moved with six other families to help establish a Menno-nite community in the Hudson Valley. Doreen explains that the family initially became a fixture at local farmers markets selling baked goods and Jeremy did carpentry work on the side. With a growing family (they now have five sons), the couple need-ed to make more income. Jeremy asked friends at the Hudson Farmers Market what products were in demand and was told mushrooms. That was in 2008. Since then, Doreen jokes that their business has really “mushroomed.”

Growing up on a bee farm in Pennsylvania, Jeremy had some agricultural background but no experience growing mush-rooms. He is quick to credit Gary Wiltbank, a mushroom farmer from Saugerties, with generously encouraging him and sharing much of what he has learned. Growing mushrooms involves sci-ence and patience. This is not about tracking down wild bunch-es that spring up at the base of trees. All of Zehr and Sons’ mushrooms — they currently offer oyster and shiitake varieties — grow inside the barn he built.

The oyster mushrooms are offered in three colors: yellow, brown and gray. They start in large, long plastic bags filled with shredded straw, wheat and mycelium (the vegetative part of the fungus that propagates through asexual reproduction). The bags are poked with holes to ensure the mushrooms have air and room to grow. Jeremy sterilizes his own straw in the winter and says that this added step to kill any fungus off seems to yield better growth.

Once assembled outside, the bags’ first stop is the spawn room. The bags, which weigh between 65 and 75 pounds, are suspended from the ceiling and resemble white punching bags. “We’re worried about trichoderma — which is a weed like in your cornfield or garden. So we try to keep as many weeds out of this room as we can,” says Jeremy. “It gives the spawn, the oyster spawn that I want to grow, time to start.” The bags generally stay in the spawn room for about three weeks and ev-ery day the Zehr family removes any weeds that poke through the bag. Once the bags begin to pin, or show tiny mushrooms emerging, they are moved over to the grow room.

Inside the grow room, the bags are once again suspended. Jeremy says they can stay in the grow room much longer, up to six months. After one flush, or complete growth, the mush-rooms are all picked by hand and the bag will usually begin to pin again within 10 days. “The older the bag is, the longer it takes to pin again.”

Doreen says that as the bags get older, the mycelium loses


OySTER MuShROOMS START TO GROW from a suspended bag filled with shredded straw, wheat and mycelium while hanging in the spawn room.


its strength, causing the longer growth time. The grow room is equipped with a ventilation and mist system. Jeremy says both are necessities “because mushrooms give off carbon dioxide so we have to replace the air.” Since Zehr and Sons grow mush-rooms year-round, the barn is also equipped with hot-water radiators that are fueled by burning chopped wood, another task Jeremy and his older sons do on their own.

The back room of the barn is where the shiitakes grow. Un-like the oysters, shiitakes grow on logs placed on rows of

shelving. The shiitake “logs,” which comprise sawdust, myce-lium and millet, look like flattened loaves of bread. The myce-lium serves as a glue to keep the log together while the millet distributes the spawn throughout. To produce 180 pounds of shiitakes each week, Jeremy says that they need to “grow out” at least 150 logs.

As with the oyster mushrooms, growing shiitakes is a multi-step process. First step is the soaking, in which the logs are soaked in a tub of water for 8-12 hours. “That seems to wake everybody up,” says Jeremy. “(It) gives them moisture to feed on and then it also is like a shock. But they need moisture; mushrooms are 90 to 95 percent moisture.” In much the same way as the oyster mushrooms are harvested, the shiitakes are picked at each flush, until the log eventually breaks down and crumbles apart.

Jeremy’s business experience from owning and running a hardware store in Pennsylvania has come in handy in this new endeavor. Zehr and Sons’ mushrooms are sold at many local farmers markets and retail spaces, and they also have a delivery route for local restaurants. A quart and a half box — approxi-mately three-quarters of a pound —sells for $10.

