Lee Eun Joo

EXPRESSION AND FUNCTION OF MICRORNA IN HUMAN CANCER

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the

Degree Doctor of Philosophy in the Graduate School of

The Ohio State University

By

Eun Joo Lee, M.S.

*****

The Ohio State University

2008

Dissertation Committee:

Dr. Thomas D. Schmittgen, Adviser Approved by

Dr. James T. Dalton

Dr. Terry S. Elton

Dr. Mamuka Kvaratskhelia Adviser

Graduate program in Pharmacy

Copyright by

Eun Joo Lee

2008

ii

ABSTRACT

microRNAs (miRNA) are functional 22 nt noncoding RNAs that negatively

regulate gene expression. The mature miRNA binds to the 3’ untranslated region of the

target messenger RNA (mRNA) and represses translation. There is mounting evidence

that miRNAs are involved in a number of human cancers. Pancreatic cancer is the fourth

leading cause of cancer-related death in the United States. The prognosis for pancreatic

cancer is the worst of all cancers. Better understanding of the genetic alterations in

pancreatic cancer may improve the early detection and treatment regimens.

The expression of over 200 miRNA precursors on specimens of human pancreatic

adenocarcinoma, paired benign tissue, normal pancreas, chronic pancreatitis and

pancreatic cancer cell lines was profiled using a real-time PCR assay developed in our lab.

The results showed that a number of miRNAs were differentially upregulated in the

tumors and cell lines compared to the normal pancreas tissue. The expression of the

active, mature miRNA was validated using a Taqman real-time PCR assay and Northern

blotting. Finally, RT in situ PCR was performed to verify that aberrantly expressed

miRNAs were localized to tumor cells and not to stroma or normal acini or duct cells.

To explore the mechanism of overexpressed miRNAs in pancreatic cancer and to

evaluate potential therapeutics, antisense oligonucleotides (ASO) were used to inhibit the

activity of the overexpressed miRNAs in pancreatic cancer. ASO produced cytotoxicity

iii

to pancreatic cancer cell lines in the low nM range. Cytotoxicity was less pronounced

when the normal ductal epithelial cell line HPNE was exposed to ASO or when

pancreatic cancer cell lines were exposed to an irrelevant control oligonucleotide.

Inhibition of miRNA with antisense increased the amount of apoptosis and resulted in

cell cycle arrest in HS766T cells compared to the control oligonucleotide. Synergistic

cytotoxicity was observed when ASO was combined with gemcitabine. The mRNA

targets of the aberrantly expressed miRNA in pancreatic cancer were validated and

identified to determine mechanism of action.

The miRNA processing pattern in different tissues and cell lines were determined

and a large number of miRNAs are transcribed but are not processed to the mature

miRNA.

iv

DEDICATION

To my parents

v

ACKNOWLEDGMENTS

I would like to express sincere appreciation and gratitude to my advisor, Dr.

Thomas D. Schmittgen for his support and guidance. I have been very fortunate to have a

great teacher in the past five years who stimulated my interest in microRNA research.

Dr.Schmittgen guided my efforts to learn about microRNA and cancer and he always

encouraged me with his enthusiasm. I also would like to thank the members of my

dissertation committee, Dr. James T. Dalton, Dr. Elton S. Terry, and Dr. Mamuka

Kvaratskhelia for their comments and discussions.

I appreciate Yuriy Gusev for statistical analysis of my studies. I would like to

thank Daniel J. Brackett, Megan R. Lerner, Daniel L. Morgan, and Russell G. Postier for

providing human pancreatic tissues and cell lines and I would like to thank Dr. Wendy L.

Frankel for tissue specimen examination. I appreciate Dr. Caifu Chen for support of

Taqman real-time PCR assays and experimental discussions. I am grateful to Dr.

Christine Esau for support of antisense oligonucleotides and expertise on antisense

studies. I also would like to thank to Dr. Gerard J. Nuovo for In situ RT PCR work.

I would like to thank Dr. Jinmai Jiang, Jong-Kook Park and Myungwon Baek for

their assistance with experiments, implementation, and data interpretation of the studies

performed herein. I wish to thank Ana Clara Azevedo and Liuqing Yang for their

friendship and help.

vi

I would like to thank my parents, Sungho Lee and Keumsook Jeong, and my

brothers, Hyoshik Lee and Yongshik Lee, for their love, encouragement, and support.

I would like to thank Proctor and Gamble for the Fellowship. This research was

supported by a grant from NIH (CA107435-01 to T.D.S.) and the National Pancreas

Foundation.

vii

VITA

November 29, 1975…………………... Born in Ulsan, South Korea

1995 – 1999……………………………B.S. Pharmacy, Seoul National University

Seoul, South Korea

1999 - 2001………………………….…M.S. Pharmacy, Seoul National University

Seoul, South Korea

2003 - Present……………………….…Graduate Teaching and Research Associate,

College of Pharmacy, The Ohio State University

PUBLICATIONS

1. Schmittgen, T.D., Lee, E.J., Jiang, J., Sarkar, A., Yang, L., Elton, T.S., Chen, C.

Real-time PCR quantification of precursor and mature microRNA. Methods,

44(1):31-38, 2008.

2. Lee, E.J., Baek, M., Gusev, Y., Brackett, D.J., Nuovo, G.J., Schmittgen, T.D.

Systematic evaluation of microRNA processing patterns in tissues, cell lines, and

tumors. RNA, 14(1):35-42, 2007.

3. Calin, G.A., Liu, C.G., Ferracin, M., Hyslop, T., Spizzo, R., Sevignani, C., Fabbri,

M., Cimmino, A., Lee, E.J., Wojcik, S.E., Shimizu, M., Tili, E., Rossi, S.,

Taccioli, C., Picchiori, F., Liu, X., Zuppo, S., Herlea, V., Gramantieri, L., Lanza,

G., Alder, H., Rassenti, L., Volinia, S., Schmittgen, T.D., Kipps, T.J., Negrini, M.,

Croce, C.M. Ultraconserved regions encoding ncRNAs are altered in human

leukemias and carcinomas. Cancer Cell, 12(3):215-229, 2007.

viii

4. Lee, E.J., Gusev, Y., Jiang, J., Nuovo, G.J., Lerner, M.R., Frankel, W.L., Morgan,

D.L., Postier, R.G., Brackett, D.J., Schmittgen, T.D. Expression profiling

identifies microRNA signature in pancreatic cancer. International Journal of

Cancer, 120(5):1046-1054, 2007.

5. Lee, E.J. and Schmittgen, T.D. Comparison of RNA assay methods used to

normalize cDNA for quantitative real-time PCR. Analytical Biochemistry,

357(2):299-301, 2006.

6. Martin, M.M., Lee, E.J., Jiang, J., Buckenberger, J., Schmittgen, T.D., and Elton,

T.S. microRNA-155 regulates human angiotensin II type 1 receptor expression in

fibroblasts. Journal of Biological Chemistry, 281(27):18277-18284, 2006.

7. Jiang, J., Lee, E.J. and Schmittgen, T.D. Increased expression of microRNA-155

in Epstein-Barr Virus transformed lymphoblastoid cell lines. Genes,

Chromosomes & Cancer, 45(1):103-106, 2006.

8. Jiang, J., Lee, E.J., Gusev, Y and Schmittgen, T.D. Real-time expression

profiling of microRNA precursors in human cancer cell lines. Nucleic Acids

Research, 33(17):5394-5403, 2005.

9. Lee, E.J., Kim, E.J., Kim, Y.G., Chung, H.C., Kim, S.H., Kim, D.H., Lee, I., Kim,

S.G., Lee, M.G. Pharmacokinetic changes of intravenous 2-(allylthio) pyrazine, a

chemoprotective agent, in rats with acute renal failure induced by uranyl nitrate.

Research Communications in Molecular Pathology and Pharmacology, 111(5-

6):225-236, 2002.

10. Shim, H.J., Lee, E.J., Jung, Y.H., Kim, S.H., Kim, S.H., Yoo, M., Kwon, J.W.,

Kim, W.B., Lee, M.G. Determination of a new phosphodiesterase V inhibitor,

DA-8159, in plasma and urine by high-performance liquid chromatography.

Journal of Pharmaceutical and Biomedical Analysis, 30(3):527-533, 2002.

11. Shim, H.J., Lee, E.J., Kim, J.H., Kim, S.H., Kwon, J.W., Kim, W.B., Cha, S.W.,

Lee, M.G. Subacute toxicities and toxicokinetics of a new erectogenic, DA-8159,

after single and 4-week repeated oral administration in dogs. Biopharmaceutics &

Drug Disposition, 22(3):109-117, 2001.

12. Shim, H.J., Lee, E.J., Kim, S.H., Kim, S.H., Yoo, M., Kwon, J.W., Kim, W.B.,

Lee, M.G. Factors influencing the protein binding of a new phosphodiesterase V

ix

inhibitor, DA-8159, using an equilibrium dialysis technique. Biopharmaceutics &

Drug Disposition, 21(7):285-291, 2000.

13. Shim, H.J., Lee, E.J., Kim, S.H., Kim, S.H., Yoo, M., Kwon, J.W., Kim, W.B.,

Lee, H.S., Lee, M.G. Pharmacokinetics, stability, and blood partition of DA-8159,

a new phosphodiesterase V inhibitor. Research Communications in Molecular

Pathology and Pharmacology, 108(3-4):275-286, 2000.

14. Hurh, E., Lee, E., Lee, A., Kim, Y., Kim, S., Kim, S., Lee, M. Effects of enzyme

inducers or inhibitors on the pharmacokinetics of intravenous parathion in rats.

Biopharmaceutics & Drug Disposition, 21(5):193-204, 2000.

15. Hurh, E, Lee, E.J., Kim, Y.G., Kim, S.Y., Kim, S.H., Kim, Y.C., Lee, M.G.

Effects of physostigmine on the pharmacokinetics of intravenous parathion in rats.

Biopharmaceutics & Drug Disposition, 21(8):331-338, 2000.

16. Hurh E, Lee, E.J., Kim, Y.G., Kim, S.Y., Kim, S.H., Kim, Y.C., Lee, M.G.

Effects of neostigmine on the pharmacokinetics of intravenous parathion in rats.

Research Communications in Molecular Pathology and Pharmacology, 108(3-

4):261-273, 2000.

FIELDS OF STUDY

Major Field: Pharmacy

x

TABLE OF CONTENTS

ABSTRACT ......................................................................................................................ii

DEDICATION .................................................................................................................iv

ACKNOWLEDGMENTS ................................................................................................v

VITA ................................................................................................................................vii

LIST OF TABLES .........................................................................................................xvi

LIST OF FIGURES ......................................................................................................xvii

CHAPTERS

1. INTRODUCTION ................................................................................................1

1.1 miRNA DISCOVERY ......................................................................................1

1.2 miRNA BIOGENESIS .....................................................................................3

1.3. miRNA TARGET IDENTIFICATION ...........................................................6

1.4 miRNA EXPRESSION AND PROFILING .....................................................8

1.5 miRNA EXPRESSION IN HUMAN CANCER ............................................10

1.6 miRNA THERAPEUTICS .............................................................................14

1.6.1 Inhibition of miRNA using antisense oligonucleotides (ASO) .......15

1.6.2 Replacement of miRNA ...................................................................16

1.7 OBJECTIVE OF DISSERTATION ...............................................................17

xi

2. EXPRESSION PROFILING IDENTIFIES MICRORNA SIGNATURE IN

PANCREATIC CANCER ..................................................................................21

2.1 INTRODUCTION ..........................................................................................21

2.2 MATERIAL AND METHODS ......................................................................22

2.2.1 Tissue procurement ..........................................................................22

2.2.2 Cell lines ..........................................................................................23

2.2.3 miRNA precursor expression profiling ............................................23

2.2.4 Real-time PCR of mature miRNA ...................................................24

2.2.5 Northern blotting ..............................................................................25

2.2.6 RT in situ PCR .................................................................................25

2.2.7 Statistics ...........................................................................................26

2.3 RESULTS .......................................................................................................28

2.3.1 Validation .........................................................................................28

2.3.2 miRNA precursor profiling in pancreatic tissues .............................28

2.3.3 Data analysis by prediction analysis of micro-array algorithm (PAM)

..........................................................................................................30

2.3.4 Validation of miRNA expression .....................................................31

2.4 DISCUSSION .................................................................................................33

2.5 ACKNOWLEDGEMENTS ............................................................................37

xii

3. ANTISENSE INHIBITION OF microRNA REDUCES CELL VIABILITY

AND SENSITIZES THE EFFECT OF GEMCITABINE IN PANCREATIC

CANCER .............................................................................................................48

3.1 INTRODUCTION ..........................................................................................48


3.2.1 Cell lines and culture .......................................................................52

3.2.2 miRNA profiling ..............................................................................52

3.2.3 Antisense oligonucleotides ..............................................................53

3.2.4 Antisense oligonucleotides transfection ..........................................53

3.2.5 Gemcitabine treatment .....................................................................53

3.2.6 Cell proliferation assay ....................................................................54

3.2.7 Combination assay ...........................................................................54

3.2.8 Data analysis ....................................................................................55

3.2.9 Statistical analysis ............................................................................56

3.3 RESULTS .......................................................................................................56

3.3.1 miRNA expression in pancreatic cell lines ......................................56

3.3.2 Antiproliferative effects of antisense oligonucleotides ....................57

3.3.3 Schedule-dependent combinatorial effects of antisense with

gemcitabine ......................................................................................59

3.3.4 Evaluation of synergism in ASO combination ................................60

xiii

3.4 DISCUSSION .................................................................................................62


4. ANTISENSE INHIBITION OF microRNA ARRESTS CELL CYCLE,

INDUCES APOPTOSIS AND IDENTIFIES THE TARGET MOLECULES

IN PANCREATIC CANCER ............................................................................77

4.1 INTRODUCTION ..........................................................................................77


4.2.1 Cell lines and culture .......................................................................80

4.2.2 Antisense Oligonucleotides and Pre-miR™ miRNA Precursor ......80

4.2.3 Antisense oligonucleotide and Pre-miR™ miRNA Precursor

transfection ......................................................................................80

4.2.4 Cell cycle analysis ............................................................................80

4.2.5 Apoptosis analysis ...........................................................................81

4.2.6 Real-time PCR .................................................................................81

4.2.7 Plasmid constructs ...........................................................................82

4.2.8 Luciferase assay ...............................................................................82

4.2.9 Western blotting ...............................................................................83

4.3. RESULTS ......................................................................................................83

4.3.1 Effects of miRNA inhibition on the cell cycle .................................83

4.3.2 Effect of miRNA inhibition on apoptosis ........................................84

xiv

4.3.3 PTEN, RECK and p27(kip1) validation as target of miR-21 and miR-

221 ....................................................................................................85

4.3.4 FOXO3a as a new target of miR-212 ..............................................86

4.4 DISCUSSION .................................................................................................88


5. SYSTEMIC EVALUATION OF microRNA PROCESSING PATTERNS IN

TISSUES, CELL LINES AND TUMORS ........................................................97

5.1 INTRODUCTION ..........................................................................................97


5.2.1 Cells, tissues and RNA ....................................................................99

5.2.2 Real-time RT PCR, miRNA precursors, and mature miRNA .........99

5.2.3 Real-time RT PCR, absolute copy number for precursor and mature

miRNA .........................................................................................100

5.2.4 Northern blotting ............................................................................101

5.2.5 In situ detection of miRNA ............................................................101

5.2.6 Data analysis ..................................................................................101

5.3 RESULTS .....................................................................................................102

5.4 DISCUSSION ...............................................................................................107

5.5 ACKNOWLEDGMENTS ............................................................................109

6. SUMMARY AND DISCUSSION ....................................................................117

xv

BIBLIOGRAPHY..........................................................................................................124

APPENDICES

APPENDIX A: Data Relevant to Chapter 2 .......................................................147

Table A ....................................................................................................148

Figure A ..................................................................................................198

APPENDIX B: Data Relevant to Chapter 3 .......................................................199

Table B ....................................................................................................200

APPENDIX C: Data Relevant to Chapter 5 .......................................................215

Table C.1..................................................................................................216

Table C.2..................................................................................................251

Table C.3..................................................................................................287

Table C.4..................................................................................................302

Table C.5..................................................................................................316

Table C.6..................................................................................................321

xvi

LIST OF TABLES

Table Page

2.1 Clinical data and tumor pathology ........................................................................46

2.2 Top 20 aberrantly expressed miRNA precursors in pancreatic adenocarcinoma .47

3.1 Sequence and chemical modifications to antisense oligonucleotides ...................73

3.2 miRNA expression, pancreas cancer cell lines normalized to normal pancreas cell

(HPNE) .................................................................................................................74

3.3 Antiproliferative activity parameters of ASO against miR-21, -100, -212, -221

and -301 in human pancreatic cell lines ................................................................76

5.1 microRNA that display tissue-specific or tissue enriched expression ................115

5.2 Relative expression levels of mature miRNA and miRNA� forms ....................116

xvii

LIST OF FIGURES

Figure Page

1.1 miRNA biogenesis ................................................................................................19

1.2 Chemical modification of antisense oligonucleotides ..........................................20

2.1 18S rRNA expression in pancreatic tissue ............................................................38

2.2 miRNA precursor expression in pancreatic samples ............................................39

2.3 Three dimensional expression terrain map ...........................................................40

2.4 Estimated probabilities for the training and test data ............................................41

2.5 miRNA expression by Northern blotting ..............................................................42

2.6 Validation of precursor and mature miRNA levels ..............................................44

2.7 Histologic and molecular analysis of pancreatic cancer for microRNA

expression .............................................................................................................45

3.1 Structures of gemcitabine and deoxycytidine .......................................................65

3.2 Comparison of three antisense oligonucleotides ...................................................66

3.3 The effect of antisense oligonucleotide and control oligonucleotide in pancreatic

cell lines ................................................................................................................68

3.4 Effect of control oligonucleotides on cell proliferation ........................................69

3.5 ASO pretreatment sensitized the antiproliferative effects of gemcitabine ...........71

3.6 Combination index (CIx) versus fraction affected (fa) plots in HS766T cells .....72

xviii

4.1 Flow cytometric analysis of the effect of antisense oligonucleotide (ASO) on cell

cycle of HS766T cells ...........................................................................................92

4.2 Flow cytometric analysis of apoptosis in HS766T cells .......................................93

4.3 Western blot analysis of PTEN, RECK and p27(kip1) in HS766T cells treated

with antisense to miR-21 or miR-221 ...................................................................94

4.4 Alignment of the FOXO3a binding site with miR-212 and mRNA expression of

FOXO3a after ASO treatment .............................................................................95

4.5 Target validation by luciferase assay and FOXO3a western blotting ...................96

5.1 microRNAs with good correlation in expression levels of precursor and

mature .................................................................................................................110

5.2 Expression of miR-128a in 22 normal tissues and cells .....................................111

5.3 Lack of microRNA processing in cancer cell lines ............................................112

5.4 miR-31 expression in cancer cell lines ...............................................................113

5.5 Pearson correlation among the various samples studied .....................................114

6.1 Pancreatic cancer progression model and genetic alteration .............................123

1

CHAPTER 1

INTRODUCTION

1.1 miRNA DISCOVERY

Until very recently, the primary role of RNA was believed to carry genetic

information for protein translation. The discovery of small non-coding RNAs and other

noncoding RNAs has caused many to rethink the role of RNA in biology. microRNA

(miRNA) is endogenous ~ 22 nt non-coding RNA that negatively regulates gene

expression (1-3). miRNA was discovered by the Ambros and Ruvkun laboratories during

genetic screening of developmental progress in C. elegans (4, 5). The lin-4 gene

produced ~ 22 nt noncoding RNA that binds to sequences in the 3’ untranslated region

(3’ UTR) of lin-14 mRNA (4). The interaction between lin-4 and lin-14 caused

translational repression of the lin-14 mRNA (4). The Ruvkun laboratory also discovered

that another small non-coding RNA, let-7, recognized the 3’ UTR of lin-41 mRNA and

repressed LIN-41 protein levels (6). let-7 was conserved in a wide range of animals,

suggesting that other ~ 22 nt regulatory RNAs may exist in other organisms (7).

Shortly thereafter, RNA interference (RNAi) was uncovered in C. elegans by the

Fire and Mello laboratory. They discovered that double-stranded RNA (dsRNA)

2

produced target gene silencing, in which the target mRNA is cleaved in a sequence-

specific manner (8). Twenty-two to twenty-five nt duplex RNA, named small interfering

RNAs (siRNAs), was discovered by the Tuschl laboratory (9). siRNAs mediate

sequence-specific mRNA degradation during RNA interefence (RNAi). siRNA is

generated from long dsRNA by the RNase III, Dicer and it is incorporated into the RNA

induced silencing complex (RISC). mRNA that is 100% complementary to the siRNA

(10) is cleaved. RNAi has been a powerful tool of gene silencing and has been applied in

a wide range of human diseases.

In 2001, interest in the field peaked when hundreds of miRNAs were discovered

in Drosophila, C. elegans and mammals (1-3). These ~ 22 nt endogenous RNAs, derived

from longer hairpin precursors, were named microRNAs (miRNAs). Using

bioinformatics and cDNA cloning methods, miRNA sequences were uncovered based

upon the following criteria; expression of ~ 22 nt mature RNA in one arm of the hairpin

structure, location in intergenic regions, DNA sequence homology between similar

species and containing a stem-loop structure in the precursor transcript (1-3). The

expression of miRNAs was also examined during larval stages and young adults in C.

elegans and gene expression was varied in different stages of development,

demonstrating that they play an important role in developmental timing (1-3). A number

of miRNAs have been identified in a wide range of species such as plant, nematodes,

fruit flies, and human and more miRNA genes are expected to be discovered in many

species (11). At the time of writing, 678 Homo sapiens miRNAs have been discovered

(12).

3

1.2 miRNA BIOGENESIS

Human miRNAs are distributed in all chromosomes except the Y chromosome.

Initially, miRNAs were thought to be located only within intergenic regions (1-3).

However, Rodriguez et al. reported that around 70% of mammalian miRNAs are located

in defined transcription units (TU) i.e. intronic and exonic miRNAs (13). Among those

miRNAs, 61% RNAs are located in the introns of protein-coding TU, 18% are located in

the introns of non-coding TU and some are found in exons of non-coding gene (20%)

(13). Most miRNAs are transcribed by RNA polymerase II. However, miRNAs

positioned within Alu-repetitive elements are transcribed by RNA polymerase III (14).

Some miRNAs are clustered and transcribed together as long polycistronic RNAs.

Clustered miRNAs seem to be functionally linked to each other (15). miR-23a, -27a, -

24-2 and miR-17, -18, -19a, -20, -19b-1 are examples of polycistronic miRNA transcripts

(16). An overall picture of miRNA biogenesis is shown in Figure 1.1.

The primary transcript, called the pri-miRNA contains a 5’ 7-methyl guanosine

cap and 3’ polyadenylate tail (17, 18). Pri-miRNA is processed in the nucleus by Drosha,

an RNase III endonuclease to produce 60 to 70 nt pre-miRNA; the flanking sequences

around the hairpin structure are believed to be degraded (19). The ~ 160 kDa Drosha

crops the stem of the pri-miRNA hairpin structure asymmetrically, i.e. it produces a 2 nt

3’ overhang on the pre-miRNAs. Drosha forms a microprocessor complex of ~ 650 kDa

with the DiGeorge syndrome critical region gene 8 (DGCR8); this complex is conserved

from flies to human (20-23). Drosha shows non-specific RNase activity, but DGCR8

contains two double-stranded RNA binding sites at the C-terminus. This helps Drosha

4

correctly recognize and cleave the hairpin structure at the specific site (20-23). DGCR8

also has a WW domain at the N-terminus, which is believed to interact with proline-rich

peptides and in the proline-rich N-terminus of Drosha (20). Neither Drosha nor DGCR8

shows any processing activity independently (22).

The pre-miRNAs are then exported to the cytoplasm by Exportin-5; a Ran-

dependent nuclear transport receptor (24). Exportin-5 especially transports the minihelix

motif RNAs, which contain a double-stranded stem (> 14 nt) with 3' overhang on the end

(25). ILF3, which is a nuclear protein containing two double-stranded RNA binding

domain and RGG domain forms a quaternary complex with the minihelix motif RNA and

Exportin-5, indicating that ILF3 facilitates transport of pre-miRNA along with Exportin-5

(26). It was believed that if Exportin-5 is inhibited by siRNA, the pre-miRNA would

accumulate and mature miRNA would decrease (24). However, pre-miRNA did not

accumulate in the nucleus, which suggests that pre-miRNA is a quite unstable

intermediate in the absence of Exportin-5 (24).

In the cytoplasm, pre-miRNAs are processed into ~ 22 nt mature miRNA by

another RNase III endonuclease, Dicer (27). Dicer is a highly conserved protein. Dicer

binds with other cofactors such as Loquacious/HIV-1 TAR RNA binding protein (TRBP)

(28, 29). Dicer cleaves the loop of the hairpin to produce the miRNA:miRNA� duplex.

The duplex contains a 5’ phosphate and 2 nt 3’ overhang. Dicer-TRBP recruits

Argonaute protein (Ago 2) to form the RNA-induced silencing complex (RISC)

incorporating the mature miRNAs into the RISC (30). One strand of the duplex miRNA

is degraded and the other strand remains as the mature miRNA. The decision by RISC

as to which strand to degrade is based on base pair stability at the 5’ ends of the duplex

5

miRNA; the miRNA strand with relatively lower stability at 5’ end will remain in RISC

(31).

Finally, the mature miRNA that is incorporated into RISC binds to the 3’ UTR of

the target mRNA and mediates translational repression or target cleavage according to

sequence complementary between miRNA and target mRNA (31). If the mRNA and

miRNA have perfect complementary, miRNA will cleave the mRNA much like a siRNA.

In animals, it is more likely that the miRNA/mRNA interaction will not have perfect

complementarity and the miRNA will repress translation (32). mRNA destabilization is

caused by deadenylation and decapping (33). Translational initiation or elongation might

also be inhibited (34, 35). However, the Steitz laboratory recently reported that miRNA

may also up-regulate translation during cell cycle arrest, indicating that translational

regulation by miRNA can be either repressive or activating (36). miRNA is generally

thought to bind to the sequence of 3’ UTR. However, recent reports showed that miRNA

can also bind to other sites. For example, let-7 binds to the mRNA target sites in either

the coding region or the 5’ UTR in zebrafish (37) and the Steitz laboratory demonstrated

that miRNA binds the target mRNA efficiently in the 5’ UTR as in the 3’ UTR (38).

Also, the Lund laboratory showed that miR-10a binds to the 5’ UTR of ribosomal

proteins mRNA and enhances the translation, suggesting that miR-10a may control global

protein synthesis (39). These studies imply that miRNA has more diverse and complex

functions.

Recent work has demonstrated that miRNA biogenesis may be regulated in

developmental stages or specific tissues (40-44). One control mechanism is

transcriptional regulation. let-7 is regulated by a transcriptional enhancer element in C.

6

elegans (41). Another mechanism is post-transcriptional regulation. pri-miR-18a

requires an RNA-binding protein hnRNP A1 for processing to the precursor (40). The

RNA binding protein, lin-28 inhibits the processing of pri-let-7 miRNAs in embryonic

cells (44). pre-miR-138-2 is restricted to Dicer cleavage in certain tissues and cell types

(43). Finally RNA editing, which converts adenosine (A) to inosine (I), can inhibit Dicer

cleavage. Edited pre-miRNA accumulates, indicating that Dicer-TRBP complex cannot

bind to edited pre-miRNA (42).

1.3 miRNA TARGET IDENTIFICATION

miRNAs control gene expression by binding to the 3’ UTR of target mRNA. It is

estimated that approximately 30% of human genes are regulated by miRNA (45).

Although 678 human miRNAs have been reported, identification and validation of their

targets has been a challenge. Knowing the miRNA’s target is crucial to identifying the

miRNAs function.

The first miRNA target was the lin-14 gene (4). Further studies (46, 47)

identified the criteria for the miRNA/mRNA interaction by mutating known target

binding sites. Of particular importance is the 5’ seed region of the miRNA. This 5’ seed,

consisting of nts 2-8, must bind perfectly to the target mRNA sequence. The Cohen

laboratory reported the minimal target site for miRNA function (46). They mentioned

that seven or more sequences that are complementary at the 5’ end of the miRNA are

enough to show function. If the 5’ sequence has weaker binding, then the 3’

compensatory binding is required. However, extensive binding at the 3’ site without 5’

7

complementarity is not enough to have miRNA function (46). Even though 5’

complementary sequence is important to predict the target gene, 3’ complementary site is

also important to distinguish the target of miRNA isoforms. miRNA isoforms may target

the same gene or different genes. For example, let-7 family members (e.g. let-7, miR-48,

miR-84 and miR-241) have weak seed binding to one known target (lin-41), but only let-

7 has strong 3’ binding and lin-41 is regulated by only let-7 among let-7 family members.

In addition, G:U wobble in the seed sequence also showed negative effect in binding

activity (46).

Other elements may affect target binding. Secondary structure in 3’ UTR of the

mRNA may prevent the miRNA from binding to the site (48). Several laboratories imply

that target regulation by miRNA is also dependent on 3’ UTR context. For example, the

function of CAT-1, which is a target of miR-122, depends on the presence of HuR

protein binding site (49) and lsy-6 functionally binds to the target site (cog-1) in

endogenous 3’ UTR, but not in a heterologous 3’ UTR (50).

Several target prediction programs have been developed. The main algorithms

used in these programs include a 5’ seed sequence match and a calculation for the

thermodynamic stability between miRNA and mRNA. TargetScan

(http://www.targetscan.org) (45, 47, 51) is one program used to predict mammalian

miRNA targets. It finds conserved 8 mer and 7 mer sites that match the seed sequence of

the miRNA and calculates the free energy using the RNA Fold algorithm. A false

positive rate of between 22-31% may be expected from TargetScan. PicTar

(http://pictar.bio.nyu.edu) (52-54) is used to identify miRNA target genes in C. elegans,

Drosophila, and vertebrates. It identifies targets for single miRNA as well as targets that

8

are regulated by several miRNAs in a coordinated manner. It predicts around 200 targets

per miRNA with an estimated false positive rate of around 30%. Lastly, miRanda

(http://microrna.sanger.ac.uk) (55) uses sequence match and binding energy between the

miRNA and the predicted target site. Evolutionary conservation of the target binding site

is applied; miRanda has a 24-39% false positive rate.

However, prediction programs don’t account for all of the criteria. For example,

3’ UTR accessibility and/or 3’ UTR context (specific RNA- or protein-based cofactors)

as well as the 5’ seed region and thermodynamics may be important criteria for target

prediction. Combining all these possible factors can produce better performance to

predict the miRNA target. Moreover, a single miRNA targets numerous genes and one

target gene is regulated by multiple miRNAs. This suggests that miRNA and target

network might be more complicated than originally expected and that experimental

validation should be performed carefully.

1.4 miRNA EXPRESSION AND PROFILING

miRNA profiling is a major discovery tool to identify tissue-specific or disease-

specific miRNAs. Several methods are available to profile miRNA expression. These

include Northern blotting, microarray, real-time PCR and in situ hybridization. The

benefit of Northern blotting is that both mature and precursor transcripts are visualized at

the same time on the blot. However, it is a laborious technique with poor sensitivity and

requires large amounts of RNA (10-30 µg). Another method is cDNA microarray (56).

cDNA arrays are used in many laboratories for high-throughput screening since

9

thousands of genes may be placed on the array. cDNA microarray is based on the

hybridization between the target gene and probe. However, it often shows low sensitivity

and variation in signal intensity (57). In addition, microarray data should be corrected

from background and normalized to reduce dye labeling bias, variations in hybridization

and scanning (58). Therefore, the microarray data should be confirmed by northern blot

or real-time PCR. Real-time PCR is the most sensitive of the high-throughput screening

methods. Performing real-time PCR on miRNA is a challenge because the precursors

exist as a stable hairpin and the mature miRNA is ~ 22 nt, roughly the size of a standard

PCR primer. The Schmittgen laboratory developed a PCR assay to amplify precursor

miRNA as a means to predict the mature miRNA expression (59). Shortly thereafter,

Applied Biosystems developed a real-time PCR assay to the the mature miRNA (60).

This assay is named the looped primer PCR assay because the RT primer consists of a

stable loop structure. Stem-loop RT primers were developed for several reasons. It

increases the annealing temperature to the mature miRNA. It also avoids precursor

miRNA or genomic DNA from being amplified. Finally, it extends the size of the ~ 22 nt

mature miRNA. Since the mature assay uses TaqMan probes, it enhances sensitivity to

distinguish miRNA family members (61). The assay is sensitive enough to profile the

miRNA expression from a single cell (62, 63).

miRNA profiling of human cancers is a useful tool to classify cancer type

according to their origin. Jiang et al. (61) profiled around 200 miRNA precursors in 32

human cancer cell lines and hierarchical clustering showed that most of cell lines are

clustered into each tissue type based on their origin. Also, human pancreatic tumor

tissues and normal tissues were used to profile miRNA precursors and the heatmap

10

results demonstrated that the tumor tissue group was completely separated from the

normal tissue group (64). Golub’s group (65) profiled miRNAs in 334 human samples

using a bead-based flow cytometric method. Many miRNAs were down-regulated in the

tumor samples. Hierarchical clustering classified the epithelial and hematopoietic

samples based on the developmental origins of the tissues. Interestingly, cancers within a

single cell lineage were further discriminated according to their genetic abnormality.

Profiling data from 200 miRNAs correctly classify each tumor group, but profiling data

from around 16,000 mRNAs did not (65). This evidence suggests that miRNA profiling

can distinguish the phenotypic signature of diverse types of cancers and that miRNA may

be used as a potential diagnostic marker.

1.5 miRNA EXPRESSION IN HUMAN CANCER

Several miRNAs are tissue-specific or developmental specific, indicating that

they could play important roles in many biological processes. For example, miRNA-143

regulates adipocyte differentiation (66), miRNA-375 regulates insulin secretion (67),

human embryonic stem cells express a unique set of miRNAs (68), and miRNA also

controls oocyte maturation in Drosophila (69).

miRNA expression also plays a role in the initiation and progression of certain

diseases. miR-1 was identified to play a key role in cardiomyocyte differentiation and

cardiovascular development (70). Human angiotensin II type 1 receptor, which function

as vasoconstrictor and plays a role in the pathogenesis of cardiovascular diseases, is

regulated by miR-155 (71). miRNA is also linked to several neurodegenerative diseases

11

such as X mental retardation syndrome (72), Alzheimer’s disease (73) and Parkinson’s

disease (74).

In addition, there is mounting evidence that miRNAs are involved in a number of

human cancers and that miRNAs may act as both tumor suppressors and oncogenes. A

decrease in the expression of a tumor suppressive miRNA will cause an increase in the

target oncogene. In contrast, an increase in expression of oncogenic miRNAs will lead to

the reduction of the target tumor suppressor. Some miRNAs are overexpressed in cancer

and some are down-regulated in cancer. For example, miR-15, -16 (75), miR-143, -145

(76-78), let-7 (79), miR-199a, -199a� (80-82) and 122a (81, 83) are reduced in cancer.

miR-21 (84-87), miR-221, -222 (88-90), miR-100 (88) and miR-155 (91) are increased in

cancer. It is still uncertain if differentiated miRNA expression is a cause or outcome of

tumor transformation. Kumar et al. (92) knocked down Drosha and Dicer enzymes in

cell lines producing a global reduction of mature miRNA expression. This reduction in

mature miRNA levels caused an increase in cell growth. Using a Dicer deficient lung

cancer mouse model, tumor burden (area, size and number) was increased compared to

control. Furthermore, RAS and c-Myc were up-regulated, suggesting that a global loss of

miRNA boosts tumorigenesis.

Each cancer type shows a specific miRNA expression. Perhaps the best

characterized miRNAs in human cancer is miR-15 and miR-16 in human chronic

lymphocytic leukemia (CLL). Deletion of the chromosome 13q14 region is common in

more than 50% of CLL; miR-15 and miR-16 are located at 13q14.3 (75). The Croce

laboratory showed that miR-15 and miR-16 were deleted or down-regulated in more than

60% of CLL samples and that these miRNAs negatively regulate BCL-2 (93). Another

12

example is the miR-17-92 cluster. This cluster is increased in human B-cell lymphomas

and is located at 13q31.3, which is amplified in B-cell lymphoma (94). He et al. also

showed that expressing the miR-17-92 clutster in mice accelerated c-Myc induced tumor

formation, demonstrating that miR-17-92 cluster is oncogenic. In contrast, c-Myc

negatively regulates the transcription of the miR-17-92 cluster and two miRNAs from

this cluster (miR-17-5p and miR-20a) negatively regulate the transcription factor E2F1

(95), suggesting this cluster functions as a tumor suppressor miRNA. Theses results

suggest that the identical miRNA may show both functions depending on tissue of cell

types. miR-155/BIC RNA is elevated in B-cell lymphomas (91). The expression of miR-

155 was higher in cells with an activated B cell phenotype compared to the germinal

center phenotype. Since patients with activated B cell type lymphoma show worse

prognoses, this suggests that miR-155 may be used for as a diagnostic marker (91). The

Croce laboratory showed that a miR-155 overexpressing transgenic mouse displayed pre-

leukemic pre-B cell proliferation in spleen and bone marrow, followed by B cell

malignancy (96).

The expression of mature miR-143 and miR-145 were decreased in colorectal

neoplasia (76). Interestingly, the expression of the hairpin precursors in normal and

tumor tissues remained constant, demonstrating posttranscriptional processing is reduced

in cancer. In lung cancer, let-7 is down-regulated in the tumor and patients with reduced

let-7 had a reduced postoperative survival (79). RAS oncogene is a possible target gene

of let-7 (97) and Yanaihara et al. reported that high expression of miR-155 and low

expression of let-7a-2 correlated with poor survival in lung cancer (98). Several miRNAs

13

are also involved in human breast cancer (99), papillary thyroid carcinoma (90), primary

glioblastoma (100), and hepatocellular carcinoma (82).

Some miRNAs are implicated in several types of cancer. In particular, miR-21 is

overexpressed in B cell lymphoma (101), CLL (102) and many solid tumors, e.g.

pancreatic cancer (64), ovarian cancer (103), esophageal cancer (104), uterine

leiomyomas (105), head and neck cancer (106), colorectal cancer (107) gastric cancer

(108). It was shown that miR-21 is up-regulated in glioblastoma and knockdown of miR-

21 enhanced apoptosis, suggesting miR-21 targets apoptosis-related genes (87). Iorio et

al. (99) and Si et al. (85) also found that miR-21 is overexpressed in breast cancer. Si et

al. showed that anti-miR-21 oligonucleotide decreased cell growth in vitro and in vivo

and they suggested that miR-21 is an oncogene that is associated with the anti-apoptotic

gene BCL-2. Zhu et al. (109) used two-dimensional gel electrophoresis to identify

targets of miR-21 and found that the tumor suppressor gene tropomyosin 1 (TPM1) as a

target of miR-21 in a breast cancer cell line. The Patel laboratory demonstrated that miR-

21 is highly expressed in hepatocellular cancer (86, 110). Inhibition of miR-21 sensitized

the effect of gemcitabine and miR-21 functioned in cell proliferation, migration and

invasion targeting the phosphatase and tensin homolog of PI3 kinase signaling (PTEN).

Recently, a paper showed that the tumor suppressor gene, programmed cell death 4

(PDCD4), is also negatively regulated by miR-21 and that oncogenic miR-21 promotes

cell transformation (111). Löffler et al. explained that miR-21 contributes to signal

transducer and activator of transcription 3 (Stat3)-mediated survival of myeloma cells

(112).

14

This body of evidence indicates that miRNA may act as oncogenes or tumor

suppressor genes and that miRNAs are involved in cell proliferation, apoptosis, cell cycle,

development and metabolism. Identification of miRNAs and the genes they regulate may

provide potential targets for diagnosis and therapy in human cancer.

An important question is what are the causes of differential expression of miRNA

in cancer? Because cancer is a complex genetic disease, the cause might be complicated.

Many miRNAs are located in genomic regions that are involved in cancer including

minimal regions of loss of heterozygosity (LOH), minimal regions of amplification, or

common breakpoint regions (113). Zhang et al. showed that alterations in the DNA copy

of genes that are involved in miRNA biogenesis, such as Dicer 1 and Argonaute 2 may

regulate miRNA expression in tumors (114). In addition, epigenetic regulation such as

DNA hypomethylation, CpG island hypermethylation and the alterations of histone

acetylation (115), transcriptional, posttranscriptional, and translational regulation may

explain the deregulation of miRNA expression in tumors. For example, miR-124a and

miR-127 are inactivated by hypermethylation in several human cancers (116, 117).

1.6 miRNA THERAPEUTICS

As mentioned above, one third of the human genome is regulated by miRNA.

Since one miRNA targets multiple mRNAs, one deregulated miRNA in cancer can affect

the expression of scores of downstream genes. The expression of miRNA is deregulated

in many types of cancer, indicating that miRNAs play important roles in cancer.

Therefore, cancer-related miRNAs are promising targets for therapeutics.

15

The most common method of inhibiting miRNA is with antisense

oligonucleotides (ASO). Other possible options for miRNA blocking are using target

protector or targeting miRNA processing molecules. Target protector binds to the

miRNA binding site in the 3’ UTR of mRNA and it inhibits the miRNA’s access to the

binding site (118). Target protector has the complementary sequence of the seed region

and additional flanking sequence of the 5’ or 3’ binding site. Many molecules, including

Drosha and Dicer are involved in miRNA processing and inhibiting the processing steps

in cancer with increased miRNA expression could reduce mature miRNA. However, this

method can cause diverse blocking effects on other miRNAs and this technique showed

mild anti tumor effect in vitro experiments (19), suggesting that this is not a practical

approach to inhibit miRNA expression. For replacement of miRNA in cancer with

reduced miRNA expression, miRNA mimetics and miRNA expressing vectors could be

used. Although miRNA-based therapeutics is promising, their effective delivery to

specific tissue is a critical issue that needs to be addressed.

1.6.1 Inhibition of miRNA using antisense oligonucleotides (ASO)

For the past 20 years, the antisense field has progressed to better understand the

mechanism of action, delivery, pharmacokinetics, chemical modifications and function of

antisense (119). Antisense is 15-20 nts that binds to target RNA through Watson-Crick

base-pairing. There are several possible mechanisms of action for antisense. Antisense

may bind to the target RNA inhibiting translation (120, 121) or modulating pre-mRNA

splicing (122). Sense-antisense (RNA-DNA) duplex recruits an endogenous nuclease,

RNase H, which degrades only the target RNA (119). Chemically modified

16

antisense with 2’ sugar modifications and phosphorothioate backbone modification

showed effective inhibition of miRNAs (123-126) (Figure 2). For 2’ sugar modifications,

2’-O-methyl (2’-OMe), 2’-O-methoxyethyl (2’-MOE), 2’-flouro (2’-F) and locked

nucleic acid (LNA) are used in vitro. The modified antisense shows improved activity,

stability and delivery. Other modifications to antisense also enhance the silencing effect.

For example, antisense to miR-122 was linked with cholesterol at the 3’ end. The so-

called Antagomirs produced sustained knock down of miR-122 in mouse liver up to 23

days after injection (127). Inhibition of miR-21 in glioblastoma cells and inhibition of

miR-125b-1 in HeLa cells and PC3 cells results in apoptosis and decreased cell viability

(87, 128). These data suggest that antisense may be used to inhibit miRNA and that it

can be used as a potential therapy in cancer treatment.

However, antisense may have “off-target” effects. Antisense and random target

genes may bind to each other producing an unexpected non-target effect. One paper

demonstrated that phosphorothioate backbone modification showed non-antisense effects

through binding of cellular proteins (129). To measure the off-target effects of antisense,

several mismatch control oligos containing the same nucleotide composition as the

antisense should be tested and selection of good control oligonucleotides, better

modification and alternative delivery method might reduce these problems.

1.6.2. Replacement of miRNA

In situations of reduced miRNA expression in certain diseases, re-introduction of

the miRNA could be advantageous. One method of re-introducing miRNA is through

miRNA mimetics or miRNA expressing vectors. miRNA mimetics contain endogenous

17

mature miRNA sequence in a duplex structure. The duplex structure is necessary

because RISC is more efficient at loading small RNAs from double-stranded RNAs

rather than a single-stranded RNAs (130). RISC will also process the duplex to release

the single stranded mature miRNA. miRNA mimetics successfully inhibit Gli-1

expression and modified miRNA mimetics could show better effect than endogenous

miRNA (131).

An alternative method to replace miRNA is through the use of short hairpin RNA

(shRNA) vectors. This vector can maintain silencing effect for a long period of time and

more than one miRNA transcripts can be expressed from the same vector. shRNA may

introduce enough pre-miRNA, to cause saturation of the Exportin-5 pathway (132).

Modified adenovirus have been used, but problems with immune response to the

adenovirus and available tissues that virus can efficiently infect limit the usage of this

virus (133). Lentivirus also have been studied for shRNA vector and this produces more

stable and persistent silencing effect because it incorporates into the genome (134).

However, lentivirus shows the possibility of insertional mutagenesis and wild-type virus

production (134).

1.7 OJECTIVE OF DISSERTAION

The first aim of this study is to identify the most important miRNAs that are

deregulated in pancreatic cancer. Theoretically, these deregulated miRNAs may be used

for diagnosis or treatment of pancreatic cancer. The expression of miRNA precursors

was investigated in pancreatic tissues and cancer cell lines (Chapter 2). Overexpressed

18

miRNAs in pancreatic cancer were inhibited using antisense oligonucleotides (Chapter 3

and 4) and the effects of combining antisense oligonucleotides to miRNA and commonly

used a chemotherapeutic agent was studied (Chapter 3). The target molecules of

miRNAs that are deregulated in pancreatic cancer were studied in Chapter 4.

The second aim was to see if the processing of miRNA differed in various normal

tissues, cancer cell lines and in patients’ tumor tissue (Chapter 5).

19

Figure 1.1. miRNA biogenesis.

miRNA gene Pol II

Drosha/DGCR8

cap AAA….A Pri-miRNA

Nucleus

Cytoplasm

Pre-miRNA Exportin-5

Pre-miRNA

Dicer Dicer/TRBP/Ago

Mature miRNA in RISC

20

Figure 1.2. Chemical modification of antisense oligonucleotides. (A): 2’-MOE (2’-O-methoxyethyl), (B): 2’-OMe (2’-O-methyl), (C): 2’-F, (D): LNA,

(E): phosphorothioate backbone, (F): phosphodiester backbone.

21

CHAPTER 2

EXPRESSION PROFILING IDENTIFIES MICRORNA SIGNATURE IN

PANCREATIC CANCER

2.1 INTRODUCTION

Pancreatic cancer is the fourth leading cause of cancer-related death in the United

States (135). The annual death rate over the last five years has been ~30,000 with a

similar number of new cases diagnosed each year. The prognosis for pancreatic cancer is

the worst of all cancers with a mortality/incidence ratio of 0.99 (136). The incidence of

pancreatic cancer in the United States is ~9 per 100,000 (137). These discouraging

numbers, reflecting the increasing rates of incidence and death, are due to the lack of

improvement in detection and diagnosis strategies and the paucity of breakthroughs in

treatment regimens.

A growing number of direct and indirect evidence suggests a relationship between

altered miRNA expression and cancer. These include miR-15a and miR-16-1 in chronic

lymphocytic leukemia (56, 113), miR-143 and miR-145 in colorectal cancer (76), let-7 in

lung cancer (79, 97) and miR-155 in diffuse large B cell lymphoma (91). Expression

profiling has identified other cancers with differential expression of several miRNAs,

22

including breast cancer (99), glioblastoma (87, 100) and papillary thyroid cancer (90). A

polycistron encoding five miRNAs is amplified in human B-cell lymphomas and forced

expression of the polycistron along with c-myc was tumorigenic, suggesting that this

group of miRNAs may function as oncogenes (94, 95).

The purpose of this study was to profile the miRNA expression in clinical

specimens of pancreatic adenocarcinoma. A real-time, quantitative PCR assay (59, 61)

was used to profile the expression of over 200 miRNA precursors in clinical specimens of

pancreatic cancer and pancreatic cancer cell lines. A unique miRNA signature was

identified that distinguished pancreatic cancer from normal and benign pancreas.

2.2 MATERIAL AND METHODS

2.2.1 Tissue procurement

The tissue samples analyzed in this study were derived from patients undergoing a

surgical procedure to remove a portion of the pancreas at the University of Oklahoma

Health Sciences Center and The Ohio State University. The collection of samples

conformed to the policies and practices of the facility’s Institutional Review Board.

Upon removal of the surgical specimen, research personnel immediately transported the

tissue to the surgical pathology lab. Pathology faculty performed a gross analysis of the

specimen and selected cancerous appearing pancreatic tissue and normal appearing

pancreatic tissue for research. Each sample was placed in a cryovial and flash-frozen in

liquid nitrogen and stored at -150°C until analysis. Subsequent pathologic analysis by

the institutes providing the surgical specimens confirmed the histopathology of the

23

samples taken for research. A second level of quality control was performed on the

adjacent benign tissues by the laboratory that performed the RNA analysis. Histological

slides were prepared from the section of the frozen tissue directly adjacent to tissue from

which RNA was isolated. These slides were examined by one of us (W.L.F.) to

determine if the benign tissues contained any pancreatic tumor cells. Benign tissue that

contained residual tumor was not included in the study. The clinical data on the

specimens are listed in Table 2.1.

2.2.2 Cell lines

The following pancreatic tumor cell lines were purchased from American Type

Tissue Collection (Manassas, VA), which are Panc-1, HS766T, MIA PaCa-2, HPAF-II,

BxPC-3, Mpanc-96, PL45, Panc03.27 and Panc10.05. Cell lines were cultured in RPMI

1640 medium with 10% FBS or other optimized complete medium using standard

conditions.

2.2.3 miRNA precursor expression profiling

Total RNA was isolated from the cell lines or tissues in 1 ml of Trizol (Invitrogen,

Carslbad, CA). Frozen tissues (~10 mg) were first pulverized in a stainless steel mortar

and pestle. Total RNA from normal pancreases were purchased from Ambion (Austin,

TX), BD Biosciences (Mountain View, CA) and Stratagene (La Jolla, CA). All donors of

the normal tissue died from complications other than pancreatic diseases (Table 2.1).

RNA concentration was determined by analyzing 1 µl of solution using the ND-1000

micro-spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA integrity

24

was evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).

RNA integrity number (RIN) was determined using the RIN algorithm of the Agilent

2100 expert software (138) (Table 2.1). RNA with a RIN ≥ 4 was included in the study.

RNA was briefly treated with RNase-free DNAase I and cDNA was synthesized from 1

µg of total RNA using gene specific primers to 222 miRNA precursors plus 18S rRNA as

described (59, 61). The expression of 222 miRNA precursors was profiled using a real-

time quantitative PCR assay (59, 61). Duplicate PCRs were performed for each miRNA

precursor gene in each sample of cDNA. The mean CT was determined from the

duplicate PCRs. Relative gene expression was calculated as 2 — (C

TmiRNA— C

T18SrRNA).

Relative gene expression was multiplied by 106 to simplify the presentation of the data.

The raw relative miRNA precursor expression data are provided in Appendix Table A.

2.2.4 Real-time PCR of mature miRNA

Assays to quantify the mature miRNA (i.e. TaqMan®

microRNA Assays, Applied

Biosystems Foster City, CA) were conducted as described (60) with one modification. A

5X cocktail containing 28 different antisense looped RT primers was prepared by

concentrating the 2X stock solutions in a Speed Vac. One hundred nanograms of total

RNA was heated for 5 min at 80°C and then incubated for 5 min at 60°C with 10 µM of

the 18S rRNA antisense primer followed by cooling to room temperature. Three

microliters of the 5X looped primer mix was then added and the cDNA was made as

described (60). This allowed for the creation of a library of 28 miRNA cDNAs plus the

18S rRNA internal control. Real-time PCR (10 µl total reaction) was performed as

described (60) using 1 µl of a 1:50 dilution of cDNA. Duplicate PCRs were performed

25

for each mature miRNA gene in each sample of cDNA. The mean CT was determined

from the duplicate PCRs. Gene expression was calculated relative to 18S rRNA as

described earlier and multiplied by 106 to simplify data presentation.

2.2.5 Northern blotting

Northern blotting was performed as previously described (2, 59). DNA

oligonucleotides of the reverse compliment to the mature miRNA were used as probes.

Blots were successfully stripped and reprobed up to 3 times.

2.2.6 RT in situ PCR

The RT in situ PCR protocol was performed as previously described (139). Briefly,

optimal protease digestion time was determined using nonspecific incorporation of the

reporter nucleotide digoxigenin dUTP. Optimal protease digestion was followed by

overnight incubation in RNase-free DNase (10 U per sample, Boehringer Mannheim,

Indianapolis, IN) and one step RT/PCR using the rTth system and digoxigenin dUTP.

The chromogen is nitroblue tetrazolium and bromochloroindolyl phosphate (NBT/BCIP)

with nuclear fast red as the counterstain. The primer sequences to the precursors of miR-

221, miR-301 and miR-376a were the same as those used for the profiling (61). The

negative controls included omission of the primers and substitution with irrelevant

(human papillomavirus specific) primers, as this virus does not infect pancreatic tissue.

RT in situ PCR was performed on the archived, formalin-fixed paraffin-embedded

sample 1050005A2(T) (Table 2.1).

26

2.2.7 Statistics

The ∆CT data for 201 gene expression values (relative to control gene expression)

were mean-centered and analyzed using the following strategy. The expression patterns

of unfiltered data were assessed using unsupervised hierarchical clustering of samples

and unsupervised hierarchical clustering of genes based on average linkage and Euclidian

distance (140, 141). To determine genes that are differentially expressed between groups

of samples, the data were filtered on significance of differences using multi-group

permutations-based ANOVA test (Welch approximation) with p < 0.01 (10,000 random

permutations) and multiple testing correction (Westfall-Young step-down correction with

maxT). To compare the expression patterns of differentially expressed genes, the filtered

data were analyzed using hierarchical clustering of samples and hierarchical clustering of

genes based on average linkage and Euclidian distance (140, 141).

Additional cluster analysis of filtered data was done using an expression terrain

map (142). Terrain maps provide a three-dimensional overview of the major clusters

inherent in the data. Samples were first mapped into a two-dimensional grid in which the

placement of each element is influenced by a number of nearest neighbors based on

Euclidian distance that was calculated using miRNA precursor expression data. The third

dimension is determined by the density of points over the two-dimensional grid and its’

value is projected as a surface; higher peaks indicate larger numbers of very similar

elements. The average correlation between each pair of samples was also calculated.

Each pair of samples with an average correlation above the threshold (0.8) is indicated on

the expression terrain map by a line connecting the two samples. This allows visualizing

subsets of samples with a highly correlated pattern of miRNA expression. Peaks

27

representing samples from a particular cluster are labeled with color coded spheres on top

of each peak.

A supervised machine learning algorithm was applied for classification of

samples based on unfiltered miRNA expression data. The predictive scores for each

miRNA were calculated based on 2 class comparison (normal vs. tumor) of expression

data using the prediction analysis of micro-arrays algorithm (PAM) (143) based on

training, take-one-out cross validation and testing procedures. The division of the

samples into training and test sets is done using the commonly accepted approach of

randomly splitting data into training and test sets (usually 2/3 for train, 1/3 for test) (143).

For this study, tumor samples were randomly split into ~75% for training and 25% for

testing. Since the number of normal cases was small (N = 6), normal cases were included

in the training set only. The small number of chronic pancreatitis samples (N = 4) were

not included in the PAM analysis. While, two levels of quality control were performed to

eliminate adjacent benign tissue that contained any tumor cells, the RNA was extracted

from whole tissue rather than microdissected tissue. Thus, we could not completely rule

out the possibility that some tumor cells contaminated the adjacent benign, nor do we

know if early premalignant changes have occurred in these benign samples that are

obtained from tissue adjacent to tumor. Therefore benign samples were excluded from

the training set in order to train the classifier on true normal and tumor cases. Benign

cases were used in the test set.

28

2.3 RESULTS

2.3.1 Validation

Pancreatic tissue is rich in ribonuclease and care must be taken during RNA

isolation to reduce the possibility of autolysis. To validate the integrity of the RNA

isolated from the pancreatic tissue, ~100 ng of each RNA sample was assayed using the

Agilent 2100 Bioanalyzer. Fifty-two tissues had a RIN ≥ 4 (median 7.6, range 4.3–9.6,

Table 2.1).

miRNA precursor expression in each of the samples was determined using real-

time PCR and normalized to an internal control gene. Since equivalent amounts of total

RNA was added to each RT reaction, 18S rRNA was validated as the internal control by

comparing the mean expression among the various samples (i.e. tumor, normal and

benign). There was no statistically significant difference in the mean 18S rRNA

expression between the tumor samples or the normal pancreas (p = 0.116, Figure 2.1).

The 18S rRNA expression in the tumor and normal tissue determined here are in

agreement with those previously reported in pancreatic tissue (144). Since there was no

significant difference in the 18S rRNA expression between the tumor, normal and benign

groups, 18S rRNA was selected as the internal control gene in the study.

2.3.2 miRNA precursor profiling in pancreatic tissues

The expression of 201 miRNA precursors, representing the 222 miRNAs

discovered as of April, 2005 was profiled in 28 tumors, 15 adjacent benign tissues, 4

chronic pancreatitis specimens, 6 normal pancreas tissues and 9 pancreatic cancer cell

29

lines. Unsupervised hierarchical clustering of samples was performed on the entire set of

unfiltered data. The heatmap demonstrates that unfiltered expression data of only 201

miRNA precursors sufficiently sorts the samples into clusters of normal pancreas, tumor

and cell lines (Appendix Figure A). While most of the benign samples clustered together

with the normal pancreas samples, several benign samples clustered with the tumor

samples or pancreatitis.

The miRNA precursor expression data was filtered using multigroup ANOVA.

Statistical filtering of data is conventionally considered to be a required step of the

expression data preprocessing because gene expression data are inherently noisy.

Hierarchical clustering of samples and genes was performed on the resulting 112

miRNAs. Hierarchical clustering of filtered data allowed us to identify major groups of

miRNAs that have different patterns of expression in the resulting four clusters of

samples (Figure 2.2 a,b). One cluster contained only cell lines. Another cluster

contained all 6 normal pancreases and 9 of 15 benign tissues. A third cluster contained

the 4 chronic pancreatitis specimens and 1 benign tissue. Finally, a large cluster

contained 28 of 28 tumors and 5 benign tissues (Figure 2.2 a,b).

The filtered data were also analyzed using a different clustering technique known

as expression terrain maps (142). The terrain map separated the expression data into 5

main groups of samples (Figure 2.3). Like the hierarchical clustering, the terrain map

separates groups of samples from the normal pancreas, the cell lines, pancreatic

adenocarcinomas and chronic pancreatitis. This analysis showed that each of the clusters

of samples occupies distinct regions on the expression terrain map thus providing

additional evidence that each of the 4 groups of samples has distinct patterns of miRNA

30

expression and suggests the possibility of finding subsets of microRNAs that discriminate

normal and tumor samples. Most of the adjacent benign tissue grouped in between the

normal and tumor, while those benign samples that clustered with the tumor also grouped

with the tumor on the terrain map (Figure 2.2 and 2.3). As an additional feature of terrain

map, the average correlations of all miRNA expression values were calculated between

each pair of samples. Those correlations above the threshold of 0.8 are shown as lines

connecting pairs of samples with similar patterns of miRNA expression. This allows

visualizing subsets of samples with a highly correlated pattern of miRNA expression.

The samples within each of the 4 main groups are connected (i.e. average correlation

>0.8) but there were no between the groups connections, except for two pancreatitis

samples that correlated with some of the tumor samples (Figure 2.3).

Comparing the gene expression profile among different pancreas tissues has been

used to eliminate the stroma and cell proliferation (e.g. cell line) contributions and

identify genes expressed in pancreatic tumors (145-147). An attempt to perform such

analysis on the miRNA expression data in Figure 2.2a was unsuccessful due to the

uniformly high expression in the cancer cell lines and the uniformly low expression in the

pancreatitis samples. However, a number of possible tumor-related miRNAs were

identified that were increased in the cell lines or tumors but not in the normal or

pancreatitis (Figure 2.2a).

2.3.3 Data analysis by prediction analysis of micro-array algorithm (PAM)

The PAM classification algorithm was used to determine if the miRNA

expression data could predict which class the samples fit (tumor or normal) and to

31

determine the most important, differentially expressed miRNAs related to pancreatic

adenocarcinoma. The unfiltered data on 201 pre-miRNAs were analyzed by the PAM

algorithm (143). The 3 genes with more than 75% of missing data were eliminated from

the analysis in order to prevent possible artifacts of the imputation algorithm. PAM

training and cross-validation were conducted using the 6 normal pancreas and 18

pancreatic tumors. PAM has correctly classified 100% of the normal and tumor samples

(Figure 2.4a). PAM testing was conducted on 10 tumor samples and 15 adjacent benign

samples. PAM has correctly classified 100% of the tested tumor samples and 11 of 15 of

the tested benign samples (Figure 2.4b). The 20 top ranked differentially expressed

miRNAs in pancreatic adenocarcinoma as selected by PAM are listed in Table 2.2.

2.3.4 Validation of miRNA expression

The real-time PCR assay used in this study quantifies the miRNA precursors and

not the active, mature miRNA (59, 61). Northern blotting was performed on the identical

RNA used in the real-time PCR analysis to validate if the mature miRNA correlated with

the precursor. Expression levels of mature miR-100, mir-375and miR-155 from 4 normal

pancreases and 5 pairs of tumor/adjacent benign tissue paralleled the miRNA precursor

levels by PCR (Figure 2.5). miR-100 and miR-155 were among the top 20 differentially

expressed miRNAs (Table 2.2). miR-375 was validated by Northern blotting because it

was one of the few miRNAs with decreased expression in pancreas cancer. While miR-

375 was not among the top 20 miRNAs (Table 2.2), the expression of both precursor and

mature miR-375 was significantly decreased in pancreas cancer by real-time PCR (p < 1

X 10-5

). miRNA expression in the paired benign and tumor tissue was consistently

32

increased or decreased in all cases, demonstrating that the differences in miRNA

expression between tumor and benign are due to differences in individual patient’s tissues

and not due to differences in the mean expression of the group.

The real-time PCR data was further validated using a commercially available real-

time PCR assay to amplify and quantify the mature miRNA. Mature miRNA expression

was validated on 8 of the top aberrantly expressed miRNAs from PAM. cDNA from the

following tissues were assayed: 6 normal pancreases, 16 pancreatic adenocarcinomas and

10 adjacent benign tissues that were predicted as normal from PAM. The mature miRNA

expression highly correlated with the miRNA precursor (Figure 2.6). To our knowledge,

this is the initial presentation of both precursor and mature miRNA expression

determined by sensitive, real-time PCR assays. A direct comparison between the

precursor and mature PCR data presented in Figure 2.6 is not possible. Among other

reasons, different amounts of RNA were added to each RT, 1 µg for the precursor assay

and 100 ng for the mature. Despite these differences, the relative amount of mature

miRNA is greater than the precursors in all cases except for panel H. This demonstrates

that the steady state levels of mature miRNA are more predominant than the precursors, a

fact that is documented on nearly all published Northern blots that show the band

intensity of the mature is more intense than the precursor. We have no explanation as to

why this situation is apparently reversed in the case of panel H (miR-212). Of interest is

that while the relative expression values for these mature miRNAs spanned 3-logs (from

0.1 to 100), the trend in differential expression between the tumor and normal tissues

remained (Figure 2.6). This suggests that miRNAs function in tumor and normal

33

pancreas at different expression levels, yet the differential expression is maintained

between cancer and normal tissue.

Finally, the cell-type miRNA expression was studied using RT in situ PCR. miR-

221, miR-376a and miR-301 were selected for the in situ PCR since they were among the

top differentially expressed miRNAs (Table 2.2) and had increased expression in the

tumor and cell lines compared to the normal pancreas and pancreatitis (Figure 2.2). We

were particularly interested in the cell type expression of miR-376a since it was cloned

from pancreas cells (67). miR-221 and miR-376a are localized to the tumor cells and not

to the benign pancreatic acini or stromal cells (Figure 2.7) or benign ducts (not shown).

miR-301 was also localized to tumor (data not shown).

2.4 DISCUSSION

Reported here are the results of the first detailed miRNA expression profiling

study in pancreatic ductal adenocarcinoma. Expression profiling identified a large

number of miRNAs that are aberrantly expressed in pancreatic ductal adenocarcinoma.

A bead-based flow cytometric assay was used previously to profile the expression of 217

miRNAs in nine samples of pancreatic adenocarcinoma (65). A micro chip assay was

recently used to profile the expression of miRNAs in 39 samples of endocrine pancreas

cancer (148). Our results in pancreatic ductal adenocarcinoma more closely approximate

those of Volinia, et al. (148), in endocrine pancreas tumors and show that the majority of

miRNAs are increased in the tumor compared to normal pancreas. Many of the miRNAs

that are increased in both pancreas adenocarcinoma and endocrine pancreas cancer are

34

similar, including miR-221, -100, -125b and -21. On the other hand, Lu, et al. (65),

report an almost universal decrease in miRNA expression in the pancreatic

adenocarcinomas compared to normal pancreas.

miRNAs are believed to function primarily as negative regulators of gene

expression following binding to conserved sequences within the 3’ UTR of target

mRNAs. While the biological roles of miRNA are under intense investigation, they are

believed to define and maintain cellular fate in a manner similar to transcription factors

(149) by regulating developmental timing and differentiation (150). Since alterations in

developmental pathways play a critical role in pancreatic cancer development (151, 152),

alterations in miRNA expression may be an important contributor to the development of

pancreatic adenocarcinoma.

Our study is unique in that a sensitive, real-time PCR assay was used to profile a

relatively small number of nonconding RNAs. Real-time PCR is the gold standard of

RNA quantification and has much less technical noise and greater reproducibility than

traditional cDNA micro-arrays. miRNA expression profiling correctly identified 28 of 28

tissues as tumor (Figure 2.4). All 6 normal pancreases were correctly predicted and 11 of

15 adjacent benign tissues were classified as normal tissue (Figure 2.4). The data

presented here reinforces the argument that miRNA expression profiling may generate a

unique molecular signature for a given cancer. This concept is supported by several

recent studies. Profiling of various cancers revealed that the pattern of miRNA

expression varies markedly across different tumors and that a small number of miRNAs

define the cancer better than expression data from 16,000 mRNAs (65). A unique

expression signature of only 13 miRNAs differentiated cases of the more aggressive form

35

of chronic lymphocytic leukemia from the more indolent form and was associated with

the presence or absence of disease progression (153).

The 3 factors that are likely driving the differences in gene expression are the

normal acini, stroma and tumor cells. We cannot conclude that each of the aberrantly

expressed miRNAs (Table 2.2) reflect a difference in expression between normal ductal

epithelium and tumor and may reflect differences in expression among the different cell

types (stoma, acini and tumor). However, we confirmed by RT in situ PCR that 3 of the

top differentially expressed miRNAs that were identified in the screen are localized to the

tumor cells (Figure 2.7). We cannot explain why some of the benign tissues failed to

cluster with the normal pancreas (Figure 2.2 and 2.3). While 2 levels of quality control

were used to reduce the possibility of contaminating tumor cells, it is possible that some

tumor cells were present in the benign tissue since the RNA was isolated from whole

tissue and not microdissected tissue. Another possibility is that premalignant changes

have already occurred in some of the benign tissues as those samples are obtained from

tissue adjacent to tumor. It is interesting that most of the benign samples (and chronic

pancreatitis as well) lie in between the normal pancreas and tumor on the expression

terrain map (Figure 2.3). This observation may indeed describe the premalignant

alterations that have occurred in these benign tissues. Future studies using RT in situ

PCR and perhaps laser microdissection will be able to address these issues in more detail.

Some of the differentially expressed miRNAs in pancreatic cancer were aberrantly

expressed in other cancers. These include miR-155, which was increased in the present

study and in diffuse large B-cell lymphoma (91); miR-21 was increased here and in

glioblastomas (87, 100), breast cancer (99) and papillary thyroid cancer (90); miR-221

36

was increased in pancreatic cancer, in glioblastoma (100) and in thyroid cancer (90).

miR-221 is located ~700 bp from miR-222 on the X chromosome; both miR-221 and

miR-222 are predicted to bind to and regulate kit (90). miR-222 precursor was not

among the top 20 differentially expressed miRNAs (Table 2.2); however, subsequent

analysis of mature miR-222 by PCR showed that miR-222 was increased in pancreas

cancer at levels that were similar to miR-221 (data not shown). Thus, deregulation of the

miRNAs mentioned earlier may be unique to cancer in general. miRNAs differentially

expressed in other cancers were not deregulated to the same degree in pancreatic cancer.

The let-7 family, decreased in lung cancer (79, 97), was increased here. Expression of

the miR-17-92 polycistron (encoding miR-17, -18, -19a, -19b-1 and -92-1) was increased

in lymphoma and colorectal cancer (94) but was not significantly altered in pancreatic

cancer. We report deregulation of a number of miRNAs in pancreatic cancer such as

miR-376a and miR-301 that have not been reported in any other cancers to our

knowledge. Also of interest is the fact that most of the deregulated miRNAs reported

here show increased expression in the tumors compared to the normal pancreas. A few

miRNAs had reduced expression in pancreatic cancer including miR-375 (Figure 2.5).

miR-375 was cloned from pancreas and is believed to be islet cell specific (67).

We report significant changes in miRNA expression between pancreatic

adenocarcinoma and normal pancreas. Since each miRNA may regulate scores of

mRNAs (45), the impact on gene expression in pancreatic cancer may be profound. The

miRNA field is currently hampered by a lack of methods to sort through the many

hundreds of predicted miRNA target genes. As more sophisticated approaches become

37

available to identify and validate miRNA targets, the role of aberrant miRNA expression

in pancreas cancer will become better understood.

2.5 ACKNOWLEDGEMENTS

Supported by an NIH grant CA107435 to T.D.S. The Tissue Procurement Shared

Resource at The Ohio State University is funded by the National Cancer Institute, grant

P30 CA16058. We thank Dr. Caifu Chen at Applied Biosystems for his assistance with

the TaqMan looped primer assays.

38

Figure 2.1. 18S rRNA expression in pancreatic tissue.

The expression of the 18S rRNA internal control is shown in pancreatic tumors, adjacent

benign tissue, normal pancreas, chronic pancreatitis and pancreatic cancer cell lines. 18S

rRNA expression, determined using real-time PCR as described in Material and Methods,

is presented as 2-CT

. Dashed line, mean value.

39

Figure 2.2. miRNA precursor expression in pancreatic samples.

(a) The relative expression of each miRNA precursor was determined by real-time PCR;

data are presented as ∆CT. Hierarchical clustering was performed on a subset of 112

genes that are differentially expressed (p < 0.001) among groups (tumor, chronic

pancreatitis, cell lines and normal tissue) as determined by ANOVA multi-group

comparison test. A median expression value equal to 1 was designated black; red,

increased expression; green, reduced expression; grey, undetectable expression.

(b) Dendrogram representing the results of hierarchical clustering analysis of the miRNA

precursor expression pattern in 62 samples. Samples include primary pancreatic tumors

(N = 28), normal pancreatic tissues (N = 6), adjacent benign pancreas (N = 15), chronic

pancreatitis (N = 4) and pancreatic cancer cell lines (N = 9).

40

Figure 2.3. Three-dimensional expression terrain map.

It was created from the filtered miRNA precursor expression data presented in Figure 2.2

(a). Each mountain represents an individual sample (tumor, adjacent benign, chronic

pancreatitis, normal pancreas or pancreatic cancer cell line). The individual mountains

sort into small groups based upon their similarities or differences to each other. Colored

dots represent the same clusters as in Figure 2.2 (b). Black dots represent the 6 normal

pancreases. The lines connecting pairs of samples indicate those samples which have

very similar patterns of miRNA expression with average correlation above the threshold

(>0.8).

41

Figure 2.4. Estimated probabilities for the training and test data. All training data including 6 normal pancreas samples and 18 of the samples known to be

pancreatic tumors are correctly classified (a). Eleven out of 15 adjacent benign samples

and 10 samples known to be pancreatic tumors are correctly classified in the testing

group (b). Samples are partitioned by the true class (a) and the predicted class (b).

42

Figure 2.5. miRNA expression by Northern blotting.

The expression of miR-100, miR-375 and miR-155 was determined in tissue specimens

of pancreatic cancer (T), adjacent benign tissue (B) or normal pancreas (N). Blots were

stripped and reprobed. tRNA, visualized by ethidium bromide staining, was used as a

loading control.

43

Figure 2.6. Validation of precursor and mature miRNA levels.

The expression of 8 miRNAs was validated in 6 normal pancreas specimens, 10 adjacent

benign tissues and 16 pancreatic adenocarcinomas. The relative expression of the

miRNA precursors (open bars) was determined using a real-time PCR assay to the

miRNA precursors while the relative expression of the mature miRNA (closed bars) was

determined using a real-time PCR assay to the mature miRNAs. The mean differences in

miRNA expression between the normal pancreas (black) and tumors (red) was significant

p < 0.01 (student’s t-test). (a) let-7i, (b) miR-221, (c) miR-100, (d) miR-301, (e) miR-21,

(f) miR-181a,c (precursor) and miR-181a (mature), (g) miR-125b-1 (precursor) and miR-

125b (mature), (h) miR-212.

45

Figure 2.7. Histologic and molecular analyses of pancreatic cancer for microRNA

expression.

Panel (a) (X400) depicts the hematoxylin and eosin analysis of a pancreatic

adenocarcinoma. The normal pancreatic glands (small arrow) are being invaded by the

poorly formed glands of the carcinoma (large arrow). Serial section analysis of miR-221

after in situ amplification of the corresponding cDNA showed that many of the tumor

cells contained the target sequence; note the cytoplasmic localization (arrows, panel (b) –

X 400 and at higher magnification, panel (c) – X 1,000; the signal is blue due to

NBT/BCIP with negative cells counterstained with fast red). The signal was lost with

either omission of the primers or substitution with HPV-specific primers (panel (d),

X400). The adjacent serial section also showed many of the tumor cells expressed miR-

376a after in situ amplification of the cDNA (e, f). Panel (e) (X400) shows the positive

tumor cells (large arrow) and the negative stromal cells in the areas of desmoplasia (small

arrow) while panel (f) (X400) depicts the positive tumor cells (large arrow) adjacent to

the negative benign pancreatic gland acini (small arrow).

46

Normal Pancreas Tissues

Sample No. Supplier Age (years)/Gender Cause of Death RINa

N1 Ambion 82 / Female Emphysema 9.6

N2 Ambion 20 / Male Head Trauma 7.8

N3 Ambion 71 / Male Cerebral Vascular Accident 9.2

N4 Ambion 71 / Male Failure to Thrive 9.1

BD Clontech 35 / Male Sudden death 7.5

ST Stratagene 72 / Male Chronic Obstructive Pulmonary Disease 6.8

Pancreatic Adenocarcinoma Tissues

Sample No. Tumor Pathology Differentiatio

n

Age

(years)/Gender

RIN

(tumor)

RIN

(benign)

OUP2 T3NxMx Moderately 85 / Male 8.2 7.0

OUP14 T3N0Mx invasive Poor-moderate 71 / Male 7.8 3.8

OUP16 T3N1bMx Well 50 / Male 5.6 5.6

OUP20 T3N1aMx Poorly 70 / Male 8.2 3.4

OUP27 T3N0Mx invasive Moderate 86 / Male 3.3 5.8

OUP29 T3N0Mx invasive Poorly 63 / Male 8.3 7.0

OUP28 T3N1bMx invasive Poorly 48 / Female 7.9 6.9

OUP31 T3N0Mx Poorly 38 / Male 7.7 7.0

OUP33 T3N1Mx Poor-moderate 42 / Female 5.1 8.3

OUP36 T3N1bMx Moderate 56 / Female 7.7 7.8b

OUP37 T3N1bMx invasive Mod-poor 79 / Male 7.1 No tissue

OUP42 T3N0Mx invasive Moderate 78 / Female 6.6 7.6

OUP48 T3N1bMx invasive Moderate 61 / Male 8.1 4.3

OUP49 T3N1aMx invasive Poor-moderate 62 / Female 7.6 8.6

OUP91 T3N1bMx Moderate 65 / Male 5.9 6.1

OUP97 T3N1bMx Moderate 56 / Male 8.0 2.6

OUP101 T2N0Mx invasive Moderate 52 / Female 8.5 6.6

OUP105 T2N1aMx Moderate 55 / Male 8.3 8.9

OUP122 T3N1aMx Moderate 64 / Male 9.1 8.4

OUP123 T3N1bMx Moderate-well 52 / Male 6.4 7.6 b

OUP135 T3N0Mx Moderate 82 / Male 7.8 8.2 b

OUP139 T2N0Mx Moderate 50 / Male 6.6 6.7

0206C077B(T) T3N0Mx Moderately 49 / Male 7.2 No tissue

0206C138B(T) T3N0M1 Intermediate to

high grade 44 / Female 6.1 No tissue

1050005A2(T) T3N1Mx Poorly 73 / Female 7.0 7.3

3030800A3(T) T3N1Mx Moderately 46 / Male 7.5 No tissue

3030396A1(T)

Intraductal

papillary mucinous

tumor

- 59 / Male 7.3 No tissue

3030401A1(T)

Intraductal

papillary mucinous

tumor

- 72 / Male 8.9 No tissue

Table 2.1. Clinical data and tumor pathology.

47

Table 2.2. Top 20 aberrantly expressed miRNA precursors in pancreatic

adenocarcinoma.

Rank Name p-value

(t-test)

Fold

Change

Chromosome

location

1 miR-221 5.66E-05 26.2 Xp11.3

2 miR-424 3.62E-08 56.3 Xq26.2

3 miR-301 1.11E-05 34.2 17q23.2

4 miR-100 4.40E-06 36.9 11q24.1

5 miR-376 7.00E-04 7.79 14q32.31

6 miR-125b-1 1.00E-04 23.2 11q24.1

7 miR-021 2.00E-04 15.7 17q23.2

8 miR-345 1.44E-15 -14.5 14q32.2

9 miR-016-1 3.73E-04 14.3 13q14.2

10 miR-181a,c 8.31E-04 18.6 9q33.3, 19p13.13

11 miR-092-1 3.40E-03 19.6 13q31.3

12 miR-015b 4.00E-04 8.55 3q25.33

13 miR-142-P 3.63E-07 -15.4 17q23.2

14 miR-155 1.51E-03 14.0 21q21

15 let-7f-1 4.00E-04 10.9 9q22.32

16 miR-212 2.00E-04 22.2 17p13.3

17 miR-107 3.86E-05 8.20 10q23.31

18 miR-024-1,2 9.12E-08 8.17 9q22.32, 19p13

19 let-7d 7.06E-04 8.38 9q22.32

20 miR-139 6.79E-11 -7.91 11q13.4

48

CHAPTER 3

ANTISENSE INHIBITION OF microRNA REDUCES CELL VIABILITY AND

SENSITIZES THE EFFECT OF GEMCITABINE IN PANCREATIC CANCER

3.1 INTRODUCTION

Pancreatic cancer is the fourth leading cause of cancer-related death in the United

States (135). The annual death rate over the last five years has been approximately

30,000 with a similar number of new cases diagnosed each year. The prognosis for

pancreatic cancer is the worst of all cancers with a mortality/incidence ratio of 0.99. The

incidence of pancreatic cancer in the United States is approximately 9 per 100,000 (136,

137). Pancreatic ductal adenocarcinoma (PDA) is the most common and lethal type of

pancreatic cancer. The reasons for the poor survival rate are a lack of effective diagnostic

procedure to identify pancreatic cancer and a lack of effective treatments for the disease.

Normal pancreatic tissue consists primarily of acinar cells, which produce

digestive proenzymes, islets, which produce hormones that control blood sugar such as

insulin and glucagon, and a low number of ductal epithelial cells. However, if pancreatic

tissue turns to tumor, the major cell type is neoplastic ductal epithelial cells and stroma

cells.

49

Not many sensitive and specific biomarkers of pancreatic cancer are available.

Currently serum maker CA19-9 (sialylated Lewis blood group antigen) is used, but the

usage is limited because it showed the high false-positive rate and some patients do not

express Lewis antigens (154-156). Recently, serum macrophage inhibitory cytokine 1

(MIC-1) seems to be a better marker of pancreatic cancer than CA19-9 (157). Genetic

and epigenetic markers also can be used for early detection. Pancreatic cancer is caused

by genetic alterations such as chromosomal instability or point mutation of oncogenes

and tumor-suppressor genes. Chromosomal changes in pancreatic cancer have been

identified using karyotyping, comparative genomic hybridization, and allelotyping (158).

Chromosome losses are more common than gains and poorly differentiated ductal

adenocarcinoma showed more frequent karyotypic abnormalities than well-differentiated

pancreatic cancer (159). The specific oncogenes and tumor suppressor genes are also

altered in pancreatic cancer. Point mutations in K-ras oncogene occur in 85-95% of

pancreatic cancers (160) and inactivation of tumor-suppressor genes such as p16, p53 or

SMAD4 occurs in 98%, 75%, and 55% of pancreatic cancers, respectively (158).

Oncogenes and tumor-suppressor genes are also involved in cell cycle arrest and

apoptosis. BRCA2, TGF-β, BAX mutations are found in pancreatic cancers. Several

tumor suppressor genes such as PENK, RARB, CDKN2A, CACNAIG, TIMP3, CDH1

AND MLH1 are often inactivated by CpG island hypermethylation (161).

The prognosis of pancreatic cancer is poor. If patients with pancreatic cancer are

diagnosed early, surgical resection is available and the 5-year survival rate in patients

who had surgery treatment is 21% (162). However, for patients with unresectable

pancreatic cancer, the 2-year survival rate is 5%–18%, and the 5-year survival rate is less

50

than 5% (163-165). For advanced pancreatic cancer, chemotherapy or radiation

treatment, or a combination of two can be applied, however, pancreatic cancer is highly

resistant to chemotherapy and radiation treatment (166, 167).

5-Fluorouracil (5-FU) treatment was the standard treatment for pancreatic cancer

(166). Gemcitabine is currently used for the first choice of pancreatic cancer treatment.

Gemcitabine is an analog of deoxycytidine (Figure 3.1) and it blocks DNA elongation,

causing DNA fragmentation and cell death (168). Gemcitabine is a prodrug and it is

phosphorylated by deoxycytidine kinase to make gemcitabine monophosphate and then it

is converted to active, di- and triphosphate (169). This gemcitabine triphosphate is

incorporated into DNA chain and terminates DNA synthesis. Therefore, gemcitabine

shows cell killing effect at S-phase of cell cycle. Reproducible clinical benefit of

gemcitabine was 23.8%, which is higher than 4.8% in 5-FU and the 1-year survival in

gemcitabine treated patients (18%) was also higher than in 5-FU treated patients (2%)

(170). Even though gemcitabine shows better effect than 5-FU, it is still marginally

effective. The combination therapy with other anticancer drugs including 5-FU, cisplatin,

oxaliplatin, docetaxel, irinotecan, capecitabine shows a better response than single agent

gemcitabine treatment (171). However the survival rate is still poor and other

combinations of these cytotoxic reagents are needed to treat this disease.

Conceivably miRNA-based therapy of cancer may be achieved by inhibiting

miRNAs with antisense oligonucleotides in cancers that over express the miRNA. 2’-O-

methyl oligoribonucleotides (125, 126) or 2’-O-methyoxyethyl (MOE) phosphorothioate

oligonucleotides (66) are effective, essentially irreversible, inhibitors of mature miRNA

function (125). Various studies have demonstrated that transfection of chemically

51

modified antisense to cancer cell lines produces cell death in vitro (85, 87, 93, 109, 110,

172, 173). In vivo studies of anti-miRs also appear promising. Chemically modified

antisense to the liverspecific miR-122a produced sustained inhibition of the miRNA in

mouse liver in vivo for up to 23 days after a single injection (127). Injection of 2’ MOE

antisense to miR-122 was effective at miR-122 degradation, target gene up regulation and

cholesterol lowering in normal mice (174).

We showed in chapter 2 that aberrant miRNA expression exists in pancreatic

adenocarcinoma (64). By profiling over 200 miRNA precursors in 28 pairs of tissues, we

identified a number of miRNAs with increased expression including miR-21, -221, -301,

-212 and others. There were some miRNAs with decreased expression however the

expression was predominately increased in the cancer. The fold-change in the expression

was quite high (e.g. 5- to 10-fold) in the tumors compared to the normal or adjacent

benign tissue. Our results were corroborated by two additional studies (89, 175).

Szafranska, et al., used cDNA arrays to profile 281 miRNAs in 24 specimens of

pancreatic adenocarcinoma, chronic pancreatitis or normal pancreas (175). Bloomston, et

al., used miRNA arrays to profile the expression of 326 miRNAs in 107 specimens of

pancreatic adenocarcinoma or pancreatitis; to maintain cell heterogeneity, two mm tissue

cores of tumor or benign cells were isolated from the FFPE tissues (89). While some

inconsistencies were apparent between the three pancreatic adenocarcinoma studies (64,

89, 175), there was a fair amount of overlap. For example, both our study (64) and the

study by Bloomston, et al., (89) identified miR-221 as the top differentially expressed

miRNA in pancreatic adenocarcinoma.

52

In this study, we asked the question of whether inhibition of miRNAs that are

overexpressed in pancreatic cancer cell lines with antisense oligos results in cell death.

In addition, can miRNA inhibition sensitize the cells to the antiproliferative effects of

commonly used chemotherapeutic agents such as gemcitabine.


3.2.1 Cell lines and culture

The human pancreatic cancer cell lines, Panc-1, Miapaca-2, HS766T, SW1990,

PL45, MPanc-96 and CaPan-1 were purchased from American Type Tissue Collection

(Manassas, VA). Panc-1, MiaPaca-2, HS766T were cultured in DMEM with L-

glutamine and 10% fetal bovine serum. SW1990 was cultured in L-15 medium with 10%

fetal bovine serum. Normal pancreatic ductal epithelial cell line, HPNE (human

pancreatic Nestin-expressing cell) (176), was a gift from Dr. Ouellette (University of

Nebraska Medical center, Omaha, NE). HPNE cells were cultured in Medium D (176).

SW1990 were grown at 37 °C without CO2. All other cells were grown at 37 °C in a

humidified atmosphere with 5% CO2.

3.2.2 miRNA profiling

The expression of 305 mature miRNAs were profiled in PANC-1, MiaPaCa-2,

PL45, MPANC-96, HS766T, CaPan-1, SW1990 and HPNE cells using the TaqMan®

MicroRNA Assays (Applied Biosystems, Foster City, CA) as reported (60). miRNA

53

expression was related to the 18S rRNA internal control and data were calculated using

the comparative CT method.

3.2.3 Antisense oligonucleotides

Anti-miRTM

miRNA inhibitor is purchased from Ambion (Austin, Texas). 2’-O-

methoxyethyl with phosphodiester backbone (2’-O-MOE-PO) and 2’-O-methoxyethyl

with phosphorothioate backbone (2’-O-MOE-PS) antisense oligonucleotides were

provided by Isis Pharmaceuticals (Carlsbad, California). Antisense oligonucleotide

(ASO) is the complementary sequence to the mature miRNA according to miRBase 9.0.

The sequences of the antisense oligonucleotides are shown in Table 3.1.

3.2.4 Antisense oligonucleotide transfection

The cells were plated one day before transfection and antisense were transfected

using lipofectamine 2000 and Opti-MEM medium (Invitrogen, Carlsbad, CA) following

the manufacturer’s protocol. Transfection efficiency was measured using a fluorescently

(DY547) labeled miR-16 oligo and the amount of fluorescence was determined by a

LS55 Luminescence Spectrometer (Perkin Elmer, Boston, MA). The knockdown effect

of the antisense oligonucleotide was measured by quantifying the target mature miRNA

using real-time PCR.

3.2.5 Gemcitabine treatment

Gemcitabine was purchased from Eli Lilly & Co (Indianapolis, IN). Cells were

plated in triplicate at 1200 cells/well in 96 well plates overnight. Gemcitabine was then

54

added at the desired concentrations and incubated for 48 and 96 h. After treatment, cells

were used for cell proliferation assay.

3.2.6 Cell proliferation assay

Cell proliferation assay was performed using the cell proliferation reagent WST-1

(Roche, Mannheim, Germany). Cells were seeded into 96-well plates at 1200 cells/well.

Cells were treated with gemcitabine and/or antisense and incubated for 48 or 96 h. After

incubation, 15 µl of WST-1 was added to cell culture medium and incubated for 4 h.

Sample absorbance was analyzed using a microplate ELISA reader at 490 nm. All

experiments were performed at least in triplicate.

3.2.7 Combination assay

To determine the effects of ASO pretreatment on the gemcitabine potency,

HS766T cells were seeded in 100 mm Petri dishes at the initial density of 2x105 cells and

transfected with various concentrations of control oligonucleotide or ASO to miR-21, -

212, -221 or -301 for 24 h. Cells were then collected by trypsinization and then

transferred to a 96 well plate (3x103 cells/well). After incubating for 24 h to allow cells

to stabilize, gemcitabine was added in a 7 point serial dilution series, 3 replicate plate

columns per treatment. After 72 h of gemcitabine treatment, cell growth inhibition was

determined using WST-1 assay.

For the simultaneous combinatorial experiment, gemcitabine was given with

either ASO to miR-21, -212, -221, or -301 for 96 h. Each ASO was combined with

another ASO, (e.g. ASO to miR-21+ASO to miR-212) in HS766T cells for 96 h. Drugs

55

were combined at equitoxic ratios (i.e. doses were applied in combinations that would

have produced the same cytotoxic effect if the drugs were administered separately to

produce a 50% of growth inhibition, as determined by WST-1 assay). The cytotoxicities

of the two drug combinations were also determined by WST-1 assay using the same

procedure as used for single treatments. Each experiment was performed in triplicate.

3.2.8 Data analysis

ICx defined as the drug concentration required to reduce the absorbance to (100-

X) % of the control in each test was determined using an Emax model (Eq. 1).

( )[ ]

[ ]R

DK

D1R100 viabilityCell %

mm

d

m

+

+−×−= …………… (Eq. 1)

where [D] is the drug concentration, Kd is the concentration of drug that produces a 50%

reduction in absorbance (i.e., IC50), m is a Hill-type coefficient, and R is the residual

unaffected fraction (the resistance fraction).

The nature of interactions between two drugs were determined by using the median effect

analysis (177). Median effect analysis permits the calculation of the combination index

(CI) at various levels of cell kill (Eq. 2). CI was calculated for a cell death range of 20-

80%, i.e., CI20-CI80.

( ) ( ) ( ) ( )

BXAX

BA

BX

B

AX

Ax

)(D)(D

DDα

)(D

D

)(D

DCI ++= ……………… (Eq. 2)

where CIx is the CI for a fixed effect, x [fraction affected (fa)× 100], for a combination of

drug A and drug B, (Dx)A is the concentration of drug A alone giving an effect x, (Dx)B

is the concentration of drug B alone giving an effect x, (D)A is the concentration of drug

56

A in combination A+B giving an effect x, (D)B is the concentration of drug B in

combination A+B giving an effect x, and α is a parameter with value 0 when A and B are

mutually exclusive and 1 when A and B are mutually non-exclusive. A CIx less than 1

was categorized as synergistic and greater than 1 as antagonistic.

3.2.9 Statistical analysis

All data are represented as mean ± S.D. For comparison between two groups,

Student’s t test was used and p < 0.05 is considered as statistically significant.

3.3 RESULTS

3.3.1 miRNA expression in pancreas cell lines

We were initially interested in identifying pancreas cancer cell lines that had

increased expression of many of the top miRNAs that were increased in pancreas cancer

tissues (64). To determine this, the expression of over 300 mature miRNAs was profiled

in 7 pancreas cancer cell lines and in the normal HPNE cells. The results of this profiling

study are presented in Appendix Table B. Previous studies in tumors from pancreatic

cancer patients revealed that a number of miRNAs had increased expression in pancreatic

cancer (64, 89, 175). These include miR-212, -301 and -376a (64); miR-21 and -100 (64,

89); miR-221/-222 and -146 (64, 89, 175); and miR-210 and -223 (89, 175). The

expression values of these top differentially expressed miRNAs in the 7 pancreas cancer

cell lines relative to the normal HPNE cells are shown in Table 3.2. There is a

predominate increase in the expression of many of these miRNAs compared to HPNE.

57

From this analysis we selected five miRNAs for our antisense inhibition studies (miR-21,

-100, -221, -301 and -212). These miRNAs were selected because they had

predominately increased expression in these cell lines and in the pancreas tumors (64).

Also miR-21 and miR-221 have been shown to be increased in a number of solid tumors

and antisense inhibition of both miRNAs reduced clonogenicity (178) or produced cell

death in vitro (87).

3.3.2 Antiproliferative effects of antisense oligonucleotides

The antiproliferative effects of three different chemical modifications to antisense

to miR-221 were studied. These include Anti-miR™ miRNA Inhibitor from Ambion,

Isis 2’-O-MOE-PO (ISIS-PO) and Isis 2’-O-MOE-PS (ISIS-PS). HS766T cells were

transfected with various amounts of antisense for 48 and 96 h. The result showed ISIS-

PS is the most effective antisense (Figure 3.2). For the 96 h treatment of 50 nM, the

percentage survival was 76.3±16.0, 52.9±8.0, and 19.5±2.3 for Ambion, ISIS-PO, and

ISIS-PS, respectively. Therefore, ISIS-PS antisense to miR-21, -100, -212, -221, and -

301 were selected for further studies.

The antiproliferative effects of inhibiting miR-21, -100, -212, -221, and -301 with

ASO was studied for 48 and 96 h of continuous exposure. HPNE (normal pancreatic

ductal epithelial cells) and four human pancreatic cancer cell lines (HS766T, SW1990,

Panc-1 and MiaPACA-2) were transfected with various concentrations of antisense using

lipofectamine 2000. All ASO showed a reduction in cell viability compared to the lipid

control in the human pancreatic cancer cell lines. Inhibition of cell viability with ASO

for 48 and 96 h produced IC50 in the low nM range (Table 3.3). The normal HPNE cells

58

were considerably less sensitive to the effects of some of the ASO (Figure 3.3A, Figure

3.3B and Table 3.3). Inhibition of miR-21 with ASO produced very little

antiproliferative activity in HPNE cells including undetectable IC50 from triplicate

experiments (Table 3.3, Figure 3.3A, and Figure 3.3B). Inhibition of miRNAs with the

other 4 ASOs resulted in slightly greater antiproliferative activity in HPNE cells

compared to ASO-miR-21, although many of these ASO failed to produce a measurable

IC50 or IC70 in the replicate experiments (Table 3.3). Of the 5 ASOs, the IC50 of miR-301

in HPNE most closely approximated that of the pancreas cancer cell lines (Table 3.3).

These results suggest the possibility of selective cytotoxicity to pancreas cancer cells

compared to normal pancreas for some of the ASO.

The possibility exists that the HPNE cells were less sensitive to antisense because

transfection efficiency of the ASO was reduced compared to the pancreas cancer cell

lines. To test this, a DY547 labeled miR-16 oligo was transfected into both HPNE and

HS766T cells using lipofectamine 2000 and the amount of fluorescence was determined

by a spectrometer. The transfection efficiency of the miR-16 oligo was not reduced in

the HPNE cells and in fact was slightly greater than that of the HS766T cells (Figure

3.3C).

Hybridization of the antisense to the mature miRNA should reduce the amount of

freely available miRNA within the cells. To verify this, HS766T cells were transfected

with ASO-miR-221 and then the levels of mature miR-221 within the cells was

determined by quantitative RT-PCR. One hundred nM of ASO-miR-221 reduced the

amount of mature miR-221 by 70% (Figure 3.3D).

59

Experiments were conducted to evaluate any off target effects of the 2’-O-MOE-

PS oligos. A 96 h continuous exposure of up to 100 nM of an irrelevant control oligo did

not reduce cell viability below 20% (Figure 3.3A and 3.4A). Two mismatch control

oligos to ASO-miR-221 were evaluated; one with 3 nts mismatched and another with 6

nts (Table 3.1). There was a trend of reduced cytotoxicity with increasing number of

mismatched nts (Figure 3.4B).

3.3.3 Schedule-dependent combinatorial effects of antisense with gemcitabine

Gemcitabine is one of the agents used to treat pancreatic adenocarcinoma,

however it is only marginally effective. It is possible that miRNA inhibition may

sensitize cancer cells to the effects of commonly-used chemotherapeutic agents such as

gemcitabine. This effect was demonstrated for the combination of ASO-miR-21 and

gemcitabine in cholangioma cell lines (110). At first, we examined whether addition of

gemcitabine to ASO-primed HS766T cells would result in a lower IC50 for gemcitabine.

For this experiment, the cells were pre-treated with antisense for 24 h followed by

gemcitabine for an additional 72 h. We found that sequential addition of gemcitabine to

ASO-miR-21 primed HS766T cells resulted in a reduction in the gemcitabine IC50. The

gemcitabine IC50 was reduced from 5.9 nM (control oligo 50 nM) to 1.2 nM (30 nM of

ASO-miR-21) to 1.0 nM (70 nM of ASO-miR-21), respectively (Figure 3.5A). In

addition, antiproliferative effects of gemcitabine were also enhanced by pretreatment of

ASO-miR-221 (20 nM) and ASO-miR-301 (50 and 70 nM). Effects of low concentration

of gemcitabine ranging from 0.1 to 10 nM were not enhanced by ASO pre-treatment

(data not shown). However, at high effect levels (50, 200, and 500 nM), the

60

antiproliferative effects of gemcitabine were greatly increased in ASO-miR-221 and -301

primed HS766T cells compared to control oligo (Figure 3.5B).

Next, we analyzed the interaction of gemcitabine and ASO on cell survival rate

using the median effect/combination index method after exposing two agents

simultaneously for 96 h. The CIx values calculated for 0.2 ≤ fa ≤ 0.8 (i.e. fraction

affected between 20% and 80%) are shown in Figure 3.5C. All combinations were

examined at a fixed molar ratio based on approximate equitoxic concentrations at the

level of 50% growth inhibition of each agent, i.e. IC50 of drug A: IC50 of drug B. For

each ASO, the IC50 values are shown in Table 3.3. The IC50 value of gemcitabine alone

in HS766T cells was 3.2 ± 0.3 nM for a 96 h exposure. CIx values for the combination

ASO-miR-21+gemcitabine (1:6 molar ratio), ASO-miR-212+gemcitabine (1:2 molar

ratio), ASO-miR-221+gemcitabine (1:2 molar ratio), and ASO-miR-301+gemcitabine

(1:4 molar ratio) varied with fa. CIx values of the above 4 cases were decreased from 2.9,

2.7, 1.8 and 1.3 at fa=0.2 to 0.8, 0.96, 0.68 and 1.2 at fa=0.8, respectively. In the

clinically relevant range of fa ≥ 0.5, ASO-miR-221+gemcitabine combination was

considered to be synergistic. The ASO-miR-21+gemcitabine, ASO-miR-

212+gemcitabine and ASO-miR-301+gemcitabine appeared to be antagonistic. The

antagonistic effects of ASO-miR-21+gemcitabine and ASO-miR-212+gemcitabine were

more evident at lower drug concentration, with CI= 2.9 and 2.7 at fa=0.2, respectively.

3.3.4 Evaluation of synergism in ASO combination

To extend our observations, we evaluated the antiproliferative effects of various

ASO-miR-21, -212, -221, or -301 combined with each other in HS766T cells for 96 h.

61

All combinations were also examined at fixed molar ratio based on approximate

equitoxic concentrations at the level of 50% growth inhibition of each agent. For

ASO+ASO simultaneous combinations, we tested six different combinatorial effects,

which are ASO-miR-21+ASO-miR-212 (1:0.3 molar ratio), ASO-miR-21+ASO-miR-221

(1:0.3 molar ratio), ASO-miR-21+ASO-miR-301 (1:0.7 molar ratio), ASO-miR-

212+ASO-miR-221 (1:1 molar ratio), ASO-miR-212+ASO-miR-301 (1:2 molar ratio),

and ASO-miR-221+ASO-miR-301 (1:2 molar ratio), in HS766T cells. Among them,

ASO-miR-212+ASO-miR-301 showed the greatest synergism with CI value of less than

1.0 (0.55-0.99) for the whole fa range (Figure 3.6), indicating a greater advantage

compared to the other combinations. ASO-miR-221+ASO-miR-301 combination also

showed synergism at fa=0.2, but was found to be antagonistic with CI values ranging

from 0.99 to 2.0 at fa=0.5 and 0.8, respectively (Figure 3.6). When ASO-miR-21 was

combined with ASO-miR-212 or ASO-miR-221, slight synergistic effects were shown:

the CI80 was 0.80 for the ASO-miR-21+ASO-miR-212 and CI20 was 0.68 for the ASO-

miR-21+ASOmiR-221 (data not shown). However, the CI20 and CI80 were 1.78 and 1.79

for ASOmiR-21+ASO-miR-212 and ASO-miR-21+ASO-miR-221, respectively,

indicating antagonistic interactions. ASO-miR-21 was also treated with ASO-miR-301

and showed antagonistic interactions (CI values > 1) for the whole fa range. On the other

hand, only antagonistic interactions were induced by ASO-miR-212+ASO-miR-221 with

CI values increasing from 1.6 to 2.5 by escalating concentrations of each ASO (data not

shown).

62

3.4 DISCUSSION

The results of our current study demonstrate that inhibition of 5 miRNAs that are

over expressed in pancreas cancer produced cell death in vitro. Low nM concentrations

of ASO reduced cell proliferation in pancreatic cancer cell lines. ASO inhibition of

miRNA in the normal HPNE cells had less pronounced effects on cell proliferation

compared to the pancreas cancer cell lines (Figures 3.3A and 3.3B and Table 3.3).

Certain 2’-O-MOE-PS ASOs that were not complementary to any known human gene

were observed to substantially effect cell proliferation at concentrations of 100-300 nM in

vitro (179). Phosphorothioates in general have been shown to produce toxicity (reviewed

in (129)). Therefore it is possible that a portion of the cytotoxicity from the 2’-O-MOE-

PS was due to off target effects. Exposing cancer cell lines to an irrelevant control 2’-O-

MOE-PS oligo produced modest effects on cell proliferation (Figures 3.3A and Figure

3.4A). Likewise, altering the sequence of ASO-miR-221 reduced its antiproliferative

activity (Figure 3.4B).

Standard palliative gemcitabine treatment showed only a 6 month median survival.

Although many trials have been attempted to improve upon the overall survival of

gemcitabine based combination chemotherapy, only the gemcitabine/Erlotinib

combination showed a slight increase in the overall survival, but survival times

associated with combinations of gemcitabine/fluorouracil, gemcitabine/irinotecan,

gemcitabine/cisplatin, and gemcitabine/oxaliplatin appear to be either equivalent or only

marginally superior to those associated with single-agent gemcitabine (180). A phase III

study showed that a 4-drug PEFG (cisplatin, epirubicin, 5-fluorouracil (5-FU),

63

gemcitabine) regimen obtained a response rate of 38-51% and a 1-year overall survival of

38.5-39%, without compromising quality of life, which was significantly better than

single-agent gemcitabine (180). However, there are still no guidelines or

recommendations for selecting treatment for pancreatic cancer patients, and both

acquired drug resistance and considerable systemic toxicities are major reasons for the

limited advances made in cancer chemotherapy. From this point of view, our data

showing the antiproliferative effects in various pancreatic tumor cells, reduced sensitivity

of antisense toward normal HPNE cells and enhancement of gemcitabine antiproliferative

effects with ASO-miR-21, -221 and -301 and a synergistic effect between gemcitabine

and ASO-miR-221 (Figure 3.5) suggests that ASO can be used as future gemcitabine-

based combination regimen. Moreover, our results showing the greatest synergism of the

ASOmiR-212+ASO-miR-301 combination (Figure 3.6) also imply, at least in part, that

we can expect greater effects than gemcitabine-based combinations. Overall,

experiments described herein strongly support the potential for the miRNA-based

targeted therapy of pancreatic cancer using antisense oligonucleotide and the possible

target molecules and more detail mechanisms that are responsible for anti-proliferation

and sensitization effect should be further investigated.


