1

1

Lecture 16, 16 Oct. 2008Populations Species Laws

Conservation BiologyECOL 406R/506R

University of ArizonaFall 2008

Bonine & Epps

506 meet at 1505h today

Upcoming ReadingsToday 16 October (Laws etc.): Primack Ch6, ESA, SDCPTues 21 October : Primack Ch7Thurs 23 October (River Turtles, Ed Moll): Chapter 7 of his bookTues 28 October: 2nd Midterm

Q5 Dues Tuesday 2359h, if you choose to answer it

-506 today 2

Lab Friday-Sunday 17-19 October (leave 1230 Friday [west side BSE], return ~1830h on Sunday)

ID/VISA, notebook, pencil/pen, snacks, day pack, $?,

sunscreen, FLASHLIGHT or HEADLAMP, hat, water bottle (Ashwin, this includes you)

camera?, binos?, toiletries?

There is a kitchen with refrigerators: food (Sat dinner and Sun bkfst as group) [plate, cup, utensils?] KB will bring 2 coolers and 15 gal water

close-toed shoes, TEVAs?, layers, pants, ready to get wet and muddy?, sleeping bag, sheet?, tent & sleep pad? (room for >10 in house)

-Readings on Course Website-(don’t forget lab write-ups! – see syllabus)

85-50 FPartly CloudyNo Rain Predicted

LOS FRESNOSSonora, Mexico

MUSICIANS?

3

3) Fisheries Guest Speaker Next WeekThis is Colton, the president of the UA chapter of the American Fisheries Society and Trout Unlimited.I just wanted to let you know about a guest speaker that we are having next week, so that you could let RNR and whoever else know in case they would like to come.Julie Carter (formerly Meka) of the AZGFD is coming on Tuesday, October 21st at 5:30 pm to give a presentation on Arizona's native trout. She is the native trout Conservation Coordinator for the state of Arizona. She generally presents on the biology of the apache and gila trout, where they are found, where you can legally fish for apaches, volunteer opportunities if you want to become involved, etc. It should be a good presentation. I'd like as many people as possible to come out to show our support for her, as she is coming down from Phoenix in rush hour. It is going to be in room 124 of the BioScience-East building.Thank you! If you have any questions, feel free to e-mail me.Colton Finchcolton@email.arizona.edu

4

5) RNR 696A: Restoration Ecology, Spring 2009Restoration ecology is an important emerging strategy for the protection and management of biological populations, communities and ecosystems.¦nbsp; Ecological restoration is the process of assisting the recovery of an ecosystem that has been degraded, damaged, or destroyed by human activities or natural processes. In today’s world, such impacts are pervasive and increasing; thus, ecological restoration is growing in importance, as more and more ecosystems become affected by humanimpacts. In this seminar, we will review the basic theory of restoration ecology, which draws on disciplines of ecology, soil science, hydrology, landscape ecology, and other fields. Using case studies, we will examine how restoration has been used to improve the health and function a variety of terrestrial and aquatic ecosystems.¦nbsp; We will also address the relevance of restoration ecology for preserving biodiversity in a world of rapidly changing climate, land use, and global human population.The course is offered as a graduate seminar. Advanced undergraduates who wish to join the class should contact the instructor to arrange an independent study.Instructor: Don Falk (dafalk@u.arizona.edu).

5

7) Develop Communication Skills In Natural Resources!Join us in WFSC 595A BIOPOLITICS

Dr. Scott Bonar, Spring 2008· Need to work with angry landowners on a wildlife issue?

· Need to negotiate with other agencies regarding management responsibilities? · Need to speak about endangered species in front of a hostile audience?

· How do you keep your important conservation program going in the face of huge budget cuts?

Learn the political and communication skills you need to survive in the natural resources profession from a variety of agency, private and university experts. Dr. Bonar has written a book on the subject (The conservation professional's guide to working with people), and

given workshops to groups including the AZ Game and Fish Department, U.S. Fish and Wildlife Service, TX Parks and Wildlife, and the American Fisheries Society.

Reviews on book and these methods:“A ‘must read’ for the conservation professional”

--Ecology“Reassuring, wise and entertaining guidance”

--Paul R. Ehrlich, Stanford University and author of “The Population Bomb”“Simply too potentially helpful in heading off unnecessary difficulties.I am just sorry that

I did not have access to it sooner”--Quarterly Review of Biology

“This book is a guidepost and should be part of college curricula in every natural resources program”

--Mamie Parker, Assistant Director, USFWS6

13) Adaptation to Climate Change in the Desert Southwest Conferencesave the date January 22-23, 2009 Westward Look Resort, Tucson AZ