Last fall, Zehr and Sons entered the Chowder Fest at the Sara-toga Farmers Market, where they are regular vendors, and won with their mushroom version. Doreen says she enjoys watch-ing customers interact on market days; they swap recipes and cooking ideas. “(The mushrooms) basically sell themselves,” she says. As for the future, Jeremy hopes his sons will want to stay with the family business, although he won’t push it if they want to spread their wings and do something else. And if they do want to stay? “We’ll just build another barn!” @


Getting Your Mushroom FixZehr & Sons’ Mushrooms can be found at these weekly markets: Saratoga Farmers Market, Great Barrington Farmers Market, hudson Farmers Market, and these retail stores: hawthorne Farms, Guido’s, Chatham Real Food.

AMONG ThESE ROWS the shiitake mushrooms grow from “logs” filled with sawdust, mycelium and millet.

• Garden Maintenance & Restoration• Plant & Weed Identification• Seasonal Bed Cleanups• Bed Edging• Organic Fertilizing• Pruning & Hedge Trimming• Mulch & Compost• Plantings & Designs• FREE 15 Minute Consultation

Certified Master Gardeners

THE PLANT KEEPER, LLC1-855-404-2733

www.theplantkeeper.com

• Garden Maintenance & Restoration

“WE CARE ABOUT YOUR GARDENAS MUCH AS YOU DO!”

email: [email protected]

Est. 1999 - Insured

The Community Hospice

helps seriously ill people

stay in their own homes,

where they’re surrounded

by the people and things

they love.

Call Today:724-0242communityhospice.org

Quality of Life isOur First Priority.

Services paid for byMedicare, Medicaid and

most insurance plans

ThThee CoCoCommmmununununity Hospice

hehehehelplps seseririouououslslslslslsly ill people

ststststayay inn ththeir own homes,

whwhwhwhwhere they’re surrounded

by the people and things

they love.

Call Today:724-0242communityhospice.org

QQQQuuaalliitty oof Life isOOOOuurr FFirsstt Priority.

Services paid for byMedicare, Medicaid and

most insurance plans

WWW . P R E C I S I O N G L A S S I N C . C O M

T: 518 .346 .5647 � F : 518 .346 .1031115 Freemans Br idge Road , Scot ia , NY 12302

��

Come see our newSaloomDining RoomGallery!

Come try the NEWSimmons TruEnergy

RECHARGE Sleep System

OPEN: Daily 10-5, Thurs. & Fri. 'til 9, Closed Sundays1664 Main Street, Pattersonville, NY

Between Sch'dy & Amsterdam

518-887-2741 • www.pattersonvillefurniture.net

FallSavings

days

FREEDelivery

FreeFinancing& Removal


table@home

Berry Goodmarking the close of a long, hot summer

I savor the long days of summer. I love the san-dy, hot days spent with my family at the beach, the hikes on a sunny trail and even the lazy days

lounging about on our front porch, ceiling fan cranked up high and book in hand. These are the times I look forward to all winter. On cold

afternoons, days we spend working, going to school and then eating din-ner, doing homework and going to a piano lesson, I dream about the long

days with nothing to do. Then summer arrives, and we soak it up. I gather my children close, smell their

sweet scent, and am grateful for the short time we have together. The days we spend together, when I am not at work and they are not at camp, are few. I love those days.

Or I want to love those days. June, July and early August bring us plenty of happy family time: hours spent at our favorite water hole and road trips to visit my dad and his pool. By the end of August, our days together are not always blissful. Kids are tired, hot and, quite frankly, annoyed with each other. We parents know there is only one remedy for this end-of-summer illness: school.

So we have one last hurrah on Labor Day weekend. It’s their last chance for slee-povers, s’mores and sleeping until 10 a.m. Then, the long weekend over, we get down to business. We buy new shoes and lined paper, pens and three-ring bind-ers. And without any regret or wistfulness, Paul and I take our cups of coffee to

the bus stop and wish our dear children a successful first day of school. I’ve heard of parents who have a party after the bus pulls away on the first

day of school. A real party with champagne and everything.I, too, like to celebrate the beginning of another school year. We’ve successfully navigated our way through swim lessons,

backyard campouts and meltdowns in the middle of the farmers market. We deserve a celebration,

don’t you think?


by caroline barrett | photos by paul barrett

82 life@home

table@home


My back-to-school fete is quieter than hosting adults and opening bubbly wine (a disclaimer: I do not, in any way, think that drinking champagne in the morning after children get on the bus is a bad idea). My idea of a quiet celebration is some-thing one thinks of doing most often with their children, but something that can be oh-so-enjoyable without them. I call up a few friends and head out to pick berries.