Supported by an NIH grant CA107435 to T.D.S. and a grand from the National

Pancreas Foundation. We thank Dr. Caifu Chen at Applied Biosystems for his assistance

with the TaqMan looped primer assays and Christine Esau at ISIS Pharmaceuticals for

64

her assistance with the Antisense oligonucleotides. We also thank Jong-Kook Park with

experiments assistance.

65

Figure 3.1. Structures of Gemcitabine and Deoxycytidine.

66

ASO221(48hr)

lipo 20 50 250 500 lipo 20 50 250 500 lipo 20 50 250 500

Su

rviv

al(%

)

0

20

40

60

80

100

120

Ambion-221

ISIS(PO)-221

ISIS(PS)-221

ASO221(96hr)

lipo 20 50 250 500 lipo 20 50 250 500 lipo 20 50 250 500

0

20

40

60

80

100

120

140

Ambion-221(96)

ISIS(PO)-221-96

ISIS(PS)-221-96

Su

rviv

al(

%)

Figure 3.2. Comparison of three different antisense oligonucleotides.

WST-1 assay in pancreatic cancer (HS766T) cells show the relative cytotoxicity of the

antisense to miR-221. Ambion anti-miR was compared to Isis 2’ MOE-PO and Isis 2’

MOE-PS. Cells were exposed continuously for 48 h (top) or 96 h (bottom). Lipo, lipid

only control. Cells were transfected using lipofectamine 2000.

67

Figure 3.3. The effect of antisense oligonucleotide and control oligonucleotide in

pancreatic cell lines.

(A) Representative dose-response curve of ASO-miR-21 and ASO-miR-221 and control

oligonucleotide in HS766T and HPNE. Cells were transfected with oligonucleotides and

incubated continuously for 96 h. Filled symbols are HS766T, open symbols are HPNE,

circles are ASO-miR-21, triangles are ASO-miR-221, and squares are control

oligonucleotide. (B) Antiproliferative effects of ASO-miR-21 and ASO-miR-221 (50 nM,

96 h) in 5 pancreatic cell lines. (C) Cellular uptake of fluorescently labeled miR-16

oligonucleotide in HS766T and HPNE cells. (D) The knockdown effect of ASO-miR-

221 in HS766T cells. The expression levels of the target microRNA were assessed by

real-time RT-PCR 24 hours after transfection. Data presented in (B) and (D) are the

mean of 3 independent experiments (* P < 0.05; ** P < 0.01).

69

Figure 3.4. Effect of control oligonucleotides on cell proliferation.

(A) Transfection of control oligonucleotide in HS766T cells for 96 h; data are compared

to lipofectamine control. Mean data from triplicate transfections. (B) Comparison of

wild type ASO-miR-221, 3 nt and 6 nt mismatch control oligonucleotides on the

proliferation of HS766T cells; 96 h exposure. Mean data of 3 independent experiments.

70

Figure 3.5. ASO pretreatment sensitized the antiproliferative effects of gemcitabine.

Antisense to miRNAs are transfected in HS766T cells 24 h before gemcitabine treatment

and antiproliferative effects of gemcitabine are measured after 72 h treatment by WST-1

assay. ASO sensitized the gemcitabine effect showing that dose-response curve is shifted

to the left. (A) Representative dose-response curve of gemcitabine after ASO-miR-21(30

nM ●, 70 nM ■,) and control oligonucleotide pretreatment (50 nM, ○). (B) ASO-miR-

221 and ASO-miR-301 sensitize the gemcitabine effect at the high concentrations. (C)

Combination index (CIx) versus fraction affected (fa) plots in HS766T cells for

ASOmiR-21+gemcitabine (), ASO-miR-212+gemcitabine ( ), ASO-miR-

221+gemcitabine (····), and ASO-miR-301+gemcitabine (········).

72

Figure 3.6. Combination index (CIx) versus fraction affected (fa) plots in HS766T

cells for ASO-miR-212 + ASO-miR-301 ( ) and ASO-miR-221 + ASO-miR-301

(). CI < 1 and CI > 1 indicate synergism and antagonism, respectively. CIx was

calculated using Emax model parameters obtained from the WST-1 assay data.

73

Isis number

miRNA Sequence

(5’ to 3’)

327917 miR-21 TCAACATCAGTCTGATAAGCTA

327957 miR-100 CACAAGTTCGGATCTACGGGTT

327891 miR-212 GGCCGTGACTGGAGACTGTTA

346908 miR-301 ACGTGGATTTTCCTCTATGAT

327919 miR-221 GAAACCCAGCAGACAATGTAGCT

394088 miR-221

3 nt mismatch GAATCCCAGCAGAGAATGTTGCT

394091 miR-221

6 nt mismatch GAATCACACCAGAGAAAGTTGCT

386666 Irrelevant control ACATACTCCTTTCTCAGAGTCCA

Table 3.1. Sequence and chemical modifications to antisense oligonucleotides.

Each of the antisense oligonucleotides is modified with uniform MOE

w/phosphorothioate backbone [AGTmC]. Each has a 5’ end cap of hydrogen and 3’ end

cap of hydroxyl.

74

Table 3.2. miRNA expression, pancreas cancer cell lines normalized to normal pancreas cell (HPNE).

miRNA PANC-1 MIAPACA-2 PL45 MPANC-96 HS766T CaPan-1 Sw1990

miR-21 2.9 2.8 3.1 5.2 9.1 7.7 2.2

miR-221 0.6 2.5 1.2 2.0 1.9 0.4 1.7

miR-100 1.3 0.0 0.2 0.2 0.8 0.0 0.3

miR-212 3.3 2.3 2.1 1.5 3.0 0.6 1.0

miR-301 21.2 52.9 11.6 15.3 86.8 5.1 7.7

miR-376a 3.0 0.0 0.0 0.0 0.0 0.0 0.0

miR-155 3.0 0.1 2.0 1.9 14.7 0.5 1.5

miR-210 1.8 1.2 1.2 4.1 0.9 4.1 1.9

miR-223 1.2 1.8 0.0 3.3 0.2 1.3 0.7

miR-146 59.1 6.6 2.4 35.7 7.0 99.9 3.7

miR-222 0.6 1.9 1.4 0.9 1.7 0.4 1.3

miR-24 1.1 1.1 0.8 1.6 0.9 1.8 2.2

Red > 2-fold increase; Blue > 2-fold decrease

75

Table 3.3. Antiproliferative activity parameters of ASO against miR-21, -100, -212, -

221 and -301 in human pancreatic cell lines. The dose-response curves of these agents were analyzed using the Emax model (Eq. 1).

76

Cell lines Treatment

duration Parameter Anti-miR-21 Anti-miR-100 Anti-miR-212 Anti-miR-221 Anti-miR-301

IC50a 48.3±4.4 57.3±16.7 58.7±22.0 32.4±2.3 57.0±14.0

IC70 a 98.4±10.9 136.7±68.9 113.9±29.1 99.4±29.5 106.6±30.2

48 h

Rc 13.8±7.6 8.9±15.5 0 18.3±15.9 0

IC50 a 28.4±8.9 19.2±3.7 12.3±3.9 12.1±4.3 24.0±1.9

IC70 a 44.0±12.8 31.4±3.7 22.4±4.3 21.0±5.2 39.6±1.2

HS766T

96 h

Rc 0 2.8±4.9 0 3.6±6.2 0

IC50 a ND

b ND

b ND

b ND

b 43.3±12.4

IC70 a ND

b ND

b ND

b ND

b 138.1±59.3

48 h

Rc 74.0±14.4 62.8±18.7 52.7±6.6 57.9±1.3 22.6±1.3

IC50 a 21.4±7.9 16.2±12.1 18.8±6.5 10.1±5.7 14.9±4.0

IC70 a 42.6±8.7 36.6±17.8 37.4±12.7 16.1±9.6 26.8±4.9

SW1990

96 h

Rc 13.8±7.1 1.1±1.9 11.1±6.4 15.1±5.7 2.7±2.5

IC50 a 22.3±18.6 21.2±11.5 71.6±43.7 24.9±16.1 41.9±9.6

IC70 a 43.6±21.3 48.0±13.8 191.8±162.9 51.5±12.5 62.8±17.2

48 h

Rc 3.5±6.1 3.3±5.6 0 <1.0 8.2±3.4

IC50 a 15.0±7.8 9.3±4.3 12.2±4.1 2.5±1.7 20.4±1.6

IC70 a 24.8±8.9 17.4±8.1 16.7±7.1 3.6±2.6 26.6±10.7

MiaPACA-2

96 h

Rc 6.1±8.9 5.5±5.2 <1.0 10.3±9.8 <1.0

IC50 a 66.1±32.8 ND

b ND

b 64.3±24.4 89.4±18.9

IC70 a ND

b ND

b ND

b ND

b ND

b

48 h

Rc 39.3±7.7 63.0±6.2 66.2±13.8 39.4±6.9 47.7±5.2

IC50 a 37.9±3.5 50.5±10.3 55.3±25.6 10.1±2.9 49.9±21.8

IC70 a ND

b ND

b 69.9±14.7 ND

b 81.6±36.9

Panc-1

96 h

Rc 34.6±1.4 37.7±4.5 16.5±10.8 31.9±2.3 23.4±11.5

IC50 a ND

b ND

b 121.8± ND

e 1,479±1,842 155.8±49.9

IC70 a ND

b ND

b 217.1±ND

e 479.7± ND

e 285.6± ND

e

48 h

Rc 95.6±11.7 86.8±18.0 63.6±7.90 70.7±8.98 55.5±6.38

IC50 a ND

b 87.1±17.6 66.3±10.5 44.2±17.6 56.5±10.5

IC70 a ND

b 214±ND

e 120.9±10.8 88.6±7.60 87.1±6.0

HPNE

96 h

Rc 73.2±26.3 62.0±25.3 34.0±5.15 31.0±6.33 23.9±1.99

77

CHAPTER 4

ANTISENSE INHIBITION OF microRNA ARRESTS CELL CYCLE, INDUCES

APOPTOSIS AND IDENTIFIES THE TARGET MOLECULES IN PANCREATIC

CANCER

4.1 INTRODUCTION

A growing body of data implicates altered miRNA expression in cancer. The

initial study to establish a link between miRNA and cancer was from the Croce

laboratory. Numerous profiling studies have shown that miRNAs are differentially

expressed in a number of human cancers including thyroid (90, 181), breast (99, 182),

lung (98), pancreatic adenocarcinoma (64, 89, 175), glioblastoma (87, 100),

hepatocellular (81, 82), prostate (183), colorectal (184, 185), leukemia (75, 153) and

lymphoma (101). A polycistron encoding miRNAs miR-17, -18, -19a, -19b-1 and -92-1 is

amplified in human B-cell lymphomas and forced expression of the polycistron along

with c-myc was tumorigenic, suggesting that this group of miRNAs may function as

oncogenes (94). Clear evidence exists that miRNAs are involved in cancer.

What is less clear is the mechanism(s) by which altered miRNA expression

contributes to the development or maintenance of cancer. To understand the function and

78

mechanistic pathway of miRNA, the miRNA’s target gene must be discovered and

properly validated. The miRNA’s target gene may be identified from a number of freely

available data bases. However, these programs have a high percentage of false positive

results. An issue with these prediction algorithms is that since the miRNA does not need

to bind with 100% complimentarity (except the 5’ seed), several hundreds of potential

targets may be predicted for a given miRNA. Using miR-21 as an example, TargetScan,

miRanda and PicTar predict 192, 1000 and 175 targets, respectively. Different prediction

programs follow their own criteria so each program predicts different targets. Therefore,

it is important to narrow down the list of target candidates using several programs and to

properly validate the predicted target.

The target site accessibility can be considered as an important criterion in target

prediction because mRNA secondary structure may inhibit the target gene and miRNA

binding. Accessibility is estimated by the free energy of the flanking 70 nts at the 3’ and

5’ ends of the target site in the 3’ UTR (70). Once a target candidate looks promising, the

miRNA and mRNA binding should be validated using a reporter assay. The 3’ UTR

sequence of the target candidate gene is cloned downstream of a reporter gene such as

luciferase or green fluorescent protein (GFP). This cloned plasmid is transfected with

miRNA mimic or negative control into cells and the expression of reporter gene is

measured in 24-48 h after transfection. For controls, a mutated seed sequence, reversed

sequence of 3’ UTR, or vector only may be used. Another way to check miRNA/mRNA

binding is to precipitate Ago complex and compare the sequences of the 3’ UTR and

miRNA to identify functional miRNA targets in vivo (186).

79

After the binding assay, the protein level of the target gene should be validated by

western blot to see if gene knockdown affects the actual protein function. If an antibody

for target protein is not available, other validation such as ligand binding assay should be

performed (187). Target protein expression may be validated using gain of function or

loss of function studies. If endogenous miRNA is highly expressed, miRNA expression

can be blocked using antisense oligonucleotides resulting in an increase in the target

protein level. However, if the target gene expression is high and the miRNA expression

is not high enough to see a change of protein expression, a miRNA mimic may be added

and target protein should decrease. In addition, genes down stream of the miRNA’s

target gene can be checked to see biological function of target gene. For example, the

Patel laboratory identified PTEN as a target gene of miR-21 (110) and they showed that

inhibition of miR-21 in human hepatocellular cancer increased PTEN level and decreased

tumor cell proliferation, migration, and invasion (86). They also demonstrated that focal

adhesion kinase phosphorylation and matrix metalloproteases 2 and 9, which are

downstream of PTEN, are involved in cell migration and invasion (86).

In our previous study, antisense oligonucleotides to miRNA-21, -212, -221 and

301 showed anti-proliferation effect at low nM concentration and sensitized the effect of

gemcitabine in a schedule-dependent way. Here, we investigated the effects of antisense

oligonucleotides on the cell cycle and apoptosis. We validated that PTEN and RECK are

target molecules of miR-21 and that p27(kip1) is the target of miR-221 in pancreatic

cancer. We also used a reporter assay to identify new target genes for miR-212 which is

FOXO3a.

80


4.2.1 Cell lines and culture

The human pancreatic cancer cell line HS766T was purchased from American

Type Tissue Collection (Manassas, VA). HS766T was cultured in DMEM with L-

glutamine and 10% fetal bovine serum, and it was grown at 37°C in a humidified

atmosphere with 5% CO2.

4.2.2 Antisense Oligonucleotides and Pre-miR™ miRNA Precursor

2’-O-methoxyethyl with phosphorothioate backbone (2’-O-MOE-PS) antisense

oligonucleotides was provided by Isis Pharmaceuticals (Carlsbad, California). Antisense

oligonucleotides sequences are presented in Table 3.1. Pre-miR™ miRNA Precursor

Molecule was purchased from Ambion (Austin, Texas).

4.2.3 Antisense oligonucleotide and Pre-miR™ miRNA Precursor transfection

HS766T cells (2x105 cells in 100 mm dishes) were plated one day before

transfection and antisense or pre-miR were transfected using lipofectamine 2000 and

Opti-MEM medium (Invitrogen, Carlsbad, CA) following the manufacturer’s protocol.

Cells were incubated for 24 h, 48 h or 72 h depending on experiments.

4.2.4 Cell cycle analysis

To determine cell cycle distribution, cells were collected after trypsinization into a

single cell suspension, fixed with cold ethanol at 4 °C for 1 h prior to being stored at -20

81

°C until required for analysis. Upon analysis, fixed cells were washed and resuspended

in 1 ml of PBS containing 50 µg/ml of RNase A and 50 µg/ml of ethidium bromide.

After incubating for 20 min at 37 °C, cells were analyzed for DNA content by flow

cytometry (FACS Caliber, Becton Dickinson Immunocytometry Systems, San Jose, CA).

For each sample, 10,000 events were acquired and cell cycle distributions were

determined using cell cycle analysis software (Modfit®

, Verity, Topsham, ME).

4.2.5 Apoptosis analysis

Annexin V–FITC/propidium iodide (PI) staining was done to identify the

induction of apoptosis in HS766T cells treated with ASO. HS766T cells were plated in

100 mm Petri dishes at 2x105 cells per dish and cultured overnight. Twenty or 48 h after

ASO treatment, cells were collected and washed with PBS. Cells were stained with

Alexa Fluor® 488 annexin V and PI using Vybrant® Apoptosis Assay Kit #2 (Molecular

Probes, Eugene, OR) according to the manufacturer's protocol. Cells were analyzed

using flow cytometry (FACS Caliber, Becton Dickinson) and CellQuest software (Becton

Dickinson). Gating was selected using untreated cells to separate the majority of

doublenegative cells from minor populations of PI or Annexin V-FITC–positive cells.

Cells that were FITC–/PI– were considered viable, FITC+/PI– cells were considered

early apoptotic, and FITC+/PI+ cells were considered nonviable.

4.2.6 Real-time PCR

Total RNA was isolated from cells using Trizol (Invitrogen, Carslbad, CA) per

the manufacturer’s instructions. RNA was treated with DNase I and 1 µg of RNA was

82

reverse transcribed using random primers.

The expression of FOXO3a was measured using a SYBR green real-time

quantitative PCR assay and normalized to 18S rRNA. Relative gene expression was

calculated using 2-(C

TFOXO3a – C

T18S rRNA) . PCR primers for FOXO3a were followings;

sense primer, 5’-TTGCGTGCCCTACTTCAA-3’ and antisense primer, 5’-

GCATGAATCGACTATGCAGTG-3’.

4.2.7 Plasmid constructs

The 3’ UTR of the human FOXO3a (FKHRL1) was amplified using the following

sense (5’-ATGCCTCGAGATCTGCTCTCAGCAAGTGGA-3’) and antisense primer

(5’-ATTAGCGGCCGCTGGAGAGCTGAGCTGATTTCT-3’) containing enzyme

restriction site (XhoI and NotI) at the both ends. Amplified PCR product was cloned at

downstream of the Renilla luciferase stop codon in psiCHECKTM

-2 vector (Promega,

Madison, WI). Renilla luciferase is a primary reporter gene in psiCHECKTM

-2 vector

and this vector also contains a secondary Firefly luciferase reporter cassette, which was

used to normalize the Renilla luciferase signal. Constructed plasmid was verified by

DNA sequencing.

4.2.8 Luciferase assay

HS766T cells (0.5x105

cells) were plated in 24 well plates one day before

transfection. Plasmid construct was transfected with pre-miR-negative control or pre-

miR-212 using lipofectamine 2000 and Opti-MEM medium (Invitrogen, Carlsbad, CA).

Cells were harvested 24h later and Renilla and Firefly luciferase activity were measured

83

using the Dual Luciferase Assay (Promega, Madison, WI) according to the company’s

protocol.

4.2.9 Western blotting

HS766T cells (2x105 in 100 mm dish) were treated with an IC50 dose of ASO to

miR-21, -221 and -212 for 24, 48, and 72 h or with a 30 nM or 60 nM of pre-miR-212.

Cells were washed in ice-cold PBS and lysed in RIPA buffer containing protease

inhibitor. Protein concentration was measured using the BCATM

protein assay kit (Pierce,

Rockford, IL). Thirty µg of total protein extract was separated on a 10% SDS-PAGE gel.

Blotting was performed with the following antibodies: PTEN (Cell signaling, Danvers,

MA), RECK (Santa Cruz Biotechnology, Santa Cruz, CA), p27 (kip1)

(Abcam,

Cambridge, MA) and FOXO3a (Upstate, Temecula, CA). β-actin (Cell signaling, Danver,

MA) was used as a loading control. Secondary HRP antibody was detected using ECLTM

Western Blotting Analysis System (Amersham Biosciences, Piscataway, NJ).

4.3. RESULTS

4.3.1 Effects of miRNA inhibition on the cell cycle

The effects of inhibiting miR-21, -100, -221, -301 and -212 on the cell cycle were

studied in HS766T cells. A 48 h exposure of 20 nM of control oligo produced 57.1% of

G1, 12.4% of G2, 30.5% of S phase and a slight increase in the sub-G1 phase compared

to the lipid control (Figure 4.1A), however it produced no net effect on the cell cycle. An

increase in the sub-G1 fraction suggests the presence of apoptosis. Even at a higher

84

concentration of 40 nM (48 h exposure), the control oligo showed almost the same cell

cycle distribution as the lipid control (data not shown). miR-21 inhibition resulted in

62.2% of G1, 15.9% of G2, and 21.9% of S phase at IC50 (48 h exposure) and the G1

phase was increased to 65.2% at the IC70 (48 h exposure). This demonstrates that miR-

21 inhibition produced a G1 phase arrest as the amount of cells in the G1 phase increased

by about 10% and the amount of cells in the S phase decreased by about 10% (Figure

4.1B). Inhibition of miR-301 increased the sub-G1 fraction to 42.5% at an IC50 dose

(Figure 4.1C). Inhibition of miR-212 produced a 19.6% of G2 at IC50 and the G2 phase

was increased to 30.3% at an IC70 dose (Figure 4.1D). Thus ASO-miR-212 produced a

G2 phase arrest. Conversely, inhibiting miR-221 did not show any noticeable changes in

the cell cycle at the IC50 by 48 h (data not shown) and or an IC70 treatment (data not

shown). Inhibition of miR-100 also didn’t show any prominent changes at IC50 (48 h

exposure, data not shown).

4.3.2 Effect of miRNA inhibition on apoptosis

Since the results of the cell cycle analysis demonstrated that inhibition of some

miRNAs increased the sub-G1 fraction and antisense to miR-21 has been shown to

induce apoptosis (87), we wanted to examine the effects of miR-21, -221, -212 and -301

inhibition on apoptosis. This was done to determine whether the antiproliferative effects

of miRNA inhibition were due to apoptosis induction. Phosphatidylserine externalization

is a parameter of ongoing apoptosis, which can be measured by Annexin V staining. The

results of Annexin V staining showed that early apoptotic cells (Annexin V positive cells)

were increased in a time-dependent manner in HS766T cells (Figure 4.2). Only 4.9±1.2

85

% and 11.4±2.9% of cells were annexin V positive after 24 and 48 h incubation of 50 nM

of control oligo, respectively. However, HS766T cells transfected with ASO-miR-21, -

212, -221 or -301 induced 19.9%, 6.0%, 10.2% and 15.8% of annexin V positive cells

after 24 h, respectively. Furthermore, the transfection of each ASO for 48 h dramatically

increased the apoptotic cells compared to control oligo. The percentage of cells staining

positive with Annexin V was 58.2%, 28.8%, 36.6%, and 53.1% for ASO-miR-21, -212, -

221, and -301, respectively (Figure 4.2). Relatively low concentrations (25 nM) of ASO-

miR-21 and -301 also showed 21.0±1.5 and 25.4±1.3% of Annexin V positive cells after

48 h incubation (data not shown). In addition, these data showed that ASO-miR-21 and -

301 induce a relatively higher amount of apoptotic cells compared to ASO-miR-212 and -

221.

4.3.3 PTEN, RECK and p27(kip1) validation as target of miR-21 and miR-221

miRNAs exert their activity by binding to conserved sequence within the 3’ UTR

of protein coding mRNAs. miRNA target discovery and validation is an active area of

research and the targets to few mammalian miRNAs have been discovered. Some of the

mRNA targets to miR-21 and miR-221 have been recently discovered. miR-21 has been

shown to target the tumor suppressor PTEN (110). Three groups working independently

demonstrated that miR-221 targets the tumor suppressor p27(kip1) (178, 180, 188). The

tumor suppressor RECK (reversion-inducing cysteine-rich protein with Kazal motifs) is

predicted to be a target of miR-21 (107). In order to validate that the ASO to miR-21 and

miR-221 is working through a miRNA effect (i.e. at the level of translation), we

performed Western blots to detect these tumor suppressors in HS766T cells treated with

86

control oligo or antisense oligonucleotide for various times. The amount of p27(kip1)

protein increased over the 72 h period of ASO-miR-221 treatment (Figure 4.4B). This

demonstrates that as miR-221 is inhibited by antisense, less miRNA is available to

negatively regulate the p27(kip1) mRNA. ASO-miR-21 increased both PTEN and RECK

levels at 24, 48 and 72 h of exposure (Figure 4.4A).

4.3.4 FOXO3a as a new target of miR-212

FOXO3a is one of the mammalian forkhead members of the class O (FOXO)

transcription factors and is involved in cell cycle arrest and apoptosis (reviewed in (189)).

Since ASO-miR-212 showed cell cycle arrest at G2/M phase and also induced apoptosis,

we wanted to identify a possible target gene of miR-212 that explains the mechanism of

cell cycle arrest and apoptosis. First, target candidates of miR-212 were investigated

using several target prediction programs such as TargetScan, miRanda and PicTar.

Among numerous predicted target genes, FOXO3a was one of promising candidates

because all three programs predicted FOXO3a as a target of miR-212 and it is a gene that

regulates both cell cycle and apoptosis. FOXO3a contains a putative miR-212 binding

site in its’ 3’ UTR. The potential base pairing between FOXO3a and miR-212 is shown

in Figure 4.4A. The binding site is highly conserved in several species (Figure 4.4A).

It was reported that the secondary structure of the 3’ UTR of the target gene may

prevent miRNA from binding and that miRNA accessibility may be a critical

characteristic of target binding (70). To further confirm that FOXO3a may be a target

gene of miR-212, we calculated the free energy of the ~ 70 nt flanking the 5’ and 3’

87

regions of the predicted binding site using mFold (190). The values are -7.8 and -12.8

kcal/mol, respectively, showing a favorable binding.

The expression of mRNA level of FOXO3a was quantified using a real-time PCR

assay after antisense oligonucleotide (ASO) transfection. HS766T cells were treated with

either control oligonucleotide (20 nM) or ASO-miR-212 (20 nM) for 24 h and 48 h. The

data demonstrated that the mRNA level was significantly increased in the cells that were

treated with ASO-miR-212 for 48 h compared to untreated or control oligonucleotide

treated cells (Figure 4.4 B).

To verify whether miR-212 interacts with the 3’ UTR of the FOXO3a, FOXO3a

3’ UTR was cloned downstream of the Renilla luciferase translational stop codon. This

plasmid construct was transfected into HS766T cells with either pre-miR-negative control

or pre-miR-212 oligonucleotides. Cells were incubated for 24 h and Renilla luciferase

activity was normalized with Firefly luciferase activity. As shown in Figure 4.5A, the

luciferase activity in cells treated with pre-miR-212 was significantly reduced by

approximately 50% compared to the cells with pre-miR-negative treatment, indicating

that miR-212 binds to the 3’ UTR of FOXO3a.

miRNA binds to the 3’ UTR of the target gene and represses the target gene

translation (11). To determine whether miR-212 regulates FOXO3a expression through

translational repression, we performed western blotting with anti-FOXO3a antibody

(Figure 4.5 B and 4.5 C). We treated the cells with ASO-mir-212 in various time points

and protein is up-regulated at 48 h and 72 h (Figure 4.5 B). In addition, cells were treated

with pre-miR-negative and pre-miR-212 oligonucleotide at 30 nM and 60 nM and protein

88

level of FOXO3a was reduced (Figure 4.5 C). The results that we showed here

demonstrate that FOXO3a is a target gene of miR-212.

4.4 DISCUSSION

Consistent with previous reports, antisense to miR-21 resulted in a concentration

dependent G1 phase arrest and induction of apoptosis in the pancreatic cancer cell line

HS766T (Figure 4.1 and 4.2). miR-21 is highly expressed in human glioblastoma tumor

tissues and knockdown of miR-21 induced activation of caspases (87). Apoptosis

induced by ASO-miR-21 was due to downregulation of Bcl-2 in the MCF-7 breast cancer

cell line (85). In addition, the tumor suppressor PTEN that coordinates G1 cell cycle

arrest is a validated target of miR-21 (110). In HS766T pancreatic tumor cells, treatment

of ASO-miR-21 also increased PTEN protein expression (Figure 4.3A) and induced a G1

cell cycle arrest (Figures 4.1B). We also observed that miR-212, -221 and -301 regulates

the cell cycle and/or apoptosis in pancreatic tumor cells.

ASO-miR-21 also increased RECK protein levels in HS766T cells over the 72

hours of exposure. RECK is a membrane bound protein that inhibits matrix

metalloproteinases and angiogenesis (191). Increased expression of miR-21 in pancreatic

adenocarcinoma (64, 89), may likely suppress RECK protein levels. In fact, pancreatic

adenocarcinomas with positive RECK staining were less invasive compared to RECK

negative tumors and patients who had tumors with high RECK expression showed

significantly better prognosis than those with RECK-negative tumors (192).

89

Previous studies demonstrated that p27(kip1), which plays a key role in the

growth arrest at the G1/S transition, is one of the targets of miRNA-221 (178, 180, 188).

Visone, et al., showed that treatment of TPC-1 cells with miRNA-221 mimetic increased

the transition from the G1 to S phase and reduced p27(kip1) protein (180). Also, ectopic

expression of miR-221 and -222 enhanced the progression to the S phase of cell cycle,

therefore, increasing the growth of LNCaP cells (180). Of major importance in our

previous data is that the overall antiproliferative effects of ASO-miR-221 were

significant in pancreatic tumor cells (Figures 3.3). However, contrary to our expectations,

there was no cell cycle change after transfection of anti-miR-221 in HS766T cells even

though transfection of ASO-miR-221 reduced the amount of miR-221 (Figure 3.3D) and

the level of p27(kip1) protein was increased after 48 h of treatment (Figure 4.3B). This

result may be due to the possibility that apoptosis induced by ASO-miR-221 was cell

cycle independent and apoptotic cells mainly emerged from the G1 phase and therefore

resulted in no net changes in the cell cycle pattern. Also, bioinformatic analyses suggest

a great number of predicted targets of miRNA-221. If inhibition of miR-221 by antisense

may increase some proteins impairing p27(kip1) nuclear import in pancreatic cancer cells

in our experimental conditions, cell cycle arrest effects could be overcome.

ASO-miR-212 significantly blocked G2/M phase with abrogation of G1 phase

and ASO-miR-301 induced apoptosis without arresting the cell cycle (Figure 4.1 and 4.2).

These observations made us further investigate and elucidate the miRNA target genes

related with cell cycle and apoptosis mechanisms in pancreatic tumor cells. In this study,

we identified FOXO3a as a target gene of miR-212.

90

Forkhead box O transcription factors are the mammalian orthologs of C.elegans

transcription factor DAF-16 (193, 194) and FOXO3a (FKHRL1) is one of the FOXO

family members (195). FOXO3a is involved in apoptosis, cell cycle regulation, oxidative

stress and longevity (189, 196, 197). It is reported that FOXO3a functioned as a tumor

suppressive gene causing cell death in several cancers (198-200). For example, FOXO3a

inhibits estrogen-dependent breast cancer cell growth and tumorigenesis (198) and the

transcription factor RUNX3, which mediates apoptosis and cell growth inhibition in

gastric epithelial cells, physically interacts with the FOXO3a and induces apoptosis,

activating Bim (199). Also, Chen et al. (200) demonstrated that the accumulation of

FOXO3a increased radiosensitivity and patients’ survival was enhanced. FOXO3a also

regulates cell cycle. It arrests the G1/S phase during the cell cycle either in a p27(kip1)-

dependent (201) or p27(kip1)-independent (202, 203) manner. In addition, FOXO3a

induces G2/M phase delay or arrest through the GADD45a (growth arrest and DNA

damage inducible alpha protein) or cyclin G2 (189, 204). FOXO3a directly binds and

activates the promoter of GADD45a (189, 204). Tran et al. also used GADD45a-

deficient fibroblasts demonstrating that G2/M arrest by FOXO3a at least partly requires

GADD45a (204). In contrast, one paper showed that GADD45a is overexpressed in

pancreatic adenocarcinoma and it enhances cell proliferation in pancreatic cancer (205).

Yamasawa et al. reported that GADD45a is expressed in 54.2% of resectable invasive

ductal carcinomas (IDCs) of the pancreas and 13.6% of IDC patients showed a point

mutation in the GADD45a gene (206). These two results are contradictory with other

reports and our results. However, they did not explain the further mechanism of

91

overexpressed GADD45a and the expression of GADD45a in those two cases might be

affected by other upstream signaling or other miRNAs.

To date, no one has identified a target gene of miR-212. Here, we demonstrated,

for the first time, that ASO-miR-212 induced apoptosis and caused G2/M arrest during

the cell cycle (Figure 4.1 and 4.2D), regulating the FOXO3a expression at the RNA and

protein level (Figure 4.4 and 4.5). We are currently investigating the downstream gene

that might be affected by the FOXO3a to better explain the mechanism of apoptosis and

cell cycle. We expect that GADD45a or cyclin G2 are possible downstream genes to

explain G2/M arrest and Bim is a candidate for apoptotsis. Moreover, the G2/M arrest

was more significant in Panc-1 cells compared to HS766T after ASO-miR-212 treatment

(unpublished data). Therefore, the correlation of GADD45a level and the effect of G2/M

arrest between Panc-1 and HS766T will be studied and these results may explain why

miR-212 causes a cell cycle arrest and apoptosis in pancreatic cancer.


Supported by an NIH grant CA107435 to T.D.S. and a grand from the National

Pancreas Foundation. We thank Christine Esau at ISIS Pharmaceuticals for her

assistance with the Antisense oligonucleotides and also thank Jong-Kook Park with

experiments assistance.

92

Figure 4.1. Flow cytometric analysis of the effect of antisense oligonucleotide (ASO)

on cell cycle of HS766T cells.

Histograms shown here represent 10,000 events and the percentage of each cycle is

calculated. (A) cell cycle of control oligo, 20 nM for 48 h. (B) cell cycle of ASO-miR-21,

IC50 for 48 h. (C) cell cycle of ASO-miR-301, IC50 for 48 h. (D) cell cycle of ASO-miR-

212, IC70 for 72 h.

93

0

10

20

30

40

50

60

70

Anne

xin

V p

ositiv

e c

ells

(%

)

*

*

**

**

**

**

Contro

l olig

o (5

0nM

)

AS

O21 (4

5nM

)

AS

O212 (2

0 n

M)

AS

O221 (2

0 n

M)

AS

O301 (4

0 n

M)

Contro

l olig

o (5

0 n

M)

AS

O2

1 (4

5 n

M)

AS

O212 (2

0 n

M)

AS

O221 (2

0 n

M)

AS

O301 (4

0 n

M)

24 hr 48 hr

Figure 4.2. Flow cytometric analysis of apoptosis in HS766T cells.

Apoptosis induction in HS766T cells transfected with control oligo and antisense to miR-

21, -212, -221, or -301. Cells were treated with an IC70 concentration of each ASO.

Cells were harvested after 24 and 48 h of incubation and subsequently assayed for

apoptosis induction by flow cytometry using Annexin V-FITC staining.

* P < 0.05; ** P < 0.01 (Student’s t-test).

94

Figure 4.3. Western blot analysis of PTEN, RECK and p27(kip1) in HS766T cells

treated with antisense to miR-21 or miR-221.

Increased protein expression of the predicted targets to (A) miR-21(PTEN), miR-21

(RECK) and (B) miR-221(p27(kip1)) are shown. Numerical values represent the relative

levels of each protein to control protein (actin) as determined by densitometry.

95

(A)

(B)

Figure 4.4. Alignment of the FOXO3a binding site with miR-212 and mRNA

expression of FOXO3a after ASO treatment.

(A) Seed region complementarity between miR-212 and FOXO3a 3’UTR and

conservation of FOXO3a binding site across species. (B) The relative gene expression of

FOXO3a was measured after transfection. 20 nM of control oligo and ASO-miR-212

were used.

un

trea

tmen

t_24h

lip

o c

on

tro

l_24h

lip

o c

on

tro

l_48h

co

ntr

ol o

lig

o_

24h

co

ntr

ol o

lig

o_

48h

AS

O2

12_

24h

AS

O2

12_

48h

Rela

tive F

OX

O3

a m

RN

A leve

l

0

1e-7

2e-7

3e-7

4e-7

5e-7

6e-7

7e-7

96

Figure 4.5. Target validations by luciferase assay and FOXO3a western blotting.

(A) Renilla luciferase activity was normalized by firefly luciferase and cells were treated for 24 h. FOXO3a protein levels were

evaluated after ASO-miR-212 transfection at various time points (B) and transfecting pre-miR-negative (N) and pre-miR-212 (P) at 30

nM (C) and 60 nM (D). Numerical values represent the relative levels of each protein to control protein (actin) as determined by

densitometry.

97

CHAPTER 5

SYSTEMATIC EVALUATION OF microRNA PROCESSING PATTERNS

IN TISSUES, CELL LINES AND TUMORS

5.1 INTRODUCTION

The genes encoding microRNAs (miRNAs) are located within introns, intergenic

regions, and exons (15). The primary RNA transcript containing the miRNA primary

precursor (pri-miRNA) is processed in the nucleus by Drosha/DGCR8 to produce the

precursor miRNA (pre-miRNA) (19). pre-miRNA is ~70 nt in length and contains the

characteristic hairpin structure. The pre-miRNA is transported to the cytoplasm by

Exportin 5 (207), where it is subsequently processed by Dicer to the ~21 nt mature

miRNA.

Very little is known regarding the regulation of miRNA processing. Conceivably,

regulation of miRNA biogenesis may occur at the level of Drosha processing, nuclear

transport, or Dicer processing. Several studies have shown that miRNAs are present at

the level of precursor but are not processed to the mature miRNA. Michael et al. (76)

used Northern blots to show that the precursors to miR-143 and miR-145 are expressed in

colorectal tissues and tumors; however, the mature miRNA was detectable only in the

98

normal colorectal tissue. Pre-miR-138-2 was shown by Northern blotting and in situ

hybridization to be expressed in HeLa cells, but the mature miR-138 was undetectable

(43). By using published mRNA data to approximate the miRNA precursor expression

encoded within introns, Thomson et al. (208) showed widespread down-regulation of

miRNAs in cancer. To our knowledge, no one has addressed the issue of relative

differences in precursor and mature miRNA expression by large-scale profiling. This

may be due to the fact that the majority of miRNA studies have focused on quantifying

the active mature miRNA and not the miRNA precursors.

In 2004, the Schmittgen laboratory developed the first real-time RT PCR method

to quantify miRNA (59). This method quantified the miRNA precursors with the goal of

predicting the expression of mature miRNA. By designing primers to the stem of the

miRNA hairpin, the primary precursor and precursor miRNA were simultaneously

quantified (59). This technology has been applied to profile the expression of over 200

miRNA precursors in a number of human cancer cell lines (59, 61, 209) and tissues from

patients with pancreatic cancer (64). In 2005, a TaqMan-based RT-PCR assay was

designed to quantify the mature miRNA (60). PCR and Northern blotting demonstrated

that the expression of mature and precursor miRNAs generally correlate (59, 61, 64, 110,

209). However, precursors to miR-1, miR-122a, and miR-133 showed considerable

expression by PCR, yet mature miRNA was undetectable by Northern blotting (61). This

prompted us to ask the following question: How widespread are alterations in miRNA

biogenesis in different tissues, tumors, or cancer cells lines? To address this question, we

profiled the expression of over 200 precursor and mature miRNAs using sensitive

realtime PCR assays. Our results demonstrate that a wide discrepancy exists between the

99

levels of precursor and mature miRNA, suggesting that unknown mechanisms that

control processing play a critical role in regulating the expression of active, mature

miRNA.


5.2.1 Cells, tissues and RNA

Human cancer cell lines were obtained from ATCC or other investigators.

Human total RNA from 20 tissues was from Ambion. CD19+ human B cells were

purchased from AllCells. RNA from pancreas and liver tumor and adjacent benign

pancreas were obtained from our prior studies (64, 210). RNA was isolated from all

samples using Trizol per the manufacturer’s instructions. RNA purchased from Ambion

was isolated using ToTALLY RNA (Ambion). Both Trizol and ToTALLY RNA are

similar to the widely used guanidine thiocyanate, acid phenol:chloroform procedure of

Chomczynski and Sacchi (211) and will contain mature miRNA. RNA integrity was

evaluated by analyzing 50–100 ng of total RNA using the Agilent 2100 Bioanalyzer.

5.2.2 Real-time RT PCR, miRNA precursors, and mature miRNA

Expression data on 205 miRNA precursors in human cancer cell lines, pancreas,

and liver tissues were as previously reported (61, 64, 210). The expression of 201

miRNA precursors in the 21 normal human tissues was determined using real-time RT

PCR as previously described (59, 61). Mature miRNA expression in the normal tissues,

cell lines, pancreas, and liver tissues was determined using a real-time PCR assay to

100

mature miRNA as described (60) with several modifications. cDNA to the mature

miRNA was synthesized using gene specific looped primers. Primers were grouped into

five portions of 48-plex each. Mature miRNAs were selected only to match the miRNAs

on which we had precursor data. Five different cDNAs were synthesized for each sample

using one of the five RT 48 plex primer mix as described (60).

5.2.3 Real-time RT PCR, absolute copy number for precursor and mature miRNA

Absolute copy number of miR-155 precursor was determined by constructing a

standard curve of pre-miR-155. Pre-miRNA RNA was synthesized using in vitro

transcription using primers that annealed to ~50 base pairs (bp) upstream of and down-

stream from the miR-155 hairpin. The T7 promoter sequence was added to 59 end of the

forward primer. Amplification of the pri-miRNA gene was performed by amplifying

genomic DNA (Roche) using standard procedures. The PCR product served as a

template for in vitro transcription. The transcription product was gel purified, and the

concentration was measured using a Nanodrop spectrophotometer. The reverse

transcription reaction was performed as described above, and standard curves of the log

of pre-miRNA-155 copy number versus the CT were made. We also generated a standard

curve for mature miR-155 as described (60). A minimum of 10 copies/cell was used as

the selection criteria for cutoff. The raw data set for the precursor and mature miRNA

expression levels is presented in the Appendix Table C.1-C.4.

101

5.2.4 Northern blotting

Northern blotting was performed as previously described (2). LNA probes

specific to the mature miRNA were purchased from Exiqon.

5.2.5 In situ detection of miRNA

RT in situ PCR to detect the miRNA precursors was used as previously described

(64). The identical primers used to detect the miRNA precursors by real-time PCR were

used for the in situ RT-PCR. The only exception was miR-31; solution PCR used miR-

31 primary precursor primers, while the in situ PCR used precursor miR-31 primers. The

chromogen is nitroblue tetrazolium and bromochloroindolyl phosphate with nuclear fast

red as the counterstain. Therefore positive signal will appear blue, and a negative signal

will appear pink. Mature miRNA was detected by in situ hybridization using LNA

probes specific to the mature miRNA (Exiqon).

5.2.6 Data analysis

Pearson product moment correlation coefficients were determined for each pair of

precursor and mature miRNA using Microsoft Excel. The significance (probability) of

the correlation coefficients for each pair was determined from the t-statistic. The

probability of the t-statistic indicates whether the observed correlation coefficient

occurred by chance if the true correlation is zero. Correlation coefficient was considered

to be significantly different from zero at the 0.05 level (P ≤ 0.05). P values for all of the

correlations are located in the Appendix Table C.5 and C.6.

102

5.3 RESULTS

The expression of 201 mature and precursor miRNAs was profiled in a panel of

22 human tissues, 37 human cancer cell lines, and pancreas and liver tumors/tissues using

real-time PCR assays specific to each class of miRNA (Appendix Table C.1-C.4).

Expression of the active, mature miRNA was either broadly expressed in each of the 22

tissues or was expressed among one, two, or three different tissues. Our mature miRNA

data in tissues closely resembled that of Liang et al. (212), who used the identical

TaqMan assay to profile miRNA in 40 normal human tissues. miRNA expression in the

tissues is designated as ubiquitous, tissue specific, or tissue enriched (Table 5.1).

Ubiquitous expression is designated as those mature miRNAs that are broadly expressed

in all or most tissues. Tissue-specific expression was defined as those miRNAs whose

expression is 20-fold or higher in the specific tissues compared with the mean of the

other tissues. For many specific miRNAs, the expression in the nonspecific tissues was

undetectable, so it was not possible to calculate a foldchange. The tissue-enriched

designation was reserved for mature miRNAs whose expression was less than 20-fold in

the enriched tissues compared with the mean of the other tissues. Tissues expressing the

most specific miRNAs include brain, heart, skeletal muscle, and pancreas (Table 5.1).

Several miRNAs have the ability to process different mature miRNAs from either

end of the same precursor. The mature miRNA is referred to as 5’ or 3’ (e.g., miR-142-

5p and miR-142-3p) or by the star designation (e.g., miR-9 and mir-9�) (12). TaqMan

assays were available to quantify 10 of these miRNAs, thus enabling us to study their

processing patterns in a variety of cell lines and tissues. Interestingly, the expression of

103

both the 5’ and 3’ mature miRNA was detectable in most of the cell lines and tissues with

no apparent preference to process one or the other miRNA (Table 5.2). We also

compared the relative expression levels of both 5’ and 3’ miRNA. For some miRNAs,

the 5’ was expressed at somewhat higher amounts, and for other miRNAs, expression of

the 3’ was more predominate (Table 5.2). In some situations, only one of the two mature

miRNAs was detectable, for example, miR-302a and miR-302c but not miR-302a� or

miR-302c� (Table 5.2); however, this was rare. Asymmetric RISC assembly accounts

for one strand of the miRNA to accumulate (i.e., guide strand) and the other strand (i.e.,

passenger strand) to be degraded (31). Asymmetric RISC assembly likely accounts for

one of the two mature miRNAs to accumulate at slightly higher levels. However our data

demonstrate that both the 5’ and 3’ miRNAs accumulate in tissues at significant levels,

adding to the complexity of the activity of miRNAs.

The correlation between the expression levels of the precursor and mature

miRNAs was determined from the Pearson coefficient. The Pearson coefficient varied

widely among different cells/tissues and miRNA. For many miRNAs, the Pearson’s

correlation was > 0.6 (P < 0.05), demonstrating good correlation between the expression

of precursor and mature miRNA (Appendix Table C.5 and C.6). For other comparisons,

the Pearson value was near zero or negative, demonstrating that the expression of the

miRNA precursor did not correlate to the mature miRNA. miR-100 is an example of a

miRNA with good correlation between precursor and mature miRNA levels in the cell

lines, tissues, and tumors (Figure 5.1 A–C). One hundred twenty-five miRNAs displayed

good correlation (Pearson’s ≥ 0.3, P < 0.05) between the expression of the precursor and

mature miRNA (Appendix Table C.5 and C.6).

104

Other situations displayed good correlation between the expression of precursor

and mature miRNA in specific tissues, while the expression of both precursor and mature

miRNA in the other tissues was very low or undetectable. These tend to be the tissue

specific miRNAs listed in Table 5.1 and were more prevalent among the tissue panel than

in the cell lines. Examples include miR-137 and miR-9 in brain and miR-1-1 in skeletal

muscle and heart (Figure 5.1 D–F).

Still other situations exist where high amounts of precursor were present in many

samples, yet mature miRNA was undetectable or had very low expression. The precursor

to the brain-specific miR-128a was expressed predominately in brain tissue, yet it was

expressed at ~100 copies per cell in many tissues (Figure 5.2A). Expression of the

mature miRNA was detectable only in brain and skeletal muscle (Figure 5.2B). miR-

128a precursor was present in all of the cancer cell lines at levels of several hundred

copies per cell, yet mature miR-128a was not expressed in any of these cell lines (Figure

5.3B). miR-105 had detectable precursor expression, at several hundred copies per cell,

in HS766T, Panc-1, MiaPaca-2, HCT-116, HeLa, and HL-60 cells, but these cells had

undetectable mature miRNA (Figure 5.3A).

The precursor PCR assay simultaneously measures the pri- and pre-miRNA (59).

We asked the following question: Is the mature miRNA absent in some of these cell lines

because the pri-miRNA is not processed by Drosha to the pre-miRNA? To answer this

question, we used Northern blotting to detect the pre-miRNA. Our experiments required

the enhanced sensitivity of LNA probes to visualize many of the miRNA precursors. The

precursor to miR-128a was present in four cancer cell lines and mouse brain; however,

the mature miR-128a was present only in mouse brain (Figure 5.3D). Precursor to miR-

105

105 was clearly visible by Northern blotting in 6 cancer cell lines, but mature miR-105

was not (Figure 5.3C).

miR-31 was of particular interest because it displayed the greatest amount of

differential processing of any of the miRNAs studied. This differential processing was

validated by both real-time PCR and Northern blotting (Figure 5.4). Mature miR-31 was

detectable by real-time PCR and was clearly visible by Northern blotting in the cancer

cell lines HS766T and PL45 (pancreas) and HT-29 (colorectal) but not in the

hematological cell lines (K562 or HL-60) (Figure 5.4C,D). Mature miR-31 was

detectable at low to high levels in A549, HOP62, H719, MDA231, HeLa, PC3, and

HCT8 cells but was undetectable in MCF-7, LNCaP, and Daudi cells (Figure 5.4).

Interestingly the miR-31 precursor was detectable by Northern blotting in each of these

cell lines (Figure 5.4C,D). Our data clearly demonstrate situations where the miRNA

primary precursors are transcribed and processed to the precursor miRNA yet are not

processed to mature miRNA.

Precursor miRNA is generated by Drosha in the nucleus and then transported to

the cytoplasm by Exportin 5. Since Dicer processing occurs in the cytoplasm, we asked

the following question: Are certain miRNA precursors not processed to the mature

miRNA because they remain in the nucleus rather than being transported to the

cytoplasm? To answer this question, we applied in situ RT-PCR and in situ hybridization

to detect the precursor and mature miRNAs, respectively. For miRNAs that are

processed to mature (e.g., miR-31 in HS766T cells), the precursor staining was apparent

in both the nucleus and cytoplasm, while the mature miRNA was present only in the

cytoplasm (Figure 5.4E,F). For miRNAs that are not processed to the mature form, the

106

precursor staining was primarily nuclear and/or nucleolar (Figure 5.3E,F and Figure

5.4G). This phenomena is particularly striking for miR-31 precursor expression in MCF-

7 cells; extensive positive staining for pre-mir-31 was apparent in the nucleolus only

(Figure 5.4G). MCF-7 cells are negative for mature mir-31 (Figure 5.4H). For miR-31,

miR-105, and miR-128a in these cell lines, processing to the mature form does not

proceed because the miRNA precursor is retained in the nucleus. The in situ PCR signal

is for the precursor miRNA (as well as the primary precursor) because the precursor

miRNAs were detected by Northern blotting (Figure 5.3 and 5.4).

The Pearson correlation was compared among the cell lines, tissues, and tumors

by plotting the frequency versus the Pearson coefficient (Figure 5.5). The cell lines

produced a unimodal distribution centering near zero (Figure 5.5A). The histogram for

the 22 normal tissues produced a bimodal distribution with one mode centered near zero

and the other greater than zero (Figure 5.5B). The pancreas and liver tissues also

produced conflicting histograms, with the liver specimens displaying a unimodal

distribution centering at zero while the pancreas tissues were bimodal (Figure 5.5C,D). A

high positive Pearson correlation demonstrates that the expression of precursor and

mature miRNAs are directly proportional and suggests efficient processing of precursor

to mature miRNA. A low Pearson coefficient suggests no relationship between the two,

one explanation being that precursors are not being processed to mature miRNA. A

negative Pearson suggests an inverse relationship between mature and precursor miRNA.

It should be emphasized that of over 800 comparisons, only 27 negative Pearson

coefficients were significant (P < 0.05). Our data suggest that processing of many

precursor miRNAs is somehow deficient or defective in cancer cell lines and liver tissues.

107

However in 22 normal tissues and pancreas tissues, there is a population of miRNAs that

are processed efficiently. This trend parallels the miRNA expression pattern in tumors.

In pancreas cancer, there is a predominate increase in the expression of the miRNA (64),

while in liver cancer, the opposite is true (81, 210). This suggests that in pancreatic

cancer, the increased expression of miRNA is regulated at the level of transcription with

no apparent alterations in processing, but in liver cancer, the reduced expression of

miRNA in the tumors results from a reduction in miRNA processing.

It was recently demonstrated that mutations (153) or SNPs (213) within the

miRNA precursors can cause interference with miRNA processing. While we believed

this to be an unlikely explanation to describe the lack of miRNA processing, since the

phenomena was so widespread (Figure 5.3 and 5.4), we sequenced +100 bp on either side

of the miR-31 hairpin in HeLa and MCF-7 cell lines to look for evidence of mutations or

SNPs. The sequences were unchanged compared with wild type, demonstrating that

reduced levels of mature Mir-31 in these cells was not due to reduced processing caused

by a mutation or SNP.

5.4 DISCUSSION

The Pearson’s correlation data along with the relative expression levels of

precursor and mature miRNA demonstrated that biogenesis of miRNAs fit into different

categories. In one group of miRNAs, the precursor and mature miRNAs are expressed in

most tissues and cell lines, and the precursor expression correlates with the mature

miRNA expression. These miRNAs typically had a Pearson correlation coefficient > 0.3

108

and P < 0.05. Examples of these miRNAs include many of the ubiquitously expressed

miRNAs such as miR-100, miR-155, and miR-125a. Expression of these miRNAs would

presumably be regulated by transcription alone with no regulation of processing events

(i.e., all miRNA expressed as primary transcripts are processed to mature miRNA).

Another group of miRNAs, such as many of the tissuespecific miRNAs, have a

high amount of expression of both the precursor and mature in specific tissues only. So

expression of these miRNAs is regulated by transcription in specific tissues with no

apparent regulation of miRNA biogenesis. Examples of these miRNAs include miR-9,

miR-1, and miR-216. Still another group of miRNAs expressed the precursor at

significant levels in all or most of the cells or tissues; however, the mature miRNA is not

present. Examples include miR-105, miR-128a, and miR-31 in cancer cell lines (Figure

5.3 and 5.4) and represent miRNAs that are expressed at the primary transcript level yet

for some unknown reason are unable to be processed to the mature miRNA.

Our data clearly show that a large number of miRNAs are transcribed as

precursors but are not processed to mature miRNA. Conceivably any of the steps

involved in miRNA biogenesis (nuclear transport or processing by Drosha or Dicer)

could be involved to reduce the mature miRNA levels. Reduced levels of Dicer were

shown in lung tumors (214), and many of the cancer cell lines studied here had reduced

mature miRNA. It is unlikely that a whole-scale reduction in Drosha or Dicer processing

accounts for the reduced levels of mature miRNA in cells that express the miRNA

precursors since other miRNAs are efficiently processed to mature in these same cell

lines or tissues. One explanation to account for reduced nuclear transport or processing

by Drosha or Dicer in some miRNAs but not others is that other specific factors bind to

109

the miRNA precursors and either promote or interfere with processing or transport. In

fact, this inhibitory model was proposed by Obernosterer et al. (43) to account for a lack

of mature miR-138 in HeLa cells. It was recently shown that hnRNP A1 is required for

Drosha processing of miR-18 from the primary precursor (40). Conceivably, other

hnRNPs may be involved in regulating steps of miRNA biogenesis. While we did not

use Northern blotting and in situ hybridization to study all of the miRNAs with reduced

processing, the ones that were studied in several cancer cell lines showed that the miRNA

was processed to the precursor but was not transported from the nucleus to the cytoplasm.

This suggests an intriguing, unknown mechanism to guide the subcellular distribution of

miRNA precursors and prevent them from being processed to the active mature miRNA.

It is our hope that with the availability of this data set, many future studies will be

initiated to unravel the various mechanisms that control miRNA biogenesis.

5.5 ACKNOWLEDGMENTS

We thank Caifu Chen at Applied Biosystems for his assistance with the TaqMan

microRNA assays and also thank Gerard Nuovo for performing In situ RT PCR. This

work was supported by grant R21 CA114304 to T.D.S.

110

Figure 5.1. microRNAs with good correlation in expression levels of precursor and

mature.

The expression of the precursor and mature miRNAs was determined using real-time

PCR assays specific to each class of RNA. Plots of the correlation between the precursor

and mature miR-100 in a panel of 22 normal tissues (A), 37 cancer cell lines (B), and the

pancreas and liver tumors and normal tissues (C) are shown along with the Pearson

correlation coefficient. Also shown is the correlation in the expression of precursor and

mature miRNAs in the panel of 22 normal tissues for miR-1 (D), miR-137 (E), and miR-

9 (F).

111

Figure 5.2. Expression of miR-128a in 22 normal tissues and cells.

The expression of miR-128a precursor (A) and mature miR-128a (B) was determined by

quantitative real-time PCR in 22 normal human tissues and cells.

112

Figure 5.3. Lack of microRNA processing in cancer cell lines.

The expression of precursor and mature miR-105 (A) and miR-128a (B) was assayed in

several human cancer cell lines by real-time PCR. mir-128a was also detected in mouse

brain tissue. Detection of the primary precursor (black columns) was apparent in all cell

lines; expression of mature miRNA (red column) was detectable only in the brain tissue.

With the exception of mouse brain tissue, Northern blots to miR-105(C) and miR-128a

(D) reveal the presence of the precursor only. Cell lines are the same as shown for the

quantitative PCR. In situ RT-PCR results for pre-miR-105 in HeLa cells (E, note intense

nuclear localization) and pre-miR-128a in HS766T cells (F).

113

Figure 5.4. miR-31 expression in cancer cell lines.

The expression of precursor and mature miR-31 was assayed in 15 cancer cell lines.

Detection of the primary precursor (black columns) was apparent in all cell lines by real-

time RT-PCR (A, B); however, the mature miR-31(red columns) was present at varying

levels or not at all. (C, D) Northern blot confirmation of precursor and mature miR-31 in

cell lines. Note the presence of the ~70-nt precursor in each of the cell lines. Each

column of the Northern blot corresponds to the identical cell lines listed in panels A and

B. In situ RT-PCR to miR-31 precursor in HS766T cells (E) and MCF-7 cells (G). In

situ hybridization using an LNA probe to mature miR-31 in HS766T cells (F) and MCF-7

cells (H). Magnification, X400.

114

Figure 5.5. Pearson correlation among the various samples studied.

The frequency of the Pearson’s correlation coefficient describing the relationship

between the precursor and mature miRNA expression is plotted for the cell lines (A), 22

normal tissues (B), normal pancreas and pancreas tumors (C), and normal liver and liver

tumors (D).

115

Table 5.1. microRNA that display tissue-specific or tissue enriched expression.

Tissue specific expression.a

miR-122a (liver); miR-124a (brain); miR-128a (brain, skeletal muscle); miR-216, miR-217

(pancreas); miR-219 (brain); miR-302a, miR-302c (heart); miR-367 (heart); miR-373 (placenta)

Tissue specific expression.b

miR-1 (heart, skeletal muscle); miR-7 (brain, pancreas, thyroid); miR-95 (skeletal muscle);

miR-133a (heart, skeletal muscle); miR-149, miR-153 (brain); miR-203 (esophagus); miR-204

(kidney); miR-206 (skeletal muscle); miR-215 (small intestine); miR-302d (heart); miR-323,

miR-330, miR-346 (brain); miR-371, miR-372 (placenta); miR-375 (pancreas)

Tissue enriched expression.c let-7i (thyroid); miR-148a (pancreas); miR-150 (spleen, thymus, B cell); miR-181a (thymus);

miR-181b, miR-181c (brain, thymus); miR-190 (kidney); miR-192, miR-194 (colon, small-

intestine); miR-196b (cervix); miR-205 (esophagus, prostate, thymus); miR-213 (brain,

thymus); miR-223 (lung, spleen); miR-328, miR-338, miR-340 (brain); miR-376a (placenta)

Not expressed in any of the 22 tissues studied. miR-220, miR-302a�, miR-302c�, miR-384

Expression of 202 mature miRNAs was profiled in 22 human tissues and cells using real-time PCR as described in Materials

and Methods. aMature miRNA expression is detectable at sufficient levels in the specific tissue but is undetectable in all or most of the

remaining tissues. bMature miRNA expression is >20-fold higher in the specific tissue(s) compared with the mean of the other tissues.

cMature miRNA expression is <20-fold higher in the enriched tissue(s) compared with the mean of the other tissues.

116

Table 5.2. Relative expression levels of mature miRNA and miRNA star forms.

miRNA (5’ and 3’)a

Expression ratio (5’ miRNA/3’ miRNA)b

miR-9, miR-9� 4.40

miR-17–5p, miR-17-3p 25.7

miR-126�, miR-126 -10.8

miR-142–5p, miR-142-3p -13.7

miR-154, miR-154� Not expressed

miR-199a, miR-199a� -162.4

miR-302a�, miR-302a miR-302a only expressed in heart

miR-302c�, miR-302c miR-302c only expressed in heart

miR-324–5p, miR-324-3p -3.0

miR-380–5p, miR-380-3p miR-380–3p not expressed

aMature miRNAs are listed in the order as they appear within the miRNA precursor

in the 5’ (5p) to 3’ (3p) orientation. bThe mean expression of the mature miRNA and miRNA� was determined in a

panel of 22 human tissues. The expression ratio is presented as the mature miRNA

that is located on the 5’ end of the miRNA precursor compared to that which is 3’

on the end.

117

CHAPTER 6

SUMMARY AND DISCUSSION

The goal of this dissertation was to identify the most important microRNA

(miRNA) that can be used for diagnosis and treatment of pancreatic cancer. We

hypothesized that miRNAs are deregulated in pancreatic cancer and the inhibition of

upregulated miRNAs by antisense oligonucleotide would be a prospective therapy in

pancreatic cancer.

The summary of this dissertation is as follows; Expression profiling of a small

number of miRNAs (~ 200 miRNAs) distinguished pancreatic tumors from

normal/benign pancreas. Large numbers of miRNAs were differentially expressed in

pancreatic adenocarcinoma and the majority was increased in pancreatic cancer. In situ

RT PCR demonstrated that overexpressed miRNAs are restricted to pancreas tumors, not

stroma cells (Chapter 2). Overexpressed miRNAs were inhibited by antisense

oligonucleotides at low nM concentration and normal pancreatic cell lines (HPNE)

showed less sensitivity to antisense oligonucleotides, suggesting selective target therapy

in pancreatic cancer. The combination of antisense oligonucleotide with a

chemotherapeutic agent, gemcitabine showed sensitization effect via schedule-dependent

manner and the combination with two antisense oliogonucleotides also showed a

118

synergistic effect (Chapter 3). In addition, miRNA inhibition by antisense

oligonucleotide caused cell cycle arrest and increased apoptotic cells. For further

mechanism study, the target molecules of miRNAs that are deregulated in pancreatic

cancer were validated. PTEN and RECK were confirmed as a target of miR-21 and

p27(kip1) was validated as a target of miR-221. FOXO3a was identified as a new target

gene of miR-212 using reporter assay and western blotting (Chapter 4). Lastly, the

processing of miRNA was studied in various normal tissues, patients’ tumor tissues and

cancer cell lines. A number of miRNAs showed tissue-specific expression and the

miRNA processing pattern was different in various samples (Chapter 5).

There are a number of evidences that miRNAs are differentially expressed in

many human cancers (reviewed in Chapter 1). Our study suggested that overexpressed

miRNAs in pancreatic cancer could be used as a therapeutic agent and diagnostic in

pancreatic cancer. Although many miRNAs that were differentially expressed in

pancreatic cancer were also implicated in other type of cancers (i.e. miR-15, 16, 21, 155

and 221), several other miRNAs such as miR-212 and 301 appear to be deregulated

specifically in pancreatic cancer. Also, the cell proliferation assay using antisense

oligonucleotide indicated that low nM range of IC50 is effective to show cell cytotoxicity,

specifically in pancreatic cancer cells, not normal pancreas cells. These data indicate that

selective therapy targeting the miRNAs is promising. To better understand the miRNA

function, miRNA targets need to be validated. Here, one target molecule of miR-212

(FOXO3a) was identified possibly affecting cell cycle arrest and apoptosis in cancer cells.

Since one miRNA targets numerous mRNAs, it is a big challenge to identify targets and

to understand the network between miRNA and mRNA. Even, miRNA processing was

119

impaired in certain samples or conditions, implying more complicated function of

miRNAs. This study is the first to show miRNA inhibition by antisense oligonucleotide

in pancreatic cancer and to identify a target gene of miR-212 in pancreatic cancer.

The possibility of miRNAs as a therapeutic agent was some what confirmed in

our studies. The inhibition of miRNAs by ASO showed that reduced cell proliferation,

cell cycle arrest and increased apoptotic cells in vitro. Even though we haven’t

confirmed yet whether ASO inhibits those miRNAs efficiently in vivo, Krützfeldt et al.

demonstrated that cholesterol conjugated antisense inhibited liver specific miR-122 in

mouse for 23 days (127). Currently, modified antisense has been developed for stable

transfection in vivo and if antisense is conjugated with molecules that are present only in

the pancreas it might be a new form of selective targeting to pancreatic tissue.

Even though miRNAs are important targets for therapeutic purposes, miRNAs

can also be used for diagnostic purposes. The survival rate in pancreatic cancer is very

low because most pancreatic cancers are diagnosed at very late, untreatable stage. From

our study, miRNAs that are overexpressed in pancreatic cancer could be a promising

diagnosis marker in pancreatic cancer.

One of the problems of diagnosing in pancreatic cancer is distinguishing chronic

pancreatitis from pancreatic cancer. It is reported that 5% ~ 10% of resected pancreatic

tissues are eventually diagnosed as pancreatitis, not as pancreatic cancer (216).

Pancreatic cancer and chronic pancreatitis show similar symptoms and clinical data (217).

Chronic pancreatitis contains abundant stroma, similar to pancreatic cancer (146), but the

treatment of chronic pancreatitis is very different from pancreatic cancer. In our study,

we profiled ~ 200 precursor miRNAs on 4 chronic pancreatitis samples to see if miRNA

120

expression is different from cancer. Clustering data (Figure 2.2) showed chronic

pancreatitis is separated from the cancer group and terrain map (Figure 2.3) showed

chronic pancreatitis lie in between the normal pancreas and tumor. This result suggests

that miRNA may be a good marker to distinguish the pancreatic cancer and chronic

pancreatitis. Mature miRNA profiling data with sufficient samples are needed and

microdissected tumor and stroma samples may provide a better miRNA marker for

chronic pancreatitis and pancreatic cancer.

In addition, pancreatic juice has been used to investigate the genetic markers of

pancreatic cancer (218). Pancreatic juice can be collected in the duodenum during

routine upper gastrointestinal endoscopy after secretin stimulation (219). No one has

systemically profiled miRNAs in pancreatic juice samples and this method will be an

easier diagnostic for patients compared to tissue biopsy to screen the cancer marker.

The pancreatic tissue and juice samples are directly obtained from pancreas, but

tissue biopsy or GI endoscopy is not a convenient or economic procedure for the patient.

Serum is the ideal clinical specimen because it is easily obtained from patients and once a

diagnostic assay is developed, patients can have more frequent examination for early

diagnosis. However, serum samples are not from direct tissue, so pancreatic tissue or

juice might show more accurate diagnostic marker, which means a more sensitive serum

marker is needed. As mentioned in Chapter 3, serum marker CA19-9 (sialylated Lewis

blood group antigen) has been used, but the usage is limited because it shows a high

false-positive rate and some patients do not express Lewis antigens (154-156). Recently,

serum macrophage inhibitory cytokine 1 (MIC-1) seems to be a better marker of

pancreatic cancer than CA19-9 (157). However, MIC-1 is not better than CA19-9 in

121

discriminating chronic pancreatitis patients from pancreatic cancer patients (157). Our

study showed that miR-216, 217 and 375 were specifically expressed in pancreas

(Chapter 5) and miR-212 and 301 were overexpressed in pancreatic cancer (Chapter 2).

If these miRNAs are differentially expressed in patients’ serum samples, this might be the

most sensitive and accurate diagnostic marker for pancreatic cancer.

Lastly, pancreatic cancer precursor lesions can be useful for early detection of

cancer. Pancreatic ductal adenocarcinomas arise from noninvasive epithelial precursor

lesions and one of the epithelial precursors in the pancreas is pancreatic intraepithelial

neoplasm (PanINs), which can be used for a pancreatic cancer progression model (215).

This model contains a series of precursor lesions from low-grade PanIN-1A to high-grade

PanIN-3. PanINs are common in invasive ductal adenocarcinoma and many of the

genetic changes in cancer-related genes are shown in these lesions (Figure 6.1). PanIN-

1A is flat epithelial proliferation that doesn’t contain architectural or cytologic atypia and

PanIN-1B is similar with PanIN-1A, but shows intraluminal papillae. The mutations of

K-ras and HER-2/neu genes usually occurr in the early stage of PanINs. The tumor-

suppressor gene p16 is inactivated in PanIN-2, which shows moderate nuclear and

architectural atypia. In PanIN-3 stage, p53, DPC4, and BRCA2 genes are decreased and

there are significant architectural and cytological atypia that nuclei are enlarged and

overlapping. In our study, the expression of tumor suppressor gene PTEN, RECK, p27

and FOXO3a were repressed by miR-21, 221 and 212. We haven’t examined which

stage these miRNAs occur. It is possible that these oncogenic miRNAs might function in

late stage of PanINs because tumor suppressor genes such as p16 and p53 are altered in

these stages (Figure 6.1). In addition, overexpressed miRNAs in our study might be

122

targeting other tumor suppressor genes such as p53, DPC4, and BRCA2. To answer

these questions, a murine PanIN model, which are much alike in histology with human

PanIN, could be used to identify specific miRNAs in pancreatic cancer progression.

In conclusion, the study of miRNA expression and function in pancreatic cancer

suggests that miRNAs play an important role in tumor biogenesis and have a potential for

therapeutic and diagnostic agents.

123

Figure 6.1. Pancreatic cancer progression model and genetic alteration.

Oncogenic miRNA-21, 221, and 212 repress tumor suppressor genes that cause cell cycle

arrest and apoptosis and they might be specific miRs in cancer progression and could be

better marker. ? : not confirmed yet.

124

BIBLIOGRAPHY

1. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. Identification of

novel genes coding for small expressed RNAs. Science, 294: 853-858, 2001.

2. Lau, N. C., Lim, L. P., Weinstein, E. G., and Bartel, D. P. An abundant class of

tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science, 294:

858-862, 2001.

3. Lee, R. C. and Ambros, V. An extensive class of small RNAs in Caenorhabditis

elegans. Science, 294: 862-864, 2001.

4. Lee, R. C., Feinbaum, R. L., and Ambros, V. The C. elegans heterochronic gene

lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75:

843-854, 1993.

5. Wightman, B., Ha, I., and Ruvkun, G. Posttranscriptional regulation of the

heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C.

elegans. Cell, 75: 855-862, 1993.

6. Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C.,

Rougvie, A. E., Horvitz, H. R., and Ruvkun, G. The 21-nucleotide let-7 RNA

regulates developmental timing in Caenorhabditis elegans. Nature, 403: 901-906,

2000.

7. Pasquinelli, A. E., Reinhart, B. J., Slack, F., Martindale, M. Q., Kuroda, M. I.,

Maller, B., Hayward, D. C., Ball, E. E., Degnan, B., Muller, P., Spring, J.,

Srinivasan, A., Fishman, M., Finnerty, J., Corbo, J., Levine, M., Leahy, P.,

Davidson, E., and Ruvkun, G. Conservation of the sequence and temporal

expression of let-7 heterochronic regulatory RNA. Nature, 408: 86-89, 2000.

8. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C.

Potent and specific genetic interference by double-stranded RNA in

Caenorhabditis elegans. Nature, 391: 806-811, 1998.

9. Elbashir, S. M., Lendeckel, W., and Tuschl, T. RNA interference is mediated by

21- and 22-nucleotide RNAs. Genes Dev, 15: 188-200, 2001.

125

10. Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. RNAi: double-stranded

RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide

intervals. Cell, 101: 25-33, 2000.

11. Bartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell,

116: 281-297, 2004.

12. Griffiths-Jones, S. The microRNA Registry. Nucleic Acids Res, 32: D109-111,

2004.

13. Rodriguez, A., Griffiths-Jones, S., Ashurst, J. L., and Bradley, A. Identification of

mammalian microRNA host genes and transcription units. Genome Res, 14:

1902-1910, 2004.

14. Borchert, G. M., Lanier, W., and Davidson, B. L. RNA polymerase III transcribes

human microRNAs. Nat Struct Mol Biol, 13: 1097-1101, 2006.

15. Kim, V. N. and Nam, J. W. Genomics of microRNA. Trends Genet, 22: 165-173,

2006.

16. Lee, Y., Jeon, K., Lee, J. T., Kim, S., and Kim, V. N. MicroRNA maturation:

stepwise processing and subcellular localization. Embo J, 21: 4663-4670, 2002.

17. Cai, X., Hagedorn, C. H., and Cullen, B. R. Human microRNAs are processed

from capped, polyadenylated transcripts that can also function as mRNAs. Rna,

10: 1957-1966, 2004.

18. Lee, Y., Kim, M., Han, J., Yeom, K. H., Lee, S., Baek, S. H., and Kim, V. N.

MicroRNA genes are transcribed by RNA polymerase II. Embo J, 23: 4051-4060,

2004.

19. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark,

O., Kim, S., and Kim, V. N. The nuclear RNase III Drosha initiates microRNA

processing. Nature, 425: 415-419, 2003.

20. Han, J., Lee, Y., Yeom, K. H., Kim, Y. K., Jin, H., and Kim, V. N. The Drosha-

DGCR8 complex in primary microRNA processing. Genes Dev, 18: 3016-3027,

2004.

21. Landthaler, M., Yalcin, A., and Tuschl, T. The human DiGeorge syndrome

critical region gene 8 and Its D. melanogaster homolog are required for miRNA

biogenesis. Curr Biol, 14: 2162-2167, 2004.

126

22. Gregory, R. I., Yan, K. P., Amuthan, G., Chendrimada, T., Doratotaj, B., Cooch,

N., and Shiekhattar, R. The Microprocessor complex mediates the genesis of

microRNAs. Nature, 432: 235-240, 2004.

23. Denli, A. M., Tops, B. B., Plasterk, R. H., Ketting, R. F., and Hannon, G. J.

Processing of primary microRNAs by the Microprocessor complex. Nature, 432:

231-235, 2004.

24. Yi, R., Qin, Y., Macara, I. G., and Cullen, B. R. Exportin-5 mediates the nuclear

export of pre-microRNAs and short hairpin RNAs. Genes Dev, 17: 3011-3016,

2003.

25. Gwizdek, C., Ossareh-Nazari, B., Brownawell, A. M., Doglio, A., Bertrand, E.,

Macara, I. G., and Dargemont, C. Exportin-5 mediates nuclear export of

minihelix-containing RNAs. J Biol Chem, 278: 5505-5508, 2003.

26. Gwizdek, C., Ossareh-Nazari, B., Brownawell, A. M., Evers, S., Macara, I. G.,

and Dargemont, C. Minihelix-containing RNAs mediate exportin-5-dependent

nuclear export of the double-stranded RNA-binding protein ILF3. J Biol Chem,

279: 884-891, 2004.

27. Bernstein, E., Caudy, A. A., Hammond, S. M., and Hannon, G. J. Role for a

bidentate ribonuclease in the initiation step of RNA interference. Nature, 409:

363-366, 2001.

28. Forstemann, K., Tomari, Y., Du, T., Vagin, V. V., Denli, A. M., Bratu, D. P.,

Klattenhoff, C., Theurkauf, W. E., and Zamore, P. D. Normal microRNA

maturation and germ-line stem cell maintenance requires Loquacious, a double-

stranded RNA-binding domain protein. PLoS Biol, 3: e236, 2005.

29. Chendrimada, T. P., Gregory, R. I., Kumaraswamy, E., Norman, J., Cooch, N.,

Nishikura, K., and Shiekhattar, R. TRBP recruits the Dicer complex to Ago2 for

microRNA processing and gene silencing. Nature, 436: 740-744, 2005.

30. Gregory, R. I., Chendrimada, T. P., Cooch, N., and Shiekhattar, R. Human RISC

couples microRNA biogenesis and posttranscriptional gene silencing. Cell, 123:

631-640, 2005.

31. Schwarz, D. S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P. D.

Asymmetry in the assembly of the RNAi enzyme complex. Cell, 115: 199-208,

2003.

127

32. Hutvagner, G. and Zamore, P. D. A microRNA in a multiple-turnover RNAi

enzyme complex. Science, 297: 2056-2060, 2002.

33. Behm-Ansmant, I., Rehwinkel, J., Doerks, T., Stark, A., Bork, P., and Izaurralde,

E. mRNA degradation by miRNAs and GW182 requires both CCR4:NOT

deadenylase and DCP1:DCP2 decapping complexes. Genes Dev, 20: 1885-1898,

2006.

34. Humphreys, D. T., Westman, B. J., Martin, D. I., and Preiss, T. MicroRNAs

control translation initiation by inhibiting eukaryotic initiation factor 4E/cap and

poly(A) tail function. Proc Natl Acad Sci U S A, 102: 16961-16966, 2005.

35. Petersen, C. P., Bordeleau, M. E., Pelletier, J., and Sharp, P. A. Short RNAs

repress translation after initiation in mammalian cells. Mol Cell, 21: 533-542,

2006.

36. Vasudevan, S., Tong, Y., and Steitz, J. A. Switching from repression to activation:

microRNAs can up-regulate translation. Science, 318: 1931-1934, 2007.

37. Kloosterman, W. P., Wienholds, E., Ketting, R. F., and Plasterk, R. H. Substrate

requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids

Res, 32: 6284-6291, 2004.

38. Lytle, J. R., Yario, T. A., and Steitz, J. A. Target mRNAs are repressed as

efficiently by microRNA-binding sites in the 5' UTR as in the 3' UTR. Proc Natl

Acad Sci U S A, 104: 9667-9672, 2007.

39. Orom, U. A., Nielsen, F. C., and Lund, A. H. MicroRNA-10a binds the 5'UTR of

ribosomal protein mRNAs and enhances their translation. Mol Cell, 30: 460-471,

2008.

40. Guil, S. and Caceres, J. F. The multifunctional RNA-binding protein hnRNP A1

is required for processing of miR-18a. Nat Struct Mol Biol, 14: 591-596, 2007.

41. Johnson, S. M., Lin, S. Y., and Slack, F. J. The time of appearance of the C.

elegans let-7 microRNA is transcriptionally controlled utilizing a temporal

regulatory element in its promoter. Dev Biol, 259: 364-379, 2003.

42. Kawahara, Y., Zinshteyn, B., Chendrimada, T. P., Shiekhattar, R., and Nishikura,

K. RNA editing of the microRNA-151 precursor blocks cleavage by the Dicer-

TRBP complex. EMBO Rep, 8: 763-769, 2007.

128

43. Obernosterer, G., Leuschner, P. J., Alenius, M., and Martinez, J. Post-

transcriptional regulation of microRNA expression. Rna, 12: 1161-1167, 2006.

44. Viswanathan, S. R., Daley, G. Q., and Gregory, R. I. Selective blockade of

microRNA processing by Lin28. Science, 320: 97-100, 2008.

45. Lewis, B. P., Burge, C. B., and Bartel, D. P. Conserved seed pairing, often

flanked by adenosines, indicates that thousands of human genes are microRNA

targets. Cell, 120: 15-20, 2005.

46. Brennecke, J., Stark, A., Russell, R. B., and Cohen, S. M. Principles of

microRNA-target recognition. PLoS Biol, 3: e85, 2005.

47. Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P., and Burge, C. B.

Prediction of mammalian microRNA targets. Cell, 115: 787-798, 2003.

48. Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U., and Segal, E. The role of site

accessibility in microRNA target recognition. Nat Genet, 39: 1278-1284, 2007.

49. Bhattacharyya, S. N., Habermacher, R., Martine, U., Closs, E. I., and Filipowicz,

W. Relief of microRNA-mediated translational repression in human cells

subjected to stress. Cell, 125: 1111-1124, 2006.

50. Didiano, D. and Hobert, O. Perfect seed pairing is not a generally reliable

predictor for miRNA-target interactions. Nat Struct Mol Biol, 13: 849-851, 2006.

51. Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P., and

Bartel, D. P. MicroRNA targeting specificity in mammals: determinants beyond

seed pairing. Mol Cell, 27: 91-105, 2007.

52. Grun, D., Wang, Y. L., Langenberger, D., Gunsalus, K. C., and Rajewsky, N.

microRNA target predictions across seven Drosophila species and comparison to

mammalian targets. PLoS Comput Biol, 1: e13, 2005.

53. Krek, A., Grun, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J.,

MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M., and Rajewsky, N.

Combinatorial microRNA target predictions. Nat Genet, 37: 495-500, 2005.

54. Lall, S., Grun, D., Krek, A., Chen, K., Wang, Y. L., Dewey, C. N., Sood, P.,

Colombo, T., Bray, N., Macmenamin, P., Kao, H. L., Gunsalus, K. C., Pachter, L.,

Piano, F., and Rajewsky, N. A genome-wide map of conserved microRNA targets

in C. elegans. Curr Biol, 16: 460-471, 2006.

129

55. John, B., Enright, A. J., Aravin, A., Tuschl, T., Sander, C., and Marks, D. S.

Human MicroRNA targets. PLoS Biol, 2: e363, 2004.

56. Calin, G. A., Liu, C. G., Sevignani, C., Ferracin, M., Felli, N., Dumitru, C. D.,

Shimizu, M., Cimmino, A., Zupo, S., Dono, M., Dell'Aquila, M. L., Alder, H.,

Rassenti, L., Kipps, T. J., Bullrich, F., Negrini, M., and Croce, C. M. MicroRNA

profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc

Natl Acad Sci U S A, 101: 11755-11760, 2004.

57. Wang, Y., Barbacioru, C., Hyland, F., Xiao, W., Hunkapiller, K. L., Blake, J.,

Chan, F., Gonzalez, C., Zhang, L., and Samaha, R. R. Large scale real-time PCR

validation on gene expression measurements from two commercial long-

oligonucleotide microarrays. BMC Genomics, 7: 59, 2006.

58. Yin, J. Q., Zhao, R. C., and Morris, K. V. Profiling microRNA expression with

microarrays. Trends Biotechnol, 26: 70-76, 2008.

59. Schmittgen, T. D., Jiang, J., Liu, Q., and Yang, L. A high-throughput method to

monitor the expression of microRNA precursors. Nucleic Acids Res, 32: e43,

2004.

60. Chen, C., Ridzon, D. A., Broomer, A. J., Zhou, Z., Lee, D. H., Nguyen, J. T.,

Barbisin, M., Xu, N. L., Mahuvakar, V. R., Andersen, M. R., Lao, K. Q., Livak, K.

J., and Guegler, K. J. Real-time quantification of microRNAs by stem-loop RT-

PCR. Nucleic Acids Res, 33: e179, 2005.

61. Jiang, J., Lee, E. J., Gusev, Y., and Schmittgen, T. D. Real-time expression

profiling of microRNA precursors in human cancer cell lines. Nucleic Acids Res,

33: 5394-5403, 2005.

62. Tang, F., Hajkova, P., Barton, S. C., O'Carroll, D., Lee, C., Lao, K., and Surani,

M. A. 220-plex microRNA expression profile of a single cell. Nat Protoc, 1:

1154-1159, 2006.

63. Tang, F., Hajkova, P., Barton, S. C., Lao, K., and Surani, M. A. MicroRNA

expression profiling of single whole embryonic stem cells. Nucleic Acids Res, 34:

e9, 2006.

64. Lee, E. J., Gusev, Y., Jiang, J., Nuovo, G. J., Lerner, M. R., Frankel, W. L.,

Morgan, D. L., Postier, R. G., Brackett, D. J., and Schmittgen, T. D. Expression

130

profiling identifies microRNA signature in pancreatic cancer. Int J Cancer, 120:

1046-1054, 2007.

65. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet-

Cordero, A., Ebert, B. L., Mak, R. H., Ferrando, A. A., Downing, J. R., Jacks, T.,

Horvitz, H. R., and Golub, T. R. MicroRNA expression profiles classify human

cancers. Nature, 435: 834-838, 2005.

66. Esau, C., Kang, X., Peralta, E., Hanson, E., Marcusson, E. G., Ravichandran, L.

V., Sun, Y., Koo, S., Perera, R. J., Jain, R., Dean, N. M., Freier, S. M., Bennett, C.

F., Lollo, B., and Griffey, R. MicroRNA-143 regulates adipocyte differentiation. J

Biol Chem, 279: 52361-52365, 2004.

67. Poy, M. N., Eliasson, L., Krutzfeldt, J., Kuwajima, S., Ma, X., Macdonald, P. E.,

Pfeffer, S., Tuschl, T., Rajewsky, N., Rorsman, P., and Stoffel, M. A pancreatic

islet-specific microRNA regulates insulin secretion. Nature, 432: 226-230, 2004.

68. Suh, M. R., Lee, Y., Kim, J. Y., Kim, S. K., Moon, S. H., Lee, J. Y., Cha, K. Y.,

Chung, H. M., Yoon, H. S., Moon, S. Y., Kim, V. N., and Kim, K. S. Human

embryonic stem cells express a unique set of microRNAs. Dev Biol, 270: 488-498,

2004.

69. Nakahara, K., Kim, K., Sciulli, C., Dowd, S. R., Minden, J. S., and Carthew, R. W.

Targets of microRNA regulation in the Drosophila oocyte proteome. Proc Natl

Acad Sci U S A, 102: 12023-12028, 2005.

70. Zhao, Y., Samal, E., and Srivastava, D. Serum response factor regulates a muscle-

specific microRNA that targets Hand2 during cardiogenesis. Nature, 436: 214-

220, 2005.

71. Martin, M. M., Lee, E. J., Buckenberger, J. A., Schmittgen, T. D., and Elton, T. S.

MicroRNA-155 regulates human angiotensin II type 1 receptor expression in

fibroblasts. J Biol Chem, 281: 18277-18284, 2006.

72. Ishizuka, A., Siomi, M. C., and Siomi, H. A Drosophila fragile X protein interacts

with components of RNAi and ribosomal proteins. Genes Dev, 16: 2497-2508,

2002.

73. Wang, W. X., Rajeev, B. W., Stromberg, A. J., Ren, N., Tang, G., Huang, Q.,

Rigoutsos, I., and Nelson, P. T. The expression of microRNA miR-107 decreases

early in Alzheimer's disease and may accelerate disease progression through

131

regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci,

28: 1213-1223, 2008.

74. Kim, J., Inoue, K., Ishii, J., Vanti, W. B., Voronov, S. V., Murchison, E., Hannon,

G., and Abeliovich, A. A MicroRNA feedback circuit in midbrain dopamine

neurons. Science, 317: 1220-1224, 2007.

75. Calin, G. A., Dumitru, C. D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler,

H., Rattan, S., Keating, M., Rai, K., Rassenti, L., Kipps, T., Negrini, M., Bullrich,

F., and Croce, C. M. Frequent deletions and down-regulation of micro- RNA

genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl

Acad Sci U S A, 99: 15524-15529, 2002.

76. Michael, M. Z., SM, O. C., van Holst Pellekaan, N. G., Young, G. P., and James,

R. J. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol

Cancer Res, 1: 882-891, 2003.

77. Akao, Y., Nakagawa, Y., and Naoe, T. MicroRNAs 143 and 145 are possible

common onco-microRNAs in human cancers. Oncol Rep, 16: 845-850, 2006.

78. Akao, Y., Nakagawa, Y., Kitade, Y., Kinoshita, T., and Naoe, T. Downregulation

of microRNAs-143 and -145 in B-cell malignancies. Cancer Sci, 98: 1914-1920,

2007.

79. Takamizawa, J., Konishi, H., Yanagisawa, K., Tomida, S., Osada, H., Endoh, H.,

Harano, T., Yatabe, Y., Nagino, M., Nimura, Y., Mitsudomi, T., and Takahashi, T.

Reduced expression of the let-7 microRNAs in human lung cancers in association

with shortened postoperative survival. Cancer Res, 64: 3753-3756, 2004.

80. Jiang, J., Gusev, Y., Aderca, I., Mettler, T. A., Nagorney, D. M., Brackett, D. J.,

Roberts, L. R., and Schmittgen, T. D. Association of MicroRNA Expression in

Hepatocellular Carcinomas with Hepatitis Infection, Cirrhosis, and Patient

Survival. Clin Cancer Res, 14: 419-427, 2008.

81. Gramantieri, L., Ferracin, M., Fornari, F., Veronese, A., Sabbioni, S., Liu, C. G.,

Calin, G. A., Giovannini, C., Ferrazzi, E., Grazi, G. L., Croce, C. M., Bolondi, L.,

and Negrini, M. Cyclin G1 is a target of miR-122a, a microRNA frequently

down-regulated in human hepatocellular carcinoma. Cancer Res, 67: 6092-6099,

2007.

132

82. Murakami, Y., Yasuda, T., Saigo, K., Urashima, T., Toyoda, H., Okanoue, T., and

Shimotohno, K. Comprehensive analysis of microRNA expression patterns in

hepatocellular carcinoma and non-tumorous tissues. Oncogene, 25: 2537-2545,

2006.

83. Kutay, H., Bai, S., Datta, J., Motiwala, T., Pogribny, I., Frankel, W., Jacob, S. T.,

and Ghoshal, K. Downregulation of miR-122 in the rodent and human

hepatocellular carcinomas. J Cell Biochem, 99: 671-678, 2006.

84. Schetter, A. J., Leung, S. Y., Sohn, J. J., Zanetti, K. A., Bowman, E. D.,

Yanaihara, N., Yuen, S. T., Chan, T. L., Kwong, D. L., Au, G. K., Liu, C. G.,

Calin, G. A., Croce, C. M., and Harris, C. C. MicroRNA expression profiles

associated with prognosis and therapeutic outcome in colon adenocarcinoma.

Jama, 299: 425-436, 2008.

85. Si, M. L., Zhu, S., Wu, H., Lu, Z., Wu, F., and Mo, Y. Y. miR-21-mediated tumor

growth. Oncogene, 26: 2799-2803, 2007.

86. Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., and Patel, T.

MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human

hepatocellular cancer. Gastroenterology, 133: 647-658, 2007.

87. Chan, J. A., Krichevsky, A. M., and Kosik, K. S. MicroRNA-21 is an

antiapoptotic factor in human glioblastoma cells. Cancer Res, 65: 6029-6033,

2005.

88. Lee, E. J., Gusev, Y., Jiang, J., Nuovo, G. J., Lerner, M. R., Frankel, W. L.,

Morgan, D. L., Postier, R. G., Brackett, D. J., and Schmittgen, T. D. Expression

profiling identifies microRNA signature in pancreatic cancer. Int. J. Cancer, 120:

1046-1054, 2007.

89. Bloomston, M., Frankel, W. L., Petrocca, F., Volinia, S., Alder, H., Hagan, J. P.,

Liu, C. G., Bhatt, D., Taccioli, C., and Croce, C. M. MicroRNA expression

patterns to differentiate pancreatic adenocarcinoma from normal pancreas and

chronic pancreatitis. Jama, 297: 1901-1908, 2007.

90. He, H., Jazdzewski, K., Li, W., Liyanarachchi, S., Nagy, R., Volinia, S., Calin, G.

A., Liu, C. G., Franssila, K., Suster, S., Kloos, R. T., Croce, C. M., and de la

Chapelle, A. The role of microRNA genes in papillary thyroid carcinoma. Proc

Natl Acad Sci U S A, 102: 19075-19080, 2005.

133

91. Eis, P. S., Tam, W., Sun, L., Chadburn, A., Li, Z., Gomez, M. F., Lund, E., and

Dahlberg, J. E. Accumulation of miR-155 and BIC RNA in human B cell

lymphomas. Proc Natl Acad Sci U S A, 102: 3627-3632, 2005.

92. Kumar, M. S., Lu, J., Mercer, K. L., Golub, T. R., and Jacks, T. Impaired

microRNA processing enhances cellular transformation and tumorigenesis. Nat

Genet, 39: 673-677, 2007.

93. Cimmino, A., Calin, G. A., Fabbri, M., Iorio, M. V., Ferracin, M., Shimizu, M.,

Wojcik, S. E., Aqeilan, R. I., Zupo, S., Dono, M., Rassenti, L., Alder, H., Volinia,

S., Liu, C. G., Kipps, T. J., Negrini, M., and Croce, C. M. miR-15 and miR-16

induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A, 102: 13944-

13949, 2005.

94. He, L., Thomson, J. M., Hemann, M. T., Hernando-Monge, E., Mu, D., Goodson,

S., Powers, S., Cordon-Cardo, C., Lowe, S. W., Hannon, G. J., and Hammond, S.

M. A microRNA polycistron as a potential human oncogene. Nature, 435: 828-

833, 2005.

95. O'Donnell, K. A., Wentzel, E. A., Zeller, K. I., Dang, C. V., and Mendell, J. T. c-

Myc-regulated microRNAs modulate E2F1 expression. Nature, 435: 839-843,

2005.

96. Costinean, S., Zanesi, N., Pekarsky, Y., Tili, E., Volinia, S., Heerema, N., and

Croce, C. M. Pre-B cell proliferation and lymphoblastic leukemia/high-grade

lymphoma in E(mu)-miR155 transgenic mice. Proc Natl Acad Sci U S A, 103:

7024-7029, 2006.

97. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A.,

Labourier, E., Reinert, K. L., Brown, D., and Slack, F. J. RAS is regulated by the

let-7 microRNA family. Cell, 120: 635-647, 2005.

98. Yanaihara, N., Caplen, N., Bowman, E., Seike, M., Kumamoto, K., Yi, M.,

Stephens, R. M., Okamoto, A., Yokota, J., Tanaka, T., Calin, G. A., Liu, C. G.,

Croce, C. M., and Harris, C. C. Unique microRNA molecular profiles in lung

cancer diagnosis and prognosis. Cancer Cell, 9: 189-198, 2006.

99. Iorio, M. V., Ferracin, M., Liu, C. G., Veronese, A., Spizzo, R., Sabbioni, S.,

Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., Menard, S., Palazzo, J. P.,

Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G. A., Querzoli, P.,

134

Negrini, M., and Croce, C. M. MicroRNA gene expression deregulation in human

breast cancer. Cancer Res, 65: 7065-7070, 2005.

100. Ciafre, S. A., Galardi, S., Mangiola, A., Ferracin, M., Liu, C. G., Sabatino, G.,

Negrini, M., Maira, G., Croce, C. M., and Farace, M. G. Extensive modulation of

a set of microRNAs in primary glioblastoma. Biochem Biophys Res Commun,

334: 1351-1358, 2005.

101. Lawrie, C. H., Soneji, S., Marafioti, T., Cooper, C. D., Palazzo, S., Paterson, J. C.,

Cattan, H., Enver, T., Mager, R., Boultwood, J., Wainscoat, J. S., and Hatton, C. S.

MicroRNA expression distinguishes between germinal center B cell-like and

activated B cell-like subtypes of diffuse large B cell lymphoma. Int J Cancer, 121:

1156-1161, 2007.

102. Fulci, V., Chiaretti, S., Goldoni, M., Azzalin, G., Carucci, N., Tavolaro, S.,

Castellano, L., Magrelli, A., Citarella, F., Messina, M., Maggio, R., Peragine, N.,

Santangelo, S., Mauro, F. R., Landgraf, P., Tuschl, T., Weir, D. B., Chien, M.,

Russo, J. J., Ju, J., Sheridan, R., Sander, C., Zavolan, M., Guarini, A., Foa, R., and

Macino, G. Quantitative technologies establish a novel microRNA profile of

chronic lymphocytic leukemia. Blood, 109: 4944-4951, 2007.

103. Iorio, M. V., Visone, R., Di Leva, G., Donati, V., Petrocca, F., Casalini, P.,

Taccioli, C., Volinia, S., Liu, C. G., Alder, H., Calin, G. A., Menard, S., and

Croce, C. M. MicroRNA signatures in human ovarian cancer. Cancer Res, 67:

8699-8707, 2007.

104. Feber, A., Xi, L., Luketich, J. D., Pennathur, A., Landreneau, R. J., Wu, M.,

Swanson, S. J., Godfrey, T. E., and Litle, V. R. MicroRNA expression profiles of

esophageal cancer. J Thorac Cardiovasc Surg, 135: 255-260; discussion 260,

2008.

105. Wang, T., Zhang, X., Obijuru, L., Laser, J., Aris, V., Lee, P., Mittal, K.,

Soteropoulos, P., and Wei, J. J. A micro-RNA signature associated with race,

tumor size, and target gene activity in human uterine leiomyomas. Genes

Chromosomes Cancer, 46: 336-347, 2007.

106. Tran, N., McLean, T., Zhang, X., Zhao, C. J., Thomson, J. M., O'Brien, C., and

Rose, B. MicroRNA expression profiles in head and neck cancer cell lines.

Biochem Biophys Res Commun, 358: 12-17, 2007.

135

107. Slaby, O., Svoboda, M., Fabian, P., Smerdova, T., Knoflickova, D., Bednarikova,

M., Nenutil, R., and Vyzula, R. Altered expression of miR-21, miR-31, miR-143

and miR-145 is related to clinicopathologic features of colorectal cancer.

Oncology, 72: 397-402, 2007.

108. Chan, S. H., Wu, C. W., Li, A. F., Chi, C. W., and Lin, W. C. miR-21 microRNA

expression in human gastric carcinomas and its clinical association. Anticancer

Res, 28: 907-911, 2008.

109. Zhu, S., Si, M. L., Wu, H., and Mo, Y. Y. MicroRNA-21 targets the tumor

suppressor gene tropomyosin 1 (TPM1). J Biol Chem, 282: 14328-14336, 2007.

110. Meng, F., Henson, R., Lang, M., Wehbe, H., Maheshwari, S., Mendell, J. T.,

Jiang, J., Schmittgen, T. D., and Patel, T. Involvement of human micro-RNA in

growth and response to chemotherapy in human cholangiocarcinoma cell lines.

Gastroenterology, 130: 2113-2129, 2006.

111. Lu, Z., Liu, M., Stribinskis, V., Klinge, C. M., Ramos, K. S., Colburn, N. H., and

Li, Y. MicroRNA-21 promotes cell transformation by targeting the programmed

cell death 4 gene. Oncogene, 2008.

112. Loffler, D., Brocke-Heidrich, K., Pfeifer, G., Stocsits, C., Hackermuller, J.,

Kretzschmar, A. K., Burger, R., Gramatzki, M., Blumert, C., Bauer, K., Cvijic, H.,

Ullmann, A. K., Stadler, P. F., and Horn, F. Interleukin-6 dependent survival of

multiple myeloma cells involves the Stat3-mediated induction of microRNA-21

through a highly conserved enhancer. Blood, 110: 1330-1333, 2007.

113. Calin, G. A., Sevignani, C., Dumitru, C. D., Hyslop, T., Noch, E., Yendamuri, S.,

Shimizu, M., Rattan, S., Bullrich, F., Negrini, M., and Croce, C. M. Human

microRNA genes are frequently located at fragile sites and genomic regions

involved in cancers. Proc Natl Acad Sci U S A, 101: 2999-3004, 2004.

114. Zhang, L., Huang, J., Yang, N., Greshock, J., Megraw, M. S., Giannakakis, A.,

Liang, S., Naylor, T. L., Barchetti, A., Ward, M. R., Yao, G., Medina, A.,

O'Brien-Jenkins, A., Katsaros, D., Hatzigeorgiou, A., Gimotty, P. A., Weber, B.

L., and Coukos, G. microRNAs exhibit high frequency genomic alterations in

human cancer. Proc Natl Acad Sci U S A, 103: 9136-9141, 2006.

115. Fraga, M. F. and Esteller, M. Towards the human cancer epigenome: a first draft

of histone modifications. Cell Cycle, 4: 1377-1381, 2005.

136

116. Lujambio, A., Ropero, S., Ballestar, E., Fraga, M. F., Cerrato, C., Setien, F.,

Casado, S., Suarez-Gauthier, A., Sanchez-Cespedes, M., Git, A., Spiteri, I., Das, P.

P., Caldas, C., Miska, E., and Esteller, M. Genetic unmasking of an epigenetically

silenced microRNA in human cancer cells. Cancer Res, 67: 1424-1429, 2007.

117. Saito, Y., Liang, G., Egger, G., Friedman, J. M., Chuang, J. C., Coetzee, G. A.,

and Jones, P. A. Specific activation of microRNA-127 with downregulation of the

proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells.

Cancer Cell, 9: 435-443, 2006.

118. Choi, W. Y., Giraldez, A. J., and Schier, A. F. Target protectors reveal dampening

and balancing of Nodal agonist and antagonist by miR-430. Science, 318: 271-

274, 2007.

119. Crooke, S. T. Progress in antisense technology. Annu Rev Med, 55: 61-95, 2004.

120. Dias, N., Dheur, S., Nielsen, P. E., Gryaznov, S., Van Aerschot, A., Herdewijn, P.,

Helene, C., and Saison-Behmoaras, T. E. Antisense PNA tridecamers targeted to

the coding region of Ha-ras mRNA arrest polypeptide chain elongation. J Mol

Biol, 294: 403-416, 1999.

121. Baker, B. F., Lot, S. S., Condon, T. P., Cheng-Flournoy, S., Lesnik, E. A., Sasmor,

H. M., and Bennett, C. F. 2'-O-(2-Methoxy)ethyl-modified anti-intercellular

adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1

mRNA level and inhibit formation of the ICAM-1 translation initiation complex

in human umbilical vein endothelial cells. J Biol Chem, 272: 11994-12000, 1997.

122. Kole, R. and Sazani, P. Antisense effects in the cell nucleus: modification of

splicing. Curr Opin Mol Ther, 3: 229-234, 2001.

123. Orom, U. A., Kauppinen, S., and Lund, A. H. LNA-modified oligonucleotides

mediate specific inhibition of microRNA function. Gene, 372: 137-141, 2006.

124. Davis, S., Lollo, B., Freier, S., and Esau, C. Improved targeting of miRNA with

antisense oligonucleotides. Nucleic Acids Res, 34: 2294-2304, 2006.

125. Hutvagner, G., Simard, M. J., Mello, C. C., and Zamore, P. D. Sequence-specific

inhibition of small RNA function. PLoS Biol, 2: E98, 2004.

126. Meister, G., Landthaler, M., Dorsett, Y., and Tuschl, T. Sequence-specific

inhibition of microRNA- and siRNA-induced RNA silencing. Rna, 10: 544-550,

2004.

137

127. Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoharan, M.,

and Stoffel, M. Silencing of microRNAs in vivo with 'antagomirs'. Nature, 438:

685-689, 2005.

128. Lee, Y. S., Kim, H. K., Chung, S., Kim, K. S., and Dutta, A. Depletion of human

micro-RNA miR-125b reveals that it is critical for the proliferation of

differentiated cells but not for the down-regulation of putative targets during

differentiation. J Biol Chem, 280: 16635-16641, 2005.

129. Levin, A. A. A review of the issues in the pharmacokinetics and toxicology of

phosphorothioate antisense oligonucleotides. Biochim Biophys Acta, 1489: 69-84,

1999.

130. Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R., and Tuschl, T. Single-

stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110: 563-

574, 2002.