The University of Arizona¦nbsp; is hosting a climate change conference sponsored by the Institute for the Study of Planet Earth, James E.¦nbsp; Rogers College of Law, Climate Assessment for the Southwest, and the Program on Economics, Law, and the Environment.Scientists predict that climate change will exact a heavy toll upon the southwestern United States regardless of what is done to reduce greenhouse gas emissions. As a result, the southwestern United States is a test case for climate scientists, economists, lawyers, policymakers and national, state, tribal and community leaders across the nation. This conference will explore how we can adapt to these changes in a manner that reduces the environmental and social costs of climate change. Specifically, what can we do now to maximize the potential for a sustainable southwestern natural and human habitat? Join an outstanding group of scientists, scholars, and national and regional community leaders to take a hard look at one of the most powerful questions of our time: what will climate change mean for the southwest?¦nbsp; The keynote speaker is the 2005 Nobel Prize Laureate in Economics, Thomas Schelling.Go to http://www.law.arizona.edu/adaptationconference/¦nbsp; for conference info and registration.

2

7

19) Help Remove Giant Cane GrassI and several MWS Stewards have been involved with a volunteer effort to remove a giant cane grass (Arundo) from Sabino Canyon for the past year. We are teaming up with the U.S. Forest Service and the Sabino Canyon Volunteer Naturalists for 2 big volunteer removal events in November. Volunteers are needed to help cut and dig out the invasive plant Giant Reed (Arundo donax) from the creek bottom. This plant is threatening the natural wildlife habitat and may soon dominate the landscape if these fast-growing, water-loving plants are not removed. Tools are provided, but wear boots, a hat, long-sleeve shirt and long pants. Participants may want to bring a backpack, water and gloves.

When: Sunday, November 2nd and Sunday, November 9th

Time: 8:00 a.m. - 12:00 p.m.

Where: Sabino Canyon Recreation Area - meet at the Visitor's Center (5700 N Sabino Canyon Rd. -Tucson, AZ 85750)

What to bring: boots, a hat, long-sleeve shirt and long pants, backpack, water and gloves

To sign-up, email: tucson.arundo@gmail.com or for additional information visit: www.sahra.arizona.edu/education2/arundoThanks!CandiceCandice RupprechtStatewide CoordinatorArizona Master Watershed Steward ProgramUniversity of Arizona Cooperative ExtensionWater Resources Research Center350 N. Campbell Ave.Tucson, AZ 85719office: 520.792.9591 x.24cell: 520.275.1950

8

20) Graduate Positions (MS or Ph.D): Conservation Genetics & Snake Evolutionary EcologyOhio State University Graduate Position (MS or Ph.D) in Conservation Genetics in the lab of Dr. H. Lisle Gibbs, Department of Evolution, Ecology and Organismal Biology, Ohio State University.I am seeking a highly motivated student with a demonstrated ability to work independently for a lab and field-based project that will use DNA and isotope markers to source mallard ducks as part of an effort to further define the natural history of type A influenza viruses in wild birds. There will also be the option of pursuing other independent projects related to the ecology of type A influenza viruses. This project is in collaboration with Dr. Richard Slemons, College of Veterinary Medicine, Ohio State University. The position, currently funded by for one year with the expectation of additional funding in subsequent years, includes an annual stipend ($22,800/yr), full tuition waiver, partial coverage for health insurance and will begin in September 2009. Candidates should have prior experience with DNA-based genetic and/or isotope analysis and must be willing to work closely with agency personnel to coordinate sample collections and analyses.

Ph.D Position in Snake Evolutionary Ecology in the lab of Dr. H. Lisle GibbsI am seeking a Ph.D. student to join my research group starting in September 2009 to begin studies in the general area of snake evolutionary ecology. Recently, a major research focus of the lab has been investigating questions about the evolutionary, ecological, and functional basis of venom variation using Sistrurus rattlesnakes as a model system. I am interested in recruiting students who will build on the results of our previous venom research by developing their own projects in this area but am equally interested in students who are keen to develop other projects in the general area of snake evolutionary ecology. Students who are interested in research which combines both lab and field work are especially encouraged to apply.Guaranteed funding of over $23,000/yr for a minimum of 5 years (plus tuition and partial coverage of health benefits) is available through a combination of Graduate Teaching Assistantships, Research Assistantships, and University Fellowships.For more information on my lab, see my homepage:http://eeob.osu.edu/~eeob/gibbs/index.htmlFor information on the Department of Evolution, Ecology, and Organismal Biology at Ohio State University including our Graduate Program, see: http://eeob.osu.edu/Please send via email (gibbs.128@osu.edu) a letter of interest, transcripts and GRE scores and contact information for 3 references to H. Lisle Gibbs, Department of Evolution, Ecology and Organismal Biology, Ohio State University, Columbus OH 43210-1293 (PH: 614 688 3861). Review of applicants will begin 1 December 2008 and will continue until a suitable candidate is identified.

