Lago News 2009
description
Transcript of Lago News 2009
![Page 1: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/1.jpg)
1
#5
LAGONEWS APRILE 2009
01BrochureMilano.indd 1 16-04-2009 11:36:17
![Page 2: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/2.jpg)
LAGO HOMESDesign Frammenti
Una storia, una vita, un modo di usare lo spazio
che ci sta attorno… ognuno di noi vive lo spazio
dell’abitare in modo unico, irripetibile. I prodotti
LAGO contengono la possibilità di dare un’immagine
a questa unicità. Da qui l’idea di LAGO HOMES,
per dare una forma unica alla propria casa,
sperimentando soluzioni che fondano architettura
e design. Ogni casa diventa una storia, i prodotti
diventano i mattoni con cui costruire questa storia,
con cui fare architettura. Il progetto LAGO HOMES
segna l’inizio di una sperimentazione e nel contempo
riassume lo spirito LAGO, gli ingredienti della nostra
passione, del nostro lavoro attorno a ciò da cui non
possiamo prescindere: HOME.
One story, one life, one way to use the space
surrounding us: each of us live his/her living space in
a unique and unrepeatable way. The LAGO
products contain the possibility to offer a picture
of such uniqueness. Hence the idea of LAGO
HOMES, in order to give an outstanding shape to
people’s home, experimenting solutions which melt
architecturte with design. Each home becomes a
story, and the products become the bricks
with which people build their story, with which they
can become architects. The LAGO HOMES project
marks the beginning of a testing process and, at
the same time, summarizes the LAGO spirit, the
ingredients of our passion, of our work on this and
from which we cannot do without: HOME.
1
2
hOMe
Prodotti utilizzati: Air, Now.
Product used: Air, Now.
Having Only More Earth
Prodotti utilizzati: 36e8 cucina,
36e8 e Now.
Product used: 36e8 cucina,
36e8 and Now.
1
2
02BrochureMilano.indd 2 16-04-2009 11:35:34
![Page 3: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/3.jpg)
3
1
2
03BrochureMilano.indd 3 16-04-2009 11:35:54
![Page 4: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/4.jpg)
36e8
Basato su un modulo da 36,8 cm x 36,8 cm questo
sistema dona allo spazio forma e sostanza creando
volumi di differente lunghezza da accostare gli
uni agli altri con innumerevoli opportunità di
contenimento.
Con 36e8 tutti possono diventare i designer
del proprio spazio. Come? Accostando i moduli
36e8 per disegnare la composizione che soddisfa
maggiormente gusto e necessità.
Based on a 36.8 cm x 36.8 cm module, this system
gives space a form and substance by creating
volumes of different lengths that can be matched
together in endless combinations.
36e8 means that everyone can design their own
home spaces. How? 36e8 modules can be mixed
and matched to design compositions meeting every
taste and requirement.
1
36e8: comp. 170
Contenitori in vetro lucido lilla,
paglia, bianco e in vetro
opaco nero.
Lilla, paglia, bianco polished
glass and nero opaque glass
storage units.
L 358,8 H 207 P 27/40,6/56
Prezzo a partire da/Price from
€ 4.242
1 36e8: comp. 164
Contenitori in vetro lucido
grafi te, aragosta, mandorla,
salvia, sole, verde acido,
bosco e fumo.
Grafi te, aragosta, mandorla,
salvia, sole, verde acido,
bosco and fumo polished
glass storage units.
L 368 H 202,4 P 27/40,6/56
Prezzo a partire da/Price from
€ 4.140
2
04BrochureMilano.indd 4 16-04-2009 11:36:45
![Page 5: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/5.jpg)
05BrochureMilano.indd 5 16-04-2009 11:37:24
![Page 6: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/6.jpg)
36e8: comp. 171 Contenitori in vetro lucido bianco, amaranto e in vetro opaco nero.
Bianco, amaranto polished glass and nero opaque glass storage units.
L 368 H 211,6 P 27/40,6/56 Prezzo a partire da/Price from € 4.945
06BrochureMilano.indd 6 16-04-2009 11:38:03
![Page 7: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/7.jpg)
7
07BrochureMilano.indd 7 16-04-2009 11:38:35
![Page 8: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/8.jpg)
36e8: comp. 161
Contenitori in vetro lucido
bianco, lilla, verde acido,
paglia e grafi te.
Bianco, lilla, verde acido,
paglia and grafi te polished
glass storage units.
L. 772,8 - H. 259,3 - P. 27/40,6
Prezzo a partire da/Price from
€ 10.643
36e8: comp. 150
Contenitori in vetro lucido
kaki, verde acido e in vetro
opaco bianco.
Kaki, verde acido polished
glass and bianco opaque glass
storage units.
L 404,8 H 222,5 P 27/40,6/56
Prezzo a partire da/Price from
€ 5.076
36e8: comp. 173
Contenitori in vetro lucido
bianco, paglia, spago e sole.
Bianco, paglia, spago and sole
polished glass storage units.
L 515,2 H 167,3 P 27/56
Prezzo a partire da/Price from
€ 6.286
1
2
3
1
2
3
08BrochureMilano.indd 8 16-04-2009 11:39:23
![Page 9: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/9.jpg)
9
30MM
Non importa dove importa come
30MM è l’esile spessore dei fi anchi di questo
nuovo sistema di librerie LAGO che grazie ad
uno speciale attacco a muro può essere fi ssato
a parete e anche sospeso. Questa versatilità
consente di creare composizioni fantasiose come
alberi, nuvole, forme astratte, semplici o eleganti.
Il sistema 30MM è disponibile anche con fi anchi e
ripiani di spessore 50mm e 80mm.
30MM - LAGO’s new slim line bookshelf system
that, thanks to a special wall-mounting system,
can be secured to or suspended from walls.
Such versatility can be exploited to create
imaginative compositions such as trees, clouds,
abstract, simple or elegant shapes.
The 30MM system is also available with sides and
tops in 50mm and 80mm thicknesses.
1
2
30MM: comp. 15/16
Laccato castagno e bosco.
Castagno and bosco
lacquering.
L. 281,6 - H. 369,7 - P. 38,4
L. 202 - H. 296,1 - P. 38,4
Prezzo a partire da/Price from
€ 2.163 (comp.15)
€ 3.478 (comp.16)
30MM: comp. 31
Laccato aragosta.
Aragosta lacquering.