131. Tsuda, N., Ishiyama, S., Li, Y., Ioannides, C. G., Abbruzzese, J. L., and Chang, D.

Z. Synthetic microRNA designed to target glioma-associated antigen 1

transcription factor inhibits division and induces late apoptosis in pancreatic

tumor cells. Clin Cancer Res, 12: 6557-6564, 2006.

132. Grimm, D., Streetz, K. L., Jopling, C. L., Storm, T. A., Pandey, K., Davis, C. R.,

Marion, P., Salazar, F., and Kay, M. A. Fatality in mice due to oversaturation of

cellular microRNA/short hairpin RNA pathways. Nature, 441: 537-541, 2006.

133. Esau, C. C. and Monia, B. P. Therapeutic potential for microRNAs. Adv Drug

Deliv Rev, 59: 101-114, 2007.

134. Buchschacher, G. L., Jr. and Wong-Staal, F. Development of lentiviral vectors for

gene therapy for human diseases. Blood, 95: 2499-2504, 2000.

135. Jemal, A., Murray, T., Ward, E., Samuels, A., Tiwari, R. C., Ghafoor, A., Feuer,

E. J., and Thun, M. J. Cancer statistics, 2005. CA Cancer J Clin, 55: 10-30, 2005.

136. Niederhuber, J. E., Brennan, M. F., and Menck, H. R. The National Cancer Data

Base report on pancreatic cancer. Cancer, 76: 1671-1677, 1995.

137. Warshaw, A. L. and Fernandez-del Castillo, C. Pancreatic carcinoma. N Engl J

Med, 326: 455-465, 1992.

138

138. Imbeaud, S., Graudens, E., Boulanger, V., Barlet, X., Zaborski, P., Eveno, E.,

Mueller, O., Schroeder, A., and Auffray, C. Towards standardization of RNA

quality assessment using user-independent classifiers of microcapillary

electrophoresis traces. Nucleic Acids Res, 33: e56, 2005.

139. Nuovo, G. J., Plaia, T. W., Belinsky, S. A., Baylin, S. B., and Herman, J. G. In

situ detection of the hypermethylation-induced inactivation of the p16 gene as an

early event in oncogenesis. Proc Natl Acad Sci U S A, 96: 12754-12759, 1999.

140. Saeed, A. I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J.,

Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A.,

Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A.,

Trush, V., and Quackenbush, J. TM4: a free, open-source system for microarray

data management and analysis. Biotechniques, 34: 374-378, 2003.

141. Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. Cluster analysis and

display of genome-wide expression patterns. Proc Natl Acad Sci U S A, 95:

14863-14868, 1998.

142. Kim, S. K., Lund, J., Kiraly, M., Duke, K., Jiang, M., Stuart, J. M., Eizinger, A.,

Wylie, B. N., and Davidson, G. S. A gene expression map for Caenorhabditis

elegans. Science, 293: 2087-2092, 2001.

143. Tibshirani, R., Hastie, T., Narasimhan, B., and Chu, G. Diagnosis of multiple

cancer types by shrunken centroids of gene expression. Proc Natl Acad Sci U S A,

99: 6567-6572, 2002.

144. Rubie, C., Kempf, K., Hans, J., Su, T., Tilton, B., Georg, T., Brittner, B., Ludwig,

B., and Schilling, M. Housekeeping gene variability in normal and cancerous

colorectal, pancreatic, esophageal, gastric and hepatic tissues. Mol Cell Probes, 19:

101-109, 2005.

145. Binkley, C. E., Zhang, L., Greenson, J. K., Giordano, T. J., Kuick, R., Misek, D.,

Hanash, S., Logsdon, C. D., and Simeone, D. M. The molecular basis of

pancreatic fibrosis: common stromal gene expression in chronic pancreatitis and

pancreatic adenocarcinoma. Pancreas, 29: 254-263, 2004.

146. Logsdon, C. D., Simeone, D. M., Binkley, C., Arumugam, T., Greenson, J. K.,

Giordano, T. J., Misek, D. E., Kuick, R., and Hanash, S. Molecular profiling of

pancreatic adenocarcinoma and chronic pancreatitis identifies multiple genes

differentially regulated in pancreatic cancer. Cancer Res, 63: 2649-2657, 2003.

139

147. Iacobuzio-Donahue, C. A., Maitra, A., Olsen, M., Lowe, A. W., van Heek, N. T.,

Rosty, C., Walter, K., Sato, N., Parker, A., Ashfaq, R., Jaffee, E., Ryu, B., Jones,

J., Eshleman, J. R., Yeo, C. J., Cameron, J. L., Kern, S. E., Hruban, R. H., Brown,

P. O., and Goggins, M. Exploration of global gene expression patterns in

pancreatic adenocarcinoma using cDNA microarrays. Am J Pathol, 162: 1151-

1162, 2003.

148. Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A., Petrocca, F., Visone,

R., Iorio, M., Roldo, C., Ferracin, M., Prueitt, R. L., Yanaihara, N., Lanza, G.,

Scarpa, A., Vecchione, A., Negrini, M., Harris, C. C., and Croce, C. M. A

microRNA expression signature of human solid tumors defines cancer gene

targets. Proc Natl Acad Sci U S A, 103: 2257-2261, 2006.

149. Hobert, O. Common logic of transcription factor and microRNA action. Trends

Biochem Sci, 29: 462-468, 2004.

150. Alvarez-Garcia, I. and Miska, E. A. MicroRNA functions in animal development

and human disease. Development, 132: 4653-4662, 2005.

151. Miyamoto, Y., Maitra, A., Ghosh, B., Zechner, U., Argani, P., Iacobuzio-

Donahue, C. A., Sriuranpong, V., Iso, T., Meszoely, I. M., Wolfe, M. S., Hruban,

R. H., Ball, D. W., Schmid, R. M., and Leach, S. D. Notch mediates TGF alpha-

induced changes in epithelial differentiation during pancreatic tumorigenesis.

Cancer Cell, 3: 565-576, 2003.

152. Thayer, S. P., di Magliano, M. P., Heiser, P. W., Nielsen, C. M., Roberts, D. J.,

Lauwers, G. Y., Qi, Y. P., Gysin, S., Fernandez-del Castillo, C., Yajnik, V.,

Antoniu, B., McMahon, M., Warshaw, A. L., and Hebrok, M. Hedgehog is an

early and late mediator of pancreatic cancer tumorigenesis. Nature, 425: 851-856,

2003.

153. Calin, G. A., Ferracin, M., Cimmino, A., Di Leva, G., Shimizu, M., Wojcik, S. E.,

Iorio, M. V., Visone, R., Sever, N. I., Fabbri, M., Iuliano, R., Palumbo, T.,

Pichiorri, F., Roldo, C., Garzon, R., Sevignani, C., Rassenti, L., Alder, H., Volinia,

S., Liu, C. G., Kipps, T. J., Negrini, M., and Croce, C. M. A MicroRNA signature

associated with prognosis and progression in chronic lymphocytic leukemia. N

Engl J Med, 353: 1793-1801, 2005.

154. DiMagno, E. P., Reber, H. A., and Tempero, M. A. AGA technical review on the

epidemiology, diagnosis, and treatment of pancreatic ductal adenocarcinoma.

140

American Gastroenterological Association. Gastroenterology, 117: 1464-1484,

1999.

155. Lamerz, R. Role of tumour markers, cytogenetics. Ann Oncol, 10 Suppl 4: 145-

149, 1999.

156. Steinberg, W. The clinical utility of the CA 19-9 tumor-associated antigen. Am J

Gastroenterol, 85: 350-355, 1990.

157. Koopmann, J., Rosenzweig, C. N., Zhang, Z., Canto, M. I., Brown, D. A., Hunter,

M., Yeo, C., Chan, D. W., Breit, S. N., and Goggins, M. Serum markers in

patients with resectable pancreatic adenocarcinoma: macrophage inhibitory

cytokine 1 versus CA19-9. Clin Cancer Res, 12: 442-446, 2006.

158. Hansel, D. E., Kern, S. E., and Hruban, R. H. Molecular pathogenesis of

pancreatic cancer. Annu Rev Genomics Hum Genet, 4: 237-256, 2003.

159. Bardi, G., Johansson, B., Pandis, N., Mandahl, N., Bak-Jensen, E., Andren-

Sandberg, A., Mitelman, F., and Heim, S. Karyotypic abnormalities in tumours of

the pancreas. Br J Cancer, 67: 1106-1112, 1993.

160. Almoguera, C., Shibata, D., Forrester, K., Martin, J., Arnheim, N., and Perucho,

M. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras

genes. Cell, 53: 549-554, 1988.

161. Ueki, T., Toyota, M., Sohn, T., Yeo, C. J., Issa, J. P., Hruban, R. H., and Goggins,

M. Hypermethylation of multiple genes in pancreatic adenocarcinoma. Cancer

Res, 60: 1835-1839, 2000.

162. Yeo, C. J., Cameron, J. L., Lillemoe, K. D., Sitzmann, J. V., Hruban, R. H.,

Goodman, S. N., Dooley, W. C., Coleman, J., and Pitt, H. A.

Pancreaticoduodenectomy for cancer of the head of the pancreas. 201 patients.

Ann Surg, 221: 721-731; discussion 731-723, 1995.

163. Evans, D. B., Rich, T. A., Byrd, D. R., and Ames, F. C. Adenocarcinoma of the

pancreas: current management of resectable and locally advanced disease. South

Med J, 84: 566-570, 1991.

164. Moertel, C. G., Frytak, S., Hahn, R. G., O'Connell, M. J., Reitemeier, R. J., Rubin,

J., Schutt, A. J., Weiland, L. H., Childs, D. S., Holbrook, M. A., Lavin, P. T.,

Livstone, E., Spiro, H., Knowlton, A., Kalser, M., Barkin, J., Lessner, H., Mann-

Kaplan, R., Ramming, K., Douglas, H. O., Jr., Thomas, P., Nave, H., Bateman, J.,

141

Lokich, J., Brooks, J., Chaffey, J., Corson, J. M., Zamcheck, N., and Novak, J. W.

Therapy of locally unresectable pancreatic carcinoma: a randomized comparison

of high dose (6000 rads) radiation alone, moderate dose radiation (4000 rads + 5-

fluorouracil), and high dose radiation + 5-fluorouracil: The Gastrointestinal

Tumor Study Group. Cancer, 48: 1705-1710, 1981.

165. Burris, H. A., 3rd, Moore, M. J., Andersen, J., Green, M. R., Rothenberg, M. L.,

Modiano, M. R., Cripps, M. C., Portenoy, R. K., Storniolo, A. M., Tarassoff, P.,

Nelson, R., Dorr, F. A., Stephens, C. D., and Von Hoff, D. D. Improvements in

survival and clinical benefit with gemcitabine as first-line therapy for patients

with advanced pancreas cancer: a randomized trial. J Clin Oncol, 15: 2403-2413,

1997.

166. Okusaka, T., Ito, Y., Furuse, J., Yamada, S., Ishii, H., Shibuya, K., Ioka, T., and

Shinchi, H. Current status of chemoradiotherapy for locally advanced pancreatic

cancer in Japan. Int J Clin Oncol, 13: 127-131, 2008.

167. Von Hoff, D. D. and Bearss, D. New drugs for patients with pancreatic cancer.

Curr Opin Oncol, 14: 621-627, 2002.

168. Huang, P., Chubb, S., Hertel, L. W., Grindey, G. B., and Plunkett, W. Action of

2',2'-difluorodeoxycytidine on DNA synthesis. Cancer Res, 51: 6110-6117, 1991.

169. Plunkett, W., Huang, P., Xu, Y. Z., Heinemann, V., Grunewald, R., and Gandhi,

V. Gemcitabine: metabolism, mechanisms of action, and self-potentiation. Semin

Oncol, 22: 3-10, 1995.

170. Braakhuis, B. J., van Dongen, G. A., Vermorken, J. B., and Snow, G. B.

Preclinical in vivo activity of 2',2'-difluorodeoxycytidine (Gemcitabine) against

human head and neck cancer. Cancer Res, 51: 211-214, 1991.

171. Heinemann, V. Gemcitabine-based combination treatment of pancreatic cancer.

Semin Oncol, 29: 25-35, 2002.

172. Matsubara, H., Takeuchi, T., Nishikawa, E., Yanagisawa, K., Hayashita, Y., Ebi,

H., Yamada, H., Suzuki, M., Nagino, M., Nimura, Y., Osada, H., and Takahashi,

T. Apoptosis induction by antisense oligonucleotides against miR-17-5p and miR-

20a in lung cancers overexpressing miR-17-92. Oncogene, 26: 6099-6105, 2007.

173. Dews, M., Homayouni, A., Yu, D., Murphy, D., Sevignani, C., Wentzel, E., Furth,

E. E., Lee, W. M., Enders, G. H., Mendell, J. T., and Thomas-Tikhonenko, A.

142

Augmentation of tumor angiogenesis by a Myc-activated microRNA cluster. Nat

Genet, 38: 1060-1065, 2006.

174. Esau, C., Davis, S., Murray, S. F., Yu, X. X., Pandey, S. K., Pear, M., Watts, L.,

Booten, S. L., Graham, M., McKay, R., Subramaniam, A., Propp, S., Lollo, B. A.,

Freier, S., Bennett, C. F., Bhanot, S., and Monia, B. P. miR-122 regulation of

lipid metabolism revealed by in vivo antisense targeting. Cell Metab, 3: 87-98,

2006.

175. Szafranska, A. E., Davison, T. S., John, J., Cannon, T., Sipos, B., Maghnouj, A.,

Labourier, E., and Hahn, S. A. MicroRNA expression alterations are linked to

tumorigenesis and non-neoplastic processes in pancreatic ductal adenocarcinoma.

Oncogene, 26: 4442-4452, 2007.

176. Lee, K. M., Yasuda, H., Hollingsworth, M. A., and Ouellette, M. M. Notch 2-

positive progenitors with the intrinsic ability to give rise to pancreatic ductal cells.

Lab Invest, 85: 1003-1012, 2005.

177. Chou, T. C. and Talalay, P. Quantitative analysis of dose-effect relationships: the

combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul, 22:

27-55, 1984.

178. Galardi, S., Mercatelli, N., Giorda, E., Massalini, S., Frajese, G. V., Ciafre, S. A.,

and Farace, M. G. miR-221 and miR-222 expression affects the proliferation

potential of human prostate carcinoma cell lines by targeting p27Kip1. J Biol

Chem, 282: 23716-23724, 2007.

179. Drygin, D., Barone, S., and Bennett, C. F. Sequence-dependent cytotoxicity of

second-generation oligonucleotides. Nucleic Acids Res, 32: 6585-6594, 2004.

180. Visone, R., Russo, L., Pallante, P., De Martino, I., Ferraro, A., Leone, V.,

Borbone, E., Petrocca, F., Alder, H., Croce, C. M., and Fusco, A. MicroRNAs

(miR)-221 and miR-222, both overexpressed in human thyroid papillary

carcinomas, regulate p27Kip1 protein levels and cell cycle. Endocr Relat Cancer,

14: 791-798, 2007.

181. Visone, R., Pallante, P., Vecchione, A., Cirombella, R., Ferracin, M., Ferraro, A.,

Volinia, S., Coluzzi, S., Leone, V., Borbone, E., Liu, C. G., Petrocca, F.,

Troncone, G., Calin, G. A., Scarpa, A., Colato, C., Tallini, G., Santoro, M., Croce,

C. M., and Fusco, A. Specific microRNAs are downregulated in human thyroid

anaplastic carcinomas. Oncogene, 26: 7590-7595, 2007.

143

182. Mattie, M. D., Benz, C. C., Bowers, J., Sensinger, K., Wong, L., Scott, G. K.,

Fedele, V., Ginzinger, D., Getts, R., and Haqq, C. Optimized high-throughput

microRNA expression profiling provides novel biomarker assessment of clinical

prostate and breast cancer biopsies. Mol Cancer, 5: 24, 2006.

183. Porkka, K. P., Pfeiffer, M. J., Waltering, K. K., Vessella, R. L., Tammela, T. L.,

and Visakorpi, T. MicroRNA expression profiling in prostate cancer. Cancer Res,

67: 6130-6135, 2007.

184. Cummins, J. M., He, Y., Leary, R. J., Pagliarini, R., Diaz, L. A., Jr., Sjoblom, T.,

Barad, O., Bentwich, Z., Szafranska, A. E., Labourier, E., Raymond, C. K.,

Roberts, B. S., Juhl, H., Kinzler, K. W., Vogelstein, B., and Velculescu, V. E. The

colorectal microRNAome. Proc Natl Acad Sci U S A, 103: 3687-3692, 2006.

185. Lanza, G., Ferracin, M., Gafa, R., Veronese, A., Spizzo, R., Pichiorri, F., Liu, C.

G., Calin, G. A., Croce, C. M., and Negrini, M. mRNA/microRNA gene

expression profile in microsatellite unstable colorectal cancer. Mol Cancer, 6: 54,

2007.

186. Easow, G., Teleman, A. A., and Cohen, S. M. Isolation of microRNA targets by

miRNP immunopurification. Rna, 13: 1198-1204, 2007.

187. Kuhn, D. E., Martin, M. M., Feldman, D. S., Terry, A. V., Jr., Nuovo, G. J., and

Elton, T. S. Experimental validation of miRNA targets. Methods, 44: 47-54, 2008.

188. le Sage, C., Nagel, R., Egan, D. A., Schrier, M., Mesman, E., Mangiola, A., Anile,

C., Maira, G., Mercatelli, N., Ciafre, S. A., Farace, M. G., and Agami, R.

Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222

promotes cancer cell proliferation. Embo J, 26: 3699-3708, 2007.

189. Furukawa-Hibi, Y., Kobayashi, Y., Chen, C., and Motoyama, N. FOXO

transcription factors in cell-cycle regulation and the response to oxidative stress.

Antioxid Redox Signal, 7: 752-760, 2005.

190. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction.

Nucleic Acids Res, 31: 3406-3415, 2003.

191. Clark, J. C., Thomas, D. M., Choong, P. F., and Dass, C. R. RECK--a newly

discovered inhibitor of metastasis with prognostic significance in multiple forms

of cancer. Cancer Metastasis Rev, 26: 675-683, 2007.

144

192. Masui, T., Doi, R., Koshiba, T., Fujimoto, K., Tsuji, S., Nakajima, S., Koizumi,

M., Toyoda, E., Tulachan, S., Ito, D., Kami, K., Mori, T., Wada, M., Noda, M.,

and Imamura, M. RECK expression in pancreatic cancer: its correlation with

lower invasiveness and better prognosis. Clin Cancer Res, 9: 1779-1784, 2003.

193. Lin, K., Dorman, J. B., Rodan, A., and Kenyon, C. daf-16: An HNF-3/forkhead

family member that can function to double the life-span of Caenorhabditis elegans.

Science, 278: 1319-1322, 1997.

194. Ogg, S., Paradis, S., Gottlieb, S., Patterson, G. I., Lee, L., Tissenbaum, H. A., and

Ruvkun, G. The Fork head transcription factor DAF-16 transduces insulin-like

metabolic and longevity signals in C. elegans. Nature, 389: 994-999, 1997.

195. Anderson, M. J., Viars, C. S., Czekay, S., Cavenee, W. K., and Arden, K. C.

Cloning and characterization of three human forkhead genes that comprise an

FKHR-like gene subfamily. Genomics, 47: 187-199, 1998.

196. Huang, H. and Tindall, D. J. Dynamic FoxO transcription factors. J Cell Sci, 120:

2479-2487, 2007.

197. Morris, B. J. A forkhead in the road to longevity: the molecular basis of lifespan

becomes clearer. J Hypertens, 23: 1285-1309, 2005.

198. Zou, Y., Tsai, W. B., Cheng, C. J., Hsu, C., Chung, Y. M., Li, P. C., Lin, S. H.,

and Hu, M. C. Forkhead box transcription factor FOXO3a suppresses estrogen-

dependent breast cancer cell proliferation and tumorigenesis. Breast Cancer Res,

10: R21, 2008.

199. Yamamura, Y., Lee, W. L., Inoue, K., Ida, H., and Ito, Y. RUNX3 cooperates

with FoxO3a to induce apoptosis in gastric cancer cells. J Biol Chem, 281: 5267-

5276, 2006.

200. Chen, M. F., Fang, F. M., Lu, C. H., Lu, M. S., Chen, W. C., Lee, K. D., and Lin,

P. Y. Significance of nuclear accumulation of foxo3a in esophageal squamous cell

carcinoma. Int J Radiat Oncol Biol Phys, 71: 1220-1229, 2008.

201. Nakamura, N., Ramaswamy, S., Vazquez, F., Signoretti, S., Loda, M., and Sellers,

W. R. Forkhead transcription factors are critical effectors of cell death and cell

cycle arrest downstream of PTEN. Mol Cell Biol, 20: 8969-8982, 2000.

202. Schmidt, M., Fernandez de Mattos, S., van der Horst, A., Klompmaker, R., Kops,

G. J., Lam, E. W., Burgering, B. M., and Medema, R. H. Cell cycle inhibition by

145

FoxO forkhead transcription factors involves downregulation of cyclin D. Mol

Cell Biol, 22: 7842-7852, 2002.

203. Ramaswamy, S., Nakamura, N., Sansal, I., Bergeron, L., and Sellers, W. R. A

novel mechanism of gene regulation and tumor suppression by the transcription

factor FKHR. Cancer Cell, 2: 81-91, 2002.

204. Tran, H., Brunet, A., Grenier, J. M., Datta, S. R., Fornace, A. J., Jr., DiStefano, P.

S., Chiang, L. W., and Greenberg, M. E. DNA repair pathway stimulated by the

forkhead transcription factor FOXO3a through the Gadd45 protein. Science, 296:

530-534, 2002.

205. Schneider, G., Weber, A., Zechner, U., Oswald, F., Friess, H. M., Schmid, R. M.,

and Liptay, S. GADD45alpha is highly expressed in pancreatic ductal

adenocarcinoma cells and required for tumor cell viability. Int J Cancer, 118:

2405-2411, 2006.

206. Yamasawa, K., Nio, Y., Dong, M., Yamaguchi, K., and Itakura, M.

Clinicopathological significance of abnormalities in Gadd45 expression and its

relationship to p53 in human pancreatic cancer. Clin Cancer Res, 8: 2563-2569,

2002.

207. Lund, E., Guttinger, S., Calado, A., Dahlberg, J. E., and Kutay, U. Nuclear export

of microRNA precursors. Science, 303: 95-98, 2004.

208. Thomson, J. M., Newman, M., Parker, J. S., Morin-Kensicki, E. M., Wright, T.,

and Hammond, S. M. Extensive post-transcriptional regulation of microRNAs and

its implications for cancer. Genes Dev, 20: 2202-2207, 2006.

209. Jiang, J., Lee, E. J., and Schmittgen, T. D. Increased expression of microRNA-

155 in Epstein-Barr virus transformed lymphoblastoid cell lines. Genes

Chromosomes Cancer, 45: 103-106, 2006.

210. Jiang, J., Gusev, Y., Aderca, I., Mettler, T. A., Nagorney, D. M., Brackett, D. J.,

Roberts, L. R., and Schmittgen, T. D. Association of MicroRNA expression in

hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival.

Clin Cancer Res, 14: 419-427, 2008.

211. Chomczynski, P. and Sacchi, N. Single-step method of RNA isolation by acid

guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem, 162: 156-

159, 1987.

146

212. Liang, Y., Ridzon, D., Wong, L., and Chen, C. Characterization of microRNA

expression profiles in normal human tissues. BMC Genomics, 8: 166, 2007.

213. Duan, R., Pak, C., and Jin, P. Single nucleotide polymorphism associated with

mature miR-125a alters the processing of pri-miRNA. Hum Mol Genet, 16: 1124-

1131, 2007.

214. Karube, Y., Tanaka, H., Osada, H., Tomida, S., Tatematsu, Y., Yanagisawa, K.,

Yatabe, Y., Takamizawa, J., Miyoshi, S., Mitsudomi, T., and Takahashi, T.

Reduced expression of Dicer associated with poor prognosis in lung cancer

patients. Cancer Sci, 96: 111-115, 2005.

215. Hruban, R. H., Goggins, M., Parsons, J., and Kern, S. E. Progression model for

pancreatic cancer. Clin Cancer Res, 6: 2969-2972, 2000.

216. Taylor, B. Carcinoma of the head of the pancreas versus chronic pancreatitis:

diagnostic dilemma with significant consequences. World J Surg, 27: 1249-1257,

2003.

217. Ohuchida, K., Mizumoto, K., Yu, J., Yamaguchi, H., Konomi, H., Nagai, E.,

Yamaguchi, K., Tsuneyoshi, M., and Tanaka, M. S100A6 is increased in a

stepwise manner during pancreatic carcinogenesis: clinical value of expression

analysis in 98 pancreatic juice samples. Cancer Epidemiol Biomarkers Prev, 16:

649-654, 2007.

218. Teich, N. and Mossner, J. Molecular analysis of pancreatic juice: a helpful tool to

differentiate benign and malignant pancreatic tumors? Dig Dis, 22: 235-238, 2004.

219. Goggins, M. Molecular markers of early pancreatic cancer. J Clin Oncol, 23:

4524-4531, 2005.

147

APPENDIX A

DATA RELEVANT TO CHAPTER 2

148

Tissue Type Chronic pancreatitis Normal Pancreas

miRNAs CP1 CP4 CP6 CP7 Ambion1 (N) Ambion2 (N)

let-7a-1* 0.012767564 0.004554593 0.010716357 0.005650276

let-7a-2-P 0.06314825 0.024298885 0.034370636 0.016007037 0.03634888 0.034601248

let-7a-3* 0.022277452 0.007258358 0.018295382 0.008624916 0.005953737 0.00733402

let-7b* 0.020109563 0.008586259 0.020264444 0.009398919 0.002387898 0.004160942

let-7c* 0.000543603 0.000190536 0.000434601 0.000198266

let-7d* 0.067560629 0.016552798 0.03898443 0.023946308 0.002639577 0.013907924

let-7e* 0.001953556 0.001065562

let-7f-1* 0.090772624 0.016667845 0.079698693 0.036982564 0.009458314 0.006559961

let-7f-2* 0.001815394 0.001042869 0.001410304

let-7g* 0.02490334 0.003639678 0.01497907 0.015056488 0.006369932 0.009764104

let-7i* 0.016838315 0.006728574 0.013672666 0.004408677 0.004876282 0.011195291

MIR-001-1 0.006010193 0.004590641 0.002594387 9.81398E-05 0.00099491 0.000930663

MIR-001-2 0.041960177 0.007066112 0.036118865 0.007905583 0.020764554 0.017999122

MIR-007-1 0.001198204 0.001263922 0.002724717 0.002435421 0.007157494 0.002328745

MIR-007-2 0.00022334 0.000236127 0.000747346 0.001181303 0.008283994 0.001740222

MIR-007-3 0.066299558 0.022849619 0.083151717 0.071358573 0.338322544 0.236435712

MIR-009-1-P 0.042820043 0.03842686 0.041434789 0.014831626 0.257808586 0.164846752

MIR-009-2-P 0.030410789 0.016794899 0.016108008 0.020724227 0.072412457 0.056627214

MIR-009-3-P 0.004868059 0.001665171 0.000395768

MIR-010a,b 0.000255121 0.009949689

MIR-015a 0.006271364 0.002268153 0.010861246 0.000420431 0.009179118 0.007294283

MIR-015b 0.007608744 0.00967714 0.001799911 0.000589615 0.006865729 0.015960159

MIR-016-1 0.014258866 0.014620986 0.030510124 0.017130381 0.019011395 0.010796828

MIR-016-2 0.097736996 0.103802955 0.089869873 0.041846625 0.101426442 0.069059053

MIR-017-P 0.067500597 0.008675703 0.041673089 0.004841798 0.055632402 0.054880421

MIR-018 0.710241994 0.046432247 0.545149137 0.168437418 0.253759848 0.241946399

MIR-019a-P 0.156661987 0.013489642 0.106883375 0.018285629 0.008367024 0.099447014

MIR-019b-1-P 0.005065515 0.004846943 0.00568522 0.000321186 0.02919225 0.023905516

MIR-019b-2-P 0.000382308 0.000369341

MIR-020 0.000315185 0.000163262 0.000147853 0.000369211

MIR-021 2.341142206 0.484202999 1.813199124 0.467826363 2.001817175 2.956513509

MIR-022-P 0.036732593 0.019780181 0.013561291 0.009714151 0.021133181 0.019293649

MIR-023a 0.053611733 0.01947956 0.049424267 0.02630918 0.013086115 0.009449887

MIR-023b-P 0.152687733 0.083139473 0.063950297 0.035967509 0.037915255 0.14623336

MIR-024-1,2 4.022794578 1.797990526 2.617194909 2.221679286 1.262563736 1.213713886

Continued

Table A. microRNA precursor expression in pancreatic tissues and cell lines. The expression of each miRNA precursor relative to 18S rRNA was determined using

real-time PCR as described in Materials and Methods. The data for each miRNA

precursor was determined using SYBR green detection on all miRNAs except those

with an asterik (*) which were determined using TaqMan probes. The expression of

each mature miRNA relative to 18S rRNA was determined using real-time PCR as

described in Materials and Methods. Data are presented as 2^-∆CT (CT miRNA - CT

18S rRNA) X 1,000,000. The data on 18S rRNA is the raw CT value.

149

Table A. continued

MIR-025 0.014534236 0.002017191 0.021287722 0.009170814 0.010690275 0.026596429

MIR-026a-1,2 0.010159932 0.004278047 0.003379688 0.002254476 0.001348446 0.003898703

MIR-026b 0.061031192 0.066914743 0.060933139 0.030577008 0.091468241 0.087280028

MIR-027a, b 0.043054581 0.00702677 0.024868156 0.016746479 0.020994121 0.028610011

MIR-028 0.002108041 0.0002481 0.002824025 0.000113562 0.001476794 0.000725965

MIR-029a,c 0.036616687 0.024450163 0.024079101 0.025740809 0.006679354

MIR-029b-1,2 0.000447457 0.000350692

MIR-030a,e 0.009098381 0.028338288 0.006146813 0.011618504 0.005538956 0.006441949

MIR-030b 0.057518827 0.036746545 0.069638762 0.044324666 0.042986329 0.06069794

MIR-030c-1,2 0.004284252 0.009825101 0.021738307 0.015281528 0.011527214 0.092756543

MIR-030d 0.043036247 0.005221449 0.004020804 0.006113272

MIR-031-P 0.038013945 0.043783555 0.040284213 0.011792264 0.189825896 0.19217051

MIR-032 0.01136044 0.013064081 0.004168735 0.001263644 0.006806407 0.001915632

MIR-033 0.000928967 0.000349703 0.000497972 0.00042864 0.000153537

MIR-034a 0.001606097 0.001025468 0.007751783 0.000470035 0.034041259 0.007937255

MIR-034b 0.00056078 0.000640861 0.000383238 0.000305746 0.004631787 0.002595809

MIR-034c

MIR-092-1 0.00467656 0.000575484

MIR-092-2-P 0.00028443 0.000986795 0.000732006 0.010868467 0.005224251

MIR-093 0.004549785 0.002066059 0.005246143 0.000678746 0.026074677 0.018327507

MIR-095 0.008550817 0.000237352 0.000619099 0.003892058

MIR-096-P 0.135395629 0.166538705 0.122449295 0.058341046 0.691508178 0.548908989

MIR-098 0.395513288 0.200547922 0.282877605 0.150995878 0.348510546 0.420654846

MIR-099a 0.00068848 0.000449164 0.000449417 0.000601951 0.004451034 0.002625458

MIR-099b 0.052199058 0.020044676 0.050994691 0.031251431 0.051381301 0.029222843

MIR-100 0.011726527 0.002945217 0.012368136 0.010485966 0.003268844 0.021370743

MIR-101-1 0.001256223 0.000639224 0.001044442 0.000164776 0.000235339 0.00048706

MIR-101-2 0.067390058 0.025316932 0.057451341 0.015532023 0.151054254 1.752910539

MIR-103-1,2 0.113320955 0.040466038 0.059308713 0.068214562 0.203195269 0.140712156

MIR-105-1,2 0.008403084 0.013297846 0.004531591 0.002389855 0.013743099 0.005700536

MIR-106a-P 0.000346189 0.000268811 0.001528436 0.000535674

MIR-106b 0.029821499 0.013409037 0.028810417 0.009571024 0.035342018 0.080899347

MIR-107 0.161549262 0.074540738 0.169600799 0.08313928 0.231565418 0.15655515

MIR-108 0.005332403 0.008613235 0.01351545 0.002144737 0.008016303 0.012246038

MIR-122a 0.000271888 0.000168237 0.000202524 0.001497577 0.000744918

MIR-124a-1,2,3 0.000271765 0.005854591 0.00560694

MIR-125a 0.037638686 0.007781262 0.028077492 0.001526758 0.068244151 0.055909214

MIR-125b-1 0.028684567 0.020528989 0.004835816 0.008964481 0.012792711

MIR-125b-2 0.000318138 0.00033646 0.002826068 0.000474395 0.001900974 0.003763557

MIR-126 0.031139435 0.018682553 0.010326938 0.012578255 0.107276146 0.024853897

MIR-127 1.443391405 1.322518514 1.338535006 0.652239432 1.228175066 1.193624348

MIR-128a 0.01308109 0.01497742 0.003764339 0.012932415 0.011828256 0.005029126

MIR-128b 0.00389817 0.003606393 0.002140326 0.001638763 0.008546143 0.008074703

MIR-129-2 0.04255903 0.053792447 0.039322391 0.012627467 0.285810578 0.214750124

MIR-130a-P 0.05095675 0.073840054 0.056078589 0.012432141 0.252355112 0.177391264

MIR-130b 0.000174327 0.000389355 0.001809944 0.001542816 0.001823327

Continued

150

Table A. continued

MIR-133a-1,2 0.025152857 0.006156363 0.010857505 0.004650737 0.032489475 0.011994326

MIR-133b 0.02396675 0.021021551 0.00931909 0.003391111 0.048682674 0.023065036

MIR-134 0.018352025 0.019122731 0.018976627 0.01182464 0.136395478 0.255991421

MIR-135a-1,2 0.000934791 0.000803997 0.020177299 0.005874401 0.001761802 0.007305083

MIR-135b-P 0.00118657 0.002349502 0.001346749 0.00614135 0.017659866 0.005187981

MIR-136 0.006804062 0.002207299 0.020303354 0.007678385 0.003676769 0.082237423

MIR-137 0.000447471 0.00103947 0.000883174 0.001245746 0.000575506 0.001122707

MIR-138-1,2 0.001714094 0.000262827 0.001397973 0.00044973 0.00093339

MIR-139 0.025153005 0.016604429 0.020384394 0.006667056 0.106312064 0.061125699

MIR-140

MIR-141 0.004501049 0.0086425 0.003534605 0.005206018 0.013817426 0.019355198

MIR-142-P 0.00339802 0.008042978 0.010785362 0.000911796 0.115605763 0.166751526

MIR-143 0.00369372 0.001751684 0.004817672 0.00097074 0.016971657 0.012679392

MIR-144 0.000273698 0.000420075 0.000233496 0.00743239

MIR-145-P 0.031911651 0.022850047 0.024736512 0.013065508 0.020027785 0.013671064

MIR-146 0.001451618 0.000251733 0.00673389

MIR-147 0.002270519 0.001758809 0.000515769 0.00221494 0.006845594

MIR-148a-P 0.002155628 0.002563387 0.003181465 0.001131528 0.008784268 0.007050901

MIR-148b-P 0.037287376 0.017141687 0.045625949 0.033291209 0.004765249 0.047246831

MIR-149 0.015495854 0.008078378 0.015534955 0.00936547 0.113169941 0.069601122

MIR-150 0.003753128 0.006012553 0.001885013 0.001145313 0.028573998 0.026609088

MIR-151 0.012107099 0.009395958 0.011398042 0.003513248 0.000953368 0.00487287

MIR-152 0.008298464 0.001777718 0.007610349 0.013484572 0.011065352 0.005798285

MIR-153-1,2 0.00346641 0.019314136 0.014266135 0.000216381 0.007504883 0.000905268

MIR-154 0.009455281 0.002693799 0.006473768 0.011609966 0.013345639 0.140458892

MIR-155 0.006474987 0.011309025 0.000104749 0.014553467 0.002732431

MIR-181a,c 0.016747454 0.015833126 0.014009326 0.002935386 0.014163854 0.006231712

MIR-181b-1,2 0.001071404 0.000394636 0.000714214 0.000402429 0.00082498 0.002324979

MIR-182 0.114077333 0.039264489 0.063994395 0.095568075 0.044764448 0.049877168

MIR-183 0.000176519 0.000759672 0.002275914 0.004266724 0.000981441 0.000911294

MIR-184 0.013735575 0.015170747 0.004686897 0.003159899 0.047283535 0.057244777

MIR-185 0.265489106 0.25329402 0.205033332 0.142422656 0.28688426 0.264546433

MIR-186-P 0.249354314 0.238891499 0.343926782 0.310028354 0.131957908 0.192107782

MIR-187 0.000169812 0.003297623 0.000112497 0.003482237 0.001683475

MIR-188b-P 0.000272428 0.000597614 0.000910898 0.001806537 0.002886692

MIR-190 0.00017583

MIR-191 0.000731131 0.000607368 0.000391679

MIR-192 0.000699001 0.005158609 0.001272982 0.000278215 0.004109972 0.022998034

MIR-193 0.002903987 0.000351593 0.006451089 0.005409161 0.005158557 0.011033806

MIR-194-1,2 0.000252311 0.000568257 0.000765849 0.002568362 0.00080106

MIR-195-P 0.033704664 0.064680131 0.055662456 0.021886735 0.323387702 0.366278232

MIR-196a-1 0.000388584 0.000304802 0.000741552 0.000111348 0.004269769 0.009067291

MIR-196a-2 0.003463811 0.001560232 0.001208741 0.001227677 0.002913668 0.003392027

MIR-196b 0.002501064 0.013480959 0.001895779 0.001053794 0.056271578 0.022356015

MIR-197 0.039397436 0.00767588 0.046983349 0.012516197 0.120997632 0.198911952

MIR-198 0.002505612 0.001030131 0.004541608 0.000452906 0.00298949 0.001381301

Continued

151

Table A. continued

MIR-199a-1-P 0.298467256 0.25086062 0.166578992 0.092487139 0.433476359 0.360208809

MIR-199a-2-P 0.027350084 0.000421998 0.016245933 0.001672517 0.006325522 0.015860102

MIR-199b-P 0.094182157 0.067465461 0.068591441 0.02481399 0.156936215 0.150919054

MIR-200a-P 1.040433725 1.097327693 0.927129884 0.357621176 3.561935073 2.349448867

MIR-200b 0.005236239 0.00882399 0.005748241 0.005008713 0.008166116 0.013887001

MIR-200c 0.001875655 0.002254475 0.002430292 0.001505718 0.007420339 0.006308269

MIR-203 0.000497538 0.000222475 0.000152136

MIR-204 0.008004919 0.012991352 0.012451945 0.004396321 0.065474308 0.04547774

MIR-205 0.004022595 0.003139284 0.000884591 0.000333252 0.000239987 0.000250098

MIR-206 0.002138564 0.000282114 0.002042835 0.006840329

MIR-208 0.000733871 0.007252755 0.000367513 0.001065468 0.00897855 0.002034795

MIR-210 0.09111678 0.044985782 0.043284832 0.012617147 2.13176546 0.754484605

MIR-211 0.073901403 0.006813515 0.050940321 0.026306618 0.277102997 0.124284679

MIR-212 0.170904889 0.009373009 0.115209842 0.028910654 0.019571386 0.024553472

MIR-213 0.002785865 0.003108049 0.00200287 0.00070607 0.013444866 0.001219855

MIR-214 0.067405311 0.06752029 0.067519399 0.033686739 0.107147472 0.121379179

MIR-215 0.005950176 0.005737333 0.012282213 0.004135509 0.000180488 0.005897319

MIR-216 0.290399841 0.066188341 0.135031778 0.053202619 0.023985374 0.796469692

MIR-217 0.000235323 0.000170291 0.000180144 0.00165481

MIR-218-1,2 0.008985653 0.008121506 0.01599596 0.001907882 0.011345368 0.00237825

MIR-219-1,2 0.000752839 0.000781918 0.006967928 0.000183472 0.001300564 0.000636546

MIR-220 0.000649481 0.000380729 0.000707701 0.00193472 0.003250969 0.002219262

MIR-221 0.009422457 0.001132225 0.012976988 0.001583838 0.001503949 0.003099277

MIR-222-P 0.010800759 0.000349949 0.005152114 0.003193503 0.0025027 0.0047615

MIR-223 0.000174591 0.000475107 0.002287581 0.000896812

MIR-224 0.025570773 0.014669204 0.020176872 0.011781545 0.024495308 0.015615969

MIR-296 0.003529366 0.012403017 0.002707379 0.000628015 0.004989904 0.007946184

MIR-299-P 0.015990563 0.017543379 0.015012946 0.002988038 0.039464444 0.041617262

MIR-301 0.010070304 0.007361512 0.000388674 0.021308422 0.002189063 0.000468284

MIR-302 0.01186985 0.006763867 0.000808252 0.005987218 0.002020106 0.001943118

MIR-302b 0.009426909 0.009476736 0.006532407 0.004181685 0.014986297 0.010019941

MIR-302c 0.000259907 0.000742716 0.00141125 0.004454245 0.001977327

MIR-302d 0.002969431 0.000343145 0.001321731 0.000104538 0.005817989 0.006271514

MIR-320 0.007278607 0.001174052 0.001375367 0.00141726 0.019171901 0.006686201

MIR-321 0.503973775 0.572789686 0.726818914 0.70760864 1.844779286 1.4878209

MIR-323 0.042517514 0.014855041 0.00657378 0.020966772 0.071572775 0.124469517

MIR-324-P 0.00365075 0.008846233 0.01163056 0.002844806 0.057851482 0.0335496

MIR-325 0.00443695 0.004339746 0.002946879 0.002596601 0.018084716 0.008847416

MIR-326-P 0.002547828 0.000698274 0.002562807 0.000540673 0.003020398 0.006940688

MIR-328 0.204784023 0.133565649 0.124115988 0.060584396 0.519801326 0.137784391

MIR-330 0.001550312 0.002652331 0.003890964 0.004113695 0.003163172 0.013502907

MIR-331-P 0.018226976 0.022177498 0.013292796 0.00801185 0.084372445 0.119610369

MIR-335 0.000312403 0.001414699

MIR-337 0.003370729 0.004834715 0.002915711 0.000719814 0.030593664 0.034853802

MIR-338 0.005481172 0.013365456 0.004720068 0.000785842 0.000259684 0.00033258

MIR-339 0.308455883 0.19562273 0.207006844 0.104573707 0.124672201 0.05196366

Continued

152

Table A. continued

MIR-340 0.049059593 0.0378978 0.05342104 0.031652792 0.056894942 0.047978933

MIR-342 0.006266854 0.00277656 0.005425455 0.000138995 0.010622662 0.009543253

MIR-345 0.038088996 0.060830468 0.019169923 0.009714649 0.270400968 0.349214863

MIR-346 0.04285465 0.015982046 0.018191917 0.023584676 0.092284631 0.087633717

MIR-361 0.00429402 0.011935766 0.002435201 0.000983947 0.0168768 0.013473494

MIR-367 0.005381289 0.000687387

MIR-368 0.002403004 0.00279905 0.003731997 0.001802181 0.006710613 0.004295533

MIR-369 0.035557566

MIR-370 0.064662207 0.017665837 0.067686052 0.025862769 0.073265952 0.565532315

MIR-371 0.010450665 0.015527791 0.003743435 0.001098226 0.06270993 0.08601612

MIR-372 0.001638097 0.000154308

MIR-373 0.002161575 0.003207945 0.003245283 0.000257784 0.003133078 0.00899273

MIR-374-P 0.00108488

MIR-375 0.09199046 0.020887258 0.076421181 0.036105478 0.044454914 0.078275215

MIR-376 0.144953399 0.055565489 0.053468328 0.080314571 0.020308574 0.318603246

MIR-377 0.028962703 0.002024902 0.001257267 0.001239998 0.008179125 0.041882631

MIR-378 0.000456763 0.001340092 0.00061336 0.000603437 0.005806966 0.005676372

MIR-379 0.048961856 0.036919925 0.049887852 0.040966972 0.07170906 0.284864524

MIR-380 0.011264273 0.007518173 0.009380535 0.00919796 0.00197598 0.023827351

MIR-381 0.000455134 0.001046901 0.000532353 0.000771986 0.002547867

MIR-382 0.000798927 0.000181261 0.000189964 0.000419186 0.02977139

MIR-383 0.001573386 0.00062277 0.000602749 0.000579965 0.006042031 0.006407707

MIR-384 0.000189276

MIR-422b 0.003561243 0.002401419 0.004134326 0.001615879 0.006772073 0.017108082

MIR-423 0.005969613 0.003617062 0.001078241 0.001447259 0.012702645 0.009890974

MIR-424 0.008935437 0.007596207 0.001936085 0.002342667 0.000832088 0.000381683

MIR-425 0.000207824 0.004474417 0.003891083 0.003835097

18S rRNA (CT) 7.4282695 7.16372935 7.1029398 6.620629 6.96878565 6.9713573

Tissue Type Normal Pancreas Adjacent Benign

miRNAs Ambion3 (N) Ambion4 (N) BD(N) ST(N) OUP2 (B) OUP16 (B)

let-7a-1*

let-7a-2-P 0.023460053 0.036785208 0.029860799 0.02020963 0.037667539 0.093053858

let-7a-3* 0.002120054 0.012402666 0.001374538 0.007318707 0.01802732

let-7b* 0.001147644 0.004249536 0.001646644 0.010710603 0.019361678

let-7c* 0.000233558

let-7d* 0.009596833 0.003219003 0.003923437 0.018450767 0.010403781

let-7e*

let-7f-1* 0.010351675 0.005823148 0.004188598 0.009445643 0.01896164 0.021296686

let-7f-2*

let-7g* 0.011776659 0.004639262 0.001956045 0.002432392 0.017344566 0.01545451

let-7i* 0.015881941 0.00541939 0.010567787 0.006528355

MIR-001-1 0.001803267 0.002863931 0.005548375 0.001255527 0.009524411 0.002519756

MIR-001-2 0.010873115 0.00493528 0.011064788 0.033083994 0.051208019 0.036468781

MIR-007-1 0.002328092 0.000603521 0.007105338 0.003188275 0.021646972 0.008558352

MIR-007-2 0.009572003 0.006148408 0.001458586 0.002237086 0.0057143 0.010822801

Continued

153

Table A. continued

MIR-007-3 0.156077402 0.174041959 0.010044876 0.05389782 0.42119379 0.445348077

MIR-009-1-P 0.273344655 0.11382549 0.152454757 0.266531919 0.285545701 0.612935117

MIR-009-2-P 0.062292124 0.06740517 0.045638623 0.068708134 0.124172884 0.122161854

MIR-009-3-P 0.003210086 0.000758332 0.000894607 0.001112762 0.00101393 0.006873555

MIR-010a,b 0.005657954 0.000151693 0.005058089 0.003654635 0.011068939

MIR-015a 0.009824138 0.007794737 0.001693084 0.0005465 0.017652105 0.023057338

MIR-015b 0.001427992 0.006178981 0.000173985 0.004656992 0.015822222 0.037806622

MIR-016-1 0.018770737 0.012843548 0.003367142 0.001493087 0.058034478 0.080209658

MIR-016-2 0.113455273 0.229469222 0.121675033 0.099270868 0.151546829 0.249867258

MIR-017-P 0.053755142 0.050202519 0.086076461 0.074940334 0.066453089 0.13410294

MIR-018 0.204774868 0.140910602 0.066609099 0.102862264 0.334647367 0.395013337

MIR-019a-P 0.072782609 0.001250622 0.019498792 0.000303401 0.042358508 0.134387166

MIR-019b-1-P 0.047490856 0.025862545 0.030810504 0.04124096 0.030029943 0.042803031

MIR-019b-2-P 0.00052715 0.000163743 0.001892753 0.000496062

MIR-020 0.000303129 0.002960546 0.000264216 0.00016767 0.000743265

MIR-021 1.501904488 1.200033823 0.035227199 0.533652763 5.56391573 3.534118144

MIR-022-P 0.025448626 0.008153166 0.044840326 0.036020318 0.025029514 0.06061866

MIR-023a 0.024108648 0.016621675 0.021428439 0.019036799 0.049623716 0.040917314

MIR-023b-P 0.079367522 0.062571525 0.064043172 0.022874051 0.13764824 0.214746313

MIR-024-1,2 1.425510899 0.656514404 0.607524531 0.912583971 5.816894221 4.507791443

MIR-025 0.105448397 0.00904403 0.011247803 0.012385116 0.012075561 0.025820545

MIR-026a-1,2 0.005033104 0.004790236 0.00698449 0.006123918 0.004343039 0.004452315

MIR-026b 0.115073383 0.112902949 0.129196695 0.131683749 0.188996192 0.276350719

MIR-027a, b 0.03889639 0.01301159 0.042972174 0.030975937 0.064792834 0.067463841

MIR-028 0.004468245 0.001008326 0.005605024 0.002936795 0.000800383

MIR-029a,c 0.003287862 0.003816043 0.000699254 0.029521487 0.013385748 0.034633338

MIR-029b-1,2 0.002261889 0.001620089 0.000255493 0.00018277 0.00454898

MIR-030a,e 0.015817568 0.008049749 0.009548634 0.009069786 0.025886829 0.024622819

MIR-030b 0.032213273 0.023990467 0.022876007 0.020156573 0.130639182 0.152129809

MIR-030c-1,2 0.041040641 0.029998695 0.02228078 0.016353471 0.064907638 0.101747572

MIR-030d 0.009544095 0.000165124 0.00596619 0.005911626

MIR-031-P 0.336204297 0.162341592 0.181180748 0.177014656 0.333619627 0.290619874

MIR-032 0.017677206 0.004104854 0.014120912 0.007388497 0.067239559 0.037292925

MIR-033 0.000324672 0.00036525 0.000309193 0.000780286 0.000264862 0.002796651

MIR-034a 0.011954566 0.009155803 0.01539088 0.055732849 0.028583929 0.041453444

MIR-034b 0.001773097 0.002599786 0.002959749 0.004140476 0.001218406 0.004212564

MIR-034c

MIR-092-1 0.000144635 0.00012471 0.000249382 0.005416338

MIR-092-2-P 0.010771247 0.005495992 0.007871286 0.006107824 0.026786559 0.04677749

MIR-093 0.012527037 0.015571612 0.025333462 0.025478784 0.040930343 0.045465145

MIR-095 0.000569694 0.000769415 0.001368625 0.00797047 0.003997888

MIR-096-P 1.124034307 0.278904587 0.891192854 1.147945555 1.097127024 1.409226265

MIR-098 0.259493277 0.221867471 0.150235855 0.319546152 0.729152542 0.6203603

MIR-099a 0.00173979 0.00092881 0.001507435 0.000970997 0.01062897 0.013378301

MIR-099b 0.053190985 0.052300573 0.348553029 0.60279369 0.087067166 0.111896186

MIR-100 0.008855046 0.012598498 0.006302979 0.025774187 0.074910178 0.064522774

Continued

154

Table A. continued

MIR-101-1 0.002931117 0.001015358 0.000221379 0.006172721

MIR-101-2 0.235941658 0.038637996 0.015768345 0.047561144 0.122494771 0.152216301

MIR-103-1,2 0.235761013 0.129790579 0.07850055 0.11851263 0.355137982 0.555116996

MIR-105-1,2 0.015572745 0.017640522 0.084224576 0.023321829 0.022313282 0.040999802

MIR-106a-P 0.001203728 0.002257931 0.002010854 0.0026566 0.002562772 0.001730264

MIR-106b 0.052692906 0.059722467 0.003582022 0.040712192 0.062722422 0.114530898

MIR-107 0.152248569 0.173840673 0.043072491 0.118730313 0.417790493 0.459355265

MIR-108 0.01075514 0.026687714 0.010867656 0.01581359 0.009152107 0.048140995

MIR-122a 0.002549942 0.00240095 0.002987762 0.002515619 0.00459102 0.011318596

MIR-124a-1,2,3 0.002686129 0.000658507 0.001218382 0.005805475 0.002438195 0.007479024

MIR-125a 0.084603905 0.048511667 0.036995332 0.044760803 0.098270457 0.083749203

MIR-125b-1 0.010984146 0.014991817 0.000781507 0.018714181 0.118832311 0.048184377

MIR-125b-2 0.001497081 0.000680202 0.006278051 0.001215792 0.006702658 0.006046269

MIR-126 0.045011644 0.078728542 0.002029374 0.035357859 0.109963571 0.167638075

MIR-127 1.336976465 1.067937391 1.102588584 1.241384226 1.586315318 2.386303875

MIR-128a 0.018793402 0.004390741 0.017214732 0.012338255 0.036454559 0.052427471

MIR-128b 0.012375542 0.006851913 0.006063076 0.015875042 0.017239928 0.036817826

MIR-129-2 0.206795267 0.112882799 0.216273539 0.22336642 0.270976861 0.553785149

MIR-130a-P 0.315547166 0.123233344 0.158971061 0.227245199 0.45856418 0.550764802

MIR-130b 0.000786065 0.001727677 0.006192231 0.010242067 0.001507291 0.005174768

MIR-132 0.000319802 0.005560879 0.00311748 0.016005766 0.013241228

MIR-133a-1,2 0.033429523 0.036249278 0.025803714 0.023672432 0.044246038 0.019377064

MIR-133b 0.050694641 0.044961176 0.089600499 0.072949466 0.049220413 0.185451876

MIR-134 0.154609575 0.079926214 0.025135864 0.047759407 0.200802491 0.349498161

MIR-135a-1,2 0.005116539 0.001398151 0.002868652 0.014636184 0.048358358 0.037962301

MIR-135b-P 0.015226372 0.002906444 0.003458274 0.002605853 0.007809707 0.031701486

MIR-136 0.000670647 0.003114314 0.001136085 0.001619897 0.027114306 0.011153206

MIR-137 0.000724876 0.000862998 0.001544331 0.002664959 0.008930174 0.023446165

MIR-138-1,2 0.001066134 0.000576575 0.001728739 0.007064216 0.003303705 0.003278719

MIR-139 0.082889667 0.066300087 0.144733578 0.132227093 0.070429984 0.272459041

MIR-140 0.000462177 0.00046819 0.000408068

MIR-141 0.011214605 0.014088019 0.005989983 0.006822167 0.024340432 0.048454846

MIR-142-P 0.517754671 0.26796966 0.479720857 0.526207683 0.243503948 0.543002321

MIR-143 0.008451526 0.015601852 0.010951802 0.039678663 0.026571787 0.044878267

MIR-144 0.000347188 0.000911752 0.0002132

MIR-145-P 0.023213737 0.011188544 0.022409909 0.020842934 0.137626297 0.085129164

MIR-146 0.00045774 0.00040188 0.000990003 0.000746375 0.000552401 0.000462866

MIR-147 0.00777064 0.002639743 0.001681868 0.009283466 0.030928658 0.049109324

MIR-148a-P 0.009808805 0.017715783 0.0377653 0.016374892 0.005185303 0.015497295

MIR-148b-P 0.018034323 0.004860362 0.011763634 0.006406296 0.075776119 0.017302158

MIR-149 0.122808776 0.047948868 0.088025179 0.095504546 0.195066247 0.356558393

MIR-150 0.030451003 0.012556238 0.023499357 0.018558678 0.03085871 0.059512592

MIR-151 0.003569036 0.003699959 0.004052687 0.005374349 0.015999433 0.023107056

MIR-152 0.002381058 0.001678749 0.001132278 0.014883908 0.008987076 0.027016784

MIR-153-1,2 0.004683363 0.003224637 0.010789898 0.002446533 0.019285657 0.024446526

MIR-154 0.035653711 0.001603305 0.00961808 0.00401225 0.004369722 0.046171047

Continued

155

Table A. continued

MIR-155 0.008739164 0.008826817 0.000401429 0.009368866 0.024332967 0.007784827

MIR-181a,c 0.006196471 0.01807232 0.000438938 0.004720704 0.066524961 0.06114737

MIR-181b-1,2 0.00207454 0.000549543 0.000796762 0.002495298 0.002561531 0.011229689

MIR-182 0.097172411 0.069783007 0.008536329 0.038550362 0.166420443 0.308155889

MIR-183 0.008598809 0.004633092 0.001991851 0.001918504 0.009382591 0.010075294

MIR-184 0.032143494 0.040467501 0.030947734 0.033263233 0.116268006 0.197394031

MIR-185 0.238603493 0.444582039 0.453059699 0.373060422 0.475669052 0.580944508

MIR-186-P 0.181171141 0.04262321 0.115565011 0.107269975 0.73587242 0.547239119

MIR-187 0.000558598 0.003961983 0.001154775 0.000310979 0.003765043 0.003647572

MIR-188b-P 0.007268549 0.00308475 0.001278001 0.000639631 0.008641111 0.02614141

MIR-190 0.000250425 0.000339337

MIR-191 0.000658371 0.000778382 0.000847187 0.000208854 0.000496219 0.002886264

MIR-192 0.018058502 0.013162306 0.041929765 0.019252308 0.020109466 0.033714331

MIR-193 0.008240885 0.015266213 0.010562928 0.003656862 0.010758286 0.014924788

MIR-194-1,2 0.004080247 0.000438034 0.001203061 0.002232689 0.004554802 0.004502761

MIR-195-P 0.297343011 0.24129101 0.262356887 0.110027703 0.21278363 0.799173843

MIR-196a-1 0.005299245 0.00660894 0.011725129 0.005306211 0.005740733 0.027134521

MIR-196a-2 0.007123347 0.001871324 0.00155058 0.005808471 0.015049184 0.049274832

MIR-196b 0.039444202 0.014298083 0.038965161 0.030449371 0.059391924 0.09970905

MIR-197 0.189617046 0.045936845 0.25367277 0.202323418 0.285322034 0.315722125

MIR-198 0.00087355 0.000214464 0.005640857 0.000440909 0.008943583 0.005461098

MIR-199a-1-P 0.497798079 0.799643061 1.013671412 0.731949855 1.000941091 1.476407805

MIR-199a-2-P 0.013458119 0.005413726 0.007984001 0.003251728 0.006032081 0.039974679

MIR-199b-P 0.180422175 0.075547984 0.100902272 0.069749961 0.316475576 0.3840639

MIR-200a-P 4.095998166 1.74546759 5.53811714 6.880177186 6.191369533 7.367462281

MIR-200b 0.021707706 0.015252273 0.107896433 0.01228045 0.068796647 0.176803013

MIR-200c 0.007691571 0.002094369 0.001304947 0.001843116 0.03170013 0.064013712

MIR-203 0.001020997 0.001314431 0.006133442 0.004690611 0.001887462

MIR-204 0.107210794 0.041991222 0.05457712 0.031980764 0.225873209 0.312754006

MIR-205 0.013931497 0.005608937 0.000388849 0.001429942 0.006043995 0.003970808

MIR-206 0.009027684 0.001421654 0.0012271 0.002029891 0.017358109 0.018082159

MIR-208 0.003284983 0.002320861 0.004636049 0.00870919 0.011147898 0.026583793

MIR-210 1.139689297 0.685260089 0.415676205 0.167266765 1.354844773 2.194505323

MIR-211 0.263884875 0.182771252 0.27665647 0.209902568 0.446570721 0.78599349

MIR-212 0.026633901 0.001685785 0.023479583 0.058080864 0.185966101 0.106532776

MIR-213 0.007426131 0.005707231 0.006498503 0.004705345 0.034337851 0.010997419

MIR-214 0.142593346 0.070352869 0.157445297 0.138599717 0.223581166 0.318789666

MIR-215 0.005906295 0.00176932 0.005884178 0.000159815 0.000374749 0.002932552

MIR-216 0.026532769 0.015560099 0.018389264 0.010548109 0.272845768 0.08897441

MIR-217 0.000544327 0.000145199 0.001535443 0.000902913

MIR-218-1,2 0.019397413 0.007089284 0.004667189 0.008428845 0.027820923 0.042569554

MIR-219-1,2 0.0102539 0.002822347 0.001696013 0.000178188 0.000853387 0.013578028

MIR-220 0.004515206 0.004346103 0.001716496 0.005808445 0.003181942 0.005308315

MIR-221 0.001690099 0.001967066 0.000540588 0.008587802 0.010153596 0.001787793

MIR-222-P 0.003724321 0.002775237 0.001366649 0.00138896 0.007657905 0.009410791

MIR-223 0.001013411 0.001732987 0.001290372 0.000699716 0.002335613 0.005021617

Continued

156

Table A. continued

MIR-224 0.021638234 0.025557421 0.038613913 0.038797506 0.008696566 0.033478084

MIR-296 0.016779332 0.013666604 0.014778494 0.009389338 0.019221091 0.031866696

MIR-299-P 0.030739523 0.030973593 0.090631324 0.087728184 0.095289071 0.148039212

MIR-301 0.002905409 0.001421795 0.00102095 0.000386695 0.0058713 0.017762067

MIR-302 0.001671448 0.001432421 0.001484567 0.001344435 0.008632556 0.005327614

MIR-302b 0.014037692 0.009199927 0.008301893 0.005957663 0.037275488 0.0353411

MIR-302c 0.006637214 0.002553558 0.002007514 0.005042276 0.000953833 0.007174643

MIR-302d 0.003558781 0.003707237 0.004372718 0.004119177 0.005444761 0.007732396

MIR-320 0.011101828 0.005988764 0.019042432 0.00640881 0.024686944 0.043652157

MIR-321 1.795608797 3.289936115 0.258181596 2.148871508 2.323744691 1.960181534

MIR-323 0.039524501 0.041433172 0.034394831 0.039717296 0.055565514 0.116587722

MIR-324-P 0.055726412 0.04804315 0.030020869 0.0252393 0.078389518 0.08321952

MIR-325 0.01259103 0.033482303 0.037368606 0.039328888 0.017826522 0.048511001

MIR-326-P 0.001893571 0.001223979 0.000421041 0.001382688 0.002858711 0.005407891

MIR-328 0.206092666 0.230141182 0.791047411 0.437211793 0.594908654 0.367686795

MIR-330 0.03223628 0.012095126 0.016349525 0.009695901 0.036549338 0.043044889

MIR-331-P 0.097557228 0.027971493 0.285186297 0.051885698 0.228247912 0.521268566

MIR-335 0.001043954 0.001386457 0.000729032

MIR-337 0.037751652 0.022216896 0.043250978 0.038542547 0.054823702 0.046272209

MIR-338 0.000773837 0.063324521 0.036599309 0.000418386

MIR-339 0.073799051 0.036187345 0.055842083 0.069319628 0.088011117 0.12692822

MIR-340 0.062018312 0.041251863 0.041818353 0.029906393 0.117032576 0.127060479

MIR-342 0.01350495 0.007849076 0.014434516 0.020664084 0.0403018 0.032895494

MIR-345 0.350543544 0.270729043 0.389454197 0.313538763 0.153215809 0.595157028

MIR-346 0.090088862 0.015340152 0.567170369 0.581581474 0.130991406 0.249313648

MIR-361 0.020562066 0.013229232 0.014924264 0.017117861 0.024979737 0.030476389

MIR-367 0.002762393 0.000297385 0.003626158 0.00432079

MIR-368 0.008678889 0.002211545 0.000533164

MIR-369 0.011705903 0.014161332

MIR-370 0.061321384 0.024106651 0.029574387 0.04990111 0.100154009 0.122309152

MIR-371 0.078235737 0.04891952 0.06485547 0.057243878 0.124162986 0.151275658

MIR-372 0.000571339 0.000329452 0.000385333 0.001134313 0.000248125 0.002027938

MIR-373 0.009413654 0.009162396 0.00822495 0.012185728 0.006167551 0.023381978

MIR-374-P 0.001585969 0.000821807

MIR-375 0.113815509 0.012963212 0.065761001 0.019541117 0.181389276 0.235983807

MIR-376 0.007708886 0.001442693 0.00042116 0.000414878 0.167537455 0.2948857

MIR-377 0.003676877 0.002957325 0.005718306 0.01205171 0.015430767 0.024634197

MIR-378 0.001544141 0.003236343 0.008925366 0.004419913 0.009333139 0.010166908

MIR-379 0.023621478 0.01855919 0.00534838 0.024262116 0.059573708 0.062262282

MIR-380 0.011458405 0.005951694 0.008073218 0.006201162 0.015381922 0.003542559

MIR-381 0.003291062 0.002320368 0.001581146 0.000445611 0.007160823 0.002066094

MIR-382 0.003515956 0.00153345 0.001235961 0.000448333 0.004727747 0.002053751

MIR-383 0.006798745 0.002960483 0.002885863 0.0046032 0.008793981 0.012559425

MIR-384 0.000510172 0.000186446

MIR-422b 0.021293355 0.012380952 0.032601396 0.036130655 0.037434027 0.053077152

MIR-423 0.015180115 0.01248593 0.015330011 0.012016893 0.008449895 0.025349617

Continued

157

Table A. continued

MIR-424 0.000655915 0.00138276 0.00039961 0.000268085 0.038575471 0.025073562

MIR-425 0.005043245 0.007785204

18S rRNA (CT) 7.0593355 7.1759525 7.066974 7.09703565 7.430182 8.0021922

Tissue Type Adjacent Benign

miRNAs OUP28 (B) OUP48 (B) OUP91 (B) OUP27 (B) OUP33 (B) OUP42 (B)

let-7a-1* 0.000234982 0.000164582

let-7a-2-P 0.08413606 0.043721617 0.037881836 0.321861154 0.070628189 0.07727867

let-7a-3* 0.008107015 0.004695749 0.009361647 0.011628666 0.000224623 0.005076983

let-7b* 0.0039822 0.005228008 0.006809922 0.034445095 0.001812017 0.01721141

let-7c* 0.000145887 0.00286499

let-7d* 0.008425529 0.013956868 0.014672678 0.083597892 0.013210459 0.019800505

let-7e* 0.001577992 0.001475721

let-7f-1* 0.015723526 0.027090448 0.041635734 0.117425844 0.007365754 0.04703942

let-7f-2* 0.002114508 0.003559086 0.003177816

let-7g* 0.005819238 0.005261778 0.011710622 0.048761062 0.003512886 0.010525949

let-7i* 0.048058871 0.005084697 0.008521305 0.007224064 0.019896356

MIR-001-1 0.012619793 0.002494582 0.002278975 0.00800549 0.00740626 0.005949032

MIR-001-2 0.065555906 0.002539466 0.0036048 0.061903482 0.056976879 0.003923197

MIR-007-1 0.014817954 0.013399478 0.006481258 0.026311383 0.017638105 0.005078746

MIR-007-2 0.004043715 0.000432792 0.003231624 0.004259125 0.00090441

MIR-007-3 0.212521554 0.198384961 0.404523822 0.850770178 0.119152689 0.233273943

MIR-009-1-P 0.276967782 0.075619943 0.061080305 0.077312895 0.295916679 0.134810995

MIR-009-2-P 0.156779308 0.081782307 0.028972552 0.064461111 0.211529667 0.09337794

MIR-009-3-P 0.001808542 0.001189292 0.002079533 0.001513423

MIR-010a,b 0.003091333 0.004893302 0.033574759 0.000295203

MIR-015a 0.027070532 0.011626463 0.004110325 0.047280361 0.02193097 0.004886728

MIR-015b 0.011300818 0.01484316 0.0686602 0.000186049 0.065753139

MIR-016-1 0.06533433 0.037405652 0.011899783 0.168712511 0.045605809 0.034755559

MIR-016-2 0.305141449 0.121720711 0.039833597 0.109591808 0.237746403 0.065151562

MIR-017-P 0.045966307 0.052137368 0.029531134 0.025978931 0.094595766 0.044719568

MIR-018 0.397378595 0.592319944 0.403941442 0.382361685 0.189655934 0.307391797

MIR-019a-P 0.070918659 0.105428847 0.059611338 0.059209557 0.016635539 0.072384598

MIR-019b-1-P 0.054198137 0.018827661 0.01244431 0.125487574 0.015128786

MIR-019b-2-P 0.000501627 0.000846554

MIR-020 0.000402039 0.000705469 0.000370353 0.000518267

MIR-021 3.922993838 3.365094616 3.227823223 11.79674446 1.651297909 2.252012085

MIR-022-P 0.019673918 0.036212487 0.024622304 0.051963192 0.115946439 0.053735249

MIR-023a 0.059530985 0.020981463 0.034731657 0.131601594 0.068897857 0.023021451

MIR-023b-P 0.084095538 0.079623719 0.033565247 0.106167041 0.160887196 0.063663998

MIR-024-1,2 3.509217989 2.809710656 2.701301307 6.696340409 4.346802115 3.804182791

MIR-025 0.035892832 0.010981383 0.014457046 0.090961627 0.019237164 0.023804845

MIR-026a-1,2 0.010089406 0.008074027 0.00606708 0.01501254 0.018548707 0.010727663

MIR-026b 0.19202061 0.099960302 0.084238997 0.078715517 0.163247683 0.095625359

MIR-027a, b 0.03166631 0.025928617 0.016429884 0.128196108 0.101167508 0.066751384

MIR-028 0.004084006 0.001063208 0.001473975 0.005803773 0.001906219 0.004740957

Continued

158

Table A. continued

MIR-029a,c 0.015314654 0.004782879 0.104714045 0.007100252 0.028025503

MIR-029b-1,2 0.000237819 0.000533374 0.000627306 0.000680682

MIR-030a,e 0.013500878 0.00714361 0.006099316 0.018799139 0.035800273 0.015091699

MIR-030b 0.102604511 0.057823994 0.067999199 0.095296258 0.096918267 0.104093152

MIR-030c-1,2 0.084763359 0.025625857 0.029109605 0.08391278 0.0280025 0.024250731

MIR-030d 0.000629274 0.008994885 0.008634738 0.028996616 0.023877911 0.008541855

MIR-031-P 0.309218828 0.131902706 0.110714 0.077957567 0.09198264 0.139425425

MIR-032 0.020608954 0.028395794 0.003922288 0.030303314 0.009475097 0.005815605

MIR-033 0.000220521 0.000527277 0.000727156

MIR-034a 0.024957679 0.014539687 0.001610452 0.048682375 0.053107279 0.012241037

MIR-034b 0.016092113 0.00132246 0.000597503 0.000946134 0.007038862 0.00072473

MIR-034c

MIR-092-1 0.000255167 0.002282102 0.004221994 0.001558821

MIR-092-2-P 0.025387419 0.002898233 0.00448304 0.010784472 0.011201901 0.005442254

MIR-093 0.06071983 0.017685172 0.004436942 0.012888399 0.034225286 0.054579692

MIR-095 0.006051509 0.002562215 0.000204695 0.020968528 0.004869382 0.00991631

MIR-096-P 0.779840275 0.124493349 0.216903926 0.111881536 0.793870955 0.528221551

MIR-098 0.83784546 0.41963199 0.239425392 1.672631188 0.579853727 0.664410634

MIR-099a 0.002226261 0.00306157 0.002911853 0.006143723 0.001031319 0.000712835

MIR-099b 0.108884694 0.094329483 0.070551256 0.162735778 0.112613947 0.0792654

MIR-100 0.095282665 0.027529354 0.022930348 0.384194792 0.030445365 0.027402372

MIR-101-1 0.003438277 0.00037762 0.000962309 0.001052697 0.002080896

MIR-101-2 0.168955834 0.154783551 0.346808117 0.14476722 0.089292228 0.109907411

MIR-103-1,2 0.294929506 0.227929185 0.152352974 0.365027704 0.252951802 0.355640509

MIR-105-1,2 0.03104887 0.029861492 0.010025584 0.008893589 0.077070626 0.036737253

MIR-106a-P 0.000796113 0.000331205 0.00121592 0.004037087 0.00345913 0.000291003

MIR-106b 0.077773343 0.029381494 0.047628917 0.10624953 0.040860266 0.0639964

MIR-107 0.365844904 0.206893406 0.192343245 1.063596452 0.267694596 0.41292311

MIR-108 0.018157628 0.011169745 0.002391069 0.001568711 0.040712706 0.01670109

MIR-122a 0.004642035 0.000196141 0.001944131 0.001203634

MIR-124a-1,2,3 0.008884637 0.001205011 0.000572846 0.00659248 0.004228399

MIR-125a 0.077360213 0.063626963 0.02803547 0.065445208 0.030932139 0.042160859

MIR-125b-1 0.078756842 0.010662363 0.009916564 0.230666015 0.020745646 0.024832014

MIR-125b-2 0.002370775 0.003722611 0.000243287 0.005118509 0.000501884

MIR-126 0.102293478 0.011745293 0.016270322 0.232877049 0.027331897 0.037173892

MIR-127 2.216024097 1.656945407 1.617585051 1.082989585 1.126158131 0.83118589

MIR-128a 0.028906577 0.011604668 0.008562469 0.03655326 0.015758788 0.027933401

MIR-128b 0.012189786 0.011882285 0.007685384 0.00596623 0.008038304 0.004625216

MIR-129-2 0.313967486 0.173418542 0.05710853 0.025112429 0.560911831 0.245182101

MIR-130a-P 0.40428962 0.143096676 0.060107218 0.04265066 0.436634012 0.204870912

MIR-130b 0.028034916 0.00558854 0.000374729 0.010806618 0.000745937

MIR-132 0.003088596 0.008384841 0.005825663 0.032162545 0.00081037 0.000807703

MIR-133a-1,2 0.045509863 0.021765222 0.015713736 0.125734622 0.042394265 0.02670025

MIR-133b 0.073986767 0.056522578 0.013035905 0.009255684 0.062635393 0.062626327

MIR-134 0.22107918 0.089114319 0.034670863 0.019632366 0.193212913 0.068271183

MIR-135a-1,2 0.029853483 0.026907759 0.00408374 0.023525976 0.008821905 0.00515723

Continued

159

Table A. continued

MIR-135b-P 0.011710744 0.000449021 0.008062137 0.006282678 0.017146339 0.001666304

MIR-136 0.012992898 0.00315236 0.019444508 0.028983394 0.011324643 0.004839458

MIR-137 0.004923941 0.000762835 0.010697556 0.001176041 0.002353161 0.000265256

MIR-138-1,2 0.000718863 0.001660083 0.000749769 0.002953181 0.001111941 0.003175957

MIR-139 0.119689921 0.043784334 0.040409269 0.006288985 0.121668062 0.060761659

MIR-140 0.000234661

MIR-141 0.031089281 0.017324218 0.017328728 0.006608451 0.017621022 0.004804847

MIR-142-P 0.210736785 0.026621858 0.010171153 0.060264945 0.021759775 0.064671419

MIR-143 0.010665412 0.009474773 0.008380111 0.032199461 0.003236343 0.010908009

MIR-144 0.00042125 0.000182078 0.000278555

MIR-145-P 0.061210505 0.019807959 0.017214213 0.490124228 0.027306456 0.035988046

MIR-146 0.000256347 0.000264944

MIR-147 0.02497475 0.009668864 0.002814281 0.001669416 0.045892586 0.024778816

MIR-148a-P 0.007124599 0.006653592 0.009418892 0.003325934 0.007954596 0.004778285

MIR-148b-P 0.042273183 0.006743095 0.017285176 0.093089604 0.064617105 0.045206955

MIR-149 0.132515275 0.166105594 0.053524494 0.018059921 0.246809173 0.144175814

MIR-150 0.040269282 0.02143109 0.010986583 0.095748014 0.049614493 0.030865641

MIR-151 0.012811605 0.01495816 0.002590492 0.001253338 0.014571502 0.008452156

MIR-152 0.010489612 0.013312184 0.000643859 0.022770052 0.004651357 0.00018941

MIR-153-1,2 0.006999621 0.011451057 0.020678761 0.01088628 0.017671311 0.00160908

MIR-154 0.000473873 0.010814262 0.042956584 0.054559846 0.000850523 0.019621213

MIR-155 0.00782965 0.003305353 0.000680438 0.209116219 0.00161709 0.001200658

MIR-181a,c 0.031671194 0.028904884 0.016081654 0.097962498 0.032485651 0.048816801

MIR-181b-1,2 0.003025911 0.00132746 0.002040976 0.00591001 0.008911676 0.001499668

MIR-182 0.231623906 0.140235992 0.141192667 0.031469223 0.172687782 0.143819337

MIR-183 0.007699829 0.008899463 0.001471681 0.00422692 0.010514973 0.016087992

MIR-184 0.131239651 0.084854829 0.001509601 0.019808252 0.115810496 0.05080015

MIR-185 0.6120577 0.350467257 0.283879597 0.506095436 0.537428196 0.365881422

MIR-186-P 0.392152056 0.186860634 0.263269641 0.643156559 0.476374442 0.365849596

MIR-187 0.005301438 0.000484393 0.000333395 0.008131597 0.005681169

MIR-188b-P 0.014227378 0.001181555 0.001280577 0.006393178 0.002498412

MIR-190 0.000151625 0.000233282 0.000280636

MIR-191 0.000558084 0.000465288 0.000249152

MIR-192 0.044483283 0.021902465 0.008314156 0.001383875 0.017967624 0.007758328

MIR-193 0.01844468 0.00329149 0.000616123 0.013183323 0.011183448 0.002291398

MIR-194-1,2 0.003320436 0.0006792 0.001073062 0.000821191 0.002687984 0.002336058

MIR-195-P 0.492637743 0.172730717 0.171225273 0.060741796 0.323705643 0.224219797

MIR-196a-1 0.004301889 0.007242847 0.000641151 0.005008573 0.02227901 0.018257184

MIR-196a-2 0.029827711 0.012476042 0.000687665 0.012590125 0.014437161 0.001411738

MIR-196b 0.048395579 0.015876383 0.008424198 0.046986866 0.038942503 0.010778488

MIR-197 0.25833653 0.078302331 0.077371233 0.073212833 0.275926977 0.134609121

MIR-198 0.008228191 0.000691307 0.000310343 0.013556254 0.000831424 0.000742233

MIR-199a-1-P 1.067870771 0.368490561 0.259500922 0.182511765 0.674776866 0.366588407

MIR-199a-2-P 0.033527555 0.006555216 0.007164407 0.16130291 0.024979933 0.039653598

MIR-199b-P 0.255282062 0.101079131 0.038226186 0.025767125 0.220654247 0.072754489

MIR-200a-P 4.703462067 2.384878171 1.777765542 0.657466991 5.951620014 3.004357655

Continued

160

Table A. continued

MIR-200b 0.072216788 0.190434275 0.031083937 0.003258583 0.181465717 0.049982663

MIR-200c 0.039647565 0.066019456 0.008855369 0.018427388 0.099660451 0.014937821

MIR-203 0.00406014 0.000479102 0.000983115

MIR-204 0.165458472 0.051715716 0.027832283 0.006131148 0.144945296 0.037148418

MIR-205 0.002896328 0.000585291 0.000207173 0.017841928 0.006921418 0.003178783

MIR-206 0.008818323 0.024298466 0.001241969 0.00072871 0.012548232 0.004020759

MIR-208 0.017574587 0.003567121 0.009921532 0.009112556 0.000879958

MIR-210 1.90050401 0.534722233 0.508250653 0.05847618 1.154804728 0.404474756

MIR-211 0.570812 0.292701404 0.153841866 0.129316061 0.593116709 0.273940707

MIR-212 0.132632898 0.082847161 0.124400791 0.578056481 0.069205496 0.062857494

MIR-213 0.030048975 0.011276828 0.01340049 0.047280738 0.029589998 0.007572391

MIR-214 0.258099557 0.07755317 0.110557597 0.089510974 0.158627567 0.113021102

MIR-215 0.009568285 0.007101194 0.006205621

MIR-216 0.107962865 0.104393086 0.088923656 0.001513805 0.07325771 0.074498752

MIR-217 0.00040942 0.001661952 0.000245461 0.000849568 0.000603338

MIR-218-1,2 0.05234393 0.004554355 0.013413198 0.057306153 0.010000916 0.006047498

MIR-219-1,2 0.005928826 0.001038774 0.001767721 0.009114754 0.01049447

MIR-220 0.006214304 0.005444088 0.000435066 0.009085524 0.005951004 0.002214173

MIR-221 0.045575682 0.011350838 0.002001654 0.055376008 0.01520112 0.000667747

MIR-222-P 0.016091996 0.008175902 0.001190568 0.019668917 0.00567379 0.000675161

MIR-223 0.002923861 0.00245088 0.000530116 0.003006313 0.003730473 0.001107651

MIR-224 0.043112576 0.014976456 0.013955886 0.00855908 0.032614593 0.014438904

MIR-296 0.01532531 0.004319816 0.002994118 0.048733693 0.028180781 0.009503203

MIR-299-P 0.078681325 0.054944774 0.003418628 0.010905762 0.117998949 0.050009087

MIR-301 0.014894015 0.029149846 0.002720049 0.054720316 0.027557903 0.023711744

MIR-302 0.003014402 0.001285655 0.004369301 0.014803005 0.006631148 0.001801872

MIR-302b 0.029120594 0.014553047 0.018129005 0.005290135 0.009473156 0.010280506

MIR-302c 0.01037688 0.001964958 0.000777434 0.001917303 0.006566469 0.005096544

MIR-302d 0.00483927 0.003929107 0.000257331 0.000770693 0.003552945 0.001754567

MIR-320 0.019564548 0.01396628 0.005496657 0.005817255 0.034933655 0.007863891

MIR-321 1.634714926 0.989010381 0.942101933 1.525698475 0.848276452 1.278434786

MIR-323 0.086797637 0.058084703 0.053378888 0.026394833 0.066951023 0.06927519

MIR-324-P 0.052501377 0.03753091 0.013700383 0.017316442 0.037078056 0.031599785

MIR-325 0.027058498 0.00847426 0.010734204 0.009581966 0.034536769 0.0164059

MIR-326-P 0.002971626 0.00247575 0.001537659 0.000482912 0.00297898 0.001623585

MIR-328 0.392702332 0.446743012 0.164869229 0.03598269 0.92444021 1.566199583

MIR-330 0.030269435 0.009721766 0.003750032 0.002039085 0.015856096 0.003701896

MIR-331-P 0.022495256 0.174547073 0.044244489 0.013797755 0.392531114 0.149622295

MIR-335 0.000464215 0.000294875

MIR-337 0.080553862 0.015869979 0.00096346 0.001705795 0.044751254 0.011896261

MIR-338 0.000598119 0.008156783 0.006396992 0.139155846 0.045999853

MIR-339 0.123387664 0.05465162 0.058363353 0.060271232 0.071044162 0.05604345

MIR-340 0.06950117 0.064959826 0.088047879 0.149203974 0.03361564 0.1144591

MIR-342 0.022062706 0.005099657 0.002649976 0.072531544 0.023778218 0.012693529

MIR-345 0.210104515 0.191396794 0.088861547 0.016947384 0.289629994 0.166878334

MIR-346 0.199630432 0.285835511 0.22105382 0.298317469 0.174906695 0.119635509

Continued

161

Table A. continued

MIR-361 0.029099871 0.011969806 0.01483849 0.014552788 0.030087383 0.015790116

MIR-367 0.006116846 0.002986056 0.00770823 0.001278695

MIR-368 0.000188323 0.005916756 0.002077999 0.000558584 0.00019956

MIR-369 0.00915447 0.0063059 0.00872308 0.01042334 0.013383739

MIR-370 0.043934987 0.06120535 0.059649571 0.084327639 0.037748769 0.045432439

MIR-371 0.125301281 0.03285388 0.005353871 0.006172574 0.126983629 0.034278792

MIR-372 0.000701899 0.002392081

MIR-373 0.014851918 0.008239669 0.000776753 0.000501465 0.015317641 0.004096831

MIR-374-P 0.000461169 0.002166815 0.000859515 0.002013852

MIR-375 0.161824457 0.104045687 0.171561361 0.003519514 0.071583774 0.120343704

MIR-376 0.070940562 0.102342307 0.144028734 0.385698214 0.058887467 0.120841681

MIR-377 0.008541343 0.002637997 0.009593727 0.015221854 0.034747366 0.003542248

MIR-378 0.005377037 0.001527965 0.002291028 0.000365252 0.019686459 0.002171276

MIR-379 0.008220296 0.054211926 0.066550835 0.102617122 0.00901298 0.063004604

MIR-380 0.015409059 0.008523006 0.029427838 0.001436367 0.010491524

MIR-381 0.000764528 0.001041043 0.000234227 0.003273774 0.003442245

MIR-382 0.001563587 0.00132686 0.004607718 0.002593456 0.004123975 0.002206109

MIR-383 0.008034253 0.009597698 0.001416751 0.00076871 0.011731058 0.001394468

MIR-384 0.000638454

MIR-422b 0.042041926 0.019073112 0.023588534 0.000355638 0.023065069 0.007148073

MIR-423 0.020461469 0.007385471 0.003011961 0.000931051 0.012388484 0.004602476

MIR-424 0.015747756 0.02244214 0.00022913 0.02186877 0.002311079 0.011818208

MIR-425 0.004937966 0.004139409

18S rRNA (CT) 7.288695 7.2963655 7.3134995 7.9507668 7.22896885 7.6139735


miRNAs OUP105 (B) OUP122 (B) OUP139 (B) OUP29(B) OUP49(B) OUP101(B)

let-7a-1* 0.002036074 0.003450972 0.005977055

let-7a-2-P 0.171442693 0.271995421 0.041441454 0.059309784 0.03991665 0.0373892

let-7a-3* 0.005822275 0.011321189 0.003395118 0.002460471 0.001943705 0.013502889

let-7b* 0.034222971 0.012946377 0.015466166 0.015948394 0.005586341 0.029624311

let-7c* 0.000671359 0.000450217 0.00053108 0.000608686

let-7d* 0.100665297 0.025669176 0.020641819 0.020184014 0.019825245 0.029853645

let-7e* 0.001469486 0.000861823

let-7f-1* 0.142972622 0.063836407 0.038071334 0.042773303 0.031752422 0.031526819

let-7f-2* 0.00293584 0.002239283 0.001844438 0.003533604

let-7g* 0.046798361 0.024640883 0.007943425 0.014480773 0.019393392 0.008377804

let-7i* 0.036662622 0.017135076 0.022833961 0.016913387

MIR-001-1 0.004958847 0.0001661 0.002190754 0.01204077 0.00045796 0.009270089

MIR-001-2 0.050465974 0.070586582 0.003562829 0.073032626 0.06957549 0.026205808

MIR-007-1 0.052003348 0.024267584 0.017542497 0.02222934 0.053522895 0.003160654

MIR-007-2 0.005175238 0.008434637 0.000779341 0.000793416 0.002347539 0.000301137

MIR-007-3 0.833719983 1.115347113 0.14052799 0.273927862 0.182279026 0.004832704

MIR-009-1-P 0.134446706 0.060378816 0.113434541 0.122419596 0.121941531 0.269762725

MIR-009-2-P 0.167261501 0.097165285 0.101194404 0.085711727 0.087539926 0.083538869

MIR-009-3-P 0.004037377 0.000179446 0.003604225 0.000417506

Continued

162

Table A. continued

MIR-010a,b 0.008907423 0.004366331 0.000205852 0.000409696 0.022055725

MIR-015a 0.014350366 0.03057341 0.006486835 0.014238485 0.015435339 0.016705841

MIR-015b 0.008878821 0.009736509 0.007673561 0.002112287 0.017943796 0.023917169

MIR-016-1 0.058628454 0.139459756 0.054333674 0.03133548 0.081828231 0.033140827

MIR-016-2 0.139998892 0.018137724 0.162999554 0.080853269 0.145360881 0.340954332

MIR-017-P 0.021996798 0.050395694 0.038492306 0.041174756 0.032552045 0.07303212

MIR-018 0.863942271 0.829451062 0.181720542 0.315043821 0.407389999 0.081603504

MIR-019a-P 0.126659818 0.059801616 0.053923518 0.065642087 0.022363014 0.038385797

MIR-019b-1-P 0.012807377 0.007224464 0.024924285 0.032861165 0.006048638 0.017852921

MIR-019b-2-P 0.00039806

MIR-020 0.000735194 0.00738248 0.000673233 0.000191459 0.001694727 0.00040318

MIR-021 11.41062428 17.49711634 0.710014267 1.841671078 8.281381564 0.580710256

MIR-022-P 0.074296616 0.112934663 0.032338441 0.032673151 0.014816192 0.074062801

MIR-023a 0.143565133 0.178679901 0.026684317 0.059395087 0.034245292 0.053596289

MIR-023b-P 0.137688485 0.075503575 0.104605848 0.058129948 0.011766993 0.148822382

MIR-024-1,2 6.061510365 8.819499397 2.586544333 3.085846757 2.973793498 1.789123428

MIR-025 0.079524341 0.032275623 0.017101799 0.011242997 0.0122648 0.020627588

MIR-026a-1,2 0.006972902 0.022133889 0.014824789 0.008222472 0.02057332 0.005486999

MIR-026b 0.106487598 0.041007689 0.126855583 0.106156964 0.128376004 0.1483895

MIR-027a, b 0.099868625 0.248310258 0.040927105 0.033746844 0.03978576 0.073597033

MIR-028 0.004212822 0.004134382 0.000885828 0.002317432 0.001789441 0.001631792

MIR-029a,c 0.072507011 0.12539383 0.00055959 0.002499034 0.036865751 0.004236411

MIR-029b-1,2 0.0004825 0.000227837 0.000332737 0.000438608 0.00035349

MIR-030a,e 0.012676992 0.017232308 0.010349837 0.026180545 0.026286584 0.049497618

MIR-030b 0.08675227 0.065113354 0.044868505 0.072402806 0.062383507 0.028530432

MIR-030c-1,2 0.05395808 0.046819465 0.030936492 0.021233447 0.044577993 0.01898766

MIR-030d 0.009111071 0.027173068 0.017276035 0.00751518 0.00466896 0.02339306

MIR-031-P 0.177638207 0.079189023 0.137546985 0.157096878 0.133362778 0.137182696

MIR-032 0.038293645 0.031802396 0.02579764 0.031319346 0.020035301 0.030698148

MIR-033 0.000226292 0.00037556 0.000268967 0.001281948

MIR-034a 0.026388393 0.019198052 0.014307143 0.013880409 0.012774224 0.002883053

MIR-034b 0.001978356 0.000367248 0.003202699 0.001360882 0.000767622 0.004085926

MIR-034c

MIR-092-1 0.003350196 0.004855447 0.001256448

MIR-092-2-P 0.001062677 0.005118988 0.007529355 0.002016076 0.001410371 0.013147952

MIR-093 0.065061835 0.02208181 0.012338928 0.006579795 0.024184415 0.014505315

MIR-095 0.012980536 0.010569436 0.003325673 0.003332236 0.001801792 0.011950369

MIR-096-P 0.289410731 0.062771642 0.454660135 0.457445228 0.538086669 0.307379087

MIR-098 1.854886382 1.719247526 0.52460553 0.532373225 0.90276192 0.370778866

MIR-099a 0.00842044 0.010464631 0.004092118 0.012038921 0.004242218 0.005254097

MIR-099b 0.198619176 0.288660432 0.108264219 0.360399251 0.304262401 0.229880886

MIR-100 0.194540821 0.365647846 0.030455739 0.048996718 0.059078744 0.009407603

MIR-101-1 0.004468616 0.002071022 0.000813845 0.000600037 0.000311706 0.003589417

MIR-101-2 0.137637531 0.097090959 0.03202479 0.065109322 0.098992084 0.11285032

MIR-103-1,2 0.635003223 0.504839524 0.161954832 0.240952541 0.855815652 0.119736833

MIR-105-1,2 0.006915229 0.005985592 0.02664507 0.026595517 0.009716743 0.04703591

Continued

163

Table A. continued

MIR-106a-P 0.001869572 0.001034073 0.001365182 0.000648165 0.00068566

MIR-106b 0.151382078 0.123441146 0.038005958 0.067512662 0.15699271 0.031692185

MIR-107 0.849026106 1.000927701 0.201687408 0.270442898 1.250803334 0.097332061

MIR-108 0.022524616 0.012384018 0.00882707 0.014676039 0.010268555 0.032439759

MIR-122a 0.00410661 0.000117169 0.003006461 0.000874917 0.001824824

MIR-124a-1,2,3 0.00118559 0.00099952 0.00114563 0.006629864

MIR-125a 0.059035122 0.057205821 0.020948125 0.070753554 0.025069647 0.138175134

MIR-125b-1 0.212750263 0.653496887 0.029321636 0.036891862 0.006024885 0.014074963

MIR-125b-2 0.009814142 0.004275673 0.00231327 0.005253252 0.010791378 0.000616116

MIR-126 0.212553632 0.179647874 0.053214968 0.049590254 0.085211766 0.018958044

MIR-127 1.580111997 0.804091882 2.806568787 1.726232656 1.829027757 1.874928941

MIR-128a 0.078699093 0.049085689 0.023713089 0.023060761 0.03865002 0.034235346

MIR-128b 0.007774784 0.002056656 0.011013169 0.00801294 0.009642236 0.004853733

MIR-129-2 0.148825054 0.048189838 0.190066532 0.201090582 0.17273316 0.198988908

MIR-130a-P 0.118573155 0.032977247 0.17259211 0.221321486 0.136246821 0.223315906

MIR-130b 0.002067666 0.005265759 0.002967465 0.010841299 0.002119046 0.006357183

MIR-132 0.022289334 0.139400367 0.001605969 0.016497771 0.000713527

MIR-133a-1,2 0.048650816 0.015192017 0.026170729 0.043770113 0.033140897 0.027355418

MIR-133b 0.012227238 0.004156224 0.046629909 0.05811623 0.041400528 0.03691949

MIR-134 0.11129609 0.071201319 0.105675176 0.076795944 0.05727028 0.116529725

MIR-135a-1,2 0.047675035 0.110184735 0.003295847 0.013291686 0.046775665 0.000967633

MIR-135b-P 0.00223109 0.001077774 0.003528515 0.005737872 0.00987869 0.005730525

MIR-136 0.031321949 0.046587566 0.005894705 0.00387682 0.002493754 0.016141936

MIR-137 0.002091926 0.000873836 0.000987531 0.001641519 0.00455792 0.00225232

MIR-138-1,2 0.000261425 0.000176663 0.002243003 0.000862323 0.000912428 0.002025076

MIR-139 0.023772341 0.007196872 0.062234157 0.115061367 0.095064564 0.103355704

MIR-140 0.000167232

MIR-141 0.009618155 0.009466634 0.011467498 0.015464295 0.016372018 0.006790775

MIR-142-P 0.039220883 0.023985682 0.0859142 0.045270166 0.033048073 0.119431344

MIR-143 0.022120163 0.041179932 0.007770615 0.013418144 0.059485216 0.006969916

MIR-144 0.000166561 0.000211268

MIR-145-P 0.466023728 0.327857606 0.021918235 0.049873592 0.513378566 0.024421607

MIR-146 0.000411582 0.000295193 0.00024814 0.000453244

MIR-147 0.024019065 0.00789972 0.00916992 0.007857938 0.003014966 0.012075296

MIR-148a-P 0.005289774 0.00262788 0.009238757 0.013823655 0.008645337 0.005668697

MIR-148b-P 0.108909961 0.036040423 0.058186727 0.050351233 0.016842685 0.039522621

MIR-149 0.086928516 0.014751876 0.10008852 0.065855736 0.064803901 0.122870154

MIR-150 0.035257765 0.044970782 0.013524245 0.01911125 0.040557779 0.009163173

MIR-151 0.001502221 0.00077307 0.010963144 0.004838186 0.006287782 0.006666998

MIR-152 0.034286319 0.010969406 0.017066789 0.003675564 0.013946964 0.000363235

MIR-153-1,2 0.000919004 0.009606747 0.017836767 0.012194694 0.00483984 0.008528321

MIR-154 0.067320132 0.022274012 0.009956041 0.015287597 0.009191066 0.046768417

MIR-155 0.077038308 0.106141428 0.009407303 0.007075424 0.036898819

MIR-181a,c 0.079996174 0.077614756 0.007461971 0.038300523 0.066369259 0.018223267

MIR-181b-1,2 0.008946982 0.011017054 0.002067445 0.007418372 0.010369003

MIR-182 0.100757338 0.055598442 0.07960848 0.237692192 0.073684295 0.058844583

Continued

164

Table A. continued

MIR-183 0.008979481 0.004047088 0.001348589 0.004340321 0.000263908 0.000497427

MIR-184 0.05051926 0.044330218 0.072557946 0.050761004 0.03901425 0.108419895

MIR-185 0.633710937 0.294187381 0.645035255 0.527134645 0.551639041 0.385112116

MIR-186-P 0.935706071 0.446803926 0.303885116 0.462042805 0.469631951 0.309301111

MIR-187 0.007270467 0.000225482 0.001157761 0.018903162 0.000410903 0.000914804

MIR-188b-P 0.000724496 0.00039633 0.000844523 0.001944489 0.000759956 0.004218657

MIR-190 0.00016077 0.000644722 0.000392073

MIR-191 0.000778864 0.000556995 0.000542173 0.014965024

MIR-192 0.006696026 0.002958968 0.011764676 0.024988808 0.012608168 0.005743996

MIR-193 0.01589906 0.009701276 0.002605877 0.000346507 0.012174915 0.003679046

MIR-194-1,2 0.001023204 0.000168363 0.001232811 0.000836408 0.001864715 0.000584266

MIR-195-P 0.20080002 0.091912779 0.176476797 0.274802383 0.19269873 0.318727282

MIR-196a-1 0.00075266 0.00602119 0.025502269 0.005256543 0.004501955 0.008737234

MIR-196a-2 0.020158999 0.016142438 0.005548917 0.018756903 0.004827768 0.004313703

MIR-196b 0.004148833 0.020908049 0.012660226 0.006458653 0.011279579 0.027315363

MIR-197 0.128289662 0.081209976 0.115599288 0.174571254 0.232768779 0.190387929

MIR-198 0.011877079 0.010301322 0.003112217 0.001372084 0.002911026 0.001698491

MIR-199a-1-P 0.490659235 0.057050695 0.735557954 1.05119143 0.879916463 2.030860887

MIR-199a-2-P 0.162976439 0.052733051 0.0281056 0.013863914 0.009744109 0.032226547

MIR-199b-P 0.073831169 0.028130232 0.099536152 0.10838026 0.09472772 0.142055433

MIR-200a-P 2.224986094 0.61231578 3.024940823 2.167233981 3.167045226 1.844070637

MIR-200b 0.00763465 0.007354512 0.072845033 0.058596423 0.021555607 0.059740906

MIR-200c 0.010965055 0.005957201 0.016358887 0.006783925 0.000252496 0.03293596

MIR-203 0.000322681 0.000279717 0.000554647

MIR-204 0.015467586 0.009911398 0.064307638 0.076332641 0.038022204 0.061313812

MIR-205 0.000824276 0.000206456 0.000561284 0.003656465 0.000804026 0.002872373

MIR-206 0.001280679 0.00361721 0.010987957 0.005991716 0.005113015 0.028726488

MIR-208 0.004187299 0.001000292 0.001682885 0.001433102 0.009417615 0.010745176

MIR-210 0.11420006 0.070357609 0.437976516 0.363063529 0.212747999 0.614282172

MIR-211 0.167179727 0.133986659 0.241419969 0.284634791 0.117382844 0.391738932

MIR-212 0.607649507 2.227095262 0.029085722 0.052035947 0.076748479 0.016447481

MIR-213 0.038917917 0.051476482 0.00749061 0.014536648 0.031619798 0.012966522

MIR-214 0.10280425 0.031914686 0.120174351 0.117618542 0.102636798 0.158354846

MIR-215 0.006677625 0.008058862 0.000140962 0.013605591 0.028699979 0.001628544

MIR-216 0.044542113 0.00181394 0.129891274 0.088193089 0.018426367 0.342708984

MIR-217 0.000519976 0.000379363 0.003348429 0.000820813 0.000783614

MIR-218-1,2 0.023693782 0.084363501 0.015582331 0.01008886 0.02302267 0.003839183

MIR-219-1,2 0.002019892 0.016415719 0.007952686 0.008569094 0.008980708 0.00027338

MIR-220 0.002382353 0.004243432 0.003798587 0.005317768 0.000525515 0.001328607

MIR-221 0.045363486 0.206668765 0.00234579 0.010829076 0.048879471 0.001251769

MIR-222-P 0.003004928 0.088710659 0.002082103 0.005599045 0.000902771 0.007808702

MIR-223 0.002536158 0.005514143 0.000849194 0.000363298 0.002199216 0.002855262

MIR-224 0.02191821 0.02538591 0.028971344 0.068689335 0.060831356 0.057696432

MIR-296 0.00089422 0.000193964 0.001173404 0.032340312 0.006783403 0.096706483

MIR-299-P 0.028004798 0.007496133 0.02124658 0.039260692 0.06252084 0.052699932

MIR-301 0.039358194 0.03021299 0.000914754 0.03120901 0.025459837 0.00122564

Continued

165

Table A. continued

MIR-302 0.000438643 0.000743334 0.000550085 0.00239683 0.012472072 0.00166151

MIR-302b 0.009215929 0.006770132 0.01302563 0.01354319 0.017943094 0.023260742

MIR-302c 0.000538611 0.00268758 0.005115213 0.012038796 0.004563745 0.004448112

MIR-302d 0.001196595 0.000598 0.001447207 0.003459445 0.001136237 0.003239474

MIR-320 0.010573108 0.004776736 0.012614514 0.007403522 0.012559214 0.018312549

MIR-321 2.529263454 2.614628126 1.53730766 0.538865609 0.824102944 2.33561409

MIR-323 0.084757733 0.161079943 0.056647532 0.053255688 0.007384009 0.062183512

MIR-324-P 0.027382924 0.020772034 0.032597009 0.029904552 0.042127072 0.030508032

MIR-325 0.023730673 0.008489088 0.018331256 0.004664147 0.006476886 0.010704524

MIR-326-P 0.001163984 0.000345657 0.000807971 0.004226001 0.000790603 0.00441383

MIR-328 0.094916935 0.023315615 0.376005174 0.368961815 0.058289162 0.108346685

MIR-330 0.011098298 0.001304801 0.004215824 0.002236816 0.010305098 0.009432601

MIR-331-P 0.017249189 0.016156329 0.043577309 0.1404588 0.00454517 0.194754412

MIR-335 0.000714167 0.005257783 0.000672328 0.001290817

MIR-337 0.009655227 0.011671912 0.013385751 0.021223155 0.004854431 0.014204156

MIR-338 0.022085623 0.003777932 0.043793587 0.03686966 0.012337565 0.052496768

MIR-339 0.063598622 0.023829686 0.071011349 0.326150426 0.282321806 0.441632858

MIR-340 0.219196827 0.19207162 0.095976926 0.07959692 0.061918742 0.064557227

MIR-342 0.016094274 0.019453031 0.008519163 0.022949578 0.023347518 0.010823815

MIR-345 0.052473209 0.01913323 0.673656907 0.139146056 0.078091264 0.363043523

MIR-346 0.131372418 0.055734377 0.187011633 1.702067697 1.720500092 0.966097981

MIR-361 0.026527432 0.008025018 0.014664096 0.019732772 0.0191621 0.031629782

MIR-367 0.017411313 0.003441667 0.01419365 0.008290518

MIR-368 0.005919593 0.019300075 0.004895244 0.001663394

MIR-369 0.015298408 0.022314592 0.010494316

MIR-370 0.207743295 0.353701752 0.047575427 0.068266775 0.008909545 0.074734641

MIR-371 0.015295969 0.004654935 0.049514965 0.033780428 0.029479012 0.036412155

MIR-372 0.001488946 0.000276836

MIR-373 0.007286965 0.005215133 0.00493249 0.006754358 0.004468675 0.015911779

MIR-374-P 0.001586066 0.00065878 0.000329356 0.000411191

MIR-375 0.018845107 0.012796072 0.079823338 0.076721776 0.010241788 0.054882401

MIR-376 0.684268206 0.96146135 0.103764864 0.093991064 0.065889938 0.132299583

MIR-377 0.061988131 0.037628883 0.007205174 0.006368867 0.001786016 0.01837233

MIR-378 0.001222423 0.000900602 0.002548353 0.002219935 0.003549328 0.003510605

MIR-379 0.215938115 0.423991066 0.029022275 0.028653862 0.005718092 0.017189929

MIR-380 0.019415953 0.097228783 0.003817961 0.017182055 0.025984398

MIR-381 0.001494169 0.000508724 0.000776632

MIR-382 0.001797466 0.017487875 0.002343918 0.005644862 0.000321918 0.001972611

MIR-383 0.00187283 0.000543504 0.003751125 0.003483109 0.00289563 0.005342967

MIR-384 0.000370038 0.00091871

MIR-422b 0.003091468 0.00114528 0.004550325 0.012206081 0.011444339 0.004703813

MIR-423 0.004722377 0.001345595 0.016782389 0.002335283 0.003845286 0.004210295

MIR-424 0.079727421 0.068436096 0.009423116 0.001933843 0.00518589

MIR-425 0.005968921 0.003859785 0.005535466

18S rRNA (CT) 7.79091525 6.9697087 7.26284335 7.50819785 7.5580864 7.96171685

Continued

166

Table A. continued


Pancreatic Tumor

miRNAs 1050005B1(B) OUP2 (T) OUP14 (T) OUP16 (T) OUP20 (T) OUP28 (T)

let-7a-1* 0.001423629 0.000594958 0.000654234

let-7a-2-P 0.070348517 0.41475642 0.054388235 0.153671717 0.273395304 0.069215121

let-7a-3* 0.003195853 0.034800063 0.005204295 0.014361603 0.01200169 0.019794612

let-7b* 0.00973822 0.042247981 0.003221621 0.031400744 0.031384942 0.020265373

let-7c* 0.000310178 0.00149755 0.000284694 0.000326848 0.000723875 0.000183141

let-7d* 0.025884968 0.110129259 0.01759205 0.029142018 0.086463669 0.015816548

let-7e* 0.001361318 0.001234311 0.002509369

let-7f-1* 0.045191064 0.156129409 0.040443185 0.040201233 0.109517959 0.008588948

let-7f-2* 0.006048117 0.003416149 0.002539039 0.003217479

let-7g* 0.025027939 0.066040288 0.016596541 0.032628106 0.058961064 0.016901927

let-7i* 0.017535353 0.066659103 0.020771129 0.039947017 0.081398858 0.076358103

MIR-001-1 0.002811673 0.000108908 0.005656477 0.000213749 0.017297908 0.000274362

MIR-001-2 0.098096184 0.101109623 0.076408498 0.087032501 0.093526718 0.024111665

MIR-007-1 0.008814753 0.021169709 0.023474633 0.019440883 0.013064094 0.027358825

MIR-007-2 0.008383578 0.008165377 9.73217E-05 0.017088038 0.002281971 0.005971564

MIR-007-3 0.133564112 1.379062383 0.259782278 2.40610578 1.68836856 0.098712498

MIR-009-1-P 0.122060755 0.047504211 0.026638662 0.049903111 0.034224989 0.044998464

MIR-009-2-P 0.098047205 0.032441216 0.01455807 0.025395674 0.040686271 0.036625051

MIR-009-3-P 0.000285954 0.000264532 0.000786932 0.00059768

MIR-010a,b 0.000925525 0.073408464 0.012636642 0.017514924 0.032294658 0.031635618

