Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping...
Transcript of Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping...
![Page 1: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/1.jpg)
Leonore Reiser and Lisa Harper
Plantae WebinarMay 30, 2018
![Page 2: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/2.jpg)
What does it mean to be FAIR? Why is it so
important?
How to make your published work more
FAIR
Planning your data management strategy
Stay to the end to complete a survey about
future webinars
![Page 3: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/3.jpg)
Community databases/knowledgebases
Researchers
Data type specific repositories
![Page 4: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/4.jpg)
What’s in it for YOU?
We all benefit from data sharing.
More citations of YOUR work, increasing
your visibility in the research community.
Easily comply with journal and
funding requirements
Less time spent fulfilling requests for data.
![Page 5: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/5.jpg)
ACGATTGAAGAGAGACTTAAAGTGGTGGAATAAGCACATTTTTGGAGATATTTTTAAAATCCTCCGATTG
GCAGAAGTTGAAGCTGAACAAAGAGAATTGAATTTCCAACAGAATCCCTCAGCAGCTAATAGAGAATTGA
TGCATAAGGCTTATGCCAAACTTAACCGGCAGTTAAGTATTGAAGAACTTTTTTGGCAACAAAAGTCGGG
TGTCAAATGGTTAGTGGAGGGGGAACGCAACACCAAATTTTTTCATATGAGGATGCGTAAAAAAAGAATG
AGAAATCACATCTTCCGGATTCAGGATCAGGAAGGGAATGTGCTTGAAGAACCTCATTTAATCCAAAACT
CGGGTGTTGAATTCTTTCAAAACTTGCTGAAGGCAGAACAATGTGACATCTCCAGGTTTGATCCTTCTAT
TACTCCACGAATTATCTCCACCACTGATAATGAATTCTTGTGTGCAACCCCATCGTTACAGGAAGTGAAA
GAGGCAGTATTTAACATTAATAAAGATAGTGTCGCTGGGCCTGACGGTTTCTCATCCTTGTTTTACCAAC
ACTGCTGGGACATAATCAAGCAAGACCTTTTTGAAGCAGTGCTTGATTTTTTCAAGGGGAGCCCGCTACC
ACGTGGCATTACCTCCACAACGCTTGTCTTGTTACCTAAAACTCAGAATGTCAGCCAATGGAGTGAATTT
CGGCCCATTAGTTTATGCACTGTCTTAAACAAGATAGTAACTAAACTTTTGGCCAACCGGCTATCCAAAA
TTCTCCCATCCATCATCTCAGAAAACCAAAGTGGCTTCGTTAATGGAAGGCTTATAAGTGACAATATCTT
GCTTGCACAGGAGCTGGTTGATAAGATTAATGCAAGATCAAGGGGAGGTAATGTGGTCCTAAAACTTGAT
ATGGCAAAAGCTTATGACCGTCTGAATTGGGAATTTCTTTATCTTATGATGGAGCAGTTTGGTTTTAATG
CACTTTGGATAAACATGATTAAGGCCTGCATCTCCAACTGTTGGTTTTCATTACTCATCAATGGATCCTT
AGTGGGCTATTTCAAATCCGAGAGGGGACTGAGACAGGGCGATTCTATTTCCCCTTCGCTTTTTATCTTG
GCTGCAGAATATTTATCAAGGGGACTCAATCAGTTATTCAGCCGCTACAATTCTTTACATTACTTATCTG
GATGTTCCATGTCTGTGAGTCACCTTGCTTTTGCCGATGATATTGTAATTTTTACTAATGGTTGCCACTC
AGCCTTGCAGAAGATCTTGGTCTTCTTACAGGAATATGAACAGGTATCGGGGCAACAGGTTAATCATCAA
What types of Data are we talking about?