L. 401 - H. 184 (H. 202,4 da
terra/from fl oor) - P. 38,4
Prezzo a partire da/Price from
€ 2.889
1
2
09BrochureMilano.indd 9 16-04-2009 11:40:32
![Page 10: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/10.jpg)
Nasce la cucina non cucina 36e8 cucina è un progetto che alleggerisce la
percezione di ingombro e pienezza delle cucine viste
sino ad oggi; l’approccio progettuale è totalmente
rivoluzionario: nasce la cucina-non-cucina che si
sgancia dai rigidi schemi compositivi e consente di
creare volumi e forme sorprendenti.
Questa innovazione dà voce alla “quarta dimensione
del progetto” che è in grado di evocare alberi,
nuvole, aragoste, etc…
I contenitori, posizionabili orizzontalmente e
verticalmente, possono essere composti in modo
infi nito su un’ipotetica griglia (36,8cm x 36,8cm)
che lascia libertà di composizione, tenendo equilibri
formali eccellenti.
Agli ambienti domestici, spesso sovraccarichi di
oggetti dalle elevate prestazioni tecnologiche, LAGO
crede invece nel bisogno di più amore, armonia
e calore. L’innovazione semiotica della “quarta
dimensione”, pur essendo accattivante, garantisce
risposte eccellenti in termini di praticità e funzionalità
senza dimenticare che la funzione primaria rimane
cucinare.
1
The 36e8 cucina project today takes a lighter
approach to perception, overall dimensions and
solidity for kitchen suites; this design approach is
totally revolutionary: our kitchen-non-kitchen suites
break away from rigid outlines and modularity to
create astonishing volumes and forms.
This innovation expresses the “fourth project
dimension” to evoke trees, clouds, lobsters, etc…
Storage units can be positioned horizontally or
vertically and combined in infi nite ways around a
hypothetical grid (36.8cm x 36,8cm) ensuring both
design freedom and excellent formal composition.
Household settings are often over-loaded with
high-tech devices - yet LAGO on the other hand
believes that more love, harmony and warmth are
essential. The semiotic innovation of the “fourth
dimension” is both very attractive and also ensures
excellent responses in practical and functional
terms without forgetting that the primary function is
“cooking”. The 36e8 kitchen suites system develops
around three macro areas: N.O.W bases, wall units
and cupboards.
Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.
10BrochureMilano.indd 10 16-04-2009 13:50:04
![Page 11: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/11.jpg)
11
1
36e8 Cucina: comp. 200
Laccato kaki, prato, bianco,
bosco, salvia e castagno
con top “Laminglass” e ante
in vetro lucido.
Lacquered kaki, prato, bianco,
bosco, salvia and castagno
with “Laminglass” top and
door panels in polished glass.
L. 460 - H. 240,4 - P. 40,6/67
Prezzo a partire da/Price from
€ 9.400 (Elettrodomestici e
dispensa esclusi/ Appliances
and storeroom excluded)
Dispensa N.O.W.
Laccato prato, bosco,
salvia e castagno con ante
in vetro lucido.
N.O.W. Storeroom.
Lacquered prato, bosco,
salvia and castagno with
door panels in polished glass.
L. 294,8 - H. 227 - P. 67
1
2
2
1
11BrochureMilano.indd 11 16-04-2009 11:52:09
![Page 12: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/12.jpg)
1
36e8 Cucina: comp. 209 Laccato aragosta con top “Laminglass” e ante in vetro lucido. Dispensa N.O.W. Laccato kaki, nero e bianco con ante in vetro lucido.
Lacquered aragosta with “Laminglass” top and door panels in polished glass. N.O.W. Storeroom. Lacquered kaki, nero and bianco with door panels in polished glass.
L. 441,6 - H. 202 - P. 40,6/67 Prezzo a partire da/Price from € 6.410 (Elettrodomestici e dispensa esclusi/Appliances and storeroom excluded).
12BrochureMilano.indd 12 17-04-2009 11:01:15
![Page 13: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/13.jpg)
13
13BrochureMilano.indd 13 17-04-2009 11:02:41
![Page 14: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/14.jpg)
1
2
14BrochureMilano.indd 14 16-04-2009 11:59:36
![Page 15: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/15.jpg)
15
Dispensa N.O.W.
Trasferisce in cucina tutti
i plus della zona notte.
Sostituisce la dispensa-
vano elettodomestici con
un vero e proprio armadio
da top di gamma, con
guadagni in termini di
robustezza, risparmio di spazi,
confi gurabilità, semplicità di
forme, qualità delle fi niture e
molteplici opzioni di apertura
dei vani.
Move to the kitchen all the
features from the bedroom.
Plays the role of cupboard
and contains all the
electric devices (apart from
dishwasher), but still keeps
his identity of high quality
wardrobe: is tough as anyone
else, saves more space due to
his special modularity, same
high quality fi nishes of our
successfull wardrobe , clean
design and many different
opening systems.
Touch System
Ovviato il problema delle
impronte di farina su pensili
e cassettoni da aprire
eseguendo acrobazie circensi.
È suffi ciente utilizzare testa,
gambe, gomiti, ginocchia
et voilà!
The Touch System helps you
in bad moments.
How to open a wall-cabinet
after kneading pizza? just a
masterstroke!
How to pick up the knife from
the drawer while cleaning
the fi sh? You only need a
knee (pay attention to your
kneecap, by the way).
Tecnologia nascosta
Andando un po’
controcorrente, abbiamo
deciso di privilegiare armonia,
calore e forme piuttosto
che proporre un ambiente
sovraccarico di tecnologie.
La soluzione?
Le abbiamo nascoste.
Lavastoviglie, cappa, forno,
frigorifero, congelatore sono
ospitati e protetti all’interno
dei moduli.
Clean design hides
technology. The whole project
aim to lighten the perception
of the ordinary kitchen.
Usually cumbersome and full
of things. We prefer balance,
colour, warmth, clean shapes.
That’s why used all of these
solution to keep technology
in hiding. Fan and dishwasher
are hidden into 36e8 cabinets.
Oven, fridge and freezer are
embraced by the N.O.W.
cupboard instead.
1
2
3
3
15BrochureMilano.indd 15 16-04-2009 12:01:50
![Page 16: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/16.jpg)
36e8 Cucina: comp. 204
Laccato sole e blu oltremare
con top “Laminglass” e ante in
vetro lucido, frigo free-standing.
Lacquered sole and blu oltremare
with “Laminglass” top and
door panels in polished glass,
free-standing refrigerator.
L. 441,6 - H. 195 - P. 40,6/67
Prezzo a partire da/Price from
€ 6.496 (Elettrodomestici
esclusi/Appliances excluded).
36e8 Cucina: comp. 217
Laccato bianco con top
“Laminglass” e ante in
vetro lucido e dispensa.
Lacquered bianco with
“Laminglass” top and
door panels in polished
glass and storeroom.
