Lab safety Documentation, GLP Practical tips; primers and PCR

10
Lab safety Documentation, GLP Practical tips; primers and PCR

TAGS:

description

Lab safety Documentation, GLP Practical tips; primers and PCR. Lab safety wash your hands EtBr sterile technique. Lab safety Use Labcoats No food in the lab Common sense!. Lab safety Documentation, GLP Practical tips; primers and PCR. What can an experiment looks like?. Title - PowerPoint PPT Presentation

Transcript of Lab safety Documentation, GLP Practical tips; primers and PCR

Page 1: Lab safety Documentation, GLP Practical tips; primers and PCR

Lab safety

Documentation, GLP

Practical tips; primers and PCR

Page 2: Lab safety Documentation, GLP Practical tips; primers and PCR

Lab safety

- wash your hands

- EtBr

- sterile technique

Page 3: Lab safety Documentation, GLP Practical tips; primers and PCR

Lab safety

- Use Labcoats

- No food in the lab

- Common sense!

Page 4: Lab safety Documentation, GLP Practical tips; primers and PCR

Lab safety

Documentation, GLP

Practical tips; primers and PCR

Page 5: Lab safety Documentation, GLP Practical tips; primers and PCR

What can an experiment looks like?

Title should be descriptive!

Background informationwhy do you do this experiment?

Methods all steps you do in the lab, include all calculations made in preparing solutions

Results and conclusion

Page 6: Lab safety Documentation, GLP Practical tips; primers and PCR

Day 1. Mutation PCR reaction

Day 2. DpnI digestion

Analytical agarose gel

Transformation to TOP10

Day 3. Pick 3 colonies, patch and

inoculate o/n cultures

Day 4. Plasmid miniprep

Analytical PCR and

inoculate o/n cultures

Overview

Day 5. Do small-scale expression test

Analysis: SDS-PAGE

Day 6. Analysis: SDS-PAGE

Day 7. Large scale fermentation

Day 8. Purification (I)

Day 9. Purification (II)

Analysis: SDS-PAGE,

Protein concentration

Day 10. Activity test.

Page 7: Lab safety Documentation, GLP Practical tips; primers and PCR

Where to store stuff  at room temperature:DNA loading dye10 mM Tris pH 8.55xSB  at 4C:agar plates with bacteria on them (if you want to keep them)cultures that you want to use as inoculum  -20C:dNTP (keep on ice whenever out of freezer)10xPfu buffer10xTaq buffertemplateprimersDNA ladderAmpplasmidssamples taken out for SDS-PAGE

Page 8: Lab safety Documentation, GLP Practical tips; primers and PCR

Lab safety

Documentation, GLP

Practical tips; primers and PCR

Page 9: Lab safety Documentation, GLP Practical tips; primers and PCR

Primers Materials:tube with dried primer. On the tube label, you can see how many nmoles there are inside.   Experiment: Stock solution (100 µM): Spin the tube a few seconds.Open carefully and add 10 x (nmoles of primer) µl of autoclaved distilled waterRehydrate for 2 min (ie. leave on bench).Tap the tube.  Working solution (20 µM): 20 µl 100 µM stock solution80 µl autoclaved distilled water

Page 10: Lab safety Documentation, GLP Practical tips; primers and PCR

Pipetting enzymes

in 50% glycerol tip just below surfacelook at the tip!!!


Molecular systematics of the barklouse family Psocidae ... · Primers and PCR pro- ... TYG GNC AYC CHG AAG T) + H7005 for second PCR of weak initial PCR products.

Molecular systematics of the barklouse family Psocidae ... · Primers and PCR pro- ... TYG GNC AYC CHG AAG T) + H7005 for second PCR of weak initial PCR products.