It’s been a ritual now for a few years to peacefully and effi-ciently pick a few quarts of berries with a friend or two in the

warm September sun without our children. We move among the rows, talking and filling our containers. And though we are each of us good and kind mothers who love our children, no one misses them. In fact, we don’t even talk about them much. Instead, we discuss the berries. Raspberries, usually. We talk about the deep, rich color and how sweet they are. And just like our children, we sneak a few berries, feeling their warm, rich sweetness on our tongues.

We move along, talking and laughing. There is an account of a good dinner, a movie or a book. Confidences are exchanged. Nine years ago, I told my friends that Paul and I were expecting a baby. The very next year, I had a small Elliot strapped on my back as we talked and picked berries. Another year, a friend told me her marriage was over. She was leaving her husband. We stood there, holding our berry containers, crying. It was a

sad and touching moment. Mostly, though, it’s joyful. We pick. We talk and laugh. No one

has a temper tantrum. Our sentences are only interrupted by an exclamation from one of us when a new, bountiful berry bush is spotted. Last year, I picked six quarts of raspberries on our day out, certainly something I couldn’t have done easily with three children in tow.

At home, I rinse and lay out my berries. I am determined to freeze these and eat them well into the winter months. Raspber-ries freeze so well that my daughter Zoe will sneak downstairs to our basement freezer, swipe a bag and eat its entire contents in one sitting. It doesn’t matter that it’s 30 degrees outside and the berries are frozen through. Each bite is a memory of the warm days of summer and a glimpse of the next one to come. Before I wash and prepare the berries for our freezer, I’ll use a pint or two in our kitchen. We sprinkle a few on cereal and bake muffins.

On the first day of school, my three children march in and spend six hours in a hot classroom. It’s a long day. We all know the fun and adventures of summer are over, but I long to have them with me, for a bike ride or a trip to the farm stand. Before I can miss them too much, they step off the bus. They are happy, exhausted and ready to slip back into summertime hang-out mode. It’s not hard to do.

I like to reward them for their first day by baking something special. A slice of this warm almond and raspberry cake is just

TIpS FOR FREEzING RASpBERRIES

• Gently rinse berries in small batches (a pint or so at a time).

• Lay rinsed berries on paper towels in a single layer and allow to dry.

• Freeze in freezer-safe zip-top plastic bags in small batches.

• Berries keep for up to one year.

• Use berries in smoothies or baking directly from the freezer (thawing in

the refrigerator is all right too, but they will be mushy).

There’s a betterinsurance deal?

649-1717

24/7 online quotesAAA.com/Insurance

Insurance products are offered through AAA Hudson Valley Insurance Agency,an independent agency licensed by the State of New York. Our primary officeis located at 618 Delaware Avenue Albany, NY 12209.

Call now!

There’ betterWhat if…

AAA members& neighborswelcome!

A Division of Herzog Supply Company

New Loudon Rd. (Rt. 9)Latham, New York

782-1590

296 Central AvenueAlbany, New York

465-1526

Arborcoat’s cutting edge technology provides a finish thatoutperforms the best alkyd stains on the market.

Enhance....Protect....Renew

Raspberry Almond Buttermilk Snack Cakeingredients1 1/2 cup white whole wheat flour3 tablespoons ground flaxseed (found

in the health food department)1/8 cup ground almonds (grind to a dry crumbly

texture in a spice grinder or small food processor)2 teaspoons baking powder1/4 teaspoon salt2 eggs3/4 cup sunflower or other light cooking oil1/2 cup buttermilk1 teaspoon almond extract3/4 cup plus 2 teaspoons sugar1 1/2 cup fresh raspberries

methodHeat the oven to 350 degrees. Grease a 9-inch cake pan.