• We used to publish all the data we needed to prove a hypothesis within a publication
• But things have changed:• Some data is now too large for inclusion in a publication
• Data can now be computationally analyzed, so it must be machine readable
![Page 6: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/6.jpg)
Zhang et al, Plant Cell, 2018. doi.org/10.1105/tpc.17.00791
Photos of specimens
Data that can be included in Publications
Data OK in primary publication
Data goes in appropriate, stable, long term repository
Guo et al, Plant Cell, 2018. doi.org/10.1105/tpc.17.00842
Gel images, charts and graphs
![Page 7: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/7.jpg)
Caseys et al, Plant Cell 2018. doi.org/10.1105/tpc.18.00278
Model cartoons
Kumar, et al, Plant Physiology 2018, doi.org/10.1104/pp.18.00263
SHORT lists of
primers in text format
(not pdf)
Data OK in primary publication
Data goes in appropriate, stable, long term repository
Data that can be included in Publications
![Page 8: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/8.jpg)
Data OK in primary publication
Data goes in appropriate, stable, long term repository
• Genome Assemblies
• RNAseq/ChIPseq/OtherSeq
• QTL data (bi-parental or GWAS)/ SNPs/INDELs
• Other Genome Diversity data
• Proteomics
• Metabolomics
• Ionomics
• Etc.
Data TOO BIG for Publications
These Data Types need ADDITIONAL
attention to be FAIR
![Page 9: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/9.jpg)
Data TOO BIG for PublicationsTwo Examples of Big Data in publications:
1. Paper reports on a new genome sequence assembly:
That genome sequence MUST be made available; should
be submitted to Genbank Genome.
2. Paper used RNAseq to show that expression of their gene
of interest is altered under a certain condition. Only a
subset needs to be shown, but ALL the RNAseq data is
valuable. Publish the paper AND publish the RNAseq
Data! You get TWO publications instead of one!
![Page 10: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/10.jpg)
Credit: Melissa Haendel
Wilkinson, et al., (2016) The FAIR Guiding Principles for scientific data management and stewardship
10.1038/sdata.2016.18. https://www.nature.com/articles/sdata201618
• Findable means data is human and machine readable
and attached to persistent identifiers
• Accessible means data can be found and retrieved by
humans and machines using standard formats
• Interoperable means data can be exchanged and used
between systems.
• Reusable means data can be used by others
![Page 11: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/11.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 12: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/12.jpg)
CHROM POS REF ALT Line 1
Line2
1 12345 A C A A
3 67891 C T H C
10 23456 G T T U
CHROM POS REF ALT Line 1
Line 2
Gm01 12345 A C 0/0 0/0
Gm03 67891 C T 0/1 0/0
Gm10 23456 G T 1/1 ./.
CHROM POS REF ALT Line 1
Line2
Chr01 12345 A C AA AA
Chr03 67891 C T C/T CC
Chr10 23456 G T TT NN
ALL MEAN THE SAME!
BUT ARE NOT THE SAME
Use Standard formats: SNP example
SNP (Single Nucleotide Polymorphism): A base, a chromosome
number and genome position, and a reference to the genome
assembly used, and the genotypes of lines tested.
VCF: Variant Call Format
Is the STANDARD
Use the File format
STANDARD
for your data type
![Page 13: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/13.jpg)
DOI:/10.3389/fpls.2017.01812
Use Standard formats: Data in images is NOT accessible
Data in PDF (image) format
is not findable or
accessible.
Leave tabular data in tables
![Page 14: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/14.jpg)
If you use EXCEL, look out for data corruption and hidden Microsoft characters that impede parsing
Zeimann, 2016
10.1186/s13059-016-1044-7
Use Standard formats: Beware of Excel
Fig. 1: Prevalence of gene name errors in Supplementary Excel files
Percentage of papers with gene lists effected Increase in supplementary files with gene
name errors per year
![Page 15: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/15.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 16: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/16.jpg)
Metadata: Species = xxx
Germplasm = xxx
Field location = xxx
Environment = xxx
Measurement = xxx
method
Phenotype (Data): Plant is 170cm tall
Metadata is data about the data,and allows understanding of the data
Supply Complete Metadata
![Page 17: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/17.jpg)
• Write your Materials and Methods as if you wanted someone else to be able to reproduce your work.