MIR-015a 0.003139291 0.025435173 0.008587057 0.042420475 0.051521356 0.007613352

MIR-015b 0.037206199 0.084688725 0.023812492 0.052495318 0.100748437 0.035067565

MIR-016-1 0.019114984 0.270849479 0.08842511 0.133920068 0.32799219 0.11675353

MIR-016-2 0.139145516 0.025521151 0.020283338 0.095239877 0.067542639 0.059259287

MIR-017-P 0.044288143 0.027135856 0.003290477 0.014054209 0.014257777 0.004727934

MIR-018 0.449438718 0.978574246 0.577999808 0.389764357 1.537229289 0.663102854

MIR-019a-P 0.026767641 0.029440025 0.001385299 0.026498657 0.007963914 0.060079352

MIR-019b-1-P 0.008297876 0.000633804 0.000303771 0.011387103 0.001855173 0.001145669

MIR-019b-2-P 0.000299944

MIR-020 0.000326171 0.000174797 0.000776441 0.000523797 0.000728277 0.000318034

MIR-021 3.32085175 33.03194965 20.00060754 24.40019157 49.81759151 21.54238488

MIR-022-P 0.032683206 0.056601564 0.002437109 0.042205024 0.015249004 0.011769718

MIR-023a 0.017375741 0.170334458 0.093003635 0.092513266 0.061500134 0.117316071

MIR-023b-P 0.02561225 0.200593216 0.009025818 0.084612145 0.042366254 0.056902706

MIR-024-1,2 1.6222974 14.4739142 2.232703103 6.045809702 15.82213487 4.468922635

MIR-025 0.05853855 0.095042969 0.033293213 0.031330619 0.073565893 0.028544064

MIR-026a-1,2 0.004259835 0.028838586 0.0079225 0.007713646 0.010445725 0.023549489

MIR-026b 0.17143889 0.021161867 0.026445186 0.087311958 0.026206434 0.088677602

MIR-027a, b 0.021581865 0.159556105 0.082599589 0.077883205 0.110975943 0.032486668

MIR-028 0.002795153 0.004105197 0.00126089 0.012541694 0.006013315 0.002775389

MIR-029a,c 0.018200108 0.090071327 0.006956831 0.040700027 0.032580722 0.041813817

MIR-029b-1,2

MIR-030a,e 0.020627751 0.01895925 0.004099504 0.022583025 0.006508866 0.034690695

MIR-030b 0.050257625 0.143950801 0.054403581 0.0789416 0.1647504 0.077281777

Continued

167

Table A. continued

MIR-030c-1,2 0.023641384 0.080363584 0.00929344 0.011671583 0.094145691 0.033005415

MIR-030d 0.003100896 0.014624886 0.003271975 0.012337326 0.011237784 0.000267971

MIR-031-P 0.202680377 0.020485085 0.022983048 0.079666145 0.042430879 0.068590571

MIR-032 0.040828003 0.02452186 0.010487797 0.036083837 0.039026445 0.071635999

MIR-033 0.000247156

MIR-034a 0.036099179 0.055252257 0.018020563 0.029261328 0.073340269 0.018140224

MIR-034b 0.001742753 0.000234882 0.001279748 0.000336393 0.000798177 0.000276005

MIR-034c

MIR-092-1 0.000482094 0.001916867 0.00453689

MIR-092-2-P 0.001097092 0.001143311 0.000537272 0.000366962

MIR-093 0.025100185 0.038220639 0.028757148 0.011517262 0.03514242 0.042088053

MIR-095 0.006630502 0.011968127 0.002042306 0.013679393 0.027287752 0.016018741

MIR-096-P 0.82492526 0.054086439 0.052680813 0.067317671 0.053692127 0.053018129

MIR-098 0.864319922 1.989325314 0.710710747 0.726886527 2.311994345 1.287634886

MIR-099a 0.001502566 0.013021101 0.002561091 0.013732504 0.016380473 0.009978862

MIR-099b 0.287747903 0.273889473 0.166356532 0.196485066 0.44922352 0.219059482

MIR-100 0.007726843 1.045013601 0.184805413 0.550541632 0.850119978 0.260610221

MIR-101-1 0.000574251 0.000114148 0.000603556 0.002618999 0.000506199

MIR-101-2 0.053282952 0.114554316 0.052932108 0.074149644 0.091755781 0.054819446

MIR-103-1,2 1.041487713 1.142245073 0.640659155 0.606960724 1.089584714 0.453651731

MIR-105-1,2 0.008822458 0.000253703 0.001499894 0.002588451 0.001859081 0.00510165

MIR-106a-P 0.001913151 0.0010251 0.000257802

MIR-106b 0.154871472 0.377205919 0.331988672 0.127712361 0.403460228 0.130109352

MIR-107 1.246659797 2.014763806 1.058910326 1.266147138 2.079282626 1.014989336

MIR-108 0.0126535 0.000602809 0.006769328 0.004133766 0.00010351 0.000988227

MIR-122a

MIR-124a-1,2,3 0.008766206 0.000679315 0.000866019 0.011991408 0.007437836

MIR-125a 0.02132425 0.103826759 0.032821305 0.090736421 0.131816454 0.080511354

MIR-125b-1 0.00339042 0.436484467 0.048809251 0.362610491 0.333609984 0.086095585

MIR-125b-2 0.006943558 0.028819242 0.000857125 0.030752587 0.00265846 0.009407536

MIR-126 0.073632491 0.406998031 0.062798914 0.450461768 0.472090831 0.17547502

MIR-127 1.491380951 0.369918721 0.344945159 1.547889054 0.322749411 1.650171614

MIR-128a 0.068899357 0.068079215 0.033367651 0.022981505 0.129549008 0.023501148

MIR-128b 0.003559303 0.000823473 0.001592361 0.007884708 0.002342978 0.004101107

MIR-129-2 0.165441299 0.019140857 0.010305594 0.028149685 0.009116937 0.019040459

MIR-130a-P 0.158091677 0.015114051 0.013109486 0.046471969 0.023445248 0.017381827

MIR-130b 0.005957265 0.003137524 0.006230894 0.008432719 0.004700242 0.000470127

MIR-132 0.039175004 0.005173848 0.043977414 0.027373436 0.00887761

MIR-133a-1,2 0.029254763 0.004488091 0.012952603 0.012135241 0.006477363 0.007122044

MIR-133b 0.028256769 0.00455372 0.001958075 0.002333041 0.002116244 0.00247161

MIR-134 0.083809252 0.027093202 0.015784528 0.073104426 0.069236825 0.024672634

MIR-135a-1,2 0.015335477 0.021934912 0.013030714 0.016963652 0.014889136 0.016643487

MIR-135b-P 0.006577668 0.074539927 0.00866846 0.000924352 0.014142308 0.021576618

MIR-136 0.002986287 0.114399228 0.010742327 0.088190225 0.034812322 0.005343529

MIR-137 0.001205778 0.007247988 0.002720449 0.00151674 0.06091669 0.001017882

MIR-138-1,2 0.000732259 0.00065052 0.000227073 0.001188417 0.002637915

Continued

168

Table A. continued

MIR-140 0.000162007 0.000353196 0.000498704

MIR-141 0.008248353 0.018631275 0.024406858 0.008700389 0.012734621 0.022307553

MIR-142-P 0.055352156 0.002938322 0.006623013 0.019342145 0.006219485 0.021121975

MIR-143 0.017013035 0.043010649 0.043236136 0.04795525 0.076879532 0.062566862

MIR-144 0.000170108 0.000327711 0.000218607

MIR-145-P 0.01914608 0.281342658 0.050788509 0.413330454 0.328809838 0.254115022

MIR-146 0.000508526 0.000452192

MIR-147 0.018011839 0.004491567 0.001033817 0.009479696 0.003437581

MIR-148a-P 0.003418715 0.001012706 0.001944396 0.002573135 0.00065437 0.00791107

MIR-148b-P 0.029661088 0.061098498 0.001217379 0.027829997 0.028425605 0.017861903

MIR-149 0.028928239 0.009460841 0.007895842 0.011829407 0.013594815 0.024331137

MIR-150 0.0221614 0.014447636 0.017992356 0.031936844 0.01247748 0.025761628

MIR-151 0.017515164 0.000530026 0.003151417 0.00232387 0.000460497 0.003200594

MIR-152 0.003047563 0.059223363 0.022734395 0.012827916 0.07522262 0.019393084

MIR-153-1,2 0.00310781 0.020732117 0.021598388 0.008297029 0.011625257 0.003217185

MIR-154 0.000790577 0.041700015 0.008057877 0.059609954 0.081907244 0.014092766

MIR-155 0.078521134 0.127762311 0.035422981 0.14405709 0.139463826 0.0821331

MIR-181a,c 0.073427858 0.529327025 0.069205256 0.06624044 0.228176065 0.105751576

MIR-181b-1,2 0.005278691 0.002931564 0.000324859 0.001868653 0.002983088 0.009558584

MIR-182 0.032742625 0.399783329 0.428272195 0.021532626 0.452498956 0.084079685

MIR-183 0.038885544 0.0221167 0.017430882 0.012374033

MIR-184 0.080126197 0.012232056 0.003025155 0.013648456 0.013686699 0.010320249

MIR-185 0.495805204 0.103222202 0.146215881 0.422300122 0.116697282 0.463699016

MIR-186-P 0.382627327 0.52261003 0.119684059 0.303578509 0.220727053 0.377130195

MIR-187 0.002138727 0.000152959 0.00011883

MIR-188b-P 0.000377317 0.000284233 0.000362888 0.000777692 0.000320542

MIR-190

MIR-191 0.000183643

MIR-192 0.010704998 0.000425292 0.000163171 0.00169449

MIR-193 0.001189316 0.007645713 0.000235521 0.005407178 0.02016257 0.00362276

MIR-194-1,2 0.000284146 0.000266272 0.002080237 0.00064955 0.000189386 0.001433465

MIR-195-P 0.231352296 0.024622861 0.02819055 0.067335008 0.029055626 0.073685092

MIR-196a-1 0.007635185 0.00609675 0.031358327 0.007436588 0.006898141 0.01124891

MIR-196a-2 0.0206613 0.007366368 0.003963594 0.035846264 0.004984437 0.008691706

MIR-196b 0.00777359 0.222707758 0.432932622 0.028887248 0.180595502 0.130427507

MIR-197 0.315556625 0.045423706 0.011730025 0.034968096 0.028799845 0.080224103

MIR-198 0.023011643 0.000639717 0.001968135 0.001184933 0.00259598

MIR-199a-1-P 0.744604283 0.014404249 0.092822085 0.320494959 0.00765696 0.217100442

MIR-199a-2-P 0.008845125 0.043923969 0.005639766 0.065001646 0.022967424 0.033399182

MIR-199b-P 0.086970342 0.02069062 0.021915986 0.027048616 0.01322923 0.029196456

MIR-200a-P 4.280903514 0.178786997 0.226108153 0.419195481 0.225827075 0.526664663

MIR-200b 0.02990711 0.053776707 0.070716879 0.011251862 0.042175833 0.007332864

MIR-200c 0.001475001 0.000135777 0.000144547 0.004377857

MIR-203 0.00034598 0.004857104 0.004901797 0.000404506

MIR-204 0.053025195 0.002795896 0.002823991 0.009749366 0.00473756 0.003819462

MIR-205 0.000773773 0.000606239 0.012370112 0.00234449

Continued

169

Table A. continued

MIR-206 0.001984982 0.015136997 0.002018393

MIR-208 0.002603413 0.001226127 0.009615127 0.010792376

MIR-210 0.166658906 0.113925864 0.419966577 0.058884534 0.127703801 0.05291181

MIR-211 0.13028716 0.029213565 0.021780259 0.171086588 0.05940894 0.085007537

MIR-212 0.024943873 0.963572563 0.106369277 0.686635365 0.538302626 0.105167152

MIR-213 0.011435187 0.200780591 0.014729895 0.062404054 0.125496442 0.019430961

MIR-214 0.119638764 0.009174687 0.017236915 0.070371475 0.0179198 0.057123951

MIR-215 0.04486903 0.004663094 0.009870688 0.006479021 0.004399442 0.013177893

MIR-216 0.015583988 0.004792052 0.0011552 0.002476852 0.000632454 0.016206581

MIR-217 0.000193888 0.000336781

MIR-218-1,2 0.008193751 0.300640801 0.037268948 0.103573804 0.104541949 0.117272209

MIR-219-1,2 0.002966792 0.00259582 0.003897984 0.001079005 0.009428942

MIR-220 0.001172217 0.000132585 0.000299487 0.001936894 0.004598896 0.005858608

MIR-221 0.031372098 0.073490329 0.034905034 0.060384562 0.087033545 0.067769788

MIR-222-P 0.000281751 0.020685444 0.001332613 0.011253941 0.035167751 0.011913586

MIR-223 0.000359368 0.001212042 0.000286561 0.000341708 0.003150087 0.001435801

MIR-224 0.058444166 0.074824016 0.026717159 0.013940847 0.070294707 0.043150769

MIR-296 0.009403023 0.002735499 0.001492529 0.000268309 0.015296086 0.000389812

MIR-299-P 0.042670322 0.002600696 0.001867947 0.000718676 0.000187316 0.008094348

MIR-301 0.022523664 0.087728549 0.01676406 0.030743369 0.102489099 0.061407453

MIR-302 0.009143792 0.016078573 0.011714636 0.012898931 0.00770312

MIR-302b 0.016169275 0.001778454 0.00455068 0.010732296 0.003238623 0.01810689

MIR-302c 0.01321861 0.001064876 0.001301286 0.000354531 0.004456342

MIR-302d 0.000685746 0.000747311 0.000296246 0.001801801

MIR-320 0.010840314 0.006055577 0.004623993 0.00506651 0.003109003 0.005894559

MIR-321 0.88907148 1.522499463 0.855360754 6.581710496 3.270910693 3.390836141

MIR-323 0.017313423 0.035881779 0.002077474 0.119722986 0.090518116 0.010950485

MIR-324-P 0.02337608 0.010188664 0.017434683 0.011538789 0.0023143 0.007463596

MIR-325 0.006190612 0.013532055 0.004005924 0.008328163 0.015322955 0.005070055

MIR-326-P 0.00186242 0.001027406 0.000284791 0.000108019 0.000235086

MIR-328 0.076486732 0.009429802 0.004137039 0.006837943 0.012402273 0.027921612

MIR-330 0.005196489 0.014491364 0.001816003 0.001070896 0.009896941 0.002220484

MIR-331-P 0.007967384 0.028540427 0.00186289 0.00131094 0.006459387 0.003468454

MIR-335 0.00111324 0.000267524

MIR-337 0.007868977 0.022216744 0.000640083 0.006128425 0.004491249

MIR-338 0.013068885 0.000175346 0.001089081 0.0066515 0.005335516

MIR-339 0.344605903 0.086379048 0.04340805 0.048272658 0.11314752 0.077121535

MIR-340 0.072734433 0.247468057 0.092358812 0.209861593 0.384719102 0.087591007

MIR-342 0.018975344 0.008843126 0.011040363 0.003878336 0.011063149 0.003529608

MIR-345 0.063969425 0.003089068 0.011244824 0.006105734 0.009219951 0.014441967

MIR-346 0.813830254 0.031585106 0.016382041 0.077717029 0.023651449 0.314494691

MIR-361 0.022147886 0.005055518 0.003786216 0.016090903 0.004675649 0.017377039

MIR-367 0.007063752 0.008037384 0.003605343 0.007813283 0.002367325 0.003034458

MIR-368 0.010289472 0.004241377 0.01557411 0.001370014 0.01612779

MIR-369 0.005407072 0.021170447 0.006108604

MIR-370 0.020032424 0.274228842 0.066135006 0.390578535 0.33460731 0.073458364

Continued

170

Table A. continued

MIR-371 0.039729524 0.000673832 0.005368888 0.040970607 0.001813638 0.02209352

MIR-372

MIR-373 0.007505463 0.000496482 0.001702052 0.001279374 0.016912941 0.001103472

MIR-374-P 0.003430427 0.001290493 0.000720987 0.001141035 0.001289678

MIR-375 0.015131059 0.02463161 0.034556344 0.02256787 0.014556662 0.016307829

MIR-376 0.016315537 0.661370554 0.074945877 0.880770815 1.343314274 0.239373038

MIR-377 0.007414514 0.008789405 0.000569931 0.015128446 0.010797659 0.005941476

MIR-378 0.000352964 0.002082651 0.000334934 0.000669631 0.00084637

MIR-379 0.016226828 0.268418445 0.036440029 0.456266162 0.641024263 0.085209292

MIR-380 0.0117664 0.054731576 0.008789674 0.136483132 0.186616295 0.014466744

MIR-381

MIR-382 0.002117621 0.004880133 0.023802816 0.000973482 0.000921405

MIR-383 0.002635481 0.000890139 0.000407181 0.000871883 0.0008852 0.001569394

MIR-384 0.000204873

MIR-422b 0.014706965 0.000402593 0.001140709 0.006732409 0.001049863 0.000696487

MIR-423 0.005866872 0.000818558 0.000836558 0.002009754 0.001158201 0.002887534

MIR-424 0.002357025 0.089123872 0.008895522 0.087598475 0.052309322 0.022706963

MIR-425 0.005784848 0.004630251 0.002615099 0.007988618 0.006540982 0.005011067

18S rRNA (CT) 7.43896825 6.87257765 6.64977285 7.778018 6.7326428 7.58807

Tissue Type Pancreatic Tumor

miRNAs OUP48 (T) OUP91 (T) OUP97 (T) OUP31 (T) OUP33 (T) OUP36 (T)

let-7a-1* 0.002375689 0.000251654

let-7a-2-P 0.174871619 0.062582913 0.140469831 0.251181144 0.397074417 0.072780018

let-7a-3* 0.002451198 0.009024262 0.009691037 0.021109403

let-7b* 0.017043537 0.007846468 0.018585402 0.046381188 0.026275596 0.02146025

let-7c* 0.000618048 0.000456827 0.000594125 0.002815045

let-7d* 0.020703838 0.037607263 0.027132264 0.135711565 0.155384911 0.03714613

let-7e* 0.002047996 0.000771036 0.00153489 0.002532193 0.001527224

let-7f-1* 0.053401518 0.065145445 0.059576068 0.179328609 0.286323367 0.063951266

let-7f-2* 0.004326124 0.003916182 0.005949953 0.014587938 0.001628424

let-7g* 0.011708265 0.018601015 0.011599932 0.075882266 0.096861075 0.011340886

let-7i* 0.019014938 0.070566468 0.072104855 0.189752108 0.023663811

MIR-001-1 0.000454842 0.014223544 0.001969135

MIR-001-2 0.043985126 0.018191416 0.086214792 0.068748096 0.090368095 0.040501488

MIR-007-1 0.017389926 0.0053618 0.012899118 0.023399241 0.069480253 0.026008134

MIR-007-2 0.004963586 0.004264282 0.005312526

MIR-007-3 0.837572842 0.010016457 0.126406427 0.336669532 0.219981837 0.422214116

MIR-009-1-P 0.053929354 0.032333783 0.054032405 0.078948659 0.080194845 0.061331146

MIR-009-2-P 0.048408898 0.007968678 0.011184567 0.036210178 0.134006819 0.103766396

MIR-009-3-P 0.000326805 0.000142562 0.000946667

MIR-010a,b 0.003965822 0.006778899 0.031493474 0.05793922 0.027032548 0.00717817

MIR-015a 0.013663601 0.0095409 0.018514376 0.041288693 0.035979572 0.02058099

MIR-015b 0.031978056 0.020280234 0.048217636 0.087076943 0.057527609 0.017516583

MIR-016-1 0.050341031 0.076212007 0.151176858 0.245329235 0.414347413 0.077597782

MIR-016-2 0.039068768 0.023005293 0.050641299 0.049920911 0.061398632 0.079422122

Continued

171

Table A. continued

MIR-017-P 0.004092378 0.023879809 0.002761863 0.040519272 0.018091895 0.032053845

MIR-018 0.404686203 0.578040555 0.32674311 0.598454334 0.968630489 0.595679914

MIR-019a-P 0.039188538 0.037596238 0.003551665 0.036859864 0.032937145 0.10991565

MIR-019b-1-P 0.008293027 0.001173528 0.005369914 0.00386905 0.003356515 0.01240839

MIR-019b-2-P 0.000520497

MIR-020 0.007016487 0.000269524 0.002685945 0.003106072

MIR-021 8.915153074 9.29252471 20.14473217 33.46846708 60.29188037 6.203911986

MIR-022-P 0.033302564 0.025851963 0.00192182 0.050022417 0.011647941 0.017909529

MIR-023a 0.082847448 0.041920177 0.096394305 0.170793748 0.168910079 0.043063674

MIR-023b-P 0.07670506 0.019845003 0.032034121 0.156090709 0.050648236 0.150752749

MIR-024-1,2 4.696952713 2.766813919 7.782349215 12.63394305 11.6705797 5.325519328

MIR-025 0.008971367 0.022043867 0.02162083 0.055577377 0.098841747 0.025888204

MIR-026a-1,2 0.003637923 0.001550269 0.015720541 0.029696435 0.03440193 0.01031878

MIR-026b 0.041885322 0.02917748 0.055386885 0.063960036 0.097817427 0.078311458

MIR-027a, b 0.049458852 0.053785743 0.068466198 0.209648741 0.21286399 0.062765353

MIR-028 0.002300939 0.000167934 0.002243287 0.003752732 0.005140997 0.003519445

MIR-029a,c 0.076721199 0.06576351 0.021734334 0.094951465 0.116818391 0.03655622

MIR-029b-1,2

MIR-030a,e 0.01117558 0.006586796 0.013026124 0.035515007 0.01795595 0.018998169

MIR-030b 0.039549755 0.025803912 0.078978798 0.236727968 0.081111671 0.133680063

MIR-030c-1,2 0.01622249 0.028214794 0.008191738 0.059599357 0.081563038 0.042306869

MIR-030d 0.007653008 0.004551354 0.008924195 0.049774584 0.015872132

MIR-031-P 0.029271907 0.017409935 0.041140274 0.090789173 0.101459884 0.108782751

MIR-032 0.02714509 0.023998011 0.025903758 0.043004593 0.048055315 0.077554845

MIR-033 0.003852279 0.000331804

MIR-034a 0.012109395 0.028234857 0.041777608 0.107283422 0.085745889 0.021213695

MIR-034b 0.000462068 0.001007995 0.000855576 0.000907242 0.001068435

MIR-034c

MIR-092-1 0.00534726 0.00444817

MIR-092-2-P 0.001600195 0.002005769

MIR-093 0.001848427 0.001536199 0.028375964 0.028475097 0.077782549 0.024975722

MIR-095 0.019226108 0.003740904 0.004621919 0.003513477 0.011507305 0.000876822

MIR-096-P 0.0581947 0.023237564 0.065071279 0.106536934 0.095742303 0.226503181

MIR-098 1.136349063 0.654748892 1.268561725 2.324841835 3.424253049 1.019385487

MIR-099a 0.009191083 0.003225301 0.002005711 0.012794181 0.007040794 0.005683736

MIR-099b 0.164961478 0.085089511 0.137374413 0.271714426 0.252083102 0.16137866

MIR-100 0.308345152 0.273155357 0.431133693 0.452482866 1.021568057 0.103461271

MIR-101-1 0.000199618 0.000622726 0.000419343 0.001298185 0.000910355

MIR-101-2 0.032801124 0.04497843 0.048809566 0.104415556 0.212174961 0.225216935

MIR-103-1,2 0.275715555 0.263741156 0.611026019 0.976355921 1.293323174 0.372128997

MIR-105-1,2 0.00590601 0.001850064 0.004099411 0.004145807 0.008903716 0.010205921

MIR-106a-P 0.003122135

MIR-106b 0.049369781 0.064434208 0.191940321 0.324217433 0.574997393 0.110564046

MIR-107 0.480582516 0.612008298 1.169745533 1.792514848 3.124857322 0.612717609

MIR-108 0.005455694 0.001608269 0.00298808 0.0040745 0.002244292 0.0035056

MIR-122a 0.000344241 0.000526904

Continued

172

Table A. continued

MIR-124a-1,2,3 0.001364448 0.004952929 0.003923339 0.002345384 0.001712259

MIR-125a 0.017368471 0.025818663 0.055238491 0.096971833 0.093411943 0.077564172

MIR-125b-1 0.317002049 0.24086449 0.174914491 0.181022015 0.272093768 0.171111689

MIR-125b-2 0.00808599 0.001639445 0.012867305 0.025264261 0.008707521

MIR-126 0.115181472 0.252049696 0.24751 0.143317389 0.682134114 0.135155087

MIR-127 1.33315966 0.754465648 0.908663932 0.53615055 0.7704164 0.838639518

MIR-128a 0.013267015 0.030986103 0.034711132 0.080185605 0.114472528 0.045839837

MIR-128b 0.003905234 0.00192626 0.00411876 0.00227602 0.002182065 0.005930637

MIR-129-2 0.026788908 0.002982398 0.015706094 0.023302605 0.026883025 0.098735672

MIR-130a-P 0.024839614 0.011434365 0.013705737 0.028605107 0.038794658 0.067236839

MIR-130b 0.002289573 0.004774959 0.012460362 0.000379298

MIR-132 0.019150244 0.022916613 0.007834352 0.009723336 0.015585846 0.013192472

MIR-133a-1,2 0.001381522 0.033408734 0.004321917 0.007171284 0.019136792 0.004577611

MIR-133b 0.006419293 0.002147493 0.001268783 0.003154369 0.014693077 0.002080704

MIR-134 0.032487692 0.031911 0.037249767 0.046176322 0.051722177 0.03875105

MIR-135a-1,2 0.026150876 0.003103367 0.01236813 0.031493918 0.017255437 0.045204955

MIR-135b-P 0.008201802 0.002568828 0.023474548 0.121218649 0.015258514 0.006694241

MIR-136 0.056375439 0.030632685 0.040394249 0.027810733 0.037016 0.029534075

MIR-137 0.001365421 0.000463725 0.003589698 0.003332088 0.00189424 0.001392531

MIR-138-1,2 0.00116473 0.000227122 0.000793388 0.000197738

MIR-139 0.003172905 0.004768797 0.00459128 0.005706983 0.003475921 0.017453519

MIR-140

MIR-141 0.006231754 0.003402831 0.009246232 0.005372581 0.024837001 0.03296751

MIR-142-P 0.012956219 0.022137884 0.011626311 0.01949134 0.029117793 0.039921167

MIR-143 0.016016332 0.019204053 0.032429256 0.050116677 0.104210772 0.012483902

MIR-144 0.017091676 0.000239447

MIR-145-P 0.161045982 0.050396701 0.069283457 0.570052647 0.395361781 0.053981569

MIR-146 0.000688781 0.003327388 0.002044179 0.00084399

MIR-147 0.001826336 0.009561288 0.009450898 0.008325547 0.001576685

MIR-148a-P 0.003982496 0.002576764 0.001939047 0.002951064 0.003350569 0.00358937

MIR-148b-P 0.031666255 0.009158904 0.015597809 0.174367983 0.05535254 0.046611047

MIR-149 0.020191621 0.007242094 0.026685756 0.019770266 0.022811305 0.035755592

MIR-150 0.020697618 0.038570593 0.02834126 0.014354223 0.121849042 0.034709941

MIR-151 0.00255306 0.001736121 0.004902219 0.001588551 0.002996407 0.003931311

MIR-152 0.016226533 0.005885655 0.020613999 0.067066474 0.073049075 0.007475961

MIR-153-1,2 0.002979602 0.002101668 0.019633997 0.02159845 0.016826102 0.023919478

MIR-154 0.013885752 0.031618344 0.029901149 0.061843812 0.061107841 0.013197548

MIR-155 0.050208679 0.097400138 0.08282248 0.1228496 0.4502786 0.017813548

MIR-181a,c 0.042972501 0.040023485 0.229723558 0.270278483 0.384125546 0.060013597

MIR-181b-1,2 0.001364315 0.001786362 0.002429174 0.005062249 0.013692473 0.00431506

MIR-182 0.04543921 0.047703308 0.206746558 0.505949595 0.658809982 0.12650109

MIR-183 0.006139635 0.001891321 0.005095243 0.011320548 0.016274729 0.008687253

MIR-184 0.014254553 0.001125258 0.00617167 0.009820942 0.018403753 0.022041561

MIR-185 0.330303708 0.181212342 0.317220568 0.248436331 0.381816358 0.333350829

MIR-186-P 0.34728658 0.12979868 0.229974008 0.703396991 0.509581681 0.563277293

MIR-187 0.006272037 0.000563867

Continued

173

Table A. continued

MIR-188b-P 0.000487728 0.000127221 0.000206177 0.000814204

MIR-190

MIR-191 0.000134575 0.000717139

MIR-192 0.000892925 0.00131462 0.006106586 0.00463612 0.001627811 0.001621101

MIR-193 0.003313716 0.006684434 0.010013076 0.034054879 0.012060008

MIR-194-1,2 0.000181649 0.000299554 0.000191336 0.000381267 0.000162547

MIR-195-P 0.056985654 0.022465136 0.085626889 0.090847402 0.099323597 0.142903655

MIR-196a-1 0.003030552 0.00140209 0.014818961 0.004267677 0.002479721

MIR-196a-2 0.013513204 0.005559592 0.015160622 0.026773732 0.032253551 0.016411976

MIR-196b 0.009665909 0.022325157 0.587951566 0.108872015 0.090967109 0.013453186

MIR-197 0.019066073 0.024411904 0.042409366 0.070692064 0.130103738 0.033690595

MIR-198 0.00805707 0.001519203 0.003746865 0.013813398 0.002623591 0.003136449

MIR-199a-1-P 0.124099488 0.041369279 0.085209448 0.166098399 0.062444522 0.26750286

MIR-199a-2-P 0.066122362 0.015239201 0.009595331 0.2501125 0.075400052 0.020576134

MIR-199b-P 0.017801431 0.011948962 0.030016368 0.037361821 0.059447701 0.04485875

MIR-200a-P 0.391462514 0.154941457 0.267121632 0.708893383 0.680456018 1.944302533

MIR-200b 0.003986881 0.034661015 0.069868722 0.003002542 0.028430075

MIR-200c 0.000170232 0.000847621 0.000436411 0.001417595 0.004711308

MIR-203 0.008457119 0.011767159

MIR-204 0.00699417 0.004203253 0.012102956 0.004516252 0.005412134 0.012372014

MIR-205 0.000981725 0.004389103 0.018311878 0.000417331 0.001011072

MIR-206 0.000113684 0.002421001 0.000191598 0.01517024

MIR-208 0.000189051 0.007420385 0.005829808 0.001003326 0.001656682

MIR-210 0.012718877 0.014630462 0.088438368 0.180715677 0.11866154 0.105044987

MIR-211 0.045200015 0.040064662 0.0292698 0.075433782 0.130469349 0.167076904

MIR-212 1.207396538 0.730775473 0.116234175 0.072442772 0.189771641 0.297681448

MIR-213 0.001272518 0.035887597 0.05703806 0.123255426 0.189045684 0.030800161

MIR-214 0.056898624 0.018039137 0.052388491 0.025057731 0.038034431 0.050644616

MIR-215 0.007164139 0.004898121 0.012054409 0.017332644 0.024663192 0.009860259

MIR-216 0.001988267 0.000144878 0.004115875 0.002819579 0.002017466 0.121120017

MIR-217 0.000178382

MIR-218-1,2 0.050288073 0.022986556 0.079675127 0.06967694 0.131260371 0.024784814

MIR-219-1,2 0.004825463 0.008775561 0.035731563 0.000222407

MIR-220 0.002426513 0.001861135 0.000215074 0.007354689 0.016709679 0.001842324

MIR-221 0.061594851 0.051107475 0.073181953 0.087411692 0.077621295 0.028454344

MIR-222-P 0.052140711 0.014320926 0.005309734 0.061849042 0.028799195 0.017971003

MIR-223 0.000614763 0.000588934 0.000730995 0.014426817 0.001354051

MIR-224 0.022395747 0.003697312 0.005293577 0.041010342 0.031611226 0.015974789

MIR-296 0.006148843 0.003639805 0.013397567 0.003877334

MIR-299-P 0.009718572 0.005090384 0.004656523 0.003254094 0.00444764 0.017297888

MIR-301 0.02935791 0.016784154 0.047597141 0.096108882 0.149210123 0.030944584

MIR-302 0.004501982 0.01065104 0.022258888 0.005659859

MIR-302b 0.009351176 0.00651674 0.003848187 0.00264148 0.007051258 0.006084375

MIR-302c 0.002000653 0.003851216 0.00848551 0.002829871 0.001354076

MIR-302d 0.000383137 0.000840641 0.001316292 0.00099471

MIR-320 0.004912525 0.003313739 0.002829148 0.009143895 0.007145246 0.007845435

Continued

174

Table A. continued

MIR-321 0.730240237 2.143619907 1.072759531 2.758076684 4.626782623 2.438901037

MIR-323 0.035229494 0.022633839 0.01295367 0.051967774 0.03981533 0.108028675

MIR-324-P 0.013873081 0.007904474 0.005453166 0.011117676 0.027093072 0.022761607

MIR-325 0.003588706 0.003889537 0.007835085 0.044388202 0.002457333 0.001112918

MIR-326-P 0.000178388 0.000413953 0.001183104 0.002655551

MIR-328 0.014531401 0.005604581 0.009592082 0.014765859 0.02834414 0.337895424

MIR-330 0.001622196 0.004279635 0.004116745 0.012288708 0.008955501 0.005966658

MIR-331-P 0.008185156 0.002884108 0.007223695 0.031697735 0.007292493 0.033477271

MIR-335 0.000306528

MIR-337 0.024922776 0.005490347 0.009495105 0.006115932 0.003321689 0.011396757

MIR-338 0.000349397 0.000837554 0.010565389 0.001161091 0.001489948 0.010969767

MIR-339 0.026842002 0.027951889 0.053964285 0.075437939 0.134201418 0.099021301

MIR-340 0.091694249 0.09829335 0.163884943 0.245991278 0.571337377 0.165409582

MIR-342 0.000867772 0.015386204 0.019056714 0.005767061 0.04089486 0.010342177

MIR-345 0.013952114 0.007279442 0.00651134 0.007362307 0.024036303 0.02807346

MIR-346 0.280606546 0.096020957 0.095327067 0.135547092 0.06619804 0.083407604

MIR-361 0.008079104 0.006357958 0.008870165 0.010324299 0.009656987 0.012053444

MIR-367 0.007694309 0.007232177 0.007174038 0.006465353 0.007622581

MIR-368 0.003183887 0.001860413 0.001435985 0.003199552 0.002825024 0.003548283

MIR-369 0.007039214 0.010129186

MIR-370 0.184238831 0.088917557 0.135775137 0.227052696 0.21696772 0.105219953

MIR-371 0.011481883 0.001842655 0.004946263 0.015855543 0.006569106 0.014918298

MIR-372 0.000487635

MIR-373 0.0040842 0.001066271 0.000473402 0.006274535 0.004308892

MIR-374-P 0.001859374 0.001324964 0.00252264

MIR-375 0.008452097 0.007444286 0.012015069 0.006645793 0.006249317 0.1405951

MIR-376 0.307425144 0.450474273 0.403234706 0.616346724 0.539294348 0.251553247

MIR-377 0.001930621 0.003229018 0.011552058 0.003000158 0.004808737 0.00586711

MIR-378 0.001594542 0.000316037 0.001197333

MIR-379 0.100746426 0.110979616 0.187693842 0.206098094 0.195760734 0.091600274

MIR-380 0.046818307 0.004368401 0.037231504 0.037260299 0.018951572 0.006962097

MIR-381 0.001043082 0.00095589 0.002400681

MIR-382 0.003015705 0.0013447 0.003908465 0.002913046 0.000666651 0.006236149

MIR-383 0.000843659 0.000465562 0.000684608 0.001304542 0.002071034 0.002102763

MIR-384 0.000517599

MIR-422b 0.003082095 0.000902503 0.00202931 0.001059912 0.001412219 0.006441202

MIR-423 0.002383671 0.000375396 0.00074112 0.00205373 0.000865719 0.004851127

MIR-424 0.010583852 0.033383791 0.025013395 0.083420228 0.043011949 0.03351759

MIR-425 0.004346291 0.003831344 0.00959848 0.005350899 0.006846412 0.004123022

18S rRNA (CT) 7.44394 6.93464755 7.72409115 7.0264585 7.58747125 7.34983915


miRNAs OUP42 (T) OUP105 (T) OUP122 (T) OUP123 (T) OUP135 (T) OUP139 (T)

let-7a-1* 0.011153874

let-7a-2-P 0.688322831 0.248999322 0.236854308 0.066422711 0.080029484 0.402757796

let-7a-3* 0.012142239 0.003610824 0.004198746 0.013842985 0.019092422

Continued

175

Table A. continued

let-7b* 0.014714647 0.017323169 0.016879861 0.001820256 0.018691063 0.045821577

let-7c* 0.000195859 0.00015392 0.000376859 0.002790285

let-7d* 0.100287331 0.068949563 0.047733811 0.037614622 0.048940611 0.077217487

let-7e* 0.000404457 0.00304275 0.000922099 0.001784704

let-7f-1* 0.106961927 0.120782448 0.036984275 0.018973734 0.063442367 0.160077719

let-7f-2* 0.003271698 0.001138562 0.001407034 0.000841361 0.001834153

let-7g* 0.090000528 0.03702743 0.013058602 0.001136373 0.009316543 0.044855149

let-7i* 0.097010705 0.128698908 0.109011884 0.035167606

MIR-001-1 0.002127454 0.000597795 0.005301019 0.000194888

MIR-001-2 0.058387699 0.107542977 0.136596964 0.029222095 0.050836497 0.059622737

MIR-007-1 0.031256992 0.036693205 0.063844419 0.032762277 0.024094237 0.044438623

MIR-007-2 0.000388743 0.00211759 0.006107399 0.003893446

MIR-007-3 0.402919007 0.012855974 0.44454067 0.039732239 0.011105552 0.227010498

MIR-009-1-P 0.041234287 0.047822114 0.134174723 0.041980711 0.140554634 0.10498524

MIR-009-2-P 0.050717318 0.072867976 0.138929639 0.040229341 0.111340272 0.099447294

MIR-009-3-P 0.000161224 0.000537159 0.003824657

MIR-010a,b 0.015558068 0.02495436 0.019885433 0.026049995 0.032965458 0.070620553

MIR-015a 0.061154407 0.045896429 0.008106494 0.026616652 0.006679831 0.048207366

MIR-015b 0.044129945 0.065482046 0.050257469 0.041261524 0.035976931 0.062363833

MIR-016-1 0.408619446 0.122116768 0.162899583 0.093360035 0.109966875 0.307499276

MIR-016-2 0.038267919 0.054911732 0.139097589 0.061869403 0.114243574 0.052586304

MIR-017-P 0.081200773 0.025263034 0.028738863 0.005222739 0.017970513 0.012490988

MIR-018 2.298142519 0.676080162 0.489542432 0.195482236 0.279761224 0.74350684

MIR-019a-P 0.037793941 0.048105619 0.0524743 0.019596943 0.027302728 0.024943469

MIR-019b-1-P 0.00600025 0.001176736 0.012676799 0.012386384 0.00093186

MIR-019b-2-P 0.001397596

MIR-020 0.000174162 0.000904387 0.0009279 0.000507017 0.000134285

MIR-021 21.08385499 24.11291594 27.11143966 15.06278798 19.98249633 35.43957553

MIR-022-P 0.043107696 0.04812201 0.030614795 0.019061988 0.016213894 0.023713352

MIR-023a 0.131323341 0.102545829 0.162772775 0.044849817 0.086546688 0.265839782

MIR-023b-P 0.023038958 0.069965995 0.101711931 0.022495245 0.045016429 0.165166433

MIR-024-1,2 10.83605915 14.83697133 8.224633086 3.472530629 5.262918009 11.16399067

MIR-025 0.074282582 0.043745433 0.05960575 0.024737893 0.034130087 0.058610742

MIR-026a-1,2 0.017757543 0.019216597 0.008900541 0.004484721 0.01129557 0.031360881

MIR-026b 0.02275712 0.046647246 0.096765013 0.060787244 0.080537803 0.06452855

MIR-027a, b 0.119314747 0.139287454 0.13460961 0.075082028 0.09326124 0.157295077

MIR-028 0.00247522 0.008746916 0.010342386 0.010647182 0.004371646 0.003794492

MIR-029a,c 0.179349455 0.074022066 0.039110216 0.033399526 0.031124024 0.061580544

MIR-029b-1,2 0.000499387 0.003487473

MIR-030a,e 0.014041553 0.024515478 0.037383924 0.021832058 0.019133557 0.009745699

MIR-030b 0.169153012 0.085862573 0.068731575 0.098531335 0.040527105 0.079761366

MIR-030c-1,2 0.104675359 0.035320087 0.023997024 0.025358398 0.014498037 0.007513454

MIR-030d 0.035200525 0.011324834 0.015128993 0.012044129 0.005849646

MIR-031-P 0.05121525 0.065614784 0.223803161 0.061077419 0.187569209 0.115240954

MIR-032 0.049790654 0.034388267 0.035498203 0.002220442 0.029697163 0.06127016

MIR-033 0.000627595 0.002387511

Continued

176

Table A. continued

MIR-034a 0.029164967 0.043462523 0.02889291 0.036105838 0.020694281 0.053524414

MIR-034b 0.000780442 0.001631532 0.000859591 0.001109632 0.000522144

MIR-034c

MIR-092-1 0.006665484 0.003569446 0.006805377 0.011679865 0.006086105 0.000951352

MIR-092-2-P 0.000863784 0.003697936 0.001322151

MIR-093 0.051227091 0.02832441 0.06847102 0.014210119 0.024299677 0.039661139

MIR-095 0.003585117 0.008257219 0.011091958 0.008648759 0.00662366

MIR-096-P 0.040894929 0.071872801 0.316341628 0.059266942 0.148826869 0.104301508

MIR-098 3.556540936 2.039094616 1.688527668 0.816042061 1.053010571 2.129961597

MIR-099a 0.015863454 0.012654477 0.017117607 0.007352777 0.002565888 0.018004314

MIR-099b 0.40525005 0.270088893 0.349223323 0.146795985 0.096843727 0.326844181

MIR-100 1.402372168 0.458825894 0.508039586 0.167851626 0.263521197 1.040547929

MIR-101-1 0.000479077 0.001160504 0.000243918 0.022788597 0.003442366

MIR-101-2 0.138866477 0.106064827 0.072316458 0.065702379 0.082473156 0.126623178

MIR-103-1,2 0.839665298 0.659709013 0.576691362 0.331092772 0.460798817 1.137816904

MIR-105-1,2 0.001121142 0.00480088 0.002384874 0.003385044 0.013864274 0.007154315

MIR-106a-P 0.002705627 0.000270455

MIR-106b 0.504079528 0.235635812 0.193303856 0.084574434 0.145761581 0.317673559

MIR-107 1.99626157 1.435887499 1.24187229 0.722537524 0.948884845 2.270244089

MIR-108 0.003581982 0.001794761 0.006841106 0.000669585 0.005569042 0.001514441

MIR-122a 0.000358526

MIR-124a-1,2,3 0.004069764 0.000596661 0.002231204 0.00698847 0.000692076

MIR-125a 0.137858466 0.094014117 0.102931918 0.04589696 0.030027245 0.088934495

MIR-125b-1 0.687723128 0.538242314 0.202496702 0.044163886 0.051385724 0.303207095

MIR-125b-2 0.005064144 0.00106304 0.000804029 0.000535104 0.011317369

MIR-126 0.775452205 0.259144238 0.284959999 0.17001046 0.079755174 0.408178591

MIR-127 0.254498184 0.487857164 1.517319411 1.593874369 2.385665741 1.753283652

MIR-128a 0.079265109 0.065503428 0.02570827 0.011110383 0.028262461 0.104063311

MIR-128b 0.000213193 0.003483577 0.003364488 0.003775118 0.006075157 0.002646146

MIR-129-2 0.01462178 0.022534749 0.133509316 0.015615845 0.098493131 0.030059158

MIR-130a-P 0.017024365 0.024179869 0.112037905 0.031212061 0.117510243 0.038951574

MIR-130b 0.002902601 0.00128909 0.021757443 0.002630986 0.001409979

MIR-132 0.071470405 0.034558507 0.006556369 0.012296222 0.00041139 0.005514002

MIR-133a-1,2 0.002673943 0.017492505 0.017410794 0.013269887 0.036008752 0.009496232

MIR-133b 0.002362342 0.010749883 0.019756995 0.010868235 0.004935281 0.006026021

MIR-134 0.047638053 0.071040632 0.130854035 0.035424527 0.096600899 0.034224444

MIR-135a-1,2 0.014094638 0.009156892 0.024439309 0.011381902 0.011376763

MIR-135b-P 0.05486412 0.007979097 0.01601553 0.064516654 0.01762261 0.102299743

MIR-136 0.782894476 0.017599134 0.05423084 0.025889034 0.013439189 0.034199699

MIR-137 0.001143579 0.027448894 0.000974664 0.001004018 0.003740879

MIR-138-1,2 0.000116578 0.00024647 0.00020945 0.000448854

MIR-139 0.002300581 0.004433939 0.025558223 0.006822657 0.017848794 0.006249835

MIR-140

MIR-141 0.003181201 0.013808584 0.006154301 0.012339677 0.021613266 0.019160877

MIR-142-P 0.020230247 0.023098408 0.059933931 0.015194425 0.049406406 0.037645466

MIR-143 0.026303667 0.086199554 0.067875081 0.017577381 0.06803052 0.131543642

Continued

177

Table A. continued

MIR-144 0.006141817 0.000140749

MIR-145-P 0.021075005 0.867642254 0.40671788 0.087233671 0.146327306 0.99943796

MIR-146 0.001371395 0.000216433 0.001161194

MIR-147 0.001875832 0.000177472 0.012228407 0.014023822 0.002903713 0.005259396

MIR-148a-P 0.000490003 0.002118387 0.006395987 0.009903625 0.008355729 0.006930076

MIR-148b-P 0.034533019 0.055854612 0.057463386 0.034314649 0.018214673 0.039426458

MIR-149 0.01285908 0.014443005 0.086374114 0.017665182 0.069421696 0.025285111

MIR-150 0.104112325 0.029983398 0.036489111 0.003204711 0.022706583 0.056800617

MIR-151 0.005297955 0.001235936 0.007762574 0.006522508 0.010315903 0.00304762

MIR-152 0.021103546 0.032029681 0.061538446 0.039037499 0.02640672 0.178600549

MIR-153-1,2 0.007463242 0.013054276 0.010169851 0.008351965 0.033556776 0.015329473

MIR-154 0.03810684 0.040433397 0.076242029 0.018287129 0.011788753 0.047374414

MIR-155 0.34355602 0.144719298 0.061952329 0.029434816 0.066867891 0.171104003

MIR-181a,c 0.295406867 0.174006635 0.229481828 0.113669682 0.122260766 0.292324554

MIR-181b-1,2 0.003320301 0.003466467 0.005242987 0.00469798 0.005529986 0.004434762

MIR-182 1.8092199 0.36510978 0.213300806 0.404927609 0.154220282 0.461689049

MIR-183 0.034626437 0.013416868 0.003729239 0.008781873 0.006127556 0.011673087

MIR-184 0.00650917 0.018151244 0.069584212 0.024543783 0.054876277 0.01811862

MIR-185 0.111836984 0.26769159 0.502010108 0.402068277 0.558487509 0.43384359

MIR-186-P 0.253484734 0.571298133 0.871751786 0.222153522 0.518808283 0.530816794

MIR-187 0.000503286 0.000357186 0.000993338

MIR-188b-P 0.000785985 0.0011076 0.000465485 0.000601966 0.002324476

MIR-190

MIR-191 0.000142585 0.003426759

MIR-192 0.001038721 0.003912362 0.005096535 0.000760393 0.005560321 0.001542617

MIR-193 0.022215482 0.004463101 0.019746158 0.00282715 0.002278155 0.033789491

MIR-194-1,2 0.000197003 0.00019211 0.002085518 0.001424343 0.000897184 0.000459821

MIR-195-P 0.025015884 0.06126635 0.256608403 0.068948808 0.175923537 0.096333068

MIR-196a-1 0.0025842 0.00253663 0.026677769 0.009978592 0.013863184 0.011072873

MIR-196a-2 0.007672252 0.020286408 0.082465833 0.008198623 0.036655079 0.047218546

MIR-196b 2.979555807 0.252353713 0.258893889 0.168122756 0.056456751 0.389062927

MIR-197 0.042846161 0.247770154 0.037168864 0.270062254 0.110716252

MIR-198 0.009788881 0.01326493 0.010915189 0.070886191 0.015912777

MIR-199a-1-P 0.005221231 0.035316954 0.410063949 0.126582899 0.377579782 0.042773347

MIR-199a-2-P 0.032327814 0.098385105 0.028148538 0.014269587 0.022799112 0.068797093

MIR-199b-P 0.027329877 0.030308573 0.084343975 0.018338379 0.10655834 0.043853762

MIR-200a-P 0.283689718 0.515488525 3.189947807 0.454580725 1.487552844 0.643583578

MIR-200b 0.020598824 0.013630655 0.039301994 0.032514745 0.011597936 0.050700891

MIR-200c 0.003775958 0.002015532 0.000977821 0.000249069 0.000318477 0.000835879

MIR-203 0.000934692

MIR-204 0.004495986 0.002774125 0.027315494 0.009332164 0.024473036 0.01480281

MIR-205 0.001038263 0.00210141 0.021473041 0.000283769 0.093822738 0.000404397

MIR-206 0.007976526 0.000320314 0.006888821 0.000670541 0.00438929

MIR-208 0.000170272 0.000983384 0.002823915 0.000327634 0.001136457

MIR-210 0.064105359 0.198336172 0.337325274 0.379640397 0.247647235 0.090546044

MIR-211 0.024666225 0.088092024 0.324387767 0.065680887 0.171249588 0.138424807

Continued

178

Table A. continued

MIR-212 1.734100809 0.251638351 0.299386862 0.243900466 0.021787023 0.339788968

MIR-213 0.172383043 0.047836287 0.089505294 0.057114957 0.027733748 0.186163858

MIR-214 0.005838752 0.020846106 0.091150717 0.048397855 0.097374878 0.037349362

MIR-215 0.003182246 0.012959871 0.032184901 0.013474303 0.018900771 0.019979114

MIR-216 0.006268814 0.006914431 0.010009143 0.002249678 0.013410756 0.005669772

MIR-217

MIR-218-1,2 0.091817074 0.035684682 0.041428613 0.013744921 0.016049253 0.068160603

MIR-219-1,2 0.004857408 0.009317029 0.003553838 0.009537877 0.012689956 0.002892494

MIR-220 0.004110083 0.000115645 0.001746064 0.000495082 0.005868884 0.000665098

MIR-221 0.228098722 0.091094245 0.198320857 0.074026104 0.086007806 0.061330262

MIR-222-P 0.140955558 0.037316984 0.025880464 0.019984897 0.011469926 0.022403958

MIR-223 0.00136571 0.00363094 0.001180088 0.001440352 0.000802095 0.001881075

MIR-224 0.011965282 0.035757625 0.031122577 0.010143008 0.031984504 0.047172011

MIR-296 0.00334642 0.000189265 0.001629796 0.007836955

MIR-299-P 0.000334262 0.002609252 0.035914726 0.007176307 0.029695753 0.009572082

MIR-301 0.064131403 0.047687046 0.054432791 0.036190213 0.084813188 0.074209794

MIR-302 0.007376687 0.010333911 0.002505876 0.005827179 0.006302511 0.010483167

MIR-302b 0.003009381 0.008773616 0.010203506 0.010700622 0.010286218 0.005688616

MIR-302c 0.000325725 0.003751419 0.002204114 0.00031053 0.008372136 0.003688501

MIR-302d 0.000313573 0.002101205 0.00221209 0.000464874

MIR-320 0.003101203 0.007169517 0.012966023 0.004122146 0.004543907 0.009680685

MIR-321 3.098310579 2.546448816 3.974356586 1.856676438 2.96830002 5.747712576

MIR-323 0.038619459 0.090303093 0.104044587 0.025876045 0.026635375 0.067894636

MIR-324-P 0.007975534 0.020212551 0.03895901 0.016909366 0.021689813 0.020786071

MIR-325 0.004211059 0.016226051 0.030837494 0.008372362 0.029178245 0.019742389

MIR-326-P 0.000328991 0.000429908 0.000197371 0.00037133 0.000707421

MIR-328 0.027043511 0.010072424 0.056335898 0.005480001 0.026340589 0.013101496

MIR-330 0.004129905 0.057564342 0.006762174 0.001432638 0.008400692 0.008882047

MIR-331-P 0.016453203 0.007779463 0.022774305 0.00422324 0.006723189 0.008870403

MIR-335 0.00070767

MIR-337 0.000109879 0.007463625 0.016655752 0.000354743 0.00227729 0.002048544

MIR-338 0.000624876 0.004451165 0.00881761 0.000356383 0.002253046 0.002279318

MIR-339 0.071945999 0.043825253 0.073350333 0.026386283 0.036534706 0.100194444

MIR-340 0.242215529 0.139297012 0.143854157 0.097001403 0.074171894 0.338029935

MIR-342 0.044457443 0.024027489 0.020423088 0.008155005 0.008306687 0.022786915

MIR-345 0.006488071 0.01858919 0.037761119 0.014685512 0.037042093 0.022758802

MIR-346 0.024943838 0.044033222 0.129453764 0.116897414 0.171418761 0.151873169

MIR-361 0.006717009 0.007929638 0.017574504 0.012526619 0.010567031 0.013935011

MIR-367 0.003931997 0.003504681 0.006263242 0.003507165 0.003840721

MIR-368 0.001574375 0.004425354 0.004797315 0.00377174 0.011859758

MIR-369 0.008518767 0.01407022 0.019133277 0.001249833 0.019324011

MIR-370 0.131031063 0.203429346 0.301997041 0.1087202 0.082204969 0.212060294

MIR-371 0.001305691 0.008552629 0.047106887 0.012208002 0.064540851 0.013701374

MIR-372

MIR-373 0.000677376 0.003713663 0.00964173 0.000378412 0.006322294 0.001460952

MIR-374-P 0.001036425 0.005261715 0.001164899

MIR-375 0.010471546 0.003388719 0.004931668 0.005542282 0.00444107 0.005042451

Continued

179

Table A. continued

MIR-376 0.621788039 0.961455652 0.63752765 0.216697951 0.160983577 0.576807736

MIR-377 0.017909244 0.013897982 0.011774445 0.000973283 0.00211521 0.011833018

MIR-378 0.000355776 0.000167964 0.000539144 0.000590746 0.000443352

MIR-379 0.361800867 0.314748895 0.356709445 0.126581188 0.080886285 0.229311151

MIR-380 0.114597682 0.065735236 0.09543669 0.011207983 0.008679135 0.065920702

MIR-381 0.005382904

MIR-382 0.000503092 0.013105032 0.008290006 0.000300506 0.000678756 0.002098368

MIR-383 0.000392014 0.000945061 0.001596799 0.000483469 0.001526976 0.000506535

MIR-384 0.000292133 0.005148446 0.000381008 0.00178303

MIR-422b 0.001244667 0.017058644 0.000608045 0.009283818 0.00757575

MIR-423 0.000210693 0.001415262 0.007030621 0.000708415 0.002881546 0.002672606

MIR-424 0.028173064 0.068299684 0.040104719 0.003977816 0.031530698 0.060103296

MIR-425 0.003850515 0.006943904 0.002634194 0.000219709 0.012170029

18S rRNA (CT) 6.7847897 6.89571015 7.61849425 7.23457885 7.40222035 7.14890985


miRNAs OUP29(T) OUP37(T) OUP49(T) OUP101(T) OUP119(T) 0206C077B(T)

let-7a-1* 0.005190609 0.019623511 0.003227546 0.004840743 0.007383645 0.006690052

let-7a-2-P 0.038127954 0.407206083 0.049689959 0.116258872 0.208928668 0.377440612

let-7a-3* 0.001969118 0.04808016 0.004766276 0.008299529 0.013157488 0.011266257

let-7b* 0.009728148 0.091165168 0.014240614 0.012433176 0.025092967 0.031333084

let-7c* 0.002783066 0.001314505 0.001053485 0.00140158 0.002431742

let-7d* 0.045355692 0.069931173 0.042285612 0.038554477 0.051585248 0.069894298

let-7e* 0.001535123 0.001146975 0.00211911 0.000875175

let-7f-1* 0.070529075 0.100014114 0.054580207 0.051462656 0.099020763 0.093238724

let-7f-2* 0.007991821 0.001829775 0.0040218 0.003995694 0.00470112

let-7g* 0.02539987 0.010809743 0.007668925 0.01621097 0.023601647 0.028242069

let-7i* 0.042260464 0.085996188 0.033767617 0.025821296 0.044466291 0.093194658

MIR-001-1 0.0002544 0.005505491 0.000494027 0.000274864 0.000178149 0.000280116

MIR-001-2 0.109124044 0.074538341 0.090779048 0.029781665 0.117847525 0.097306978

MIR-007-1 0.049739573 0.017149259 0.028647969 0.007729912 0.020364961 0.01316299

MIR-007-2 0.000891226 0.000856129 0.000781181 0.000719643 0.002880158 0.002650389

MIR-007-3 0.000744681 0.00026217 0.275813823 0.052827125 0.673031703 0.886936712

MIR-009-1-P 0.110610321 0.12187837 0.091140252 0.032755244 0.081172163 0.105712367

MIR-009-2-P 0.072559404 0.131555778 0.06256832 0.02067369 0.050663546 0.048182033

MIR-009-3-P 0.003474616 0.000214548 0.000193969 0.007432694

MIR-010a,b 0.003757459 0.040425839 0.01506602 0.001195833 0.03801286 0.013890026

MIR-015a 0.010921296 0.074715274 0.026593116 0.004688968 0.041151943 0.025763967

MIR-015b 0.099645117 0.132851002 0.061040546 0.011962529 0.047807271 0.026761793

MIR-016-1 0.140006957 0.208287046 0.085861975 0.037565216 0.097333778 0.130061157

MIR-016-2 0.10268746 0.219125383 0.060563994 0.160868272 0.079899865 0.082778968

MIR-017-P 0.019504184 0.204083863 0.028559404 0.01072776 0.006482243 0.008380698

MIR-018 0.348734601 0.337874182 0.223818651 0.347720064 0.428829741 0.737244505

MIR-019a-P 0.039289426 0.139518807 0.018837805 0.048122694 0.031246564 0.031113652

MIR-019b-1-P 0.001438642 0.028035916 0.000243213 0.003023003

MIR-019b-2-P 0.000931787 0.000956506

Continued

180

Table A. continued

MIR-020 0.001198682 0.003833154 0.000885174 0.00040551 0.004116999

MIR-021 34.25400846 18.76520335 20.82220098 2.393053614 14.5300259 12.03163724

MIR-022-P 0.005918232 0.068903521 0.016998034 0.078240382 0.0202839 0.045954631

MIR-023a 0.105803659 0.246958584 0.085955107 0.043038414 0.070819102 0.130900687

MIR-023b-P 0.016958042 0.34063711 0.038576864 0.0730886 0.023125748 0.07360801

MIR-024-1,2 7.496719482 7.749668072 6.374734114 3.148811117 7.033724702 8.963695056

MIR-025 0.022896945 0.204638999 0.026981646 0.019044988 0.036817931 0.042508807

MIR-026a-1,2 0.003935454 0.009481296 0.017063 0.012921248 0.003090214 0.008232812

MIR-026b 0.086423168 0.112039396 0.107833524 0.103600633 0.058461103 0.057845321

MIR-027a, b 0.078799862 0.257413125 0.090297394 0.05640388 0.069804477 0.175987037

MIR-028 0.001740466 0.007598638 0.004308622 0.001257993 0.007344902

MIR-029a,c 0.067934556 0.037752317 0.023073756 0.019905276 0.017180899 0.086672376

MIR-029b-1,2 0.000339086

MIR-030a,e 0.048786149 0.086298185 0.034542125 0.01684911 0.008045514 0.023768474

MIR-030b 0.062626342 0.096236969 0.035588222 0.028703415 0.078220462 0.087719906

MIR-030c-1,2 0.037793696 0.077349888 0.016060083 0.011452765 0.035321303 0.041628246

MIR-030d 0.011491177 0.023820591 0.026423606 0.026175941 0.005994682 0.012371962

MIR-031-P 0.100288766 0.262323147 0.065718263 0.049346454 0.046529964 0.078961629

MIR-032 0.037866737 0.026628612 0.015114328 0.024350137 0.015330912 0.045920147

MIR-033 0.000223873 0.00097476 0.000284058

MIR-034a 0.025757001 0.056446581 0.017826245 0.008154249 0.024502306 0.048447132

MIR-034b 0.000700295 0.002073332 0.003953876 0.000369023 0.000376257 0.000538527

MIR-034c

MIR-092-1 0.006928516 0.007802262 0.006364699

MIR-092-2-P 0.003511438 0.0014085 0.000423229

MIR-093 0.029213397 0.098722245 0.018152873 0.006566841 0.012573311 0.017271606

MIR-095 0.002895011 0.000638801 0.024420697 0.000391646 0.014332875 0.000392524

MIR-096-P 0.161364812 0.430595611 0.242925639 0.094082142 0.058448219 0.04515536

MIR-098 0.947134304 0.973202897 1.160151062 0.425766463 1.244553604 1.44326485

MIR-099a 0.019101582 0.013804773 0.0140718 0.004592343 0.004946065 0.005596537

MIR-099b 0.40134892 0.310688559 0.476092455 0.175282725 0.281551135 0.293147583

MIR-100 0.211274041 0.428107204 0.265544245 0.101050245 0.538468318 0.807868884

MIR-101-1 0.002961118 0.001342611 0.000272736 0.000280868 0.000486862 0.001501755

MIR-101-2 0.046652507 0.114828767 0.076910995 0.139956628 0.047470593 0.089101194

MIR-103-1,2 0.405694717 0.57061557 0.510652463 0.085221498 0.404894477 0.626518306

MIR-105-1,2 0.005538728 0.00737148 0.004763688 0.00879835 0.00414743 0.009998342

MIR-106a-P 0.001006782 0.001621932 0.000248733

MIR-106b 0.1791513 0.441471901 0.168598391 0.024185903 0.129034152 0.087929317

MIR-107 0.941212848 1.151386354 1.010081126 0.232323053 0.986303713 0.981638385

MIR-108 0.001104128 0.032485957 0.007686839 0.000772301 0.006234832 0.010088224

MIR-122a 0.000601161 0.000338755

MIR-124a-1,2,3 0.001791065 0.002765688 0.007078759 0.000267038

MIR-125a 0.061475907 0.111372775 0.064563324 0.019929001 0.06914757 0.063029109

MIR-125b-1 0.17824888 0.147056914 0.141182352 0.173835449 0.306352041 0.835943632

MIR-125b-2 0.009280415 0.000722788 0.013408412 0.020055933 0.005538385

MIR-126 0.130255926 0.063859343 0.179187595 0.03702444 0.219193568 0.242719945

Continued

181

Table A. continued

MIR-127 1.484400528 1.85785965 2.045772429 1.492194111 1.069952959 1.01554669

MIR-128a 0.031267722 0.079543482 0.034319948 0.013608225 0.049869753 0.106473482

MIR-128b 0.004928695 0.008788731 0.008531057 0.003250506 0.002162373 0.001751919

MIR-129-2 0.067096807 0.242136256 0.065352406 0.036145033 0.011779906 0.025150826

MIR-130a-P 0.061839541 0.22541103 0.034280184 0.018910282 0.017735593 0.023566373

MIR-130b 0.001500851 0.004873544 0.000751554 0.000679396 0.000597797 0.002260342

MIR-132 0.011074312 0.011920595 0.011117939 0.022667243 0.016798135 0.029370967

MIR-133a-1,2 0.029171855 0.02653447 0.009347392 0.011819974 0.014615762 0.013232162

MIR-133b 0.004969662 0.045104792 0.010187181 0.005038628 0.007459144 0.019875598

MIR-134 0.067450639 0.118682203 0.061402137 0.024852016 0.033244255 0.089753597

MIR-135a-1,2 0.011163857 0.011145754 0.018611068 0.011315493 0.016060915 0.02613233

MIR-135b-P 0.025364498 0.102976784 0.031368235 0.000784901 0.00851511 0.00603735

MIR-136 0.017629776 0.018391864 0.035402748 0.009165989 0.627872647 0.029188706

MIR-137 0.006326062 0.001240787 0.00258976 0.003558575 0.004106527 0.00163034

MIR-138-1,2 0.000256382 0.000967204 0.000590038 0.000213566

MIR-139 0.039695586 0.085839324 0.010132793 0.009215092 0.013239146 0.006827961

MIR-140

MIR-141 0.024379797 0.016797706 0.010101772 0.009816526 0.004855319 0.003757123

MIR-142-P 0.054568811 0.037573687 0.009521425 0.006775611 0.015988793 0.035722183

MIR-143 0.041143103 0.039377546 0.02549462 0.008035083 0.046078701 0.024500858

MIR-144 0.000340943 0.000194942 0.000391057 0.000169911 0.000307827

MIR-145-P 0.207925113 0.304479292 0.12503238 0.105623717 0.297665385 0.241356832

MIR-146 0.005721858 0.002687878 0.001476033

MIR-147 0.016217519 0.001820846 0.008622107 0.001159237 0.0155992 0.012452309

MIR-148a-P 0.008807211 0.004260692 0.010296424 0.027419265 0.002453605 0.002168032

MIR-148b-P 0.005638792 0.098504915 0.02735182 0.031909653 0.045084204 0.074340081

MIR-149 0.041821016 0.116085446 0.045990467 0.017671805 0.014397927 0.017973523

MIR-150 0.03441369 0.039254722 0.038282097 0.009232815 0.024062951 0.026756414

MIR-151 0.010201523 0.01040586 0.008662335 0.000601256 0.000689154 0.005617956

MIR-152 0.015194841 0.058774351 0.017610866 0.013387099 0.021457047 0.011286735

MIR-153-1,2 0.007878452 0.010008364 0.025512767 0.009809387 0.00336995 0.026994112

MIR-154 0.00984527 0.016898658 0.011973014 0.026914692 0.015022918 0.062383684

MIR-155 0.081727642 0.058689553 0.048194946 0.015283425 0.041427552 0.159247769

MIR-181a,c 0.195881414 0.041271624 0.133374214 0.010416661 0.090044338 0.133507164

MIR-181b-1,2 0.007708412 0.011374221 0.005134209 0.002292759 0.003490386 0.003929164

MIR-182 0.715197659 0.183032852 0.495278592 0.041563536 0.105238308 0.07361676

MIR-183 0.045100052 0.009707507 0.013534751 0.004367593 0.010918904 0.001686843

MIR-184 0.027311851 0.068477793 0.022078878 0.016901765 0.019659976 0.021546795

MIR-185 0.494075499 0.350749273 0.705486152 0.541015457 0.313552813 0.314587242

MIR-186-P 0.562481643 0.870979712 0.403696552 0.395942467 0.573038458 0.442642557

MIR-187 0.003872087 0.000669155

MIR-188b-P 0.00107626 0.000885221 0.000274675 0.000479486 0.000267771 0.00020454

MIR-190 0.000163823 0.002418818 0.000206894

MIR-191 0.00127826

MIR-192 0.000465782 0.024213871 0.002387051 0.000501319 0.000291665 0.002367452

MIR-193 0.007527693 0.01855991 0.00057251 0.00251124 0.008512298 0.008577691

Continued

182

Table A. continued

MIR-194-1,2 0.001496059 0.002737784 0.000654082 0.000256153 0.000284806 0.000549224

MIR-195-P 0.137360387 0.273272752 0.128861363 0.033313084 0.061247462 0.074372371

MIR-196a-1 0.008171037 0.013876856 0.020576325 0.003345235 0.002927246 0.001238501

MIR-196a-2 0.026680581 0.062430508 0.005617472 0.072196308 0.016817838

MIR-196b 0.453012078 0.040426259 0.366569376 0.002109657 0.07247998 0.022554679

MIR-197 0.210408212 0.266344246 0.125610561 0.046727324 0.03972293 0.029588894

MIR-198 0.007105062 0.083157547 0.010905828 0.004856889 0.004341597 0.03062434

MIR-199a-1-P 0.30953746 1.222164532 0.768696588 0.825172827 0.159207408 0.08751712

MIR-199a-2-P 0.032431261 0.077353454 0.027146108 0.028835457 0.069276837 0.105692328

MIR-199b-P 0.057802469 0.160770991 0.07737518 0.014085135 0.027996298 0.043092768

MIR-200a-P 1.311363749 3.522129658 1.821912495 0.677648115 0.493509195 0.404491578

MIR-200b 0.027078853 0.0173219 0.047295826 0.021880966 0.003196334 0.02120144

MIR-200c 0.001014449 0.006108869 0.001194732 0.001233378 0.002618399 0.001483928

MIR-203 0.001404067

MIR-204 0.0091206 0.07692309 0.026637014 0.004619786 0.004513416 0.017811046

MIR-205 0.078338967 0.802624733 0.001323626 0.001752852 0.00834341 0.000892431

MIR-206 0.004511863 0.000179183 0.001901606

MIR-208 0.005701337 0.00132666 0.000603529 0.000333249 0.000508886

MIR-210 0.147353008 0.657721629 0.226861574 0.022569358 0.084295818 0.024982741

MIR-211 0.152433925 0.374236588 0.079315997 0.106724345 0.086729576 0.107526754

MIR-212 0.374247328 0.072225521 0.206226076 0.631667048 0.266144908 0.841938389

MIR-213 0.09421019 0.048527001 0.045657152 0.011913096 0.040649146 0.041556373

MIR-214 0.074213575 0.139634469 0.119461378 0.042010571 0.038571949 0.03406277

MIR-215 0.006499662 0.009180255 0.015106421 0.017175886 0.014011285

MIR-216 0.003528071 0.019598316 0.002926614 0.084536912 0.005283735 0.004980839

MIR-217 0.000689051

MIR-218-1,2 0.031779361 0.020618619 0.044638804 0.019362314 0.064471411 0.166662631

MIR-219-1,2 0.002538328 0.002100193 0.009224038 0.013575432

MIR-220 0.000501464 0.001492289 0.001805237 0.001532295 0.000325151 0.001622782

MIR-221 0.161433726 0.09394564 0.032224743 0.032882407 0.072310796 0.095200738

MIR-222-P 0.017272628 0.032556717 0.027655748 0.01781203 0.028232591 0.055230771

MIR-223 0.001000929 0.005271949 0.005754667 0.00023975 0.000238844 0.000614094

MIR-224 0.03325865 0.050340785 0.043138809 0.036399457 0.048762668 0.022543019

MIR-296 0.004824083 0.039016104 0.00118709 0.002042393 0.006701775 0.003253258

MIR-299-P 0.019769099 0.069138112 0.001770341 0.009962446 0.001115395 0.00506267

MIR-301 0.048498046 0.033301259 0.027041391 0.005245679 0.025413271 0.043455047

MIR-302 0.007969298 0.001694076 0.001175164 0.004820923 0.011628057 0.008726075

MIR-302b 0.012195907 0.015725482 0.019016238 0.013433371 0.007256992 0.009015037

MIR-302c 0.001334648 0.00448576 0.003846231 0.000438636 0.007442922 0.001301518

MIR-302d 0.00680626 0.000250321 0.000227788

MIR-320 0.017652269 0.014639149 0.005125735 0.00492222 0.004100879 0.007790775

MIR-321 1.333289823 2.770880551 1.899444646 0.897989648 2.634677484 1.73986886

MIR-323 0.027577738 0.048903839 0.04436249 0.041554606 0.047698753 0.100927769

MIR-324-P 0.030104812 0.038942964 0.033462039 0.016988888 0.014956183 0.017618227

MIR-325 0.026115161 0.037412314 0.005776934 0.00546184 0.02103173 0.012368189

MIR-326-P 0.000805373 0.00047485 0.000817109 0.000254828 0.000355397

Continued

183

Table A. continued

MIR-328 0.046246898 0.062345426 0.03438071 0.309404314 0.01134404 0.066085019

MIR-330 0.017082541 0.011241135 0.005832929 0.0008414 0.007572597 0.003904443

MIR-331-P 0.006654334 0.052383673 0.006772772 0.019607926 0.008511628 0.005850364

MIR-335 0.000178061

MIR-337 0.000852917 0.010751219 0.001372181 0.003720402 0.00462012

MIR-338 0.001122829 0.010599592 0.002687488 0.004858061 0.003025312 0.00291603

MIR-339 0.279239883 0.349018283 0.31886655 0.227095767 0.238741102 0.302493819

MIR-340 0.086971343 0.131609316 0.101426755 0.082402317 0.184531226 0.260496441

MIR-342 0.013799377 0.026200761 0.006408532 0.000702628 0.001868692 0.022003526

MIR-345 0.022259514 0.138467233 0.013055424 0.017578676 0.018288029 0.011513163

MIR-346 2.088388934 0.800109311 1.985488726 0.580464692 0.522643956 0.602309354

MIR-361 0.013321274 0.023841148 0.019682894 0.027925012 0.009957625 0.017845586

MIR-367 0.004086766 0.009473144 0.006236316 0.005012577 0.018772816 0.009228476

MIR-368 0.006224171 0.000908156 0.008908203 0.002494841 0.003868248

MIR-369 0.000524079 0.011952492 0.011321594 0.006458143

MIR-370 0.125828481 0.102021457 0.109038662 0.136238817 0.113931957 0.231580562

MIR-371 0.016477097 0.044126542 0.021318558 0.011342871 0.002805517 0.007352429

MIR-372 0.000362248

MIR-373 0.002173051 0.003063609 0.004324189 0.004388368 0.003187707 0.00184673

MIR-374-P 0.00491866 0.00025829

MIR-375 0.004505106 0.002259283 0.012703661 0.044787477 0.001657973 0.016360709

MIR-376 0.179836145 0.156697603 0.172329628 0.415869481 0.551318672 0.859904333

MIR-377 0.00154463 0.014921884 0.001945539 0.020150329 0.011231846 0.018646777

MIR-378 0.001602331 0.00138221 0.001314221 0.004003088 0.000231394

MIR-379 0.081108809 0.088753635 0.078844568 0.194429323 0.131021536 0.409344543

MIR-380 0.041974368 0.013828893 0.015633268 0.06770425 0.039316205 0.126424946

MIR-381 0.000226291 0.000416741

MIR-382 0.002432487 0.00942344 0.002685371 0.006875509 0.002141019 0.005676615

MIR-383 0.001153561 0.00635137 0.000754455 0.00131812 0.000176869 0.003106914

MIR-384 0.000596919 0.000388749 0.000269839

MIR-422b 0.003656171 0.016855457 0.003746491 0.000314766 0.000291427 0.001376291

MIR-423 0.004173199 0.007779489 0.001162248 0.00174003 0.001340675 0.001446238

MIR-424 0.010986506 0.008345999 0.003322422 0.015458179 0.026692206 0.07555076

MIR-425 0.006625752 0.00399033 0.006436585

18S rRNA (CT) 7.42572085 7.29846145 7.7145896 7.46156665 7.5298803 7.5777325


miRNAs 0206C138B(T) 3030401A1(T) 3030800A3(T) 3030396A1(T) 1050005A2(T)