L. 386,4 - H. 202,4 - P. 40,6/67
Prezzo a partire da/Price from
€ 6.323 (Elettrodomestici
esclusi/Appliances excluded).
36e8 Cucina: comp. 215
Laccato rosso con top e ante
in vetro lucido, dispensa.
Lacquered rosso with top and
door panels in polished glass,
storeroom.
L. 220,8 - H. 93,2 - P. 137
(Isola/Island)
Prezzo a partire da/Price from
€ 14.777 (Elettrodomestici
esclusi/Appliances excluded).
1
2
3
2
3
1
16BrochureMilano.indd 16 16-04-2009 12:02:43
![Page 17: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/17.jpg)
17
PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPooooooiiiiiiiiinnnnnnnnntttttttt SSSSSSSSSSSpppppppppppppaaaaaaaaaccccccccceeeeeeeeeeee SSSSSSSSSttttttttooooooooorrrrrrrrrrrre
PPPPPPoPoPoPoPoPoPPPoPPPPPPP ininininnint,t,t,t,t,t P P P PPPoioioioioioo ntntntntnntntnn XXX X XXL,L,L,L,L, SSS SSSSpapapapapaapacececececece, , , ,,, SpSpSpSpSpSSpSpSpacacaacacaacaace e ee ee ee XXXXXLXXXXXX , StStStStStStStStStSSttStSSS ororororrororoorrrrrororrre…e…e…e…e…e…e…e…ee…e…ee…e…e…eee…eeeeee…eee
qqqqqqquququqquqquqququuququesesesese titititit s ss ssononononononno o oo oooo o oooo i ii ii i nonononononostststststss ririririri p p p ppppparaaararrartntntntntnntnt erererererererer. . QuQuQuQuQuQuQ eestiiiiiiiiii
ssssssosososososososssssss nononononooo ii i i n nnnegegeggggeggggggggozozozozozozozozozozozozozozozoozzozozozozozzozozozzziiiiii iiiiiiiiiiiii chchchchhchhchhhhhchhhhchhhhheeeeeeeeee ee eeeee hahhahahahhhhhhhh nnnnnnnnnnnno o o oo o ininninninsisisiiemeemmmmmmmme a aaaaaaaaa a aa a nonononononononononononnnoiiiiiiiii
aaabbabababababbbbrbrbrbrbracacaacciciccic atatatttttttatttoooooooooooooooooooooooooooooo uuununuununununununuuunuuuunuuuuuuuuuunuuu pppppppppppppppppppppppppppppprororororoorooorororororororororororororororooroororrrr gggggegegeggegegg ttttttttttttttt oooooo dididididi rrininnnnnnoonnovaaaaaaaamememememmmmmememeentntntntntnttntn oooooooababaabbbrbrracacaccicc atatatoooo ununn p p p prororogegegetttttttoo didi rrrininiini nonnnovavamemenntnto oo
prprprprpprp opopopoppopo onononononenenenee dododoododoo u u uuun n nn n nununununun ovovovovoovo o o concncccn eteteeetetee totototooo d ddddi ii cacacassasaasaa
LALALAALAALALAGOGOGOGOGOO.. . NoNoNooooon n n nn sososososos lolololololo dd d deeieie fforo mamaaat tt esesessespopoppppp sisissisititit vivivv
dododoodd veveveevvv p p ppppppototottttototerererrerrrrr t t ttt tttrorororooroooroororoovavavavarererer l le e nonoststttrereere proopopoopp ststttttttststttttttte e eee mamammamama
unununna a a rererererereeteteteeteteee d dd dddddddi iiiii pepepepepepepepepepeepersrsr ononoo e eee chchche e e poppp rtrtanano o i i nononooststtstriririiri
vavavavavaavavav lolololoooloooririrrir aa a aaaalllllllllllllll’ii’i’i’’’intntntnttntntnttnttntterererererrrererererererrrnnnnonononnnonnnn d dele le vvvosososo trtre e caseee, cocoonnnn
prpppprprprprprpprpppprpppppp ofofofofofofofffo esesesessesessessssisisisisisiiiis onononnonononononono alalalalalalalalalalla itititittititititiitàààà à ààààà e e cocompppetetettenenzaz . .
DDDaDaDaDaDaDaDDDDaDaDDD l l l l llll lororororororoooro o o o o o o o oo o popopopopopopopopopopopopoooopoop trtrtrtrtrtrtrtrtrtrtrrtrrttrttrt aiaiaiaiaiaaiaiaiaiaiaiaai tttrororrorr vavare nnnuuouoveve i ii dededee eee e eee spspss ununnntitititi
prprprprprprppprpprrogogogogogogogogoggogggggoggoggogooggetetetetetetetteteteteteteteteetetetetetetettettttte tututttutututututtutttutttuualalalaalallalaallaaaaaaaaaaaaaaaa i i ii iiiiii crcrcrcrcrcrcrcrrrcrrrrreeeeaeaeeeaeaeeeeeeaae teteteteteetetee a a aaaaa aaaappp osostata ppperr te eeeee e eeeeeeeeeeeee eeeeeeeee pepppppppppppppppppppppp r rr rr lalalaaa
tututututututuuua aa a aaaa aaaaaaaaaa cacacacacacacacacaaacacacaacaacacaacaacasasasassasssssasasssasasasasasa....
PePePePePePePeerr rrrrrr viviviviviviviviv sususususususuuaalalallaalallizizzazarrere iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii nnnnnnnn n n nnn n nnnnnnnnn nnnnnnnnnnnn n nnnn nnnnnneeeeeeeegeeeeeeeeeeeeeeeeeeeeeeeeeee ozi pipipppp ù ùùùùùùùù ùùùùùùùùùùùùùùùùùùù vivivivivivvivivivivivivivvvivivivvvvivvvviivvvvvvvvvv cciciciccccciiciciccicciciccccciccccciciccicccicicccccccccc niniiiniiinnininininininnnn aa v vvvvvvvoioioio
clclclclclclcclclclclclccliciccciccicicciccicicicciccacacacacacacacacaacaccacaccaacaatttetetetetetetetttetete s ss ssssssssu u u wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww wwww.wwwwwwwwwwwwwwwwwwwwwwwww LaLLaLaLLLLLLaLLLLLLaLLLLLLLLLLLLLLLLaLLLLLL gogooo i.it ttt - - nenegog ziii
PoPoPooooooPooPoPooooinint,t,,, P PPoioioioioioiointntntntntntntnntntnn X XXXXXXXX XXXXXXXXXXXXXL, Spaceceeceeeeececeeeeecc , , , SpSSSSSSSSSSS ace XLL, StS oro e.