Stir together the flour, flax, almonds, baking powder and salt. Make a hole in the center, drop in the eggs and stir. Add the oil, buttermilk, almond extract and 3/4 cup sugar. Beat by hand for a minute. Batter will be slightly lumpy. Pour into the prepared dish, spread the raspberries over evenly and press gently into the batter. Sprinkle the sugar over top.

Bake for 45 minutes or until the center of the cake is spongy. Especially good after a long day of school and accompanied by a cold glass of milk.

right in the early fall sun. Each kid will have a cold slice tucked into lunch boxes the next day.

As you read this, kids will be trying on squeaky new sneakers and parents will be looking down the road, wondering why that school bus can’t arrive just a few days earlier. And I will pick up the phone, inviting friends, reminding them that it’s that time. Time for our berry-picking party. No matter what your method of cel-ebration, I invite you to raise your glass, your coffee cup or even a forkful of this sweet and delicious cake. Let’s toast to another successful summer behind us, and many more to come. @

Do you live a healthy life?

Be one of our next

cover models

It’s your life. Live it well.HealthyLife is a about de-stressing, nutrition and self-fulfillment.Each issue offers ideas and solutions to enhance readers’ bodies, minds and spirits.

HealthyLife is a free publication with a circulation of 30,000 distributed via homedelivery and through local businesses throughout the region including Bruegger’sBagels, spas, physicians’ offices, health clubs and various other locations.

Want more information about the magazine? Go to www.timesunion.com/healthylife

Whatever!

All theRightMovesDoing exercisesthe right way

Tips for talkingwith your teen

Plus...• Fit as a Family• Preventing frostbite• Eyebrow tips

Decisions,DecisionsDo you overthinkEVERYTHING?

Don’t miss ourfree HealthyLife

seminar onMarch 6!See page 34for details

body.mind.spirit.

A TIMES UNION PUBLICATION

january/february 2012

WhatWhatWhatWhatWhatWhatWhatWhatever

AllAllAllAllAllAllAllAll thRigRigRigRigRigRigRigRightMovMovMovMovMovMovMovMovesRigRigRigRigRigRigRigRight

sevoMRigRigRigRigRigRigRigRigDoing eDoing eDoing eDoing eDoing eDoing eDoing eDoing exercisethe rigthe rigthe rigthe rigthe rigthe rigthe rigthe right way

Tips foTips foTips foTips foTips foTips foTips foTips for talkiwith yowith yowith yowith yowith yowith yowith yowith yowith your teen

Don’t missDon’t missDon’t missDon’t miss ourfreefreefreefreefreefreefree HealthyLife

seminar onseminar onMarch 6!See page 34for details

A TIMESTIMEST UNION

Tell us in an essay of 100 words or lesshow you live your healthylife and youcould appear on the cover ofHealthyLife magazine.

Send us your essay, along with your photo showing an activity related to your healthy life. Entries can besubmitted online from August 15–September 7, 2012 at timesunion.com/healthylife.

Finalists will be notified by September 14, and must be available for a trial photo shoot on September 25.Ten winners will be chosen from finalists. No purchase necessary to enter.

Winners will receive a makeover from Kimberley’s...A Day Spa Ltd. andbe featured in the Up Close magazine article.

Cover model search sponsored byKimberley’s...A Day Spa Ltd. encouragesclients to attain that glorious realizationof mind & body in sync.