let-7a-1* 0.005133434 0.003980403 0.003588572 0.007406153

let-7a-2-P 0.067724306 0.036461071 0.067871915 0.101835662 0.202099418

let-7a-3* 0.0027362 0.004138353 0.002825296 0.007187211 0.005254625

let-7b* 0.014200077 0.036120064 0.00652169 0.032833236 0.029841184

let-7c* 0.001296226 0.000571947 0.001048809 0.003410567 0.001464899

let-7d* 0.044361379 0.044300238 0.010683169 0.051607848 0.039624666

let-7e* 0.002330971 0.003173779 0.001016213

let-7f-1* 0.05739057 0.090066803 0.021603517 0.073737191 0.058947587

Continued

184

Table A. continued

let-7f-2* 0.003214436 0.004087468 0.002061849

let-7g* 0.022313815 0.026479979 0.008009262 0.050434902 0.021374309

let-7i* 0.010710417 0.013920171 0.040476 0.067297922 0.061433635

MIR-001-1 0.000185864 0.001153697 0.006882548

MIR-001-2 0.107157298 0.132953095 0.051055264 0.110791781 0.046387071

MIR-007-1 0.013396594 0.016516769 0.000988303 0.004297732 0.014080512

MIR-007-2 0.003656055 0.003294781 0.004864514 0.001307652 0.000379573

MIR-007-3 0.53349495 0.151614619 0.84002171 0.373098191 0.182495471

MIR-009-1-P 0.083248554 0.171092244 0.011364654 0.024435158 0.100813522

MIR-009-2-P 0.050843654 0.105340511 0.011572646 0.007623321 0.051673112

MIR-009-3-P 0.000208292 0.005687138

MIR-010a,b 0.007838058 0.036153516 0.00480031 0.030721673

MIR-015a 0.002036612 0.018853312 0.019576376 0.040761354 0.031309354

MIR-015b 0.012348953 0.07410955 0.018484919 0.028097971 0.03522079

MIR-016-1 0.061886649 0.079434265 0.016048419 0.209230093 0.19073904

MIR-016-2 0.074056928 0.14150209 0.059219619 0.045478351 0.077775931

MIR-017-P 0.077356188 0.129454881 0.005759932 0.010224537 0.015322304

MIR-018 0.635436347 0.20012763 0.142691967 0.905631955 0.835042522

MIR-019a-P 0.16067212 0.045579022 0.002251513 0.000610185 0.030842052

MIR-019b-1-P 0.000269706 0.002018759 0.002199803 0.000836654

MIR-019b-2-P 0.000514895 0.000283057

MIR-020 0.001149537 0.000546007

MIR-021 7.059918452 5.288735295 6.270571861 27.81134803 25.16211119

MIR-022-P 0.051382398 0.067656543 0.014312386 0.004882434 0.033923999

MIR-023a 0.098726933 0.066388022 0.083639487 0.374299174 0.190266183

MIR-023b-P 0.081223979 0.105518493 0.008041409 0.014433758 0.051110006

MIR-024-1,2 5.526066867 4.913434315 2.972515884 26.88841425 9.075235426

MIR-025 0.021747125 0.066744037 0.007090905 0.029942682 0.014042081

MIR-026a-1,2 0.010227104 0.011032276 0.000944987 0.001062035 0.015271293

MIR-026b 0.07118892 0.106845109 0.042593778 0.035444812 0.077575428

MIR-027a, b 0.120185605 0.102356439 0.041785393 0.500900261 0.140819309

MIR-028 0.002501705 0.006366796 0.003453827 0.002257449 0.00029716

MIR-029a,c 0.048300821 0.061244146 0.017380791 0.072455714 0.039529063

MIR-029b-1,2 0.000250855

MIR-030a,e 0.016969131 0.030801091 0.003032602 0.001281762 0.010311222

MIR-030b 0.092656373 0.161932926 0.018912587 0.047815553 0.068134938

MIR-030c-1,2 0.027047865 0.030434517 0.010453755 0.039842259 0.048824347

MIR-030d 0.014283026 0.02732231 0.005915813

MIR-031-P 0.074932506 0.28572284 0.026278341 0.026160089 0.084416163

MIR-032 0.043981604 0.053500818 0.017411539 0.03415543 0.029994755

MIR-033 0.000198075 0.000217769 0.000211416

MIR-034a 0.02823966 0.093015004 0.004565357 0.030673153 0.061463344

MIR-034b 0.001168115 0.000825941 0.000344679 0.000509186

MIR-034c

MIR-092-1 0.006951167 0.00186516 0.004593812 0.004865847

MIR-092-2-P 0.002704837 0.021909848

Continued

185

Table A. continued

MIR-093 0.00388917 0.020397714 0.003054499 0.013815947 0.005461748

MIR-095 0.012538313 0.009456996 0.001271361 0.002037609

MIR-096-P 0.044343087 0.741084661 0.013738788 0.010632825 0.04503338

MIR-098 0.665067427 0.813998065 0.484337972 1.85252212 0.976102846

MIR-099a 0.00478524 0.002577298 0.003095662 0.00515806 0.007069699

MIR-099b 0.281366021 0.300048219 0.151934828 0.216656852 0.188814317

MIR-100 0.11912974 0.048838553 0.138879881 0.98025892 0.49795372

MIR-101-1 0.000949648 0.002790775 0.000239699 0.002136586

MIR-101-2 0.051854447 0.074882389 0.011944485 0.071704341 0.12253014

MIR-103-1,2 0.264510064 0.578820037 0.101264508 0.591232003 0.555660876

MIR-105-1,2 0.012632483 0.015088684 0.005728648 0.001913748 0.002636037

MIR-106a-P 0.000406344 0.000325471

MIR-106b 0.072825223 0.147488132 0.021052852 0.378509986 0.180477022

MIR-107 0.449040669 0.793146498 0.314224161 1.564766912 1.264302396

MIR-108 0.003615312 0.022703519 0.000660336 0.000436892 0.002225968

MIR-122a 0.003027487

MIR-124a-1,2,3 0.00736493 0.007949146 0.005037345 0.004510536

MIR-125a 0.042875566 0.052009492 0.015719373 0.120851582 0.079071772

MIR-125b-1 0.146649344 0.016371477 0.166565962 0.486989567 0.243003175

MIR-125b-2 0.000902296 0.005595133 0.013831283 0.012544803

MIR-126 0.066831266 0.071358335 0.113775239 0.460292477 0.217992978

MIR-127 1.742168323 1.776435453 0.721081143 0.359269724 0.732704595

MIR-128a 0.034823814 0.032421312 0.017142704 0.060452917 0.048565347

MIR-128b 0.003209529 0.010520126 0.003821411 0.001279039 0.001034149

MIR-129-2 0.023414232 0.216043356 0.002834036 0.006121459 0.017715163

MIR-130a-P 0.030384798 0.201631545 0.001161742 0.003852122 0.027757839

MIR-130b 0.000470602 0.013946581 0.000332304 0.00369559 0.00052755

MIR-132 0.023327112 0.008476041 0.06810448 0.09817461 0.049866874

MIR-133a-1,2 0.018503045 0.029893254 0.004880026 0.009463387 0.010844644

MIR-133b 0.004548681 0.047295698 0.006441822 0.002140901 0.006807645

MIR-134 0.039301536 0.12592763 0.015673058 0.029215915 0.036916871

MIR-135a-1,2 0.049037934 0.019368188 0.001443465 0.012758094

MIR-135b-P 0.007500401 0.068118726 0.00181632 0.082854655

MIR-136 0.025374637 0.000760031 0.033544267 0.051625146 0.016697548

MIR-137 0.001529667 0.004043845 0.000256484 0.000208251 0.000691625

MIR-138-1,2 0.001700043 0.001326426

MIR-139 0.005898286 0.04686726 0.000384512 0.000465882 0.003734112

MIR-140

MIR-141 0.006446387 0.002644701 0.00112953 0.00473075 0.002419915

MIR-142-P 0.014210548 0.039088208 0.000691913 0.00042035 0.016115894

MIR-143 0.014404601 0.033038174 0.012179794 0.010536469 0.052912268

MIR-144 0.000205069

MIR-145-P 0.039513735 0.09587904 0.026225081 0.007790487 0.229164515

MIR-146 0.007052113

MIR-147 0.001636001 0.001782 0.011373709

MIR-148a-P 0.003319025 0.004575077 0.002577803 0.001173523 0.002084363

Continued

186

Table A. continued

MIR-148b-P 0.017268404 0.099431706 0.005512634 0.006305899 0.035077374

MIR-149 0.021688544 0.030066052 0.001459487 0.003403049 0.027743278

MIR-150 0.026248677 0.06441595 0.016791047 0.034768985 0.028912478

MIR-151 0.000390508 0.005797014 0.002143134 0.00038253

MIR-152 0.012879108 0.009310115 0.019896349 0.025789306 0.036431989

MIR-153-1,2 0.000402803 0.018667704 0.000249464 0.020269148 0.02211369

MIR-154 0.014063958 0.015213256 0.061518591 0.021097028

MIR-155 0.01728457 0.024495003 0.019151551 0.125347947 0.149013771

MIR-181a,c 0.072811292 0.038602812 0.022991741 0.190192501 0.141687321

MIR-181b-1,2 0.008649896 0.00858242 0.002383363 0.001216357

MIR-182 0.191805636 0.340861431 0.014243145 0.621496542 0.260557117

MIR-183 0.006405074 0.015948911 0.000630222 0.008188999 0.014005294

MIR-184 0.01502821 0.088288159 0.006684394 0.007154875 0.008094707

MIR-185 0.387898478 0.366531798 0.27972954 0.176576073 0.198324054

MIR-186-P 0.434041537 0.534320683 0.046497083 0.020914854 0.629861297

MIR-187 0.001018437 0.001032328

MIR-188b-P 0.00051732 0.003991716 0.000334174 0.000176922

MIR-190 0.000131644

MIR-191

MIR-192 0.00392765 0.002466196 0.001903334 0.001777137

MIR-193 0.000632672 0.006792337 0.008818246 0.001957129 0.013948933

MIR-194-1,2 0.000564285 0.003288802 0.003126241 0.000244758

MIR-195-P 0.113982917 0.268037037 0.014028718 0.015097425 0.084560755

MIR-196a-1 0.008944596 0.031997916 0.004074153 0.009249766

MIR-196a-2 0.012494622 0.058818417 0.004522012 0.030699013

MIR-196b 0.128627589 0.870294009 0.012715306 0.188282167 0.03337612

MIR-197 0.060867293 0.581706677 0.002985747 0.021805476 0.071213944

MIR-198 0.038616066 0.029845263 0.003660028 0.000317785 0.008177772

MIR-199a-1-P 0.187336318 0.676234614 0.013107665 0.005886626 0.060755573

MIR-199a-2-P 0.006763288 0.027034458 0.023794889 0.001475803 0.051922371

MIR-199b-P 0.037678936 0.131216156 0.014612973 0.008295305 0.04063218

MIR-200a-P 0.593061868 9.898159357 0.098839363 0.15236382 0.415450376

MIR-200b 0.013768274 0.068792723 0.01161234 0.035155574 0.030538618

MIR-200c 0.010609037 0.004393416 0.007098808 0.000382971

MIR-203 0.004446687

MIR-204 0.006929214 0.038646572 0.001482941 0.008689894 0.012842408

MIR-205 0.000594056 0.00161093 0.0007031 0.00022595 0.000743754

MIR-206 0.005270811 0.000159631

MIR-208 0.000295565 0.001947902 0.001422938 0.000332861

MIR-210 0.064894927 0.402440183 0.01932195 0.038292755 0.467524077

MIR-211 0.113925533 0.242531286 0.035062982 0.012392493 0.090443527

MIR-212 0.60471699 0.043223637 1.613536283 2.752592926 0.618693838

MIR-213 0.006946979 0.002607694 0.00318656 0.078152767 0.080824196

MIR-214 0.062290243 0.133342656 0.030005744 0.009672166 0.03038799

MIR-215 0.007927032 0.024192694 0.006077755 0.016813036

MIR-216 0.053821784 0.007802998 0.003311114 0.001114756 0.003314349

Continued

187

Table A. continued

MIR-217

MIR-218-1,2 0.016590211 0.005959881 0.025820487 0.25448319 0.103025443

MIR-219-1,2 0.007534375 0.007584828 0.000503811 0.002456052

MIR-220 0.000314305 0.001419836 0.01530923 0.000500937

MIR-221 0.019540491 0.030082364 0.016909122 0.07809036 0.048878458

MIR-222-P 0.019462651 0.011043906 0.009277357 0.007292238 0.013609285

MIR-223 0.001878422 0.000713941

MIR-224 0.037116964 0.040680783 0.005497194 0.011878852 0.033868786

MIR-296 0.000550249 0.032697537 0.001220638 0.00037179

MIR-299-P 0.00960382 0.047632886 0.005999488 0.008632112 0.003551492

MIR-301 0.006077179 0.023034128 0.014709164 0.037592125 0.044428048

MIR-302 0.008741421 0.003152153 0.000474752

MIR-302b 0.016776534 0.022288453 0.005663282 0.001113922 0.004483787

MIR-302c 0.000880399 0.007049097

MIR-302d 0.000290718 0.00433254 0.000392968

MIR-320 0.005868675 0.020592043 0.00315622 0.003536285 0.007851699

MIR-321 1.863159286 1.138156755 5.177203472 3.505016581 3.022862945

MIR-323 0.008347781 0.01736615 0.028916636 0.098556803 0.045511504

MIR-324-P 0.023062089 0.062842647 0.006043123 0.007497513 0.01719757

MIR-325 0.006720909 0.007139218 0.005650405 0.011242937 0.021111349

MIR-326-P 0.001140307 0.000423802 0.0025738

MIR-328 0.135299369 0.114523119 0.005052671 0.003774015 0.010919246

MIR-330 0.000267543 0.018177741 0.002583705 0.007034458

MIR-331-P 0.0163592 0.038865187 0.002931579 0.004649203 0.004425099

MIR-335 0.000374453

MIR-337 0.009114783 0.032840827 0.009765059 0.005351827 0.001614225

MIR-338 0.000399859 0.033035346 0.000240558 0.003445407 0.005257115

MIR-339 0.278673267 0.204247634 0.138118791 0.125824151 0.215747698

MIR-340 0.113907766 0.134223275 0.083617199 0.143854252 0.150457932

MIR-342 0.001610873 0.014855045 0.00657685 0.023631521 0.0167211

MIR-345 0.025482913 0.097940425 0.001370104 0.001061799 0.011535878

MIR-346 0.695879069 0.807154228 0.535144542 0.325263033 0.423613382

MIR-361 0.024530059 0.02535974 0.018478552 0.010103635 0.013820878

MIR-367 0.008643849 0.002338299 0.003248284

MIR-368 0.004417447 0.002818706 0.001084104 0.003028076

MIR-369 0.021602177

MIR-370 0.116781449 0.019463565 0.052653747 0.226491886 0.109222468

MIR-371 0.004066243 0.037174155 0.003501078 0.005018484 0.001924185

MIR-372

MIR-373 0.005607757 0.00323157 0.006648237 0.007168144 0.001573446

MIR-374-P 0.0112507 0.001301029

MIR-375 0.040484908 0.014356519 0.008896268 0.025434037 0.004616719

MIR-376 0.25573429 0.071457204 0.095333364 0.748915716 0.231732945

MIR-377 0.009052823 0.002112221 0.010919401 0.000940251 0.001911933

MIR-378 0.003330636 0.000586207

MIR-379 0.126584048 0.02556935 0.052139191 0.211128504 0.110762511

Continued

188

Table A. continued

MIR-380 0.036233627 0.008850289 0.016818181 0.075804341 0.021945768

MIR-381 0.005881141

MIR-382 0.000528506 0.000666256 0.001181835 0.004237192 0.001681083

MIR-383 0.000522747 0.002064121 0.001005945

MIR-384 0.001201817 0.00031384

MIR-422b 0.001292978 0.025362526 0.000857448 0.004619174

MIR-423 0.001280638 0.005961579 0.002559155 0.002873356

MIR-424 0.017288159 0.018592113 0.037290715 0.058462368

MIR-425 0.004472042 0.005050771 0.006491324

18S rRNA (CT) 7.43077495 7.5112732 7.71568895 7.4559257 6.83367

Tissue Type Pancreatic Cancer Cell Lines

miRNAs Panc-1 HS766T MIA PaCa-2 HPAF-II BxPC-3

let-7a-1* 0.014689983 0.029424063 0.026016543 0.021891226 0.054560029

let-7a-2-P 1.215614736 0.951875153 0.170737643 0.218718411 0.382668146

let-7a-3* 0.016761953 0.007213141 0.006991831 0.011108887 0.005784802

let-7b* 0.060569406 0.023890217 0.004356528 0.006321863 0.002151561

let-7c* 0.000224922

let-7d* 0.052034005 0.128278542 0.082853392 0.102022769 0.152568361

let-7e* 0.001029079 0.002531811

let-7f-1* 0.050880532 0.102415662 0.05535581 0.063213218 0.094124116

let-7f-2* 0.006086532 0.001937428 0.003713729 0.009928174 0.003426986

let-7g* 0.026948786 0.041999072 0.027204065 0.040502986 0.032870386

let-7i* 0.035329021 0.075670814 0.062553051 0.055809211 0.060615086

MIR-001-1 0.084373489 0.074377407 0.038418142 0.052467308 0.043130634

MIR-001-2 0.114839795 0.11923323 0.15254339 0.078857242 0.089589329

MIR-007-1 0.033656817 0.04559057 0.043051702 0.012926357 0.048478293

MIR-007-2 0.063038677 0.055770413 0.014865544 0.008825643 0.016855891

MIR-007-3 0.01656259 0.013061064 0.004597732 0.005322429 0.005645176

MIR-009-1-P 1.965336801 1.113472764 0.454012546 0.209237025 0.599450993

MIR-009-2-P 2.510819936 2.186238461 0.358302514 0.644507061 0.5289729

MIR-009-3-P 0.030135098 0.03161609 0.002268181 0.002355114 0.004251714

MIR-010a,b 0.178421647 0.020252717 0.016980739

MIR-015a 0.132661539 0.109618847 0.028228085 0.003701092 0.031254965

MIR-015b 0.227935662 0.141716512 0.434778369 0.127119219 0.358185222

MIR-016-1 0.115393396 0.15607315 0.195903974 0.008982745 0.029782996

MIR-016-2 0.416784511 0.406453515 0.176315727 0.179994418 0.143718403

MIR-017-P 0.614890776 0.736865273 0.452785941 0.300975627 0.258729367

MIR-018 0.421903678 1.901870835 1.277508216 0.298697707 0.351443145

MIR-019a-P 0.147038776 0.73395869 0.327244209 0.086583718 0.073681958

MIR-019b-1-P 0.102008945 0.484021242 0.11768722 0.106247262 0.126697479

MIR-019b-2-P 0.002367534 0.000939725 0.000633613 0.000516091

MIR-020 0.000896613 0.005801776 0.006423023 0.000710354 0.002237857

MIR-021 3.760822115 9.582149147 1.972360915 0.599660383 0.91993971

MIR-022-P 0.264434363 0.210206731 0.37645402 0.490434906 0.528786855

MIR-023a 0.416988664 0.38517014 0.109734195 0.174904652 0.117583475

Continued

189

Table A. continued

MIR-023b-P 0.486750906 0.546206644 0.169812677 0.458434514 0.354744868

MIR-024-1,2 1.578850499 1.155728696 1.265184748 0.97456078 0.842553802

MIR-025 0.208011842 0.348605629 0.336704421 0.223547462 0.502601966

MIR-026a-1,2 0.071196596 0.065274521 0.019025228 0.024919641 0.036988631

MIR-026b 0.699443326 0.700339454 0.136718234 0.274594012 0.305880113

MIR-027a, b 0.507591589 0.574960707 0.165823637 0.181005014 0.223834251

MIR-028 0.020922594 0.008321381 0.005522501 0.009275158 0.006113161

MIR-029a,c 0.117629887 0.715769398 0.295527967 0.165642188 0.097988226

MIR-029b-1,2 0.008302405 0.014061451 0.000427962 0.000708616 0.005549684

MIR-030a,e 0.15955172 0.119571359 0.257736107 0.100822817 0.098816839

MIR-030b 0.44866796 0.549599947 0.126600374 0.139861624 0.253051638

MIR-030c-1,2 0.390038264 0.209342519 0.0505533 0.060380084 0.109786283

MIR-030d 0.007240289 0.009241507 0.017006606 0.00041239 0.027582398

MIR-031-P 2.057803277 1.936402376 0.765265396 1.067807117 0.974132362

MIR-032 0.024433402 0.088664093 0.108435539 0.015955367 0.035594934

MIR-033 0.011418204 0.005042666 0.000995876 0.004200039 0.003459053

MIR-034a 0.048000794 0.132358318 0.041085997 0.130966893 0.144220507

MIR-034b 0.038106266 0.049876577 0.0066778 0.013846821 0.011676791

MIR-034c

MIR-092-1 0.012733025 0.026810311 0.028767339 0.010579106 0.01232452

MIR-092-2-P 0.215627647 0.145450965 0.022954647 0.0584104 0.065666584

MIR-093 0.338061603 0.31416193 0.104214366 0.141346451 0.218977223

MIR-095 0.004024628 0.003257062 0.001209885 0.002364665 0.002491766

MIR-096-P 9.448907745 8.907741976 2.852457852 3.808336791 4.079556212

MIR-098 1.788369776 2.601441508 0.92821928 1.348737949 1.056971678

MIR-099a 0.024845684 0.023788412 0.004336244 0.002090208 0.002820906

MIR-099b 0.149972467 0.140219925 0.317633959 0.152413919 0.297243099

MIR-100 0.87253419 1.706741739 0.003376366 0.005179794 0.001180531

MIR-101-1 0.01979219 0.010725657 0.00399536 0.005549358 0.005533284

MIR-101-2 0.082452273 0.173813346 0.063388703 0.069489416 0.038273409

MIR-103-1,2 1.454256819 1.633027708 0.709262251 0.767925132 0.858795013

MIR-105-1,2 0.084867681 0.08865383 0.024232475 0.061406346 0.023827596

MIR-106a-P 0.04143455 0.04303069 0.004276059 0.007400803 0.011686354

MIR-106b 0.318227533 0.874255135 0.255560375 0.175975998 0.620078262

MIR-107 1.167490709 1.737092127 1.137013646 0.689367203 0.990919124

MIR-108 0.147506156 0.104290581 0.053001062 0.042003652 0.080452341

MIR-122a 0.046206899 0.034778639 0.001876223 0.003857975 0.008251306

MIR-124a-1,2,3 0.046255687 0.04093469 0.005467568 0.011906941 0.011735814

MIR-125a 0.34411366 0.119008066 0.051784713 0.084178585 0.179638965

MIR-125b-1 0.115293179 0.05919954 0.005196338 0.00382292 0.004344772

MIR-125b-2 0.036297842 0.054503484 0.018430826 0.012933007 0.015347987

MIR-126 0.026105382 0.069834065 0.026173906 0.018848004 0.007130457

MIR-127 2.991003439 2.85193731 1.159040974 0.927787343 0.989493558

MIR-128a 0.10598989 0.082129611 0.095090272 0.070300734 0.052004426

MIR-128b 0.059616503 0.042031544 0.017719148 0.01749488 0.015117734

MIR-129-2 3.363711724 2.533240886 1.104991345 1.278370985 1.718137168

Continued

190

Table A. continued

MIR-130a-P 4.292721475 2.960371576 0.780075987 1.004394177 1.208414348

MIR-130b 0.040522207 0.036931298 0.0187605 0.020251633 0.015256478

MIR-132 0.004581836 0.000275392 0.002125923 0.001520406 0.003940443

MIR-133a-1,2 0.260091484 0.246877587 0.104452474 0.119490603 0.09496612

MIR-133b 0.655079574 0.354244723 0.166671816 0.205001102 0.255693204

MIR-134 1.355103052 1.915921922 0.110267655 0.231476729 0.303297649

MIR-135a-1,2 0.038550184 0.045445784 0.014733087 0.041729431 0.047340286

MIR-135b-P 0.135599012 0.051358247 0.02634575 0.061940274 0.046744444

MIR-136 0.041367084 0.020137666 0.02994192 0.005384869 0.006809345

MIR-137 0.006967067 0.00378194 0.262315156 0.001022685 0.004195416

MIR-138-1,2 0.022761289 0.031557665 0.004548506 0.005390234 0.013908231

MIR-139 0.990850682 0.837172757 0.138702103 0.199450075 0.213728502

MIR-140 0.000494714 0.000790884 0.000185383

MIR-141 0.047453443 0.021268208 0.013292222 0.014359502 0.01846378

MIR-142-P 1.84510839 1.72689668 0.269200234 0.316402756 0.370671916

MIR-143 0.146796306 0.121602835 0.045282316 0.078702216 0.090456546

MIR-144 0.004273995 0.000211521 0.001611783 0.000196573

MIR-145-P 0.279932824 0.19608088 0.03118981 0.049227783 0.073245134

MIR-146 0.008739174 0.002933663 0.001122817 0.001402907 0.003093878

MIR-147 0.06800634 0.057225353 0.016070304 0.008937955 0.007352174

MIR-148a-P 0.034389253 0.035980568 0.01310991 0.020190355 0.008971872

MIR-148b-P 0.160079899 0.116090938 0.054532385 0.098589347 0.100347336

MIR-149 0.850694817 0.798509662 0.211119474 0.186259262 0.305890291

MIR-150 0.252732494 0.263711843 0.110007674 0.108335545 0.13836186

MIR-151 0.076475454 0.114664068 0.012730502 0.025198158 0.047565446

MIR-152 0.03298394 0.049564699 0.004510791 0.003247903 0.021062109

MIR-153-1,2 0.023889021 0.042377411 0.016159457 0.003848826 0.010305503

MIR-154 0.036697614 0.027289699 0.001752782 0.002042525 0.003501138

MIR-155 0.032031431 0.180881626 0.00901883 0.033454233 0.033461971

MIR-181a,c 0.111326509 0.077604266 0.029614213 0.039796147 0.034017884

MIR-181b-1,2 0.059067365 0.022395129 0.007794791 0.038861963 0.034669749

MIR-182 0.969931703 1.538739241 2.387781077 0.532845457 0.925524906

MIR-183 0.064979077 0.035714761 0.027999581 0.014641798 0.016832949

MIR-184 0.789539894 0.65826882 0.331164187 0.317596423 0.347606923

MIR-185 1.592553202 1.452835408 0.619911456 0.835331397 0.412348544

MIR-186-P 0.887603689 0.958754779 0.802428954 0.828483327 0.908724713

MIR-187 0.056302296 0.021898354 0.009822807 0.033257973 0.050340268

MIR-188b-P 0.090124369 0.093399509 0.010901066 0.015880285 0.006715506

MIR-190 0.002650681 0.000683253 0.000248049 0.00023973

MIR-191 0.027667777 0.01048616 0.001033269 0.005814767 0.011002805

MIR-192 0.238862961 0.213643565 0.074683848 0.104687063 0.097302266

MIR-193 0.130988455 0.089787491 0.024510336 0.01919638 0.012208246

MIR-194-1,2 0.034644114 0.031304878 0.006601834 0.008154661 0.011534184

MIR-195-P 4.045403391 1.463522849 0.78508843 0.993658536 1.243551899

MIR-196a-1 0.183169356 0.162622273 0.065926992 0.023597586 0.077905539

MIR-196a-2 0.144371669 0.06813804 0.0331909 0.021441046 0.044720735

Continued

191

Table A. continued

MIR-196b 0.567789104 2.190982209 0.071559696 0.372834965 0.768942017

MIR-197 2.886561712 8.189062333 1.49356401 2.320790137 2.539767123

MIR-198 0.013737255 0.000825324 0.010110881 0.037196239 0.030077943

MIR-199a-1-P 1.763449876 1.834023684 0.575726119 1.387842228 1.08485725

MIR-199a-2-P 0.160294804 0.160347389 0.050400018 0.092224672 0.051054333

MIR-199b-P 1.432595256 1.335762733 0.499945095 0.65931649 0.73065979

MIR-200a-P 33.89899434 37.57524926 15.35388741 21.84227266 22.08802038

MIR-200b 0.052592525 0.04161224 0.029261267 0.038537013 0.047395593

MIR-200c 0.077414953 0.053718032 0.006388538 0.012474161 0.011491992

MIR-203 0.012564025 0.012226263 0.000366726 0.019008237 0.005788181

MIR-204 0.91047264 1.174366948 0.178871082 0.136685259 0.297152561

MIR-205 0.007647747 0.012209909 0.001356812 0.003122242 0.006691474

MIR-206 0.098836523 0.063932188 0.017067506 0.020759789 0.023259949

MIR-208 0.059670951 0.050966065 0.013181479 0.008854049 0.018139063

MIR-210 8.069417694 11.23286292 0.793942026 1.336135729 2.29606617

MIR-211 1.785009892 1.479762116 0.635122845 0.412873884 1.056524864

MIR-212 0.451087299 0.934878166 0.112668964 0.057055749 0.136171455

MIR-213 0.120233103 0.131966191 0.011870171 0.014735763 0.021443619

MIR-214 1.025481218 1.043302319 0.283351073 0.290716844 0.451570523

MIR-215 0.024187544 0.041476135 0.051919708 0.035676368 0.02355323

MIR-216 0.149841959 0.103966797 0.047588856 0.051919528 0.035701988

MIR-217 0.003877702 0.004875057 0.002679534 0.001148097 0.002268328

MIR-218-1,2 0.018270679 0.01369654 0.005678606 0.001269134 0.005688168

MIR-219-1,2 0.017816436 0.033019058 0.003351322 0.014872284 0.007248844

MIR-220 0.153397999 0.145895245 0.08823957 0.030933172 0.049256493

MIR-221 0.051986779 0.26248698 0.198088642 0.194905346 0.183702189

MIR-222-P 0.104068732 0.167242193 0.184939855 0.141519972 0.099790357

MIR-223 0.023883425 0.0438661 0.01085596 0.002493738 0.0047137

MIR-224 0.082441557 0.083705386 0.044308078 0.069132867 0.06054962

MIR-296 0.105960985 0.006719787 0.017487757 0.007425259 0.047182992

MIR-299-P 0.675010603 0.536266958 0.079293838 0.121553941 0.175746422

MIR-301 0.057561642 0.124495351 0.043526628 0.005133029 0.026028279

MIR-302 0.017007755 0.024180339 0.002229517 0.006394428 0.016328502

MIR-302b 0.180730584 0.175827821 0.023349348 0.055298305 0.059011695

MIR-302c 0.085237794 0.085136186 0.018194769 0.04122325 0.036834277

MIR-302d 0.041030031 0.074029945 0.020333594 0.015939151 0.017445935

MIR-320 0.245108695 0.244671466 0.057031412 0.050273574 0.07436676

MIR-321 4.858343745 2.965308631 0.935444567 0.87030173 0.907855265

MIR-323 0.057981203 0.101093964 0.029696013 0.047848336 0.027498138

MIR-324-P 0.38600771 0.294014104 0.078050845 0.100470723 0.112827193

MIR-325 0.044254472 0.016023418 0.01091732 0.01427224 0.018499688

MIR-326-P 0.063360326 0.051234796 0.005800438 0.006009989 0.005938992

MIR-328 1.195419573 1.758591949 0.292340288 0.443862142 0.67912414

MIR-330 0.227123292 0.178744192 0.049171053 0.032752199 0.082701982

MIR-331-P 0.178113845 0.221228824 0.084231465 0.09833161 0.078404932

MIR-335 0.002140884 0.005067129 0.011269436 0.002848179 0.007332281

Continued

192

Table A. continued

MIR-337 0.325058113 0.281893627 0.049669863 0.0852297 0.128232843

MIR-338 0.530496842 0.379431476 0.043799314 0.060879067 0.075029524

MIR-339 0.738687756 0.406190885 0.213998275 0.153064812 0.20964869

MIR-340 0.115483974 0.177133903 0.19547284 0.110320635 0.098423915

MIR-342 0.203630359 0.173455774 0.053469873 0.047276812 0.133599288

MIR-345 1.625364815 1.735458985 0.365907672 0.501684256 0.425251792

MIR-346 1.265900988 1.193876222 1.214366645 0.608903947 1.383527403

MIR-361 0.073122924 0.058831118 0.025912636 0.036607158 0.036216971

MIR-367 0.001535133 0.005162706 0.022811033 0.009574187

MIR-368 0.002261099 0.001432198 0.000723483 0.000538328

MIR-369 0.004093066 0.000935518 0.00996237

MIR-370 0.210093156 0.109012333 0.019887263 0.022520881 0.027865411

MIR-371 1.011833261 0.709777511 0.132356327 0.2249251 0.244906797

MIR-372 0.004742757 0.003843257 0.000728109 0.002007003

MIR-373 0.213937615 0.191986899 0.01783599 0.055384614 0.069419689

MIR-374-P 0.023350448 0.031589968 0.002495027 0.010228498 0.005226204

MIR-375 0.002678673 0.040655639 0.011090591 0.014533662 0.013451676

MIR-376 0.245514829 0.011812865 0.001363119 0.016815245 0.007531802

MIR-377 0.164414115 0.139027508 0.039130519 0.034602668 0.055716202

MIR-378 0.047020708 0.075951948 0.013409703 0.038895568 0.017880938

MIR-379 0.104241422 0.001057981 0.003631251 0.002226923 0.023643783

MIR-380 0.046779737 0.006165358 0.00311734 0.015082596 0.008442844

MIR-381 0.031302335 0.017096488 0.000278593 0.00513895

MIR-382 0.020188689 0.008611324 0.003163937 0.004260514 0.002420862

MIR-383 0.072073543 0.061676588 0.002356651 0.010283595 0.012549004

MIR-384 0.00090068 0.000585526 0.000158037 0.00141642 0.000503453

MIR-422b 0.283622731 0.272515136 0.083057086 0.151554707 0.193058398

MIR-423 0.157948273 0.128951125 0.017209274 0.047172098 0.05108644

MIR-424 0.011412503 0.027615944 0.001305959 0.001597745 0.005569692

MIR-425 0.039172094 0.010394677 0.021429865 0.028883344 0.029431252

18S rRNA (CT) 7.343109 7.3157717 7.3665025 7.807472 7.29358315

Tissue Type Pancreatic Cancer Cell Lines

miRNAs Mpanc-96 PL45 Panc03.27 Panc10.05

let-7a-1* 0.036952533 0.046147461 0.050414918 0.058756905

let-7a-2-P 0.168434441 0.506043415 0.631018199 0.268278848

let-7a-3* 0.038356385 0.033472766 0.010069662 0.016953198

let-7b* 0.008537471 0.00425231 0.00175498 0.006474351

let-7c* 0.000174829

let-7d* 0.166182235 0.168128542 0.147753122 0.131633374

let-7e* 0.001230644 0.002630083 0.001846209

let-7f-1* 0.133895703 0.145748311 0.155049956 0.164683363

let-7f-2* 0.009513738 0.027067737 0.004253808 0.006391174

let-7g* 0.053536293 0.029966223 0.053932511 0.05206843

let-7i* 0.171302792 0.025608562 0.024245293 0.02795596

MIR-001-1 0.016879583 0.034339624 0.018673032 0.053395657

Continued

193

Table A. continued

MIR-001-2 0.062011262 0.097926903 0.286958402 0.126871218

MIR-007-1 0.039219123 0.046464367 0.083247631 0.069763669

MIR-007-2 0.009033827 0.012699479 0.070005545 0.026587247

MIR-007-3 0.000854203 0.004095028 0.015011527 0.009415688

MIR-009-1-P 0.267408841 0.524550679 1.541344682 0.61424909

MIR-009-2-P 0.205097466 0.583987976 1.583642312 0.896325856

MIR-009-3-P 0.001665989 0.008048949 0.015446042 0.008927851

MIR-010a,b 0.063408786 0.060663122 0.02119504 0.025974652

MIR-015a 0.045213865 0.04149298 0.068289852 0.063560894

MIR-015b 0.188753666 0.574116558 1.055935724 0.479453305

MIR-016-1 0.115963892 0.140884038 0.125929834 0.173592704

MIR-016-2 0.098097492 0.324663604 0.359161227 0.204928099

MIR-017-P 0.61982939 0.42247696 0.8038354 0.473829432

MIR-018 1.099089651 0.426470563 0.950038918 0.785650308

MIR-019a-P 0.2823961 0.133210856 0.437269013 0.275277714

MIR-019b-1-P 0.098420324 0.123493804 0.381636224 0.071499686

MIR-019b-2-P 0.000321462 0.000738694 0.000289451

MIR-020 0.005703424 0.011159178 0.008057201 0.001427686

MIR-021 3.491355029 1.491954015 2.121551234 4.335253089

MIR-022-P 1.058946402 0.123116119 0.376091738 0.149210268

MIR-023a 0.254987348 0.166226012 0.34865994 0.241387641

MIR-023b-P 0.279687575 0.340818386 0.584881199 0.270575332

MIR-024-1,2 4.491900806 0.994272058 1.065213427 2.271743923

MIR-025 0.289961964 0.30807768 0.411187559 0.394759727

MIR-026a-1,2 0.043420949 0.040929563 0.089796188 0.059387052

MIR-026b 0.154611128 0.291118629 0.624139541 0.32750032

MIR-027a, b 0.214589006 0.150052324 0.450931131 0.304433435

MIR-028 0.000937392 0.01202717 0.026102296 0.010506808

MIR-029a,c 0.263219553 0.390939447 0.125706227 0.305149413

MIR-029b-1,2 0.001590337 0.000888185 0.00303903 0.000553909

MIR-030a,e 0.044135614 0.169293275 0.303131991 0.105450637

MIR-030b 0.157991634 0.19505151 0.405413917 0.293680365

MIR-030c-1,2 0.049027876 0.09418183 0.130357367 0.106800234

MIR-030d 0.051848842 0.03095123 0.032656818 0.034803223

MIR-031-P 0.304943119 0.365363664 2.686196826 1.579659067

MIR-032 0.065948816 0.085047968 0.107992013 0.110787208

MIR-033 0.002038838 0.00306635 0.00808488 0.004183629

MIR-034a 0.030340014 0.068892301 0.13728758 0.098841055

MIR-034b 0.002470559 0.006352009 0.025357108 0.036689059

MIR-034c

MIR-092-1 0.033720484 0.014452928 0.026446993 0.030317019

MIR-092-2-P 0.007329335 0.02242087 0.118182434 0.054368383

MIR-093 0.232766214 0.445634573 0.224746962 0.369011509

MIR-095 0.00026051 0.004281519 0.005365045 0.011006196

MIR-096-P 1.831185024 4.815274588 7.150509383 6.912206026

MIR-098 0.881466147 2.490519262 2.641559707 1.560396556

Continued

194

Table A. continued

MIR-099a 0.002548339 0.008901521 0.004835492 0.007042375

MIR-099b 0.256197902 0.74593435 0.425435262 0.293184394

MIR-100 0.061221388 0.111523958 0.224371295 0.202721951

MIR-101-1 0.007186142 0.00727429 0.014404252 0.021762049

MIR-101-2 0.049928264 0.054892736 0.174582096 0.060871563

MIR-103-1,2 0.614871383 1.047206218 1.602468524 1.190551657

MIR-105-1,2 0.021782986 0.076577882 0.087970951 0.042180579

MIR-106a-P 0.006021247 0.00730393 0.040726214 0.014797423

MIR-106b 0.337005506 0.207592765 0.54659627 0.392770156

MIR-107 1.015961385 1.088310007 1.145563967 1.037616783

MIR-108 0.027474843 0.161451256 0.157564619 0.057923967

MIR-122a 0.002018879 0.006303953 0.023069372 0.011620188

MIR-124a-1,2,3 0.004996954 0.007322967 0.045709822 0.017903168

MIR-125a 0.052313644 0.115595654 0.194473437 0.173714155

MIR-125b-1 0.000804773 0.014539955 0.023166157 0.030171176

MIR-125b-2 0.004123797 0.053592932 0.047543108 0.026405087

MIR-126 0.004871651 0.008577804 0.025283798 0.0338066

MIR-127 1.096190905 1.837541801 1.702771702 1.483041757

MIR-128a 0.064635814 0.197238429 0.128821207 0.197510153

MIR-128b 0.011056063 0.014506382 0.039473548 0.019889947

MIR-129-2 0.531237564 1.705443629 2.76603233 1.658259418

MIR-130a-P 0.406529533 1.136378601 2.629150119 1.459585495

MIR-130b 0.019142082 0.003902893 0.047719708 0.029610789

MIR-132 0.004356065 0.0007963 0.004118003 0.002465293

MIR-133a-1,2 0.076996307 0.086714861 0.301318993 0.189432033

MIR-133b 0.129994913 0.234164303 0.380307295 0.33873682

MIR-134 0.075252669 0.238135658 0.771499977 0.298946084

MIR-135a-1,2 0.097811443 0.005371444 0.054747979 0.03914037

MIR-135b-P 0.013633432 0.07573007 0.085506122 0.084167304

MIR-136 0.001334299 0.002605869 0.01301952 0.007236146

MIR-137 0.001628188 0.01065173 0.007767524 0.007860235

MIR-138-1,2 0.00098652 0.000869442 0.037960124 0.006028892

MIR-139 0.075996304 0.14764824 0.501924933 0.253455736

MIR-140

MIR-141 0.013502558 0.032151126 0.036954197 0.045835103

MIR-142-P 0.127289566 0.492307482 0.750806747 0.471383191

MIR-143 0.033316763 0.062052067 0.163513598 0.095378818

MIR-144 0.001879816

MIR-145-P 0.022719156 0.038725417 0.095554228 0.068384716

MIR-146 0.001585507 0.002184824 0.005301194 0.004697727

MIR-147 0.000793618 0.025616001 0.029463508 0.028573859

MIR-148a-P 0.009562732 0.022384611 0.027245221 0.018279067

MIR-148b-P 0.070475351 0.063615762 0.170614896 0.149152516

MIR-149 0.085460056 0.182809072 0.683557933 0.26962669

MIR-150 0.059042252 0.199816215 0.27137656 0.117294252

MIR-151 0.025995723 0.02407893 0.079652697 0.041989174

Continued

195

Table A. continued

MIR-152 0.010908606 0.013413417 0.01066396 0.032411806

MIR-153-1,2 0.116845864 0.002953036 0.008482951 0.010924694

MIR-154 0.000291465 0.013117986 0.007917705 0.007825175

MIR-155 0.016089386 0.043714602 0.05183188 0.030752846

MIR-181a,c 0.059130368 0.022451125 0.030012848 0.031324108

MIR-181b-1,2 0.026068865 0.049510131 0.054644232 0.028201471

MIR-182 1.630877102 1.254717928 0.5227306 1.240326739

MIR-183 0.038337806 0.027194356 0.013066885 0.052034588

MIR-184 0.094840006 0.534222842 0.791623047 0.432025454

MIR-185 0.478874185 1.151945186 1.153850266 0.84028534

MIR-186-P 0.684479894 0.693917026 1.265761875 0.756385556

MIR-187 0.003844267 0.021046885 0.073001024 0.037118423

MIR-188b-P 0.005062757 0.012186588 0.032858946 0.008696932

MIR-190 0.002807551 0.000237945 0.000601121

MIR-191 0.001163652 0.001602566 0.017670627 0.007974997

MIR-192 0.020216605 0.079064593 0.176425318 0.090882524

MIR-193 0.002948186 0.016055635 0.05243682 0.039464963

MIR-194-1,2 0.005533913 0.011547102 0.044280659 0.010839423

MIR-195-P 0.350408474 0.96448892 2.672581641 1.324131331

MIR-196a-1 0.01698214 0.093533668 0.191996514 0.091833365

MIR-196a-2 0.052658695 0.039967775 0.067355241 0.061740361

MIR-196b 3.736652932 0.49512547 0.492338348 0.34051806

MIR-197 1.369599015 2.514929694 8.535493209 3.578360453

MIR-198 0.001236303 0.101539965 0.065339717 0.044099381

MIR-199a-1-P 0.495837252 1.450978929 1.982502272 2.221685677

MIR-199a-2-P 0.020536556 0.070677341 0.127759327 0.102305827

MIR-199b-P 0.177735783 0.603460426 1.658551166 0.742590734

MIR-200a-P 8.22191564 21.15355259 32.34254987 22.02274227

MIR-200b 0.016848857 0.031719956 0.076784 0.049138384

MIR-200c 0.002160144 0.034314248 0.013605031 0.011832459

MIR-203 0.004350579 0.001443964 0.001990637 0.005267192

MIR-204 0.11033528 0.270174153 0.829592939 0.385331683

MIR-205 0.000381588 0.036009992 0.020365182 0.046785968

MIR-206 0.005075737 0.017904513 0.083588572 0.054113926

MIR-208 0.008016233 0.011840986 0.047682147 0.027384014

MIR-210 0.311220192 2.148108804 8.184220526 2.770512199

MIR-211 0.349769663 0.999916181 2.04359742 1.739338488

MIR-212 0.08178038 0.069869667 0.325163453 0.180127795

MIR-213 0.055734601 0.041444388 0.065005834 0.036332784

MIR-214 0.202760997 0.338462304 0.946441027 0.476409379

MIR-215 0.054823778 0.166206657 0.048953235 0.071482937

MIR-216 0.019265428 0.080884079 0.118579253 0.049079359

MIR-217 0.000418496 0.001202333 0.009433799 0.001456757

MIR-218-1,2 0.001495712 0.009202711 0.032168735 0.01780271

MIR-219-1,2 0.011332328 0.006684591 0.030460333 0.011190317

MIR-220 0.021096801 0.029541401 0.139721508 0.066215979

Continued

196

Table A. continued

MIR-221 0.110905865 0.121730329 0.142014291 0.13505334

MIR-222-P 0.112327383 0.190940238 0.132093009 0.063909279

MIR-223 0.007593202 0.007904509 0.021832309 0.014428731

MIR-224 0.157707652 0.106133615 0.118615465 0.095752451

MIR-296 0.008407765 0.030691832 0.098439287 0.056547017

MIR-299-P 0.078299292 0.115255106 0.282519043 0.212813521

MIR-301 0.021283527 0.090568462 0.149821442 0.132081354

MIR-302 0.018505778 0.021012201 0.036365419 0.022461954

MIR-302b 0.017382544 0.078936566 0.117106618 0.049917802

MIR-302c 0.02333714 0.024370558 0.051116311 0.034354686

MIR-302d 0.002463914 0.025930396 0.074527156 0.022004856

MIR-320 0.049871557 0.060541325 0.147684622 0.060940292

MIR-321 2.041175272 1.289958426 1.619070177 1.32337343

MIR-323 0.031151632 0.047227438 0.069135404 0.031733198

MIR-324-P 0.07795982 0.114396123 0.238114523 0.064816221

MIR-325 0.007246477 0.021813016 0.024580814 0.012525133

MIR-326-P 0.004937004 0.005051491 0.012497042 0.008518684

MIR-328 0.142401581 0.389305483 1.208252952 0.546026441

MIR-330 0.024454234 0.032544354 0.138415462 0.08220436

MIR-331-P 0.047200406 0.147267764 0.176748395 0.14511567

MIR-335 0.001089579 0.028130384 0.007656915 0.00838748

MIR-337 0.02737863 0.094483163 0.236712618 0.132575879

MIR-338 0.035246702 0.09626089 0.338815086 0.124527538

MIR-339 0.128454209 0.196915567 0.393681963 0.187664441

MIR-340 0.127528276 0.091999834 0.186578612 0.128098432

MIR-342 0.03043408 0.080770908 0.216630611 0.104742672

MIR-345 0.127470743 0.537801457 1.048298457 0.710367124

MIR-346 1.213669467 2.036278752 2.016020095 1.710536891

MIR-361 0.039135917 0.066620157 0.063305735 0.045357399

MIR-367 0.018859341 0.026131433 0.009801244 0.00997665

MIR-368 0.001189537

MIR-369 0.000283338

MIR-370 0.003686426 0.004071542 0.068177264 0.023037879

MIR-371 0.067913023 0.214636088 0.631794603 0.313783244

MIR-372 0.000994048 0.000750959 0.003778768 0.002828137

MIR-373 0.010972002 0.039190616 0.13619664 0.051928909

MIR-374-P 0.010169867 0.01010349 0.004821966

MIR-375 0.001827666 0.007745586 0.022122688 0.009557382

MIR-376 0.000294884 0.001095805 0.004766586 0.002611058

MIR-377 0.020755595 0.032653344 0.112177327 0.051069959

MIR-378 0.030074469 0.028584088 0.104060108 0.043706699

MIR-379 0.000952635 0.001254 0.005160251

MIR-380 0.000294495 0.00097759 0.00379323 0.000723768

MIR-381 0.000647896 0.003422718 0.012407429 0.00666265

MIR-382 0.004980409 0.003448936 0.046626114 0.006732531

MIR-383 0.004711872 0.011586536 0.053446712 0.026420603

Continued

197

Table A. continued

MIR-384 0.000249289 0.000548724 0.000212704

MIR-422b 0.057932835 0.134893204 0.242676955 0.211581768

MIR-423 0.01027527 0.022001651 0.06636151 0.036148954

MIR-424 0.00931013 0.002139775 0.008987201 0.005215917

MIR-425 0.013000519 0.009358127 0.034758895 0.04344016

18S rRNA (CT) 7.5105845 8.1212795 7.68454695 7.41360115

198

Figure A. Heatmap of miRNA precursor expression in pancreatic samples.

A. The relative expression of 201 miRNA precursors was determined by real-time PCR;

data are presented as ∆CT. Unsupervised hierarchical clustering was performed on a

subset of the entire data set; data are unfiltered. A median expression value equal to one

was designated black; red increased expression; green, reduced expression; grey,

undetectable expression. B. Dendrogram representing the results of hierarchical

clustering analysis of the miRNA precursor expression pattern in 47 samples. Sample

include primary pancreatic tumors (yellow, N = 28), normal pancreatic tissues (blue, N =

6), chronic pancreatitis (orange, N = 4) and pancreatic cancer cell lines (turquoise, N = 9).

199

APPENDIX B


200

miRNAs PANC-1 Miapaca-2 PL45 Mpanc-96

hsa-let-7a 864.050 610.148 692.112 876.530

hsa-let-7b 1474.656 1963.588 2611.949 2520.782

hsa-let-7c 44.810 68.821 97.517 114.943

hsa-let-7d 5.421 93.119 43.893 85.019

hsa-let-7e 24.693 28.415 47.948 32.652

hsa-let-7f 0.000 0.000 0.000 0.000

hsa-let-7g 420.650 442.835 316.674 1081.594

hsa-let-7i 118.281 393.891 63.906 560.419

hsa-miR-001 213.734 0.000 0.000 0.000

hsa-miR-007 79.325 231.578 258.703 220.865

hsa-miR-010a 3098.537 526.233 710.944 3555.518

hsa-miR-010b 208.210 2.341 7.859 155.023

hsa-miR-015a 136.041 194.730 118.999 175.215

hsa-miR-015b 5759.848 5761.402 5575.903 3631.885

hsa-miR-016 3475.243 3487.545 3978.712 3726.583

hsa-miR-017-3p 8.642 13.903 10.035 37.234

hsa-miR-017-5p 766.778 746.268 402.184 695.511

hsa-miR-018 65.312 124.656 25.865 78.355

hsa-miR-018b 0.000 0.000 0.000 0.000

hsa-miR-019a 977.282 2804.102 930.467 2128.957

hsa-miR-019b 5694.475 9111.486 5122.005 11294.600

hsa-miR-020 7364.867 10422.994 5679.185 12659.767

hsa-miR-020b 29.127 32.889 54.914 39.529

hsa-miR-021 2830.742 2438.259 2273.815 4791.171

hsa-miR-022 72.957 81.611 23.991 45.179

hsa-miR-023a 47.623 60.197 84.017 55.265

hsa-miR-023b 86.425 30.806 23.786 310.926

hsa-miR-023bN 2158.286 277.655 590.804 4914.756

hsa-miR-024 15456.092 15628.700 11551.171 23228.328

hsa-miR-025 712.021 739.761 659.609 934.655

hsa-miR-026aN 2092.323 944.888 1946.820 5468.540

hsa-miR-026b 1285.701 864.814 1327.705 3368.339

hsa-miR-026bN 573.340 175.721 0.000 1568.819

hsa-miR-027a 1480.905 2334.120 1474.833 1526.871

hsa-miR-027b 209.614 37.791 72.515 733.133

hsa-miR-027bN 1917.231 336.787 597.086 6020.465

hsa-miR-028 486.117 299.220 302.150 499.902

hsa-miR-029a 1835.877 2770.324 2476.119 3207.799

Continued

Table B. mature miRNA expression in pancreas cell lines.

Data are presented as copies of miRNA per cell.

201

Table B. continued

hsa-miR-029b 30.828 117.666 37.678 49.756

hsa-miR-029c 115.697 143.373 157.860 228.731

hsa-miR-030a-3p 2180.979 1887.253 1471.714 1025.028

hsa-miR-030c 6212.199 3016.941 3929.825 4837.394

hsa-miR-030d 510.943 132.479 442.222 940.854

hsa-miR-030e-3p 346.787 137.825 103.274 207.163

hsa-miR-031 14804.605 7.356 26384.031 14512.570

hsa-miR-032 49.803 125.343 33.579 41.937

hsa-miR-033 1.396 10.720 3.637 0.000

hsa-miR-034a 12.535 0.000 0.000 1.043

hsa-miR-034aN 49.334 0.000 14.296 0.000

hsa-miR-034b 1.687 7.955 0.000 0.000

hsa-miR-092N 6603.685 6110.632 4414.971 8329.002

hsa-miR-093 6586.754 9209.706 5769.697 7367.281

hsa-miR-095 8.873 23.383 31.929 28.131

hsa-miR-096 6653.265 3957.866 7663.497 4879.448

hsa-miR-098 85.958 107.388 110.607 85.914

hsa-miR-099a 5335.978 3.656 975.095 1261.087

hsa-miR-099b 403.800 358.360 380.070 298.054

hsa-miR-100 6756.446 0.000 1057.410 1313.591

hsa-miR-101 2.796 10.780 8.918 8.063

hsa-miR-103 492.989 433.180 284.603 513.420

hsa-miR-105 369.745 186.663 110.401 244.717

hsa-miR-106a 1123.657 510.667 707.918 912.946

hsa-miR-106b 890.556 1546.384 570.629 1003.441

hsa-miR-107 0.000 2.155 0.000 1.869

hsa-miR-108 0.000 0.000 0.000 0.000

hsa-miR-122a 0.000 0.000 0.000 0.000

hsa-miR-124a 0.000 0.000 0.000 0.000

hsa-miR-125a 2895.833 1984.226 3235.627 2885.609

hsa-miR-125b 2495.930 0.000 740.942 858.086

hsa-miR-126 827.387 1208.406 256.223 1151.908

hsa-miR-126* 113.682 160.048 45.041 159.173

hsa-miR-127 1952.821 0.000 0.000 0.000

hsa-miR-128a 0.000 0.000 0.000 0.000

hsa-miR-130a 246.117 301.649 97.281 3.154

hsa-miR-130aN 576.053 815.060 200.421 6.888

hsa-miR-130b 24.032 6.581 2.693 23.622

hsa-miR-132 536.345 352.690 108.404 226.632

hsa-miR-133a 51.221 0.000 4.624 0.000

hsa-miR-134 328.861 0.000 0.000 0.000

Continued

202

Table B. continued

hsa-miR-135a 9.756 18.647 15.274 21.882

hsa-miR-135b 83.673 402.734 540.723 499.139

hsa-miR-139 0.000 0.000 2.053 0.000

hsa-miR-140 419.579 1107.229 136.013 616.546

hsa-miR-141 5.253 2.603 318.910 121.750

hsa-miR-142-3p 0.000 0.000 0.000 0.000

hsa-miR-142-5p 4.454 2.571 2.202 8.790

hsa-miR-143 0.000 0.000 0.000 0.000

hsa-miR-145 1.080 0.000 8.260 6.709

hsa-miR-146 2022.389 241.074 261.745 1268.557

hsa-miR-146b 225.030 22.697 104.692 66.056

hsa-miR-147 0.000 0.000 0.000 0.000

hsa-miR-148a 7.923 19.597 16.990 0.000

hsa-miR-148b 109.169 60.215 31.270 91.221

hsa-miR-149 467.903 425.551 237.590 389.086

hsa-miR-150 5.302 10.623 11.357 418.904

hsa-miR-152 307.416 228.562 121.006 203.444

hsa-miR-152N 282.147 190.061 66.664 110.735

hsa-miR-153 0.000 0.000 0.000 0.000

hsa-miR-154 0.000 0.000 0.000 0.000

hsa-miR-154* 0.000 0.000 0.000 0.000

hsa-miR-155 509.124 10.975 223.197 322.275

hsa-miR-181a 99.637 0.000 59.778 505.728

hsa-miR-181b 713.205 105.385 415.634 2092.094

hsa-miR-181c 12.595 2.880 9.466 33.485

hsa-miR-181d 266.629 45.062 197.154 602.723

hsa-miR-182* 7.227 5.143 8.097 2.959

hsa-miR-183 245.306 401.057 150.450 243.460

hsa-miR-184 15.522 0.000 0.000 0.000

hsa-miR-186 1328.437 2129.946 618.104 1293.600

hsa-miR-187 135.515 11.274 0.000 0.000

hsa-miR-188 383.579 521.567 629.668 397.911

hsa-miR-188b 18.017 15.545 16.555 31.289

hsa-miR-190 0.000 0.000 0.000 0.000

hsa-miR-191 6749.922 2755.005 1256.139 3624.652

hsa-miR-192 107.284 190.029 72.533 14804.427

hsa-miR-193 200.340 130.367 54.820 54.030

hsa-miR-193b 2.319 0.000 1.831 0.000

hsa-miR-194 56.171 42.884 29.659 4032.189

hsa-miR-195 260.372 172.332 165.696 190.578

hsa-miR-196a 2020.987 24.667 12.565 1709.624

Continued

203

Table B. continued

hsa-miR-196b 0.000 0.000 0.000 140.840

hsa-miR-197 822.094 825.354 367.643 501.897

hsa-miR-199a 0.000 0.000 0.000 0.000

hsa-miR-199a* 0.000 0.000 3.487 0.000

hsa-miR-199b 0.000 0.000 0.000 0.000

hsa-miR-199-s 0.000 0.000 0.000 0.000

hsa-miR-200a 6.694 0.000 470.674 1001.577

hsa-miR-200a* 0.000 0.000 1.408 14.060

hsa-miR-200b 15.266 8.503 1433.556 2756.762

hsa-miR-200bN 7.323 3.151 651.476 1247.651

hsa-miR-200c 36.863 32.998 11833.947 4445.524

hsa-miR-200cN 26.774 10.587 12003.373 4263.624

hsa-miR-202 0.000 0.000 0.000 0.000

hsa-miR-202* 0.000 0.000 0.000 0.000

hsa-miR-203 9.644 0.000 422.577 16.102

hsa-miR-204 0.000 0.000 0.000 4.077

hsa-miR-205 0.000 0.000 233.410 0.000

hsa-miR-206 4.067 8.670 0.000 0.000

hsa-miR-208 0.000 0.000 0.000 0.000

hsa-miR-210 191.115 109.303 84.243 393.737

hsa-miR-210N 408.362 173.477 201.879 818.525

hsa-miR-211 0.000 1.738 0.000 0.000

hsa-miR-212 147.366 84.625 80.253 79.186

hsa-miR-213 31.440 0.000 10.486 111.251

hsa-miR-214 9.084 0.000 11.213 6.801

hsa-miR-215 14.019 0.000 0.000 55.928

hsa-miR-216 0.000 0.000 0.000 0.000

hsa-miR-217 0.000 1.014 4.797 0.000

hsa-miR-218 40.258 7.585 9.284 0.000

hsa-miR-219 0.000 0.000 0.000 0.000

hsa-miR-220 0.000 0.000 0.000 0.000

hsa-miR-221 1684.751 5026.917 2247.497 1510.636

hsa-miR-222 10090.208 26850.543 14378.551 15557.420

hsa-miR-223 5.059 6.392 0.000 12.204

hsa-miR-296 0.000 9.428 3.075 3.386

hsa-miR-299 0.000 0.000 0.000 0.000

hsa-miR-299-3p 0.000 0.000 0.000 0.000

hsa-miR-301 289.144 530.584 138.497 245.915

hsa-miR-302a 0.000 0.000 0.000 0.000

hsa-miR-302a* 0.000 0.000 0.000 0.000

hsa-miR-302b 11.686 6.143 14.718 2.928

Continued

204

Table B. continued

hsa-miR-302c 0.000 0.000 0.000 14.714

hsa-miR-302c* 0.000 0.000 0.000 0.000

hsa-miR-302d 0.000 0.000 0.000 0.000

hsa-miR-320 639.095 2664.822 531.259 2487.994

hsa-miR-321 7560.518 3685.384 3385.922 6463.011

hsa-miR-323 30.810 0.000 0.000 0.000

hsa-miR-324-3p 578.447 587.352 150.425 426.858

hsa-miR-324-5p 213.037 309.322 34.634 177.638

hsa-miR-325 1.707 1.227 2.309 1.656

hsa-miR-326 0.000 1.948 0.000 3.732

hsa-miR-328 81.036 157.912 57.546 191.665

hsa-miR-329 0.000 0.000 0.000 0.000

hsa-miR-330 9.699 17.584 4.314 11.096

hsa-miR-331 1741.754 1549.752 1247.694 1732.790

hsa-miR-335 154.016 0.000 74.827 33.366

hsa-miR-337 0.000 0.000 0.000 0.000

hsa-miR-338 0.000 11.127 9.954 0.000

hsa-miR-339 28.274 48.238 33.163 38.287

hsa-miR-340 93.409 87.527 42.445 65.627

hsa-miR-342 1074.575 0.000 0.000 12.481

hsa-miR-345 218.322 512.148 26.062 158.712

hsa-miR-346 5.678 0.000 5.614 7.678

hsa-miR-361 166.953 121.277 124.104 276.048

hsa-miR-362 8.808 15.993 10.860 13.851

hsa-miR-363 0.000 0.000 0.000 0.000

hsa-miR-365 876.765 355.292 346.851 478.339

hsa-miR-367 0.000 0.000 0.000 0.000

hsa-miR-368 0.000 0.000 0.000 0.000

hsa-miR-369 0.000 0.000 0.000 0.000

hsa-miR-369-5p 23.844 0.000 0.000 0.000

hsa-miR-370 480.461 42.935 27.846 54.579

hsa-miR-371 0.000 0.000 0.000 0.000

hsa-miR-372 0.000 0.000 0.000 0.000

hsa-miR-373 0.000 0.000 0.000 0.000

hsa-miR-374 1048.932 1208.292 381.134 1904.360

hsa-miR-375 10.015 28.024 297.572 14.582

hsa-miR-376a 454.336 0.000 0.000 5.407

hsa-miR-376b 0.000 0.000 0.000 0.000

hsa-miR-377 4.017 0.000 0.000 0.000

hsa-miR-378 66.322 82.101 17.322 42.386

hsa-miR-379 87.029 0.000 0.000 7.725

Continued

205

Table B. continued

hsa-miR-380-3p 0.000 0.000 0.000 0.000

hsa-miR-380-5p 13.915 0.000 0.000 0.000

hsa-miR-381 0.000 0.000 0.000 0.000

hsa-miR-382 657.786 0.000 0.000 4.158

hsa-miR-383 0.000 0.000 2.547 0.000

hsa-miR-384 0.000 0.000 0.000 0.000

hsa-miR-409-5p 3.894 0.000 0.000 0.000

hsa-miR-410 0.000 0.000 0.000 0.000

hsa-miR-412 0.000 0.000 0.000 0.000

hsa-miR-422b 57.130 25.544 14.357 20.773

hsa-miR-423 434.353 300.457 231.107 242.732

hsa-miR-425 286.101 96.894 23.421 68.294

hsa-miR-429 0.000 0.000 71.396 126.156

hsa-miR-431 211.319 319.630 348.651 275.681

hsa-miR-432 2.803 0.000 0.000 0.000

hsa-miR-432* 0.000 0.000 0.000 0.000

hsa-miR-433 94.334 0.000 0.000 0.000

hsa-miR-448 0.000 0.000 0.000 0.000

hsa-miR-449 7.233 0.000 9.279 6.456

hsa-miR-450 0.000 0.000 0.000 0.000

hsa-miR-451 0.000 0.000 0.000 0.000

hsa-miR-452 0.000 0.000 0.000 3.134

hsa-miR-452* 5.756 0.000 13.718 131.110

hsa-miR-453 0.000 0.000 0.000 0.000

hsa-miR-485-3p 14.821 0.000 0.000 0.000

hsa-miR-485-5p 0.000 0.000 0.000 0.000

hsa-miR-488 0.000 0.000 3.197 0.000

hsa-miR-489 0.000 4.417 0.000 22.000

hsa-miR-490 0.000 0.000 2.628 1.634

hsa-miR-491 32.483 0.000 49.550 15.174

hsa-miR-492 1.194 0.000 2.088 1.031

hsa-miR-493 0.000 0.000 0.000 0.000

hsa-miR-494 0.000 0.000 0.000 0.000

hsa-miR-495 2.887 0.000 0.000 0.000

hsa-miR-496 2.759 3.250 1.830 2.165

hsa-miR-497 2.028 0.000 0.000 0.000

hsa-miR-498 0.000 0.000 0.000 0.000

hsa-miR-499 0.000 0.000 0.000 0.000

hsa-miR-500 1.027 9.896 0.000 0.000

hsa-miR-501 35.130 82.369 1.463 1.410

hsa-miR-502 32.843 30.164 6.356 1.690

Continued

206

Table B. continued

hsa-miR-503 3.298 0.000 1.836 0.000

hsa-miR-504 0.000 0.000 0.000 0.000

hsa-miR-505 0.000 0.000 0.000 0.000

hsa-miR-506 0.000 0.000 0.000 0.000

hsa-miR-507 0.000 0.000 0.000 0.000

hsa-miR-508 0.000 0.000 0.000 0.000

hsa-miR-509 0.000 0.000 0.000 0.000

hsa-miR-510 0.000 0.000 0.000 0.000

hsa-miR-511 2.567 0.000 0.000 1.062

hsa-miR-512-3p 1.717 1.805 2.120 1.647

hsa-miR-512-5p 0.000 0.000 0.000 0.000

hsa-miR-513 0.000 0.000 0.000 0.000

hsa-miR-514 0.000 0.000 0.000 0.000

hsa-miR-515-3p 0.000 0.000 0.000 0.000

hsa-miR-515-5p 0.000 0.000 0.000 0.000

hsa-miR-516-3p 960.116 1168.878 863.947 1079.079

hsa-miR-516-5p 0.000 0.000 0.000 0.000

hsa-miR-517* 0.000 0.000 0.000 0.000

hsa-miR-517a 0.000 0.000 0.000 0.000

hsa-miR-517b 0.000 0.000 0.000 0.000

hsa-miR-517c 3.523 0.000 0.000 0.000

hsa-miR-518a 0.000 0.000 0.000 0.000

hsa-miR-518a-2* 0.000 0.000 0.000 0.000

hsa-miR-518b 8.894 7.300 1.703 9.942

hsa-miR-518c 0.000 0.000 0.000 0.000

hsa-miR-518c* 0.000 0.000 0.000 0.000

hsa-miR-518d 0.000 0.000 0.000 0.000

hsa-miR-518e 0.000 0.000 0.000 0.000

hsa-miR-518f 9.541 10.827 8.377 10.899

hsa-miR-518f* 0.000 0.000 0.000 0.000

hsa-miR-519a 0.000 0.000 0.000 0.000

hsa-miR-519b 0.000 0.000 0.000 0.000

hsa-miR-519c 0.000 0.000 0.000 0.000

hsa-miR-519d 0.000 0.000 0.000 0.000

hsa-miR-519e 0.000 0.000 0.000 0.000

hsa-miR-519e* 0.000 0.000 0.000 0.000

hsa-miR-520a 0.000 0.000 0.000 0.000

hsa-miR-520a* 0.000 0.000 0.000 0.000

hsa-miR-520b 0.000 0.000 0.000 0.000

hsa-miR-520c 0.000 0.000 0.000 0.000

hsa-miR-520d 0.000 0.000 0.000 0.000

Continued

207

Table B. continued

hsa-miR-520d* 0.000 0.000 0.000 0.000

hsa-miR-520e 0.000 0.000 0.000 0.000

hsa-miR-520f 0.000 0.000 0.000 0.000

hsa-miR-520g 0.000 0.000 0.000 0.000

hsa-miR-520h 0.000 0.000 0.000 0.000

hsa-miR-521 0.000 0.000 0.000 0.000

hsa-miR-522 0.000 0.000 0.000 0.000

hsa-miR-523 0.000 0.000 0.000 0.000

hsa-miR-524 0.000 3.378 0.000 0.000

hsa-miR-524* 0.000 0.000 0.000 0.000

hsa-miR-525 0.000 0.000 0.000 0.000

hsa-miR-525* 0.000 0.000 0.000 0.000

hsa-miR-526a 5.233 0.000 0.000 3.382

hsa-miR-526b 0.000 0.000 0.000 0.000

hsa-miR-526b* 0.000 0.000 0.000 0.000

hsa-miR-526c 0.000 0.000 0.000 0.000

hsa-miR-527 0.000 0.000 0.000 0.000

mmu-miR-129-2 0.000 0.000 0.000 0.000

mmu-miR-137 9.284 90.286 0.000 0.000

mmu-miR-224 0.000 0.000 0.000 161.951

mmu-miR-424 0.000 0.000 0.000 0.000

miRNAs HS766T CaPan-1 SW1990 HPNE

hsa-let-7a 1230.081 1343.353 1263.019 605.962

hsa-let-7b 1870.761 6985.835 8055.159 4187.560

hsa-let-7c 107.477 157.190 297.774 114.545

hsa-let-7d 78.436 247.065 133.216 28.820

hsa-let-7e 45.127 35.538 88.329 30.823

hsa-let-7f 0.000 121.826 71.422 5.908

hsa-let-7g 1161.567 3031.906 873.430 282.382

hsa-let-7i 493.237 544.535 420.083 80.513

hsa-miR-001 0.000 15.051 0.000 0.000

hsa-miR-007 1012.601 937.597 48.221 14.883

hsa-miR-010a 347.279 1954.989 714.767 1394.986

hsa-miR-010b 35.477 86.905 21.067 42.125

hsa-miR-015a 332.178 301.383 296.721 80.922

hsa-miR-015b 4744.868 7517.884 4741.230 1200.995

hsa-miR-016 4131.638 23216.771 14016.092 2512.889

hsa-miR-017-3p 25.878 55.282 21.189 9.003

hsa-miR-017-5p 1380.350 752.711 1293.216 315.911

hsa-miR-018 364.269 350.333 234.236 50.776

Continued

208

Table B. continued

hsa-miR-018b 0.000 0.000 0.000 0.000

hsa-miR-019a 6318.760 1495.374 1293.129 529.616

hsa-miR-019b 23081.349 8009.110 12500.154 3190.566

hsa-miR-020 26691.162 11682.849 17932.811 2490.852

hsa-miR-020b 106.782 111.376 23.815 6.805

hsa-miR-021 8821.574 15409.072 4669.247 2087.704

hsa-miR-022 68.976 319.141 320.670 428.544

hsa-miR-023a 57.620 118.519 165.938 69.734

hsa-miR-023b 58.732 333.215 242.951 30.653

hsa-miR-023bN 537.732 2602.756 4106.748 2134.444

hsa-miR-024 12423.694 24900.704 30833.748 14084.569

hsa-miR-025 1548.002 1750.739 532.804 261.889

hsa-miR-026aN 3038.350 4458.238 2478.393 1521.919

hsa-miR-026b 2099.444 1947.564 1826.644 443.561

hsa-miR-026bN 1025.426 1313.722 1043.522 286.698

hsa-miR-027a 1768.429 3478.949 6465.401 3559.906

hsa-miR-027b 97.459 783.443 528.889 241.408

hsa-miR-027bN 2008.269 4809.437 2516.272 454.336

hsa-miR-028 559.050 1324.563 523.289 361.597

hsa-miR-029a 8124.016 3084.855 5753.919 3515.821

hsa-miR-029b 369.113 86.659 262.013 40.482

hsa-miR-029c 644.829 455.700 302.248 219.232

hsa-miR-030a-3p 19.117 1575.964 5670.309 536.095

hsa-miR-030c 2155.741 9266.575 17675.582 1176.811

hsa-miR-030d 823.568 1815.420 615.465 91.388

hsa-miR-030e-3p 156.083 414.980 604.461 144.368

hsa-miR-031 19942.068 0.000 31129.427 2122.582

hsa-miR-032 194.211 81.655 47.929 23.753

hsa-miR-033 0.000 15.118 0.000 0.000

hsa-miR-034a 2.347 81.504 171.386 65.499

hsa-miR-034aN 108.398 512.232 1058.130 577.213

hsa-miR-034b 0.000 19.256 19.865 12.382

hsa-miR-092N 12125.994 10970.557 18541.166 2862.333

hsa-miR-093 16351.386 18053.346 7062.033 1352.865

hsa-miR-095 33.619 88.552 6.537 0.000

hsa-miR-096 12850.829 23034.217 4325.126 31648.318

hsa-miR-098 258.059 150.612 125.405 19.961

hsa-miR-099a 4416.500 167.790 3575.349 8310.965

hsa-miR-099b 587.805 280.100 567.198 356.239

hsa-miR-100 4187.824 228.749 4369.825 12384.337

hsa-miR-101 41.897 41.807 36.456 5.212

Continued

209

Table B. continued

hsa-miR-103 1125.711 1005.124 731.269 184.123

hsa-miR-105 330.355 0.000 0.000 0.000

hsa-miR-106a 2434.386 2082.088 1167.924 2363.999

hsa-miR-106b 3647.757 3304.220 1315.166 250.698

hsa-miR-107 1.959 15.750 31.695 0.000

hsa-miR-108 0.000 0.000 0.000 0.000

hsa-miR-122a 0.000 0.000 2.636 0.000

hsa-miR-124a 0.000 0.000 0.000 0.000

hsa-miR-125a 3827.792 3359.685 9669.414 5131.341

hsa-miR-125b 1255.494 111.703 1958.705 13036.950

hsa-miR-126 3848.807 577.380 441.293 54.490

hsa-miR-126* 630.679 93.165 69.148 18.806

hsa-miR-127 0.000 24.931 42.675 2273.944

hsa-miR-128a 0.000 0.000 0.000 0.000

hsa-miR-130a 9.510 180.776 1111.568 221.231

hsa-miR-130aN 0.000 427.174 1795.276 397.051

hsa-miR-130b 78.839 355.509 451.201 164.759

hsa-miR-132 462.927 507.215 506.850 581.839

hsa-miR-133a 2.454 4.241 0.000 0.000

hsa-miR-134 2.964 681.593 568.509 1222.877

hsa-miR-135a 11.286 40.137 35.974 0.000

hsa-miR-135b 292.133 1194.599 1716.795 0.000

hsa-miR-139 0.000 0.000 1.739 0.000

hsa-miR-140 1617.380 272.987 554.315 1288.762

hsa-miR-141 9.082 1506.712 1204.831 0.000

hsa-miR-142-3p 5.654 11.362 5.569 0.000

hsa-miR-142-5p 4.260 10.001 3.795 10.382

hsa-miR-143 0.000 0.000 0.000 20.678

hsa-miR-145 5.650 3.945 6.095 302.601

hsa-miR-146 322.064 7358.944 373.788 88.525

hsa-miR-146b 65.501 456.306 130.435 34.729

hsa-miR-147 0.000 0.000 0.000 0.000

hsa-miR-148a 234.763 1630.279 308.654 0.000

hsa-miR-148b 148.676 372.873 223.158 50.074

hsa-miR-149 93.256 283.171 1061.771 212.812

hsa-miR-150 10.961 18.824 169.116 15.944

hsa-miR-152 628.287 523.679 465.356 1032.125

hsa-miR-152N 599.658 692.663 556.732 1135.140

hsa-miR-153 0.000 7.434 0.000 0.000

hsa-miR-154 0.000 0.000 0.000 0.000

hsa-miR-154* 0.000 0.000 0.000 8.270

Continued

210

Table B. continued

hsa-miR-155 2137.202 188.687 583.550 294.940

hsa-miR-181a 17.400 964.439 904.511 356.895

hsa-miR-181b 266.273 1637.691 2029.040 393.906

hsa-miR-181c 41.747 39.454 47.768 9.065

hsa-miR-181d 362.719 741.119 1479.025 383.596

hsa-miR-182* 24.720 13.045 7.770 2.086

hsa-miR-183 565.677 198.625 266.500 20.418

hsa-miR-184 0.000 27.011 15.719 13.788

hsa-miR-186 2176.914 3285.703 1386.103 1415.933

hsa-miR-187 0.000 0.000 0.000 0.000

hsa-miR-188 559.796 379.661 0.000 0.000

hsa-miR-188b 23.751 28.448 33.452 34.604

hsa-miR-190 0.000 25.343 1.004 1.287

hsa-miR-191 4498.375 7857.945 2541.623 1219.360

hsa-miR-192 285.059 20713.292 92.498 10.457

hsa-miR-193 47.319 79.671 338.336 16.534

hsa-miR-193b 0.000 1.705 0.000 2.857

hsa-miR-194 78.359 8254.343 41.730 4.993

hsa-miR-195 175.615 310.565 115.463 36.794

hsa-miR-196a 448.196 433.017 217.178 0.000

hsa-miR-196b 15.217 1.432 0.000 0.000

hsa-miR-197 579.670 683.293 473.212 409.397

hsa-miR-199a 0.000 0.000 0.000 4.078

hsa-miR-199a* 0.000 3.552 6.243 615.044

hsa-miR-199b 0.000 0.000 0.000 2.950

hsa-miR-199-s 0.000 0.000 0.000 95.152

hsa-miR-200a 1753.483 10033.353 1240.690 7.685

hsa-miR-200a* 8.560 35.373 0.000 2.569

hsa-miR-200b 1989.668 13394.016 1726.807 0.000

hsa-miR-200bN 1193.297 11574.351 1117.805 0.000

hsa-miR-200c 157.598 25566.636 27898.251 5.807

hsa-miR-200cN 13.356 21426.505 18828.799 11.024

hsa-miR-202 0.000 0.000 1.590 2.351

hsa-miR-202* 0.000 0.000 0.000 0.000

hsa-miR-203 2160.283 6149.604 2850.220 0.000

hsa-miR-204 0.000 0.000 0.000 1073.849

hsa-miR-205 0.000 12.517 1812.285 0.000

hsa-miR-206 2.954 0.000 4.148 0.000

hsa-miR-208 0.000 0.000 0.000 0.000

hsa-miR-210 102.257 806.164 428.513 174.681

hsa-miR-210N 263.965 2223.338 882.036 467.532

Continued

211

Table B. continued

hsa-miR-211 0.000 0.000 0.000 0.000

hsa-miR-212 126.575 78.580 144.966 112.896

hsa-miR-213 10.821 145.462 185.144 66.503

hsa-miR-214 2.098 3.894 1.564 2330.115

hsa-miR-215 6.570 44.638 0.000 2.848

hsa-miR-216 0.000 0.000 0.000 0.000

hsa-miR-217 0.000 0.000 0.000 1.520

hsa-miR-218 1.300 0.000 371.070 168.110

hsa-miR-219 0.000 0.000 0.000 28.468

hsa-miR-220 0.000 0.000 0.000 0.000

hsa-miR-221 4584.006 2795.365 11340.689 6383.703

hsa-miR-222 30537.231 14207.475 50548.416 30388.349

hsa-miR-223 1.246 12.086 6.564 7.594

hsa-miR-296 6.712 922.706 4.709 43.272

hsa-miR-299 0.000 0.000 0.000 0.000

hsa-miR-299-3p 0.000 0.000 66.344 99.348

hsa-miR-301 983.825 199.935 326.238 40.694

hsa-miR-302a 0.000 0.000 0.000 33.565

hsa-miR-302a* 0.000 0.000 0.000 0.000

hsa-miR-302b 8.425 69.915 145.936 173.138

hsa-miR-302c 0.000 0.000 0.000 31.408

hsa-miR-302c* 0.000 0.000 0.000 0.000

hsa-miR-302d 0.000 0.000 1.529 55.058

hsa-miR-320 1161.400 1832.677 2212.398 546.854

hsa-miR-321 4799.042 16652.105 9201.774 4799.142

hsa-miR-323 0.000 0.000 0.000 11.742

hsa-miR-324-3p 1235.105 369.688 422.612 131.295

hsa-miR-324-5p 1036.678 541.087 271.914 107.849

hsa-miR-325 2.574 0.000 0.000 0.000

hsa-miR-326 8.178 1.137 0.000 0.000

hsa-miR-328 224.212 192.866 377.848 102.847

hsa-miR-329 0.000 0.000 0.000 0.000

hsa-miR-330 26.528 21.571 33.648 1.029

hsa-miR-331 1206.615 4792.239 1866.307 493.060

hsa-miR-335 114.012 139.660 321.407 11.130

hsa-miR-337 0.000 0.000 0.000 0.000

hsa-miR-338 0.000 41.650 0.000 0.000

hsa-miR-339 32.684 98.825 78.484 25.924

hsa-miR-340 116.539 100.997 75.191 34.890

hsa-miR-342 7.999 485.986 14.409 243.629

hsa-miR-345 863.672 420.297 490.352 84.162

Continued

212

Table B. continued

hsa-miR-346 10.275 27.980 24.326 0.000

hsa-miR-361 208.257 305.695 309.550 143.547

hsa-miR-362 9.367 3.768 25.012 10.654

hsa-miR-363 0.000 0.000 0.000 0.000

hsa-miR-365 168.404 419.028 26.289 14.586

hsa-miR-367 0.000 3.484 0.000 21.045

hsa-miR-368 0.000 0.000 0.000 0.000

hsa-miR-369 0.000 0.000 0.000 2.792

hsa-miR-369-5p 0.000 0.000 0.000 0.000

hsa-miR-370 19.938 103.808 126.559 530.437

hsa-miR-371 0.000 0.000 0.000 0.000

hsa-miR-372 0.000 258.181 227.498 104.621

hsa-miR-373 0.000 8.521 0.000 0.000

hsa-miR-374 1766.875 795.440 769.622 424.904

hsa-miR-375 9.792 7695.302 233.070 0.000

hsa-miR-376a 0.000 4.989 0.000 379.324

hsa-miR-376b 0.000 0.000 0.000 0.000

hsa-miR-377 0.000 0.000 0.000 4.113

hsa-miR-378 47.868 105.177 28.631 0.000

hsa-miR-379 0.000 7.566 1.621 89.641

hsa-miR-380-3p 0.000 0.000 0.000 0.000

hsa-miR-380-5p 0.000 0.000 7.624 8.699

hsa-miR-381 0.000 0.000 0.000 6.121

hsa-miR-382 0.000 9.162 0.000 254.060

hsa-miR-383 0.000 4.304 6.354 10.057

hsa-miR-384 0.000 0.000 0.000 0.000

hsa-miR-409-5p 0.000 0.000 0.000 0.000

hsa-miR-410 0.000 0.000 3.078 0.000

hsa-miR-412 0.000 0.000 0.000 0.000

hsa-miR-422b 14.104 57.014 28.176 3.285

hsa-miR-423 281.004 611.035 701.210 227.045

hsa-miR-425 80.644 187.599 91.016 20.357

hsa-miR-429 233.282 868.079 0.000 0.000

hsa-miR-431 325.854 102.400 0.000 3.097

hsa-miR-432 0.000 0.000 195.799 227.988

hsa-miR-432* 0.000 1.407 231.798 0.000

hsa-miR-433 0.000 0.000 179.318 46.546

hsa-miR-448 0.000 0.000 0.000 0.000

hsa-miR-449 53.301 7.283 0.000 0.000

hsa-miR-450 0.000 0.000 0.000 3.178

hsa-miR-451 0.000 0.000 0.000 0.000

Continued

213

Table B. continued

hsa-miR-452 0.000 0.000 0.000 8.297

hsa-miR-452* 0.000 52.765 1678.851 197.182

hsa-miR-453 0.000 0.000 0.000 0.000

hsa-miR-485-3p 0.000 0.000 9.359 16.103

hsa-miR-485-5p 0.000 0.000 0.000 0.000

hsa-miR-488 0.000 0.000 0.000 0.000

hsa-miR-489 0.000 4.757 41969.654 1448.000

hsa-miR-490 0.000 1.371 5975.722 3903.870

hsa-miR-491 156.672 0.000 0.000 0.000

hsa-miR-492 0.000 43.254 38.559 3.028

hsa-miR-493 0.000 0.000 0.000 0.000

hsa-miR-494 1.281 0.000 0.000 0.000

hsa-miR-495 0.000 0.000 8.217 0.000

hsa-miR-496 0.000 3.479 5.179 7.017

hsa-miR-497 0.000 1.963 0.000 0.000

hsa-miR-498 0.000 0.000 249.153 300.940

hsa-miR-499 0.000 0.000 1162.533 331.758

hsa-miR-500 0.000 0.000 0.000 0.000

hsa-miR-501 27.548 6.703 3.427 0.000

hsa-miR-502 7.486 4.154 7.851 0.000

hsa-miR-503 0.000 0.000 0.000 6.121

hsa-miR-504 0.000 0.000 0.000 0.000

hsa-miR-505 0.000 0.000 0.000 0.000

hsa-miR-506 0.000 0.000 0.000 0.000

hsa-miR-507 0.000 0.000 0.000 0.000

hsa-miR-508 0.000 0.000 0.000 0.000

hsa-miR-509 0.000 1.460 5.563 0.000

hsa-miR-510 0.000 0.000 0.000 0.000

hsa-miR-511 0.000 0.000 0.000 0.000

hsa-miR-512-3p 7.494 0.000 0.000 6.048

hsa-miR-512-5p 0.000 0.000 0.000 0.000

hsa-miR-513 0.000 0.000 0.000 0.000

hsa-miR-514 0.000 0.000 0.000 0.000

hsa-miR-515-3p 0.000 0.000 0.000 0.000

hsa-miR-515-5p 0.000 0.000 0.000 0.000

hsa-miR-516-3p 1082.658 152.779 55.446 527.907

hsa-miR-516-5p 0.000 0.000 0.000 0.000

hsa-miR-517* 0.000 0.000 0.000 0.000

hsa-miR-517a 0.000 0.000 0.000 0.000

hsa-miR-517b 0.000 0.000 0.000 0.000

hsa-miR-517c 1.670 0.000 0.000 0.000

Continued

214

Table B. continued

hsa-miR-518a 0.000 0.000 0.000 0.000

hsa-miR-518a-2* 0.000 0.000 0.000 0.000

hsa-miR-518b 12.890 6.953 4.007 5.351

hsa-miR-518c 0.000 0.000 0.000 0.000

hsa-miR-518c* 0.000 0.000 0.000 0.000

hsa-miR-518d 0.000 0.000 0.000 0.000

hsa-miR-518e 0.000 0.000 0.000 0.000

hsa-miR-518f 9.566 2.828 1.097 2.149

hsa-miR-518f* 0.000 0.000 0.000 0.000

hsa-miR-519a 0.000 0.000 0.000 0.000

hsa-miR-519b 0.000 0.000 0.000 0.000

hsa-miR-519c 0.000 0.000 0.000 0.000

hsa-miR-519d 1.560 0.000 0.000 0.000

hsa-miR-519e 0.000 1.458 0.000 0.000

hsa-miR-519e* 0.000 0.000 0.000 0.000

hsa-miR-520a 0.000 0.000 0.000 0.000

hsa-miR-520a* 0.000 0.000 0.000 0.000

hsa-miR-520b 0.000 0.000 0.000 0.000

hsa-miR-520c 0.000 0.000 0.000 0.000

hsa-miR-520d 0.000 0.000 0.000 0.000

hsa-miR-520d* 0.000 0.000 0.000 0.000

hsa-miR-520e 0.000 0.000 0.000 0.000

hsa-miR-520f 0.000 0.000 0.000 0.000

hsa-miR-520g 0.000 0.000 0.000 0.000

hsa-miR-520h 0.000 0.000 0.000 0.000

hsa-miR-521 0.000 0.000 0.000 0.000

hsa-miR-522 0.000 0.000 0.000 0.000

hsa-miR-523 0.000 0.000 0.000 0.000

hsa-miR-524 0.000 1.442 0.000 0.000

hsa-miR-524* 0.000 0.000 0.000 0.000

hsa-miR-525 0.000 0.000 0.000 0.000

hsa-miR-525* 0.000 0.000 0.000 0.000

hsa-miR-526a 0.000 0.000 0.000 0.000

hsa-miR-526b 0.000 0.000 0.000 0.000

hsa-miR-526b* 0.000 0.000 0.000 0.000

hsa-miR-526c 0.000 0.000 0.000 0.000

hsa-miR-527 0.000 0.000 0.000 0.000

mmu-miR-129-2 0.000 0.000 0.000 0.000

mmu-miR-137 0.000 5.496 13.293 297.839

mmu-miR-224 0.000 14.446 18.831 0.000

mmu-miR-424 0.000 0.000 0.000 0.000

215

APPENDIX C


216

Lung Cancer

miRNA H23 H522 HOP62 A549 H719

let-7a-1* 265.95 179.87 207.33 185.52 161.16

let-7a-2-P 955.49 689.95 6963.23 2285.83 2472.69

let-7a-3* 33.08 83.42 211.59 93.59 156.54

let-7b* 39.04 51.46 315.75 193.40 111.64

let-7c* 6.88 211.35 0.00 7.26 16.56

let-7d* 758.26 892.58 531.53 559.29 518.95

let-7e* 11.11 8.41 8.54 13.67 8.44

let-7f-1* 604.63 767.32 536.23 407.61 566.88

let-7f-2* 99.43 152.62 146.06 28.71 60.48

let-7g* 240.90 216.06 265.32 210.99 229.67

let-7i* 192.47 103.50 302.70 397.01 61.15

MIR-001-1 235.74 237.72 150.40 161.25 158.32

MIR-001-2 280.89 489.68 206.65 230.54 201.40

MIR-007-1 102.12 63.49 74.22 33.50 106.96

MIR-007-2 41.92 135.67 54.82 131.72 172.50

MIR-007-3 131.37 80.56 30.97 18.73 38.89

MIR-009-1-P 5597.95 3393.11 1115.78 2307.45 2675.05

MIR-009-2-P 2581.00 2242.82 1550.28 1797.72 3018.59

MIR-009-3-P 80.10 67.50 42.41 45.62 58.83

MIR-010a,b 12.71 19.45 295.67 99.21 97.38

MIR-015a 481.02 329.27 431.62 171.29 309.16

MIR-015b 1702.45 907.46 1615.58 633.01 492.64

MIR-016-1 1089.23 372.69 1273.77 562.81 658.91

MIR-016-2 1004.04 979.67 946.32 721.99 474.10

MIR-017-P 2942.14 2181.34 2119.10 1400.82 1987.48

MIR-018 3558.02 1840.52 3488.41 1989.36 3561.25

MIR-019a-P 720.25 596.47 808.46 391.81 1115.88

MIR-019b-1-P 1685.67 1948.48 534.60 913.41 1423.75

MIR-019b-2-P 7.91 252.37 7.56 7.44 0.00

MIR-020 8.33 15.47 86.39 4.59 13.58

MIR-021 34307.94 28445.73 56698.21 28133.73 7919.58

MIR-022-P 687.51 630.50 1131.34 686.01 431.19

MIR-023a 772.08 663.06 395.42 522.18 577.20

MIR-023b-P 1643.49 1054.85 1133.81 2111.67 1385.47

Continued

Table C.1. microRNA precursor expression in 37 different human cancer cell

lines. All data was generated using real-time PCR and SYBR green detection except

(*) which was assayed using TaqMan probes. Data is presented as copies of

microRNA per cell. (P) Real-time PCR was performed on the microRNA primary

precursor.