9

PVA Florida ManateeMarmontel et al. 1997

44% likelihood persist 1000 years

10% increase in mortality OR10% decrease in birth rate

10% decrease in mortality = lambda >1

= lambda <1

Boat-Manatee Collisions!10

MiscellaneousPrimack Ch 5, Extinctions

Millenium Ecosystem Assessment 8-35% species extinct by 2050 depending on biome and geography(= more than 35 species/day!)

Ne averages 11% N

What is the founder effect?Implications for adaptability?

11

Primack Ch 6

RelocationRestorationEx Situ Strategies

A few examples…

12

3

13

Either returned (18/18, <1km) or died? (7/7, 1-25km)

14

15

http://www.nwf.org/endangered/pronghorn.cfm

Sonoran PronghornESA listing 1967

The U.S. Fish and Wildlife Service set a population of 300 Sonoran pronghorn as its recovery goal. Some conservationists judge this to be unattainable, as viable desert habitat is limited and much of the Sonoranpronghorn's former range is now fragmented by development. Captive breeding and relocation is also a possibility… One critical step is reducing fawn mortality, which has ranged from about 75 to 100 percent in recent years. Scientists believe this high rate results primarily from poor environmental conditions.

16

17

BACKGROUNDThe Sonoran pronghorn antelope, the fastest terrestrialmammal on the American continent (clocked at 86.5 km per hour), isendangered. The species population fluctuates from a low of around 100 animals to a high of more than 250. Population trends correlate closely with climate: wet weather years allow for increased fawnpropagation and survival; the reverse is true during dry seasons. The Sonoran pronghorn’s habitat is located entirely on federal lands in southwestern Arizona. These lands are controlled by multiple federal agencies, including the U.S. Marine Corps, the U.S. Air Force, the U.S. Army National Guard, the Bureau of Land Management, the NationalPark Service, and the Fish and Wildlife Service. The Immigration and Naturalization Service and the Border Patrol also conduct activity (illegal alien patrols) in the pronghorn’s habitat.

18

The situation grew dire in summer of 2002. Neither the winter rains nor the monsoons came. It was the driest year on record. Wildlife biologists hoped that the pronghorn’s protected range could provide enough food to skirt through, but, without rain, seasonal water sources ran dry. The US population dwindled to 25 individuals, a tight genetic bottleneck. There was still a viable population of 600 animals in Mexico, but new mining and ranching development had begun to limit their habitat as well.

http://www.nps.gov/orpi/naturescience/pronghorn.htm

4

19

In 2004, scientists started a captive breeding program. Eleven animals were caught (not an easy task considering the animal’s elusive reputation), some taken from Mexico to provide for genetic diversity. A square mile of desert was set aside in a non-wilderness area of Cabeza Prieta National Wildlife Refuge. It took a few years and some supplemental food and water, but the captive population grew. The experiment seemed a success. Some of the male yearlings were released in 2006 and seemed to integrate well into the US population. A few more were released in the following two years. In 2008, another twenty-seven fawns were born, nudging the captive population to around 55 animals. Up to fifteen more yearlings are slated to be introduced during the winter of 2009. Biologists hope that the new shot of genetic material will keep the next generation resistant to disease and as wary as ever.

20

21

Last year, $5 million was spent on condor recovery efforts, including $1.2 million from the U.S. Fish and Wildlife Service. The San Diego Wild Animal Park and the Arizona-based Peregrine Fund spent more than $1 million each, and the Los Angeles Zoo, which operates on damaged birds, spent more than $500,000, according to the report.

CALIFORNIA’$ CONDOR$

Human aid has led to “inappropriate behavior” of the condors, which are attracted to people and man-made structures, the 57-page report found. The gregarious birds perch on utility poles, risking electrocution and, in Southern California, have taken to soaring with hang gliders and mingling with humans to pick through food wrappers. So much effort is required to feed, nurse and protect wild condors, the scientists wrote, “that one might argue that they constitute little more than outdoor zoo populations.”Since the last wild condor was captured in 1987, federal and state agencies, zoos and conservation groups have spent tens of millions of dollars breeding more than 300 birds in captivity. About 150 have been released to fly free over forests and deserts in California, Arizona, Utah, New Mexico and Baja California. Survival of freed condors doubted They depend on man-made ‘feeding stations’ of lead-free carcasses, a practice that has damaged their ability to forage. Scientists call for removal of such ammunition.By Margot Roosevelt, August 09, 2008 in print edition B-1 LA Times 22

By John Ritter, USA TODAYSAN FRANCISCO — One of the great feel-good environmental stories of the past 30 years is the recovery of the majestic California condor, North America's largest bird, a scavenger-turned-billboard for the campaign to save endangered species.On the brink of extinction, saved by a captive-breeding program, the condor population has grown from just 22 birds in 1982 to 289 today; 135 are in the wild and more are released every year.Even so, condors have failed to gain a secure foothold in the hills and deserts of California and Arizona because of lead poisoning, the most often diagnosed cause of death, environmentalists say. Environmental groups say the most likely source is condors' eating of game that was shot by hunters using lead bullets. Frustrated that most hunters have not switched to substitutes, the Natural Resources Defense Council (NRDC) and other groups notified California officials in July that they will sue under the Endangered Species Act to force a ban.