ThThThThhhhThThhThhhheseseseeesse eee ee ararararaarrre eeeee eee ouououuouououoouoouuuouurrrrr rrrrrrrrrrrr papapaapartrtrtrtrtrrtnenen rssrss. ThThTT esese e arararare ee thththt ee
shshshhshshshsshshshshshsshopopopopopopopopopopopopppss ssss sss whwhwhwhwhwho havevev e eeeeeeemmbmmmmmmm raceed, ttogogetetheher
wiiwiwiwiw thththththh u uuuu uuuuuuuuus,s,s,s,s,s,s,s,s,,,,,, a renovovvaatataatataaaaaaatiiiioiiiiii n projjecceccccccccct,t,tt,t,t,t,t, bbbbbb bby yy y yyyyyyyyy
prprprprprppppprpp oopppppppooooooo osososososososososososososososoossssinininininininininininnnnng g g g g g g g g ggg g ggggggg a aaaaaaaa aa aaaa aaa nenennnnnnnnnnnnnnn w w ccccocccoccocc ncncncncncncncncepepepepepepepe t t ofoofofoffoffffofffffffofofof tt ttttttttttttttttttt hehehehehehehehehhehhehhehhehehehhehehhehehe LL Lagago
hohohohohohohohohohohohohoohoooomememememememememememmeemmemmemmmm ........ . NoNoNoNNNNNNNNoNNNNNNNNott t t ononononononnonononnononononnonly exhhibibititittttioioooioioon formmats ss whhere e e
itititittititittitiititittit i i i is poooooooooooooossssssssssssssssssss ibibibibibibibibibiibibibbbbbi leleleleeeeeleeleeleleleleleleeleee t t tttttttto findd ooooouurrruruuruu p roposals, bubut t
aaaaalaaaaaaaa so a neeeteeeeee workrkkk o o oooooooooff fff fffff peppppppp opoopopopoo llelellllele who bringnnn
ououuuuuuuuuuur r rrrrr vavvavvvvvvv luuuuuuueeeeseseeee insiddddddddde e e ee eeee yyyyoyyyyyy ur homommomo eseseseses, , ,, ,, wiwiwiwwiwiwiiththththtthh
prpprprprprprprprppprprprrprpp ofofoffooooofofesesessssssseseeesssisisisisississiiiiooonooooooonoo ala ism mm mm mmm anananananananananannnnnnnnnd d expeeertrtrtrtrtrtrtrtrtttrtrtttisisisisisisissisisisisssisi e.e.e.eee T T T TT TTThehehehehehhhererererere y youou
wwwwwwiwiwiwiwwwww lllllllll bb bbbbbbbe ee eeeeee ababababaabababababababaababa lelelelelleleleeeele tt t ttttoooo o oo fififif ndndndndndndndndndnddnddnd nnewew iiddddededeedeeeededeeedeaasasasasasasasaasasaasaaasasasass aaaaaandndndndndndnd c c ccluluuluueses
ononono hh howowowowowowowowowwowooowww t tooo o o ooooooo plplplplplaanaaanaa a a c cusussustotototototom-m-m-m-m-m-mm mamamamamamamamamamamamamamamaamamamammmmadededededddeddddededdedededddedddedd h hh hhhhomomomomomome e e fof r
yoyoyou.u. T To o seseseseseses e e ee ee e thththththhht e e clclososesesesest tttt ssshsshs opops s clclicick k k onoon
wwwwwwwww.w.wwww.ww.w.www LaLaLaLaLaLLLaLLL ggogogo.i.iit t tt - - shshshshshshshshsshhopopopopopopopooppsssssssss
17BrochureMilano.indd 17 16-04-2009 12:03:31
![Page 18: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/18.jpg)
AIR
Letto AIR
Testiera in pelle bianca.
Pianale in HPL sorretto da
un telaio metallico fi ssato
su 4 lastre di vetro Starphire
extrachiaro rettangolari.
AIR Bed
Leather headboard.
HPL platform supported
by a metal frame attached
to 4 extra clear rectangular
Starphire glass plates.
180x200 - H. 29-71 o/or 39-81
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 2.340
Letto AIR
Testiera in ecopelle bianco.
Armadio N.O.W. con ante
battenti e fi anchi in vetro
lucido avio, paglia, lilla, bianco
e salvia e in vetro opaco
bianco e paglia. Libreria AIR
laccato paglia, avio, salvia,
bianco e lilla.
AIR bed
White eco-leather headboard.
N.O.W. wardrobe with hinged
doors and sides in avio,
paglia, lilla, bianco and salvia
coloured bright glass and
bianco and paglia coloured
matt glass. AIR bookcase,
paglia, avio, salvia, bianco
and lilla lacquering.
Letto/Bed 120x200
Armadio/Wardrobe N.O.W.
L. 201,5 - H. 265 - P. 60,9
Libreria/Bookcase AIR
L. 310,4 H. 154 P. 40,6
1
2
1
2
18BrochureMilano.indd 18 16-04-2009 12:04:00
![Page 19: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/19.jpg)
19
Leggerezza estrema
Un nuovo trio di prodotti, libreria, tavolo e letto che
inverte l’ordine dei fattori: leggerezza estrema nelle
strutture portanti, in cristallo trasparente e fi sicità
piena del piano e delle mensole. Il risultato è che
mensole, piano del tavolo e letto fl uttuino nell’aria,
quasi fossero sospese nel vuoto.
All’intero ambiente si conferisce una lettura nuova
dello spazio modifi cando la percezione dei rapporti
pieno/vuoto, leggero/pesante.
Il tavolo è costituito da due lastre perpendicolari
su cui poggia il piano in legno. La libreria è realizzata
con montanti eterei in cristallo che sostengono
le mensole in legno. Posizionata a centro stanza
o addossata al muro la libreria è free-standing ed
evita l’ancoraggio a parete. L’effetto di sospensione
diventa ancor più evidente nel neonato letto AIR.
La base del letto in HPL si appoggia su un telaio
metallico su cui sono innestate 4 lastre di cristallo
che, se ruotate, cambiano l’altezza del letto.
Le venti fi gure del kamasutra che si trovano sotto
il materasso, oltre a divertire e rendere sexy il letto,
consentono al materasso stesso di essere areato.
A new product “trio” - a bookshelf, table and bed
reversing the order of factors: extremely light
load-bearing structures, in transparent crystal glass,
and very solid tops and shelves.
The result is that the shelves, table top and bed
seemingly fl oat on air, almost as if suspended in
a vacuum. The entire setting benefi ts from a new
interpretation of space by modifying perception
of solid/void and light/heavy ratios.