217

Table C.1. continued

MIR-024-1,2 7040.69 6254.60 7985.92 19753.19 4869.47

MIR-025 1099.19 1253.20 378.54 503.76 616.32

MIR-026a-1,2 280.92 181.99 163.98 153.29 148.84

MIR-026b 2145.20 2227.08 1214.05 1237.43 1671.01

MIR-027a, b 1910.70 1729.11 1008.48 864.06 1033.30

MIR-028 28.26 57.34 37.84 38.49 33.75

MIR-029a,c 818.00 162.66 629.82 227.71 380.48

MIR-029b-1,2 43.77 37.08 9.39 66.72 72.46

MIR-030a,e 522.59 1376.50 507.33 425.58 487.65

MIR-030b 1425.69 824.97 701.24 758.20 677.09

MIR-030c-1,2 1199.30 1143.95 600.29 529.57 1072.09

MIR-030d 239.05 100.49 77.00 87.62 76.41

MIR-031-P 8055.97 7666.13 3031.34 4014.24 4909.87

MIR-032 101.94 177.39 103.16 40.81 138.36

MIR-033 17.73 34.24 19.36 11.76 4.61

MIR-034a 544.66 1046.52 336.85 415.98 583.76

MIR-034b 122.55 79.37 87.76 107.06 94.86

MIR-034c 0.00 0.00 0.00 0.00 0.00

MIR-092-1 54.63 46.45 52.81 5.84 32.67

MIR-092-2-P 457.29 2077.18 157.23 203.76 300.75

MIR-093 1197.11 879.23 394.02 593.41 603.87

MIR-095 7.57 3.93 3.12 2.80 5.47

MIR-096-P 28318.18 23105.14 14521.64 22762.64 21271.33

MIR-098 5020.89 6762.98 4878.86 2605.99 2730.18

MIR-099a 85.21 147.46 106.00 89.92 48.01

MIR-099b 1778.78 1931.36 2476.97 2059.50 1699.39

MIR-100 66.86 174.68 7120.22 1396.05 2294.07

MIR-101-1 52.98 33.33 13.28 16.77 37.39

MIR-101-2 382.15 292.62 115.17 392.38 326.67

MIR-103-1,2 4723.29 4433.55 5005.15 3179.53 3623.14

MIR-105-1,2 103.87 209.00 173.88 144.27 267.53

MIR-106a-P 85.40 488.85 56.22 74.68 110.61

MIR-106b 2137.52 2795.99 1025.55 1011.34 2039.91

MIR-107 4995.26 6507.37 7196.86 4386.27 4628.41

MIR-108 635.56 390.56 401.27 264.16 391.74

MIR-122a 119.27 44.69 50.22 67.22 99.48

MIR-124a-1,2,3 157.84 55.04 65.61 59.89 130.66

MIR-125a 1038.26 709.12 806.27 969.24 586.48

MIR-125b-1 56.32 192.33 912.40 63.85 967.47

MIR-125b-2 130.81 291.63 73.80 68.32 126.51

MIR-126 132.34 56.15 48.61 122.86 173.58

Continued

218


MIR-127 4108.54 4358.95 3771.20 4154.41 4551.32

MIR-128a 546.67 589.97 417.97 328.73 520.99

MIR-128b 81.00 92.31 50.64 91.92 74.19

MIR-129-2 6335.68 5503.13 3261.62 6108.57 7099.30

MIR-130a-P 7812.21 5720.04 3814.80 4229.86 5197.07

MIR-130b 82.44 135.93 180.25 62.54 126.19

MIR-132 36.31 28.02 36.29 18.47 23.96

MIR-133a-1,2 1086.70 2412.47 367.12 628.16 1392.66

MIR-133b 1637.94 2096.22 1127.32 1450.87 1685.24

MIR-134 3819.51 2658.98 1733.16 1950.82 2164.33

MIR-135a-1,2 131.72 19.10 20.53 109.86 18.81

MIR-135b-P 284.95 229.48 121.78 60.20 229.33

MIR-136 300.20 56.44 32.38 59.31 96.91

MIR-137* 31.37 496.85 37.78 54.93 133.17

MIR-138-1,2 28.52 55.93 12.11 20.99 59.51

MIR-139 380.22 428.01 398.54 238.36 317.64

MIR-140 2.33 6.23 0.00 1.11 0.00

MIR-141 162.30 90.81 41.16 87.45 46.51

MIR-142-P 2269.21 2887.45 1558.12 1324.71 876.08

MIR-143 381.69 296.83 163.91 220.85 193.39

MIR-144 7.59 7.56 14.05 21.42 7.86

MIR-145-P 657.81 298.35 331.74 261.49 283.33

MIR-146 27.13 16.99 52.65 18.50 10.59

MIR-147 119.02 75.31 65.69 115.36 122.04

MIR-148a-P 86.97 96.69 68.42 60.80 103.86

MIR-148b-P 795.38 454.00 374.21 488.03 706.18

MIR-149 2139.25 1537.53 1175.00 958.50 1508.87

MIR-150 708.53 597.52 368.56 347.51 483.59

MIR-151 269.79 324.81 97.88 214.02 261.14

MIR-152 53.98 90.93 63.91 45.83 41.55

MIR-153-1,2 68.99 43.96 66.13 17.66 100.98

MIR-154 64.37 48.57 55.44 20.30 52.56

MIR-155 104.58 54.75 387.31 27.19 115.75

MIR-181a,c 462.74 1586.52 788.12 45.19 327.79

MIR-181b-1,2 170.82 105.22 478.39 51.93 119.33

MIR-182 16782.47 11635.17 3098.97 3692.70 5421.11

MIR-183 422.42 502.89 86.79 68.75 201.35

MIR-184 1277.07 2593.48 254.41 4276.10 1563.48

MIR-185 4185.25 3742.88 2618.53 3127.12 4049.31

MIR-186-P 2363.83 3071.69 1342.94 1535.31 2276.32

MIR-187 176.31 88.73 65.65 112.54 97.52

Continued

219


MIR-188b-P 247.95 169.92 123.15 135.49 240.23

MIR-190 4.19 4.47 1.54 1.49 2.73

MIR-191 79.51 35.34 20.38 13.27 10.44

MIR-192 862.58 1238.62 398.72 162.03 419.74

MIR-193 461.51 213.56 195.89 121.91 203.39

MIR-194-1,2 128.92 102.70 49.43 78.38 73.32

MIR-195-P 11048.43 9480.00 5569.01 5961.99 8309.40

MIR-196a-1 333.47 273.37 318.43 342.37 372.13

MIR-196a-2 403.49 718.06 254.52 218.08 523.36

MIR-196b 1886.11 485.29 1721.86 1332.71 244.78

MIR-197 7737.92 5623.72 5846.92 6877.23 6379.99

MIR-198 121.41 421.77 1855.34 107.09 61.85

MIR-199a-1-P 4603.30 3755.66 3064.37 4221.39 3742.74

MIR-199a-2-P 388.19 892.72 205.15 329.86 448.33

MIR-199b-P 3821.25 3086.45 2398.82 2164.54 2520.14

MIR-200a-P 48724.36 103362.05 52243.79 88095.16 79423.16

MIR-200b 70.31 61.37 33.90 42.31 66.46

MIR-200c 76.02 98.52 70.05 107.34 80.79

MIR-203 50.97 57.56 24.18 37.76 4.40

MIR-204 2340.50 2050.83 1150.18 1039.84 237.25

MIR-205 151.63 42.09 23.46 8.78 4.00

MIR-206 157.92 99.63 94.43 149.39 84.66

MIR-208 168.49 101.77 42.39 75.17 71.40

MIR-210 19101.01 8854.71 11551.43 6828.08 9473.77

MIR-211 5349.76 3265.12 3061.06 3179.64 3884.94

MIR-212 495.65 372.03 581.62 250.42 554.22

MIR-213 388.37 75.83 456.26 170.08 198.73

MIR-214 2472.16 2248.12 1468.28 1950.73 2392.13

MIR-215 320.99 234.47 202.01 59.81 112.19

MIR-216 349.64 324.80 202.14 189.70 294.41

MIR-217 14.59 3.70 3.34 5.15 0.88

MIR-218-1,2 32.87 109.99 204.29 13.90 26.48

MIR-219-1,2 149.47 84.22 56.01 60.13 72.36

MIR-220 557.37 260.42 266.69 296.23 386.24

MIR-221 93.53 726.01 381.65 129.43 234.46

MIR-222-P 240.53 984.95 258.50 180.07 363.07

MIR-223 82.00 92.44 41.17 61.27 99.10

MIR-224 436.36 293.11 579.04 400.99 276.96

MIR-296 401.58 391.90 235.52 304.70 329.08

MIR-299-P 1718.54 1038.23 902.64 857.70 294.06

MIR-301 452.34 1335.66 738.04 409.57 563.00

Continued

220


MIR-302 83.93 61.08 56.91 44.35 61.45

MIR-302b 217.14 168.72 91.18 157.19 64.78

MIR-302c 208.27 111.79 159.48 190.25 151.05

MIR-302d 245.29 173.45 140.30 167.43 196.37

MIR-320 457.64 508.20 244.78 328.84 342.20

MIR-321 9128.86 25372.00 4610.81 4473.53 5045.22

MIR-323 702.28 180.75 293.73 377.52 200.13

MIR-324-P 1061.12 864.04 525.11 578.77 679.76

MIR-325 52.16 75.95 37.19 37.46 69.16

MIR-326-P 121.32 75.59 24.12 57.81 40.66

MIR-328 2926.73 2635.76 1361.21 2047.73 1998.69

MIR-330 647.99 502.23 405.89 342.33 218.09

MIR-331-P 626.40 605.77 319.12 412.74 695.55

MIR-335 13.65 21.22 11.49 6.96 9.01

MIR-337 764.55 1013.00 467.62 523.29 821.16

MIR-338 1296.14 824.71 601.20 698.75 853.24

MIR-339 1894.43 877.10 1113.03 847.31 913.17

MIR-340 1277.88 1113.02 303.39 387.71 775.69

MIR-342 556.25 373.72 281.70 281.32 400.09

MIR-345 2542.22 2499.85 1452.14 1474.08 2096.17

MIR-346 3166.03 2632.09 2434.64 2407.84 2923.48

MIR-361 72.23 195.27 180.72 81.02 184.98

MIR-367 48.67 12.90 21.68 14.78 24.06

MIR-368 3.20 0.00 1.67 2.56 4.74

MIR-369 0.00 0.00 0.00 0.00 0.00

MIR-370 392.03 254.26 202.93 203.30 167.93

MIR-371 2053.40 1491.35 988.15 1038.79 1354.55

MIR-372 25.94 5.48 9.64 19.80 11.66

MIR-373 415.26 270.11 168.62 212.80 316.57

MIR-374-P 6.47 36.55 78.86 24.40 52.41

MIR-375 60.68 68.16 58.33 73.47 83.37

MIR-376 594.09 75.43 332.41 88.43 21.39

MIR-377 210.11 322.03 86.72 103.31 235.85

MIR-378 144.84 123.16 44.99 30.91 65.25

MIR-379 256.34 10.46 148.76 44.74 5.89

MIR-380 119.87 6.60 68.91 2.79 43.51

MIR-381 7.49 21.78 20.95 26.01 22.36

MIR-382 40.07 27.73 31.35 31.30 28.88

MIR-383 99.97 277.46 63.06 107.91 121.73

MIR-384 6.59 0.00 16.86 5.30 2.49

MIR-422b 926.07 731.49 546.45 636.06 791.78

Continued

221

Table C.1 continued

MIR-423 425.22 588.86 234.32 248.33 348.79

MIR-424 155.90 45.19 145.28 46.28 25.17

MIR-425 306.97 141.99 154.45 119.62 139.43

Pancreas Cancer

miRNA PANC-1 HS766T MIAPACA-2 MPANC-96 PL45

let-7a-1* 16.80 30.16 80.27 102.05 84.19

let-7a-2-P 3224.23 2598.29 485.50 435.56 832.20

let-7a-3* 38.96 3.97 22.84 105.76 61.93

let-7b* 182.96 76.51 14.52 25.13 8.60

let-7c* 0.74 0.00 0.00 0.61 0.00

let-7d* 194.21 509.85 243.10 429.99 290.02

let-7e* 5.20 9.34 0.00 3.94 5.43

let-7f-1* 28.23 93.16 165.28 349.71 252.98

let-7f-2* 27.53 6.81 12.47 27.87 50.54

let-7g* 149.76 255.29 83.77 145.50 55.71

let-7i* 46.10 126.67 185.79 442.66 47.93

MIR-001-1 251.23 226.75 116.54 48.23 63.46

MIR-001-2 337.41 356.14 435.89 167.46 172.93

MIR-007-1 104.29 141.97 129.95 108.03 84.75

MIR-007-2 190.09 172.16 46.99 26.52 24.50

MIR-007-3 52.92 42.94 15.29 2.78 8.30

MIR-009-1-P 5105.28 3018.80 1237.39 677.78 861.29

MIR-009-2-P 6453.36 5756.35 986.62 525.86 954.43

MIR-009-3-P 93.83 100.03 7.78 5.26 15.84

MIR-010a,b 514.30 65.33 53.37 171.07 109.37

MIR-015a 387.34 328.62 86.78 123.78 76.05

MIR-015b 650.08 420.14 1187.20 485.70 938.99

MIR-016-1 338.96 460.77 553.75 304.77 244.89

MIR-016-2 1157.98 1151.18 500.66 259.69 544.29

MIR-017-P 1679.82 2033.84 1234.19 1514.81 700.23

MIR-018 1171.58 5037.96 3329.06 2620.18 706.56

MIR-019a-P 427.41 2026.17 904.64 714.08 232.12

MIR-019b-1-P 301.25 1360.53 340.09 260.51 215.90

MIR-019b-2-P 8.23 3.46 0.00 1.09 0.00

MIR-020 3.25 19.76 21.06 17.08 21.65

MIR-021 16468.89 27976.87 5043.89 7916.38 2341.17

MIR-022-P 749.33 612.63 1034.38 2528.56 215.26

MIR-023a 1158.52 1093.45 318.07 647.63 286.88

MIR-023b-P 1343.30 1527.30 482.98 707.53 570.17

MIR-024-1,2 4140.45 3128.31 3298.33 10074.36 1587.91

Continued

222


MIR-025 595.61 993.94 929.65 732.37 517.66

MIR-026a-1,2 213.56 200.13 59.50 119.08 75.06

MIR-026b 1900.16 1937.29 392.53 401.30 490.37

MIR-027a, b 1398.27 1604.13 472.12 549.12 260.12

MIR-028 66.18 27.90 18.22 3.04 23.26

MIR-029a,c 345.25 1978.11 820.59 667.62 650.14

MIR-029b-1,2 27.34 46.08 1.58 5.03 1.92

MIR-030a,e 462.14 357.11 719.91 120.96 291.94

MIR-030b 1242.58 1536.38 364.69 409.69 334.30

MIR-030c-1,2 1086.79 610.22 151.54 133.75 166.60

MIR-030d 23.98 30.84 53.45 141.11 57.46

MIR-031-P 5334.83 5125.43 2039.01 768.53 609.39

MIR-032 76.77 268.26 314.47 177.62 151.11

MIR-033 37.08 17.28 3.54 6.38 6.29

MIR-034a 146.47 393.56 124.27 84.51 123.53

MIR-034b 117.44 154.72 21.85 7.67 12.63

MIR-034c 0.00 0.00 0.00 0.00 0.00

MIR-092-1 41.15 85.43 88.37 93.50 27.73

MIR-092-2-P 616.46 430.73 71.21 21.71 42.21

MIR-093 947.82 899.78 302.75 593.54 736.90

MIR-095 13.67 11.37 4.26 0.89 8.66

MIR-096-P 22929.50 22068.04 7178.77 4269.90 7181.80

MIR-098 4664.63 6798.12 2452.58 2121.58 3822.24

MIR-099a 78.01 76.20 14.46 7.90 17.44

MIR-099b 435.56 415.90 879.21 650.58 1206.24

MIR-100 2347.78 4542.34 11.38 165.42 195.83

MIR-101-1 62.76 35.56 13.37 21.31 14.38

MIR-101-2 245.76 510.76 188.16 136.10 99.40

MIR-103-1,2 3827.33 4354.49 1896.03 1503.21 1668.69

MIR-105-1,2 252.64 268.23 74.99 61.55 136.68

MIR-106a-P 127.24 134.34 14.27 17.99 14.43

MIR-106b 894.55 2395.23 714.09 845.66 354.84

MIR-107 3102.02 4619.59 2977.95 2430.28 1731.29

MIR-108 428.70 313.32 158.55 76.86 278.99

MIR-122a 141.23 109.58 6.49 6.32 12.54

MIR-124a-1,2,3 141.37 128.07 18.05 15.05 14.47

MIR-125a 964.05 355.50 155.07 142.32 202.67

MIR-125b-1 338.68 182.28 17.19 2.62 27.89

MIR-125b-2 112.11 168.42 57.72 12.53 97.15

MIR-126 81.79 213.49 80.73 14.69 16.83

MIR-127 7629.42 7423.07 3033.12 2613.57 2857.53

Continued

223


MIR-128a 312.49 249.31 277.34 174.23 337.89

MIR-128b 180.21 131.35 55.59 32.17 27.83

MIR-129-2 8536.54 6627.53 2897.67 1307.01 2660.70

MIR-130a-P 10779.62 7692.85 2076.75 1011.86 1804.38

MIR-130b 124.56 116.06 58.71 54.40 7.93

MIR-132 15.48 1.07 7.31 13.20 1.73

MIR-133a-1,2 737.55 714.50 303.41 205.98 153.94

MIR-133b 1784.71 1009.31 474.43 339.96 398.17

MIR-134 3577.31 5073.56 319.55 201.52 404.63

MIR-135a-1,2 118.75 141.54 46.59 258.97 10.76

MIR-135b-P 395.54 159.11 81.24 39.32 135.23

MIR-136 127.04 64.97 91.82 4.26 5.39

MIR-137* 23.11 13.12 732.14 5.15 20.71

MIR-138-1,2 71.74 99.85 15.14 3.19 1.88

MIR-139 2651.48 2297.95 397.97 203.42 256.13

MIR-140 1.84 2.94 0.00 0.00 0.00

MIR-141 144.87 68.46 42.22 38.95 59.59

MIR-142-P 4806.11 4593.64 750.51 333.19 810.57

MIR-143 426.73 362.91 136.39 92.43 111.77

MIR-144 14.48 0.83 0.00 0.00 0.00

MIR-145-P 791.29 573.19 95.47 64.08 71.19

MIR-146 28.71 10.29 3.97 5.02 4.55

MIR-147 204.40 176.46 50.63 2.59 47.94

MIR-148a-P 106.46 113.20 41.67 28.00 42.14

MIR-148b-P 463.60 347.16 162.93 189.26 114.46

MIR-149 2291.53 2196.33 594.82 227.59 314.20

MIR-150 717.58 761.04 318.83 159.78 342.11

MIR-151 228.69 343.08 40.51 72.90 45.19

MIR-152 102.30 153.79 15.02 31.76 25.82

MIR-153-1,2 75.13 132.39 50.90 306.99 6.07

MIR-154 113.29 86.90 6.08 0.99 25.27

MIR-155 99.47 530.61 29.13 46.07 79.94

MIR-181a,c 327.53 236.16 90.85 160.01 42.26

MIR-181b-1,2 178.62 71.92 25.34 73.09 90.05

MIR-182 2597.90 4113.66 6055.84 3821.98 1983.74

MIR-183 195.69 112.40 86.11 105.71 50.77

MIR-184 2133.69 1825.81 915.01 251.44 876.48

MIR-185 4174.82 3893.69 1666.88 1183.49 1828.01

MIR-186-P 2386.55 2616.25 2133.64 1665.63 1125.64

MIR-187 170.61 70.40 31.61 11.71 39.73

MIR-188b-P 267.59 281.95 34.93 15.24 23.56

Continued

224


MIR-190 9.17 2.55 0.94 0.00 5.78

MIR-191 86.46 34.80 3.67 3.73 3.38

MIR-192 679.86 622.21 220.12 57.31 140.92

MIR-193 382.66 271.51 75.82 9.09 30.67

MIR-194-1,2 107.22 99.09 21.62 16.59 22.37

MIR-195-P 10184.74 3921.09 2089.51 877.81 1542.37

MIR-196a-1 527.38 479.25 195.36 48.51 165.50

MIR-196a-2 419.99 208.52 101.33 143.21 73.38

MIR-196b 1556.51 5768.30 211.30 8447.67 815.01

MIR-197 7374.37 20361.72 3865.80 3234.06 3858.07

MIR-198 44.25 3.06 32.50 3.96 179.03

MIR-199a-1-P 4602.43 4865.89 1553.04 1223.57 2279.62

MIR-199a-2-P 464.20 472.84 151.10 58.18 126.59

MIR-199b-P 3772.77 3593.00 1356.90 458.55 984.85

MIR-200a-P 77829.22 87456.35 35921.32 17962.89 29588.61

MIR-200b 159.84 130.10 89.82 48.14 58.82

MIR-200c 231.37 166.10 20.95 6.75 63.41

MIR-203 40.63 40.31 1.36 13.18 3.06

MIR-204 2445.34 3176.55 507.60 290.60 456.56

MIR-205 25.27 40.26 4.76 1.28 66.41

MIR-206 292.28 196.19 53.63 15.28 34.04

MIR-208 180.37 157.95 41.88 23.66 22.92

MIR-210 19716.38 27549.84 2112.05 783.66 3317.95

MIR-211 4656.25 3962.70 1705.99 876.28 1596.53

MIR-212 1248.99 2553.89 326.20 218.21 125.20

MIR-213 352.55 392.45 37.89 151.21 75.97

MIR-214 2740.06 2836.55 788.21 520.13 566.40

MIR-215 76.03 129.69 155.46 148.84 286.85

MIR-216 435.20 312.39 143.03 54.73 144.02

MIR-217 13.20 16.73 9.12 1.40 2.57

MIR-218-1,2 58.13 44.94 18.72 4.75 18.01

MIR-219-1,2 56.75 104.27 11.30 32.94 13.26

MIR-220 445.07 431.98 258.20 59.70 54.95

MIR-221 158.08 757.66 559.65 292.04 212.95

MIR-222-P 307.07 492.27 524.06 295.62 327.56

MIR-223 75.12 136.83 34.79 22.46 15.57

MIR-224 245.73 253.89 133.58 408.99 186.77

MIR-296 312.41 22.74 54.89 24.76 57.00

MIR-299-P 1836.62 1500.70 233.10 209.32 202.10

MIR-301 174.26 371.17 131.33 60.20 160.48

MIR-302 54.28 77.40 7.65 52.66 39.67

Continued

225


MIR-302b 520.66 516.42 72.38 49.60 140.70

MIR-302c 253.69 258.04 57.01 65.75 45.71

MIR-302d 126.05 225.74 63.41 7.65 48.51

MIR-320 696.86 708.39 170.07 135.95 109.16

MIR-321 12134.67 7705.12 2470.84 4737.19 2037.01

MIR-323 175.48 304.13 91.09 86.67 86.08

MIR-324-P 1076.04 844.50 229.60 208.45 200.66

MIR-325 135.51 52.21 34.97 21.48 41.11

MIR-326-P 191.02 158.74 19.10 14.88 10.14

MIR-328 3172.97 4674.27 812.12 370.93 647.54

MIR-330 647.86 524.61 147.57 68.76 60.28

MIR-331-P 513.45 643.32 246.97 128.98 255.50

MIR-335 7.48 17.36 36.05 3.51 52.44

MIR-337 912.91 811.17 149.01 76.60 167.11

MIR-338 1458.57 1077.86 132.11 97.54 170.11

MIR-339 2002.03 1150.47 602.58 336.10 337.36

MIR-340 339.22 520.09 552.58 333.78 162.90

MIR-342 583.60 509.75 159.89 84.76 143.83

MIR-345 4257.07 4615.43 1006.64 333.64 882.09

MIR-346 3351.71 3227.02 3171.48 2880.92 3152.52

MIR-361 219.09 181.19 79.96 107.82 119.63

MIR-367 5.44 17.67 0.00 53.63 48.87

MIR-368 7.88 5.18 2.61 0.00 0.00

MIR-369 13.90 3.45 0.00 0.97 0.00

MIR-370 601.31 326.88 62.08 11.25 8.25

MIR-371 2705.17 1962.26 380.54 182.67 366.35

MIR-372 16.00 13.32 0.00 3.21 1.64

MIR-373 611.83 561.73 55.94 31.94 72.01

MIR-374-P 73.51 99.95 8.52 29.70 19.69

MIR-375 9.26 127.24 35.51 5.75 15.27

MIR-376 697.96 39.00 4.78 1.00 2.35

MIR-377 475.60 412.51 118.61 58.77 60.48

MIR-378 143.60 231.34 42.58 83.80 53.25

MIR-379 307.56 3.88 12.20 3.08 2.68

MIR-380 142.90 20.94 10.54 1.00 2.11

MIR-381 97.30 55.55 1.05 2.13 6.99

MIR-382 63.96 28.83 10.70 15.00 7.04

MIR-383 216.08 189.57 8.07 14.23 22.44

MIR-384 3.27 2.20 0.61 0.86 1.21

MIR-422b 801.27 785.33 243.67 156.91 234.92

MIR-423 457.69 383.86 54.05 30.00 41.45

Continued

226


MIR-424 37.06 87.89 4.59 27.30 4.46

MIR-425 120.59 34.51 66.67 37.57 18.30

Prostate Cancer

miRNA PC3 PPC1 DU145 TSUPR1 LNCAP

let-7a-1* 143.19 3.38 13.13 43.56 11.49

let-7a-2-P 7803.95 1821.31 1279.00 270.94 1081.41

let-7a-3* 468.33 41.00 16.76 15.01 168.71

let-7b* 362.67 214.51 115.40 37.70 633.87

let-7c* 0.00 1.98 0.00 6.95 696.73

let-7d* 250.35 84.65 133.10 139.25 182.83

let-7e* 10.25 2.62 2.06 0.00 14.23

let-7f-1* 189.51 17.10 6.48 38.59 100.43

let-7f-2* 25.79 37.07 16.86 12.57 4.84

let-7g* 213.29 41.25 26.16 137.57 172.53

let-7i* 195.52 82.13 85.05 89.15 76.55

MIR-001-1 89.47 0.61 182.82 7.01 323.81

MIR-001-2 490.26 466.93 791.41 103.47 432.13

MIR-007-1 102.00 2.16 107.86 1.69 175.44

MIR-007-2 31.22 3.32 66.10 1.94 80.76

MIR-007-3 12.26 4.26 20.27 3.93 78.76

MIR-009-1-P 1421.70 1676.30 1834.68 761.10 2469.69

MIR-009-2-P 791.18 638.66 1737.68 769.99 4470.95

MIR-009-3-P 17.74 9.25 31.99 5.10 38.68

MIR-010a,b 177.69 0.00 44.03 3.81 12.53

MIR-015a 138.46 75.13 193.41 27.99 163.98

MIR-015b 801.98 526.38 440.52 192.09 700.09

MIR-016-1 692.86 213.80 444.17 1258.48 1097.20

MIR-016-2 476.06 289.82 680.06 136.66 547.78

MIR-017-P 278.14 372.46 537.63 176.51 911.49

MIR-018 1843.05 1591.29 838.76 2140.52 5244.02

MIR-019a-P 261.29 53.79 57.81 31.05 1394.49

MIR-019b-1-P 519.82 206.98 698.10 175.33 999.42

MIR-019b-2-P 2.57 0.00 0.00 0.00 4.55

MIR-020 0.99 0.00 1.94 0.00 24.87

MIR-021 27307.07 16179.01 26034.95 58978.05 11180.51

MIR-022-P 847.47 224.08 228.01 312.93 1998.11

MIR-023a 384.12 93.54 451.50 122.45 489.04

MIR-023b-P 697.38 141.92 1156.37 292.68 1639.94

MIR-024-1,2 3192.41 2824.37 6164.42 4829.63 1930.89

MIR-025 120.90 248.46 334.29 192.51 583.07

Continued

227


MIR-026a-1,2 67.86 30.10 137.99 5.53 182.86

MIR-026b 618.60 146.02 702.08 139.92 1126.24

MIR-027a, b 627.34 286.11 958.46 261.29 1245.07

MIR-028 18.74 11.17 19.72 24.97 39.45

MIR-029a,c 389.26 117.98 1554.76 687.60 78.84

MIR-029b-1,2 4.59 13.41 22.10 0.00 16.71

MIR-030a,e 101.61 42.71 204.39 42.16 386.97

MIR-030b 660.66 297.34 639.77 217.38 839.65

MIR-030c-1,2 497.20 180.53 551.17 101.24 541.49

MIR-030d 105.90 50.66 37.70 1.45 101.11

MIR-031-P 2897.58 2220.49 3777.19 1207.00 3333.38

MIR-032 84.70 63.31 362.60 86.38 172.04

MIR-033 1.29 2.64 1.94 4.14 7.67

MIR-034a 159.55 92.83 237.03 75.04 714.64

MIR-034b 30.25 30.26 43.46 18.08 129.86

MIR-034c 0.00 0.00 0.00 0.00 0.00

MIR-092-1 2.29 0.65 1.29 1.08 22.82

MIR-092-2-P 102.50 19.82 128.43 8.26 263.51

MIR-093 237.81 73.29 258.23 77.70 555.98

MIR-095 35.73 0.00 1.66 0.00 17.20

MIR-096-P 8420.23 7080.78 7725.59 4131.95 16119.55

MIR-098 3064.95 9591.90 3002.87 5470.93 11417.13

MIR-099a 50.42 24.17 13.15 18.92 113.79

MIR-099b 719.48 143.94 256.80 203.49 350.12

MIR-100 27721.96 10716.83 2443.09 3061.02 69.42

MIR-101-1 3.08 3.27 32.13 2.59 48.74

MIR-101-2 168.77 119.16 371.70 383.37 168.14

MIR-103-1,2 2255.30 870.77 2771.90 2628.59 3985.63

MIR-105-1,2 83.01 48.36 211.21 56.74 225.47

MIR-106a-P 50.46 5.49 29.26 5.54 91.88

MIR-106b 1140.59 1221.49 1037.03 1675.07 2317.89

MIR-107 4209.53 1366.77 3687.58 6232.79 4434.74

MIR-108 161.06 78.38 316.94 72.05 237.81

MIR-122a 16.74 8.61 51.57 0.90 48.63

MIR-124a-1,2,3 23.04 46.82 19.87 29.09 59.03

MIR-125a 519.27 324.47 592.44 125.99 940.32

MIR-125b-1 1639.63 572.43 199.41 247.66 12.65

MIR-125b-2 47.70 47.20 73.46 4.30 489.56

MIR-126 38.85 2.20 98.54 12.94 54.94

MIR-127 3596.37 525.31 2803.02 383.88 3797.87

MIR-128a 450.87 245.01 463.95 487.28 708.52

Continued

228


MIR-128b 59.26 22.24 53.68 15.25 107.76

MIR-129-2 3557.64 1015.30 3696.52 770.40 6436.40

MIR-130a-P 3014.93 1341.66 3706.16 925.38 4999.61

MIR-130b 29.91 30.59 22.24 4.07 126.40

MIR-132 0.63 0.75 28.06 36.09 62.30

MIR-133a-1,2 359.43 135.31 546.52 65.56 559.46

MIR-133b 451.32 321.68 642.65 141.05 1117.14

MIR-134 1074.84 478.97 1419.85 375.11 3132.08

MIR-135a-1,2 65.92 11.93 39.76 31.24 115.13

MIR-135b-P 89.87 89.04 148.00 25.55 111.23

MIR-136 80.15 7.37 55.13 5.46 44.03

MIR-137* 73.09 0.99 12.03 420.03 24.67

MIR-138-1,2 6.61 3.58 12.99 0.86 50.24

MIR-139 605.63 333.74 849.31 198.32 609.30

MIR-140 0.00 0.00 0.00 0.00 1.53

MIR-141 34.75 1.89 49.50 1.37 151.39

MIR-142-P 598.68 460.07 894.10 493.80 907.11

MIR-143 117.78 48.04 184.77 35.76 350.82

MIR-144 0.00 0.00 36.75 0.00 1.15

MIR-145-P 147.38 62.53 241.61 41.59 218.53

MIR-146 19.57 0.00 11.11 0.00 7.47

MIR-147 53.80 15.65 87.62 49.44 169.96

MIR-148a-P 52.29 4.30 36.68 3.01 41.99

MIR-148b-P 372.22 135.92 358.94 13.26 636.13

MIR-149 635.84 366.13 506.15 323.25 425.02

MIR-150 221.82 454.15 296.94 339.28 539.24

MIR-151 47.71 30.94 64.82 29.58 174.25

MIR-152 30.27 4.37 75.59 7.27 71.16

MIR-153-1,2 110.48 37.16 20.92 10.97 34.50

MIR-154 15.87 6.36 3.55 2.53 66.54

MIR-155 49.88 21.75 100.50 0.00 34.19

MIR-181a,c 513.58 373.99 674.73 1013.07 570.72

MIR-181b-1,2 28.29 44.54 100.55 68.09 63.61

MIR-182 19259.56 3736.58 5289.56 2424.54 6254.87

MIR-183 2185.76 31.11 115.86 21.08 165.81

MIR-184 790.67 450.90 1090.14 308.72 1901.97

MIR-185 1520.52 444.78 2044.93 382.46 2361.75

MIR-186-P 3362.29 1415.85 1178.33 663.57 5835.59

MIR-187 15.06 25.00 44.25 3.59 57.11

MIR-188b-P 34.55 17.24 75.31 15.91 149.05

MIR-190 0.00 0.00 13.47 0.00 4.49

Continued

229


MIR-191 34.03 1.55 16.00 2.97 24.98

MIR-192 0.00 0.00 0.00 0.00 0.00

MIR-193 123.67 55.81 78.76 25.82 156.08

MIR-194-1,2 32.15 23.36 26.60 12.59 71.58

MIR-195-P 3566.94 3078.37 5740.18 1707.15 7202.21

MIR-196a-1 63.86 29.78 144.96 54.71 235.03

MIR-196a-2 209.86 161.48 217.71 71.71 247.93

MIR-196b 17440.37 7906.50 2621.91 6794.11 2220.79

MIR-197 11434.15 4772.09 6465.38 2466.05 3859.64

MIR-198 374.49 582.26 7.64 129.93 142.70

MIR-199a-1-P 1115.10 378.34 1855.95 303.14 1808.13

MIR-199a-2-P 150.70 122.14 151.10 25.18 206.67

MIR-199b-P 1261.58 1242.56 1802.80 485.85 1692.24

MIR-200a-P 33749.36 22042.83 26561.37 14966.42 71326.06

MIR-200b 44.61 7.59 29.23 2.77 145.67

MIR-200c 56.75 5.20 38.74 3.08 110.18

MIR-203 1.47 3.38 14.24 10.18 55.33

MIR-204 680.36 505.12 859.68 87.35 1466.30

MIR-205 23.76 5.41 57.73 9.72 58.22

MIR-206 54.13 24.04 45.58 13.47 165.32

MIR-208 15.48 26.00 63.55 35.44 84.71

MIR-210 2674.65 4916.21 5848.40 1665.02 9218.05

MIR-211 1303.52 1153.79 2765.18 899.53 4017.09

MIR-212 180.80 377.71 161.77 218.13 447.85

MIR-213 298.07 82.32 116.19 183.03 84.92

MIR-214 935.20 660.71 1158.28 430.22 1646.30

MIR-215 139.39 117.68 91.56 37.01 123.30

MIR-216 110.10 73.09 100.43 18.79 186.22

MIR-217 4.16 0.00 3.43 0.00 5.86

MIR-218-1,2 418.16 15.35 17.86 4.63 23.84

MIR-219-1,2 46.51 5.54 54.73 22.93 95.47

MIR-220 133.55 96.01 341.59 109.66 308.06

MIR-221 603.99 43.65 257.19 176.78 9.85

MIR-222-P 217.09 52.04 179.16 17.24 55.69

MIR-223 35.41 6.46 28.34 3.71 68.14

MIR-224 80.28 18.11 102.78 5.00 170.27

MIR-296 53.83 72.81 165.47 22.65 271.33

MIR-299-P 775.60 776.13 786.66 167.41 730.48

MIR-301 220.22 91.25 647.67 333.49 435.60

MIR-302 21.16 1.03 27.99 2.51 65.48

MIR-302b 89.25 10.61 128.93 6.75 85.94

Continued

230


MIR-302c 61.09 10.91 106.79 5.17 85.09

MIR-302d 49.25 21.25 65.77 5.40 134.24

MIR-320 148.34 140.07 259.58 100.77 530.67

MIR-321 4727.31 5456.91 4070.12 7669.81 11284.62

MIR-323 103.81 19.90 136.03 61.73 136.41

MIR-324-P 281.42 302.40 496.47 144.67 508.54

MIR-325 71.26 4.78 13.98 8.34 25.91

MIR-326-P 20.25 12.95 25.77 2.64 28.13

MIR-328 839.85 563.54 1160.87 422.23 2225.28

MIR-330 225.25 187.22 202.35 45.33 515.13

MIR-331-P 213.19 103.34 263.55 59.11 470.40

MIR-335 2.83 6.95 25.08 5.44 2.17

MIR-337 158.62 127.84 327.55 38.22 578.33

MIR-338 300.39 85.36 538.28 88.57 378.56

MIR-339 992.34 257.97 630.54 258.69 1047.38

MIR-340 275.40 217.03 375.50 156.23 1234.53

MIR-342 108.53 72.67 149.55 42.10 233.95

MIR-345 696.32 460.56 1135.27 411.69 1954.75

MIR-346 1130.91 325.37 824.50 242.79 1555.54

MIR-361 111.41 55.01 42.87 178.79 9.16

MIR-367 18.01 0.00 5.55 27.26 84.53

MIR-368 1.90 0.00 1.80 0.00 0.00

MIR-369 0.00 0.00 17.06 0.00 0.00

MIR-370 114.48 64.86 146.39 46.64 162.50

MIR-371 454.50 454.08 915.52 265.16 807.42

MIR-372 5.77 0.72 1.70 1.33 3.47

MIR-373 70.22 49.74 153.42 25.31 289.97

MIR-374-P 8.93 0.00 0.00 1.42 15.88

MIR-375 36.15 53.13 14.69 65.38 9.93

MIR-376 21.81 9.84 0.70 10.86 2.67

MIR-377 63.20 102.88 5.07 184.44 3.77

MIR-378 62.81 22.56 5.59 75.57 32.68

MIR-379 10.53 1.41 0.00 2.30 0.85

MIR-380 0.00 9.15 0.00 2.48 0.00

MIR-381 4.34 3.81 2.02 11.42 1.66

MIR-382 14.20 21.58 4.17 47.78 0.00

MIR-383 26.00 31.59 8.60 95.19 75.27

MIR-384 0.00 0.00 0.00 0.00 0.00

MIR-422b 319.03 183.74 365.61 91.60 787.16

MIR-423 134.69 97.50 68.78 30.63 64.90

MIR-424 128.90 38.32 79.82 30.05 51.41

Continued

231


MIR-425 1270.22 38.46 176.90 32.92 808.57

Head & Neck squamous cell carcinoma

miRNA SCC17A SCCD12 SCC10B SCC17B SCC5

let-7a-1* 97.56 47.14 85.66 9.29 114.80

let-7a-2-P 2181.48 1627.60 3047.02 677.51 2725.60

let-7a-3* 48.99 50.62 15.27 40.13 104.19

let-7b* 182.72 59.10 93.54 14.10 331.79

let-7c* 0.00 0.00 2.92 0.00 38.87

let-7d* 345.83 211.88 784.53 83.32 469.00

let-7e* 4.96 11.01 1.51 12.36 8.06

let-7f-1* 99.87 58.37 106.21 21.82 147.73

let-7f-2* 18.45 60.75 86.28 18.48 35.20

let-7g* 107.16 162.06 85.51 29.96 112.65

let-7i* 49.93 20.53 64.82 11.99 52.46

MIR-001-1 392.94 220.71 987.67 27.28 764.84

MIR-001-2 277.98 206.70 441.68 78.87 596.56

MIR-007-1 92.56 103.20 271.79 16.87 206.96

MIR-007-2 232.01 342.48 438.46 134.85 325.54

MIR-007-3 69.07 11.64 19.72 39.44 120.86

MIR-009-1-P 8684.55 20022.85 11202.45 11727.26 9435.17

MIR-009-2-P 6674.43 3045.53 10112.89 1060.81 6878.04

MIR-009-3-P 168.68 53.62 362.10 32.20 270.25

MIR-010a,b 27.62 6.59 101.83 5.02 86.28

MIR-015a 776.87 382.58 995.75 215.98 1354.60

MIR-015b 1255.74 1245.00 712.93 550.41 1381.27

MIR-016-1 755.82 544.73 532.42 278.58 1023.78

MIR-016-2 1246.09 1267.98 1776.64 1011.29 1927.71

MIR-017-P 1603.86 1489.17 2718.48 841.44 2868.79

MIR-018 1478.61 3390.66 1471.00 381.73 4950.29

MIR-019a-P 454.99 1046.33 608.93 100.91 2342.99

MIR-019b-1-P 1863.56 1605.28 3111.60 1995.79 3401.75

MIR-019b-2-P 16.14 15.11 7.79 1.06 6.43

MIR-020 9.71 6.81 27.84 3.46 7.98

MIR-021 18734.27 24011.81 47626.61 14564.60 34924.79

MIR-022-P 1070.96 559.58 1680.01 256.00 2087.32

MIR-023a 1624.96 1101.81 3336.22 746.34 1144.15

MIR-023b-P 2916.82 998.91 4747.52 517.43 4086.99

MIR-024-1,2 5952.26 8113.48 10823.30 6466.39 36802.72

MIR-025 945.74 369.86 1426.20 178.76 1076.87

MIR-026a-1,2 390.12 146.41 746.95 80.09 518.96

Continued

232


MIR-026b 2710.92 988.23 6541.30 618.02 4084.45

MIR-027a, b 3032.99 898.39 5323.47 489.58 4219.40

MIR-028 153.57 41.40 120.23 46.08 210.64

MIR-029a,c 1059.72 542.59 746.53 317.15 623.57

MIR-029b-1,2 81.55 157.76 185.85 97.77 119.17

MIR-030a,e 551.97 244.24 1164.23 40.88 751.33

MIR-030b 1657.44 653.01 3347.95 338.52 2090.38

MIR-030c-1,2 1680.65 554.29 2886.48 247.58 2648.28

MIR-030d 38.30 23.30 169.64 1.13 74.68

MIR-031-P 13347.76 7342.21 22554.51 3398.07 18361.32

MIR-032 297.89 155.64 646.36 18.45 521.43

MIR-033 54.13 15.28 140.81 2.59 57.96

MIR-034a 1180.68 1256.29 1866.80 940.88 1963.02

MIR-034b 249.32 129.02 366.22 50.76 296.73

MIR-034c 0.00 0.00 0.00 0.00 0.00

MIR-092-1 36.20 78.10 80.81 13.42 164.98

MIR-092-2-P 436.53 168.57 1234.94 82.99 707.04

MIR-093 1143.10 1900.00 2190.31 1537.15 1459.50

MIR-095 20.13 6.81 64.55 4.02 7.08

MIR-096-P 23359.90 29188.11 34457.00 14239.61 31733.46

MIR-098 4764.91 4042.46 10246.63 1564.73 6956.44

MIR-099a 60.48 73.72 108.94 50.51 78.87

MIR-099b 427.35 741.58 574.89 983.86 351.67

MIR-100 540.14 4523.79 223.19 404.51 216.87

MIR-101-1 46.62 58.15 195.90 25.74 248.27

MIR-101-2 570.40 952.04 939.28 649.54 1673.92

MIR-103-1,2 4049.09 3479.62 6695.88 1931.93 5920.25

MIR-105-1,2 540.48 174.25 799.38 102.53 542.19

MIR-106a-P 209.74 128.27 419.22 43.81 335.08

MIR-106b 1460.17 1453.89 1683.50 1242.37 2058.86

MIR-107 4244.97 4207.71 6625.55 2942.94 6387.63

MIR-108 766.01 270.31 1271.85 181.27 946.23

MIR-122a 131.01 46.89 290.76 43.68 228.04

MIR-124a-1,2,3 183.49 127.47 423.20 144.37 215.31

MIR-125a 1188.83 542.18 2048.02 513.90 1483.59

MIR-125b-1 101.68 95.04 133.72 33.12 115.51

MIR-125b-2 227.94 107.49 546.85 32.49 292.52

MIR-126 139.81 58.30 149.61 264.35 130.80

MIR-127 7650.07 8157.38 8719.52 6955.59 10030.36

MIR-128a 851.90 8021.02 941.47 3298.28 661.52

MIR-128b 242.05 592.67 303.19 541.96 318.26

Continued

233


MIR-129-2 11576.75 3555.18 22329.18 1561.83 14186.73

MIR-130a-P 11632.11 4613.82 23551.55 1716.34 14632.10

MIR-130b 239.94 173.32 428.58 82.58 190.41

MIR-132 61.16 32.87 47.40 24.91 80.16

MIR-133a-1,2 1478.76 1913.47 4147.62 746.93 2080.98

MIR-133b 1874.82 1182.64 3505.91 968.99 2782.82

MIR-134 5729.84 2114.71 9802.38 1311.28 7729.64

MIR-135a-1,2 52.20 21.35 295.44 10.34 452.52

MIR-135b-P 448.43 261.97 778.06 145.47 709.39

MIR-136 118.44 132.40 160.18 23.63 102.57

MIR-137* 14.79 17.67 71.14 13.33 101.48

MIR-138-1,2 54.06 36.87 151.82 3.74 131.09

MIR-139 2982.05 731.49 4998.87 450.09 3804.79

MIR-140 1.91 1.63 6.95 0.00 5.36

MIR-141 273.58 110.40 502.94 17.18 285.18

MIR-142-P 4106.24 2751.41 11185.70 1328.93 15395.12

MIR-143 658.22 327.55 1097.02 151.76 822.89

MIR-144 6.87 8.66 14.55 8.02 18.61

MIR-145-P 1110.14 386.56 1250.66 214.01 1282.89

MIR-146 60.02 14.45 106.86 9.64 71.46

MIR-147 326.07 96.59 513.02 51.41 512.53

MIR-148a-P 186.34 48.55 300.14 65.68 315.33

MIR-148b-P 880.30 387.60 1262.86 128.64 1764.13

MIR-149 2158.86 1228.15 4215.90 563.31 2698.16

MIR-150 782.01 408.29 1389.83 178.73 1074.33

MIR-151 371.93 110.58 813.58 27.91 472.92

MIR-152 168.31 256.71 340.49 272.63 507.01

MIR-153-1,2 152.19 147.65 129.60 53.05 96.22

MIR-154 74.29 41.38 260.06 16.33 144.73

MIR-155 80.38 107.04 107.64 4.32 89.60

MIR-181a,c 447.28 620.27 806.30 97.59 409.56

MIR-181b-1,2 139.44 99.19 229.24 27.85 242.17

MIR-182 7325.60 1833.42 3938.31 465.06 3876.78

MIR-183 327.81 96.59 192.64 33.02 210.72

MIR-184 1892.12 905.51 3621.02 671.69 1185.44

MIR-185 6032.23 2332.06 9623.37 1500.70 3822.44

MIR-186-P 2659.76 1744.18 9527.89 550.08 3317.72

MIR-187 181.07 202.73 517.92 197.08 256.41

MIR-188b-P 498.70 166.67 994.36 141.09 752.37

MIR-190 15.83 59.15 14.99 39.90 39.63

MIR-191 151.52 49.75 286.89 6.90 155.01

Continued

234


MIR-192 0.00 0.00 0.00 0.00 0.00

MIR-193 462.00 136.08 738.65 206.70 605.22

MIR-194-1,2 279.89 88.99 548.62 16.74 411.24

MIR-195-P 15927.75 6364.69 33332.36 3295.25 25899.02

MIR-196a-1 453.71 411.79 481.64 189.05 662.24

MIR-196a-2 327.33 46.25 803.54 130.94 282.45

MIR-196b 7154.48 2691.84 3038.97 2540.60 3251.90

MIR-197 17908.72 10930.58 19754.36 4470.89 16845.99

MIR-198 12.34 292.61 13.19 2.04 70.93

MIR-199a-1-P 3457.14 2498.51 3105.85 2122.33 4079.92

MIR-199a-2-P 696.18 3597.22 1302.08 2368.02 900.48

MIR-199b-P 5659.02 2204.29 8779.40 1289.17 5365.19

MIR-200a-P 100103.73 101638.35 144466.94 64438.67 171307.39

MIR-200b 126.85 139.39 404.22 62.70 304.12

MIR-200c 235.17 45.70 539.77 58.61 364.74

MIR-203 151.04 117.60 317.63 40.81 267.75

MIR-204 3233.23 1203.17 6361.16 694.51 6005.70

MIR-205 2749.62 1267.39 2885.66 790.15 4024.49

MIR-206 352.40 140.91 701.21 49.18 666.24

MIR-208 113.87 122.62 252.76 52.96 228.10

MIR-210 15197.87 24887.13 24766.25 23943.21 8658.47

MIR-211 6933.81 3403.82 12057.56 1726.98 8537.68

MIR-212 631.76 240.09 1060.80 153.28 883.01

MIR-213 191.89 179.01 485.61 85.86 200.71

MIR-214 3786.62 2262.78 8176.70 956.18 5818.80

MIR-215 92.32 52.54 131.80 38.23 171.35

MIR-216 601.33 256.10 1134.51 133.74 822.36

MIR-217 12.64 2.04 19.29 5.59 11.87

MIR-218-1,2 118.76 2951.44 207.92 1159.07 143.27

MIR-219-1,2 82.25 366.00 135.39 295.67 218.89

MIR-220 840.95 246.02 647.88 208.23 469.76

MIR-221 671.66 167.92 586.67 156.66 1236.55

MIR-222-P 640.72 239.75 969.30 114.25 581.48

MIR-223 254.31 39.10 290.81 17.41 314.21

MIR-224 482.70 162.84 664.38 149.62 1078.74

MIR-296 593.97 213.61 1582.79 92.71 1016.76

MIR-299-P 834.48 749.58 3344.78 398.50 2253.92

MIR-301 402.60 710.74 691.72 612.24 736.99

MIR-302 87.36 278.52 151.71 45.39 139.47

MIR-302b 384.89 174.11 482.25 68.35 425.28

MIR-302c 405.12 129.41 1129.58 24.63 777.64

Continued

235


MIR-302d 333.91 115.87 837.21 21.62 645.86

MIR-320 495.18 330.76 1074.47 152.23 1046.60

MIR-321 12633.16 7751.71 12660.01 7624.21 38764.26

MIR-323 307.22 231.00 498.40 103.57 684.46

MIR-324-P 964.56 884.51 1556.49 349.54 1590.87

MIR-325 643.14 45.07 141.98 80.62 157.49

MIR-326-P 145.30 45.63 307.32 39.55 192.77

MIR-328 6705.11 1794.17 11160.98 878.38 10478.66

MIR-330 976.01 323.99 1695.54 177.45 1643.84

MIR-331-P 881.57 293.60 1598.51 74.19 1153.36

MIR-335 38.60 14.04 86.72 3.04 35.00

MIR-337 1302.14 526.90 2495.57 368.88 2050.33

MIR-338 1383.21 474.44 1826.35 189.56 1887.33

MIR-339 1522.38 791.77 1388.57 503.36 1472.69

MIR-340 166.89 137.59 587.12 42.34 365.17

MIR-342 594.31 125.11 1781.11 133.77 1409.85

MIR-345 5520.16 1625.70 7090.30 1002.69 8379.26

MIR-346 2615.44 958.33 5360.92 516.74 2845.74

MIR-361 105.57 66.89 124.44 110.76 303.97

MIR-367 4.57 12.52 44.95 1.59 3.31

MIR-368 12.66 4.00 23.24 2.92 11.53

MIR-369 1.68 0.00 0.00 0.00 0.00

MIR-370 487.40 364.35 898.71 168.74 587.33

MIR-371 3061.09 1682.88 4857.15 622.86 3302.94

MIR-372 43.68 3.79 72.51 27.82 64.05

MIR-373 557.55 175.04 1249.87 89.80 597.21

MIR-374-P 0.00 1.03 7.89 0.00 0.00

MIR-375 30.10 32.92 28.42 67.27 58.26

MIR-376 3.78 147.74 2.97 47.57 42.88

MIR-377 120.72 52.02 127.89 56.21 330.70

MIR-378 104.49 11.12 92.28 67.28 242.08

MIR-379 9.64 124.19 3.01 144.09 21.24

MIR-380 22.92 6.37 6.80 3.99 57.08

MIR-381 13.91 1.17 58.61 2.51 78.44

MIR-382 50.42 15.40 14.58 3.62 66.50

MIR-383 69.88 11.88 44.99 28.25 155.36

MIR-384 0.00 0.00 0.00 0.00 0.00

MIR-422b 1054.18 387.48 2299.62 32.64 1401.36

MIR-423 568.32 274.84 3562.62 137.58 846.98

MIR-424 28.82 109.27 123.45 14.68 81.20

MIR-425 89.95 92.16 49.76 38.87 304.93

Continued

236


Breast Cancer

miRNA T47D SKBR3 MDA361 MCF7 MDA231

let-7a-1* 62.25 43.55 158.66 81.18 42.38

let-7a-2-P 688.29 1113.40 1507.16 860.86 563.29

let-7a-3* 111.26 74.66 53.56 51.86 205.56

let-7b* 175.54 113.98 62.44 75.15 176.07

let-7c* 0.00 11.87 12.70 3.22 10.72

let-7d* 273.02 283.48 422.64 319.91 210.57

let-7e* 8.64 8.14 17.71 7.94 9.09

let-7f-1* 479.87 214.50 441.00 439.57 279.89

let-7f-2* 19.25 18.62 30.97 18.75 12.32

let-7g* 84.74 80.38 152.01 39.30 103.62

let-7i* 121.17 34.10 42.70 105.70 248.82

MIR-001-1 111.86 441.72 560.64 136.05 82.99

MIR-001-2 271.90 377.84 700.50 374.80 235.78

MIR-007-1 76.16 122.37 175.51 243.58 129.69

MIR-007-2 60.77 66.59 168.69 104.48 97.31

MIR-007-3 40.55 32.19 43.46 39.24 32.80

MIR-009-1-P 2837.00 6147.47 6808.78 2913.26 3389.38

MIR-009-2-P 2474.60 3521.04 5729.07 2588.92 2095.63

MIR-009-3-P 62.92 59.04 72.35 78.77 39.65

MIR-010a,b 6.32 3.45 3.26 2.00 94.73

MIR-015a 287.29 332.38 611.60 219.33 150.22

MIR-015b 1226.15 983.08 1532.48 456.28 413.33

MIR-016-1 786.46 360.43 400.51 519.05 920.46

MIR-016-2 942.96 827.13 683.45 543.06 575.55

MIR-017-P 730.07 1136.57 1259.00 701.41 603.79

MIR-018 912.46 2437.49 1159.92 443.18 1616.64

MIR-019a-P 243.80 797.03 696.68 150.88 382.36

MIR-019b-1-P 1147.48 684.13 702.13 1380.25 1521.93

MIR-019b-2-P 3.83 4.76 7.75 2.44 5.49

MIR-020 2.82 5.46 7.34 9.83 2.22

MIR-021 4449.65 1695.60 3734.70 54580.57 23376.82

MIR-022-P 310.62 594.88 999.26 605.58 1611.30

MIR-023a 484.17 856.21 1263.72 648.93 533.03

MIR-023b-P 1156.68 1829.98 2632.32 2217.37 1062.31

MIR-024-1,2 6014.17 6789.07 4590.01 10811.48 5329.28

MIR-025 444.13 1221.73 707.49 418.93 356.35

MIR-026a-1,2 298.20 200.80 441.08 149.64 89.68

MIR-026b 1499.59 1935.09 2380.76 1562.26 530.44

MIR-027a, b 916.93 1477.60 1834.31 1120.67 940.45

Continued

237


MIR-028 56.31 57.74 72.81 38.91 60.11

MIR-029a,c 108.76 310.95 317.41 118.38 909.67

MIR-029b-1,2 11.38 77.04 103.42 11.28 27.64

MIR-030a,e 482.77 381.29 854.43 416.18 342.82

MIR-030b 465.52 900.25 1762.20 1069.91 1149.89

MIR-030c-1,2 719.85 851.89 959.04 684.72 454.47

MIR-030d 80.78 17.98 413.93 112.75 15.74

MIR-031-P 4357.22 5886.28 7941.88 4975.91 6153.68

MIR-032 144.78 63.81 360.54 223.48 97.75

MIR-033 23.94 15.67 26.07 17.58 10.55

MIR-034a 402.02 724.91 828.41 411.77 366.20

MIR-034b 87.83 61.84 114.55 74.69 77.56

MIR-034c 0.00 0.00 0.00 0.00 0.00

MIR-092-1 43.91 37.47 42.58 2.38 10.81

MIR-092-2-P 199.46 285.98 374.90 237.64 102.99

MIR-093 527.99 700.97 1078.20 404.09 397.40

MIR-095 6.57 10.17 32.50 15.51 16.14

MIR-096-P 8705.83 19556.09 16927.21 12463.90 15769.94

MIR-098 3923.73 3912.68 5167.08 4590.02 2513.38

MIR-099a 13.05 41.01 56.81 58.62 26.45

MIR-099b 433.84 718.37 644.30 880.44 562.50

MIR-100 34.23 61.54 31.70 9.39 4910.96

MIR-101-1 57.19 53.99 91.15 17.70 7.35

MIR-101-2 431.29 496.55 444.50 757.69 705.47

MIR-103-1,2 2824.43 3735.04 4344.53 4052.00 3637.89

MIR-105-1,2 182.63 248.15 494.46 177.27 51.29

MIR-106a-P 39.99 76.79 132.13 48.68 34.83

MIR-106b 847.46 2181.43 544.63 1513.56 2151.66

MIR-107 3872.58 4127.91 2194.33 4054.20 5617.71

MIR-108 377.90 431.93 641.51 222.86 247.58

MIR-122a 23.34 48.77 109.86 83.45 70.56

MIR-124a-1,2,3 44.36 147.50 170.64 88.34 64.48

MIR-125a 1029.68 1861.53 4424.16 1454.55 695.39

MIR-125b-1 20.24 42.81 35.40 10.71 299.73

MIR-125b-2 112.08 187.57 266.78 136.81 152.50

MIR-126 43.94 66.09 78.80 100.39 40.93

MIR-127 5745.33 5878.40 5840.05 5391.94 4800.48

MIR-128a 333.52 1081.04 1726.56 419.10 327.99

MIR-128b 113.44 175.13 210.29 96.97 103.98

MIR-129-2 4823.24 6984.59 7619.57 6112.24 4036.01

MIR-130a-P 4924.21 6820.42 10705.49 5561.44 4933.34

Continued

238


MIR-130b 68.69 175.56 286.05 44.94 39.88

MIR-132 7.86 10.36 82.39 42.26 17.01

MIR-133a-1,2 671.92 674.48 1000.23 636.45 657.88

MIR-133b 986.75 971.33 1173.69 887.52 915.55

MIR-134 2147.20 2854.69 3493.59 2083.45 3436.23

MIR-135a-1,2 77.93 53.95 52.20 68.79 57.72

MIR-135b-P 142.27 306.25 455.58 67.81 410.20

MIR-136 23.42 36.00 56.89 29.24 42.38

MIR-137* 20.93 32.20 31.22 54.54 19.87

MIR-138-1,2 48.47 48.96 66.88 27.36 24.62

MIR-139 1242.27 1423.97 1564.71 1115.19 810.34

MIR-140 0.00 0.83 3.33 0.99 1.02

MIR-141 61.85 175.44 135.60 109.94 82.61

MIR-142-P 834.07 1803.41 2639.43 1164.34 1240.16

MIR-143 147.35 443.79 502.10 234.25 164.74

MIR-144 6.16 9.64 8.24 65.90 6.29

MIR-145-P 147.76 589.08 408.63 353.07 371.05

MIR-146 8.43 13.66 27.70 16.89 17.70

MIR-147 99.63 150.80 332.58 88.94 95.80

MIR-148a-P 74.31 69.59 60.83 75.62 82.62

MIR-148b-P 857.16 586.37 1727.98 397.96 414.32

MIR-149 1387.37 1312.37 1989.93 1344.34 1761.82

MIR-150 503.48 478.36 548.66 382.17 477.60

MIR-151 137.06 174.13 353.87 255.64 129.77

MIR-152 48.91 73.20 106.41 137.98 171.43

MIR-153-1,2 31.71 37.01 57.91 40.75 86.26

MIR-154 4.63 30.12 39.11 11.69 64.67

MIR-155 10.48 41.57 150.38 105.92 382.40

MIR-181a,c 526.25 320.93 352.45 164.21 894.54

MIR-181b-1,2 90.07 185.35 226.58 101.45 194.93

MIR-182 4001.65 4445.20 1426.94 8261.33 8280.74

MIR-183 148.97 191.99 98.05 291.27 390.85

MIR-184 1411.99 1536.55 2368.26 1542.60 1152.12

MIR-185 2970.97 3586.65 3673.96 3417.54 2484.17

MIR-186-P 1776.40 3199.59 4034.67 2033.39 1559.13

MIR-187 58.54 146.67 173.64 125.80 61.46

MIR-188b-P 131.00 171.89 358.77 169.89 108.23

MIR-190 12.21 27.22 28.14 0.95 2.63

MIR-191 43.94 69.87 92.95 46.02 12.11

MIR-192 0.00 0.00 0.00 0.00 0.00

MIR-193 347.41 306.98 320.03 203.38 206.30

Continued

239


MIR-194-1,2 36.90 108.57 56.38 96.72 41.80

MIR-195-P 4392.29 8430.40 8891.78 5641.60 8186.25

MIR-196a-1 121.91 210.47 429.53 334.39 143.51

MIR-196a-2 377.53 316.74 617.67 162.95 249.69

MIR-196b 222.43 863.03 1063.27 445.86 735.45

MIR-197 7025.10 24608.73 13504.50 3916.36 1973.59

MIR-198 30.19 7.97 9.39 1.77 2.97

MIR-199a-1-P 2006.88 2718.44 3351.06 2476.13 1998.50

MIR-199a-2-P 331.62 989.45 1328.12 360.36 244.54

MIR-199b-P 2375.35 3000.15 3298.06 3261.80 2230.47

MIR-200a-P 57526.35 32110.60 68020.47 46917.79 66490.12

MIR-200b 93.33 58.59 234.11 174.94 34.20

MIR-200c 88.20 136.54 222.29 145.93 57.19

MIR-203 88.75 61.64 50.97 39.79 7.83

MIR-204 803.02 1462.54 2400.18 379.38 1870.90

MIR-205 273.21 77.85 234.10 28.61 22.36

MIR-206 11.87 120.80 339.45 115.18 31.33

MIR-208 61.45 94.89 84.41 61.91 39.13

MIR-210 1251.49 10642.91 8897.04 13227.19 15161.91

MIR-211 3511.02 3749.33 6996.25 3879.47 3316.68

MIR-212 124.33 206.66 323.50 259.13 437.06

MIR-213 270.56 235.05 201.22 264.04 725.56

MIR-214 1818.16 2440.67 3668.78 1916.36 1540.07

MIR-215 174.40 178.94 249.84 87.29 124.09

MIR-216 192.32 280.14 408.72 228.03 181.29

MIR-217 7.41 26.01 17.80 7.90 2.19

MIR-218-1,2 28.19 593.60 709.95 94.89 20.51

MIR-219-1,2 84.76 132.03 130.01 49.52 148.28

MIR-220 149.46 258.83 299.02 289.09 680.37

MIR-221 35.67 37.02 38.03 37.22 243.54

MIR-222-P 56.47 110.29 160.25 133.10 99.38

MIR-223 54.56 135.34 217.84 85.06 53.51

MIR-224 181.41 286.00 281.54 168.92 142.44

MIR-296 251.92 89.98 538.08 334.28 253.02

MIR-299-P 585.45 920.19 1897.78 2717.80 569.88

MIR-301 788.21 286.71 374.65 1137.02 612.53

MIR-302 89.48 94.55 277.30 120.71 23.64

MIR-302b 165.52 346.73 306.09 226.29 137.81

MIR-302c 115.90 191.66 321.50 161.90 131.02

MIR-302d 128.09 220.19 275.97 84.05 86.58

MIR-320 409.76 438.32 750.84 393.78 488.45

Continued

240


MIR-321 2457.71 7312.89 15327.99 68262.76 11380.68

MIR-323 619.72 592.20 526.24 169.92 96.00

MIR-324-P 571.93 614.68 926.84 794.07 519.32

MIR-325 42.11 40.02 37.14 105.82 17.09

MIR-326-P 34.98 49.61 101.96 83.70 32.27

MIR-328 1339.08 2747.11 4416.14 1934.46 1887.74

MIR-330 272.23 342.89 674.43 464.94 357.97

MIR-331-P 201.32 583.44 987.66 406.33 365.48

MIR-335 8672.16 15.48 23.83 16.20 18.10

MIR-337 460.97 774.96 697.24 75.04 530.19

MIR-338 625.99 872.31 1090.44 702.12 634.21

MIR-339 987.15 965.65 943.34 978.02 764.80

MIR-340 602.43 212.03 956.98 864.57 1010.18

MIR-342 252.31 317.36 403.08 450.77 251.75

MIR-345 1529.57 2797.94 3450.28 1806.99 523.98

MIR-346 1247.74 1507.08 1152.95 2164.04 1719.51

MIR-361 165.11 82.17 50.93 198.82 96.81

MIR-367 8.28 24.84 17.59 40.50 23.38

MIR-368 0.00 0.94 1.99 6.15 3.12

MIR-369 0.00 2.16 0.00 0.00 0.00

MIR-370 167.34 193.30 369.51 198.67 144.19

MIR-371 841.11 1591.51 1663.46 1318.69 1749.81

MIR-372 5.36 7.48 38.52 19.75 4.56

MIR-373 194.64 286.49 353.84 228.32 151.31

MIR-374-P 24.94 5.49 6.11 1.57 0.00

MIR-375 59.32 25.95 101.19 72.24 17.45

MIR-376 4.13 2.51 2.07 15.51 7.56

MIR-377 109.56 11.34 30.87 347.19 71.63

MIR-378 37.30 56.46 54.87 234.68 63.52

MIR-379 1.44 7.31 6.37 16.52 2.84

MIR-380 11.86 4.24 34.21 4.58 4.52

MIR-381 15.27 6.16 36.54 27.24 8.73

MIR-382 9.67 7.87 9.30 14.27 27.48

MIR-383 66.51 20.24 28.99 130.99 84.30

MIR-384 0.00 0.00 0.00 0.00 0.00

MIR-422b 658.88 831.07 1622.54 853.33 473.31

MIR-423 232.65 350.31 270.22 225.82 200.45

MIR-424 12.14 89.07 56.92 126.24 206.92

MIR-425 217.74 155.79 565.54 89.11 233.39

Colorectal Cancer

Continued

241


miRNA HCT8 HCT116 HT29 SW620 HCT15 HeLa

let-7a-1* 858.6328 26.56572 103.2427 118.4805 183.6582 25.74712

let-7a-2-P 396.5826 1448.423 904.466 944.8584 1740.836 1857.928

let-7a-3* 779.3264 33.83821 460.5481 191.8136 388.4083 71.64201

let-7b* 666.7015 140.1044 430.6308 177.4954 416.9417 150.0497

let-7c* 2.139169 0 0 1.966706 0 0

let-7d* 1652.745 319.0011 623.4727 643.5575 287.5726 111.6563

let-7e* 17.60674 0 27.02524 0 16.84116 0

let-7f-1* 1983.959 480.2421 847.6834 737.6523 495.6824 132.7326

let-7f-2* 67.00685 24.49063 38.95639 21.29969 18.34627 9.176052

let-7g* 625.3398 143.5549 63.57787 256.2802 163.6351 26.97658

let-7i* 225.3582 87.03372 51.60207 180.7823 160.3876 228.2109

MIR-001-1 29.96919 125.0151 15.76709 218.114 331.3349 320.1529

MIR-001-2 452.1449 261.2442 265.1213 306.5967 1177.074 337.7787

MIR-007-1 88.78428 148.2617 158.5793 173.1882 262.1453 102.6599

MIR-007-2 26.99634 49.14339 141.9696 137.9683 146.9345 207.0472

MIR-007-3 2.197971 23.89761 59.15871 4482.319 41.89004 149.18

MIR-009-1-P 1451.901 6319.989 4207.668 2610.739 4601.714 1455.045

MIR-009-2-P 913.5585 2653.155 2516.776 3651.288 7360.267 7251.747

MIR-009-3-P 5.910899 74.97863 62.53537 60.41976 67.56843 96.99898

MIR-010a,b 619.1 86.19631 266.6186 78.49641 1901.472 56.19538

MIR-015a 145.9512 378.2724 333.8203 495.4617 776.2445 502.9424

MIR-015b 386.8024 931.5294 706.1382 900.2918 1107.319 502.2059

MIR-016-1 660.0388 876.3006 702.3629 1205.397 2270.934 276.4983

MIR-016-2 300.8195 738.2241 727.1829 613.9356 858.8586 1157.982

MIR-017-P 424.6995 1359.089 1377.29 3260.714 2047.729 900.4742

MIR-018 2081.512 2616.175 6256.62 12520.61 8806.856 1728.682

MIR-019a-P 416.7196 731.731 1286.29 4039.599 3258.111 1022.288

MIR-019b-1-P 864.9197 859.0292 1785.739 1182.591 1936.753 579.6239

MIR-019b-2-P 0 4.336451 10.56738 0 5.713239 4.062523

MIR-020 7.505857 14.61272 28.04179 32.71384 11.72935 1.32159

MIR-021 50874.99 58938.4 17778.59 14369.48 4720.269 6712.824

MIR-022-P 1909.665 712.7892 1911.439 2520.227 757.4464 733.3245

MIR-023a 240.2744 592.8306 716.3597 779.2062 1407.155 1201.024

MIR-023b-P 675.0464 1962.236 1303.544 1594.949 2894.791 360.3628

MIR-024-1,2 3769.404 3275.857 7780.918 10350.49 10848.19 6529.597

MIR-025 418.9766 438.5579 1004.11 1740.284 1624.791 506.4707

MIR-026a-1,2 246.9806 145.2754 233.6056 304.7698 298.4189 318.475

MIR-026b 672.3596 1600.749 1511.269 1402.817 2249.309 1154.567

MIR-027a, b 603.8183 1323.765 1324.007 1223.712 1941.031 1531.911

MIR-028 18.96326 31.46524 33.42726 47.57557 81.76565 42.16035

Continued

242


MIR-029a,c 175.5249 923.1972 241.7734 748.8847 967.5754 109.7668

MIR-029b-1,2 3.131238 25.64242 73.733 13.69045 26.82112 21.42734

MIR-030a,e 131.2142 186.5888 241.3156 259.7985 622.7983 360.9059

MIR-030b 293.2278 1113.478 1116.101 991.1852 1655.255 941.8097

MIR-030c-1,2 425.1509 691.1524 853.9301 679.8306 1435.298 729.6663

MIR-030d 50.05628 95.89363 172.0392 103.4067 182.5863 29.27537

MIR-031-P 3636.022 9515.312 6730.927 4758.911 11835.72 6526.764

MIR-032 175.8589 116.0979 187.4735 137.3989 555.828 131.0234

MIR-033 6.380136 7.845837 13.69873 26.96014 21.39319 32.09109

MIR-034a 114.7969 404.5851 689.6787 508.8551 616.5719 509.5557

MIR-034b 43.90841 151.7012 76.38421 114.3459 151.8128 52.63946

MIR-034c 0 0 0 0 0 0

MIR-092-1 52.24811 52.30043 95.98827 156.6745 251.6343 47.65748

MIR-092-2-P 89.67869 311.23 277.6539 203.2726 379.0785 297.8797

MIR-093 292.1088 723.8734 827.0072 939.9623 986.3213 420.677

MIR-095 47.0068 26.42547 4.353642 19.85175 51.82277 14.76487

MIR-096-P 7814.41 23747.99 17050.31 14472.33 37251.3 14151.99

MIR-098 2120.708 2253.724 3885.721 9781.361 13142.37 3682.978

MIR-099a 6.977367 25.569 20.92022 26.31396 136.5722 97.52835

MIR-099b 436.9488 243.2771 491.9417 230.9324 1442.155 1442.525

MIR-100 7.230838 8366.922 16.65482 405.3392 54.78532 1002.784

MIR-101-1 26.54289 7.940138 10.34086 61.59516 44.3979 21.81055

MIR-101-2 223.2018 361.7411 537.9242 1202.656 655.1078 247.3087

MIR-103-1,2 1947.736 3288.189 3458.059 5432.269 8465.019 3404.049

MIR-105-1,2 107.2489 193.9397 217.3292 202.5615 363.8384 343.6853

MIR-106a-P 17.82535 77.62886 71.00889 83.51111 116.1518 73.04081

MIR-106b 1194.63 1314.696 3225.651 4127.674 3566.511 607.9477

MIR-107 2766.868 3405.163 4607.7 8226.097 12181.71 2083.073

MIR-108 94.60239 278.2872 322.534 190.7989 512.1909 3.082367

MIR-122a 7.459651 36.69896 29.73935 43.41953 111.0434 155.046

MIR-124a-1,2,3 13.92713 75.44121 63.41554 100.1347 167.9732 65.45739

MIR-125a 312.2859 1121.213 730.2028 743.4873 1311.396 756.9644

MIR-125b-1 4.426267 1165.244 32.6417 47.81384 44.05668 168.745

MIR-125b-2 29.39134 197.8012 124.2387 78.89522 83.40107 123.868

MIR-126 45.1213 131.4173 66.74584 72.37189 29.29237 428.2762

MIR-127 3789.418 3821.264 5811.132 4529.653 3397.028 4810.069

MIR-128a 409.2436 617.281 398.6055 323.1376 1078.223 540.5957

MIR-128b 24.79734 67.95487 81.44437 106.2937 81.75552 132.3815

MIR-129-2 3252.573 7358.586 6573.032 5799.161 9972.255 8423.595

MIR-130a-P 2527.761 7547.183 6471.418 6467.01 8418.279 6466.665

MIR-130b 60.07852 20.81728 45.86715 110.1567 154.7273 40.43121

Continued

243


MIR-132 3.392268 10.54607 30.60755 43.08519 43.57966 39.57838

MIR-133a-1,2 593.6712 664.8818 671.4538 449.8052 1335.077 551.3551

MIR-133b 414.7147 1359.772 1029.132 1266.517 512.5088 1947.167

MIR-134 1134.351 1901.47 2974.258 2484.47 426.9678 3013.016

MIR-135a-1,2 108.5499 35.63658 59.46605 108.3684 399.6547 94.2825

MIR-135b-P 213.8267 495.0453 333.3833 292.3017 162.6791 348.2613

MIR-136 16.42341 32.59869 23.23807 35.61811 67.26193 81.64402

MIR-137* 6.706809 17.59405 22.47996 39.4592 45.94706 3.584687

MIR-138-1,2 7.840621 33.79533 20.07316 19.30726 60.12293 54.64548

MIR-139 676.9869 1964.388 1506.958 1148.339 1990.836 1455.485

MIR-140 0.99355 0.77326 0 0 2.08558 0

MIR-141 96.90152 75.62146 101.0013 51.94906 237.3693 153.924

MIR-142-P 742.1889 2180.873 1944.425 93.08532 2444.312 2174.696

MIR-143 116.873 242.5868 208.6492 144.0841 514.7473 514.8569

MIR-144 4.672227 0.628385 2.17791 3.061594 5.872603 0

MIR-145-P 161.9171 523.5928 388.4528 313.7008 351.346 243.1834

MIR-146 4.326121 182.8769 15.50638 29.38146 11.5396 31.6192

MIR-147 52.03633 190.5483 161.8781 343.2752 332.4611 200.0979

MIR-148a-P 23.38892 104.532 63.98417 51.15979 80.02053 15.87187

MIR-148b-P 191.9018 503.0921 378.48 466.9279 1703.11 682.4618

MIR-149 273.87 263.1702 1473.368 1224.909 2369.59 1814.888

MIR-150 225.8272 463.4491 518.1132 495.5266 795.23 928.579

MIR-151 48.46468 221.9175 242.1159 248.1392 277.7097 394.1336

MIR-152 77.45324 69.03609 43.70144 75.43123 196.9967 114.6715

MIR-153-1,2 13.86209 103.8692 22.36573 265.4505 91.39711 25.4118

MIR-154 3.869608 22.38215 33.1496 24.34255 38.98702 38.05686

MIR-155 12.42286 55.04169 77.95959 15.36145 259.746 134.442

MIR-181a,c 143.8996 332.8634 561.3267 1189.489 427.5878 453.3771

MIR-181b-1,2 32.94578 110.9696 69.27151 65.49388 191.7068 164.9875

MIR-182 3471.177 11760.68 7875.101 14851.87 11546.05 1052.715

MIR-183 167.8081 493.7559 211.6685 452.9504 314.8324 55.94216

MIR-184 482.8474 1217.5 1302.477 1503.389 2430.265 1696.498

MIR-185 1655.257 3543.113 3587.202 2314.415 3844.361 2252.288

MIR-186-P 1534.839 2294.337 3083.847 3085.927 9961.895 2040.209

MIR-187 48.8742 172.2086 94.01175 85.77991 77.46041 150.1551

MIR-188b-P 85.91987 224.7902 168.7507 185.2942 242.2323 208.9167

MIR-190 0 1.627128 1.100183 16.3053 12.03259 20.90265

MIR-191 19.70146 25.8896 32.86388 47.7036 53.94927 47.63331

MIR-192 0 1074.752 0 523.274 610.6581 519.2557

MIR-193 94.17563 198.2033 156.1941 46.82278 246.4542 334.6753

MIR-194-1,2 28.68354 77.98645 111.8687 147.7562 117.6403 54.10766

Continued

244


MIR-195-P 3503.953 13905.82 8484.665 7887.77 15530.54 7771.25

MIR-196a-1 1109.454 313.8951 1008.097 287.2314 926.9358 494.4576

MIR-196a-2 89.39692 101.5213 148.4484 200.5871 369.093 65.10065

MIR-196b 430.8136 14753.53 24194.42 11119.59 10390.38 3911.31

MIR-197 3171.504 12127.31 5059.421 5976.362 14323.88 15025.78

MIR-198 0.810397 41.22313 3.835345 3.398553 6.038527 9.890589

MIR-199a-1-P 858.5674 1301.236 2448.376 3025.907 1992.933 1805.783

MIR-199a-2-P 157.97 320.2873 260.9154 592.8856 513.4992 195.426

MIR-199b-P 1029.394 3249.48 1077.528 2604.771 4301.675 6835.134

MIR-200a-P 36539.68 92229.37 75610.08 49235.55 125174 55241.49

MIR-200b 163.5854 62.35029 760.2065 172.5957 204.7594 108.5994

MIR-200c 108.2049 35.02744 137.3241 76.14315 202.6843 239.9847

MIR-203 94.28691 14.61154 60.7142 73.73222 163.786 77.26294

MIR-204 840.4258 1995.016 1954.807 1305.777 2403.835 1853.281

MIR-205 5.302058 6.012355 21.23884 38.19757 35.29727 20.44176

MIR-206 31.23536 171.1748 226.168 184.5706 427.2351 142.4579

MIR-208 13.67356 85.60709 68.01402 66.61015 122.5556 144.5863

MIR-210 4693.817 29509.37 8259.725 6299.346 29003.47 63.51755

MIR-211 1760.765 3780.557 3280.637 3808.365 6854.794 3392.772

MIR-212 238.8805 492.1094 246.0567 881.8622 1346.46 404.9515

MIR-213 35.85119 722.4231 436.9843 360.1484 358.7738 142.3082

MIR-214 1040.015 1724.102 3260.109 1721.53 2832.766 1827.1

MIR-215 53.17391 103.3322 76.92807 59.78262 155.5646 53.13787

MIR-216 112.0725 277.7547 306.5443 259.5179 359.4469 351.6544

MIR-217 15.26014 6.470761 3.532712 2.278755 19.34929 3.729676

MIR-218-1,2 7.637745 66.02772 30.49248 39.07788 60.19512 72.05416

MIR-219-1,2 83.49827 42.5829 47.46584 88.41967 198.1093 71.7328

MIR-220 123.3407 245.8683 202.4307 179.7148 509.197 282.5261

MIR-221 107.3138 794.0723 273.5634 397.8852 343.9514 127.902

MIR-222-P 31.33221 3017.878 166.1777 120.7482 339.7038 231.9186

MIR-223 27.62982 27.98896 64.82215 64.75493 101.7956 3.497619

MIR-224 88.74434 129.1676 272.4346 250.7757 263.6765 855.595

MIR-296 95.04047 354.2562 342.4293 228.2298 361.4993 768.5301

MIR-299-P 368.4251 1967.997 682.9783 860.2205 1398.926 1444.011

MIR-301 252.6409 267.3405 234.8289 930.1332 1532.321 213.291

MIR-302 18.28203 63.12679 81.33678 56.05573 86.99968 27.34738

MIR-302b 83.838 98.12517 143.8903 169.9355 305.597 318.0692

MIR-302c 50.42963 172.1014 169.3356 135.0086 302.1697 0

MIR-302d 39.031 163.2747 178.0246 131.7586 245.5951 183.7419

MIR-320 489.3002 412.7287 502.0868 609.2567 1476.951 532.4651

MIR-321 5699.42 20846.95 16162.7 5800.888 20094.89 5317.977

Continued

245


MIR-323 65.27868 129.7469 119.1797 137.3871 411.4272 382.2681

MIR-324-P 537.6329 619.6461 792.0435 839.5042 1588.497 690.3973

MIR-325 68.18792 42.85667 70.74943 313.2638 114.5458 42.42922

MIR-326-P 6.368802 67.8049 48.52222 43.86994 83.51881 104.3394

MIR-328 1001.711 3079.63 2991.854 2181.811 4949.716 4486.09

MIR-330 268.1315 545.9928 374.8421 402.7715 576.319 511.4956

MIR-331-P 268.4213 368.9336 426.6046 389.2076 912.9941 30.81881

MIR-335 11.53739 34.5304 11.36867 4.327626 8.429286 5.887744

MIR-337 410.4399 567.2167 520.4553 646.2871 1048.427 769.6332

MIR-338 202.4377 891.3485 467.7347 693.0709 1121.582 278.0501

MIR-339 553.6613 1137.904 938.9432 678.1472 1517.897 1570.045

MIR-340 506.743 535.116 406.8421 471.7936 1320.466 231.1919

MIR-342 97.63136 323.29 242.2573 202.1271 402.1698 856.0626

MIR-345 241.1075 1984.368 2432.859 2182.408 3279.497 561.8711

MIR-346 977.9059 2267.955 1449.065 1385.61 1998.735 2077.889

MIR-361 41.62921 156.2936 110.8631 144.5701 166.8953 129.6966

MIR-367 42.87979 21.25949 31.42357 21.77565 96.02627 4.851067

MIR-368 0 7.475348 2.509002 9.705547 27.33484 1.082579

MIR-369 13.40863 0 0 0 0 0

MIR-370 49.93002 318.7627 132.4245 141.267 356.5916 364.7185

MIR-371 267.9453 3764.923 1293.84 961.8371 1768.312 20.88434

MIR-372 4.040082 7.464502 26.28481 0 13.19192 15.65218

MIR-373 58.48832 264.0393 186.106 260.127 391.8836 213.7537

MIR-374-P 0 31.19252 0 13.96407 115.2487 89.98624

MIR-375 89.87842 44.47787 90.58668 206.0609 224.8806 11.34272

MIR-376 0 16.02958 12.74379 6.915397 17.19225 16.01698

MIR-377 21.17526 179.9386 201.2492 226.4024 443.5638 394.4266

MIR-378 36.70699 139.4146 201.9541 220.9498 409.1737 112.3007

MIR-379 0 7.045688 3.157919 3.566075 3.495784 54.92527

MIR-380 0 18.06349 12.7084 43.95977 37.94854 12.48013

MIR-381 2.0587 16.60751 47.25099 34.17626 37.03083 75.91218

MIR-382 3.435885 35.04295 43.54007 83.76556 69.52062 41.85704

MIR-383 10.71362 207.8169 173.9212 119.2419 256.8142 147.2181

MIR-384 0 0 0 0 0 1.575494

MIR-422b 296.4645 707.789 698.0748 765.0957 1151.567 820.1639

MIR-423 92.93823 356.5244 194.9094 158.1259 301.6657 224.4276

MIR-424 16.90948 54.37745 24.08734 286.3969 34.78159 47.78524

MIR-425 1857.477 498.9913 221.6507 396.941 400.8351 23.93992

Hematological Cancer

miRNA RAMOS HL60 K562 JURCAT DAUDI 293T

Continued

246


let-7a-1* 166.6366 13.8676 17.14962 45.91204 49.82124 13.92584

let-7a-2-P 3753.81 746.0296 2851.498 2891.934 3460.508 360.4258

let-7a-3* 0 19.68504 0 21.09172 9.386879 5.125911

let-7b* 18.98209 66.10125 10.16696 13.42023 22.75995 23.46274

let-7c* 68.968 1.539028 0 0 29.12717 0

let-7d* 1313.732 294.2404 321.4057 307.9057 540.0203 114.0851

let-7e* 0 0 10.35786 0 0 0

let-7f-1* 333.5827 47.52613 77.08861 49.36752 174.2227 116.2856

let-7f-2* 81.47435 19.7481 27.74237 57.10392 45.57301 6.957312

let-7g* 963.3425 131.7437 157.3901 313.1559 299.5628 37.97679

let-7i* 154.7413 63.66212 27.74033 45.91237 137.0321 41.47092

MIR-001-1 348.7775 527.14 653.3058 101.7155 519.1936 151.9754

MIR-001-2 648.7846 432.0157 674.5672 290.1393 403.8103 707.4584

MIR-007-1 353.9373 241.9987 182.987 213.5199 241.3748 34.75693

MIR-007-2 189.9284 192.6722 285.8939 284.9488 244.211 91.25417

MIR-007-3 39.40603 57.94656 58.30487 88.11923 76.38345 191.5245

MIR-009-1-P 5285.905 342.5796 6279.909 9198.968 8508.782 3656.139

MIR-009-2-P 6173.907 670.4272 7942.355 8483.259 7111.381 1877.768

MIR-009-3-P 114.6106 11.12941 139.3301 194.4032 233.4594 63.45952

MIR-010a,b 25.52333 4.363303 4.33287 13.69781 2.646115 68.55621

MIR-015a 1274.957 364.2969 480.3505 814.0665 1220.395 226.9485

MIR-015b 2248.663 401.7331 670.3534 899.7338 2042.665 929.5878

MIR-016-1 2343.225 524.5504 326.0847 1775.581 1923.831 504.4688

MIR-016-2 1023.092 1290.183 920.9948 915.8345 1449.551 801.2603

MIR-017-P 6702.649 1519.419 3921.64 3488.064 3969.541 1486.773

MIR-018 26948.86 3956.59 58445.24 9301.178 18844.29 6476.756

MIR-019a-P 11109.49 2408.492 10702.01 3249.181 6637.693 3294.422

MIR-019b-1-P 3763.131 1137.872 1176.243 1445.265 1844.2 339.4511

MIR-019b-2-P 11.29745 0 2.90275 12.76187 17.86829 8.503979

MIR-020 73.75672 12.36713 27.9209 18.37304 53.46666 10.94048

MIR-021 1123.287 429.1152 3577.846 762.0187 2002.423 287.9245

MIR-022-P 584.323 657.0663 716.1434 1024.528 1125.224 481.8155

MIR-023a 1146.567 875.5624 104.4223 1127.198 1842.966 421.3858

MIR-023b-P 2697.446 2557.975 2807.599 2927.525 2907.672 769.3893

MIR-024-1,2 1817.421 2596.787 2183.636 1936.612 1583.455 1706.141

MIR-025 2925.217 862.43 963.5741 1173.715 1175.759 502.8365

MIR-026a-1,2 186.3581 419.2091 485.9575 99.1406 563.6515 174.1412

MIR-026b 2473.301 2665.344 2864.806 3211.984 4327.093 429.3476

MIR-027a, b 2284.84 1969.356 593.0105 2948.62 3674.049 879.3945

MIR-028 89.40984 74.92992 21.50215 81.95749 154.7436 20.34191

MIR-029a,c 561.8704 97.14448 13.54629 351.6844 552.4925 44.04115

Continued

247


MIR-029b-1,2 62.88458 0.638325 74.57517 94.75991 249.1745 32.36581

MIR-030a,e 457.7892 558.6207 592.1317 429.6142 651.5329 154.418

MIR-030b 1676.761 866.2407 1922.159 2108.047 2645.966 733.9129

MIR-030c-1,2 1519.404 363.8571 1509.466 1442.812 2416.158 583.2534

MIR-030d 107.5944 69.02615 37.48549 73.18422 172.9553 87.41096

MIR-031-P 12019.31 1205.848 10478.9 11902.38 11238.99 4207.385

MIR-032 269.4431 124.2691 277.1414 259.4543 365.3757 92.12944

MIR-033 32.96648 11.24012 33.89762 32.09194 74.98626 8.217943

MIR-034a 1500.261 1085.274 1259.33 842.2176 1495.214 286.3861

MIR-034b 173.706 189.3395 231.1241 266.7051 248.9697 82.72159

MIR-034c 0 0 0 0 0 0

MIR-092-1 253.5061 58.98973 807.4232 171.0063 141.5984 117.4945

MIR-092-2-P 400.2367 612.5352 576.7292 775.0618 744.3792 81.69878

MIR-093 1526.799 508.0304 828.0654 1383.011 1220.094 328.1417

MIR-095 9.206388 12.0491 4.199426 7.690361 16.45554 19.71498

MIR-096-P 29596.91 21364.58 18939.54 15973.93 24151.32 10816.44

MIR-098 13177.82 6898.605 5111.825 7710.336 8417.604 1710.517

MIR-099a 33.02749 4.55678 52.15852 48.61796 32.51622 15.72285

MIR-099b 4169.225 459.3873 658.2106 193.2048 196.7277 990.7318

MIR-100 76.48112 89.44438 112.3623 53.02756 93.01511 17.41665

MIR-101-1 95.65256 88.42841 99.6927 75.03961 157.409 30.03772

MIR-101-2 1616.706 623.3177 1041.445 1067.626 862.1386 107.1349

MIR-103-1,2 10752.85 4888.763 5039.741 7216.911 5533.608 2408.706

MIR-105-1,2 593.0519 528.6808 487.0151 444.5546 343.2208 181.3683

MIR-106a-P 118.4912 9.463457 231.5252 215.0468 216.9674 42.91796

MIR-106b 12293.47 989.756 3279.127 2596.978 3434.494 765.6042

MIR-107 14540.57 3397.628 3983.135 7036.947 8073.282 2306.637

MIR-108 443.2815 534.8737 729.2897 163.9282 894.7754 522.8028

MIR-122a 86.95339 111.8566 209.2704 227.3072 176.4073 61.48922

MIR-124a-1,2,3 259.0413 269.9636 40.506 273.0116 264.5819 187.4368

MIR-125a 642.1005 168.9118 755.2254 857.7192 997.5324 408.3563

MIR-125b-1 56.06253 1.072293 77.62582 86.82186 122.6815 10.18362

MIR-125b-2 328.655 130.2673 217.4513 313.9123 127.6051 62.26342

MIR-126 31.04462 231.5804 964.5492 103.8981 197.332 38.07505

MIR-127 5503.809 11899.7 5537.267 6073.212 7367.812 3427.893

MIR-128a 1913.021 970.5096 506.0228 1211.692 1065.062 467.3048

MIR-128b 322.0318 44.22209 225.0595 741.7277 37.67092 74.71641

MIR-129-2 15514.78 8406.395 10838.85 7713.455 9565.983 3876.494

MIR-130a-P 11760.81 8379.556 10425.72 10587.92 13496.31 4096.524

MIR-130b 277.2207 200.6143 401.3942 233.8788 189.5791 89.73827

MIR-132 7.492078 12.90677 57.81666 34.34195 68.44209 30.39035

Continued

248


MIR-133a-1,2 1014.981 133.8339 535.0988 1261.684 1665.34 340.2207

MIR-133b 1856.095 307.0956 1839.104 1788.284 2072.672 980.5206

MIR-134 5118.074 79.43878 5128.883 4638.395 4291.477 1153.442

MIR-135a-1,2 68.75971 79.38836 125.3644 187.7691 163.1687 32.19183

MIR-135b-P 257.806 66.29544 699.3765 728.8616 263.905 93.29344

MIR-136 51.18809 86.71628 139.9647 121.31 197.1764 39.34398

MIR-137* 8.449507 30.54883 27.82634 27.35567 41.46985 0

MIR-138-1,2 58.17899 159.7229 133.4808 85.87914 154.979 12.28462

MIR-139 2263.82 1804.829 2795.394 2623.898 1877.469 1068.205

MIR-140 0.930443 0 1.798528 2.253947 1.814974 0

MIR-141 113.3429 195.1747 199.0103 275.1045 229.4861 58.2686

MIR-142-P 4970.718 4914.531 3629.009 6598.056 8289.224 1643.344

MIR-143 190.3961 175.2943 698.4452 602.3399 622.3735 324.4794

MIR-144 8.099548 11.95214 117.7107 8.643246 7.571883 0

MIR-145-P 164.0109 674.885 827.5368 697.4703 1059.785 406.4187

MIR-146 35.93817 27.10695 29.37064 78.74723 89.44939 7.230668

MIR-147 225.4706 253.7893 323.8461 365.772 430.9656 77.8308

MIR-148a-P 123.2298 104.3512 169.3357 247.605 123.3789 45.51435

MIR-148b-P 986.9186 877.0721 368.0117 380.3213 959.9428 292.5218

MIR-149 2042.878 987.4495 2554.727 2603.416 3547.527 1330.131

MIR-150 672.3065 598.6471 1117.75 1290.867 993.7567 419.0044

MIR-151 352.4521 257.3444 625.6778 525.5154 339.3763 336.8306

MIR-152 152.3424 29.09152 47.69829 132.6514 150.5859 63.4437

MIR-153-1,2 111.7338 78.28592 89.37798 257.7483 35.23463 26.89646

MIR-154 32.07609 57.96254 65.24155 81.0974 89.90831 22.71621

MIR-155 66.21983 69.26097 44.91643 102.4712 190.5929 48.37833

MIR-181a,c 374.4215 166.7022 234.3763 522.6439 238.5709 124.0678

MIR-181b-1,2 266.679 296.5336 183.5354 632.9201 255.8292 69.49202

MIR-182 874.1759 510.1722 6538.934 2105.695 229.1402 1060.095

MIR-183 111.1306 7.169283 281.7026 64.65016 110.2007 17.91935

MIR-184 2764.261 2816.466 2538.674 1695.443 2345.092 1888.283

MIR-185 2820.113 3900.864 5143.746 5087.112 7930.047 2022.923

MIR-186-P 8687.487 3596.165 2774.455 5004.273 5556.093 8091.426

MIR-187 172.457 202.4664 213.9742 375.2911 270.0591 80.67414

MIR-188b-P 307.3053 96.97499 389.0439 516.829 599.2478 95.60117

MIR-190 8.40962 9.038517 7.304781 22.14138 30.37547 1.281402

MIR-191 59.72927 127.677 146.4452 83.26219 127.9571 12.38503

MIR-192 1274.346 0 658.2719 1142.952 1303.27 410.5423

MIR-193 297.0796 32.63499 444.3399 407.9212 518.7426 158.4782

MIR-194-1,2 110.122 9.022362 205.3603 234.9899 270.2057 73.97635

MIR-195-P 12890.37 8651.802 8004.317 17193.54 22818.52 7326.805

Continued

249


MIR-196a-1 373.5948 524.8424 624.9976 29.92536 927.8567 190.3845

MIR-196a-2 308.9209 377.6943 425.1981 579.8911 696.5027 209.0003

MIR-196b 1188.553 526.462 1514.445 1269.183 1990.884 4574.995

MIR-197 9561.154 6715.475 10936.72 8552.249 10430.31 839.5568

MIR-198 10.25485 27.23975 7.496891 20.50808 31.81037 3.381763

MIR-199a-1-P 3532.271 3122.76 2012.811 5307.241 5745.302 2183.591

MIR-199a-2-P 331.3024 14.70907 329.9027 568.1804 559.7591 193.8401

MIR-199b-P 4247.27 4209.361 4464.392 6410.907 5633.432 4673.392

MIR-200a-P 114526.1 97963.03 103183.2 66872.43 44753.15 45100.52

MIR-200b 93.98931 164.9444 187.893 172.5996 136.6537 2.442379

MIR-200c 227.6598 148.6829 293.986 300.8705 472.2938 59.00694

MIR-203 70.12542 30.84829 234.1509 160.0123 121.1458 18.54053

MIR-204 2741.664 1138.05 4929.028 4018.32 4515.916 875.1448

MIR-205 120.4677 61.92127 72.27868 91.26884 159.6102 29.07442

MIR-206 360.8429 143.2401 450.0692 96.63232 492.1118 141.9149

MIR-208 156.3394 17.50686 112.0073 180.5634 299.7183 61.85746

MIR-210 15574.55 16447.28 30876.33 24397.38 30757.05 8070.606

MIR-211 5522.785 4861.41 7371.303 10298.18 8073.044 7495.651

MIR-212 972.1366 425.6314 1344.729 935.1716 1130.86 602.2588

MIR-213 335.0652 437.0121 268.0511 1623.766 559.5108 92.23252

MIR-214 3839.569 3477.23 4920.847 5002.451 6113.85 2091.734

MIR-215 58.6363 95.30843 213.3499 179.9374 13.28411 97.30162

MIR-216 440.2898 549.3449 395.9147 565.4973 764.8198 234.5174

MIR-217 13.00112 4.448138 19.72684 14.59379 27.97344 4.222659

MIR-218-1,2 56.61873 28.3997 138.224 80.14827 11.04128 176.8762

MIR-219-1,2 201.0228 52.64486 181.6867 128.6737 121.7531 101.3339

MIR-220 444.9044 126.8869 610.8679 436.9656 433.458 176.3589

MIR-221 62.66685 187.8869 88.28524 101.7863 85.09758 382.4978

MIR-222-P 185.3001 239.6429 183.5392 376.9927 348.161 464.8981

MIR-223 78.67755 330.7864 208.076 196.1029 99.57811 43.05095

MIR-224 348.7584 343.0587 582.8114 531.6224 550.543 384.9217

MIR-296 564.9293 521.3971 741.983 896.1399 964.069 521.3143

MIR-299-P 1545.776 1356.846 1304.308 1663.249 813.0071 1309.007

MIR-301 770.6185 197.7101 557.6147 889.8942 522.8079 333.8545

MIR-302 77.66245 78.27097 154.8214 134.8323 159.654 21.95135

MIR-302b 223.9796 186.7529 234.4275 393.7961 516.4862 190.8893

MIR-302c 289.5766 317.166 445.3348 163.2359 618.8807 134.7958

MIR-302d 232.6644 362.3634 308.6238 450.1622 585.1192 96.48595

MIR-320 847.312 485.0178 693.0725 728.369 1305.679 288.541

MIR-321 13324.32 4899.416 22267.29 14451.83 8919.571 5974.062

MIR-323 298.1843 204.215 88.25127 597.1822 472.5881 102.2437

Continued

250

Table C.1 continued

MIR-324-P 2759.529 720.3999 1307.927 1801.631 2393.748 532.4331

MIR-325 152.4464 132.9968 146.3717 303.4011 240.979 18.63928

MIR-326-P 58.71795 84.53467 217.3564 192.9703 167.4323 65.94607

MIR-328 3873.451 1046.446 5290.15 6757.513 7758.295 2358.274

MIR-330 819.0916 27.09692 876.5171 1144.065 487.4847 307.855

MIR-331-P 1101.107 773.4277 852.2676 922.7296 1295.376 424.9777

MIR-335 3.411301 0.704119 29.35963 36.84565 33.96236 7.469318

MIR-337 1066.353 415.411 1622.734 1283.364 1991.248 386.1977

MIR-338 1234.583 1096.385 1766.293 2114.484 2179.54 852.4476

MIR-339 1759.958 1660.233 1366.792 1414.341 1567.968 754.5532

MIR-340 37.81213 650.7559 409.9121 1623.347 125.2216 322.266

MIR-342 590.5115 230.8284 705.2253 550.0349 1126.927 369.7657

MIR-345 3885.185 2094.946 5356.345 5017.119 7266.97 1890.927

MIR-346 2337.821 3251.396 2949.508 3453.948 3900.961 1428.855

MIR-361 242.3455 137.3803 270.5726 314.1634 376.7746 109.1156

MIR-367 39.46731 12.85456 22.22441 21.31749 28.22367 2.299073

MIR-368 5.713689 1.386273 29.81746 10.63905 9.435455 6.089259

MIR-369 0 0 0 2.179649 0 0

MIR-370 297.309 8.653101 461.9151 408.771 493.3364 207.6563

MIR-371 1938.035 2147.472 2155.386 4056.725 3646.81 3873.5

MIR-372 6.847668 12.55147 25.82391 31.65229 23.07713 8.65932

MIR-373 398.5249 430.5096 373.6562 727.1402 798.8929 170.4009

MIR-374-P 13.53244 1.007478 97.60728 61.02578 151.5996 4.252739

MIR-375 55.88773 74.08621 1.445392 148.4851 161.4004 34.45429

MIR-376 8.111453 8.306807 103.5633 56.44974 85.15578 10.84863

MIR-377 184.5237 73.34587 400.0104 699.9629 719.1905 133.0643

MIR-378 181.8826 205.7557 383.0841 610.5676 627.5236 344.9614

MIR-379 6.712977 16.94751 8.575964 7.988344 13.52819 18.71345

MIR-380 14.51789 4.140085 39.19494 41.00681 74.84995 7.934333

MIR-381 27.94209 0.606482 61.25342 78.07433 80.59869 47.75855

MIR-382 65.98568 77.54664 89.94332 176.4227 63.18845 13.7173

MIR-383 206.4342 149.7354 350.5311 298.1358 554.0786 101.8361

MIR-384 0 0 0 0 2.908049 0

MIR-422b 861.6428 1483.341 1463.262 1101.987 1367.448 520.5563

MIR-423 231.5228 206.3646 412.1263 539.5416 430.4981 493.5497

MIR-424 78.38365 37.26375 82.77558 179.1021 102.518 99.51117

MIR-425 764.9245 582.1007 136.7403 247.8503 232.1649 40.42695

251

Lung Cancer

miRNA H23 H522 HOP62 A549 H719

hsa-let-7a 899.88 1530.13 2043.04 868.86 1373.08

hsa-let-7b 682.35 5733.94 7066.97 1891.98 1257.43

hsa-let-7c 211.92 9700.35 399.42 277.45 468.20

hsa-let-7d 158.69 268.77 87.27 55.03 30.14

hsa-let-7e 157.39 120.78 198.15 118.63 100.83

hsa-let-7g 1252.68 2000.31 1310.87 485.38 343.36

hsa-let-7i 392.94 503.21 629.73 485.35 71.92

hsa-miR-001 14.43 0.00 8.22 0.00 0.00

hsa-miR-007 914.32 745.16 81.01 269.64 415.48

hsa-miR-009 2276.04 3002.72 404.75 1347.05 1958.56

hsa-miR-009* 270.66 361.76 42.31 262.34 193.83

hsa-miR-010a 76.77 24.74 1873.87 668.02 1418.74

hsa-miR-010b 9.45 42.60 128.45 4.40 127.67

hsa-miR-015a 288.22 144.60 424.57 219.49 332.83

hsa-miR-015b 8832.73 8907.93 8829.58 3857.78 4753.76

hsa-miR-016 35541.03 29566.27 41832.45 18083.14 22618.47

hsa-miR-017-3p 47.54 6.75 32.37 8.17 13.75

hsa-miR-017-5p 1386.56 6338.38 1641.61 950.11 2262.56

hsa-miR-018 302.15 288.13 335.55 151.83 437.38

hsa-miR-019a 3122.63 5467.28 4701.67 2601.78 4276.36

hsa-miR-019b 14569.79 44195.40 22689.42 11846.99 18958.50

hsa-miR-020 17268.10 24522.55 22197.05 12957.76 24890.93

hsa-miR-021 7589.28 11119.87 12348.62 10244.70 3374.18

hsa-miR-022 176.62 228.39 479.17 245.50 153.97

hsa-miR-023a 187.84 243.34 154.58 69.30 119.97

hsa-miR-023b 77.30 68.23 336.52 570.72 20.97

hsa-miR-023bN 968.30 1778.11 5367.13 10278.06 1470.27

hsa-miR-024 47088.89 62228.03 37424.15 38647.31 42904.20

hsa-miR-025 2257.41 2990.67 1597.18 869.60 1967.47

hsa-miR-026aN 5460.20 9092.17 6596.03 2586.12 5159.77

hsa-miR-026b 4254.76 7004.17 3064.66 1900.34 4309.97

hsa-miR-026bN 2965.01 3492.98 1513.02 983.71 2129.98

hsa-miR-027a 4080.64 5572.63 4895.00 2999.93 6723.94

hsa-miR-027b 235.69 259.19 816.93 3375.89 243.33

hsa-miR-027bN 2014.61 1243.44 5104.12 18497.50 1177.00

hsa-miR-028 982.45 820.74 697.78 497.96 546.20

Continued

Table C.2. Mature microRNA expression in 37 different human cancer cell lines. All data was generated using real-time PCR and TaqMan microRNA assays (Applied

Biosystems). Data is presented as copies of microRNA per cell.

252


hsa-miR-029a 5210.51 865.32 5425.87 1654.53 1389.46

hsa-miR-029b 124.48 44.42 125.25 55.31 28.95

hsa-miR-029c 338.56 63.64 366.92 167.27 119.81

hsa-miR-030a-3p 1948.95 17239.55 5124.64 2063.07 3412.84

hsa-miR-030c 10482.69 44316.76 11935.75 6665.34 11291.55

hsa-miR-030d 2171.37 905.56 833.59 672.53 315.54

hsa-miR-030e-3p 529.48 1536.30 576.82 272.12 1276.27

hsa-miR-031 9374.28 77314.37 23959.23 26433.63 38187.87

hsa-miR-032 284.37 122.99 96.07 116.80 81.95

hsa-miR-033 0.00 0.00 0.00 0.00 0.00

hsa-miR-034a 55.35 1.73 14.43 53.27 0.00

hsa-miR-034aN 656.10 39.47 306.20 588.23 19.31

hsa-miR-034b 21.88 0.00 15.61 13.61 12.18

hsa-miR-034b 13.42 0.00 13.53 0.00 10.44

hsa-miR-092N 12724.76 31479.87 15012.67 7909.82 14757.47

hsa-miR-093 25915.10 35420.31 12044.02 8901.47 21471.88

hsa-miR-095 90.45 298.60 0.00 26.64 73.00

hsa-miR-096 16047.13 11664.91 9902.69 14110.78 15808.94

hsa-miR-098 353.87 870.82 397.23 124.56 35.27

hsa-miR-099a 336.29 11836.72 22408.06 3649.68 5546.68

hsa-miR-099b 2355.45 2203.28 2057.37 1517.41 1783.86

hsa-miR-100 211.08 6707.09 22531.58 3685.07 5723.36

hsa-miR-101 3.97 65.46 55.38 31.29 20.71

hsa-miR-103 1273.12 2325.36 1586.77 671.09 1084.05

hsa-miR-105 3.82 0.00 0.00 0.00 0.00

hsa-miR-106a 2608.37 7696.12 1878.89 2230.82 2979.23

hsa-miR-106b 4494.90 6028.76 2247.55 1680.11 3246.68

hsa-miR-107 26.34 89.90 7.93 13.19 36.93

hsa-miR-108 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 10142.80 13307.54 15530.30 8528.33 8695.46

hsa-miR-125b 337.48 19256.93 11525.70 1808.52 10964.15

hsa-miR-126 1600.08 2028.18 864.25 951.45 1059.80

hsa-miR-126* 323.29 340.17 129.18 158.65 182.10

hsa-miR-127 1071.81 36.15 530.14 55.70 27.64

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 712.60 3509.15 1127.11 405.60 1384.88

hsa-miR-130aN 2081.01 8593.69 3133.12 1002.93 3124.95

hsa-miR-130b 370.06 1647.11 948.81 167.24 979.26

hsa-miR-132 3865.34 1802.05 1044.98 828.13 2500.11

Continued

253


hsa-miR-133a 0.00 0.00 0.00 0.00 6.96

hsa-miR-134 327.64 3.35 125.74 18.27 4.80

hsa-miR-135a 12.88 3.69 0.00 0.00 2.92

hsa-miR-135b 19.75 21.80 97.17 12.45 6.23

hsa-miR-138 0.00 0.00 0.00 14.09 0.00

hsa-miR-139 27.01 0.00 0.00 0.00 0.00

hsa-miR-140 816.52 899.06 1851.63 984.77 51.11

hsa-miR-141 15.74 0.00 4.82 9.18 0.00

hsa-miR-142-3p 0.00 0.00 9.63 20.60 8.15

hsa-miR-142-5p 3.22 12.62 20.14 6.30 6.05

hsa-miR-143 0.00 0.00 0.00 2.53 0.00

hsa-miR-145 4.03 9.44 10.62 1.88 4.75

hsa-miR-146 807.79 432.21 23325.90 408.86 317.25

hsa-miR-146b 326.66 674.33 670.90 115.09 180.44

hsa-miR-147 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 221.24 58.35 125.54 41.11 128.70

hsa-miR-148b 345.77 318.59 120.85 145.21 179.16

hsa-miR-149 461.03 6836.16 640.35 676.19 1738.99

hsa-miR-150 17.97 133.18 0.00 17.33 16.80

hsa-miR-152 486.99 486.31 1016.58 526.32 57.73

hsa-miR-152N 512.87 432.28 776.35 396.84 87.71

hsa-miR-153 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 233.98 7.13 1930.77 28.28 3.70

hsa-miR-181a 535.97 1370.30 958.41 70.21 139.62

hsa-miR-181b 2235.91 3401.72 2640.64 479.14 939.75

hsa-miR-181c 55.71 95.80 48.88 12.60 16.99

hsa-miR-182* 36.81 82.00 3.22 21.30 29.23

hsa-miR-183 920.69 3190.40 171.59 261.55 917.14

hsa-miR-184 0.00 18.51 0.00 0.00 12.23

hsa-miR-186 3956.10 6427.62 1191.90 1347.47 3909.96

hsa-miR-187 3.38 0.00 0.00 0.00 0.00

hsa-miR-188 39.51 55.79 41.90 53.28 49.86

hsa-miR-190 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 9396.24 21765.42 7137.11 2799.44 5871.74

hsa-miR-192 130.97 571.15 370.89 12855.43 173.43

hsa-miR-193 327.89 93.37 470.84 162.67 222.38

hsa-miR-194 42.36 130.47 105.19 2401.70 40.74

hsa-miR-195 944.74 372.59 407.90 267.23 212.38

hsa-miR-196a 1583.10 1966.47 529.34 511.12 2004.00

Continued

254


hsa-miR-196b 0.00 0.00 0.00 0.00 0.00

hsa-miR-197 1881.88 6168.33 722.61 501.80 1540.31

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 13.01 15.21 5.27 0.00 0.00

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 0.00 0.00 244.34 279.06 0.00

hsa-miR-200b 10.47 0.00 675.85 488.72 10.49

hsa-miR-200bN 10.78 0.00 217.68 158.67 0.00

hsa-miR-200c 326.09 117.89 157.79 231.20 52.97

hsa-miR-200cN 184.14 158.07 176.52 212.95 48.32

hsa-miR-203 633.11 220.46 51.85 25.64 871.36

hsa-miR-204 0.00 2.34 110.79 0.00 8.45

hsa-miR-205 20.59 0.00 0.00 0.00 0.00

hsa-miR-206 0.00 4.41 1.80 1.94 11.55

hsa-miR-208 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 273.82 1338.65 1541.72 408.86 753.17

hsa-miR-210N 469.28 2240.51 2458.81 618.79 1233.28

hsa-miR-211 0.00 0.00 0.00 0.00 0.00

hsa-miR-212 891.54 488.73 366.67 181.64 397.98

hsa-miR-213 18.53 10.16 155.29 10.76 40.12

hsa-miR-214 35.80 99.66 14.40 5.41 29.86

hsa-miR-215 6.52 7.59 14.05 10.54 0.00

hsa-miR-216 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 10.48 0.00 0.00 0.00 9.27

hsa-miR-218 119.45 791.21 1349.43 119.98 293.02

hsa-miR-219 0.00 0.00 7.21 0.00 3.06

hsa-miR-220 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 1932.07 20272.96 5132.26 1986.06 6329.01

hsa-miR-222 10244.92 89173.26 30145.83 14584.82 45016.44

hsa-miR-223 0.00 0.00 9.79 8.91 0.00

hsa-miR-296 1335.45 68.73 237.21 9.27 97.74

hsa-miR-299 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 1465.22 6640.75 1367.05 534.53 2645.06

hsa-miR-302a 32.86 7.04 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 146.12 37.48 3.70 27.90 55.39

hsa-miR-302c 109.03 35.01 0.00 11.03 33.94

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 101.39 11.14 0.00 0.00 6.91

hsa-miR-320 2371.90 5266.80 1440.08 1816.07 4299.30

Continued

255


hsa-miR-321 8269.38 28905.04 7037.49 5219.78 7474.25

hsa-miR-323 146.40 0.00 10.41 0.00 0.00

hsa-miR-324-3p 1101.42 2053.62 541.66 594.70 3650.79

hsa-miR-324-5p 950.17 1577.04 362.96 409.64 3754.22

hsa-miR-325 0.00 0.00 0.00 0.00 0.00

hsa-miR-326 5.21 13.06 0.00 0.00 5.96

hsa-miR-328 1094.99 1435.59 862.58 160.85 356.59

hsa-miR-330 56.31 105.03 74.92 26.16 50.67

hsa-miR-331 3093.78 5102.36 1603.08 2702.55 3416.70

hsa-miR-335 186.40 22.60 329.18 197.52 32.70

hsa-miR-337 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 22.00 13.05 14.43 0.00 33.71

hsa-miR-339 103.89 117.04 67.79 29.25 119.46

hsa-miR-340 155.56 570.79 61.89 138.57 397.98

hsa-miR-342 1785.92 9449.89 1171.69 881.74 2982.02

hsa-miR-345 1082.62 7455.65 1160.13 311.01 1967.32

hsa-miR-346 111.96 32.32 10.51 31.25 43.36

hsa-miR-361 347.33 803.89 343.55 147.04 1029.79

hsa-miR-367 12.17 8.22 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 587.51 142.34 351.36 126.68 137.22

hsa-miR-371 0.00 0.00 0.00 0.00 0.00

hsa-miR-372 163.46 200.08 124.68 149.12 234.75

hsa-miR-373 0.00 0.00 0.00 4.29 0.00

hsa-miR-374 3308.46 5076.11 2478.66 3497.09 3059.69

hsa-miR-375 331.62 597.33 17.06 146.22 318.68

hsa-miR-376a 548.37 26.52 159.70 15.51 4.18

hsa-miR-377 0.00 0.00 0.00 0.00 0.00

hsa-miR-378 96.36 203.38 13.50 32.00 29.07

hsa-miR-379 423.49 15.97 83.52 21.45 3.70

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 7.66 0.00 0.00 0.00 0.00

hsa-miR-381 9.58 0.00 0.00 0.00 0.00

hsa-miR-382 678.89 25.90 200.50 31.66 23.58

hsa-miR-383 0.00 0.00 0.00 0.00 1.64

hsa-miR-384 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 53.43 162.05 7.39 44.75 35.60

hsa-miR-423 643.72 518.82 557.33 497.64 538.65

hsa-miR-425 359.13 1755.68 271.38 81.56 361.66

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00

Continued

256


miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 25.77 1012.22 158.65 77.00 251.79

miR-224(mmu) 17.03 0.00 177.18 196.26 0.00

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00

Pancreas Cancer

miRNA PANC-1 HS766T MIAPACA-2 MPANC-96 PL45

hsa-let-7a 1182.55 1683.50 835.05 1199.63 947.23

hsa-let-7b 2018.23 2560.34 2687.39 3449.97 3574.74

hsa-let-7c 61.33 147.09 94.19 157.31 133.46

hsa-let-7d 7.42 107.35 127.44 116.36 60.07

hsa-let-7e 33.79 61.76 38.89 44.69 65.62

hsa-let-7g 575.71 1589.73 606.07 1480.28 433.40

hsa-let-7i 161.88 675.05 539.08 766.99 87.46

hsa-miR-001 292.52 0.00 0.00 0.00 0.00

hsa-miR-007 108.56 1385.86 316.94 302.28 354.06

hsa-miR-009 1019.56 0.00 47.10 30.47 283.82

hsa-miR-009* 89.09 3.87 11.47 15.05 119.81

hsa-miR-010a 4240.69 475.29 720.21 4866.12 973.01

hsa-miR-010b 284.96 48.55 3.20 212.17 10.76

hsa-miR-015a 186.19 454.62 266.51 239.80 162.86

hsa-miR-015b 7882.98 6493.87 7885.11 4970.63 7631.24

hsa-miR-016 4756.25 5654.60 4773.09 5100.24 5445.30

hsa-miR-017-3p 11.83 35.42 19.03 50.96 13.73

hsa-miR-017-5p 1049.42 1889.16 1021.35 951.88 550.43

hsa-miR-018 89.39 498.54 170.61 107.24 35.40

hsa-miR-019a 1337.52 8647.92 3837.72 2913.71 1273.45

hsa-miR-019b 7793.51 31589.36 12470.07 15457.90 7010.03

hsa-miR-020 10079.63 36529.78 14265.01 17326.28 7772.59

hsa-miR-021 3874.18 12073.29 3337.03 6557.24 3111.97

hsa-miR-022 99.85 94.40 111.69 61.83 32.83

hsa-miR-023a 65.18 78.86 82.39 75.64 114.99

hsa-miR-023b 118.28 80.38 42.16 425.54 32.55

hsa-miR-023bN 2953.85 735.94 380.00 6726.38 808.58

hsa-miR-024 21153.36 17003.19 21389.59 31790.52 15809.04

hsa-miR-025 974.48 2118.61 1012.44 1279.18 902.75

hsa-miR-026aN 2863.57 4158.32 1293.18 7484.30 2664.44

hsa-miR-026b 1759.62 2873.32 1183.59 4609.94 1817.11

hsa-miR-026bN 784.68 1403.41 240.49 2147.10 0.00

hsa-miR-027a 2026.78 2420.29 3194.50 2089.69 2018.47

hsa-miR-027b 286.88 133.38 51.72 1003.37 99.24

Continued

257


hsa-miR-027bN 2623.94 2748.54 460.93 8239.67 817.18

hsa-miR-028 665.30 765.12 409.52 684.17 413.53

hsa-miR-029a 2512.60 11118.61 3791.49 4390.23 3388.84

hsa-miR-029b 42.19 505.17 161.04 68.10 51.57

hsa-miR-029c 158.34 882.52 196.22 313.04 216.05

hsa-miR-030a-3p 2984.91 26.16 2582.91 1402.86 2014.20

hsa-miR-030c 8502.08 2950.37 4129.02 6620.50 5378.40

hsa-miR-030d 699.28 1127.14 181.31 1287.66 605.23

hsa-miR-030e-3p 474.62 213.62 188.63 283.53 141.34

hsa-miR-031 20261.73 27292.91 10.07 19862.04 36109.44

hsa-miR-032 68.16 265.80 171.55 57.39 45.96

hsa-miR-033 1.91 0.00 14.67 0.00 4.98

hsa-miR-034a 17.16 3.21 0.00 1.43 0.00

hsa-miR-034aN 67.52 148.35 0.00 0.00 19.57

hsa-miR-034b 14.26 0.00 13.02 0.00 0.00

hsa-miR-034b 2.31 0.00 10.89 0.00 0.00

hsa-miR-092N 9037.87 16595.75 8363.07 11399.15 6042.37

hsa-miR-093 9014.69 22378.67 12604.49 10082.93 7896.46

hsa-miR-095 12.14 46.01 32.00 38.50 43.70

hsa-miR-096 9105.72 17587.77 5416.77 6678.06 10488.34

hsa-miR-098 117.64 353.18 146.97 117.58 151.38

hsa-miR-099a 7302.87 6044.46 5.00 1725.94 1334.53

hsa-miR-099b 552.64 804.48 490.45 407.92 520.17

hsa-miR-100 9246.94 5731.50 0.00 1797.79 1447.18

hsa-miR-101 3.83 57.34 14.75 11.03 12.21

hsa-miR-103 674.71 1540.66 592.86 702.67 389.51

hsa-miR-105 0.00 0.00 0.00 0.00 0.00

hsa-miR-106a 1537.85 3331.72 698.90 1249.47 968.86

hsa-miR-106b 1218.82 4992.36 2116.40 1373.32 780.97

hsa-miR-107 0.00 2.68 2.95 2.56 0.00

hsa-miR-108 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 3963.27 5238.75 2715.63 3949.27 4428.31

hsa-miR-125b 3415.95 1718.28 0.00 1174.38 1014.06

hsa-miR-126 1132.37 5267.51 1653.84 1576.51 350.67

hsa-miR-126* 155.59 863.15 219.04 217.85 61.64

hsa-miR-127 2672.65 0.00 0.00 0.00 0.00

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 336.84 13.02 412.84 4.32 133.14

hsa-miR-130aN 788.39 0.00 1115.50 9.43 274.30

Continued

258


hsa-miR-130b 32.89 107.90 9.01 32.33 3.69

hsa-miR-132 734.05 633.57 482.70 310.17 148.36

hsa-miR-133a 70.10 3.36 0.00 0.00 6.33

hsa-miR-134 450.08 4.06 0.00 0.00 0.00

hsa-miR-135a 13.35 15.45 25.52 29.95 20.90

hsa-miR-135b 114.52 399.82 551.19 683.13 740.04

hsa-miR-138 0.00 6.34 0.00 0.00 0.00

hsa-miR-139 0.00 0.00 0.00 0.00 2.81

hsa-miR-140 574.24 2213.56 1515.36 843.81 186.15

hsa-miR-141 7.19 12.43 3.56 166.63 436.46

hsa-miR-142-3p 0.00 7.74 0.00 0.00 0.00

hsa-miR-142-5p 6.10 5.83 3.52 12.03 3.01

hsa-miR-143 0.00 0.00 0.00 0.00 0.00

hsa-miR-145 1.48 7.73 0.00 9.18 11.31

hsa-miR-146 2767.86 440.78 329.94 1736.16 358.23

hsa-miR-146b 307.98 89.65 31.06 90.41 143.28

hsa-miR-147 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 10.84 321.30 26.82 0.00 23.25

hsa-miR-148b 149.41 203.48 82.41 124.85 42.80

hsa-miR-149 640.38 127.63 582.41 532.51 325.17

hsa-miR-150 7.26 15.00 14.54 573.32 15.54

hsa-miR-152 420.73 859.88 312.81 278.44 165.61

hsa-miR-152N 386.15 820.70 260.12 151.55 91.24

hsa-miR-153 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 696.79 2925.00 15.02 441.07 305.47

hsa-miR-181a 136.36 23.81 0.00 692.14 81.81

hsa-miR-181b 976.10 364.42 144.23 2863.26 568.84

hsa-miR-181c 17.24 57.14 3.94 45.83 12.96

hsa-miR-182* 9.89 33.83 7.04 4.05 11.08

hsa-miR-183 335.73 774.19 548.89 333.20 205.91

hsa-miR-184 21.24 0.00 0.00 0.00 0.00

hsa-miR-186 1818.11 2979.35 2915.06 1770.43 845.94

hsa-miR-187 185.47 0.00 15.43 0.00 0.00

hsa-miR-188 24.66 32.51 21.27 42.82 22.66

hsa-miR-190 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 9238.01 6156.52 3770.53 4960.73 1719.16

hsa-miR-192 146.83 390.13 260.08 20261.48 99.27

hsa-miR-193 274.19 64.76 178.42 73.95 75.03

hsa-miR-194 76.88 107.24 58.69 5518.49 40.59

Continued

259


hsa-miR-195 356.35 240.35 235.86 260.83 226.77

hsa-miR-196a 2765.94 613.40 33.76 2339.81 17.20

hsa-miR-196b 0.00 20.83 0.00 192.75 0.00

hsa-miR-197 1125.13 793.34 1129.59 686.90 503.16

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 0.00 0.00 0.00 0.00 4.77

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 9.16 2399.83 0.00 1370.77 644.17

hsa-miR-200b 20.89 2723.08 11.64 3772.93 1961.98

hsa-miR-200bN 10.02 1633.16 4.31 1707.55 891.62

hsa-miR-200c 50.45 215.69 45.16 6084.19 16196.05

hsa-miR-200cN 36.64 18.28 14.49 5835.24 16427.93

hsa-miR-203 13.20 2956.58 0.00 22.04 578.34

hsa-miR-204 0.00 0.00 0.00 5.58 0.00

hsa-miR-205 0.00 0.00 0.00 0.00 319.45

hsa-miR-206 5.57 4.04 11.87 0.00 0.00

hsa-miR-208 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 261.56 139.95 149.59 538.87 115.30

hsa-miR-210N 558.89 361.26 237.42 1120.24 276.29

hsa-miR-211 0.00 0.00 2.38 0.00 0.00

hsa-miR-212 201.69 173.23 115.82 108.38 109.83

hsa-miR-213 43.03 14.81 0.00 152.26 14.35

hsa-miR-214 12.43 2.87 0.00 9.31 15.35

hsa-miR-215 19.19 8.99 0.00 76.54 0.00

hsa-miR-216 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 0.00 0.00 1.39 0.00 6.57

hsa-miR-218 55.10 1.78 10.38 0.00 12.71

hsa-miR-219 0.00 0.00 0.00 0.00 0.00

hsa-miR-220 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 2305.77 6273.71 6879.89 2067.47 3075.95

hsa-miR-222 13809.56 41793.55 36747.91 21292.04 19678.62

hsa-miR-223 6.92 1.71 8.75 16.70 0.00

hsa-miR-296 0.00 9.19 12.90 4.63 4.21

hsa-miR-299 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 395.72 1346.47 726.16 336.56 189.55

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 15.99 11.53 8.41 4.01 20.14

hsa-miR-302c 0.00 0.00 0.00 20.14 0.00

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00

Continued

260


hsa-miR-302d 0.00 0.00 0.00 0.00 0.00

hsa-miR-320 874.67 1589.50 3647.10 3405.09 727.09

hsa-miR-321 10347.40 6568.02 5043.85 8845.34 4634.01

hsa-miR-323 42.17 0.00 0.00 0.00 0.00

hsa-miR-324-3p 791.67 1690.38 803.86 584.20 205.87

hsa-miR-324-5p 291.56 1418.81 423.34 243.12 47.40

hsa-miR-325 2.34 3.52 1.68 2.27 3.16

hsa-miR-326 0.00 11.19 2.67 5.11 0.00

hsa-miR-328 110.91 306.86 216.12 262.31 78.76

hsa-miR-330 13.27 36.31 24.07 15.19 5.90

hsa-miR-331 2383.78 1651.38 2121.01 2371.51 1707.61

hsa-miR-335 210.79 156.04 0.00 45.66 102.41

hsa-miR-337 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 0.00 0.00 15.23 0.00 13.62

hsa-miR-339 38.70 44.73 66.02 52.40 45.39

hsa-miR-340 127.84 159.50 119.79 89.82 58.09

hsa-miR-342 1470.67 10.95 0.00 17.08 0.00

hsa-miR-345 298.80 1182.03 700.93 217.21 35.67

hsa-miR-346 7.77 14.06 0.00 10.51 7.68

hsa-miR-361 228.49 285.02 165.98 377.80 169.85

hsa-miR-367 0.00 0.00 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 657.56 27.29 58.76 74.70 38.11

hsa-miR-371 0.00 0.00 0.00 0.00 0.00

hsa-miR-372 0.00 0.00 0.00 0.00 0.00

hsa-miR-373 0.00 0.00 0.00 0.00 0.00

hsa-miR-374 1435.58 2418.16 1653.68 2606.33 521.62

hsa-miR-375 13.71 13.40 38.35 19.96 407.26

hsa-miR-376a 621.81 0.00 0.00 7.40 0.00

hsa-miR-377 5.50 0.00 0.00 0.00 0.00

hsa-miR-378 90.77 65.51 112.36 58.01 23.71

hsa-miR-379 119.11 0.00 0.00 10.57 0.00

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 19.04 0.00 0.00 0.00 0.00

hsa-miR-381 0.00 0.00 0.00 0.00 0.00

hsa-miR-382 900.25 0.00 0.00 5.69 0.00

hsa-miR-383 0.00 0.00 0.00 0.00 3.49

hsa-miR-384 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 78.19 19.30 34.96 28.43 19.65

hsa-miR-423 594.46 384.58 411.21 332.21 316.29

Continued

261


hsa-miR-425 391.56 110.37 132.61 93.47 32.05

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 12.71 0.00 123.57 0.00 0.00

miR-224(mmu) 0.00 0.00 0.00 221.65 0.00

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00

Prostate Cancer

miRNA PC3 PPC1 DU145 TSUPR1 LNCAP

hsa-let-7a 248.64 2305.57 1209.72 1457.35 1891.86

hsa-let-7b 1790.37 4713.23 2376.29 5686.75 21296.95

hsa-let-7c 94.51 445.03 148.22 463.82 16362.12

hsa-let-7d 16.90 98.60 153.70 90.55 146.32

hsa-let-7e 22.58 111.35 32.20 69.12 94.09

hsa-let-7g 155.05 1354.98 1139.74 1011.21 1654.15

hsa-let-7i 90.89 751.05 502.07 445.62 198.57

hsa-miR-001 0.00 0.00 1.68 0.00 0.00

hsa-miR-007 25.23 134.49 507.95 519.90 217.20

hsa-miR-009 324.61 3542.37 760.84 11.93 986.36

hsa-miR-009* 23.69 492.44 115.89 0.00 68.69

hsa-miR-010a 196.65 193.28 1028.68 1526.50 5.93

hsa-miR-010b 0.00 20.39 9.09 161.49 0.00

hsa-miR-015a 36.80 378.10 472.76 414.05 676.86

hsa-miR-015b 998.70 5672.10 6980.34 6572.05 6602.90

hsa-miR-016 1317.36 21365.37 36158.78 27371.26 34778.76

hsa-miR-017-3p 0.00 25.38 27.58 5.78 24.61

hsa-miR-017-5p 105.16 2100.65 1317.66 1852.93 2777.61

hsa-miR-018 26.84 537.88 216.08 235.85 426.26

hsa-miR-019a 169.23 6135.63 2103.06 5012.79 7732.10

hsa-miR-019b 912.67 22847.43 11275.52 23341.12 31302.75

hsa-miR-020 799.78 28984.67 14464.54 25677.52 34089.62

hsa-miR-021 161.84 3557.98 7101.08 8197.32 943.58

hsa-miR-022 8.52 152.68 406.41 175.24 66.77

hsa-miR-023a 26.39 73.95 226.08 101.91 0.00

hsa-miR-023b 18.24 113.72 191.94 21.99 41.05

hsa-miR-023bN 156.25 3098.45 5211.46 1296.45 1011.47

hsa-miR-024 5332.92 27574.56 31197.25 31981.14 3474.57

hsa-miR-025 190.56 1603.58 1303.46 891.75 1825.62

hsa-miR-026aN 671.00 1321.81 3812.02 4712.45 6365.70

hsa-miR-026b 113.08 1578.39 1678.96 4053.37 4864.09

hsa-miR-026bN 64.73 849.93 873.11 1880.25 2076.05

Continued

262


hsa-miR-027a 399.50 3240.49 5464.23 5730.23 237.64

hsa-miR-027b 0.00 500.80 1143.60 213.29 227.69

hsa-miR-027bN 126.21 3143.08 5999.86 1103.12 1262.66

hsa-miR-028 77.08 332.04 893.73 532.26 1459.06

hsa-miR-029a 437.78 1852.21 5349.11 3941.16 424.46

hsa-miR-029b 4.24 80.52 138.22 204.44 37.68

hsa-miR-029c 41.00 180.49 506.00 148.86 485.00

hsa-miR-030a-3p 22.32 40.17 1321.05 3703.89 244.84

hsa-miR-030c 1066.79 2909.14 5676.08 9925.13 5328.64

hsa-miR-030d 229.69 419.32 423.15 195.20 720.92

hsa-miR-030e-3p 26.96 242.41 471.20 772.32 379.05

hsa-miR-031 4701.60 11519.16 30487.37 10080.98 9.58

hsa-miR-032 8.44 179.14 246.44 209.02 316.04

hsa-miR-033 0.00 0.00 0.00 0.00 0.00

hsa-miR-034a 9.53 0.00 71.82 0.00 92.36

hsa-miR-034aN 0.00 4.21 922.96 0.00 1087.61

hsa-miR-034b 0.00 0.00 61.73 0.00 0.00

hsa-miR-034b 0.00 0.00 13.27 0.00 0.00

hsa-miR-092N 1517.93 15305.20 8479.11 12791.92 14952.96

hsa-miR-093 981.55 19938.32 15453.07 7735.01 16114.06

hsa-miR-095 9.49 20.60 32.27 0.00 17.68

hsa-miR-096 6904.79 14288.44 19008.81 9715.03 9993.99

hsa-miR-098 22.71 926.21 204.82 225.49 272.99

hsa-miR-099a 10434.41 26141.84 5529.25 11159.14 15743.31

hsa-miR-099b 1096.16 2115.44 574.02 1002.27 1342.27

hsa-miR-100 9604.95 26646.09 5104.97 12940.54 9477.41

hsa-miR-101 0.00 29.89 27.43 9.52 76.96

hsa-miR-103 188.42 870.50 802.03 880.06 899.45

hsa-miR-105 0.00 18.02 0.00 6.98 27.11

hsa-miR-106a 490.08 2343.29 2995.59 1939.78 2215.90

hsa-miR-106b 164.25 4335.05 2270.95 1317.71 2474.42

hsa-miR-107 0.00 28.06 10.77 9.86 32.99

hsa-miR-108 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 5550.89 7722.41 3669.96 7011.86 8007.42

hsa-miR-125b 7241.52 9389.55 2272.91 4976.48 18641.08

hsa-miR-126 26.56 480.65 1395.29 220.48 578.73

hsa-miR-126* 26.10 131.47 217.06 53.74 160.96

hsa-miR-127 0.00 0.00 0.00 0.00 0.00

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00

Continued

263


hsa-miR-130a 59.70 8.34 1008.53 1167.46 4.45

hsa-miR-130aN 253.02 6.22 2361.61 2703.81 12.32

hsa-miR-130b 67.57 815.31 381.89 597.61 562.61

hsa-miR-132 83.47 155.89 410.04 762.79 723.04

hsa-miR-133a 0.00 0.00 0.00 0.00 0.00

hsa-miR-134 4.60 10.14 3.41 14.61 2.92

hsa-miR-135a 0.00 0.00 18.29 0.00 6.69

hsa-miR-135b 23.63 13.11 520.24 61.67 0.00

hsa-miR-138 0.00 0.00 29.81 3.30 2.48

hsa-miR-139 13.58 0.00 3.52 0.00 0.00

hsa-miR-140 81.66 911.94 1572.64 1658.06 736.25

hsa-miR-141 0.00 0.00 112.29 0.00 1962.62

hsa-miR-142-3p 0.00 12.70 0.00 10.83 8.02

hsa-miR-142-5p 2.04 7.72 8.71 6.95 6.74

hsa-miR-143 0.00 0.00 0.00 2.11 0.00

hsa-miR-145 0.00 21.47 12.63 4.77 0.00

hsa-miR-146 458.52 372.96 455.69 501.98 404.83

hsa-miR-146b 17.87 74.41 85.26 115.10 739.34

hsa-miR-147 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 3.15 1.80 221.97 25.91 3034.66

hsa-miR-148b 12.81 236.38 216.50 162.04 342.35

hsa-miR-149 101.46 1453.42 917.41 472.04 584.67

hsa-miR-150 0.00 4.18 0.00 0.00 0.00

hsa-miR-152 11.31 0.00 552.58 60.27 470.38

hsa-miR-152N 78.53 57.93 483.12 81.79 462.79

hsa-miR-153 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 8.69 11.37 488.95 6.32 8.54

hsa-miR-181a 27.55 151.57 395.55 179.42 51.82

hsa-miR-181b 230.36 909.47 1532.69 1310.84 283.96

hsa-miR-181c 8.87 13.64 44.56 14.99 2.19

hsa-miR-182* 7.32 4.58 0.00 15.14 15.03

hsa-miR-183 198.15 621.03 403.22 124.21 423.05

hsa-miR-184 0.00 0.00 0.00 0.00 0.00

hsa-miR-186 517.48 3977.23 2416.84 3818.16 5837.81

hsa-miR-187 0.00 0.00 21.14 0.00 0.00

hsa-miR-188 38.13 39.83 33.14 56.44 46.24

hsa-miR-190 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 2949.10 4882.11 5126.32 2695.08 9832.45

hsa-miR-192 10.49 257.61 488.52 215.71 405.10

Continued

264


hsa-miR-193 24.14 355.44 406.64 105.76 196.37

hsa-miR-194 14.08 47.68 120.34 67.56 99.91

hsa-miR-195 24.07 261.41 506.97 243.77 2652.71

hsa-miR-196a 7.25 306.59 929.18 802.49 142.21

hsa-miR-196b 0.00 132.30 11.28 42.61 0.00

hsa-miR-197 827.04 1471.11 796.72 1748.38 2122.89

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 0.00 10.46 18.54 0.00 12.96

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 438.34 0.00 1319.82 414.58 3629.46

hsa-miR-200b 450.01 8.24 4014.36 1179.32 9999.19

hsa-miR-200bN 146.94 0.00 1251.11 327.32 3604.62

hsa-miR-200c 35.16 74.30 3901.39 76.17 41166.56

hsa-miR-200cN 0.00 65.74 4283.23 11.04 35677.28

hsa-miR-203 0.00 0.00 30.68 0.00 1964.66

hsa-miR-204 0.00 0.00 0.00 0.00 0.00

hsa-miR-205 14.31 0.00 0.00 0.00 0.00

hsa-miR-206 0.00 0.00 0.00 0.00 3.63

hsa-miR-208 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 245.92 207.03 921.80 1025.47 2171.44

hsa-miR-210N 454.75 346.15 1745.85 1753.32 3648.52

hsa-miR-211 2.16 0.00 0.00 0.00 0.00

hsa-miR-212 125.78 145.08 255.78 148.78 154.44

hsa-miR-213 0.00 25.90 45.98 23.77 0.00

hsa-miR-214 0.00 18.69 10.07 3.59 4.58

hsa-miR-215 0.00 10.08 2.52 0.00 8.82

hsa-miR-216 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 0.00 0.00 0.00 0.00 0.00

hsa-miR-218 163.87 386.42 24.05 152.93 0.00

hsa-miR-219 0.00 0.00 0.00 0.00 0.00

hsa-miR-220 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 680.25 4111.80 2903.41 4537.31 509.99

hsa-miR-222 8097.75 21467.41 21031.43 27649.99 3340.37

hsa-miR-223 0.00 0.00 0.00 20.30 38.70

hsa-miR-296 2.91 5.01 280.08 18.00 63.51

hsa-miR-299 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 221.87 2116.43 783.40 861.80 1906.77

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 4.78 0.00 15.04 22.93 27.64