Cover model clothing provided by

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’’sssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooouuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuurrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr lllllllllllllllllllliiiiiiiiiiiiiiiiiiiiiiiiiffffffffffffffffffffffffffffffffffffeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee............ LLLLLLLLLLLLLLLLLLiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiivvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvveeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee iiiiiiiiiiiiiiiiiiiiiiiiiiittttttttttttttttttttttttttttttttttttttttttt wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeelllllllllllllllllllllllllllllllllllllllllllllllllll.......HeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHealthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLifefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefe isisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisis a aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aa aboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubouboubout dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt dt de-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-se-stretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretretressississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississississing,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng,ng, nununununununununununununununununununununununununununununununununununununununutritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritritiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotion an an an an an an an an an an an an an an an an an an an an an an an an an an an an an an an an an andndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndndnd selselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselselself-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-ff-fulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfiulfillllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenmenment.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.t.EacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEacEach ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih ih issussussussussussussussussussussussussussussussussussussussussussussussussussussussussussussussussussue oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe oe offeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffeffersrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrsrs ideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideideasasasasasasasasasasasasasasasasasasasasasasasasasas andandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandand sososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososososolutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutlutionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionions ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts to eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo eo enhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhanhancencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencencence rerererererererererererererererererererererererererererererererererererererererererereadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeadeaders’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’rs’ bobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobobodiediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediediedies,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s, minminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminminmindsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsdsds andandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandand spspspspspspspspspspspspspspspspspspspspspiriiriiriiriiriiriiriiriiriiriiriiriiriirits.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.ts.

HeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHeaHealthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthlthyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLiyLifefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefefe isisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisisis a fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa fa freereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereereeree pupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupupubliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblibliblicatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcationionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionionion wiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiththththththththththththththththththththththththththththththththththththth a ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca ca circircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircircirculaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulaulatiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotiotion on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on on of 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 3f 30,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000 disdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdisdistritritritritritritritritritritritritritritritritritritritritritritritritritritributbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutbutededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededededed viaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviaviavia hohohohohohohohohohohohohohohohohohohohohohohohohohohohomememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememememedeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeldeliveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveiveryryryryryryryryryryryryryryryryryryryryryryryryryry andandandandandandandandandandandandandandandandandandandandandandandandand thththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththththrourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourourouroughghghghghghghghghghghghghghghghghghghghghghgh loclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalalal busbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusbusineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineineinessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessessesses ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts ts throhrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohrohroughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughughoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutout ththththththththththththththththththththththththththththththththe re re re re re re re re re re re re re re re re re re re re re re re re re re re re re re re re re re regiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiegiononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononononon incincincincincincincincincincincincincincincincincincincincincincincincincludludludludludludludludludludludludludludludludludludludludludludludludludludludludludludinginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginginging BrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBrBruegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueguegueggergergergergergergergergergergergergergergergergergergergergergergergergergerger’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’s’sBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagBagelselselselselselselselselselselselselselselselselselselselselselselsels, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, s, spaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspaspas, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, p, physhyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshyshysiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciiciansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansansans’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ o’ offiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffifficescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescescesces, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, h, healealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealealththththththththththththththththththththththththththththththththththththththththththththth clucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclucluclubsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbsbs andandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandandand vavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavavariorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioriorioususususususususususususususususususususususususususususususususus othothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothothotherererererererererererererererererererererererer loclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocloclocatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiatiationsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsonsons....

WanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWanWant mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt mt moreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreoreore ininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininininforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforforformatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmatmationionionionionionionionionionionionionionionionionionionionionionionionionionionionionion ababababababababababababababababababababababababababababababababababoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutoutout ththththththththththththththththththththththththththththththe me me me me me me me me me me me me me me me me me me me me me me me me me me me me me me magaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagazinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzinzine?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e?e? GoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGoGo totototototototototototototototototototototototototototototo wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.ti.timesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesmesuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniuniunion.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.on.comcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcomcom/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/he/healtaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltaltalthylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylhylifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeifeife

Cover model clothing providedCover model clothing provi

It’s your life. Live it well.HealthyLife is a about de-stressing, nutrition and self-fulfillment.Each issue offers ideas and solutions to enhance readers’ bodies, minds and spirits.

HealthyLife is a free publication with a circulation of 30,000 distributed via homedelivery and through local businesses throughout the region including Bruegger’sBagels, spas, physicians’ offices, health clubs and various other locations.

Want more information about the magazine? Go to www.timesunion.com/healthylife

five things

Greta Killmer wasn’t sure she wanted to be a nurse. But once she began working as a nurse in labor and deliv-ery at Bellevue Women’s Hospital, where she was for

15 years, she knew she wanted to stay in the business. “I loved babies and I couldn’t wait to have babies,” she says.