The table comprises two perpendicular plates
supporting the wood top. The bookshelves have
ethereal crystal glass uprights supporting the
wooden shelves. Whether positioned in the middle
of a room or set against a wall, these bookshelves
are free-standing and avoid the need for wall
anchorage. The suspension effect is even more
evident with the brand-new AIR bed. The base
of the bed in HPL is supported by a metal frame
in turn housing 4 crystal glass plates that can be
rotated to modify the height of the bed.
The twenty kamasutra fi gures underneath the
mattress not only make the bed delightful and
sensual but also mean that the mattress itself is
well-aired.
Letto AIR
Testiera in pelle nero.
Armadio N.O.W. con ante
scorrevoli e fi anchi in vetro
lucido salvia, nero, avio,
fumo, lilla, grafi te. Cassettiere
MORGANA laccato avio e lilla
con frontali in vetro.
Comò 36e8 laccato nero.
AIR bed
Black leather headboard.
N.O.W. wardrobe with sliding
doors and sides in salvia,
nero, avio, fumo, lilla, grafi te
bright glass. MORGANA
chest of drawers, avio and lilla
lacquering with glass fronts.
Black lacquered 36e8 chest
of drawers.
Letto/Bed 180x200
Armadio/Wardrobe N.O.W.
L. 287,3 - H. 265 - P. 66,7
MORGANA
L. 60 - H. 54 - P. 45,3
Comò/Chest of drawers
L. 147,2 - H. 552 - P. 40,6
3
3
19BrochureMilano.indd 19 16-04-2009 12:04:59
![Page 20: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/20.jpg)
Television
È un libro nato come alternativa al finto
televisore usato abitualmente nei negozi
di arredamento, per portare vita, ironia
e fantasia all’interno dei punti vendita
LAGO. Un viaggio di semplici fotogrammi
che ci hanno permesso di raccontare
la storia di ciascuna delle persone che
lavora nella “non fabbrica” e i luoghi che
fanno da cornice a questa realtà.
A book intended as a valid alternative
to the “dummy television” customarily
used in furnishing shops - to ensure a
touch of life, irony and imagination in
LAGO sales points. A travel focusing on
straightforward photographs that helped
us tell the story of
everyone working
in the “non-
factory” and the
places where this
reality is set.
20BrochureMilano.indd 20 16-04-2009 12:06:06
![Page 21: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/21.jpg)
21
AIR: comp. 72
Laccato verde acido, sole e
bosco. Set vetri porta dvd.
Verde acido, sole and bosco.
Lacquering. Glass set,
dvd player holder.
L. 384 - H. 169,7 - P. 40,6
Prezzo a partire da/Price from
€ 4.471
AIR: comp. 78
Laccato bianco.
Bianco lacquering.
L. 261,4 - H. 423,7 - P. 261,4
Tavolo AIR
Rovere grigio HP.
AIR Table
HP Grey oak.
L. 250 - P. 100 - H. 76
Prezzo a partire da/Price from
€ 1.953
1
2
3
1
2
3
21BrochureMilano.indd 21 16-04-2009 12:06:44
![Page 22: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/22.jpg)
Una “rete” di cubi
Un cubo, due cubi, una “rete” di cubi da 40
centimetri per lato si incontrano e si combinano
offrendo ad ognuno l’opportunità di creare una
libreria a propria immagine e somiglianza.
NET allarga i confi ni della creatività, e non teme
i limiti spaziali adattandosi con facilità alle situazioni,
dividendo aree e creandone di nuove.
Uno dei suoi punti di forza è il perno di congiunzione
verticale tra un cubo e l’altro: questo consente
la rotazione di ogni singolo elemento.
E così, una composizione lineare e ordinata
può diventare sinuosa e dinamica.
A single cube, two cubes, a “network” of cubes
measuring 40 centimetres per side mix and match
to offer everyone the chance to create bookshelves
with a truly personal touch.
NET expands the boundaries of creativity by
overcoming spatial limitations and easily adapting
to different situations to share existing and create
new spaces. One of its selling points is the vertical
pin between each of the cubes: this means that
every single element can be rotated.
Which in turn means that linear and orderly
composition can become sinuous and dynamic.
NET
1
NET: comp. 52
Laccato bianco.
Bianco lacquering.
L. 527 - H. 281 - P. 299
1 cubo laccato bianco prezzo
a partire da/1 single cube,
bianco lacquering price from
€ 290
1
22BrochureMilano.indd 22 16-04-2009 12:09:35
![Page 23: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/23.jpg)
APPARTAMENTOTEMPORARY SHOPVIA TORTONA 21 MILANO
1° PIANO
DAL 22 AL 27 APRILE 10.30–24
Re-inventare i luoghi
Galvanizzati dall’innovazione portata nei nostri
prodotti, abbiamo cominciato ad interrogarci
su come cambiare il modo di farli conoscere
alle persone. E non stiamo parlando di pubblicità.
Vogliamo capire se in futuro sarà soltanto il negozio
così come lo conosciamo oggi a farci avvicinare,
conoscere e toccare i mobili oppure potranno
esistere nuovi scenari e nuove opportunità.
Re-inventare i luoghi.
L’appartamento è un progetto all’interno di
questa rifl essione alla quale ci stiamo sempre più
appassionando. E allora noi di LAGO non staremo
in un qualsiasi hotel di Milano in quei giorni di
lavoro allo stand della fi era. Abbiamo disdetto la
prenotazione e ci siamo presi una casa che sarà
arredata completamente con i mobili LAGO.
Vivremo in 13, condividendo la cucina, la doccia,
gli armadi. Al mattino ci sarà chi andrà in fi era e
chi resterà per tenere aperta la casa ai visitatori dei
fuorisalone durante il giorno. Alla sera ci ritroveremo
tutti, assieme a quanti vorranno cenare con noi, o
passare per un brindisi. Basta suonare il campanello
e vi apriremo.
L’appartamento è un progetto naturale.
Che riparte da zero, dalle persone e dalle relazioni,
dalle sensazioni e dalle opinioni che possono
nascere toccando non solo un prodotto ma anche
un progetto, rimettendo in discussione tutto quello
che ci hanno detto bisogna fare per forza durante la
design week milanese.
Galvanised by the innovative capacity of our
products, we have begun to ask ourselves how
we can change the way they are communicated to
people. And we are not talking about advertising.
We want to understand whether, in the future,
shops as we know them today will still be the only
way we can get in touch with people and ensure
hands-on experience of our furniture or if there are
new scenarios and new opportunities.
Re-inventing places.
The Apartment is an exciting project continually
focusing our passion on this consideration.