• Be accurate and complete about your bench and field work; include samples/stocks/lines used, accession numbers, sources of materials, exact measuring techniques etc.
• Be AS accurate and complete about your computational pipelines. Include your created raw data files and versions. If you use reference data (eg; sequence assembly), include the version number, download dates, and download source.
• Include names of software applications, versions, platforms and source. If you use a CyVerse, use their metadata reporting tools.
Supply Complete Metadata
![Page 18: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/18.jpg)
Supply Complete Metadata: Example
Pretty Good
![Page 19: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/19.jpg)
Pretty Goodbut lots of metadata
in free text
![Page 20: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/20.jpg)
Supply Complete Metadata
Not so good
![Page 21: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/21.jpg)
But NONE of those are really great…
597 Possible Attributes
At least 50 Attributes
At least 100 Attributes
![Page 22: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/22.jpg)
Budget TIME
to provide Metadata
The metadata in public databases is often confusing
and very incomplete
A test case with Zea mays RNAseq data reveals a high proportion
of missing, misleading or incomplete metadata.Bhandary, et al, Plant Science 2018. Raising orphans from a metadata morass: A researcher's
guide to re-use of public ’omics data. https://doi.org/10.1016/j.plantsci.2017.10.014
![Page 23: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/23.jpg)
![Page 24: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/24.jpg)
• Established: Genomic Standards Consortium (http://gensc.org)
• Minimal Information about Any Sequence• Emerging
• Minimal Information about a Plant Phenotyping Experiment (MIAPPE)
Metadata Standards for Various Data Types
Ask For Help from Database People
![Page 25: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/25.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete and deep metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 26: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/26.jpg)
Cell
Same word,
different meanings
Different words, same concept
Eggplant
Aubergine
Melongene
Credit: Monica Munoz Torres
![Page 27: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/27.jpg)
An Ontology is:
A set of precisely defined terms
in a logical hierarchy, and the
relationship between terms can be
understood by computers
![Page 28: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/28.jpg)
PO:0020105ligule
Ontologies: Hierarchy of terms and
explicit relationship among terms
Plant
Ontology
(PO)
Ligule
PO:0020105
Vascular leaf
PO:0009025
Leaf sheath
PO:0020104
Flag leaf
PO:0020103
Adult vascular leaf
PO:0020103
Leaf
PO:0025034
![Page 29: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/29.jpg)
Embracing ontologies
• Ontologies provide a POWERFUL, MACHINE READABLE utility to ensure we are all speaking the same language
• Examples of ontologies:
• Gene Function = Gene Ontology (GO)
• Plant Anatomy and Development = Plant Ontology (PO)
• Phenotypes = Phenotype and Trait Ontology (PATO)
• …..many many others
• Find and use existing ontologies:• http://bioportal.bioontology.org// (711 ontologies)
• https://www.ebi.ac.uk/ols/index (208 ontologies)
• Planteome (http://planteome.org)
• Ask Questions!
![Page 30: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/30.jpg)
Using Ontologies in Metadata
![Page 31: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/31.jpg)
Questions?
![Page 32: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/32.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete and deep metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 33: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/33.jpg)
Use persistent, unambiguous identifiers
Example: Gene names
GOOD!
![Page 34: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/34.jpg)
Identifiers also resolve confusion over species
Is this Arabidopsis? Maize? Tomato?