Continued

265


hsa-miR-302c 0.00 0.00 0.00 0.00 0.00

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 0.00 0.00 0.00 0.00 0.00

hsa-miR-320 1053.72 2470.85 1721.10 3163.14 2100.71

hsa-miR-321 1495.88 6988.05 7266.64 8810.17 7492.00

hsa-miR-323 0.00 0.00 0.00 0.00 0.00

hsa-miR-324-3p 144.75 696.30 196.62 2110.81 1876.14

hsa-miR-324-5p 153.72 860.59 489.33 1144.39 1267.45

hsa-miR-325 0.00 0.00 0.00 0.00 0.00

hsa-miR-326 0.00 11.37 0.00 1.60 15.09

hsa-miR-328 415.86 129.24 218.75 127.19 538.61

hsa-miR-330 15.40 91.85 13.01 32.01 26.88

hsa-miR-331 1533.35 2960.79 4388.04 2221.64 2578.03

hsa-miR-335 12.29 0.00 266.29 0.00 152.22

hsa-miR-337 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 0.00 0.00 0.00 0.00 0.00

hsa-miR-339 29.65 55.60 90.30 46.57 86.36

hsa-miR-340 19.51 103.84 177.12 91.73 201.86

hsa-miR-342 444.31 3312.30 2566.61 908.06 1626.29

hsa-miR-345 283.42 1004.11 593.95 348.95 940.61

hsa-miR-346 11.62 24.95 16.93 22.04 17.16

hsa-miR-361 29.22 527.75 236.79 264.04 270.05

hsa-miR-367 0.00 0.00 1.55 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 109.86 133.32 82.30 69.82 96.83

hsa-miR-371 0.00 0.00 0.00 0.00 0.00

hsa-miR-372 67.28 124.89 91.78 211.41 100.90

hsa-miR-373 0.00 0.00 0.00 4.43 13.40

hsa-miR-374 62.62 2869.91 1750.01 2124.95 2628.65

hsa-miR-375 32.16 38.94 141.10 0.00 417.78

hsa-miR-376a 10.80 11.67 0.00 20.40 0.00

hsa-miR-377 0.00 0.00 0.00 0.00 6.41

hsa-miR-378 0.00 58.24 94.01 41.80 80.50

hsa-miR-379 2.53 21.94 0.00 11.40 10.02

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 0.00 0.00 0.00 14.79 27.08

hsa-miR-381 0.00 0.00 0.00 0.00 0.00

hsa-miR-382 0.00 26.09 0.00 28.16 0.00

hsa-miR-383 0.00 2.29 0.00 0.00 3.45

hsa-miR-384 0.00 0.00 0.00 0.00 0.00

Continued

266


hsa-miR-422b 2.35 90.48 27.68 61.72 37.44

hsa-miR-423 70.66 335.16 647.27 439.82 384.63

hsa-miR-425 88.57 423.28 156.14 184.42 428.14

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 0.00 0.00 23.25 649.01 0.00

miR-224(mmu) 0.00 0.00 0.00 0.00 18.08

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00

Head & Neck squamous cell carcinoma

miRNA SCC17A SCCD12 SCC10B SCC17B SCC5

hsa-let-7a 1432.17 1422.63 2492.13 1352.32 1196.91

hsa-let-7b 5603.36 2448.27 3698.29 3766.39 3580.95

hsa-let-7c 293.72 138.95 360.04 200.70 547.20

hsa-let-7d 147.70 119.16 306.49 89.48 87.89

hsa-let-7e 120.12 82.25 345.64 79.65 17.58

hsa-let-7g 1573.21 1468.61 1776.82 929.83 863.15

hsa-let-7i 507.34 325.87 484.10 173.40 339.43

hsa-miR-001 38.40 0.00 0.00 0.00 0.00

hsa-miR-007 1096.74 662.71 284.21 222.43 671.49

hsa-miR-009 967.60 521.56 296.60 1557.24 704.42

hsa-miR-009* 122.00 82.11 36.76 126.10 95.61

hsa-miR-010a 688.40 218.31 780.56 443.15 406.95

hsa-miR-010b 45.67 3.63 16.82 24.24 5.05

hsa-miR-015a 706.67 553.66 735.54 300.12 559.98

hsa-miR-015b 7123.47 8131.90 9440.75 9040.04 5371.61

hsa-miR-016 49138.68 36045.07 46396.61 38182.58 34757.70

hsa-miR-017-3p 37.99 49.39 4.85 7.13 28.89

hsa-miR-017-5p 1025.08 2600.63 1639.36 1354.59 1911.85

hsa-miR-018 177.63 670.32 298.50 136.57 259.13

hsa-miR-019a 3530.79 4763.06 3088.77 2163.89 6580.42

hsa-miR-019b 16523.96 28827.05 12748.53 10503.62 27604.21

hsa-miR-020 22396.19 35690.95 18899.59 13421.80 32642.91

hsa-miR-021 9671.83 5293.54 26677.05 4331.44 7200.48

hsa-miR-022 288.38 340.80 429.22 328.03 240.48

hsa-miR-023a 125.31 228.76 167.66 63.60 152.89

hsa-miR-023b 65.99 42.61 455.77 123.00 314.85

hsa-miR-023bN 1103.36 1465.06 7551.85 2530.85 8578.99

hsa-miR-024 20496.76 35050.50 41223.35 25676.28 32990.65

hsa-miR-025 1060.01 719.49 1708.72 1088.65 1328.36

hsa-miR-026aN 7264.31 4701.94 19974.22 7103.69 5152.03

Continued

267


hsa-miR-026b 4445.90 3161.08 3952.33 3158.05 1648.16

hsa-miR-026bN 2477.70 1654.49 2068.10 1370.63 757.74

hsa-miR-027a 4510.17 5304.75 3926.65 4333.81 6256.32

hsa-miR-027b 256.93 332.92 2097.33 253.65 1835.57

hsa-miR-027bN 1627.44 2167.60 11174.64 2314.35 8291.54

hsa-miR-028 1228.88 676.82 861.53 1401.61 620.13

hsa-miR-029a 7498.57 3000.26 2691.27 2780.28 1103.67

hsa-miR-029b 505.15 94.42 201.56 55.28 73.88

hsa-miR-029c 684.04 252.28 300.06 224.58 162.53

hsa-miR-030a-3p 1524.75 708.62 1061.08 531.08 1373.86

hsa-miR-030c 3662.33 4989.50 14772.29 5544.51 6752.67

hsa-miR-030d 438.93 998.84 3123.83 496.58 528.68

hsa-miR-030e-3p 594.01 486.87 1380.50 512.99 527.08

hsa-miR-031 121187.86 36327.20 38963.94 86345.07 22803.02

hsa-miR-032 403.04 212.18 814.76 19.13 231.46

hsa-miR-033 0.00 0.00 14.58 0.00 0.00

hsa-miR-034a 107.73 14.75 0.00 39.41 18.54

hsa-miR-034aN 1330.28 169.80 149.74 523.74 311.56

hsa-miR-034b 20.13 8.24 25.96 8.18 28.65

hsa-miR-034b 11.27 0.00 15.90 0.00 0.00

hsa-miR-092N 11220.69 20022.99 9013.43 9347.40 16055.06

hsa-miR-093 12665.59 9682.32 22616.87 10025.99 13025.53

hsa-miR-095 43.28 14.41 210.56 191.81 100.70

hsa-miR-096 6325.35 13314.77 30352.78 13673.57 6370.14

hsa-miR-098 241.84 358.11 2038.54 69.87 351.55

hsa-miR-099a 994.25 5509.79 1182.19 522.35 800.10

hsa-miR-099b 1175.21 834.24 2918.64 1380.12 291.74

hsa-miR-100 930.03 6220.09 1076.12 508.77 530.13

hsa-miR-101 45.49 15.40 135.82 47.54 40.57

hsa-miR-103 603.50 754.20 1696.41 928.22 812.93

hsa-miR-105 16.52 15.54 0.00 11.04 22.15

hsa-miR-106a 1351.41 3260.90 3367.12 1902.95 1624.86

hsa-miR-106b 3416.05 1994.43 4845.71 1535.21 2606.35

hsa-miR-107 10.51 19.72 45.09 23.01 15.49

hsa-miR-108 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 9683.18 4804.78 20089.22 10392.15 2211.89

hsa-miR-125b 762.80 2230.30 995.28 709.73 592.19

hsa-miR-126 2165.59 128.81 50.44 2911.92 1066.11

hsa-miR-126* 378.33 37.03 8.55 321.54 240.08

Continued

268


hsa-miR-127 0.00 2.16 0.00 0.00 3.18

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 1216.93 549.23 4377.06 926.57 403.38

hsa-miR-130aN 2618.26 1817.11 9037.45 2229.60 1165.90

hsa-miR-130b 498.16 833.29 1762.70 903.80 404.27

hsa-miR-132 906.37 606.72 821.18 772.87 1412.52

hsa-miR-133a 5.31 4.40 0.00 11.77 0.00

hsa-miR-134 3.30 32.36 2.38 3.98 2.43

hsa-miR-135a 128.17 67.08 41.32 60.66 139.43

hsa-miR-135b 4713.59 1646.60 1155.04 1361.54 1226.12

hsa-miR-138 3.96 15.74 11.60 13.30 33.44

hsa-miR-139 12.97 0.00 2.81 0.00 0.00

hsa-miR-140 572.76 532.56 2018.01 606.24 616.28

hsa-miR-141 1745.93 1128.41 6705.89 609.18 1476.14

hsa-miR-142-3p 5579.99 0.00 12.20 1205.81 11.78

hsa-miR-142-5p 710.77 6.20 4.28 417.58 6.37

hsa-miR-143 0.00 0.00 0.00 0.00 0.00

hsa-miR-145 27.71 6.78 10.18 104.36 22.46

hsa-miR-146 3137.52 728.77 373.72 7566.56 440.81

hsa-miR-146b 734.41 96.44 432.17 2268.08 263.53

hsa-miR-147 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 673.64 543.52 382.81 1209.71 137.08

hsa-miR-148b 132.87 227.23 427.84 172.71 158.73

hsa-miR-149 1794.34 1177.33 4151.14 2864.00 902.33

hsa-miR-150 21.57 7.81 6.80 50.90 85.35

hsa-miR-152 1661.66 407.09 2605.15 2011.11 1903.20

hsa-miR-152N 1643.86 450.69 2510.97 1376.50 1657.79

hsa-miR-153 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 35.00 594.63 84.69 9.31 493.08

hsa-miR-181a 244.18 658.06 856.84 62.33 0.00

hsa-miR-181b 728.23 1607.38 2142.98 284.71 34.95

hsa-miR-181c 10.12 36.29 60.55 10.54 6.02

hsa-miR-182* 66.01 15.12 20.22 49.02 18.76

hsa-miR-183 1389.40 476.98 1006.88 585.86 577.57

hsa-miR-184 278.97 0.00 0.00 348.18 93.44

hsa-miR-186 2295.89 3763.10 7386.77 3147.66 1411.05

hsa-miR-187 0.00 20.06 16.89 2.41 0.00

hsa-miR-188 35.33 41.00 65.72 57.01 28.54

hsa-miR-190 0.00 0.00 0.00 0.00 0.00

Continued

269


hsa-miR-191 5488.01 5080.40 6459.18 7471.67 4164.59

hsa-miR-192 527.15 279.89 447.68 524.59 39.62

hsa-miR-193 366.97 18.44 24.30 385.56 126.24

hsa-miR-194 183.01 55.69 161.45 191.21 21.31

hsa-miR-195 734.89 434.85 984.56 917.31 483.57

hsa-miR-196a 1243.07 992.28 1331.75 2450.78 234.01

hsa-miR-196b 393.29 30.67 17.39 174.89 81.36

hsa-miR-197 1214.73 1423.20 3609.89 2525.99 1382.43

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 0.00 0.00 9.32 0.00 0.00

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 5893.33 4203.88 7628.01 2805.06 2977.62

hsa-miR-200b 10716.71 7665.11 10488.52 10176.51 6113.98

hsa-miR-200bN 4480.53 3348.50 5424.39 3274.34 2516.38

hsa-miR-200c 18969.64 21459.45 86582.01 42338.19 26097.67

hsa-miR-200cN 27278.85 32710.20 84005.63 45245.42 26028.66

hsa-miR-203 3697.47 4213.54 5027.72 10178.17 6553.21

hsa-miR-204 0.00 0.00 4.51 0.00 0.00

hsa-miR-205 19002.31 9310.67 18948.25 12564.18 20304.15

hsa-miR-206 0.00 2.80 3.30 2.15 0.00

hsa-miR-208 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 1746.62 3945.62 3858.69 4218.64 1330.00

hsa-miR-210N 2746.80 5989.76 7487.66 6202.59 2369.62

hsa-miR-211 2.94 0.00 0.00 0.00 0.00

hsa-miR-212 202.25 106.14 194.80 116.10 327.78

hsa-miR-213 0.00 59.56 6.06 0.00 0.00

hsa-miR-214 9.33 9.48 5.72 5.48 20.33

hsa-miR-215 4.50 8.91 9.30 0.00 12.19

hsa-miR-216 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 3.36 0.00 0.00 0.00 0.00

hsa-miR-218 0.00 527.51 17.45 175.11 107.60

hsa-miR-219 0.00 0.00 0.00 0.00 0.00

hsa-miR-220 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 5263.74 2644.30 3883.90 4228.78 4612.91

hsa-miR-222 40414.60 17046.69 17770.14 29584.67 29111.49

hsa-miR-223 17.18 35.90 36.24 12.18 1.95

hsa-miR-296 397.27 2.30 46.66 416.68 2.45

hsa-miR-299 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 965.36 423.55 5180.45 653.93 959.68

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00

Continued

270


hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 35.45 56.31 165.84 38.44 24.41

hsa-miR-302c 0.00 20.78 0.00 0.00 14.19

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 3.69 0.00 0.00 0.00 11.90

hsa-miR-320 2693.86 3096.55 4396.66 3073.21 6590.27

hsa-miR-321 13650.16 7422.58 9823.46 4382.17 35515.52

hsa-miR-323 0.00 6.18 0.00 0.00 0.00

hsa-miR-324-3p 623.90 1325.04 2274.23 967.31 896.19

hsa-miR-324-5p 451.43 713.85 3064.81 586.92 657.07

hsa-miR-325 0.00 0.00 0.00 0.00 1.86

hsa-miR-326 0.00 6.14 0.00 7.37 1.91

hsa-miR-328 149.23 222.98 1325.51 292.55 159.77

hsa-miR-330 78.28 26.31 63.57 106.26 34.71

hsa-miR-331 2896.78 3477.73 6992.40 2849.81 2086.21

hsa-miR-335 678.78 53.76 150.98 216.08 264.45

hsa-miR-337 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 17.60 0.00 0.00 20.20 0.00

hsa-miR-339 110.31 115.24 139.68 158.82 108.72

hsa-miR-340 85.94 89.40 169.57 147.71 36.48

hsa-miR-342 454.61 1204.99 1399.69 3457.64 1015.11

hsa-miR-345 656.94 1156.85 1468.44 1005.66 937.58

hsa-miR-346 6.19 6.25 10.59 3.84 35.88

hsa-miR-361 774.16 360.47 868.05 381.60 390.53

hsa-miR-367 0.00 0.00 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 100.75 73.24 107.84 123.66 105.54

hsa-miR-371 0.00 1.39 0.00 0.00 0.00

hsa-miR-372 179.95 185.15 139.27 141.50 285.58

hsa-miR-373 0.00 1.84 12.02 0.00 0.00

hsa-miR-374 1869.42 3226.98 5827.30 1695.29 2458.98

hsa-miR-375 262.59 74.29 59.06 228.98 29.78

hsa-miR-376a 3.96 112.36 10.29 9.48 0.00

hsa-miR-377 2.50 1.59 0.00 0.00 0.00

hsa-miR-378 81.93 59.30 35.74 110.11 35.37

hsa-miR-379 0.00 35.06 3.41 4.17 3.36

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 0.00 0.00 0.00 0.00 0.00

hsa-miR-381 0.00 0.00 15.44 0.00 5.61

hsa-miR-382 0.00 46.85 0.00 0.00 2.00

Continued

271


hsa-miR-383 0.00 0.00 0.00 0.00 3.95

hsa-miR-384 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 81.73 12.21 44.78 68.83 33.34

hsa-miR-423 391.07 727.64 1015.64 597.22 313.14

hsa-miR-425 277.88 139.92 467.20 245.33 171.92

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 11.54 0.00 0.00 0.00 24.52

miR-224(mmu) 0.00 0.00 0.00 12.96 195.87

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00

Breast Cancer

miRNA T47D SKBR3 MDA361 MCF7 MDA231

hsa-let-7a 1498.74 870.57 401.65 2045.14 648.65

hsa-let-7b 800.13 5424.95 3941.58 2922.04 246.17

hsa-let-7c 41.34 849.64 985.18 255.92 44.16

hsa-let-7d 0.00 108.15 84.79 317.25 0.00

hsa-let-7e 80.01 83.86 198.59 345.80 0.00

hsa-let-7g 153.64 642.89 459.41 1451.71 40.60

hsa-let-7i 58.12 150.71 73.43 988.90 66.23

hsa-miR-001 0.00 0.00 0.00 0.00 0.00

hsa-miR-007 192.74 169.83 42.46 1454.10 36.79

hsa-miR-009 52.04 567.34 16.49 635.36 19.44

hsa-miR-009* 6.09 52.86 9.64 128.30 0.00

hsa-miR-010a 580.48 0.00 38.64 0.00 101.22

hsa-miR-010b 9.16 0.00 0.00 0.00 0.00

hsa-miR-015a 757.25 159.85 129.69 761.34 32.44

hsa-miR-015b 11503.50 3795.32 7597.36 6613.15 245.00

hsa-miR-016 50925.02 19355.99 21337.19 49759.77 459.92

hsa-miR-017-3p 16.00 4.15 11.53 23.13 0.00

hsa-miR-017-5p 1346.56 772.00 287.62 395.16 70.06

hsa-miR-018 140.41 213.76 71.66 113.81 15.99

hsa-miR-019a 2442.86 3124.30 383.55 1777.67 143.49

hsa-miR-019b 11108.91 13834.15 2470.18 9249.32 817.59

hsa-miR-020 12836.43 13155.39 4057.42 13266.80 0.00

hsa-miR-021 2193.41 1127.54 2291.07 59172.65 89.45

hsa-miR-022 81.96 130.00 115.73 172.28 1.42

hsa-miR-023a 41.93 53.54 56.24 101.85 0.00

hsa-miR-023b 490.04 224.44 510.34 634.33 0.00

hsa-miR-023bN 8771.84 2545.64 3509.36 4124.28 142.33

hsa-miR-024 21049.93 18641.43 24760.84 35646.73 1696.98

Continued

272


hsa-miR-025 1066.59 1612.10 932.12 2989.40 174.42

hsa-miR-026aN 9812.92 3722.20 6215.36 14042.07 7254.63

hsa-miR-026b 3262.33 1513.86 1026.98 5462.80 45.09

hsa-miR-026bN 1757.11 884.11 588.70 3499.17 8.04

hsa-miR-027a 1551.66 1942.48 1037.34 3529.82 356.05

hsa-miR-027b 1867.36 717.08 293.92 1795.35 497.96

hsa-miR-027bN 9042.91 5962.23 3991.23 16414.79 1350.30

hsa-miR-028 344.29 274.84 461.54 507.43 39.61

hsa-miR-029a 321.57 993.01 246.18 355.78 266.59

hsa-miR-029b 58.18 44.49 17.67 36.38 10.11

hsa-miR-029c 584.63 587.96 114.50 374.06 8.63

hsa-miR-030a-3p 621.79 366.05 1409.36 138.52 161.50

hsa-miR-030c 6600.76 5742.83 9952.22 6981.41 1161.27

hsa-miR-030d 487.78 744.02 3694.70 2602.19 50.74

hsa-miR-030e-3p 556.03 726.45 370.48 444.66 32.28

hsa-miR-031 14.40 3050.21 691.74 10.32 376.38

hsa-miR-032 535.07 102.56 36.76 553.70 18.03

hsa-miR-033 6.44 0.00 0.00 0.00 0.00

hsa-miR-034a 55.67 36.31 37.94 127.03 0.00

hsa-miR-034aN 944.76 615.06 387.65 749.21 1.84

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00

hsa-miR-092N 6523.59 9185.64 7370.18 8570.93 56.70

hsa-miR-093 14289.92 14076.43 13635.59 29148.70 0.00

hsa-miR-095 15.40 0.00 106.09 636.75 0.00

hsa-miR-096 12229.11 11180.21 14572.08 16948.46 158.78

hsa-miR-098 22.66 229.72 126.74 937.27 641.10

hsa-miR-099a 33.06 545.66 954.38 130.01 760.15

hsa-miR-099b 1894.27 826.25 5065.86 3324.39 93.83

hsa-miR-100 22.08 326.86 570.26 83.85 874.67

hsa-miR-101 69.45 14.05 18.00 148.07 0.00

hsa-miR-103 1930.92 521.98 944.27 1737.23 11.89

hsa-miR-105 13.27 5.84 0.00 0.00 17.22

hsa-miR-106a 1775.25 1345.88 704.82 1511.32 19.76

hsa-miR-106b 2922.91 2634.66 958.85 5376.53 77.73

hsa-miR-107 41.28 11.82 9.80 34.00 0.00

hsa-miR-108 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 10610.36 5907.63 34298.11 21630.77 1109.70

hsa-miR-125b 33.88 754.41 1355.85 183.70 1162.40

Continued

273


hsa-miR-126 296.52 115.01 652.26 1483.07 0.00

hsa-miR-126* 94.77 49.87 81.12 259.14 0.00

hsa-miR-127 0.00 0.00 380.84 0.00 0.00

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 1667.75 552.09 152.62 2.98 1.93

hsa-miR-130aN 3782.08 1669.05 561.97 4.77 23.25

hsa-miR-130b 534.90 338.02 411.64 393.53 14.85

hsa-miR-132 409.01 117.11 344.49 1003.90 172.12

hsa-miR-133a 0.00 0.00 0.00 0.00 0.00

hsa-miR-134 1.48 3.42 15.09 7.82 11.48

hsa-miR-135a 202.54 0.00 10.98 1079.76 8.87

hsa-miR-135b 37.65 44.11 119.70 311.68 34.75

hsa-miR-138 0.00 2.26 1.77 3.85 7.95

hsa-miR-139 0.00 0.00 0.00 13.33 0.00

hsa-miR-140 555.92 546.61 256.60 857.85 244.23

hsa-miR-141 625.98 1938.85 1032.20 3096.63 0.00

hsa-miR-142-3p 3.33 0.00 0.00 7.90 0.00

hsa-miR-142-5p 5.84 1.69 4.69 4.41 2.78

hsa-miR-143 0.00 0.00 0.00 12.89 0.00

hsa-miR-145 0.00 14.79 21.02 19.61 9.36

hsa-miR-146 405.51 333.55 380.21 311.33 826.08

hsa-miR-146b 289.02 121.45 57.52 242.47 66.87

hsa-miR-147 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 871.04 544.88 688.91 395.60 0.00

hsa-miR-148b 612.02 127.35 233.78 356.35 4.82

hsa-miR-149 1990.84 1286.17 3107.17 1435.43 76.43

hsa-miR-150 20.77 0.00 10.39 24.03 0.00

hsa-miR-152 704.23 13.14 126.31 464.24 45.17

hsa-miR-152N 749.04 59.42 157.93 550.59 68.70

hsa-miR-153 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 15.46 11.26 0.00 17.81 53.85

hsa-miR-181a 934.44 819.13 1631.80 656.42 20.37

hsa-miR-181b 2442.65 2895.16 2575.19 2071.75 199.51

hsa-miR-181c 63.46 39.55 80.90 43.53 2.84

hsa-miR-182* 27.25 29.12 24.42 27.31 3.14

hsa-miR-183 670.02 496.59 927.99 1218.41 11.74

hsa-miR-184 97.66 118.77 100.52 31.45 0.00

hsa-miR-186 2931.40 3726.12 1629.45 1783.62 304.48

hsa-miR-187 204.74 0.00 172.97 12.78 0.00

Continued

274


hsa-miR-188 44.57 50.33 34.74 29.62 42.15

hsa-miR-190 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 10861.30 7001.03 27487.01 8542.76 460.62

hsa-miR-192 848.53 175.86 302.99 694.20 57.61

hsa-miR-193 647.36 324.80 420.16 661.17 22.20

hsa-miR-194 203.98 29.93 169.07 241.10 12.49

hsa-miR-195 934.69 359.98 228.29 2533.98 30.24

hsa-miR-196a 11284.40 807.33 1718.36 122.02 32.91

hsa-miR-196b 2.11 0.00 0.00 0.00 0.00

hsa-miR-197 1618.67 1485.51 3025.34 1677.30 476.30

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 16.86 11.00 0.00 9.21 0.00

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 4873.52 10.30 1966.60 5197.61 0.00

hsa-miR-200b 8457.67 4.90 7128.69 7749.47 0.00

hsa-miR-200bN 3880.92 103.03 5200.34 5423.04 9.62

hsa-miR-200c 13019.23 32384.49 88921.49 32197.20 0.00

hsa-miR-200cN 11492.03 29978.08 70071.61 29302.55 4.20

hsa-miR-203 8507.06 459.16 2229.81 10460.21 0.00

hsa-miR-204 0.00 0.00 0.00 0.00 24.60

hsa-miR-205 1801.77 93.86 6731.92 52.70 0.00

hsa-miR-206 4.53 0.00 12.27 0.00 0.00

hsa-miR-208 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 942.76 589.61 1599.54 505.32 71.07

hsa-miR-210N 1533.71 869.99 2284.77 958.25 142.42

hsa-miR-211 0.00 0.00 0.00 22.34 0.00

hsa-miR-212 154.95 120.80 222.56 236.86 140.39

hsa-miR-213 12.18 126.10 56.35 5.03 4.21

hsa-miR-214 12.83 12.51 3.89 9.47 5.24

hsa-miR-215 11.86 0.00 11.79 0.00 0.00

hsa-miR-216 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 0.00 0.00 0.00 0.00 0.00

hsa-miR-218 9.63 0.00 0.00 277.06 0.00

hsa-miR-219 0.00 0.00 0.00 0.00 0.00

hsa-miR-220 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 0.00 2.48 0.00 139.68 201.49

hsa-miR-222 6.59 425.70 98.30 1154.48 5827.27

hsa-miR-223 0.00 5.26 1.58 44.65 0.00

hsa-miR-296 757.33 522.24 34.03 1738.66 386.05

hsa-miR-299 0.00 0.00 0.00 0.00 0.00

Continued

275


hsa-miR-301 4943.87 218.46 1209.26 8225.62 22.28

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 42.02 41.53 16.65 30.49 53.60

hsa-miR-302c 0.00 61.26 0.00 0.00 0.00

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 0.00 0.00 1.56 10.03 0.00

hsa-miR-320 4970.52 1722.84 2372.43 3364.47 928.48

hsa-miR-321 5745.97 5749.84 17712.84 9302.29 1408.56

hsa-miR-323 0.00 0.00 2.02 0.00 0.00

hsa-miR-324-3p 1271.33 114.67 1223.51 1176.52 139.26

hsa-miR-324-5p 1205.83 55.49 628.77 1225.76 55.51

hsa-miR-325 0.00 0.00 0.00 0.00 0.00

hsa-miR-326 15.03 0.00 7.00 22.72 0.00

hsa-miR-328 991.98 30.03 1468.84 347.30 49.42

hsa-miR-330 32.76 5.43 40.30 41.67 0.00

hsa-miR-331 3125.21 2410.47 13185.67 2953.99 56.15

hsa-miR-335 0.00 512.36 47.39 399.00 0.00

hsa-miR-337 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 0.00 0.00 0.00 0.00 0.00

hsa-miR-339 133.91 94.38 172.69 214.64 5.18

hsa-miR-340 201.75 76.90 128.21 206.35 15.24

hsa-miR-342 2258.91 794.08 1871.69 20000.33 121.53

hsa-miR-345 1429.28 611.30 2285.66 4000.28 29.30

hsa-miR-346 8.37 8.01 16.52 49.75 1.89

hsa-miR-361 191.93 95.40 88.81 249.58 16.46

hsa-miR-367 0.00 0.00 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 67.96 79.56 173.90 138.53 60.16

hsa-miR-371 0.00 0.00 0.00 0.00 0.00

hsa-miR-372 223.30 117.62 127.50 231.01 68.32

hsa-miR-373 0.00 0.00 0.00 0.00 4.47

hsa-miR-374 3029.43 2150.67 803.59 3746.70 11.82

hsa-miR-375 2889.81 470.68 21466.35 1474.46 4.85

hsa-miR-376a 0.00 1.45 18.66 0.00 0.00

hsa-miR-377 0.00 0.00 0.00 0.00 0.00

hsa-miR-378 20.59 57.74 81.89 36.93 23.44

hsa-miR-379 0.00 2.68 21.74 0.00 0.00

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 0.00 0.00 0.00 0.00 0.00

Continued

276


hsa-miR-381 0.00 0.00 4.90 0.00 17.70

hsa-miR-382 0.00 0.00 11.98 0.00 0.00

hsa-miR-383 0.00 0.00 0.00 16.39 0.00

hsa-miR-384 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 29.84 108.27 28.79 47.56 25.81

hsa-miR-423 708.68 590.66 1283.90 416.90 95.42

hsa-miR-425 704.22 241.59 943.45 421.79 29.72

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 0.00 0.00 0.00 0.00 0.00

miR-224(mmu) 0.00 91.37 0.00 0.00 0.00

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00

Colorectal Cancer

miRNA HCT8 HCT116 HT29 SW620 HCT15 HeLa

hsa-let-7a 2981.59 183.91 1458.70 1146.77 1994.70 97.64

hsa-let-7b 14540.76 679.83 4177.99 4045.54 18455.59 3004.33

hsa-let-7c 650.74 34.35 237.37 297.57 733.22 347.79

hsa-let-7d 130.88 13.11 237.52 131.11 84.33 9.31

hsa-let-7e 226.88 7.58 247.92 45.25 151.88 5.55

hsa-let-7g 1671.78 136.22 929.23 1390.01 2045.86 23.38

hsa-let-7i 183.71 102.34 429.32 279.31 257.20 164.52

hsa-miR-001 13.65 0.00 0.00 49.13 0.00 0.00

hsa-miR-007 302.92 124.84 2469.58 3391.31 955.96 0.00

hsa-miR-009 31.67 254.87 5.36 3332.02 15.83 0.00

hsa-miR-009* 18.39 45.33 0.00 594.67 0.00 1.37

hsa-miR-010a 11539.35 231.93 6261.34 3321.67 5038.28 0.00

hsa-miR-010b 3273.00 4.93 1815.59 1343.14 435.07 0.00

hsa-miR-015a 387.64 0.00 441.85 493.21 694.29 17.46

hsa-miR-015b 4008.22 394.29 5725.16 6057.67 4583.43 493.58

hsa-miR-016 29240.66 2019.13 22778.48 36400.59 31816.51 57.90

hsa-miR-017-3p 36.34 0.00 42.81 16.83 11.80 0.00

hsa-miR-017-5p 2861.47 279.37 2015.85 4931.14 3440.33 27.67

hsa-miR-018 281.96 43.23 798.21 461.67 357.08 1.50

hsa-miR-019a 5080.70 812.14 8003.93 14387.34 7672.47 0.00

hsa-miR-019b 25484.30 3165.02 34546.51 66636.93 37604.17 22.80

hsa-miR-020 34241.85 4357.09 44883.87 80463.19 50806.43 161.35

hsa-miR-021 1676.77 1527.42 4011.47 3527.59 4460.74 22.00

hsa-miR-022 66.12 0.00 117.41 9.13 81.13 0.00

hsa-miR-023a 18.71 11.27 32.92 55.58 118.78 8.98

hsa-miR-023b 132.36 30.39 190.24 422.68 68.79 0.00

Continued

277


hsa-miR-023bN 1765.34 247.55 2098.77 11575.28 1745.85 233.63

hsa-miR-024 12999.89 2529.96 26074.78 36341.93 28448.54 1250.05

hsa-miR-025 963.37 419.84 2070.35 3664.79 1113.67 35.63

hsa-miR-026aN 10395.19 925.23 4996.18 9947.63 6718.07 79.77

hsa-miR-026b 3304.79 229.07 3109.24 3602.51 4491.24 20.15

hsa-miR-026bN 1605.33 119.74 1635.25 1952.60 2239.18 10.79

hsa-miR-027a 1372.15 529.44 1644.03 2344.51 4434.74 46.14

hsa-miR-027b 531.21 20.88 486.81 2608.71 409.93 17.39

hsa-miR-027bN 3220.54 160.89 3748.76 11881.83 1981.29 169.79

hsa-miR-028 305.87 48.73 642.32 440.15 315.05 0.00

hsa-miR-029a 3957.26 809.99 1976.32 3391.55 3048.37 20.87

hsa-miR-029b 170.26 36.07 85.41 96.66 159.85 0.00

hsa-miR-029c 293.55 88.99 229.72 204.47 294.84 0.00

hsa-miR-030a-3p 0.00 0.00 0.00 39.94 108.86 108.19

hsa-miR-030c 6404.44 1147.38 5324.90 6262.14 4542.52 123.32

hsa-miR-030d 674.24 107.79 2021.45 633.55 271.64 10.93

hsa-miR-030e-3p 750.43 46.13 311.19 833.51 546.77 3.63

hsa-miR-031 3214.75 17316.78 48373.34 3645.68 8322.72 340.26

hsa-miR-032 208.14 40.98 153.82 152.39 276.81 0.00

hsa-miR-033 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-034a 62.82 0.00 12.82 4.08 19.58 19.38

hsa-miR-034aN 753.46 156.77 186.64 101.05 280.87 65.99

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-092N 18967.69 2405.82 23341.01 54271.90 21328.96 4638.85

hsa-miR-093 16206.79 2448.54 23278.79 34278.99 17925.49 751.21

hsa-miR-095 346.78 75.88 22.14 391.30 136.75 24.34

hsa-miR-096 17398.44 12454.29 10421.57 11006.18 37633.61 48346.58

hsa-miR-098 216.04 29.24 492.65 323.15 348.71 0.00

hsa-miR-099a 198.10 2012.21 106.30 1461.20 92.11 59.50

hsa-miR-099b 825.85 302.29 2126.07 559.74 1524.52 42.66

hsa-miR-100 158.95 2342.43 118.76 1604.34 54.61 25.35

hsa-miR-101 38.32 9.03 62.66 81.59 56.34 0.00

hsa-miR-103 550.54 147.47 1362.73 1288.98 1002.92 10.91

hsa-miR-105 0.00 0.00 0.00 0.00 2.77 0.00

hsa-miR-106a 3683.00 995.85 2439.15 4614.12 5110.52 2901.07

hsa-miR-106b 1880.20 449.59 3230.59 3480.99 2940.59 18.04

hsa-miR-107 20.30 0.00 16.55 42.79 0.00 0.00

hsa-miR-108 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-124a 0.00 0.00 0.00 0.00 0.00 0.00

Continued

278


hsa-miR-125a 8212.77 1859.42 10620.96 4116.32 12708.71 887.81

hsa-miR-125b 0.00 2224.88 20.36 831.65 29.05 227.86

hsa-miR-126 938.73 314.39 37.38 1098.62 5.78 0.00

hsa-miR-126* 636.12 234.70 78.21 751.68 3.53 8.09

hsa-miR-127 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 164.04 81.53 101.90 258.04 8.58 2.76

hsa-miR-130aN 18.92 150.94 21.83 60.03 2.17 26.95

hsa-miR-130b 817.38 148.94 473.50 1081.93 968.71 11.27

hsa-miR-132 441.82 142.27 307.82 1863.09 651.60 70.17

hsa-miR-133a 4.58 0.00 0.00 25.14 0.00 8.48

hsa-miR-134 9.65 3.84 14.04 9.82 7.06 8.29

hsa-miR-135a 28.33 4.93 46.85 494.73 9.42 0.00

hsa-miR-135b 771.14 295.36 1244.98 2450.92 226.45 0.00

hsa-miR-138 0.00 0.00 10.86 4.83 1.93 0.00

hsa-miR-139 12.36 4.08 0.00 0.00 0.00 0.00

hsa-miR-140 1611.25 170.68 696.76 2626.31 2319.61 0.00

hsa-miR-141 1232.71 338.65 1274.09 26.59 1291.73 0.00

hsa-miR-142-3p 227.84 0.00 198.21 5492.13 77.41 0.00

hsa-miR-142-5p 58.04 7.35 49.78 1692.60 15.67 2.71

hsa-miR-143 3.16 0.00 0.00 2.19 0.00 0.00

hsa-miR-145 6.95 28.55 7.99 20.89 6.55 6.57

hsa-miR-146 462.04 302.07 885.46 665.53 392.93 349.86

hsa-miR-146b 2911.73 90.27 143.77 500.11 293.38 17.26

hsa-miR-147 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 792.39 94.73 69.32 926.29 1169.72 0.00

hsa-miR-148b 223.71 49.20 232.68 286.83 245.40 0.00

hsa-miR-149 330.27 267.94 177.26 1177.31 704.51 32.52

hsa-miR-150 7.95 22.21 350.76 232.74 23.03 17.93

hsa-miR-152 490.61 19.04 164.36 685.59 565.02 32.53

hsa-miR-152N 512.91 62.09 220.70 442.64 474.89 26.82

hsa-miR-153 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 36.25 2.38 146.31 7.51 552.12 52.39

hsa-miR-181a 4.37 29.48 564.03 663.50 58.26 115.06

hsa-miR-181b 115.39 153.53 1929.59 2033.60 256.72 223.55

hsa-miR-181c 1.99 4.03 37.81 76.67 17.59 7.03

hsa-miR-182* 19.92 13.41 24.77 16.20 25.62 12.38

hsa-miR-183 427.97 97.01 419.13 914.00 627.03 2.10

hsa-miR-184 0.00 1.48 0.00 0.00 14.35 0.00

Continued

279


hsa-miR-186 1822.96 861.05 5015.29 3939.76 3434.66 21.57

hsa-miR-187 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-188 18.45 38.05 47.61 51.40 30.78 32.45

hsa-miR-190 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 3821.39 1563.03 3664.16 5584.09 10469.55 291.06

hsa-miR-192 4407.85 22.58 24270.80 14008.19 933.89 0.00

hsa-miR-193 178.07 26.59 42.27 6.05 38.45 9.63

hsa-miR-194 1218.36 6.71 5196.53 3638.52 292.06 0.00

hsa-miR-195 299.43 28.62 189.76 261.73 375.13 1.81

hsa-miR-196a 1304.06 134.34 2638.79 3410.42 1153.35 228.79

hsa-miR-196b 0.00 0.00 395.26 265.11 16.98 0.00

hsa-miR-197 1241.78 1254.49 1769.50 1904.93 1980.97 292.87

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 9.67 0.00 6.85 8.74 12.62 0.00

hsa-miR-199b 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 3803.53 667.47 14210.01 2946.38 4976.87 0.00

hsa-miR-200b 11575.51 599.72 40770.61 10992.02 12333.80 0.00

hsa-miR-200bN 3800.74 278.08 13412.99 3434.33 3696.94 0.00

hsa-miR-200c 26716.43 4957.90 23494.64 1106.80 35698.53 1.46

hsa-miR-200cN 22284.01 3550.53 24454.01 667.17 39036.64 0.00

hsa-miR-203 9763.52 343.04 3009.16 831.61 6205.45 13.62

hsa-miR-204 0.00 0.00 0.00 921.30 48.75 4.78

hsa-miR-205 0.00 0.00 79.10 13.53 0.00 0.00

hsa-miR-206 3.96 2.07 8.99 1.50 0.00 1.43

hsa-miR-208 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 913.12 116.36 538.88 333.63 858.50 5.70

hsa-miR-210N 1498.52 248.57 713.75 490.69 1558.61 29.03

hsa-miR-211 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-212 209.55 186.29 145.47 329.65 203.79 73.62

hsa-miR-213 0.00 2.26 40.38 88.13 2.86 0.00

hsa-miR-214 5.26 6.78 10.12 3.93 0.00 6.06

hsa-miR-215 39.17 0.00 139.59 26.67 15.20 0.00

hsa-miR-216 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 7.64 0.00 0.00 0.00 1.42 0.00

hsa-miR-218 0.00 19.45 0.00 51.08 1.41 0.00

hsa-miR-219 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-220 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 1607.73 1101.84 3639.45 3074.69 2441.29 9.91

hsa-miR-222 13748.91 14902.59 19900.07 19247.57 20363.61 730.06

hsa-miR-223 0.00 0.00 0.00 0.00 0.00 21.54

Continued

280


hsa-miR-296 18.71 22.47 5.71 5.32 2.79 94.50

hsa-miR-299 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 642.38 201.45 1388.28 842.44 1467.44 0.00

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 7.78 4.95 1.54 6.39 108.25 34.35

hsa-miR-302c 0.00 34.38 0.00 0.00 24.26 0.00

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-320 4707.69 1193.35 1854.40 7736.92 6465.03 881.54

hsa-miR-321 6516.35 1613.15 18992.34 8820.76 6827.65 505.53

hsa-miR-323 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-324-3p 285.05 127.77 483.67 1513.06 1430.63 122.48

hsa-miR-324-5p 640.68 155.76 449.69 542.14 906.36 8.14

hsa-miR-325 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-326 7.15 2.11 5.08 2.21 9.05 0.00

hsa-miR-328 226.63 135.11 59.95 791.33 178.80 46.52

hsa-miR-330 39.71 15.17 56.23 29.63 61.11 1.76

hsa-miR-331 1673.72 778.22 2668.59 2437.66 2157.33 321.60

hsa-miR-335 351.12 21.95 324.67 1093.08 184.04 0.00

hsa-miR-337 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 0.00 0.00 106.59 0.00 9.19 0.00

hsa-miR-339 83.50 28.73 78.38 108.15 41.52 10.02

hsa-miR-340 124.51 34.50 108.95 180.35 89.00 0.00

hsa-miR-342 0.00 176.07 0.00 13.76 0.00 43.99

hsa-miR-345 723.00 207.45 380.66 765.68 600.24 19.54

hsa-miR-346 10.11 13.85 20.02 33.91 8.20 27.85

hsa-miR-361 242.91 62.41 256.46 596.96 267.64 4.41

hsa-miR-367 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 92.82 80.39 102.63 44.87 57.94 85.25

hsa-miR-371 106.77 0.00 0.00 0.00 507.15 0.00

hsa-miR-372 602.69 99.64 84.52 264.02 2785.91 129.72

hsa-miR-373 31.48 0.00 0.00 3.39 288.91 0.00

hsa-miR-374 3849.70 417.93 5233.17 6911.48 1880.54 0.00

hsa-miR-375 1217.73 124.35 3433.88 23411.10 4933.26 0.00

hsa-miR-376a 0.00 0.00 5.90 2.29 7.15 0.00

hsa-miR-377 5.68 0.00 1.99 9.73 1.87 0.00

hsa-miR-378 102.18 22.53 74.04 36.02 91.66 12.17

hsa-miR-379 1.77 0.00 2.31 0.00 0.00 0.00

Continued

281


hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 1.53 0.00 0.00 0.00 0.00 0.00

hsa-miR-381 0.00 7.22 0.00 3.45 0.00 0.00

hsa-miR-382 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-383 0.00 0.00 0.00 0.00 3.58 0.00

hsa-miR-384 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 76.55 26.23 7.23 40.17 44.74 2.56

hsa-miR-423 411.15 194.95 398.49 467.78 470.12 288.90

hsa-miR-425 183.07 55.19 227.40 314.96 759.80 12.15

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

miR-137(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

miR-224(mmu) 8.52 0.00 144.45 7.48 8.60 3.95

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

Hematological Cancer

miRNA RAMOS HL60 K562 JURCAT DAUDI 293T

hsa-let-7a 476.24 1227.07 158.91 1561.33 257.93 576.04

hsa-let-7b 170.17 1327.88 18.92 2422.87 180.41 199.06

hsa-let-7c 395.07 149.41 0.00 143.65 95.66 330.75

hsa-let-7d 117.48 168.89 0.00 201.13 70.05 0.00

hsa-let-7e 0.00 5.02 12.18 20.57 0.00 46.84

hsa-let-7g 3023.14 2037.42 46.67 2713.04 1840.27 546.74

hsa-let-7i 334.50 261.92 36.01 479.18 302.21 70.98

hsa-miR-001 0.00 0.00 0.00 4.28 0.00 41.13

hsa-miR-007 231.19 78.48 83.06 2271.12 501.25 871.54

hsa-miR-009 116.83 30.74 833.69 3556.40 432.26 1892.64

hsa-miR-009* 40.55 3.27 272.19 698.75 166.10 468.84

hsa-miR-010a 0.00 0.00 669.55 0.00 5.80 2487.12

hsa-miR-010b 0.00 0.00 13.70 0.00 0.00 749.90

hsa-miR-015a 1160.95 697.23 252.42 1735.77 231.07 783.29

hsa-miR-015b 8136.28 5490.35 6712.70 9037.28 2819.87 6407.23

hsa-miR-016 100287.15 35183.56 27742.35 86180.90 42795.43 43217.17

hsa-miR-017-3p 209.81 78.37 123.85 96.83 176.82 135.05

hsa-miR-017-5p 2391.84 4252.95 8317.35 6578.31 2424.41 8712.46

hsa-miR-018 748.84 601.23 2138.55 1502.74 541.72 1418.87

hsa-miR-019a 15383.65 10144.15 27202.80 17315.74 11819.43 21531.63

hsa-miR-019b 64653.48 57911.03 105820.80 82056.41 63322.49 88132.29

hsa-miR-020 80036.65 70308.31 140864.52 105847.92 68168.51 73186.00

hsa-miR-021 330.54 349.04 4476.93 699.20 682.04 439.93

hsa-miR-022 6.82 0.00 101.16 29.17 7.67 100.80

Continued

282


hsa-miR-023a 0.00 94.37 25.58 4.68 0.00 15.10

hsa-miR-023b 22.05 32.95 23.53 40.98 0.00 28.69

hsa-miR-023bN 150.68 606.89 668.25 933.75 11.35 1156.84

hsa-miR-024 1205.61 16971.70 7051.43 3361.53 269.19 3258.01

hsa-miR-025 2553.96 2558.49 3451.85 3218.04 722.52 2667.26

hsa-miR-026aN 4750.03 3081.36 5040.04 5105.37 1200.29 4822.47

hsa-miR-026b 1480.03 3230.85 2766.01 3245.93 734.25 2257.01

hsa-miR-026bN 829.46 1418.85 1468.50 1428.07 511.42 1128.64

hsa-miR-027a 54.02 3629.05 1092.28 552.12 34.25 432.68

hsa-miR-027b 0.00 84.69 127.77 206.60 14.87 355.65

hsa-miR-027bN 1482.78 562.68 476.28 1373.40 279.75 2299.56

hsa-miR-028 201.68 145.03 0.00 647.47 442.10 227.69

hsa-miR-029a 2085.19 525.96 343.58 1043.35 1192.86 422.56

hsa-miR-029b 24.98 32.59 0.00 74.82 24.95 38.42

hsa-miR-029c 276.03 298.80 92.05 2086.16 532.72 272.20

hsa-miR-030a-3p 20.97 0.00 2.36 0.00 0.00 762.23

hsa-miR-030c 5574.80 7402.57 6113.83 9477.76 3176.38 7134.64

hsa-miR-030d 1476.87 561.82 1004.18 832.28 1050.14 587.32

hsa-miR-030e-3p 420.02 861.02 876.56 1050.16 354.99 677.80

hsa-miR-031 1.88 0.00 0.00 8.27 38.13 5053.65

hsa-miR-032 359.92 227.02 487.27 934.25 94.47 598.02

hsa-miR-033 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-034a 0.00 0.00 0.00 0.00 0.00 95.07

hsa-miR-034aN 2.24 0.00 11.49 8.76 0.00 939.42

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00 10.87

hsa-miR-034b 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-092N 36634.07 38856.53 76696.29 45585.33 29405.83 49278.04

hsa-miR-093 12102.83 22405.08 16757.50 32796.90 2432.46 18029.98

hsa-miR-095 46.43 0.00 0.00 58.53 57.31 228.99

hsa-miR-096 16954.20 10215.68 15049.70 12537.86 14053.04 15450.54

hsa-miR-098 34.67 167.95 0.00 782.04 7.91 68.43

hsa-miR-099a 630.48 158.16 17.61 10.08 379.06 528.84

hsa-miR-099b 0.00 6.74 714.62 134.99 3.75 659.87

hsa-miR-100 255.47 65.90 11.69 7.33 206.41 318.65

hsa-miR-101 101.93 62.14 109.87 84.69 43.61 100.83

hsa-miR-103 406.14 736.39 478.35 1212.18 189.56 1100.61

hsa-miR-105 0.00 0.00 32.45 0.00 8.16 0.00

hsa-miR-106a 2529.12 3257.09 4641.96 5226.03 2456.19 7592.53

hsa-miR-106b 5421.12 3804.48 3161.85 6202.17 1406.73 3724.92

hsa-miR-107 0.00 18.08 14.58 20.62 0.00 31.43

hsa-miR-108 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-122a 0.00 0.00 0.00 0.00 0.00 0.00

Continued

283


hsa-miR-124a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-125a 0.00 160.74 5429.93 906.74 22.52 3792.74

hsa-miR-125b 710.54 133.81 0.00 0.00 303.84 850.49

hsa-miR-126 0.00 18.49 15649.06 849.30 0.00 1462.15

hsa-miR-126* 4.89 21.32 3037.39 170.97 0.00 253.11

hsa-miR-127 0.00 0.00 35.34 0.00 0.00 12.45

hsa-miR-128a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-130a 5.15 0.00 54.28 29.04 4.60 27.99

hsa-miR-130aN 20.92 1.52 6.86 46.51 22.27 2.61

hsa-miR-130b 495.88 200.07 2751.96 1735.27 294.28 897.40

hsa-miR-132 79.16 45.56 525.33 724.73 563.68 1058.09

hsa-miR-133a 5.19 5.35 0.00 0.00 0.00 8.31

hsa-miR-134 1.82 3.47 20.45 5.54 4.74 7.27

hsa-miR-135a 0.00 8.35 29.26 174.93 0.00 0.00

hsa-miR-135b 0.00 0.00 241.70 3.28 0.00 58.73

hsa-miR-138 52.05 0.00 0.00 5.76 6.46 13.15

hsa-miR-139 0.00 0.00 0.00 11.35 0.00 7.83

hsa-miR-140 2199.51 2571.88 1993.32 1951.24 828.19 1597.67

hsa-miR-141 0.00 5.81 4.53 49.08 0.00 5.98

hsa-miR-142-3p 19725.56 23664.42 12437.70 40066.70 13900.74 15.09

hsa-miR-142-5p 2571.31 3874.12 1784.88 6533.13 1367.77 4.79

hsa-miR-143 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-145 6.10 24.56 51.85 25.44 2.65 6.79

hsa-miR-146 11941.26 1403.02 537.84 892.52 865.85 552.42

hsa-miR-146b 286.39 214.77 17729.83 312.77 308.05 470.55

hsa-miR-147 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-148a 1558.38 917.15 1176.32 2484.78 181.01 2497.30

hsa-miR-148b 94.85 188.80 141.11 242.27 33.68 298.74

hsa-miR-149 7.98 5.61 10.98 176.83 19.14 772.47

hsa-miR-150 992.51 23.18 0.00 5179.88 866.32 12.31

hsa-miR-152 199.34 4.35 47.43 127.16 38.36 275.01

hsa-miR-152N 185.95 29.66 40.18 154.50 66.98 369.07

hsa-miR-153 0.00 0.00 0.00 8.89 0.00 0.00

hsa-miR-154 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-154* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-155 31.61 434.48 6.13 5.23 337.71 6.95

hsa-miR-181a 1060.60 3933.94 0.00 6586.14 178.40 474.63

hsa-miR-181b 2127.41 6839.53 58.32 17286.88 899.36 938.48

hsa-miR-181c 59.83 163.01 0.00 342.21 15.41 57.96

hsa-miR-182* 2.80 0.00 19.09 22.36 0.00 21.75

hsa-miR-183 82.41 2.48 480.61 687.52 2.16 354.98

hsa-miR-184 0.00 0.00 0.00 86.69 30.59 18.03

Continued

284


hsa-miR-186 1551.68 5441.12 4549.78 6923.61 621.71 7705.67

hsa-miR-187 0.00 0.00 0.00 11.67 0.00 212.58

hsa-miR-188 20.91 27.89 26.29 19.80 21.06 66.72

hsa-miR-190 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-191 9349.85 14701.60 8680.03 16887.18 1467.62 5974.20

hsa-miR-192 259.75 70.63 480.52 575.28 389.65 830.94

hsa-miR-193 10.26 25.09 0.00 42.78 17.20 38.91

hsa-miR-194 65.60 26.11 143.87 180.91 132.32 260.42

hsa-miR-195 926.49 299.42 295.38 724.90 336.23 853.43

hsa-miR-196a 0.00 14.47 167.16 954.39 35.22 4465.57

hsa-miR-196b 0.00 0.00 0.00 0.00 0.00 2007.48

hsa-miR-197 638.13 2129.18 2248.85 1245.66 211.17 3281.06

hsa-miR-199a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-199a* 0.00 327.50 23.91 5.54 19.34 11.94

hsa-miR-199b 0.00 35.34 0.00 0.00 0.00 0.00

hsa-miR-199-s 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-200a 1.97 0.00 0.00 0.00 0.00 7.08

hsa-miR-200b 7.85 8.27 8.68 9.27 0.00 23.33

hsa-miR-200bN 18.19 0.00 3.20 2.44 0.00 4.80

hsa-miR-200c 19.18 68.93 99.69 606.65 28.55 187.68

hsa-miR-200cN 23.80 57.47 75.76 512.11 0.00 157.62

hsa-miR-203 8.44 0.00 0.00 221.64 0.00 18.43

hsa-miR-204 2.20 0.00 3.87 0.00 0.00 121.80

hsa-miR-205 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-206 4.54 0.00 0.00 6.68 3.28 0.00

hsa-miR-208 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-210 569.34 7.26 243.67 314.03 96.74 1119.41

hsa-miR-210N 924.90 46.43 462.86 511.37 250.23 1893.90

hsa-miR-211 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-212 125.79 79.52 215.32 167.87 114.88 217.90

hsa-miR-213 20.63 601.11 0.00 994.57 14.24 34.27

hsa-miR-214 9.22 2.12 4.80 2.85 19.88 14.66

hsa-miR-215 0.00 0.00 38.78 0.00 0.00 11.14

hsa-miR-216 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-217 0.00 0.00 9.58 0.00 0.00 0.00

hsa-miR-218 0.00 6.52 147.02 30.88 0.00 4230.55

hsa-miR-219 0.00 0.00 0.00 0.00 0.00 5.95

hsa-miR-220 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-221 0.00 2604.05 146.04 846.12 0.00 8228.70

hsa-miR-222 15.66 12446.45 928.58 4983.01 377.84 46265.29

hsa-miR-223 14.40 165722.35 73928.30 19663.34 48.10 0.00

hsa-miR-296 361.39 9.52 222.16 957.28 241.33 709.42

Continued

285


hsa-miR-299 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-301 241.26 354.73 737.55 2717.90 133.28 1119.70

hsa-miR-302a 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302a* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302b 63.42 17.29 34.34 27.70 63.59 114.87

hsa-miR-302c 32.21 0.00 0.00 0.00 0.00 0.00

hsa-miR-302c* 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-302d 0.00 0.00 14.45 2.13 0.00 0.00

hsa-miR-320 534.90 1229.68 2515.21 1362.62 839.31 2033.67

hsa-miR-321 9062.26 6436.94 6428.65 9100.69 5068.75 9831.49

hsa-miR-323 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-324-3p 258.23 277.85 444.47 2308.98 403.91 1186.91

hsa-miR-324-5p 41.59 109.83 146.97 950.35 44.15 883.63

hsa-miR-325 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-326 0.00 5.28 2.91 2.79 0.00 4.13

hsa-miR-328 16.30 103.22 186.85 491.61 37.99 698.99

hsa-miR-330 31.56 14.81 21.16 55.82 6.94 38.54

hsa-miR-331 1611.60 1616.46 940.25 4585.69 1808.18 3113.31

hsa-miR-335 119.61 56.60 0.00 0.00 20.73 15.39

hsa-miR-337 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-338 0.00 0.00 0.00 0.00 0.00 15.66

hsa-miR-339 110.36 77.48 70.42 43.05 3.57 112.03

hsa-miR-340 0.00 165.74 217.15 576.43 0.00 219.29

hsa-miR-342 1705.93 2946.96 1070.36 14531.22 690.51 1784.16

hsa-miR-345 103.55 1845.85 243.35 4617.01 31.42 714.86

hsa-miR-346 10.00 1.64 5.89 32.55 22.12 78.19

hsa-miR-361 19.35 357.66 78.53 443.88 6.25 330.99

hsa-miR-367 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-368 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-369 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-370 104.46 60.29 111.53 82.01 90.94 116.97

hsa-miR-371 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-372 122.99 100.71 118.58 110.00 93.90 232.23

hsa-miR-373 0.00 0.00 23.52 0.00 0.00 0.00

hsa-miR-374 1902.86 1720.37 1788.40 3138.22 375.59 4437.92

hsa-miR-375 0.00 0.00 25.16 24.20 0.00 467.00

hsa-miR-376a 0.00 0.00 11.92 0.00 0.00 7.46

hsa-miR-377 1.54 1.79 0.00 3.59 0.00 2.20

hsa-miR-378 117.34 213.12 325.88 74.62 28.10 241.53

hsa-miR-379 4.13 2.17 0.00 2.35 2.09 0.00

hsa-miR-380-3P 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-380-5p 0.00 0.00 0.00 0.00 0.00 0.00

Continued

286


hsa-miR-381 0.00 0.00 0.00 0.00 5.96 0.00

hsa-miR-382 0.00 0.00 7.66 0.00 3.48 0.00

hsa-miR-383 2.98 0.00 0.00 0.00 10.12 0.00

hsa-miR-384 0.00 0.00 0.00 0.00 0.00 0.00

hsa-miR-422b 103.70 144.22 194.45 40.90 26.31 184.74

hsa-miR-423 444.01 455.72 504.97 526.64 305.72 581.65

hsa-miR-425 224.34 564.43 265.32 504.65 10.67 179.91

let-7f(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

miR-129-5p(mmu) 0.00 22.19 0.00 0.00 6.32 0.00

miR-137(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

miR-224(mmu) 0.00 0.00 205.80 0.00 0.00 0.00

miR-424(mmu) 0.00 0.00 0.00 0.00 0.00 0.00

287

miRNA Adipose Bladder Brain Cervix Colon Heart Lung Liver

let-7a-1* 0.75 0.69 2.36 3.41 0.63 0.79 3.08 0.82

let-7a-2-P 59.50 77.59 382.34 782.09 94.74 133.12 63.41 12.46

let-7a-3* 7.20 3.69 30.73 24.01 4.68 2.03 22.04 2.19

let-7b* 4.40 3.75 23.77 44.83 7.94 2.61 32.00 3.67

let-7c* 0.00 0.00 10135.72 0.71 0.00 0.00 0.00 0.00

let-7d* 31.17 31.52 52.17 156.60 81.39 28.07 222.35 46.10

let-7e* 2.04 1.17 3.40 5.98 0.89 0.90 4.96 1.26

let-7f-1* 0.00 0.00 0.00 0.00 0.00 0.66 0.00 0.00

let-7f-2* 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

let-7g* 0.00 0.00 1.73 3.05 0.00 6.58 2.86 1.34

let-7i* 0.00 0.00 3.36 22.06 1.85 14.82 2.80 0.00

MIR-001-1 13.47 27.32 0.00 69.07 15.66 593.06 2.30 0.00

MIR-001-2 110.26 70.26 104.13 291.79 100.88 495.91 20.59 0.00

MIR-007-1 20.69 25.44 54.73 37.62 16.10 21.60 50.42 4.98

MIR-007-2 0.60 1.43 4.32 0.00 0.00 2.15 0.00 0.00

MIR-007-3 8.88 8.30 3159.42 12.83 114.50 5.82 0.00 1.13

MIR-009-1-P 25.62 19.76 64.32 37.55 121.07 21.16 4.05 9.72

MIR-009-2-P 19.21 40.38 4016.2 89.78 43.60 8.29 1.40 0.00

MIR-009-3-P 0.00 0.00 26.16 0.00 0.00 3.19 0.00 0.00

MIR-010a,b 4.66 7.73 0.00 32.78 21.20 0.00 12.46 0.00

MIR-015a 13.92 13.92 12.61 60.67 5.19 24.07 43.24 0.00

MIR-015b 31.84 29.94 66.48 66.43 22.14 43.33 169.60 17.31

MIR-016-1 44.78 10.32 32.91 103.59 58.68 62.70 82.10 9.60

MIR-016-2 1.62 0.78 30.46 34.06 20.79 6.13 13.21 0.00

MIR-017-P 34.40 28.13 4.51 127.28 37.37 28.99 60.31 17.94

MIR-018 463.78 527.88 507.12 1213.8 1356.1 1089.7 598.61 468.3

MIR-019a-P 0.99 0.00 1.78 10.99 9.10 6.21 0.90 3.75

MIR-019b-1-P 2.98 0.00 0.00 2.82 14.65 0.00 2.25 0.00

MIR-019b-2-P 0.00 0.00 1.93 0.00 0.00 0.00 0.00 0.00

MIR-020 0.00 1.49 0.00 4.66 0.00 0.00 3.07 0.00

MIR-021 726.86 4845.49 193.11 4116.8 6496.0 5296.2 2805.1 570.9

MIR-022-P 28.68 1.61 49.54 208.95 77.59 64.91 36.34 15.39

MIR-023a 95.83 16.55 29.70 1041.6 187.68 88.61 90.32 20.74

MIR-023b-P 98.35 54.73 167.75 804.29 108.67 150.83 133.93 38.30

MIR-024-1,2 1164.61 1651.96 2069.82 10869.64 3552.47 3825.21 1994.89 1121.87

Continued

Table C.3. microRNA precursor expression in 22 different normal human tissues

and cells. All data was generated using real-time PCR and SYBR green detection

except (*) which was assayed using TaqMan probes. Data is presented as copies of

microRNA per cell. (P) Real-time PCR was performed on the microRNA primary

precursor.

288


MIR-025 13.12 6.58 56.07 59.11 63.11 45.35 32.25 27.79

MIR-026a-1,2 0.00 10.06 58.38 52.45 4.14 16.27 15.28 0.00

MIR-026b 5.44 1.98 4.70 7.50 2.85 11.80 2.84 2.09

MIR-027a, b 6.17 37.91 8.20 407.18 30.76 40.89 60.72 10.59

MIR-028 8.95 7.21 0.00 30.84 8.61 6.65 5.48 0.00

MIR-029a,c 30.74 11.75 14.38 95.23 12.30 17.92 17.48 0.00

MIR-029b-1,2 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-030a,e 46.08 18.20 34.92 53.74 1.86 52.90 90.60 5.34

MIR-030b 90.44 28.99 72.64 162.46 81.66 215.04 77.58 53.26

MIR-030c-1,2 20.46 23.57 8.63 118.63 62.55 104.76 44.04 0.00

MIR-030d 93.16 13.61 15.84 47.13 23.93 63.52 73.58 0.00

MIR-031-P 16.66 18.93 61.40 63.24 24.67 29.96 5.29 1.82

MIR-032 49.61 12.65 36.33 29.74 34.87 13.77 34.25 5.14

MIR-033 3.72 0.00 0.00 3.30 4.68 0.00 3.49 0.00

MIR-034a 32.17 32.73 16.21 76.58 23.81 31.50 30.02 1.65

MIR-034b 1.66 0.00 23.86 5.67 4.13 9.75 1.96 0.00

MIR-092-1 0.00 0.00 7.31 33.61 0.00 10.08 5.28 2.05

MIR-092-2-P 0.00 0.00 7.84 0.00 3.28 0.00 0.00 0.00

MIR-093 9.89 27.13 22.54 25.63 47.26 26.85 9.15 16.41

MIR-095 11.46 0.00 41.77 10.74 6.99 10.67 0.78 0.00

MIR-096-P 27.63 14.29 84.64 26.31 44.66 65.84 4.95 14.22

MIR-098 1898.10 1058.63 1895.2 3204.8 1773.8 2686.1 833.86 543.0

MIR-099a 0.00 2.67 1.66 2.93 8.56 3.13 4.05 0.00

MIR-099b 181.14 140.46 206.02 572.16 252.30 363.67 181.13 22.74

MIR-100 69.39 454.57 959.06 1267.8 227.85 389.88 264.97 51.60

MIR-101-1 1.64 0.00 1.97 4.08 10.76 0.00 1.63 0.00

MIR-101-2 14.65 13.80 30.85 76.89 18.87 19.25 17.05 64.83

MIR-103-1,2 348.90 182.41 1059.69 1036.13 966.82 1007.07 437.91 245.06

MIR-105-1,2 1.06 1.64 1.00 0.87 5.34 12.00 1.79 0.00

MIR-106a-P 0.00 0.00 0.00 0.00 0.00 4.16 0.00 0.00

MIR-106b 82.19 251.39 199.94 382.05 265.91 233.14 150.92 57.76

MIR-107 576.18 678.21 1464.2 1629.8 1841.9 2065.3 713.31 517.7

MIR-108 38.28 33.63 41.75 64.64 19.32 21.85 11.82 10.00

MIR-122a 0.00 0.00 2.96 0.00 0.00 0.00 0.00 0.67

MIR-124a-1,2,3 0.00 6.46 10029.82 18.13 6.02 3.72 4.38 9.11

MIR-125a 55.77 154.82 176.16 286.06 68.36 152.02 70.14 9.10

MIR-125b-1 42.62 131.17 348.57 556.36 58.62 128.66 30.18 1.57

MIR-125b-2 0.00 12.74 34.74 57.96 1.72 12.35 7.60 11.94

MIR-126 1009.52 675.68 265.20 915.89 290.71 903.77 898.90 192.6

MIR-127 77.52 64.04 118.27 144.14 118.64 130.83 28.18 51.12

MIR-128a 45.31 21.71 790.52 183.16 80.10 77.42 24.54 1.29

Continued

289


MIR-128b 1.02 1.04 31.98 3.08 0.93 0.97 1.50 4.94

MIR-129-2 1.30 14.76 46.20 8.57 4.96 2.81 0.83 3.43

MIR-130a-P 13.43 4.44 47.72 30.76 24.73 5.87 4.44 0.00

MIR-130b 3.18 13.19 15.82 0.59 0.85 13.76 0.00 0.00

MIR-132 10.97 5.28 26.13 40.88 10.28 12.09 16.46 17.87

MIR-133a-1,2 12.25 19.25 55.32 34.69 24.94 158.24 0.00 0.00

MIR-133b 0.65 0.70 1.99 1.39 0.87 3.15 0.00 4.90

MIR-134 4.62 2.18 74.35 53.30 5.84 2.74 6.89 0.00

MIR-135a-1,2 39.70 15.12 64.95 47.51 65.65 1.11 13.94 0.00

MIR-135b-P 16.11 0.00 3.41 14.18 9.95 0.00 6.41 0.00

MIR-136 0.00 8.89 28.78 125.03 11.29 0.00 6.21 1.88

MIR-137* 0.00 0.00 16.33 1.48 0.00 0.00 0.00 0.00

MIR-138-1,2 0.00 0.00 18.71 0.00 0.00 0.00 0.00 0.00

MIR-139 33.48 25.96 9.37 43.23 43.28 40.62 18.43 10.91

MIR-140 1.87 0.00 1.21 1.38 1.84 0.00 1.11 0.00

MIR-141 7.97 3.16 0.00 4.18 15.83 0.00 12.38 2.15

MIR-142-P 33.77 7.39 3.82 30.93 41.94 3.41 22.62 0.00

MIR-143 104.91 277.38 8.82 628.55 161.54 62.42 42.98 2.63

MIR-144 10.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-145-P 525.56 268.21 53.67 3619.5 489.22 178.98 29.97 8.57

MIR-146 0.00 0.00 0.00 0.00 2.41 0.00 0.00 0.00

MIR-147 13.18 13.15 45.86 0.00 11.89 12.60 21.00 11.62

MIR-148a-P 2.01 0.00 0.00 0.00 0.00 1.09 0.86 0.00

MIR-148b-P 17.41 0.00 22.42 53.65 16.64 14.64 6.68 5.47

MIR-149 16.82 23.54 335.85 45.16 7.03 43.43 9.67 0.87

MIR-150 4.22 4.25 4.55 4.30 7.61 4.20 12.49 0.00

MIR-151 7.01 1.01 3.96 3.03 6.84 5.01 2.87 1.24

MIR-152 51.53 31.46 46.43 109.07 17.90 26.29 14.48 18.13

MIR-153-1,2 11.74 1.43 43.73 2.30 5.97 2.73 4.57 0.00

MIR-154 1.06 0.00 36.34 28.47 13.59 12.81 7.73 12.24

MIR-155 184.38 32.00 31.77 54.83 32.05 76.53 72.47 16.20

MIR-181a,c 23.73 33.72 138.14 80.11 74.92 317.05 29.04 9.16

MIR-181b-1,2 0.87 0.00 2.67 2.08 0.00 0.00 0.00 0.00

MIR-182 12.15 16.80 22.60 28.79 11.59 24.78 11.73 8.38

MIR-183 2.41 0.00 0.00 3.81 3.27 4.47 3.85 0.00

MIR-184 7.19 1.57 97.01 7.60 8.61 7.59 1.67 0.00

MIR-185 52.08 36.10 38.94 40.53 35.03 35.28 7.29 20.37

MIR-186-P 124.97 104.79 346.03 373.86 177.41 107.09 20.83 42.75

MIR-187 0.00 0.00 0.00 1.26 0.00 0.00 1.81 0.00

MIR-188b-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-190 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Continued

290


MIR-191 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-192 1.32 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-193 31.16 21.52 0.00 23.81 10.55 48.89 5.36 11.17

MIR-194-1,2 0.00 0.00 3.62 0.00 0.00 0.00 0.91 0.00

MIR-195-P 26.84 0.88 32.63 34.48 13.20 12.65 3.63 0.00

MIR-196a-1 0.00 0.00 0.00 0.00 40.11 0.00 0.00 0.00

MIR-196a-2 5.99 1.42 2.61 13.71 5.15 0.00 0.00 0.00

MIR-196b 1575.64 3263.01 0.00 13804.43 2520.04 6.07 29.39 0.00

MIR-197 22.00 9.81 67.67 95.68 83.04 37.20 12.42 16.33

MIR-198 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-199a-1-P 3.47 1.92 0.84 1.55 8.00 5.37 2.20 2.01

MIR-199a-2-P 12.45 5.14 71.30 124.54 12.83 20.45 6.26 14.25

MIR-199b-P 21.25 40.38 28.09 104.56 23.94 26.69 6.34 0.00

MIR-200a-P 153.44 152.68 589.43 268.50 405.50 200.99 57.85 60.06

MIR-200b 0.00 9.55 1.77 31.39 72.70 0.00 6.09 0.00

MIR-200c 0.00 1.37 1.18 0.00 9.95 0.00 0.00 0.00

MIR-203 0.00 0.00 0.00 17.14 0.00 0.00 0.00 0.00

MIR-204 8.32 6.78 10.97 3.68 16.56 7.39 0.00 0.00

MIR-205 33.37 23.61 0.00 65.63 0.00 10.34 6.31 0.00

MIR-206 16.69 16.52 0.00 17.98 0.00 0.00 0.00 0.00

MIR-208 5.87 2.44 21.67 0.00 0.00 2256.4 0.00 1.73

MIR-210 112.55 174.54 41.88 80.49 9.98 122.63 73.45 20.63

MIR-211 52.17 10.25 23.82 54.99 28.07 31.18 12.56 12.73

MIR-212 186.76 202.37 135.24 717.92 202.71 152.57 80.99 28.90

MIR-213 2.18 0.00 30.36 13.32 12.71 17.02 16.14 0.00

MIR-214 9.77 14.66 39.65 9.35 8.80 5.03 4.74 12.50

MIR-215 18.57 0.00 14.16 40.69 28.00 24.88 8.34 6.06

MIR-216 0.00 0.00 5.23 1.04 1.04 0.00 0.00 0.00

MIR-217 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-218-1,2 94.62 238.06 113.61 991.28 70.39 103.03 166.77 2.08

MIR-219-1,2 0.00 9.60 3.57 0.94 14.92 0.00 3.71 0.00

MIR-220 1.58 8.57 519.70 3.87 1.78 2.25 0.00 0.00

MIR-221 35.50 53.29 27.42 241.34 53.48 25.43 45.50 0.00

MIR-222-P 13.61 13.26 5.65 130.65 23.59 0.00 18.78 18.17

MIR-223 3.16 0.00 5.09 4.41 1.96 3.21 5.32 0.00

MIR-224 18.79 20.36 11.86 117.02 37.94 36.23 10.37 0.00

MIR-296 0.00 2.44 11.84 12.02 0.00 7.84 0.00 0.00

MIR-299-P 18.74 9.35 7.73 10.49 9.31 0.00 4.43 13.83

MIR-301 0.00 0.00 16.34 11.01 23.07 16.81 13.88 18.67

MIR-302 6.85 6.46 19.22 0.00 19.09 0.00 3.55 0.00

MIR-302b 20.25 8.75 13.74 15.59 15.99 13.30 5.78 0.00

Continued

291


MIR-302c 0.00 0.00 0.69 2.33 1.69 0.00 0.59 0.00

MIR-302d 1.30 0.00 0.00 0.00 1.05 0.00 0.00 0.00

MIR-320 4.22 8.04 3.34 11.35 7.75 9.22 10.76 3.61

MIR-321 2026.23 8509.22 10664.52 6486.85 2916.11 11548.94 862.79 3178.97

MIR-323 8.53 5.45 95.13 38.68 10.59 12.65 14.09 2.19

MIR-324-P 43.01 45.07 37.01 61.30 15.46 77.17 22.75 6.68

MIR-325 444.34 5.85 202.97 8.87 2.24 9.07 3.11 3.49

MIR-326-P 4.44 2.57 22.99 6.92 5.23 1.47 7.59 2.31

MIR-328 0.92 2.71 7.70 2.68 2.01 1.69 0.00 1.59

MIR-330 0.00 0.00 55.77 1.29 0.00 3.59 5.94 0.00

MIR-331-P 27.83 53.55 30.79 132.00 18.73 21.44 42.89 6.38

MIR-335 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-337 0.00 0.00 3.39 15.66 10.99 0.00 0.00 0.00

MIR-338 0.00 0.00 50.94 0.00 3.03 6.46 7.40 12.68

MIR-339 347.06 414.19 800.47 597.76 329.61 584.73 181.97 123.1

MIR-340 284.94 307.41 1266.6 438.59 344.28 300.20 158.72 40.21

MIR-342 12.96 14.62 3.99 6.29 43.73 14.89 11.60 19.13

MIR-345 7.98 17.59 23.62 24.49 13.28 17.78 6.65 1.83

MIR-346 81.49 72.61 108.90 84.95 99.27 102.51 37.66 76.24

MIR-361 3.70 1.97 11.80 7.27 2.45 1.40 11.50 2.31

MIR-367 1.74 1.12 1.00 4.80 2.01 0.00 0.86 0.00

MIR-368 1.69 0.00 28.96 20.45 6.05 6.10 0.00 2.21

MIR-369 0.00 0.00 12.16 9.51 0.00 0.00 0.00 0.00

MIR-370 36.15 58.57 491.75 506.66 64.94 23.06 46.88 6.25

MIR-371 0.00 6.08 11.60 0.00 1.81 1.51 0.00 0.00

MIR-372 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-373 0.00 0.00 0.00 0.00 0.00 0.00 0.86 0.00

MIR-374-P 0.77 0.00 1.07 0.00 0.00 0.00 0.00 0.00

MIR-375 3.00 0.00 2.22 9.49 37.45 0.00 10.75 0.00

MIR-376 0.00 3.08 140.06 109.45 23.68 10.45 0.00 0.00

MIR-377 0.00 0.00 11.68 18.39 7.22 0.00 0.00 0.00

MIR-378 0.90 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-379 31.52 40.21 234.52 291.68 52.29 55.40 23.38 6.76

MIR-380 23.30 0.00 183.03 88.59 39.45 22.94 7.63 0.00

MIR-381 0.00 0.89 0.00 0.00 0.00 0.00 0.00 0.00

MIR-382 5.51 8.48 13.29 32.67 4.18 3.65 8.76 0.00

MIR-383 1.40 0.00 14.22 2.56 1.60 0.00 0.00 0.00

MIR-384 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-422b 0.63 0.86 2.74 0.00 0.80 0.00 0.00 0.00

MIR-423 10.68 10.89 18.99 16.24 10.71 12.92 5.44 0.00

MIR-424 0.00 10.88 0.00 99.02 2.91 0.00 0.00 0.00

Continued

292


MIR-425 18.94 0.00 19.24 13.63 2.66 24.37 9.42 0.00

miRNA Kidney Esophagus Skeletal Muscle

Ovary Pancreas Placenta Prostate

let-7a-1* 2.67 0.67 0.00 2.80 0.00 4.62 0.99

let-7a-2-P 80.30 27.18 6.55 540.35 5.83 1314.62 62.17

let-7a-3* 8.55 3.97 1.68 46.81 2.17 24.25 14.78

let-7b* 16.56 5.99 6.16 88.87 5.85 20.91 8.05

let-7c* 0.00 0.00 0.00 0.77 0.00 0.00 0.00

let-7d* 175.14 30.88 97.64 208.96 20.97 83.62 24.85

let-7e* 4.38 1.85 0.00 8.44 0.75 5.22 1.63

let-7f-1* 0.00 0.00 0.00 3.54 0.88 6.73 2.68

let-7f-2* 0.00 0.00 0.00 0.00 0.00 0.00 0.00

let-7g* 1.64 0.00 2.31 24.85 6.30 90.73 9.94

let-7i* 2.00 1.64 11.79 58.97 16.98 43.95 18.59

MIR-001-1 0.00 45.93 789.78 21.24 0.00 0.00 45.50

MIR-001-2 26.67 97.04 963.41 121.68 26.64 90.52 144.03

MIR-007-1 20.21 15.14 2.83 37.16 9.66 27.09 15.61

MIR-007-2 0.00 0.00 0.00 0.00 0.71 0.00 0.00

MIR-007-3 6.23 8.57 0.00 28.99 931.86 0.00 0.00

MIR-009-1-P 29.37 13.90 13.74 24.83 7.53 17.52 38.68

MIR-009-2-P 63.01 33.59 4.70 111.30 34.36 45.60 45.27

MIR-009-3-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-010a,b 111.32 9.65 0.00 56.68 12.95 22.86 14.37

MIR-015a 15.82 6.11 10.72 38.63 0.00 135.08 5.37

MIR-015b 38.97 97.67 30.79 59.17 11.55 171.58 68.60

MIR-016-1 85.94 37.83 59.40 122.51 44.15 207.44 576.76

MIR-016-2 1.54 5.30 1.94 11.34 2.58 1.01 1.90

MIR-017-P 36.86 23.12 12.74 156.99 16.25 373.29 112.46

MIR-018 1424.95 542.80 455.34 1771.70 807.40 1309.32 363.43

MIR-019a-P 7.23 0.98 0.00 12.87 0.85 11.20 0.00

MIR-019b-1-P 7.59 0.00 0.00 2.08 0.00 23.18 5.09

MIR-019b-2-P 3.96 0.00 0.00 0.00 0.00 14.00 0.00

MIR-020 0.00 0.00 0.00 1.96 0.00 4.28 1.73

MIR-021 6882.19 5295.46 939.05 1427.79 2624.10 1657.19 1548.93

MIR-022-P 39.80 9.22 21.76 366.13 0.00 180.77 2.75

MIR-023a 48.60 44.38 26.09 382.38 10.42 576.04 52.50

MIR-023b-P 119.19 55.78 68.90 887.18 33.19 389.65 80.58

MIR-024-1,2 3505.26 4960.45 3245.22 7158.98 2515.70 8900.50 3574.82

MIR-025 38.56 12.37 55.15 98.13 8.26 120.23 48.30

MIR-026a-1,2 17.93 1.42 0.00 13.17 22.71 18.64 19.16

Continued

293


MIR-026b 10.16 6.82 4.53 3.36 4.16 14.54 4.06

MIR-027a, b 28.23 38.85 32.60 159.45 0.00 302.83 43.74

MIR-028 1.62 5.92 7.65 6.24 0.00 9.87 0.00

MIR-029a,c 28.40 3.33 2.36 71.31 5.48 75.32 8.71

MIR-029b-1,2 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-030a,e 117.16 8.78 8.84 49.69 7.42 499.41 36.98

MIR-030b 259.04 29.58 56.53 190.04 56.20 1130.36 14.15

MIR-030c-1,2 75.33 24.75 21.56 226.18 16.41 74.84 25.15

MIR-030d 79.50 7.22 0.00 77.36 0.00 843.44 25.51

MIR-031-P 15.21 14.42 4.15 17.36 6.93 24.02 17.28

MIR-032 41.50 16.68 38.30 108.15 21.98 40.95 18.73

MIR-033 0.00 0.00 0.00 0.00 0.00 3.48 0.00

MIR-034a 23.68 14.43 18.64 195.36 25.33 40.06 55.96

MIR-034b 0.00 1.57 0.00 0.00 0.00 35.42 0.00

MIR-092-1 13.07 0.00 0.00 7.63 5.88 25.61 0.00

MIR-092-2-P 17.74 0.00 0.00 0.00 0.00 13.39 0.00

MIR-093 40.09 10.70 0.00 34.32 14.57 28.86 13.17

MIR-095 2.95 10.85 14.85 2.88 0.00 0.00 0.00

MIR-096-P 49.49 37.35 50.85 26.64 19.61 16.88 14.93

MIR-098 3333.33 742.35 1343.40 5109.21 741.84 849.31 731.19

MIR-099a 3.03 1.20 0.00 7.02 1.99 4.86 1.59

MIR-099b 421.87 147.96 77.07 715.83 156.68 751.92 177.90

MIR-100 844.01 350.45 93.85 2389.21 70.90 2932.21 451.08

MIR-101-1 1.41 0.00 0.00 0.00 0.00 0.00 0.00

MIR-101-2 43.12 24.34 57.77 60.48 55.53 14.65 16.67

MIR-103-1,2 1304.78 746.74 790.22 1374.23 254.78 858.16 623.04

MIR-105-1,2 1.52 2.68 1.21 10.67 0.00 1.32 6.03

MIR-106a-P 1.11 0.00 0.00 0.00 0.00 1.05 0.00

MIR-106b 291.23 218.75 203.83 625.82 103.98 266.55 187.79

MIR-107 2183.38 1228.07 1078.47 2007.52 376.09 1462.49 763.88

MIR-108 11.87 11.98 7.60 21.02 6.99 47.12 28.87

MIR-122a 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-124a-1,2,3 71.88 8.38 5.50 11.31 0.00 0.00 35.51

MIR-125a 352.13 79.37 34.63 467.62 48.17 469.15 141.71

MIR-125b-1 102.23 47.98 26.20 702.85 29.93 148.68 67.67

MIR-125b-2 16.23 12.02 0.00 60.55 0.00 0.00 4.15

MIR-126 758.40 466.62 249.11 573.94 171.26 4231.07 429.80

MIR-127 78.63 111.59 49.85 52.50 46.12 157.32 46.62

MIR-128a 98.57 29.06 19.12 87.45 45.76 67.14 33.08

MIR-128b 0.00 16.50 1.85 5.13 0.00 12.65 1.11

MIR-129-2 10.39 8.45 0.00 4.80 7.84 5.67 2.64

Continued

294


MIR-130a-P 1.80 6.01 202.06 37.35 14.08 22.04 9.98

MIR-130b 1.86 1.10 1279.11 0.00 14.15 0.72 0.79

MIR-132 4.01 16.34 0.00 18.33 11.16 8.49 21.54

MIR-133a-1,2 17.13 11.08 0.00 13.69 19.75 34.01 20.07

MIR-133b 12.90 7.00 44.97 0.00 0.00 0.00 22.65

MIR-134 3.34 3.76 20.43 66.74 19.88 116.51 4.08

MIR-135a-1,2 17.58 10.94 14.56 630.15 34.48 21.64 26.10

MIR-135b-P 40.19 0.00 397.07 6.65 0.00 39.79 0.00

MIR-136 13.82 14.83 36.01 44.08 23.67 371.97 4.95

MIR-137* 0.00 0.00 0.00 0.00 0.00 1.55 0.00

MIR-138-1,2 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-139 33.40 56.28 35.44 14.73 33.24 28.84 22.33

MIR-140 1.53 0.00 0.00 0.00 0.00 0.00 0.00

MIR-141 13.21 13.94 1.52 0.00 28.03 20.57 4.51

MIR-142-P 1.36 1.27 13.71 22.22 10.31 50.83 0.00

MIR-143 55.43 349.42 5.30 190.18 6.14 65.88 121.08

MIR-144 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-145-P 85.34 256.59 5.41 1441.42 11.90 294.34 99.01

MIR-146 0.00 1.45 0.00 1.67 0.00 1.02 0.00

MIR-147 12.85 1.11 9.70 7.87 0.00 18.02 12.14

MIR-148a-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-148b-P 25.24 2.86 7.37 65.17 4.88 53.62 19.77

MIR-149 13.39 54.49 22.18 40.42 15.19 165.32 113.17

MIR-150 3.63 11.30 3.26 13.69 2.11 7.11 2.03

MIR-151 9.79 11.32 1.83 0.00 1.18 2.54 17.07

MIR-152 80.91 41.82 48.18 83.55 31.52 40.20 74.14

MIR-153-1,2 0.00 0.00 0.00 3.70 2.30 9.09 12.08

MIR-154 13.20 13.09 16.93 28.52 37.10 76.59 13.13

MIR-155 63.11 55.89 19.17 104.65 22.00 14.08 56.92

MIR-181a,c 93.44 18.78 20.71 87.43 31.46 64.89 60.17

MIR-181b-1,2 0.00 0.00 0.00 0.00 0.00 1.61 0.00

MIR-182 139.76 96.09 548.20 11.64 123.54 22.62 71.04

MIR-183 5.37 3.40 1.71 0.00 4.84 0.00 6.09

MIR-184 4.88 5.39 0.91 3.35 15.65 2.59 3.38

MIR-185 42.62 42.39 19.25 25.51 47.78 32.75 18.16

MIR-186-P 175.36 69.91 10.38 431.17 82.93 46.83 198.59

MIR-187 0.00 0.00 0.00 6.13 0.00 0.00 0.00

MIR-188b-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-190 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-191 0.78 0.00 0.00 1.17 0.00 0.00 0.00

MIR-192 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Continued

295


MIR-193 10.29 18.59 36.16 38.48 3.20 10.64 17.26

MIR-194-1,2 0.00 0.68 0.00 0.00 0.00 0.00 0.00

MIR-195-P 5.76 17.92 13.81 10.82 3.39 32.50 9.47

MIR-196a-1 0.92 1.66 0.00 0.00 0.00 0.00 1.25

MIR-196a-2 42.51 0.00 15.89 1.80 0.00 11.23 6.36

MIR-196b 5283.01 27.73 4189.00 2575.39 0.00 569.86 2739.71

MIR-197 73.06 108.13 25.63 99.49 31.03 57.37 24.73

MIR-198 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-199a-1-P 4.80 5.25 4.28 5.74 2.72 5.06 1.40

MIR-199a-2-P 25.76 1.59 4.81 348.71 0.00 57.92 3.87

MIR-199b-P 9.21 19.12 18.63 50.74 19.22 22.97 30.51

MIR-200a-P 142.29 167.16 145.97 222.65 74.56 178.21 148.86

MIR-200b 28.17 9.79 2.65 22.50 17.78 0.00 17.43

MIR-200c 0.00 0.00 0.00 0.00 0.00 0.00 5.02

MIR-203 0.78 90.01 0.00 0.00 0.00 0.00 0.00

MIR-204 65.37 9.14 0.00 8.30 5.15 0.00 0.00

MIR-205 7.10 147.52 0.00 0.00 0.00 28.07 107.83

MIR-206 14.04 113.46 2116.83 0.00 0.00 0.00 29.30

MIR-208 2.52 0.00 175.88 0.00 0.00 9.72 11.94

MIR-210 155.54 352.68 28.66 77.17 45.46 247.18 57.23

MIR-211 12.63 35.83 14.33 10.22 2.61 70.58 16.09

MIR-212 95.24 143.92 106.87 255.19 12.72 58.75 99.06

MIR-213 32.79 15.88 0.00 3.04 5.32 40.04 4.67

MIR-214 2.67 4.41 13.66 12.91 3.41 17.47 6.37

MIR-215 12.17 6.69 4.82 39.82 13.37 26.23 9.89

MIR-216 0.00 1.22 0.00 1.90 15.32 2.48 2.35

MIR-217 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-218-1,2 190.38 159.98 19.42 276.72 32.74 109.51 175.15

MIR-219-1,2 11.72 4.64 1.99 4.41 0.00 7.95 2.78

MIR-220 1.76 5.06 2.20 44.12 0.00 0.00 2.08

MIR-221 22.57 77.05 60.47 230.47 0.70 95.65 58.08

MIR-222-P 10.99 12.91 0.00 62.77 0.00 79.72 17.96

MIR-223 0.00 0.00 0.00 1.15 0.00 4.59 0.00

MIR-224 19.57 32.26 15.73 4.90 17.18 231.43 34.64

MIR-296 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-299-P 9.84 8.23 3.83 1.80 18.76 10.37 8.52

MIR-301 31.24 10.83 0.00 47.99 11.44 32.99 11.66

MIR-302 15.31 4.77 0.00 4.21 0.00 11.11 13.53

MIR-302b 25.22 7.94 0.00 27.78 0.00 4.70 16.07

MIR-302c 1.28 0.00 0.00 0.98 0.89 1.31 0.00

MIR-302d 0.00 1.28 0.00 0.00 0.00 0.00 0.00

Continued

296


MIR-320 6.42 9.47 3.11 21.59 6.26 23.10 8.75

MIR-321 4550.20 6835.94 1854.20 2747.62 1464.55 4763.74 24202.07

MIR-323 9.88 3.73 11.18 15.81 35.17 104.00 5.94

MIR-324-P 21.74 17.81 29.72 32.27 18.16 74.18 21.36

MIR-325 0.00 3.05 3.17 5.30 0.00 1.12 0.00

MIR-326-P 2.07 0.89 1.31 5.68 2.17 17.71 5.04

MIR-328 2.49 8.93 0.00 6.26 42.26 2.48 2.02

MIR-330 15.20 2.73 9.94 4.64 6.24 12.76 4.78

MIR-331-P 65.64 36.27 66.82 123.87 0.00 92.79 52.04

MIR-335 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-337 0.00 0.00 0.00 0.00 1.52 31.84 0.00

MIR-338 0.00 0.00 2.47 0.92 0.00 0.00 4.40

MIR-339 284.65 361.44 353.05 616.01 352.49 266.35 452.05

MIR-340 301.38 225.23 199.98 633.11 154.87 145.67 279.34

MIR-342 12.51 13.47 0.00 35.49 17.36 18.67 6.35

MIR-345 11.87 12.13 8.49 18.93 15.16 15.08 7.10

MIR-346 64.53 100.82 96.58 100.12 76.30 69.58 87.84

MIR-361 8.42 3.92 7.40 33.86 2.65 16.99 2.33

MIR-367 0.00 0.92 0.00 1.00 0.91 0.00 0.71

MIR-368 2.39 1.37 0.00 4.35 9.77 54.22 0.00

MIR-369 0.00 0.00 0.00 6.69 8.82 24.90 0.00

MIR-370 17.47 41.69 44.11 277.54 123.46 813.43 129.97

MIR-371 5.60 4.37 0.00 1.99 1.67 0.00 0.00

MIR-372 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-373 0.00 0.00 0.00 0.00 0.00 0.00 1.56

MIR-374-P 0.00 0.00 0.00 0.00 0.00 0.00 1.88

MIR-375 0.00 19.72 1.08 0.00 42.33 0.00 2.68

MIR-376 4.45 3.72 0.00 32.03 26.12 295.93 5.65

MIR-377 10.69 4.28 0.00 13.93 10.84 117.97 16.92

MIR-378 0.00 0.00 1.17 0.00 0.00 0.00 0.00

MIR-379 35.74 24.57 22.77 196.88 164.84 406.09 27.64

MIR-380 9.10 11.44 0.00 76.74 28.55 192.46 12.91

MIR-381 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-382 2.94 0.00 0.00 4.41 0.00 41.93 0.00

MIR-383 0.00 1.77 0.00 2.52 0.00 0.00 2.90

MIR-384 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-422b 0.00 1.38 0.00 0.00 1.48 0.00 0.00

MIR-423 27.54 10.66 3.43 6.96 1.83 13.64 7.97

MIR-424 15.37 0.00 30.63 55.54 0.00 44.63 0.00

MIR-425 9.72 15.61 7.35 14.28 8.43 13.93 0.00

Continued

297


miRNA Spleen Small

Intestine Trachea Thymus Thyroid Testes

Normal B cell

let-7a-1* 3.76 2.02 4.22 1.03 1.54 1.98 5.58

let-7a-2-P 26.98 15.13 143.89 122.84 68.63 103.55 13.63

let-7a-3* 15.99 8.80 42.01 6.10 5.28 9.11 9.56

let-7b* 8.56 5.37 30.85 6.55 6.52 24.05 9.11

let-7c* 0.00 0.00 0.00 0.00 0.00 0.00 0.00

let-7d* 41.06 15.57 70.48 47.31 74.16 98.78 118.02

let-7e* 0.66 0.00 0.75 0.92 1.10 2.40 0.00

let-7f-1* 4.18 0.00 0.00 0.00 0.00 0.89 10.06

let-7f-2* 0.00 0.00 0.00 0.00 0.00 0.00 1.31

let-7g* 24.78 1.36 0.00 4.44 1.62 7.14 106.34

let-7i* 51.62 1.67 4.43 11.52 19.86 16.06 118.28

MIR-001-1 0.00 4.67 14.73 0.00 22.62 24.42 0.00

MIR-001-2 121.34 87.09 211.46 163.23 105.04 140.26 124.30

MIR-007-1 62.90 44.46 57.11 42.30 33.41 31.67 879.06

MIR-007-2 0.00 0.00 1.25 1.20 0.72 0.00 0.96

MIR-007-3 4.90 116.63 2.41 13.43 0.00 1071.3 10.99

MIR-009-1-P 32.98 17.31 38.14 12.39 20.91 33.38 68.53

MIR-009-2-P 32.40 61.84 46.46 44.75 11.89 57.90 68.33

MIR-009-3-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-010a,b 29.48 48.88 12.89 12.43 7.35 44.76 7.17

MIR-015a 187.92 28.53 82.41 17.29 11.00 19.21 576.46

MIR-015b 269.72 47.19 109.93 331.21 43.99 156.56 450.15

MIR-016-1 494.76 107.08 184.33 578.36 34.30 179.48 745.52

MIR-016-2 7.13 48.31 20.17 79.11 4.39 24.40 27.50

MIR-017-P 371.57 33.60 176.83 43.16 33.52 42.23 975.57

MIR-018 2315.1 1424.52 972.14 2457.57 408.89 1534.5 4032.20

MIR-019a-P 24.24 4.00 5.49 1.61 0.93 2.81 80.23

MIR-019b-1-P 19.08 0.00 3.84 0.00 4.52 10.31 77.38

MIR-019b-2-P 0.00 0.00 0.00 0.00 0.00 0.74 5.05

MIR-020 0.00 0.00 4.01 0.00 4.56 0.00 24.15

MIR-021 4264.4 5613.86 3144.56 1882.57 764.66 2173.4 709.24

MIR-022-P 174.22 95.63 267.69 18.31 5.42 24.09 736.45

MIR-023a 132.66 112.12 258.68 40.60 50.93 46.03 352.13

MIR-023b-P 189.68 72.98 317.74 20.83 36.97 47.51 51.81

MIR-024-1,2 2610.1 3192.14 4313.32 1471.94 1017.73 1579.6 894.92

MIR-025 114.28 58.79 64.42 91.20 35.45 74.46 170.41

MIR-026a-1,2 20.65 28.55 36.90 19.21 10.46 33.74 2.61

MIR-026b 15.21 18.21 5.94 5.12 15.10 2.35 12.25

MIR-027a, b 109.63 21.79 125.60 17.08 11.24 41.09 314.92

Continued

298


MIR-028 1.29 9.70 7.20 3.25 0.00 1.28 29.30

MIR-029a,c 77.39 16.40 56.27 32.23 8.54 44.52 178.18

MIR-029b-1,2 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-030a,e 51.39 10.42 52.14 27.41 28.25 22.19 44.61

MIR-030b 230.63 153.23 204.49 94.47 35.04 155.84 35.93

MIR-030c-1,2 295.80 92.35 76.67 54.82 0.00 40.00 220.32

MIR-030d 114.20 16.05 123.63 0.00 16.23 19.93 66.64

MIR-031-P 22.82 38.43 83.25 16.58 6.32 34.47 56.06

MIR-032 108.94 83.47 48.01 31.77 51.41 141.25 69.72

MIR-033 0.00 0.00 4.40 0.00 0.00 0.00 70.27

MIR-034a 26.79 24.42 73.96 48.13 21.61 128.14 6.50

MIR-034b 0.00 0.00 13.40 1.54 0.00 20.13 0.00

MIR-092-1 12.85 0.00 3.09 0.00 6.49 5.50 154.46

MIR-092-2-P 35.84 0.00 6.09 0.00 0.00 0.00 0.00

MIR-093 38.33 19.47 26.04 108.38 13.60 53.36 77.21

MIR-095 13.11 0.00 0.00 0.00 6.33 0.00 15.95

MIR-096-P 27.08 58.54 52.25 18.93 20.00 32.74 58.64

MIR-098 2988.6 1546.78 1759.25 1017.56 817.07 2528.8 1946.42

MIR-099a 2.15 4.33 4.78 2.56 0.62 9.21 0.00

MIR-099b 390.87 20.36 267.57 98.02 121.27 513.83 11.88

MIR-100 74.40 183.60 181.89 516.16 290.00 911.31 0.00

MIR-101-1 0.00 2.14 0.00 0.00 0.00 0.79 8.26

MIR-101-2 83.67 36.37 46.66 12.11 6.35 11.27 27.78

MIR-103-1,2 1736.8 1173.50 911.28 1543.24 388.24 2042.4 988.41

MIR-105-1,2 0.00 4.98 1.01 0.00 1.53 1.40 1.66

MIR-106a-P 0.00 0.84 0.00 0.00 0.00 0.00 0.00

MIR-106b 643.23 365.45 155.34 1217.84 112.89 505.86 374.02

MIR-107 2599.9 1795.67 1130.08 2155.88 595.79 3071.9 1141.60

MIR-108 24.67 22.08 29.42 21.71 23.79 24.28 0.00

MIR-122a 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-124a-1,2,3 48.37 28.91 9.75 0.84 0.79 133.38 2.36

MIR-125a 153.37 43.12 85.41 36.28 94.69 180.34 6.87

MIR-125b-1 34.04 77.81 98.61 65.13 95.08 252.57 10.26

MIR-125b-2 0.00 0.00 0.74 11.66 0.00 13.43 0.00

MIR-126 1919.2 398.62 356.44 391.31 323.62 341.22 20.25

MIR-127 58.85 32.27 81.48 13.06 78.19 46.30 170.98

MIR-128a 283.02 74.01 123.25 41.73 23.87 104.80 395.36

MIR-128b 1.72 0.60 1.90 350.06 5.73 2.24 3.68

MIR-129-2 14.43 7.05 14.11 9.73 29.07 19.58 46.35

MIR-130a-P 27.95 19.33 29.53 6.84 14.95 11.74 1.75

MIR-130b 0.00 12.74 23.73 12.67 12.33 13.76 5.86

Continued

299


MIR-132 14.41 25.06 33.16 10.68 17.16 30.97 24.00

MIR-133a-1,2 17.50 32.24 33.68 10.26 16.37 27.26 188.07

MIR-133b 0.00 18.66 4.56 4.91 0.00 0.00 77.50

MIR-134 61.16 9.98 21.90 5.95 2.86 53.70 96.61

MIR-135a-1,2 55.93 22.03 31.35 55.86 16.96 440.41 199.79

MIR-135b-P 18.35 31.83 85.99 13.60 32.54 13.72 24.45

MIR-136 38.94 17.52 15.16 1.90 0.00 113.15 11.63

MIR-137* 0.00 0.00 0.00 0.00 0.00 1.50 0.00

MIR-138-1,2 9.46 0.00 11.27 0.00 0.00 0.00 0.00

MIR-139 33.06 38.28 45.56 51.89 30.19 30.16 20.55

MIR-140 1.28 0.95 2.06 0.78 0.75 0.83 8.87

MIR-141 0.00 55.91 7.05 8.80 2.98 13.43 52.01

MIR-142-P 272.27 22.74 10.50 13.85 56.46 1.27 1067.31

MIR-143 111.53 86.95 74.34 14.06 14.13 74.32 2.21

MIR-144 0.00 12.48 0.00 0.00 0.00 0.00 13.24

MIR-145-P 542.91 53.48 557.61 19.20 13.76 146.10 2.31

MIR-146 0.98 0.00 2.60 0.00 0.00 0.00 0.00

MIR-147 21.87 11.06 20.47 3.33 11.25 1.28 14.02

MIR-148a-P 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-148b-P 117.13 32.24 73.32 0.00 0.00 29.58 4.96

MIR-149 7.60 14.08 35.69 181.88 4.92 115.10 5.76

MIR-150 69.00 12.71 9.17 104.88 1.28 11.57 86.41

MIR-151 23.13 15.29 5.20 1.19 4.71 14.31 21.16

MIR-152 51.36 27.49 41.70 16.87 53.88 238.29 14.63

MIR-153-1,2 8.37 4.55 9.29 2.09 0.00 21.57 16.16

MIR-154 14.18 13.78 13.18 12.76 0.00 24.64 0.00

MIR-155 571.36 76.52 155.47 387.04 16.45 98.76 162.46

MIR-181a,c 229.72 103.91 55.70 270.13 141.25 87.35 10.32

MIR-181b-1,2 1.90 0.00 1.04 5.51 0.00 11.20 0.00

MIR-182 0.00 61.16 108.60 139.94 8.52 709.30 16.64

MIR-183 2.56 1.64 2.64 1.80 5.40 11.11 0.00

MIR-184 4.20 4.00 2.67 2.02 1.40 54.33 8.18

MIR-185 22.82 46.63 33.84 17.61 29.95 43.50 74.87

MIR-186-P 465.19 192.78 407.65 39.92 37.49 284.16 515.35

MIR-187 0.00 0.00 0.00 0.00 0.00 0.00 2.50

MIR-188b-P 0.00 2.23 0.00 0.00 0.00 0.00 0.00

MIR-190 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-191 2.48 0.00 0.00 0.00 0.00 0.00 15.83

MIR-192 0.00 0.00 2.38 0.00 0.00 0.00 0.00

MIR-193 27.32 14.14 26.48 6.42 22.02 10.41 7.84

MIR-194-1,2 2.19 0.76 0.78 0.92 0.00 1.30 2.65

Continued

300


MIR-195-P 14.76 5.11 25.34 11.35 12.76 8.37 45.97

MIR-196a-1 0.00 0.58 0.00 1.95 0.00 3.02 7.77

MIR-196a-2 9.53 0.00 11.48 0.71 8.02 22.46 0.00

MIR-196b 59.01 18.36 72.26 2968.06 0.00 794.75 12.63

MIR-197 170.72 78.22 65.19 24.08 8.50 95.37 456.62

MIR-198 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-199a-1-P 13.40 4.19 8.59 13.66 3.46 5.24 51.66

MIR-199a-2-P 180.20 26.78 45.31 10.04 3.48 24.68 12.75

MIR-199b-P 26.09 3.93 30.15 13.55 11.06 40.21 44.58

MIR-200a-P 211.03 272.04 374.90 180.80 121.46 279.70 493.96

MIR-200b 1.84 56.75 76.41 8.36 15.43 0.00 6.50

MIR-200c 0.00 10.07 10.45 0.00 9.58 0.00 12.83

MIR-203 8.52 20.82 0.62 1.69 16.64 21.52 0.00

MIR-204 20.22 0.00 12.65 1.88 3.91 13.81 1.70

MIR-205 0.00 0.00 228.76 82.69 0.00 4.25 0.00

MIR-206 0.00 0.00 0.00 43.22 0.00 10.70 0.00

MIR-208 3.30 0.00 1.10 0.00 1.96 0.00 4.33

MIR-210 47.39 99.78 196.22 232.78 22.58 196.01 39.17

MIR-211 18.55 5.24 23.11 30.31 18.01 16.89 54.18

MIR-212 84.07 237.55 288.11 202.56 57.46 280.21 20.46

MIR-213 23.78 20.15 0.00 204.50 0.00 25.67 51.34

MIR-214 5.06 2.70 8.20 13.24 2.52 13.29 14.31

MIR-215 28.37 31.00 22.70 30.58 14.29 34.56 125.74

MIR-216 0.00 0.00 0.00 1.75 1.02 0.00 3.41

MIR-217 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-218-1,2 285.05 85.82 164.76 94.98 45.67 243.56 9.99

MIR-219-1,2 1.61 4.87 8.38 6.10 2.38 5.74 8.92

MIR-220 8.98 3.50 20.11 6.10 2.03 133.63 14.91

MIR-221 52.24 23.83 86.11 34.64 37.60 15.59 115.02

MIR-222-P 28.69 0.00 54.51 20.18 10.99 15.30 32.35

MIR-223 20.20 0.00 3.26 0.00 0.00 0.00 33.32

MIR-224 19.96 59.41 24.60 19.73 6.86 27.13 2.10

MIR-296 11.38 0.00 11.37 11.56 0.69 16.04 3.08

MIR-299-P 7.79 5.04 0.00 9.27 9.65 8.45 52.46

MIR-301 26.16 44.44 20.75 208.64 10.46 34.45 17.26

MIR-302 7.47 7.28 5.80 4.20 14.16 12.79 48.90

MIR-302b 15.67 10.36 10.31 21.27 11.14 10.35 28.78

MIR-302c 1.13 0.00 1.69 0.00 0.00 0.00 4.90

MIR-302d 0.00 0.00 0.00 0.00 0.00 1.62 0.00

MIR-320 9.24 32.28 8.39 10.97 9.42 30.28 5.26

MIR-321 3499.4 1971.63 2990.43 1050.89 1658.58 3033.7 577.39

Continued

301


MIR-323 19.49 5.51 8.25 10.28 3.34 42.48 6.52

MIR-324-P 29.07 68.12 53.56 21.95 51.69 52.45 184.79

MIR-325 0.00 10.03 6.66 47.78 7.18 2.35 0.00

MIR-326-P 22.11 8.00 9.19 1.19 0.00 1.37 0.00

MIR-328 6.81 4.06 8.08 2.19 0.62 7.32 18.43

MIR-330 20.40 16.26 7.47 20.44 6.31 4.95 6.41

MIR-331-P 53.65 9.67 135.36 21.64 103.69 12.88 53.83

MIR-335 0.00 10.09 0.00 0.00 0.00 0.00 2.57

MIR-337 0.00 0.00 0.00 7.00 0.00 4.73 0.00

MIR-338 8.69 10.85 1.26 0.00 1.30 0.00 0.00

MIR-339 412.13 324.99 315.69 238.68 269.71 348.19 405.80

MIR-340 482.21 276.93 445.17 154.46 100.26 488.53 174.58

MIR-342 101.21 38.81 20.73 178.57 0.00 9.98 54.56

MIR-345 7.58 13.57 35.72 10.19 13.19 4.70 38.72

MIR-346 89.10 68.15 103.79 77.76 77.72 60.60 123.37

MIR-361 3.91 5.06 12.24 8.23 6.52 5.91 43.85

MIR-367 3.42 1.07 0.97 1.49 2.16 1.09 6.72

MIR-368 2.79 0.00 1.73 5.49 0.00 14.60 0.00

MIR-369 7.58 0.00 0.00 7.95 2.06 3.57 6.25

MIR-370 198.22 55.97 39.50 23.50 12.07 323.43 0.00

MIR-371 7.05 0.00 0.00 0.00 0.00 11.53 8.21

MIR-372 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-373 14.31 0.00 1.50 0.00 1.25 0.00 2.38

MIR-374-P 0.00 0.00 0.95 0.00 0.86 0.65 2.74

MIR-375 0.00 31.53 17.04 0.00 1.30 34.96 0.00

MIR-376 33.75 0.00 8.22 10.55 5.26 36.88 6.08

MIR-377 8.01 0.00 15.80 0.00 0.00 10.59 0.00

MIR-378 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-379 147.88 25.66 69.91 51.20 0.00 276.33 0.00

MIR-380 43.97 11.61 39.43 30.73 0.00 36.36 0.00

MIR-381 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-382 13.42 0.00 2.88 0.00 0.00 8.88 6.15

MIR-383 0.00 0.00 1.80 2.49 1.52 1.69 1.10

MIR-384 0.00 0.00 0.00 0.00 0.00 0.00 0.00

MIR-422b 0.00 2.02 0.60 0.00 0.82 3.37 0.00

MIR-423 16.38 12.02 9.16 8.49 10.03 11.99 32.23

MIR-424 8.90 0.00 0.00 16.17 0.00 59.19 0.00

MIR-425 24.30 15.85 21.78 9.17 0.00 95.41 314.06

302

miRNA Adipose Bladder Brain Cervix Colon Heart Lung Liver

hsa-let-7a 10613.6 13363.8 11789.5 19063.4 7767.6 8369.8 11502.0 3382.1

hsa-let-7b 53686.2 58352.8 41012.0 98751.3 24511.0 16205.2 46432.0 11378.6

hsa-let-7c 15171.5 24047.5 18520.0 59273.5 4039.5 9002.8 8229.3 5076.9

hsa-let-7d 463.0 1577.2 1288.6 1405.7 868.4 1002.0 1286.1 269.1

hsa-let-7e 177.4 870.9 837.0 799.3 445.3 387.1 424.4 98.8

mmu-let-7f 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-let-7g 14248.8 27606.9 18884.3 28180.2 14598.9 12733.3 15906.0 5263.4

hsa-let-7i 1833.3 3157.4 1586.6 3235.7 1367.8 1307.6 1755.2 306.8

hsa-miR-001 9109.7 63472.5 1325.4 17524.0 19352.9 329801.5 1615.6 110.5

hsa-miR-007 148.0 358.4 6796.9 258.3 1548.2 185.4 251.4 24.9

hsa-miR-009 447.3 1362.2 259711.7 5183.9 1958.8 734.3 287.3 100.6

hsa-miR-009* 175.8 347.5 59637.3 1009.5 467.1 141.6 53.7 32.0

hsa-miR-010a 3456.7 2843.5 178.8 7577.7 9972.8 846.7 4004.1 1117.6

hsa-miR-010b 1955.6 2675.7 1.6 5923.1 3506.6 439.6 655.5 84.6

hsa-miR-015a 1469.0 2809.8 2106.9 1700.8 1911.6 1290.5 2697.0 592.9

hsa-miR-015b 7599.0 13804.4 4762.4 10478.2 10013.2 7506.7 16577.5 3021.3

hsa-miR-016 23401.5 45700.8 22086.4 33104.2 23722.6 19664.9 34670.9 4660.6

hsa-miR-017-3p 75.3 249.2 103.2 161.9 129.7 57.9 71.1 33.1

hsa-miR-017-5p 907.5 2031.1 1124.0 1920.1 3358.2 1453.4 1701.9 1352.3

hsa-miR-018 59.6 148.6 63.7 88.5 263.0 77.7 172.4 83.3

hsa-miR-019a 4266.5 12744.0 5282.6 11758.0 18071.8 6834.0 10696.8 7416.0

hsa-miR-019b 31714.8 85010.3 33748.2 72824.1 92091.2 38935.5 64131.5 43563.2

hsa-miR-020 39732.0 95865.6 39963.5 67326.7 92793.7 41833.1 67678.4 41971.9

hsa-miR-021 26741.7 64947.7 4647.8 41063.0 55004.4 14811.2 72170.0 10514.9

hsa-miR-022 2932.6 3534.5 1178.6 2001.7 1482.6 4687.4 1309.6 1090.6

hsa-miR-023a 504.8 969.0 124.3 796.6 458.8 720.5 562.6 65.3

hsa-miR-023b 745.7 8038.1 3460.0 7083.1 4230.6 6009.6 3244.9 2064.0

hsa-miR-023bN 12333.9 61401.4 20958.3 52388.3 26920.6 96699.1 15497.5 17540.4

hsa-miR-024 120059.2 415038.3 87669.7 377404.3 205009.3 406258.4 229790.8 68404.9

hsa-miR-025 3006.7 4079.1 2281.9 4470.8 2686.5 1822.5 3062.5 1185.3

hsa-miR-026aN 129641.3 252327.8 142130.1 346478.5 130102.6 126069.0 142534.4 35995.3

hsa-miR-026b 47027.8 92977.3 26848.6 92781.3 37773.2 46607.2 46037.5 21980.7

hsa-miR-026bN 35087.9 68284.4 20878.7 68247.7 28734.4 31876.8 34435.5 15203.7

hsa-miR-027a 25238.1 43315.8 3762.6 39226.1 25347.8 28601.6 23923.0 3136.4

hsa-miR-027b 3825.6 27048.3 6982.0 17730.8 10084.8 16640.2 5480.0 3537.9

hsa-miR-027bN 40027.2 203039.0 69936.8 163833.7 82223.1 122599.9 63230.6 40280.4

hsa-miR-028 5384.3 18487.0 1583.6 11186.5 10903.8 6515.5 4118.1 2529.9

hsa-miR-029a 12067.4 40038.3 20879.1 46124.3 19275.5 19710.3 22755.2 6667.7

hsa-miR-029b 155.8 912.4 704.7 705.0 712.5 682.7 768.8 235.2

hsa-miR-029c 3901.0 13766.6 5738.9 10038.4 12226.1 11286.7 10195.7 2282.9

hsa-miR-030a-3p 11168.8 13205.0 8839.6 8944.4 5340.5 16837.6 13483.9 3227.8

hsa-miR-030c 54329.4 96796.9 71410.0 82185.6 53298.5 182162.9 66838.1 35011.5

Continued

Table C.4. Mature microRNA expression in 22 different normal human tissues and

cells. All data was generated using real-time PCR and TaqMan microRNA assays

(Applied Biosystems). Data is presented as copies of microRNA per cell.