Inasmuch, LAGO will not merely stay in a hotel in
Milan over these days of work on the stand at the
exhibition. We have cancelled our booking and have
rented a 300 sq.m. fl at on the fi rst fl oor of
Via Tortona that will be completely set up with
Lago furniture.
Thirteen of us will live there, sharing the kitchen,
shower and wardrobes. In the morning, some of
us will go to the exhibition and other will “stay at
home” to welcome “off-show” visitors during the
day. In the evening, we will all get together with
anyone who would like to have dinner with us or
drop by for a drink. Simply ring the bell for a warm
welcome.
The Apartment is a natural project. An approach
starting from scratch, from people and relationships,
from sensations and opinions, stimulated not only
by hands-on experience of products but also and
especially by a project ensuring in-depth discussion
of everything suggested to us during the
Milan design week.
appartamento.lago.it
23BrochureMilano.indd 23 16-04-2009 12:10:02
![Page 24: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/24.jpg)
24BrochureMilano.indd 24 17-04-2009 8:22:08
![Page 25: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/25.jpg)
25
25BrochureMilano.indd 25 17-04-2009 8:22:22
![Page 26: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/26.jpg)
26BrochureMilano.indd 26 16-04-2009 12:13:10
![Page 27: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/27.jpg)
27
Non sai cosa cucinare oggi?
segui le ricette di Mimmo su:
appartamento.Lago.it
You don’t know what to cook
today? Follow Mimmo’s recepit on:
appartamento.Lago.it
27BrochureMilano.indd 27 16-04-2009 12:14:09
![Page 28: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/28.jpg)
Nuovo 30mm
New 30mm
28BrochureMilano.indd 28 16-04-2009 12:19:12
![Page 29: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/29.jpg)
29
29BrochureMilano.indd 29 16-04-2009 12:20:06
![Page 30: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/30.jpg)
Studio dell’Appartamento
Appartamento studio
30BrochureMilano.indd 30 16-04-2009 12:20:28
![Page 31: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/31.jpg)
31
31BrochureMilano.indd 31 16-04-2009 12:21:27
![Page 32: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/32.jpg)
Il nuovo 36e8 bagno
The new 36e8 bagno
The online design magazine Core77 will have their temporary
offi ce based in the apartment and create the post
production of their Milan Design Week coverage from here.
Additionally to their usual extensive coverage of all the hot
stuff happening on the fair and the interni shows, Core77 will
this year also invite people to interview in their offi ce and
report daily from the Appartamento project.
With the interviews Core77 is seeking to create a
“post futurist manifesto” - in dialogue with some of the
current ‘movers and shakers’ of the design world.
La rivista di design online Core77 usufruirà provvisoriamente
dell’Appartamento come uffi cio, e da qui si occuperà del
reportage del post-produzione della Design Week di Milano.
Oltre ad un ampio reportage di tutti gli eventi più salienti della
fi era ed agli show esterni, quest’anno Core77 inviterà anche
delle persone per intervistarle nel loro uffi cio e creare un
report giornaliero del progetto dell’Appartamento. Attraverso
queste interviste, Core 77 cerca di creare un ‘manifesto
post-futurista’ - dialogando con alcuni dei personaggi che
attualmente ‘muovono e scuotono’ il mondo del design.
32BrochureMilano.indd 32 16-04-2009 12:22:13
![Page 33: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/33.jpg)
33
STEPSDesign Monica Graffeo
Una sedia e un letto dall’aspetto materico.
Il rigore e la pulizia formale, insieme alla
componente ludica di questi due prodotti,
defi niscono il loro carattere.
Per assemblare sedia e letto è suffi ciente far calzare
sulla rispettiva struttura in alluminio le corrispondenti
fette di feltro che, nel caso del letto, possono essere
anche allontanate rendendolo personalizzabile.
A solid chair and bed with a lightweight appearance.
Formal rigour and purity, together with the
delightful design of these two products, ensure
strong character.
The chair and bed are easy to assemble - simply fi t
the felt pads on the respective aluminium structure.
These “pads”, for the bed, can also be positioned at
a distance for maximum “customisation”.
STEPS_B con struttura in
alluminio e seduta, schienale e
testata in feltro grigio.
STEPS_B with aluminum
structure and grey felt sit, back
and headboard.
Letto/Bed L. 165 - H. 86,7 - P. 224
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 2.150
STEPS_C con struttura in
alluminio e seduta, schienale
e testata in feltro grigio.
STEPS_C with aluminum
structure and grey felt sit,
back and headboard.
L. 45 - H. 77 - P. 51
Prezzo a partire da/Price from
€ 230
1
2 1
2
33BrochureMilano.indd 33 16-04-2009 12:22:49
![Page 34: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/34.jpg)
JUSTMAT
1 materasso + 4 ruote = 1 letto. È questa
l’elementare addizione che sta alla base del progetto
JUSTMAT. Una soluzione semplice e funzionale che
ha come protagonista un materasso che si allunga,
si incurva e diventa, così, una testiera.
Le ruote che sostituiscono i piedini rendono il letto
facilmente trasportabile e dinamico.
1 mattress + 4 wheels = 1 bed. This is the
elementary addition underlying the JUSTMAT
project. A simple and functional solution focusing
on a mattress that can be elongated and shaped
to become a bed-head. The wheels in place of feet
make this bed easy to move and dynamic.
Letto JUSTMAT
JUSTMAT Bed
160x240
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 2.090
Letto JUSTMAT con testiera
col. righe. Armadio N.O.W.
(comp. 122) con ante battenti
e fi anchi in vetro lucido prato,
rosso, verde acido, kaki, lilla,
bosco e in vetro opaco bianco
e nero. Cassettiere MORGANA
con ruote, in vetro lucido
bianco.
JUSTMAT bed with headrest
col. striped. N.O.W. wardrobe
(comp. 122) with conventional
doors and polished glass
sides in the colours prato,
rosso, verde acido, kaki, lilla,
bosco and opaque glass in
the colours bianco and nero.
MORGANA bianco polished
glass chest of drawers with
wheels.
Letto/Bed 160x240
Armadio/Wardrobe
L 369,5 - H 265 - P 60,9
Comodini e cassettiera
MORGANA/Chest of drawers
and Bedside table MORGANA
L 60 - H 48,3/138,3 - P 45,3
1
2
1
2
34BrochureMilano.indd 34 16-04-2009 12:27:42
![Page 35: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/35.jpg)
35
BEAMDesign Ewan Robertson/Lagostudio
Il letto Beam si ispira ad una fi gura di elementare magnifi cenza: il sole
La base del letto è costituita da un sistema di assi
che, partendo da un fulcro centrale, si aprono a
raggiera verso l’esterno. Il sistema di illuminazione
della base del letto, che irradia fasci di luce
chiaro-scuro, crea nella camera da letto un’atmosfera
delicata e scenografi ca. Con BEAM viene, ancora una
volta, stravolta l’idea del letto che si regge su quattro
gambe: il tentativo è dimostrare che la creatività,
spesso, la si può ricondurre alla capacità di cambiare
punto di vista. In questo modo il sole va a letto.