Lead poisoning eyed as threat to California condor

23

http://cres.sandiegozoo.org/index.html 24http://www.montereybayaquarium.org/cr/research.asp

5

25

http://www.nativeseeds.org/v2/default.php

26

Applications of Genetics to Conservation Biology

Dr. Melanie CulverSNR, UA

27

32 Puma subspecies,as of the early 1900s

28

Modern and museum puma samples collected, total of 315

29

-Geographic clustering of individuals

~Six groups identified

2 distance methods agree

30

-Subspecies associateinto same 6 groups

-Statistical support from bootstrap values

-2 distance methods agree

6

31

Fst = 0, or <0.01 indicate little divergence among pops.

Wright’s Fixation Index

Fst > 0.1 indicate much divergence among pops.

Hardy Weinberg Equilibrium, two alleles: p, qExpected heterozygosity = 2pq

Fst = (Ht-Hs)/Ht (H= heterozygosity)

Total Pop.Subpopulations

32Groom, Meffe, & Carroll 2006

FIS, FIT, FST

33

F statistics (Sewall Wright)

FIS

FIT

FST

Genetic variation among individuals in subpopulation

Genetic variation among individuals in total population

Genetic variation among subpopulations in total population

34

Wright’s Fst Estimates and Slatkin’s Migration Estimates

(Migrants/generation)(Fst near 0 = little divergence)

35

Absolute number of migrants exchanged per generation

between populationsMethod:• Slatkin’s M = 2.9 (minimum)• Private allele method = 5.5

Gene flow occurred historically at a rate greater than one migrant per generation

Gopherus agassizii, Taylor Edwards:

36

Mitochondrial DNA Sequence Data

Microsatellites (DNA fingerprinting)

7

37

mtDNA vs. nuclear microsatellites

• Mitochondrial– from maternal lineage– no recombination with paternal genes– evolves more quickly than coding nuclear DNA

• Microsatellites– nuclear DNA that evolves very fast– short repeats of 2-4 base pairs (bps)ACGACGACGACGACGACGACGACGACG

38

Major restrictions to gene flow:-Amazon River-Rio Parana-Rio Negro-Andes?

Summary:-6 groups identified using microsatellites-mtDNA haplotypesoverlayed onto map,supports 6 groups

-Location of 2 ancestral haplotypes

39

Fossil Record versus Molecular Divergence

Estimates• Oldest fossils in North and South

America date to 0.2-0.3 Mya• From mtDNA mutation rate of

1.15%/My, divergence for extant puma lineages is 390,000 years ago

• From mutation rate of 5 x 10-9/yr for microsatellite flanking regions, pumas are less than 230,000 years old

40

Historical Inferences• Extant pumas originated in Brazillian

Highlands (ancestral haplotypes)• Fossil record suggests dispersal to

NA soon after the common origin in Brazil

• 2 historical radiation events occurred

41

-Ancestor to puma crosses land-bridge ~2-3 Mya

-Puma origin in Brazilian Highlands ~300,000 ya

42

2 Major historical radiations

-One locally distributed

-One broad ranging

8

43

Federal LawsState Laws

Administrative Laws

Treaties

Policies Agreements

Executive Orders

44

Domestic

Laws arose 1970’s following concern of 1950s+

Laws reflect current social values but also persistinto the future…

Advocacy

ConBio: science and empirical data + law/policy?

45

1872 Yellowstone NP1891 Forest Reserve Act1916 NPS

1964 Wilderness Act1965 Land and Water Conservation Fund Act

-acquire lands, use resource revenues1969/1970 NEPA (EIS)

-think about environment up front1970 Clean Air Act1972 Clean Water Act1973 ESA (species focus)

endangered, threatened, critical habitatrecovery plan

1980 Superfund (1995 Brownfields) 46

Litigatione.g., polluters liable, citizen involvement, NGOs,

public comment, transparency

EDF 1968people have right to clean environment

1978 TVA vs. Hill (Snail darter)God Squad (economic impact vs. habitat)

Endangered Species Committee

47

Conservation Easementsremove development rights -->value decreases so less in taxes

reversible?

48

National Environmental Policy Act of 1969(NEPA)

Requires that all Federal Agencies prepare detailed environmental impact statements for “every recommendation or report on proposals for legislation and other major Federal actions that significantly affect the quality of the human environment.”

Federal Hook or Nexus? (land, funds, permits)