When the in vitro fertilization (IVF) program opened at Belle-vue, Killmer took it. But when Bellevue eliminated the program, a doctor from Syracuse, Dr. Robert Kiltz, decided to expand his fer-tility practice to the Albany area. And Killmer, along with many of her colleagues, joined Dr. Kiltz at CNY Fertility Center in Latham.

“I was thinking about what I do and why I do it and I’ve always been one of those people who wants to take care of everybody,” Killmer says. “I get very close to my patients. I want to take them home with me and tell them everything is going to be all right. I love my patients; I really love my patients. I feel home here.”

At times, treating infertility can be difficult, but Killmer has learned to handle the emotional challenges of her work be-cause she’s faced them herself. “I think because I can under-stand it,” she says. “I can understand where people are coming from if they are hostile or frustrated or upset. I understand that. I knew that. I went through that.”

Killmer always wanted to have children of her own, but wasn’t able to. When she discovered she wouldn’t be able to, she says she thought, “Really, seriously, this was the only thing I wanted for my entire life and I can’t have it?” But eventually, she learned to cope.

“We’re not flawed,” she says. “It’s whatever is going to be. And I know that. It makes it easy for me to say (to a patient) ‘It’s going to be all right.’ ... If I can help somebody through it and maybe make them see it differently, get a different perspective on it, that makes me feel good.”

story and photos by suzanne kawola

GRetA KillMeRNurse, CNY Fertility Center

five things

GRETA’S FIvE ThINGS:

1. CROSS-STITChING: “It relaxes me. I’m really artsy-craftsy. I like quilting, but since I was 10 I started cross-stitching. And I just love it. I love when it’s done! It’s like art and it’s beautiful, beautiful.”

2. DARk ChOCOLATE: “I love dark chocolate. Like, I love it!” The brand doesn’t matter. “Any dark chocolate will do.” She used to eat it every day, but not anymore after undergoing gas-tric bypass surgery.

3. My “FAT” JEANS: “It’s a reminder of where I was and what I have done for myself.” Every once in a while she’ll pull them out and jump in one leg. Laughing, “I’m like those people on TV!” Gre-ta lost 165 pounds at 40 years old. She admits that before losing the weight, she was sad for most of her life. “It was the best thing I have ever done for myself. I’m a totally different person than I was before.”

i can’t live without


4. pIGS: “If I could have a pet pig where I live, I would have a pet pig. I just think they are so cute and they are happiness. They’re joy.” She has thousands of pigs in her home, from chocolate pigs and stuffed pig to pictures of pigs and more. She regularly visits a pig farm in Queensbury to pet and feed pigs.

5. hIGh hEELS: “When you’re big, you can wear high-heeled shoes, but trying to balance 300 pounds on a high-heeled shoe is very uncomfortable. So, now, clothes shopping and shoe shop-ping is so much fun! I love high-heeled shoes now.” She’s not a fanatic — she has about 12 pairs — but she loves and wears each pair. “I feel pretty, and a lot of my life I didn’t.” @

86 life@home

photo finish

CLAy DOLLS: Homemade mini-people at the Nelson-Dufel home. Read the story on page 27. Photo by Mark Samu.


* See store for details

1771 Route 9, Clifton Park518-383-2215

785 Route 9, Latham518-785-8555

661 Broadway, Kingston845-331-2230

Providing the finest in home appliances for 86 years.Support your community, buy from a locally owned and operated business.

A+ Ratingwww.earlbfeiden.com

Miele... now on exhibit in your kitchen.What better canvas to draw inspiration from than your very own kitchen. With Miele’saward-winning suite of cooking, cooling and cleaning appliances, you’re sure to debuta collection of awe inspiring masterpieces. Whether it be a hand-sculpted ventilationhood, a sleek, stainless steel refrigerator or a Clean Touch Steel™ �� oven, your senses will be awakened. So go ahead… and put your taste on exhibit.

Life@Home September 2012

Documents

Transcript of Life@Home September 2012