303


hsa-miR-030d 8337.8 15915.5 5934.4 11902.9 8795.8 19264.4 18899.8 4098.8

hsa-miR-030e-3p 2010.1 4862.3 3418.0 4468.2 3215.0 11594.2 2399.2 2989.7

hsa-miR-031 2073.0 13163.9 5489.7 14518.5 24363.7 257.6 3025.4 155.3

hsa-miR-032 984.4 2165.0 1389.1 1764.9 1608.9 1899.1 2047.1 1062.9

hsa-miR-033 0.0 0.0 8.0 23.7 0.0 0.0 20.0 8.4

hsa-miR-034a 65.1 420.7 262.5 448.2 114.5 194.0 637.5 143.0

hsa-miR-034aN 1677.3 5991.5 2872.9 5505.9 1953.6 2572.7 5635.5 1573.6

hsa-miR-034b 5.7 13.6 31.2 72.6 8.6 0.0 785.5 0.0

hsa-miR-034b 0.0 15.8 39.0 26.3 33.3 9.9 829.7 0.0

hsa-miR-092N 19228.1 32751.1 25649.4 35311.3 30903.8 24967.7 23609.6 21977.0

hsa-miR-093 15068.3 34559.4 18272.4 17943.1 27656.5 12782.2 23722.9 7257.9

hsa-miR-095 1564.2 1542.3 6938.8 1222.8 1460.5 2261.2 1063.6 272.2

hsa-miR-096 468517.2 639331.1 782408.6 481715.0 389223.7 515124.3 378240.7 390082.2

hsa-miR-098 613.1 923.3 2036.6 870.1 563.3 642.2 708.8 198.2

hsa-miR-099a 15038.0 51060.1 44826.2 87244.3 12820.7 22632.7 16840.6 6074.1

hsa-miR-099b 3098.7 7570.8 9293.8 9091.4 3670.2 6916.7 4356.8 568.6

hsa-miR-100 10345.8 32294.3 27832.9 50040.3 8073.8 13291.2 11666.9 4477.4

hsa-miR-101 80.4 498.8 81.7 672.6 251.4 273.8 455.6 181.4

hsa-miR-103 3061.9 4921.9 9048.6 5119.5 3163.5 3186.7 4475.3 1760.1

hsa-miR-105 641.3 1024.4 759.3 1125.1 799.4 546.9 656.3 564.2

hsa-miR-106a 45983.6 94030.2 105822.5 58176.8 38763.9 66565.9 59599.1 67641.6

hsa-miR-106b 2435.1 7617.3 2762.7 5292.2 6471.7 2673.9 4415.2 1362.8

hsa-miR-107 5.4 23.9 108.4 0.0 29.8 51.3 9.7 34.0

hsa-miR-108 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-122a 1.5 0.0 0.0 1.7 1.8 0.0 0.0 4135.6

hsa-miR-124a 0.0 0.0 4859.2 0.0 0.0 0.0 0.0 0.0

hsa-miR-125a 50192.1 93609.2 90938.5 126526.5 44090.2 66642.5 59930.1 10285.3

hsa-miR-125b 47325.8 109389.7 124707.2 212464.6 27670.1 57528.3 26785.3 11550.6

hsa-miR-126 217325.4 279589.6 91681.9 248430.4 123410.2 278539.3 445485.7 75287.0

hsa-miR-126* 19034.3 32416.8 9665.8 33397.8 15968.7 32268.2 43612.7 8614.8

hsa-miR-127 1251.4 4901.2 24597.2 19442.5 3838.5 3788.0 2517.6 1124.4

hsa-miR-128a 0.0 0.0 112.5 8.5 0.0 0.0 0.0 0.0

mmu-miR-129-2 0.0 3.6 119.5 0.0 0.0 0.0 0.0 0.0

hsa-miR-130a 226.4 2195.3 711.7 5060.9 1695.2 1792.5 2534.8 607.2

hsa-miR-130aN 3544.7 13294.9 3116.4 26032.9 6835.0 6236.2 13324.3 2273.4

hsa-miR-130b 18.2 82.4 78.1 123.2 119.1 102.5 93.9 159.3

hsa-miR-132 2478.2 9980.9 48090.7 7490.7 7211.4 6003.6 5579.4 825.3

hsa-miR-133a 894.8 9360.7 259.4 2386.2 3162.2 84221.7 242.3 29.4

hsa-miR-134 184.8 448.8 1803.0 1501.0 295.9 211.8 216.4 131.8

hsa-miR-135a 28.5 1134.0 4844.5 2949.6 764.9 638.7 657.1 18.1

hsa-miR-135b 285.6 682.6 681.7 2933.3 1367.2 146.5 5183.0 165.1

mmu-miR-137 0.0 45.2 3798.6 93.5 107.7 18.6 10.6 0.0

hsa-miR-139 598.4 557.2 1700.1 364.6 255.7 288.7 121.9 129.4

hsa-miR-140 12329.2 26575.0 15428.3 36322.4 15781.1 18077.5 22344.8 4913.8

hsa-miR-141 140.5 993.3 7.6 1517.9 5994.4 0.0 3630.2 33.1

hsa-miR-142-3p 3258.8 18481.3 3017.4 12062.2 30539.7 6799.8 53195.0 7053.9

Continued

304


hsa-miR-142-5p 337.0 2397.5 513.7 1605.4 2077.5 852.7 5154.0 947.6

hsa-miR-143 796.5 34165.5 411.2 15192.9 15694.5 2589.7 2430.7 367.9

hsa-miR-145 2395.0 30948.1 991.1 19029.5 16320.9 6585.8 2870.3 605.9

hsa-miR-146 14186.4 14772.1 6301.9 13472.5 19605.1 7012.8 26077.3 5830.6

hsa-miR-146b 13234.0 22446.6 9139.1 12031.0 21328.1 14911.7 93709.4 16764.5

hsa-miR-147 1.4 2.9 3.5 4.3 5.0 1.4 3.7 3.0

hsa-miR-148a 1337.0 5520.8 518.6 12745.5 8256.2 3829.5 6607.8 17951.9

hsa-miR-148b 292.7 1520.6 1279.1 1381.7 965.1 969.6 1347.7 567.3

hsa-miR-149 741.5 2623.2 35807.8 5439.7 1646.5 3171.8 719.2 186.5

hsa-miR-150 59978.4 48226.4 10449.2 49111.8 55927.0 26178.5 67589.9 4750.5

hsa-miR-152 10710.5 16574.7 3196.3 21839.2 7491.9 11178.7 5510.0 3199.8

hsa-miR-152N 7113.8 12652.8 2671.9 13593.6 6786.2 9783.6 4485.2 2768.0

hsa-miR-153 7.0 17.9 311.8 6.2 23.4 7.7 0.0 0.0

hsa-miR-154 0.0 0.0 2.9 7.3 0.0 0.0 0.0 0.0

hsa-miR-154* 0.0 0.0 119.4 42.4 15.5 0.0 0.0 11.0

hsa-miR-155 2127.3 3234.0 1011.6 2726.7 5350.1 1647.3 8906.0 413.7

hsa-miR-181a 907.5 1008.2 17247.3 2207.4 1365.9 1734.9 4932.3 206.7

hsa-miR-181b 2516.9 2808.2 55383.1 3941.3 3022.0 3878.3 8753.6 664.4

hsa-miR-181c 67.1 158.9 1172.6 286.2 158.5 140.9 292.7 22.4

hsa-miR-182 3.6 11.9 14.6 51.5 16.7 8.4 0.0 4.4

hsa-miR-183 47.8 69.7 17.3 103.2 98.9 6.0 184.8 1.8

hsa-miR-184 12.2 50.3 312.8 339.6 30.6 60.4 517.1 0.0

hsa-miR-186 6979.8 14940.1 5488.1 12654.6 8355.5 10295.0 7731.1 3003.7

hsa-miR-187 25.6 1229.3 205.1 1102.2 269.8 134.8 224.0 13.2

hsa-miR-188b 80.8 121.6 74.6 138.8 60.8 46.0 129.7 67.0

hsa-miR-190 180.1 253.9 345.8 361.1 208.7 291.7 64.8 15.5

hsa-miR-191 18254.3 30003.3 30378.0 31012.1 21922.1 16138.0 23827.8 7258.0

hsa-miR-192 875.1 3543.3 1810.0 2619.0 244571.9 933.8 2124.9 62253.7

hsa-miR-193 884.6 1500.6 199.6 1081.9 709.2 612.6 464.6 418.9

hsa-miR-194 199.0 932.0 669.5 961.3 94041.3 446.3 742.4 27056.9

hsa-miR-195 49023.9 92401.5 20025.7 128740.6 43277.1 29919.6 36915.9 6221.7

hsa-miR-196a 4767.5 1834.0 0.0 3141.2 2392.3 2.2 10.4 0.0

hsa-miR-196b 313.3 2195.7 0.0 14603.8 2739.1 0.0 0.0 0.0

hsa-miR-197 4561.6 7734.1 13720.7 11449.0 4787.0 14952.1 5190.7 1622.4

hsa-miR-199a 189.0 331.5 27.6 502.5 153.2 91.2 110.6 20.3

hsa-miR-199a* 15167.1 28938.3 507.1 44754.8 12253.4 9120.7 10163.9 2151.8

hsa-miR-199b 201.6 289.3 10.9 572.6 72.2 41.9 157.9 11.4

hsa-miR-199-s 810.2 2325.5 13.5 2946.8 1060.6 589.0 701.0 258.1

hsa-miR-200a 853.0 3753.7 284.4 7563.1 25830.3 14.9 6584.2 911.0

hsa-miR-200b 1077.4 2117.7 119.3 7187.6 41428.6 7.7 4732.8 691.4

hsa-miR-200bN 1847.4 5569.1 358.3 10300.1 34706.6 9.8 6904.3 1060.1

hsa-miR-200c 15013.1 21230.7 210.1 38007.7 88045.1 106.6 56393.3 595.5

hsa-miR-200cN 8158.9 12275.5 76.7 24293.0 74780.9 17.8 40231.9 246.4

hsa-miR-203 9762.5 3695.6 1911.0 19958.2 8302.2 448.1 9223.2 884.5

hsa-miR-204 2878.6 7813.0 21112.5 11857.7 1233.6 1945.0 628.0 964.5

hsa-miR-205 4460.3 4632.7 14.8 8029.1 3.1 0.0 1187.9 0.0

Continued

305


hsa-miR-206 3763.6 4413.2 31.2 192.2 95.2 16.0 9.2 2.6

hsa-miR-208 0.0 0.0 0.0 9.4 0.0 80.7 0.0 0.0

hsa-miR-210 225.1 1285.8 551.0 963.5 1275.1 1755.3 1375.8 485.2

hsa-miR-210N 929.6 3261.5 1640.9 2903.1 3385.0 4306.0 3653.1 1416.9

hsa-miR-211 130.6 9.0 856.2 477.4 7.0 3.6 8.4 11.0

hsa-miR-212 1185.6 1823.5 3837.4 1208.4 960.1 1221.4 1206.9 305.3

hsa-miR-213 9.2 15.7 468.9 20.6 37.7 47.8 69.7 2.8

hsa-miR-214 23094.4 43803.0 640.2 54476.8 19565.1 13524.7 12215.7 3942.7

hsa-miR-215 159.3 125.7 4.4 10.8 42464.7 18.2 4.0 85.7

hsa-miR-216 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-217 0.0 7.2 3.7 0.0 0.0 0.0 0.0 0.0

hsa-miR-218 4346.8 16850.1 22899.5 25310.3 5397.8 5478.5 11158.6 424.5

hsa-miR-219 0.0 0.0 272.2 0.0 0.0 0.0 0.0 0.0

hsa-miR-220 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-221 2923.7 10950.7 15420.3 5815.5 2840.5 11868.7 3330.3 347.3

hsa-miR-222 10729.8 36594.8 47049.5 31550.2 12310.6 23973.3 16077.2 1229.9

hsa-miR-223 44405.6 103591.4 35812.0 77032.5 91189.0 61790.4 368144.1 35692.1

mmu-miR-224 198.6 52.9 0.0 99.8 13.4 99.0 44.0 9.5

hsa-miR-296 302.0 825.8 422.3 1137.2 386.7 767.8 356.2 95.0

hsa-miR-299 0.0 0.0 0.0 7.7 0.0 0.0 0.0 0.0

hsa-miR-301 36.2 390.3 329.8 365.7 347.3 395.1 456.6 48.6

hsa-miR-302a 0.0 0.0 23.6 0.0 0.0 302.1 0.0 0.0

hsa-miR-302a* 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302b 14.5 607.7 713.5 554.9 1808.2 1899.7 1218.9 875.2

hsa-miR-302c 0.0 0.0 39.9 0.0 0.0 277.1 0.0 0.0

hsa-miR-302c* 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302d 0.0 2.9 29.1 5.2 2.0 1073.7 1.7 0.0

hsa-miR-320 11807.7 22151.8 9290.0 25780.9 13686.5 11110.1 5840.9 6033.3

hsa-miR-321 26330.9 70277.0 58569.1 41675.5 47108.8 41927.6 42983.2 44266.8

hsa-miR-323 4.9 4.3 4197.3 20.8 26.0 3.4 4.0 0.0

hsa-miR-324-3p 923.1 6344.4 6447.7 5612.4 3059.5 2398.5 3304.4 713.4

hsa-miR-324-5p 777.9 2767.0 5829.1 2047.6 1620.5 1522.6 1626.2 500.3

hsa-miR-325 5.2 5.6 9.8 1.8 7.3 16.4 4.8 2.8

hsa-miR-326 7.1 19.0 71.2 8.8 19.2 7.5 39.7 3.4

hsa-miR-328 4159.3 7195.1 31722.8 7872.9 2438.4 5631.1 3472.1 1121.2

hsa-miR-330 49.8 150.4 1879.9 75.1 69.9 55.8 83.9 11.0

hsa-miR-331 6533.2 19854.1 22978.2 12182.3 9275.6 12259.5 10546.8 3279.8

hsa-miR-335 4309.0 3070.6 3439.4 2706.9 1838.2 1414.7 3160.1 676.8

hsa-miR-337 0.0 0.0 11.3 0.0 0.0 3.5 0.0 0.0

hsa-miR-338 1.6 18.5 384.8 15.1 92.7 23.1 68.7 10.9

hsa-miR-339 98.9 163.6 88.4 160.9 118.8 55.0 134.1 15.9

hsa-miR-340 437.8 499.0 2348.8 406.4 299.1 524.7 423.2 285.7

hsa-miR-342 3234.3 9529.3 33471.6 9353.6 8580.5 6893.3 17643.4 3869.9

hsa-miR-345 2255.5 2682.4 2340.2 3443.6 1819.1 2049.9 2116.6 1055.3

hsa-miR-346 26.5 22.4 1509.1 68.0 21.8 34.1 31.4 4.7

hsa-miR-361 1213.2 2362.1 2507.0 3358.8 1366.4 1495.7 1108.2 412.4

Continued

306


hsa-miR-367 0.0 0.0 0.0 0.0 0.0 186.9 0.0 0.0

hsa-miR-368 0.0 0.0 0.0 20.2 0.0 8.2 0.0 0.0

hsa-miR-369 0.0 0.0 26.4 10.4 3.5 0.0 0.0 0.0

hsa-miR-370 279.6 551.7 6234.0 1451.8 429.6 205.4 262.4 183.5

hsa-miR-371 0.0 18.4 1.9 0.0 2.3 1.7 0.0 0.0

hsa-miR-372 5.8 13.3 7.9 8.7 0.0 13.1 9.1 7.9

hsa-miR-373 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-374 5440.2 20949.5 9032.8 20420.9 13029.0 12010.1 12554.7 5028.7

hsa-miR-375 487.3 1796.3 369.3 5491.6 26234.0 7.4 10114.3 2866.0

hsa-miR-376a 213.6 506.5 1163.4 1518.3 315.7 380.2 270.6 147.6

hsa-miR-377 0.0 4.8 7.0 7.9 2.4 4.2 0.0 0.0

hsa-miR-378 852.5 1099.9 129.9 319.1 958.6 2385.2 224.6 361.2

hsa-miR-379 216.9 286.4 1851.7 1220.9 205.8 201.8 121.1 90.6

hsa-miR-380-3p 0.0 0.0 3.8 1.5 0.0 0.0 0.0 0.0

hsa-miR-380-5p 0.0 28.2 50.7 15.1 13.2 0.0 0.0 0.0

hsa-miR-381 8.9 50.6 56.0 54.8 14.2 42.1 7.0 14.8

hsa-miR-382 458.2 723.6 4505.6 1447.3 360.3 445.8 377.6 112.6

hsa-miR-383 66.3 247.7 3430.7 67.3 250.3 0.0 0.0 43.5

hsa-miR-384 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-422b 580.4 1011.3 90.5 355.9 898.9 1149.4 178.2 334.2

hsa-miR-423 455.0 1353.7 1478.0 1907.0 1185.0 1320.1 1488.0 595.0

mmu-miR-424 0.0 0.0 0.0 1.7 0.0 0.0 0.0 0.0

hsa-miR-425 552.8 1149.0 1480.2 1071.3 719.5 574.5 786.9 305.8

miRNA Kidney Esophagus Skeletal Muscle Ovary Pancreas Placenta Prostate

hsa-let-7a 10077.2 10852.6 13532.3 25797.4 6375.2 6828.2 11414.2

hsa-let-7b 29151.7 35202.0 22384.8 112522.3 37467.0 9083.4 55437.8

hsa-let-7c 8611.3 8797.4 5552.5 42372.6 3276.7 1701.0 39946.0

hsa-let-7d 659.4 1055.9 1223.3 1118.9 293.9 344.8 1087.9

hsa-let-7e 486.1 500.3 195.5 943.8 124.0 486.7 545.6

mmu-let-7f 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-let-7g 13697.7 15929.7 15021.4 24498.5 6535.3 5644.2 18961.1

hsa-let-7i 1200.0 1604.7 1377.8 2466.0 447.0 764.6 2028.6

hsa-miR-001 809.4 67661.9 1279818.8 10321.6 591.6 1580.3 40853.4

hsa-miR-007 197.0 303.1 89.9 115.1 6013.2 438.4 242.0

hsa-miR-009 1914.8 1596.0 450.7 3437.1 443.7 573.4 1950.2

hsa-miR-009* 439.0 450.5 126.7 654.0 114.0 172.1 521.1

hsa-miR-010a 14974.1 5618.0 1356.9 5150.6 2578.0 776.7 2557.9

hsa-miR-010b 12669.9 1550.7 2195.8 12014.8 346.2 217.8 2358.1

hsa-miR-015a 1268.6 1836.0 2542.1 1548.0 662.8 2343.7 1893.9

hsa-miR-015b 7402.6 9439.1 6141.3 13089.9 3486.1 15774.0 7981.5

hsa-miR-016 15483.3 28366.5 30877.0 34598.9 5415.0 35495.9 37301.7

hsa-miR-017-3p 97.5 126.1 59.3 237.2 40.1 76.1 149.8

hsa-miR-017-5p 2007.9 1770.9 1125.5 1708.2 470.7 2618.5 1776.5

hsa-miR-018 48.7 137.9 39.9 60.9 60.0 222.4 72.4

Continued

307


hsa-miR-019a 9996.6 11367.2 6829.4 10807.9 5883.2 10765.5 10843.4

hsa-miR-019b 53795.0 66636.8 42202.9 73471.4 31443.4 66866.9 73188.9

hsa-miR-020 64255.4 85026.6 49096.9 78862.7 23741.2 77963.5 63874.3

hsa-miR-021 34629.9 48966.0 12954.5 36211.3 14739.6 43467.8 67656.1

hsa-miR-022 1529.2 1887.2 7995.9 1424.4 464.5 3404.3 2888.2

hsa-miR-023a 432.3 688.4 638.2 560.9 85.8 1322.3 631.5

hsa-miR-023b 3969.9 6327.8 2751.7 5491.9 1578.6 3550.7 6281.4

hsa-miR-023bN 28983.4 48382.4 40848.5 38443.1 8720.7 19340.6 32115.5

hsa-miR-024 160481.7 328445.2 291812.1 253145.5 69317.4 529861.1 403163.3

hsa-miR-025 2258.2 2630.2 2466.4 3937.8 1259.3 3653.9 2536.2

hsa-miR-026aN 151615.3 167946.2 179909.3 354910.3 49692.7 107719.7 212595.6

hsa-miR-026b 52285.7 51517.9 45431.2 75479.5 20646.2 69269.9 72012.2

hsa-miR-026bN 39639.5 38831.0 30671.5 60203.7 15160.8 57317.5 60006.1

hsa-miR-027a 18602.1 40746.0 37020.8 19222.5 5523.9 66255.5 33213.1

hsa-miR-027b 8606.2 19131.4 9358.3 12034.9 2810.4 7210.3 23503.6

hsa-miR-027bN 85127.9 147151.2 71229.8 115354.7 43815.3 77943.7 200770.2

hsa-miR-028 3194.7 17191.3 5864.5 7171.9 1472.6 3582.7 10413.5

hsa-miR-029a 27559.5 22459.9 35949.6 30619.2 10146.5 17298.4 32934.6

hsa-miR-029b 655.2 876.6 1201.0 413.5 345.7 618.0 564.1

hsa-miR-029c 10731.8 10086.8 12606.5 7969.7 9136.2 3501.8 13267.5

hsa-miR-030a-3p 38859.0 11564.7 17926.4 8570.8 8775.9 21285.2 10377.2

hsa-miR-030c 232146.8 77726.7 108072.7 77643.7 35355.1 82507.2 64814.7

hsa-miR-030d 21134.6 11119.3 19057.6 11524.2 6671.0 42985.5 12327.1

hsa-miR-030e-3p 2705.1 3864.6 7609.2 5815.4 1777.2 1646.9 3516.1

hsa-miR-031 10786.1 20549.9 191.1 5520.9 1183.5 6564.3 15207.5

hsa-miR-032 3166.7 1862.4 1760.5 2262.8 1217.2 2969.5 1856.0

hsa-miR-033 43.2 21.6 0.0 0.0 0.0 0.0 4.4

hsa-miR-034a 196.5 294.8 100.6 651.1 160.1 207.0 640.3

hsa-miR-034aN 2318.0 4433.9 1460.1 6753.0 2307.6 2615.5 6223.0

hsa-miR-034b 0.0 38.7 0.0 699.6 9.2 72.9 23.6

hsa-miR-034b 0.0 21.2 0.0 564.8 0.0 62.1 30.5

hsa-miR-092N 26746.7 30797.3 33938.5 56089.7 13585.8 22934.4 22135.0

hsa-miR-093 12930.1 21802.2 11116.9 19528.7 3984.0 35180.8 21769.4

hsa-miR-095 2089.9 3895.8 65316.6 1276.1 926.6 516.1 2257.0

hsa-miR-096 513477.8 624367.1 508885.3 377259.3 866530.1 585776.3 436806.1

hsa-miR-098 992.0 666.0 946.4 979.4 272.5 386.0 661.6

hsa-miR-099a 21757.2 20340.1 10295.2 66443.6 4039.7 36189.8 45368.5

hsa-miR-099b 7743.0 4869.8 1652.5 8065.5 1309.6 9065.5 3968.1

hsa-miR-100 12638.3 14558.9 5442.3 47843.3 2874.4 31058.1 29408.7

hsa-miR-101 351.7 407.2 771.3 554.2 183.3 306.5 545.4

hsa-miR-103 4380.2 3324.3 1566.7 3877.9 800.8 5139.5 3858.6

hsa-miR-105 561.1 600.7 780.9 1454.4 484.9 874.9 830.5

hsa-miR-106a 48954.8 86632.0 104687.1 66511.4 123234.3 75586.7 48471.2

hsa-miR-106b 4108.8 5031.2 2933.2 4837.2 1629.4 6720.4 4213.4

hsa-miR-107 191.1 18.7 24.6 19.8 3.8 16.1 20.1

hsa-miR-108 0.0 0.0 0.0 0.0 0.0 0.0 0.0

Continued

308


hsa-miR-122a 0.0 1.7 0.0 0.0 0.0 3.1 0.0

hsa-miR-124a 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-125a 83936.9 59566.7 21498.7 127804.7 15482.9 126209.9 56673.1

hsa-miR-125b 29566.1 54132.1 31899.8 219811.6 13399.2 35933.5 111118.5

hsa-miR-126 165237.6 185440.2 175040.4 167043.0 44896.8 242580.8 160471.4

hsa-miR-126* 18384.7 22526.1 23500.2 19513.5 5942.3 17413.4 20759.2

hsa-miR-127 2293.7 2213.2 2530.1 14586.1 2624.8 17410.7 6928.7

hsa-miR-128a 0.0 0.0 55.9 0.0 0.0 0.0 0.0

mmu-miR-129-2 0.0 0.0 0.0 15.3 18.8 0.0 9.3

hsa-miR-130a 2976.6 1998.4 462.4 3103.2 897.6 4264.5 3658.9

hsa-miR-130aN 9857.1 9536.9 2427.9 18680.6 3362.4 18147.6 20919.7

hsa-miR-130b 59.3 68.4 40.7 74.9 491.6 303.4 96.0

hsa-miR-132 6702.0 5779.3 4004.6 8949.3 3059.3 2693.8 9394.4

hsa-miR-133a 130.0 16566.8 325436.3 1197.5 67.3 263.8 9766.0

hsa-miR-134 183.3 184.8 210.4 1424.4 257.3 989.5 672.5

hsa-miR-135a 8553.8 381.6 180.9 2348.4 993.9 518.6 5918.2

hsa-miR-135b 4816.5 2086.2 45.1 1990.3 613.2 13871.2 1899.3

mmu-miR-137 0.0 53.9 0.0 17.4 30.0 253.3 53.0

hsa-miR-139 252.1 291.0 201.4 209.3 87.0 141.2 282.9

hsa-miR-140 24294.8 20568.4 19952.9 32248.7 6150.9 15014.3 21493.0

hsa-miR-141 2172.7 1802.4 20.1 421.4 13451.8 6911.1 2594.3

hsa-miR-142-3p 7731.1 15795.7 6664.7 10370.9 5628.6 19655.9 12231.4

hsa-miR-142-5p 751.4 1486.3 689.5 992.2 582.5 1905.4 2023.4

hsa-miR-143 1425.1 20497.1 1682.6 8121.5 538.2 2523.0 19912.3

hsa-miR-145 2130.0 34480.2 1870.8 11749.6 857.6 3829.0 15745.3

hsa-miR-146 14360.1 14523.5 8066.1 6477.8 3699.3 5626.3 13006.3

hsa-miR-146b 20360.1 15067.3 6327.2 33648.9 15368.4 5973.1 20290.1

hsa-miR-147 4.1 3.7 4.7 4.3 4.0 4.0 4.1

hsa-miR-148a 6108.6 4135.1 2462.4 11106.9 68386.1 3507.9 7622.4

hsa-miR-148b 1419.0 1070.6 594.1 853.0 557.7 2028.9 1342.0

hsa-miR-149 1378.5 3223.9 815.1 3076.7 477.5 10109.4 5656.0

hsa-miR-150 19990.7 39163.2 29793.8 20824.6 8550.5 7456.5 24593.9

hsa-miR-152 7578.4 10433.1 12837.4 9650.3 3333.6 8476.2 13787.5

hsa-miR-152N 5980.9 9830.7 9782.3 6787.7 2093.2 7430.4 11156.5

hsa-miR-153 6.5 5.0 20.0 14.1 10.0 0.0 2.5

hsa-miR-154 0.0 0.0 0.0 0.0 0.0 4.0 0.0

hsa-miR-154* 0.0 0.0 4.6 10.8 23.0 79.7 13.3

hsa-miR-155 1773.9 3529.1 1418.5 3979.9 515.6 897.6 2597.6

hsa-miR-181a 3718.4 1043.0 764.9 1591.5 398.9 8781.7 813.9

hsa-miR-181b 6496.3 2433.4 1477.3 5190.6 1359.8 5851.4 2906.4

hsa-miR-181c 251.3 128.1 59.3 178.1 41.5 442.0 181.2

hsa-miR-182 3.7 9.9 7.8 17.5 6.6 7.4 15.5

hsa-miR-183 187.5 228.1 115.6 17.6 170.5 233.8 238.7

hsa-miR-184 243.9 11.7 63.2 9.7 77.4 821.5 88.3

hsa-miR-186 5919.9 8622.7 8137.3 9926.3 2981.2 6981.5 13496.8

hsa-miR-187 627.5 1391.6 0.0 117.3 30.3 0.0 1554.1

Continued

309


hsa-miR-188b 93.2 88.4 100.4 109.9 77.0 92.5 82.8

hsa-miR-190 955.9 113.5 155.4 117.9 73.5 96.7 98.6

hsa-miR-191 18363.5 17658.8 11737.2 31599.3 6565.2 34049.3 22783.2

hsa-miR-192 74764.3 2593.8 1471.9 3087.0 25192.4 4889.5 6287.3

hsa-miR-193 564.7 1020.3 608.9 825.2 405.1 617.4 1182.6

hsa-miR-194 33424.2 931.4 583.5 1130.3 4766.0 1846.8 1577.5

hsa-miR-195 24047.2 48198.7 23501.7 123747.4 10053.2 8734.2 60740.4

hsa-miR-196a 5600.2 97.3 6403.9 3241.0 35.9 800.0 1884.4

hsa-miR-196b 1018.1 0.0 619.3 78.3 0.0 333.8 2756.1

hsa-miR-197 4631.5 4747.1 6150.8 7819.8 1989.1 3278.5 5382.6

hsa-miR-199a 105.0 121.6 45.9 394.6 40.5 233.6 216.4

hsa-miR-199a* 7946.2 11030.4 6974.5 38622.2 3480.8 12258.2 23259.0

hsa-miR-199b 18.0 85.6 85.6 142.5 56.6 118.1 134.5

hsa-miR-199-s 681.0 827.6 382.7 3010.3 300.4 948.2 1590.9

hsa-miR-200a 27531.9 5606.7 54.4 2694.3 14205.7 125.4 9940.1

hsa-miR-200b 20632.3 7950.4 22.9 5605.7 7348.0 37.8 11594.3

hsa-miR-200bN 22674.2 6163.1 60.6 7725.5 13569.1 578.7 17601.6

hsa-miR-200c 26304.8 35266.9 226.5 17442.3 96773.8 100754.4 49800.7

hsa-miR-200cN 15344.7 24488.4 71.8 14630.4 59080.5 73356.0 28981.4

hsa-miR-203 2843.2 104075.3 110.9 2067.3 564.5 17358.7 4062.3

hsa-miR-204 150543.5 1114.1 1135.6 12368.8 1363.1 2951.2 8591.4

hsa-miR-205 90.7 23002.5 22.8 0.0 9.8 3353.5 15420.9

hsa-miR-206 107.1 16885.0 468142.2 97.0 15.8 12.2 27381.7

hsa-miR-208 0.0 0.0 5.1 0.0 0.0 0.0 15.7

hsa-miR-210 1134.9 3106.9 777.8 445.9 159.2 1676.4 720.9

hsa-miR-210N 3026.5 6970.2 1610.5 1316.1 752.5 4835.9 2448.9

hsa-miR-211 238.0 5.7 2.8 6.9 2.3 46.8 11.0

hsa-miR-212 907.8 842.9 838.7 1811.5 651.9 575.7 1716.9

hsa-miR-213 48.3 20.7 0.0 11.2 1.9 151.8 11.2

hsa-miR-214 10752.2 18963.3 8707.0 49907.9 4655.7 9765.2 33002.8

hsa-miR-215 110.3 174.5 18.2 9.7 365.1 5.5 240.5

hsa-miR-216 0.0 0.0 0.0 0.0 999.5 0.0 0.0

hsa-miR-217 16.1 5.8 8.1 0.0 179.8 16.2 0.0

hsa-miR-218 9104.3 10346.9 2029.4 7246.4 2279.8 6245.7 12398.5

hsa-miR-219 0.0 0.0 0.0 0.0 2.9 0.0 0.0

hsa-miR-220 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-221 4475.8 4872.9 1830.1 5095.0 975.3 15978.7 12052.3

hsa-miR-222 15962.5 17110.8 6970.3 35996.9 2972.8 41450.2 35669.2

hsa-miR-223 27882.7 83327.5 36094.5 55742.6 28922.8 161905.5 65951.0

mmu-miR-224 13.4 53.7 13.5 20.6 50.6 422.0 76.0

hsa-miR-296 230.0 406.2 789.9 661.4 211.9 336.7 496.1

hsa-miR-299 0.0 0.0 0.0 0.0 0.0 8.2 3.6

hsa-miR-301 443.8 270.2 94.2 216.0 276.2 624.7 281.5

hsa-miR-302a 0.0 0.0 17.6 0.0 0.0 0.0 0.0

hsa-miR-302a* 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302b 545.0 808.2 1018.0 959.5 460.7 701.3 759.8

Continued

310


hsa-miR-302c 0.0 0.0 0.0 0.0 0.0 0.0 10.0

hsa-miR-302c* 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302d 3.8 9.1 11.1 3.1 7.1 10.6 15.2

hsa-miR-320 7752.2 15311.9 6563.2 18948.2 4799.1 40129.9 15806.6

hsa-miR-321 31941.4 67090.6 53878.2 14942.5 13477.7 57550.3 60924.3

hsa-miR-323 0.0 2.8 2.5 36.3 10.2 387.2 22.0

hsa-miR-324-3p 2956.4 3860.1 2558.7 3734.3 530.8 2493.2 5522.6

hsa-miR-324-5p 2372.4 1886.1 1014.0 1215.6 375.7 2468.5 2597.0

hsa-miR-325 5.3 6.2 3.1 2.4 15.8 2.1 4.2

hsa-miR-326 4.9 14.9 7.6 9.2 2.9 6.7 23.0

hsa-miR-328 5976.3 4604.5 6492.9 11300.5 1722.7 1595.9 4192.2

hsa-miR-330 61.1 75.6 21.9 43.1 36.7 126.2 107.4

hsa-miR-331 12206.4 9100.6 18822.6 10784.7 3495.0 10122.7 9716.4

hsa-miR-335 1374.9 790.5 1248.8 2915.5 1794.1 15039.1 1882.7

hsa-miR-337 0.0 0.0 15.6 0.0 0.0 10.9 1.8

hsa-miR-338 12.1 43.8 2.7 12.3 32.9 0.0 0.0

hsa-miR-339 118.5 114.8 60.3 243.3 87.4 109.5 156.8

hsa-miR-340 301.9 358.9 464.4 403.0 135.5 323.3 226.7

hsa-miR-342 5755.4 7442.7 4682.1 10006.2 1623.6 4974.7 8559.6

hsa-miR-345 2649.5 1851.5 3362.1 3539.3 503.6 792.1 2745.3

hsa-miR-346 13.1 26.4 26.5 41.3 9.6 13.9 16.0

hsa-miR-361 1397.2 1506.8 1679.6 2573.1 427.6 1437.2 2023.6

hsa-miR-367 0.0 0.0 14.5 0.0 0.0 0.0 0.0

hsa-miR-368 13.9 0.0 0.0 0.0 0.0 9.6 0.0

hsa-miR-369 0.0 3.8 3.7 0.0 0.0 56.5 8.5

hsa-miR-370 225.2 420.5 387.3 1183.1 210.7 2499.9 762.3

hsa-miR-371 0.0 0.0 2.8 8.0 3.1 769.2 1.5

hsa-miR-372 10.5 2.3 20.0 37.5 0.0 2795.4 7.9

hsa-miR-373 12.9 0.0 0.0 2.2 0.0 246.2 0.0

hsa-miR-374 13420.1 13060.8 13121.2 16767.3 4290.1 14582.2 14597.9

hsa-miR-375 305.0 4180.2 46.6 1342.3 219706.0 384.2 19148.5

hsa-miR-376a 197.2 230.1 280.3 1039.9 226.4 5411.4 868.2

hsa-miR-377 2.6 0.0 0.0 0.0 0.0 10.5 0.0

hsa-miR-378 432.7 980.3 7679.2 276.6 89.1 194.8 442.2

hsa-miR-379 67.3 184.5 206.0 944.6 131.5 1511.9 365.3

hsa-miR-380-3p 0.0 0.0 0.0 0.0 0.0 3.2 0.0

hsa-miR-380-5p 0.0 12.2 0.0 0.0 0.0 64.4 40.4

hsa-miR-381 16.1 15.4 12.8 46.4 11.9 51.8 64.9

hsa-miR-382 163.5 291.5 236.5 1555.9 397.8 4824.9 829.5

hsa-miR-383 3.4 38.3 56.7 2147.4 28.3 7.8 454.8

hsa-miR-384 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-422b 352.7 496.4 2022.1 263.8 0.0 183.1 464.4

hsa-miR-423 1400.0 1245.5 1513.1 1914.2 562.9 918.5 1224.5

mmu-miR-424 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-425 635.4 667.5 335.4 1157.6 0.0 1096.4 1270.6

Continued

311


miRNA Spleen Small

Intestine Trachea Thymus Thyroid Testes

Normal B cell

hsa-let-7a 7188.0 4012.1 6029.4 5546.6 10310.4 8138.0 707.8

hsa-let-7b 29589.8 16506.7 26143.2 23383.8 27150.6 40081.9 2611.6

hsa-let-7c 1544.5 1785.7 8367.4 8127.5 12071.4 17833.5 84.3

hsa-let-7d 717.8 614.8 552.2 727.0 1532.3 685.4 227.8

hsa-let-7e 338.6 185.8 220.0 210.4 325.8 503.3 3.3

mmu-let-7f 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-let-7g 15392.2 10093.1 11957.5 15582.5 18600.4 272.7 113.2

hsa-let-7i 1758.4 924.0 1304.5 1401.5 6719.3 996.6 281.8

hsa-miR-001 802.7 6667.4 4256.5 604.4 55121.3 190.0 0.0

hsa-miR-007 243.6 1766.9 226.7 443.0 12161.6 30.8 0.0

hsa-miR-009 151.4 1744.0 667.8 290.8 206.8 1477.7 25.5

hsa-miR-009* 57.8 367.5 128.7 58.8 93.0 437.8 0.0

hsa-miR-010a 5052.3 5795.6 2596.3 962.7 1277.9 2002.1 16.0

hsa-miR-010b 2819.1 889.3 966.0 1072.1 808.7 5993.6 0.0

hsa-miR-015a 2003.3 1259.6 1495.3 3869.9 1295.6 194.0 64.7

hsa-miR-015b 17069.3 8944.3 6324.8 29926.0 8386.4 15926.4 5266.7

hsa-miR-016 35112.5 11330.4 17248.6 51925.3 27178.6 8.1 6.3

hsa-miR-017-3p 134.4 49.8 65.4 147.1 109.7 19.1 4.1

hsa-miR-017-5p 1643.0 1641.7 1107.6 6085.3 909.7 423.3 60.9

hsa-miR-018 142.5 148.8 77.0 361.3 51.0 171.8 54.0

hsa-miR-019a 11025.7 12603.2 6000.6 20954.7 5815.0 12254.9 1590.5

hsa-miR-019b 59523.0 65503.5 40849.2 109027.2 38453.6 75554.6 12453.0

hsa-miR-020 53992.0 53027.9 36868.9 113277.0 42535.0 61647.5 12383.0

hsa-miR-021 33698.3 36337.4 30273.4 15321.4 19286.2 16718.0 951.4

hsa-miR-022 1344.1 1336.1 1148.1 548.0 1274.8 1458.3 12.6

hsa-miR-023a 329.1 193.9 397.0 216.7 338.1 11.3 0.0

hsa-miR-023b 2001.0 2147.4 2506.5 905.1 2398.2 2442.6 23.0

hsa-miR-023bN 10430.2 15618.8 15565.6 4528.1 11160.2 19383.9 255.0

hsa-miR-024 135165.6 113191.7 149177.4 57463.7 140186.3 126345.7 5594.1

hsa-miR-025 3283.9 2823.5 2001.6 8960.0 2232.6 2860.6 1394.8

hsa-miR-026aN 91386.4 53577.6 94348.5 92098.5 116772.8 95968.8 13895.1

hsa-miR-026b 42712.6 28077.1 32056.6 26702.4 46444.2 31198.9 4599.0

hsa-miR-026bN 35342.5 21028.5 25032.8 21607.4 35599.8 21765.8 4788.9

hsa-miR-027a 14311.5 13071.9 13803.0 6635.1 11155.8 15002.0 332.2

hsa-miR-027b 2035.7 2786.8 3603.9 879.5 2855.4 4397.4 16.6

hsa-miR-027bN 28056.9 32865.5 47071.3 14822.8 57955.7 37981.5 320.9

hsa-miR-028 3673.5 6089.0 3615.0 2916.1 2028.8 3071.1 948.6

hsa-miR-029a 18027.7 15160.2 16732.3 13944.0 27718.2 19602.0 6143.3

hsa-miR-029b 421.5 308.6 346.1 199.6 461.2 412.0 18.2

hsa-miR-029c 12558.2 5621.1 6628.4 7423.8 10471.9 5415.1 3734.3

hsa-miR-030a-3p 4403.2 5209.2 6913.0 2683.5 9835.1 7825.5 65.6

hsa-miR-030c 42349.1 39768.1 40682.7 42625.7 65687.9 47202.7 12270.8

hsa-miR-030d 6646.3 5914.5 6200.8 5862.9 10111.4 5147.6 1624.4

hsa-miR-030e-3p 2521.8 2166.9 2369.9 2983.6 1955.5 4032.3 780.9

hsa-miR-031 446.7 51594.6 13128.3 2934.0 7032.7 8456.3 47.5

Continued

312


hsa-miR-032 2132.0 1688.4 1025.0 2375.5 1514.2 1657.4 113.8

hsa-miR-033 1.9 0.0 2.5 17.5 0.0 67.8 4.6

hsa-miR-034a 102.7 120.2 249.6 203.5 230.2 500.8 3.7

hsa-miR-034aN 1435.5 1480.6 2334.7 2293.3 2557.4 5580.1 14.9

hsa-miR-034b 0.0 9.8 1360.3 36.7 0.0 967.2 0.0

hsa-miR-034b 8.3 0.0 1229.8 59.2 0.0 870.1 0.0

hsa-miR-092N 25844.3 17971.4 17433.3 49898.4 15906.2 26066.3 19970.3

hsa-miR-093 14986.0 16394.2 10689.2 35764.6 11547.8 10777.9 2854.1

hsa-miR-095 8834.0 846.4 921.3 997.9 5282.3 750.4 116.5

hsa-miR-096 582403.0 696132.5 573402.1 396347.7 837447.8 367914.0 471842.4

hsa-miR-098 479.0 242.9 327.2 393.5 670.1 446.4 31.4

hsa-miR-099a 2407.8 5332.0 18839.4 24320.9 27472.4 438.5 0.0

hsa-miR-099b 3347.5 2103.5 2669.4 1868.4 3480.2 4864.6 31.3

hsa-miR-100 2104.1 4611.9 10789.2 16583.7 16845.5 17508.3 0.0

hsa-miR-101 293.4 209.6 181.4 303.0 233.8 246.1 49.9

hsa-miR-103 4569.3 2530.3 2331.1 2785.6 2637.6 3257.8 549.2

hsa-miR-105 803.3 601.3 535.2 1534.7 454.2 870.0 567.4

hsa-miR-106a 54220.8 84168.8 64727.1 46545.4 109061.8 30324.5 52471.3

hsa-miR-106b 4713.2 4221.2 2809.5 9199.3 2872.2 296.9 76.2

hsa-miR-107 4.8 30.5 5.3 16.5 45.9 14.1 0.0

hsa-miR-108 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-122a 0.0 0.0 0.0 0.0 0.0 3.4 0.0

hsa-miR-124a 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-125a 41162.0 27795.2 36905.6 28228.3 48935.3 67233.4 421.7

hsa-miR-125b 6653.0 12497.4 36477.7 44440.7 56981.0 73863.3 17.5

hsa-miR-126 306194.7 88518.2 131469.8 94212.0 201081.6 98601.5 1735.0

hsa-miR-126* 38173.2 11128.4 14712.6 11552.4 18110.1 12545.3 203.3

hsa-miR-127 4796.2 2027.7 3171.5 2861.9 796.8 16842.7 18.0

hsa-miR-128a 0.0 0.0 0.0 7.7 0.0 0.0 0.0

mmu-miR-129-2 0.0 0.0 0.0 0.0 0.0 14.9 0.0

hsa-miR-130a 1917.0 1101.0 790.0 1908.7 2000.5 1752.8 26.9

hsa-miR-130aN 6911.0 4431.9 4738.3 9862.4 15310.3 7786.1 107.8

hsa-miR-130b 68.5 134.5 41.6 284.9 97.6 44.9 2.6

hsa-miR-132 4483.9 4945.8 4855.4 7259.9 2621.9 7860.5 131.0

hsa-miR-133a 80.5 1198.4 813.4 130.0 9296.2 921.1 4.6

hsa-miR-134 539.0 184.7 338.1 198.4 77.8 2017.9 4.0

hsa-miR-135a 56.6 118.9 485.6 402.8 49202.8 4748.0 5.6

hsa-miR-135b 767.0 1925.7 4563.4 565.6 20418.0 12368.7 15.8

mmu-miR-137 0.0 146.1 2.5 21.0 20.3 0.0 0.0

hsa-miR-139 1834.1 188.0 101.2 161.3 163.0 163.7 9.7

hsa-miR-140 17959.5 11373.3 204.3 13010.9 9317.8 19716.7 1962.3

hsa-miR-141 30.3 6699.2 3278.0 1627.4 2922.3 528.5 6.7

hsa-miR-142-3p 146286.3 25459.5 29780.7 158461.1 4822.3 7443.5 22691.4

hsa-miR-142-5p 4233.6 1913.4 2503.2 8236.6 632.2 810.8 3165.1

hsa-miR-143 1584.7 6454.6 2963.4 695.2 1085.5 3651.9 0.0

hsa-miR-145 2557.1 7942.2 4413.5 1115.7 1238.0 5101.9 13.9

Continued

313


hsa-miR-146 31506.8 8747.9 34051.8 28862.9 8255.7 7288.2 8308.8

hsa-miR-146b 24546.0 14637.0 31232.0 20135.9 13911.8 15510.6 1115.6

hsa-miR-147 5.5 9.3 1.7 0.0 3.1 0.0 0.0

hsa-miR-148a 2890.7 5330.2 11556.6 6657.1 4848.1 6089.4 35.1

hsa-miR-148b 732.6 702.0 669.9 613.6 1487.7 932.2 55.3

hsa-miR-149 608.3 1041.6 1527.8 9367.8 311.0 3450.1 8.5

hsa-miR-150 185337.1 38465.6 73851.0 212825.0 18399.5 10549.0 427307.7

hsa-miR-152 2905.4 3528.6 6634.1 4173.9 8561.5 7568.6 116.1

hsa-miR-152N 2548.7 2686.0 4606.5 2716.9 6390.5 5576.3 59.3

hsa-miR-153 27.1 47.1 7.9 2.7 10.2 3.8 0.0

hsa-miR-154 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-154* 10.3 0.0 9.2 0.0 0.0 4.2 0.0

hsa-miR-155 9587.2 3444.0 5880.1 17280.7 2354.8 156.7 653.1

hsa-miR-181a 2864.2 679.7 434.6 25794.1 3552.4 10.2 2.8

hsa-miR-181b 6888.1 2880.2 2632.8 30230.0 7682.4 3314.3 977.0

hsa-miR-181c 203.0 69.8 61.8 1060.0 303.4 0.0 0.0

hsa-miR-182 14.9 12.7 4.0 30.4 15.6 18.1 24.8

hsa-miR-183 4.2 84.5 94.0 922.1 228.7 0.0 0.0

hsa-miR-184 0.0 0.0 11.7 85.1 17.0 74.9 0.0

hsa-miR-186 5712.4 5493.7 5090.0 5504.8 3782.9 7323.1 684.5

hsa-miR-187 47.1 623.2 360.9 9.0 24.2 924.7 0.0

hsa-miR-188b 66.9 76.1 66.3 109.0 81.9 82.4 55.8

hsa-miR-190 80.9 81.4 45.7 42.3 106.5 74.7 0.0

hsa-miR-191 18796.1 11890.3 13267.9 21718.1 16439.0 2852.0 1060.2

hsa-miR-192 1999.3 334215.6 1016.8 1976.3 3082.5 2958.3 323.3

hsa-miR-193 406.1 397.8 334.5 403.5 443.8 283.7 97.7

hsa-miR-194 873.4 145110.3 382.5 759.0 1052.3 1117.2 173.4

hsa-miR-195 25739.8 20908.2 24917.6 17580.3 21127.0 4664.0 34.1

hsa-miR-196a 29.2 81.3 54.7 526.5 23.3 1263.9 0.0

hsa-miR-196b 0.0 0.0 0.0 462.3 0.0 4.3 0.0

hsa-miR-197 6054.1 3795.1 3340.2 5434.1 2102.4 3514.2 1348.1

hsa-miR-199a 109.7 59.2 60.9 51.6 47.0 242.9 0.0

hsa-miR-199a* 8462.3 5443.0 10428.7 4698.0 5608.8 1111.8 0.0

hsa-miR-199b 9.0 43.9 73.0 60.2 61.3 4.4 0.0

hsa-miR-199-s 656.1 429.8 799.8 334.3 399.7 250.9 0.0

hsa-miR-200a 40.8 19355.7 18843.7 9651.6 7837.4 371.5 2.0

hsa-miR-200b 25.4 15116.7 23077.8 5989.6 5223.9 1139.1 13.6

hsa-miR-200bN 93.3 19970.8 27034.9 13968.8 11593.9 103.1 3.2

hsa-miR-200c 388.2 85635.8 87730.1 18637.4 78343.7 7330.2 503.1

hsa-miR-200cN 277.4 54586.0 57431.8 10550.2 53186.4 556.0 37.1

hsa-miR-203 37.0 1843.8 2203.8 6554.3 5302.9 115.7 0.0

hsa-miR-204 4203.4 419.8 1698.9 2377.3 3387.7 26781.3 0.0

hsa-miR-205 0.0 0.0 6503.6 20956.2 64.5 654.9 0.0

hsa-miR-206 0.0 6.1 900.7 1740.0 14906.2 340.1 0.0

hsa-miR-208 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-210 96.3 628.7 292.1 805.6 211.4 19.0 1.7

Continued

314


hsa-miR-210N 372.0 2714.2 1394.3 1963.6 1000.4 433.2 33.2

hsa-miR-211 5.8 0.0 11.0 165.4 0.0 0.0 0.0

hsa-miR-212 1037.6 961.9 1154.0 1281.4 446.8 1135.8 301.9

hsa-miR-213 43.9 7.7 5.2 568.4 37.1 3.2 0.0

hsa-miR-214 13523.0 9057.7 12764.9 7316.9 10088.8 7671.3 0.0

hsa-miR-215 7.9 81909.2 8.2 12.1 3.7 122.3 0.0

hsa-miR-216 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-217 0.0 1.6 0.0 0.0 0.0 3.0 0.0

hsa-miR-218 9912.9 3506.1 6353.6 3903.7 4072.5 3232.2 20.5

hsa-miR-219 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-220 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-221 1540.5 2277.8 2233.2 2185.1 1679.7 2093.5 254.0

hsa-miR-222 5126.6 8085.8 9507.8 8978.5 7707.1 6393.4 1345.5

hsa-miR-223 552278.1 36160.2 136543.5 56461.9 40258.8 24194.0 59716.9

mmu-miR-224 11.2 44.0 21.6 39.5 44.1 21.9 0.0

hsa-miR-296 272.8 176.6 376.7 544.0 505.2 544.0 102.5

hsa-miR-299 0.0 0.0 0.0 0.0 0.0 10.1 0.0

hsa-miR-301 250.8 218.1 121.6 454.8 112.7 309.3 34.4

hsa-miR-302a 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302a* 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302b 2120.8 530.9 1635.4 1051.2 1298.5 721.9 727.2

hsa-miR-302c 29.2 0.0 21.3 0.0 18.8 0.0 17.3

hsa-miR-302c* 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-302d 5.6 8.6 11.7 0.0 7.0 0.0 0.0

hsa-miR-320 7978.0 8170.9 9180.7 7904.8 7391.1 7702.4 3927.5

hsa-miR-321 26118.3 46330.9 38108.7 31798.8 27618.0 29289.2 4207.4

hsa-miR-323 15.3 5.1 0.0 5.4 0.0 146.9 0.0

hsa-miR-324-3p 2292.7 2218.2 2019.2 2665.2 3361.8 2869.6 402.0

hsa-miR-324-5p 948.8 695.9 614.3 787.0 965.5 803.9 17.3

hsa-miR-325 11.3 16.3 5.7 1.4 7.0 3.9 16.1

hsa-miR-326 22.5 30.0 6.2 18.7 4.4 9.7 0.0

hsa-miR-328 2818.1 1591.3 2808.0 3789.6 3425.7 5468.0 574.9

hsa-miR-330 68.1 48.1 47.1 73.5 43.8 37.9 21.6

hsa-miR-331 5606.3 4158.5 5257.8 5986.9 8418.7 6567.2 1511.1

hsa-miR-335 3121.3 1186.7 1749.5 1489.8 1427.7 2173.8 48.3

hsa-miR-337 0.0 3.5 0.0 0.0 0.0 2.2 0.0

hsa-miR-338 17.2 33.8 4.4 14.9 4.3 0.0 0.0

hsa-miR-339 99.5 48.1 81.6 58.4 48.9 84.9 83.4

hsa-miR-340 387.8 211.4 227.8 136.1 202.2 266.7 31.3

hsa-miR-342 14736.1 6954.1 6739.3 28735.9 3235.3 5622.7 9338.8

hsa-miR-345 1717.8 1539.2 2590.8 2503.0 7157.1 2666.1 281.1

hsa-miR-346 4.8 22.6 26.8 24.5 66.2 33.8 4.1

hsa-miR-361 933.3 599.5 714.9 928.0 762.2 1149.3 179.4

hsa-miR-367 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-368 6.9 0.0 0.0 0.0 0.0 4.7 0.0

hsa-miR-369 15.2 2.0 13.4 3.0 3.6 15.1 0.0

Continued

315


hsa-miR-370 1160.8 235.8 435.0 391.2 98.7 1563.8 99.2

hsa-miR-371 13.5 3.5 1.7 9.2 7.5 98.6 0.0

hsa-miR-372 3.8 2.6 6.4 7.7 2.7 487.7 3.8

hsa-miR-373 0.0 0.0 0.0 0.0 0.0 54.0 0.0

hsa-miR-374 13252.1 9719.9 9234.4 8584.8 9448.3 11283.3 1060.6

hsa-miR-375 65.4 28817.5 23824.7 1911.2 775.9 1793.2 0.0

hsa-miR-376a 698.0 168.8 293.7 188.7 111.0 930.3 8.1

hsa-miR-377 0.0 0.0 0.0 0.0 0.0 13.5 0.0

hsa-miR-378 132.8 452.8 233.2 176.6 425.3 78.9 67.2

hsa-miR-379 288.2 111.6 196.7 143.3 53.9 979.2 0.0

hsa-miR-380-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-380-5p 11.2 0.0 0.0 0.0 1.9 49.0 0.0

hsa-miR-381 3.2 15.8 19.5 33.6 1.9 38.3 0.0

hsa-miR-382 1029.7 326.3 439.4 298.5 133.5 1690.1 0.0

hsa-miR-383 9.3 114.8 102.2 1070.1 4.6 947.8 0.0

hsa-miR-384 0.0 0.0 0.0 0.0 0.0 0.0 0.0

hsa-miR-422b 77.1 660.5 141.5 99.6 142.8 59.5 9.3

hsa-miR-423 1292.8 878.4 1008.1 1552.9 1181.7 1304.3 677.1

mmu-miR-424 0.0 0.0 0.0 0.0 0.0 19.1 0.0

hsa-miR-425 607.3 456.4 548.1 446.2 571.9 581.8 127.2

316

Normal tissues Cell lines

mature precursor pearson p-value pearson p-value

hsa-let-7a let-7a-1* -0.101 0.654 0.4 0.014

hsa-let-7a let-7a-2-P 0.334 0.128 -0.125 0.462

hsa-let-7a let-7a-3* 0.465 0.029 0.356 0.031

hsa-let-7b let-7b* 0.735 < 0.0001 0.739 < 0.0001

hsa-let-7c let-7c* 0.069 0.759 0.963 < 0.0001

hsa-let-7d let-7d* 0.213 0.341 0.331 0.046

hsa-let-7e let-7e* 0.683 0.000 0.478 0.003

mmu-let-7f let-7f-1* 0.000 1.000 0 1

mmu-let-7f let-7f-2* 0.000 1.000 0 1

hsa-let-7g let-7g* -0.448 0.037 0.541 0.001

hsa-let-7i let-7i* -0.100 0.656 0.292 0.08

hsa-miR-001 MIR-001-1 0.914 < 0.0001 -0.014 0.936

hsa-miR-001 MIR-001-2 0.933 < 0.0001 -0.041 0.809

hsa-miR-007 MIR-007-1 -0.098 0.664 0.19 0.26

hsa-miR-007 MIR-007-2 0.379 0.082 0.15 0.375

hsa-miR-007 MIR-007-3 0.434 0.044 0.64 < 0.0001

hsa-miR-009 MIR-009-1-P 0.294 0.184 0.081 0.635

hsa-miR-009 MIR-009-2-P 1.000 < 0.0001 -0.008 0.961

hsa-miR-009 MIR-009-3-P 0.992 < 0.0001 0.046 0.785

hsa-miR-009* MIR-009-1-P 0.294 0.184 0.079 0.641

hsa-miR-009* MIR-009-2-P 1.000 < 0.0001 0.077 0.649

hsa-miR-009* MIR-009-3-P 0.992 < 0.0001 0.123 0.47

hsa-miR-010a MIR-010a,b 0.774 < 0.0001 0.574 0

hsa-miR-015a MIR-015a -0.320 0.146 0.403 0.013

hsa-miR-015b MIR-015b 0.492 0.020 0.253 0.13

hsa-miR-016 MIR-016-1 0.112 0.620 0.58 0

hsa-miR-016 MIR-016-2 0.116 0.608 0.297 0.074

hsa-miR-017-3p MIR-017-P -0.220 0.326 0.728 < 0.0001

hsa-miR-017-5p MIR-017-P -0.215 0.336 0.404 0.013

hsa-miR-018 MIR-018 0.257 0.249 0.754 < 0.0001

hsa-miR-019a MIR-019a-P -0.328 0.136 0.808 < 0.0001

hsa-miR-019b MIR-019b-1-P -0.325 0.140 0.219 0.193

hsa-miR-019b MIR-019b-2-P -0.097 0.667 0.131 0.44

hsa-miR-020 MIR-020 -0.393 0.071 0.394 0.016

hsa-miR-021 MIR-021 0.452 0.035 0.522 0.001

hsa-miR-022 MIR-022-P -0.286 0.197 -0.13 0.444

hsa-miR-023a MIR-023a 0.403 0.063 0.151 0.372

hsa-miR-023b MIR-023b-P 0.395 0.069 0.256 0.126

hsa-miR-023bN MIR-023b-P 0.244 0.275 0.213 0.206

hsa-miR-024 MIR-024-1,2 0.644 0.001 0.445 0.006

hsa-miR-025 MIR-025 0.189 0.399 0.479 0.003

hsa-miR-026aN MIR-026a-1,2 0.182 0.416 0.373 0.023

Continued

Table C.5. Correlation between mature and precursor miRNA expression in

Normal tissues and Cell lines.

317


hsa-miR-026b MIR-026b -0.104 0.644 0.116 0.495

hsa-miR-026bN MIR-026b -0.071 0.753 0.175 0.299

hsa-miR-027a MIR-027a, b 0.328 0.136 0.07 0.68

hsa-miR-027b MIR-027a, b 0.058 0.797 0.159 0.348

hsa-miR-027bN MIR-027a, b 0.102 0.653 0.111 0.512

hsa-miR-028 MIR-028 0.170 0.450 0.16 0.345

hsa-miR-029a MIR-029a,c -0.127 0.575 0.774 < 0.0001

hsa-miR-029b MIR-029b-1,2 0.000 1.000 0.024 0.887

hsa-miR-029c MIR-029a,c -0.333 0.130 0.178 0.291

hsa-miR-030a-3p MIR-030a,e 0.435 0.043 0.547 0

hsa-miR-030c MIR-030c-1,2 -0.074 0.744 0.181 0.282

hsa-miR-030d MIR-030d 0.777 < 0.0001 0.736 < 0.0001

hsa-miR-030e-3p MIR-030a,e -0.185 0.411 0.515 0.001

hsa-miR-031 MIR-031-P 0.220 0.325 0.173 0.306

hsa-miR-032 MIR-032 -0.008 0.973 0.413 0.011

hsa-miR-033 MIR-033 -0.088 0.697 0.419 0.01

hsa-miR-034a MIR-034a 0.646 0.001 -0.113 0.506

hsa-miR-034aN MIR-034a 0.632 0.002 -0.046 0.788

hsa-miR-034b MIR-034b 0.268 0.228 0.176 0.298

hsa-miR-092N MIR-092-1 -0.134 0.552 0.757 < 0.0001

hsa-miR-092N MIR-092-2-P -0.083 0.713 0.27 0.106

hsa-miR-093 MIR-093 0.222 0.320 0.163 0.336

hsa-miR-095 MIR-095 0.282 0.204 0.33 0.046

hsa-miR-096 MIR-096-P 0.219 0.328 0.291 0.081

hsa-miR-098 MIR-098 0.273 0.219 0.357 0.03

hsa-miR-099a MIR-099a 0.081 0.719 0.258 0.123

hsa-miR-099b MIR-099b 0.721 0.000 0.071 0.675

hsa-miR-100 MIR-100 0.742 < 0.0001 0.52 0.001

hsa-miR-101 MIR-101-1 -0.225 0.315 0.342 0.038

hsa-miR-101 MIR-101-2 0.263 0.236 0.443 0.006

hsa-miR-103 MIR-103-1,2 0.179 0.424 0.136 0.421

hsa-miR-105 MIR-105-1,2 0.140 0.534 0.08 0.638

hsa-miR-106a MIR-106a-P -0.035 0.877 0.416 0.01

hsa-miR-106b MIR-106b 0.487 0.022 0.415 0.011

hsa-miR-107 MIR-107 0.207 0.355 -0.001 0.997

hsa-miR-108 MIR-108 0.000 1.000 0 1

hsa-miR-122a MIR-122a 0.178 0.429 0 1

hsa-miR-124a MIR-124a-1,2,3 1.000 < 0.0001 0 1

hsa-miR-125a MIR-125a 0.884 < 0.0001 0.717 < 0.0001

hsa-miR-125b MIR-125b-1 0.909 < 0.0001 0.395 0.016

hsa-miR-125b MIR-125b-2 0.889 < 0.0001 0.235 0.162

hsa-miR-126 MIR-126 0.470 0.027 0.835 < 0.0001

hsa-miR-126* MIR-126 0.315 0.153 0.806 < 0.0001

hsa-miR-127 MIR-127 0.298 0.177 0.121 0.476

hsa-miR-128a MIR-128a 0.720 0.000 0 1

mmu-miR-129-2 MIR-129-2 0.565 0.006 0.098 0.565

Continued

318


hsa-miR-130a MIR-130a-P -0.191 0.395 0.34 0.039

hsa-miR-130aN MIR-130a-P -0.165 0.464 0.294 0.078

hsa-miR-130b MIR-130b -0.152 0.500 0.613 < 0.0001

hsa-miR-132 MIR-132 0.212 0.343 0.274 0.101

hsa-miR-133a MIR-133a-1,2 -0.021 0.926 -0.086 0.612

hsa-miR-134 MIR-134 0.563 0.006 0.082 0.631

hsa-miR-135a MIR-135a-1,2 -0.051 0.823 0.028 0.867

hsa-miR-135b MIR-135b-P -0.051 0.823 0.227 0.176

mmu-miR-137 MIR-137* 0.991 < 0.0001 0.689 < 0.0001

hsa-miR-139 MIR-139 -0.207 0.356 -0.033 0.847

hsa-miR-140 MIR-140 -0.385 0.077 0.084 0.62

hsa-miR-141 MIR-141 0.467 0.028 0.667 < 0.0001

hsa-miR-142-3p MIR-142-P 0.126 0.578 0.327 0.049

hsa-miR-142-5p MIR-142-P 0.203 0.365 0.278 0.096

hsa-miR-143 MIR-143 0.672 0.001 -0.163 0.335

hsa-miR-145 MIR-145-P 0.327 0.137 0.136 0.422

hsa-miR-146b MIR-146 0.117 0.604 0.09 0.595

hsa-miR-147 MIR-147 0.088 0.696 0 1

hsa-miR-148a MIR-148a-P -0.157 0.485 0.135 0.427

hsa-miR-148b MIR-148b-P 0.053 0.813 0.186 0.269

hsa-miR-149 MIR-149 0.932 < 0.0001 0.159 0.347

hsa-miR-150 MIR-150 0.874 < 0.0001 0.413 0.011

hsa-miR-152 MIR-152 0.293 0.186 0.716 < 0.0001

hsa-miR-152N MIR-152 0.229 0.305 0.712 < 0.0001

hsa-miR-153 MIR-153-1,2 0.785 < 0.0001 0.417 0.01

hsa-miR-154 MIR-154 0.576 0.005 0 1

hsa-miR-154* MIR-154 0.732 0 0 1

hsa-miR-155 MIR-155 0.693 0 0.784 < 0.0001

hsa-miR-181a MIR-181a,c 0.503 0.017 0.099 0.561

hsa-miR-181b MIR-181b-1,2 0.282 0.203 0.717 < 0.0001

hsa-miR-181c MIR-181a,c 0.466 0.029 0.165 0.329

hsa-miR-182 MIR-182 -0.013 0.953 0.239 0.154

hsa-miR-183 MIR-183 0.016 0.943 0.091 0.594

hsa-miR-184 MIR-184 0.131 0.561 -0.065 0.702

hsa-miR-186 MIR-186-P -0.083 0.713 0.418 0.01

hsa-miR-187 MIR-187 -0.147 0.515 -0.016 0.924

hsa-miR-188b MIR-188b-P -0.097 0.668 -0.061 0.72

hsa-miR-190 MIR-190 0 1 0 1

hsa-miR-191 MIR-191 -0.39 0.072 0.208 0.217

hsa-miR-192 MIR-192 -0.125 0.578 -0.158 0.351

hsa-miR-193 MIR-193 0.359 0.1 0.024 0.888

hsa-miR-194 MIR-194-1,2 -0.107 0.636 -0.078 0.647

hsa-miR-195 MIR-195-P 0.002 0.993 0.094 0.58

hsa-miR-196a MIR-196a-1 0.069 0.76 -0.115 0.499

hsa-miR-196a MIR-196a-2 0.594 0.004 0.114 0.503

hsa-miR-196b MIR-196b 0.911 < 0.0001 0.192 0.256

Continued

319


hsa-miR-197 MIR-197 -0.177 0.432 -0.031 0.856

hsa-miR-199a MIR-199a-1-P -0.294 0.184 0 1

hsa-miR-199a MIR-199a-2-P 0.513 0.015 0 1

hsa-miR-199a* MIR-199a-1-P -0.276 0.213 0.052 0.759

hsa-miR-199a* MIR-199a-2-P 0.548 0.008 -0.152 0.368

hsa-miR-199b MIR-199b-P 0.728 0 0.093 0.585

hsa-miR-200b MIR-200b 0.888 < 0.0001 0.823 < 0.0001

hsa-miR-200bN MIR-200b 0.894 < 0.0001 0.822 < 0.0001

hsa-miR-200c MIR-200c 0.412 0.057 0.378 0.021

hsa-miR-200cN MIR-200c 0.426 0.048 0.383 0.019

hsa-miR-203 MIR-203 0.905 < 0.0001 0.342 0.038

hsa-miR-204 MIR-204 0.915 < 0.0001 -0.083 0.625

hsa-miR-205 MIR-205 0.712 0 0.95 < 0.0001

hsa-miR-206 MIR-206 0.998 < 0.0001 0.02 0.908

hsa-miR-208 MIR-208 0.976 < 0.0001 0 1

hsa-miR-210 MIR-210 0.584 0.004 0.205 0.224

hsa-miR-210N MIR-210 0.579 0.005 0.212 0.208

hsa-miR-211 MIR-211 0.204 0.363 -0.048 0.779

hsa-miR-212 MIR-212 0.209 0.352 0.053 0.756

hsa-miR-213 MIR-213 0.782 < 0.0001 0.711 < 0.0001

hsa-miR-214 MIR-214 -0.12 0.595 0.015 0.932

hsa-miR-215 MIR-215 0.064 0.779 -0.051 0.762

hsa-miR-216 MIR-216 0.911 < 0.0001 0 1

hsa-miR-217 MIR-217 0 1 0.147 0.385

hsa-miR-218 MIR-218-1,2 0.705 0 0.083 0.626

hsa-miR-219 MIR-219-1,2 -0.067 0.769 -0.102 0.548

hsa-miR-220 MIR-220 0 1 0 1

hsa-miR-221 MIR-221 0.095 0.674 0.5 0.002

hsa-miR-222 MIR-222-P 0.364 0.096 0.253 0.131

hsa-miR-223 MIR-223 0.427 0.047 0.519 0.001

mmu-miR-224 MIR-224 0.848 < 0.0001 0.462 0.004

hsa-miR-296 MIR-296 0.324 0.141 0.097 0.567

hsa-miR-299 MIR-299-P -0.036 0.874 0 1

hsa-miR-301 MIR-301 0.311 0.158 0.565 0

hsa-miR-302a MIR-302 -0.189 0.4 0.003 0.988

hsa-miR-302a* MIR-302 0 1 0 1

hsa-miR-302b MIR-302b -0.023 0.919 0.322 0.052

hsa-miR-302c MIR-302c -0.103 0.65 -0.011 0.948

hsa-miR-302c* MIR-302c 0 1 0 1

hsa-miR-302d MIR-302d -0.109 0.629 0.101 0.553

hsa-miR-320 MIR-320 0.3 0.175 0.239 0.154

hsa-miR-321 MIR-321 0.538 0.01 0.455 0.005

hsa-miR-323 MIR-323 0.663 0.001 0.343 0.038

hsa-miR-324-3p MIR-324-P -0.239 0.285 0.081 0.633

hsa-miR-324-5p MIR-324-P -0.203 0.365 0.02 0.907

hsa-miR-325 MIR-325 -0.044 0.846 -0.104 0.542

Continued

320


hsa-miR-326 MIR-326-P 0.608 0.003 -0.161 0.341

hsa-miR-328 MIR-328 -0.073 0.747 0.142 0.401

hsa-miR-330 MIR-330 0.852 < 0.0001 0.189 0.262

hsa-miR-331 MIR-331-P 0.177 0.43 0.349 0.035

hsa-miR-335 MIR-335 -0.151 0.503 -0.127 0.453

hsa-miR-337 MIR-337 0.323 0.142 0 1

hsa-miR-338 MIR-338 0.919 < 0.0001 -0.136 0.421

hsa-miR-339 MIR-339 0.413 0.056 -0.068 0.69

hsa-miR-340 MIR-340 0.839 < 0.0001 0.591 0

hsa-miR-342 MIR-342 0.499 0.018 0.027 0.875

hsa-miR-345 MIR-345 -0.092 0.682 0.097 0.568

hsa-miR-346 MIR-346 0.279 0.208 0.057 0.738

hsa-miR-361 MIR-361 -0.037 0.87 -0.014 0.935

hsa-miR-367 MIR-367 -0.213 0.341 0.089 0.599

hsa-miR-368 MIR-368 0.425 0.049 0 1

hsa-miR-369 MIR-369 0.809 < 0.0001 0 1

hsa-miR-370 MIR-370 0.722 0 0.313 0.059

hsa-miR-371 MIR-371 -0.093 0.679 -0.027 0.873

hsa-miR-372 MIR-372 0 1 -0.005 0.978

hsa-miR-373 MIR-373 -0.092 0.684 0.059 0.73

hsa-miR-374 MIR-374-P -0.445 0.038 -0.263 0.116

hsa-miR-375 MIR-375 0.617 0.002 0.508 0.001

hsa-miR-376a MIR-376 0.945 < 0.0001 0.974 < 0.0001

hsa-miR-377 MIR-377 0.518 0.014 0.064 0.709

hsa-miR-378 MIR-378 0.772 < 0.0001 0.278 0.096

hsa-miR-379 MIR-379 0.87 < 0.0001 0.741 < 0.0001

hsa-miR-380-3p MIR-380 0.931 < 0.0001 0 1

hsa-miR-380-5p MIR-380 0.674 0.001 0.285 0.087

hsa-miR-381 MIR-381 0.264 0.236 0.116 0.495

hsa-miR-382 MIR-382 0.734 0 0.107 0.53

hsa-miR-383 MIR-383 0.862 < 0.0001 0.34 0.04

hsa-miR-384 MIR-384 1 < 0.0001 0 1

hsa-miR-422b MIR-422b -0.179 0.424 0.161 0.34

hsa-miR-423 MIR-423 0.05 0.826 0.412 0.011

mmu-miR-424 MIR-424 0.431 0.045 0.000 1

hsa-miR-425 MIR-425 -0.338 0.124 0.006 0.972

hsa-miR-010b MIR-010a,b 0.334 0.043

hsa-miR-030b MIR-030b 0 1

hsa-miR-138 MIR-138-1,2 0.104 0.54

hsa-miR-151 MIR-151 0 1

hsa-miR-200a MIR-200a-P 0.286 0.086

321

Pancreatic tissues Liver tissues

mature precursor pearson p-value pearson p-value

hsa-let-7a let-7a-1* 0.377 0.15 -0.18250 0.24936

hsa-let-7a let-7a-2-P 0.925 < 0.0001 -0.25177 0.17344

hsa-let-7a let-7a-3* 0.696 0.003 -0.05620 0.41812

hsa-let-7b let-7b* 0.772 0 0.05478 0.42015

hsa-let-7c let-7c* 0.623 0.01 0.00000 0.50000

hsa-let-7d let-7d* 0.859 < 0.0001 0.51078 0.02160

hsa-let-7e let-7e* 0.773 0 0.86061 < 0.0001

hsa-let-7f let-7f-1* 0.909 < 0.0001 0.36040 0.08515

hsa-let-7f let-7f-2* 0.648 0.007 0.00000 0.50000

hsa-let-7g let-7g* 0.854 < 0.0001 0.18968 0.24084

hsa-let-7i let-7i* 0.647 0.007 0.27647 0.14997

hsa-miR-001 MIR-001-1 0.044 0.871 -0.38425 0.07086

hsa-miR-001 MIR-001-2 0.607 0.013 0.41642 0.05431

hsa-miR-007 MIR-007-1 -0.122 0.654 0.34160 0.09767

hsa-miR-007 MIR-007-2 0.383 0.143 -0.20180 0.22678

hsa-miR-007 MIR-007-3 0.904 < 0.0001 0.03250 0.45245

hsa-miR-009 MIR-009-1-P -0.322 0.224 -0.28065 0.14620

hsa-miR-009 MIR-009-2-P 0.129 0.633 -0.26464 0.16097

hsa-miR-009 MIR-009-3-P -0.025 0.927 -0.25489 0.17037

hsa-miR-009* MIR-009-1-P -0.444 0.085 -0.29059 0.13745

hsa-miR-009* MIR-009-2-P 0.076 0.78 -0.27327 0.15290

hsa-miR-009* MIR-009-3-P -0.3 0.26 -0.26322 0.16232

hsa-miR-010a MIR-010a,b 0.897 < 0.0001 0.04191 0.43876

hsa-miR-010b MIR-010a,b 0.774 0 0.28917 0.13868

hsa-miR-015a MIR-015a 0.871 < 0.0001 -0.05809 0.41539

hsa-miR-015b MIR-015b 0.868 < 0.0001 0.64628 0.00342

hsa-miR-016 MIR-016-1 0.829 < 0.0001 0.71353 0.00096

hsa-miR-016 MIR-016-2 -0.582 0.018 -0.15797 0.27950

hsa-miR-017-3p MIR-017-P -0.255 0.341 -0.23060 0.19510

hsa-miR-017-5p MIR-017-P -0.391 0.134 -0.27363 0.15257

hsa-miR-018 MIR-018 0.879 < 0.0001 0.84429 < 0.0001

hsa-miR-019a MIR-019a-P 0.061 0.823 0.87615 < 0.0001

hsa-miR-019b MIR-019b-1-P -0.54 0.031 -0.37460 0.07643

hsa-miR-019b MIR-019b-2-P -0.342 0.195 -0.26528 0.16035

hsa-miR-020 MIR-020 0.213 0.429 -0.13270 0.31209

hsa-miR-021 MIR-021 0.94 < 0.0001 0.84599 < 0.0001

hsa-miR-022 MIR-022-P 0.477 0.062 -0.05671 0.41738

hsa-miR-023a MIR-023a 0.959 < 0.0001 -0.41451 0.05521

hsa-miR-023b MIR-023b-P 0.688 0.003 -0.01457 0.47864

hsa-miR-023bN MIR-023b-P 0.631 0.009 0.11443 0.33652

hsa-miR-024 MIR-024-1,2 0.972 < 0.0001 0.68072 0.00185

hsa-miR-025 MIR-025 0.533 0.033 -0.32747 0.10784

Continued

Table C.6. Correlation between mature and precursor miRNA expression in

pancreas tissues and liver tissues.

322


hsa-miR-026aN MIR-026a-1,2 0.747 0.001 -0.10979 0.34282

hsa-miR-026b MIR-026b -0.698 0.003 -0.20663 0.22130

hsa-miR-026bN MIR-026b -0.693 0.003 -0.19477 0.23489

hsa-miR-027a MIR-027a, b 0.943 < 0.0001 -0.50024 0.02423

hsa-miR-027b MIR-027a, b 0.886 < 0.0001 -0.23204 0.19358

hsa-miR-027bN MIR-027a, b 0.845 < 0.0001 -0.27257 0.15355

hsa-miR-028 MIR-028 0.683 0.004 0.57878 0.00941

hsa-miR-029a MIR-029a,c 0.876 < 0.0001 0.37490 0.07625

hsa-miR-029b MIR-029b-1,2 -0.279 0.295 -0.06469 0.40593

hsa-miR-029c MIR-029a,c 0.643 0.007 0.12518 0.32207

hsa-miR-030a-3p MIR-030a,e 0.224 0.405 -0.51751 0.02003

hsa-miR-030c MIR-030c-1,2 0.567 0.022 -0.28793 0.13976

hsa-miR-030d MIR-030d 0.491 0.053 0.31596 0.11660

hsa-miR-030e-3p MIR-030a,e 0.354 0.178 -0.18962 0.24092

hsa-miR-031 MIR-031-P -0.412 0.113 -0.08562 0.37628

hsa-miR-032 MIR-032 0.451 0.079 0.66974 0.00227

hsa-miR-033 MIR-033 0.183 0.498 -0.02136 0.46872

hsa-miR-034a MIR-034a 0.755 0.001 0.13836 0.30467

hsa-miR-034aN MIR-034a 0.727 0.001 -0.14061 0.30175

hsa-miR-034b MIR-034b -0.588 0.017 -0.12820 0.31805

hsa-miR-034c MIR-034c 0 1 0.00000 0.50000

hsa-miR-034cN MIR-034c 0 1 0.00000 0.50000

hsa-miR-092N MIR-092-1 0.233 0.384 -0.21403 0.21303

hsa-miR-092N MIR-092-2-P -0.39 0.135 -0.14858 0.29144

hsa-miR-093 MIR-093 0.446 0.083 -0.20052 0.22825

hsa-miR-095 MIR-095 0.404 0.12 -0.48102 0.02963

hsa-miR-096 MIR-096-P 0.298 0.261 0.24300 0.18225

hsa-miR-098 MIR-098 0.854 < 0.0001 0.51564 0.02046

hsa-miR-099a MIR-099a 0.585 0.017 -0.26063 0.16480

hsa-miR-099b MIR-099b 0.386 0.14 -0.53726 0.01593

hsa-miR-100 MIR-100 0.941 < 0.0001 0.89033 < 0.0001

hsa-miR-101 MIR-101-1 -0.184 0.496 -0.02577 0.46227

hsa-miR-101 MIR-101-2 -0.135 0.619 0.68827 0.00160

hsa-miR-103 MIR-103-1,2 0.914 < 0.0001 0.48609 0.02813

hsa-miR-105 MIR-105-1,2 -0.16 0.554 -0.21435 0.21268

hsa-miR-106a MIR-106a-P 0.239 0.372 0.09714 0.36022

hsa-miR-106b MIR-106b 0.9 < 0.0001 0.79738 0.00011

hsa-miR-107 MIR-107 0.547 0.028 0.73696 0.00056

hsa-miR-108 MIR-108 -0.071 0.793 0.00000 0.50000

hsa-miR-122a MIR-122a -0.217 0.42 0.50642 0.02266

hsa-miR-124a MIR-124a-1,2,3 0 1 0.00000 0.50000

hsa-miR-125a MIR-125a 0.595 0.015 -0.26899 0.15687

hsa-miR-125b MIR-125b-1 0.799 0 0.35778 0.08682

hsa-miR-125b MIR-125b-2 0.718 0.002 0.00205 0.49699

hsa-miR-126 MIR-126 0.821 < 0.0001 0.78681 0.00015

hsa-miR-126* MIR-126 0.816 0 0.82973 < 0.0001

Continued

323


hsa-miR-127 MIR-127 -0.827 < 0.0001 -0.39102 0.06712

hsa-miR-128a MIR-128a 0 1 0.00000 0.50000

mmu-miR-129-2 MIR-129-2 -0.281 0.292 0.00000 0.50000

hsa-miR-130a MIR-130a-P -0.574 0.02 -0.33159 0.10481

hsa-miR-130aN MIR-130a-P -0.498 0.05 -0.32663 0.10846

hsa-miR-130b MIR-130b 0.13 0.63 -0.14030 0.30214

hsa-miR-132 MIR-132 0.843 < 0.0001 -0.00694 0.48983

hsa-miR-133a MIR-133a-1,2 -0.217 0.419 -0.41368 0.05560

hsa-miR-134 MIR-134 -0.292 0.272 -0.19614 0.23329

hsa-miR-135a MIR-135a-1,2 0.755 0.001 -0.21921 0.20734

hsa-miR-135b MIR-135b-P 0.852 < 0.0001 -0.30854 0.12248

mmu-miR-137 MIR-137* 0.371 0.158 0.67248 0.00216

hsa-miR-139 MIR-139 -0.024 0.93 0.57834 0.00947

hsa-miR-140 MIR-140 -0.321 0.225 -0.02641 0.46132

hsa-miR-141 MIR-141 0.43 0.097 0.05419 0.42101

hsa-miR-142-3p MIR-142-P -0.571 0.021 -0.01849 0.47291

hsa-miR-142-5p MIR-142-P -0.567 0.022 -0.16703 0.26819

hsa-miR-143 MIR-143 0.759 0.001 -0.10653 0.34728

hsa-miR-145 MIR-145-P 0.939 < 0.0001 -0.12427 0.32328

hsa-miR-146 MIR-146 -0.167 0.535 -0.10739 0.34610

hsa-miR-146b MIR-146 -0.154 0.57 -0.27217 0.15392

hsa-miR-148a MIR-148a-P 0.087 0.75 -0.13131 0.31393

hsa-miR-148b MIR-148b-P 0.679 0.004 -0.02773 0.45940

hsa-miR-149 MIR-149 -0.492 0.053 0.34013 0.09870

hsa-miR-150 MIR-150 -0.171 0.525 -0.05861 0.41464

hsa-miR-152 MIR-152 0.873 < 0.0001 -0.13685 0.30664

hsa-miR-153 MIR-153-1,2 0.483 0.058 -0.33352 0.10341

hsa-miR-154 MIR-154 -0.073 0.789 0.83900 < 0.0001

hsa-miR-154* MIR-154 0.276 0.3 0.89514 < 0.0001

hsa-miR-155 MIR-155 0.936 < 0.0001 0.79543 0.00012

hsa-miR-181a MIR-181a,c 0.946 < 0.0001 0.72170 0.00080

hsa-miR-181b MIR-181b-1,2 0.311 0.24 -0.13210 0.31289

hsa-miR-181c MIR-181a,c 0.926 < 0.0001 0.66344 0.00254

hsa-miR-183 MIR-183 0.576 0.019 0.33014 0.10586

hsa-miR-184 MIR-184 -0.186 0.491 -0.20374 0.22458

hsa-miR-186 MIR-186-P 0.755 0.001 0.33770 0.10041

hsa-miR-187 MIR-187 -0.128 0.637 0.37749 0.07473

hsa-miR-188 MIR-188b-P -0.008 0.976 0.37749 0.07473

hsa-miR-190 MIR-190 -0.003 0.991 -0.48602 0.02815

hsa-miR-191 MIR-191 -0.508 0.045 -0.10806 0.34519

hsa-miR-192 MIR-192 -0.4 0.125 -0.29203 0.13621

hsa-miR-193 MIR-193 0.029 0.916 0.25668 0.16862

hsa-miR-194 MIR-194-1,2 -0.436 0.091 -0.33974 0.09897

hsa-miR-195 MIR-195-P -0.531 0.034 -0.37283 0.07748

hsa-miR-196a MIR-196a-1 0.214 0.425 0.13614 0.30757

hsa-miR-196b MIR-196b 0.662 0.005 0.68659 0.00165

Continued

324


hsa-miR-197 MIR-197 -0.508 0.044 -0.31801 0.11501

hsa-miR-199a MIR-199a-2-P 0.241 0.368 0.50014 0.02425

hsa-miR-199b MIR-199b-P -0.559 0.024 0.13411 0.31024

hsa-miR-200a MIR-200a-P -0.408 0.117 -0.45630 0.03782

hsa-miR-200b MIR-200b 0.36 0.171 -0.33746 0.10058

hsa-miR-210 MIR-210 -0.24 0.37 0.42991 0.04826

hsa-miR-210N MIR-210 -0.245 0.36 0.44788 0.04095

hsa-miR-211 MIR-211 -0.289 0.277 0.10396 0.35080

hsa-miR-212 MIR-212 0.754 0.001 0.05598 0.41843

hsa-miR-213 MIR-213 0.784 0 -0.02345 0.46566

hsa-miR-214 MIR-214 -0.7 0.003 -0.26505 0.16058

hsa-miR-215 MIR-215 0.088 0.745 0.16477 0.27099

hsa-miR-216 MIR-216 0.176 0.515 0.00000 0.50000

hsa-miR-217 MIR-217 0.653 0.006 -0.19435 0.23538

hsa-miR-218 MIR-218-1,2 0.937 < 0.0001 0.26708 0.15866

hsa-miR-219 MIR-219-1,2 0.543 0.03 0.48877 0.02736

hsa-miR-220 MIR-220 0 1 0.00000 0.50000

hsa-miR-221 MIR-221 0.871 < 0.0001 0.13328 0.31134

hsa-miR-222 MIR-222-P 0.794 0 -0.46476 0.03485

hsa-miR-223 MIR-223 0.54 0.031 -0.23955 0.18578

mmu-miR-224 MIR-224 0.574 0.02 -0.39486 0.06506

hsa-miR-296 MIR-296 -0.406 0.118 -0.40501 0.05983

hsa-miR-299-3p MIR-299-P -0.403 0.122 0.09685 0.36061

hsa-miR-301 MIR-301 0.855 < 0.0001 0.34673 0.09414

hsa-miR-302a MIR-302 0 1 -0.21158 0.21575

hsa-miR-302a* MIR-302 0 1 0.00000 0.50000

hsa-miR-302b MIR-302b 0.207 0.441 0.48377 0.02881

hsa-miR-302c MIR-302c -0.382 0.144 -0.13736 0.30598

hsa-miR-302c* MIR-302c 0 1 0.57278 0.01020

hsa-miR-302d MIR-302d -0.073 0.787 0.00000 0.50000

hsa-miR-320 MIR-320 -0.129 0.635 -0.29220 0.13606

hsa-miR-321 MIR-321 0.624 0.01 0.36584 0.08173

hsa-miR-323 MIR-323 0.281 0.292 0.22682 0.19912

hsa-miR-324-3p MIR-324-P -0.511 0.043 -0.39547 0.06474

hsa-miR-324-5p MIR-324-P -0.253 0.344 -0.49403 0.02589

hsa-miR-325 MIR-325 -0.297 0.264 0.00000 0.50000

hsa-miR-326 MIR-326-P -0.197 0.464 -0.26311 0.16242

hsa-miR-328 MIR-328 -0.423 0.102 -0.46686 0.03414

hsa-miR-330 MIR-330 0.215 0.424 -0.43491 0.04614

hsa-miR-331 MIR-331-P -0.31 0.243 -0.27300 0.15315

hsa-miR-335 MIR-335 -0.16 0.554 -0.18301 0.24875

hsa-miR-337 MIR-337 -0.166 0.539 0.00000 0.50000

hsa-miR-338 MIR-338 -0.472 0.065 -0.30799 0.12292

hsa-miR-339 MIR-339 0.211 0.433 -0.35844 0.08640

hsa-miR-340 MIR-340 0.785 0 0.85806 < 0.0001

hsa-miR-342 MIR-342 0.278 0.297 -0.44967 0.04027

Continued

325


hsa-miR-345 MIR-345 -0.599 0.014 -0.33898 0.09951

hsa-miR-346 MIR-346 0.407 0.117 0.04167 0.43911

hsa-miR-361 MIR-361 -0.588 0.017 -0.36522 0.08212

hsa-miR-367 MIR-367 0.167 0.536 -0.32884 0.10683

hsa-miR-368 MIR-368 -0.278 0.297 0.28113 0.14576

hsa-miR-369 MIR-369 0.364 0.166 0.35733 0.08711

hsa-miR-370 MIR-370 0.304 0.252 0.95425 < 0.0001

hsa-miR-371 MIR-371 0.347 0.188 0.04957 0.42767

hsa-miR-372 MIR-372 -0.388 0.137 -0.23649 0.18894

hsa-miR-373 MIR-373 -0.087 0.749 -0.14928 0.29055

hsa-miR-374 MIR-374-P 0.465 0.07 0.41782 0.05366

hsa-miR-375 MIR-375 0.56 0.024 0.19890 0.23011

hsa-miR-376a MIR-376 0.841 < 0.0001 0.99230 < 0.0001

hsa-miR-377 MIR-377 0.464 0.07 -0.18468 0.24676

hsa-miR-378 MIR-378 -0.488 0.055 0.17028 0.26419

hsa-miR-379 MIR-379 0.792 0 0.99176 < 0.0001

hsa-miR-380-3P MIR-380 -0.055 0.839 0.98244 < 0.0001

hsa-miR-380-5p MIR-380 0.477 0.062 0.43793 0.04489

hsa-miR-381 MIR-381 -0.129 0.634 -0.26214 0.16335

hsa-miR-382 MIR-382 0.096 0.725 -0.00827 0.48788

hsa-miR-383 MIR-383 0.078 0.773 -0.06868 0.40023

hsa-miR-384 MIR-384 0 1 0.00000 0.50000

hsa-miR-422b MIR-422b -0.547 0.028 0.28046 0.14636

hsa-miR-423 MIR-423 -0.565 0.022 -0.53373 0.01661

mmu-miR-424 MIR-424 0 1 0.00000 0.50000

hsa-miR-425 MIR-425 0.444 0.085 -0.02134 0.46874

hsa-miR-020b MIR-020 0.12952 0.31630

hsa-miR-147 MIR-147 -0.02312 0.46613

hsa-miR-152N MIR-152 -0.12697 0.31969

hsa-miR-182* MIR-182 0.00336 0.49508

hsa-miR-196a MIR-196a-2 0.17554 0.25776

hsa-miR-199a MIR-199a-1-P -0.49145 0.02660

hsa-miR-199a* MIR-199a-1-P -0.52976 0.01741

hsa-miR-199-s MIR-199a-1-P -0.51851 0.01981

hsa-miR-199a* MIR-199a-2-P 0.43724 0.04517

hsa-miR-199-s MIR-199a-2-P 0.46991 0.03313

hsa-miR-200bN MIR-200b 0.389 0.136

hsa-miR-200c MIR-200c -0.027 0.92

hsa-miR-200cN MIR-200c -0.023 0.933

hsa-miR-203 MIR-203 0.646 0.007

hsa-miR-204 MIR-204 -0.281 0.292

hsa-miR-205 MIR-205 0.903 < 0.0001

hsa-miR-206 MIR-206 0.268 0.316

hsa-miR-208 MIR-208 0 1

Lee Eun Joo

Documents

Transcript of Lee Eun Joo