BEAM Bed is inspired by an elementary yet
magnifi cent fi gure: the sun. The base of the bed
comprises a system of “beams” that extend
outwards from a central fulcrum. The lighting system
at the base of the bed creates “chiaroscuro” effects
in the bedroom ensuring a delicate and scenographic
atmosphere. BEAM - once again - overturns the idea
that beds must have four legs: the concept hopefully
demonstrates that creativity can often be traced to
a capacity for changing points of view. In this way,
even the sun goes to bed.
3
4
Struttura letto BEAM.
BEAM bed structure.
Prezzo a partire da/Price from
€ 1.450
Letto BEAM laccato grafi te
con testiera in pelle col. 454.
Comodini 36e8 in vetro opaco
spago.
BEAM grafi te lacquered bed
with leather headrest col. 454.
36e8 spago opaque glass
bedside tables.
Letto/Bed 160x210
Comodini/Bedside tables
L 73,6 - H 18,4 - P 40,6
3
4
35BrochureMilano.indd 35 16-04-2009 12:28:26
![Page 36: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/36.jpg)
FLUTTUAFLUTTUA è un letto sospeso, regolabile in altezza
e disponibile nelle forme rotonda e rettangolare.
FLUTTUA è il letto dal quale abbiamo tolto il
superfl uo lasciando spazio al pensiero.
La caratteristica del prodotto è quella di avere solo
una gamba centrale e di essere composto da un
pianale di spessore 8 mm abbinato a una solida
struttura in ferro da fi ssare alla parete.
FLUTTUA is a suspended, height-adjustable bed
available in round and rectangular models.
The FLUTTUA bed eliminates everything superfl uous
to leave more room for thought.
The characteristic of the product is its single,
height-adjustable central leg and 8 mm thick layer
base combined with a solid iron structure anchored
to the wall.
1
36BrochureMilano.indd 36 16-04-2009 12:29:18
![Page 37: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/37.jpg)
37
Letto FLUTTUA R con testiera
in pelle bianca e illuminazione
sottorete. Armadio N.O.W.
con ante battenti e fi anchi
in vetro lucido bianco.
Comò 36e8 laccato bianco
con specchio argentato.
Comodini 36e8 laccato
bianco.
FLUTTUA R bed with white
leather headboard and under
slat lighting. N.O.W. wardrobe
with hinged doors and sides in
white matt glass. 36e8 chest
of drawers, white lacquering
with silver mirror.
36e8 bedside tables, white
lacquering.
Letto/Bed
L. 180 - P. 205 - H. 48/63
Armadio/ Wardrobe
L. 316,5 - H. 265 - P. 60,9
Comò/Chest of drawers
L. 147,2 - H. 55,2 - P. 40,6
Comodini/Bedside tables
L. 73,6 - H. 18,4/36,8 - P. 40,6
Specchio/Mirror
L. 147,2 - H. 73,6 - P. 2
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 9.057
1
37BrochureMilano.indd 37 16-04-2009 12:30:37
![Page 38: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/38.jpg)
Kids
Gli stessi “ingredienti” che hanno caratterizzato
gli altri ambienti della casa, ovvero i consolidati
prodotti LAGO, si amalgamano creando
ambientazioni più fresche, più vivaci e vicine a quella
fase della vita in cui tutto è gioco. La giovinezza.
Una fase in cui è ancora lecito “volare” con la
fantasia: è così che l’armadio di un bambino diventa
un grande pesce rosso. È così che un serpente
si insinua nella stanza. È così che una fi ammante
Ferrari si materializza sulla parete.
Un design a misura di bambino e non a misura
d’uomo: ecco la nuova ricetta.
The same “ingredients” characterising LAGO’s
renowned products for other home settings now
blend to create even fresher and livelier atmospheres
for the time of life when everything is playtime. Kids!
An age where “fl ights of fantasy” are so important:
which is why our wardrobe for kids resembles a
huge goldfi sh. Or a snake swirling into the bedroom.
Or a bright red Ferrari materialising on the wall.
Design for kids - not for adults: this is the new
approach.
1
2
38BrochureMilano.indd 38 16-04-2009 13:31:32
![Page 39: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/39.jpg)
39
Letto AIR
Testiera in pelle bianco.
Libreria 36e8 laccato aragosta,
bianco e nero.
AIR Bed
White leather headboard.
36e8 bookcase, aragosta,
bianco and nero lacquering.
Letto/Bed 180x200
Libreria/Bookcase 36e8
L. 368 - H. 190,4 - P. 40,6/56
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 8.912
Letto JUSTMAT. Libreria 36e8
laccato bianco e nero.
30mm con struttura laccato
bianco e nero. Altalena
SOFT-SWING laccato bianco.
JUSTMAT bed. 36e8
bookcase, bianco and nero
lacquering. 30mm with bianco
and nero lacquered structure.
SOFT-SWING, white
lacquering.
Altalena/Soft-Swing
L. 56,1 - P. 28,1 - Sp.6
Letto/Bed 240x160
Libreria/Bookcase 36e8
L. 257,6 - H. 128,8 - P. 40,6
30mm
L. 162,2 - H. 220,8 - P. 38,4
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 6.277
Libreria 36e8 laccato verde
acido e bosco. Comodino 36e8
laccato bosco. STEPS_B con
struttura in alluminio e seduta,
schienale e testata in feltro
nero. Mensole PONTACCIO
laccato bosco.
Altalene SOFT-SWING laccato
bosco e prato.
36e8 bookcase, verde acido
and bosco lacquering.
36e8 bedside table, bosco
lacquering. STEPS_B with
aluminium structure and grey
felt sit, back and headboard.
PONTACCIO shelves bosco
lacquered. SOFT-SWING,
bosco and prato lacquering.
Libreria/Bookcase 36e8
L. 612,4 - H. 147,2 - P. 151,3
Comodino/Bedside table
L. 36,8 - H. 18,4 - P. 40,6
Letto/Bed
L. 130 - H. 86 - P. 165
PONTACCIO
L. min 100/max 162 - H. 38 -
P. 18/24
SOFT-SWING
L. 56,1 - P. 28,1 - Sp.6
Prezzo a partire da (materasso
escluso)/Price from (mattress
excluded)
€ 5.070
3
1
2
3
39BrochureMilano.indd 39 16-04-2009 13:32:49
![Page 40: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/40.jpg)
NOT ONLY WHITE
An inifi nitely customisable wardrobe.