![Page 35: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/35.jpg)
DOI:10/24/pp.17.00021
One gene- many names
GOOD
OK
(history)
![Page 36: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/36.jpg)
One name- many genes
![Page 37: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/37.jpg)
A ‘gene’ may have many named sequences
![Page 38: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/38.jpg)
Community Standards and Nomenclature Resources
![Page 39: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/39.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete and deep metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 40: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/40.jpg)
Put your data in a stable public repository
Large International Repositories for many data
types for all species. ALL sequence data goes here
Large but specialized databases serving many species
Soybase
Specialized databases serving specific communities
![Page 41: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/41.jpg)
Which repository?
ALL types of sequence Data: NCBI, DDBJ, or
EMBL
SNP data: European Variation Archive (EVA,
https://www.ebi.ac.uk/eva/).
(NCBI’s dbSNP will only process Human SNPs)
RNAseq: GEO
(https://www.ncbi.nlm.nih.gov/geo/), Array
Express (https://www.ebi.ac.uk/arrayexpress/)
![Page 42: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/42.jpg)
Re3data- searching repositories
https://www.re3data.org/
![Page 43: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/43.jpg)
FAIRsharing- searching repositories
https://fairsharing.org/
![Page 44: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/44.jpg)
FAIRsharing- searching metadata standards
https://fairsharing.org/
![Page 45: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/45.jpg)
What if there is no specialized database?Or no recommendations from journals ?
You should get a Digital Object Identifier (DOI)
http://datadryad.org
** Curated, metadata
https://zenodo.org/
https://figshare.com/
https://datashare.ucsf.edu/stash
And institutional repositories
![Page 46: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/46.jpg)
But.. please, don’t forget to actually complete your submission*...
*And you never have to spend time fielding requests
or transferring huge data files again
![Page 47: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/47.jpg)
Data Management PlanningWhat external sources of data will I be using?
Where will it come from?
Are there restrictions on reuse?
What types of data will I be generating?
What sort of metadata do I need to collect?
How will I structure and store my data?
Are there existing data handling standards and tools?
Where will the data reside when my project is done?
Is there a repository that can handle my data?
What metadata and files do I need to provide and how?
If I plan to host the data myself on a website/database, how
will I maintain it, and for how long? What happens then?
Under what terms will others be able to reuse my data?
If I want to, how will I be able to track how my data is
reused?
![Page 48: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/48.jpg)
How to Make Your Published Data FAIR
• Use standard formats
• Supply complete and deep metadata
• Embrace Ontologies
• Use persistent and unambiguous identifiers
• Put your data in a long term stable repository
• Cite, share freely and encourage others
![Page 49: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/49.jpg)
Cite, share freely and encourage others to be FAIR
Include searchable and citable identifiers for your data in your papers
Release your data with clearly defined terms of use
e.g. Creative Commons (CC) CC-0, CC-BY
(https://creativecommons.org)
If you do not specify restrictions may be implied, limiting reuse
Cite all of your data sources
Enhances reproducibility….. and also shows value to funders!
When reviewing papers check them for FAIRness
![Page 50: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/50.jpg)
Good data practices benefit everyone (and help you get funded)
NSF considers the Data Management Plan (DMP) to be an integral part of all full proposals
(http://www.nsf.gov/bfa/dias/policy/dmp.jsp1), that will be “considered under Intellectual Merit or
Broader Impacts or both, as appropriate for the scientific community of relevance” (PAPPG, pg. II-212).
BIO recognizes that different research communities may have their own data management practices
and standards; that these norms will change over time; and, that lifecycles of usefulness will vary for
different data types. As such, it is essential for scientific communities to guide needed standards
development, and to shape expectations for sharing or archiving.
https://www.nsf.gov/bio/pubs/BIODMP102015.pdf
![Page 51: Leonore Reiser and Lisa Harper Plantae Webinar · • Minimal Information about a Plant Phenotyping Experiment (MIAPPE) Metadata Standards for Various Data Types ... • Supply complete](https://reader036.fdocuments.net/reader036/viewer/2022070722/5ee3a2a3ad6a402d666d5dad/html5/thumbnails/51.jpg)
Thank you!Please complete the survey
AgBioData