A hideaway cabinet-wardrobe that integrates
perfectly with home architecture hidden between
the walls. Innovative colour and a fl exible and
versatile system that meets everyone’s needs.
Not just a simple modular system but a product
that combines the fi nal object with dreams.
The modular bands (21-115 cm with many
intermediate widths) create the design of this
wardrobe-cabinet by defi ning a new visual rhythm;
moreover, the innovative door opening system
eliminates handles to blend N.O.W. with the
architecture of the wall or by creating new colour
moods in harmony with adjacent settings.
The result is a truly made-to-measure solution in
terms of dimensions and also sensations: every
band in short can have a different colour.
L’armadio personalizzabile all’infi nito
L’armadio che scompare e si integra perfettamente
con l’architettura della casa nascondendosi tra
le pareti. Con un uso del colore innovativo e un
sistema così fl essibile e versatile da essere a misura
di desiderio di ciascuno. Non un semplice sistema
componibile, ma un prodotto che fa coincidere il
sogno pensato con l’oggetto realizzato.
Le fasce modulari, da 21 a 115cm con molteplici
larghezze intermedie, creano il design dell’armadio
dando un nuovo ritmo visivo e, inoltre, l’innovativo
sistema di apertura delle ante cancella le maniglie
mimetizzando N.O.W. con l’architettura della parete,
oppure creando nuovi mood cromatici in armonia
con gli ambienti circostanti.
Nasce così una soluzione realmente al centimetro,
per le dimensioni ma anche per le sensazioni: ogni
fascia può assumere infatti un colore differente.
1
40BrochureMilano.indd 40 16-04-2009 13:33:43
![Page 41: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/41.jpg)
41
N.O.W.: comp. 101
Ante battenti e fi anchi
in vetro opaco bianco ed in
vetro lucido cocco e panna.
Hinged doors and sides
in bianco coloured matt
glass and cocco and panna
coloured bright glass.
L. 401,5 - H. 265 - P. 60,9
Prezzo a partire da/Price from
€ 5.240
Con la semplice pressione
della mano si crea una
depressione che permette di
aprire l’anta.
A new type of opening: the
door can be opened with a
simple push.
N.O.W.: comp. 105
Ante battenti e fi anchi in vetro
opaco bianco.
Hinged doors and sides in
bianco coloured matt glass.
L. 510,5 - H. 265 - P. 60,9
Prezzo a partire da/Price from
€ 6.690
N.O.W.: comp. 113
Ante scorrevoli e fi anchi
in vetro opaco nero e vetro
lucido bianco, lilla, paglia
e salvia.
Sliding doors and sides in
nero coloured matt glass and
bianco, lilla, paglia and salvia
coloured bright glass.
L. 348,3 - H. 265 - P. 66,7
Prezzo a partire da/Price from
€ 4.830
2
3
4
1
2
3
4
41BrochureMilano.indd 41 16-04-2009 13:34:21
![Page 42: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/42.jpg)
Un materasso avvolto come la cialda di un cono
gelato infi lato dentro una piccola base cilindrica
in legno. Questa è l’accogliente e pratica poltrona
HUGGY. La presa dell’anello di base stringe la
parte inferiore del materasso tenendolo unito
e creando una avvolgente seduta con morbidi
braccioli. Sfi lando la base, il materasso si srotola
automaticamente e diventa all’occorrenza un
comodo letto d’emergenza per ospiti; la base si
capovolge e diventa un utile comodino.
A mattress wrapped like the wafer of an ice-cream
cone inserted inside a small cylindrical wooden base.
This is the inviting and practical HUGGY armchair.
The hold of the base ring grips the lower part of
the mattress, holding it together and creating a
wrap-around seat with soft arms. By unscrewing
the base, the mattress is automatically unrolled and
when required becomes a comfortable emergency
bed for guests; when the base is turned upside-down
it becomes a useful night table.
Poltroncina HUGGY
HUGGY Armchair
Poltrona/Armchair
130x78x64
Materasso/Mattress
175x85
Base-comodino/Base-nigh table
D. 64 - H. 35 - Sp. 12
Prezzo a partire da/Price from
€ 910
1
1
HUGGYDesign Brit Leissler/Lagostudio
42BrochureMilano.indd 42 16-04-2009 13:36:13
![Page 43: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/43.jpg)
43
1
43BrochureMilano.indd 43 16-04-2009 13:37:11
![Page 44: Lago News 2009](https://reader031.fdocuments.net/reader031/viewer/2022020221/568c3acf1a28ab0235a7b015/html5/thumbnails/44.jpg)
Giuliana Racco e Matteo Guidi IN ATTESA DI...A cura di Caterina Benvegnù
Un fotoromanzo che narra dello scorrere del
tempo di un’azienda, della scansione data dalla
frenesia di chi la fa pulsare, degli intrecci tra stati
di quiete e di moto, tra momenti di attesa e altri di
frenesia. Come i dipendenti vivono il loro tempo,
come riflettono su di esso, cosa attendono? Cosa
sperano? Chi verrà in contatto con la sala d’attesa
avrà modo di entrare in una dimensione parallela
alla realtà in cui si trova, portandosi così dentro
alle domande su come vivere l’attesa ed il proprio
tempo in un periodo che tende a porre a margine
e a devalorizzare questi momenti.
A photo story narrating the passing of time inside
a company, the rhythm given by the frenzy of
those who make it throb, the tangle created by
states of stillness and movement, by moments of
waiting and others of frenzy. How do employees
live their time, how do they reflect on it,
what are they expecting? What are they hoping
for? Those who get in contact with the waiting
room will be able to enter a parallel dimension
with respect to the reality they belong to, thus
bringing themselves inside the questions on how
to live the waiting process and their own time, in
a period which tends to marginalize and to deprive
those very moments of their value.
ART WAITING ROOM
9 Aprile 2009 - 14 Luglio 2009
Lun/Ven 8.30-12 e 14.30-18 Sab e Dom chiuso.
L’Art Waiting Room è il modo in cui LAGO ha
interpretato la propria sala d’attesa.
Progetto in collaborazione con: Fondazione March
LAGO S.p.A
Via dell’Artigianato ll n.21
35010 Villa del Conte, Padova, Italia
T +39.049.599.4299 F +39.049.599.4191
www.lago.it
44BrochureMilano.indd 44 16-04-2009 13:37:48