False positive results using PCR detection method …journals.tubitak.gov.tr/veterinary/issues/vet-15-39-3/...of the PCR product using primers PPA1 and PPA2 primers was 257 bp. The

False positive results using PCR detection method …journals.tubitak.gov.tr/veterinary/issues/vet-15-39-3/...of the PCR product using primers PPA1 and PPA2 primers was 257 bp. The

PCR with arbitrary primers - Gene bankcropgenebank.sgrp.cgiar.org/images/file/learning_space/...(AP-PCR) PCR with arbitrary primers Three main techniques fall within the category of

PCR with arbitrary primers - Gene bankcropgenebank.sgrp.cgiar.org/images/file/learning_space/...(AP-PCR) PCR with arbitrary primers Three main techniques fall within the category of

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly

Synthetic Biology for - 2015.igem.org2015.igem.org/.../c/cb/IGEM5_OurProject_InversePCR.pdf · 2015-09-19 · Our Primers in Inverse PCR In PCR, the primers are part of the newly

Design and standardization of PCR primers and protocols for …€¦ ·  · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Design and standardization of PCR primers and protocols for …€¦ ·  · 2015-03-10LEADING ARTICLE Design and standardization of PCR primers and protocols for detection of clonal

Lab safety Documentation, GLP Practical tips; primers and PCR.

Lab safety Documentation, GLP Practical tips; primers and PCR.

Phylogenetic placement of Cryptophiale Cryptophialoidea ...mycosphere.org/pdf/MYCOSPHERE_9_6_5.pdf · 1134 of PCR products were carried out using the above-mentioned PCR primers at

Phylogenetic placement of Cryptophiale Cryptophialoidea ...mycosphere.org/pdf/MYCOSPHERE_9_6_5.pdf · 1134 of PCR products were carried out using the above-mentioned PCR primers at

Reação Polimerásica em Cadeia (PCR) - dbbm.fiocruz.br · (PCR) PCR - consiste em fazer cópias de DNA “in vitro”, ... 2. Anneal: 37 ° C - 65 ° C Primers bind to specific

Reação Polimerásica em Cadeia (PCR) - dbbm.fiocruz.br · (PCR) PCR - consiste em fazer cópias de DNA “in vitro”, ... 2. Anneal: 37 ° C - 65 ° C Primers bind to specific

Appendix 1 List of primers and PCR conditions - CORE · Appendix 1 List of primers and PCR conditions CRB1gene Primer Sequence Product (kb) PCR Mix PCR Conditions exon11_1F ACCAATGTATTCAACAGGGACC

Appendix 1 List of primers and PCR conditions - CORE · Appendix 1 List of primers and PCR conditions CRB1gene Primer Sequence Product (kb) PCR Mix PCR Conditions exon11_1F ACCAATGTATTCAACAGGGACC

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library.

sem4-cdna sythesis,pcr,designing primers for pcr, synthesis of genes, shotgun experiment and gene library.

CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection ... · technique. PCR-based DNA detection and genotyping mainly relies on the design of highly specific PCR primers and multiple

CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection ... · technique. PCR-based DNA detection and genotyping mainly relies on the design of highly specific PCR primers and multiple

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR.

Supplemental table 1 : List of primers used for Me-DIP coupled Q-PCR.

Genetic Polymorphism in Barley Detected by PCR …PCR product with arbitrary primers; this method was developed in [1, 2]. Primers used for RAPD are of relatively small size (8-12

Genetic Polymorphism in Barley Detected by PCR …PCR product with arbitrary primers; this method was developed in [1, 2]. Primers used for RAPD are of relatively small size (8-12

BIOTEKNOLOGI/ANALYTISK KEMI … · BIOTEKNOLOGI/ANALYTISK KEMI Antistoffer er proteiner, ... (PCR), som dog kræver separate primers for hver mutation eller sekventering af PCR-produktet.

BIOTEKNOLOGI/ANALYTISK KEMI … · BIOTEKNOLOGI/ANALYTISK KEMI Antistoffer er proteiner, ... (PCR), som dog kræver separate primers for hver mutation eller sekventering af PCR-produktet.

DynamicsofMyosinHeavyChainGeneRegulationinSlow … · The MHC mRNA isoform distribution was evaluated by RT with random primers followed by PCR with primers targeting the embryonic,

DynamicsofMyosinHeavyChainGeneRegulationinSlow … · The MHC mRNA isoform distribution was evaluated by RT with random primers followed by PCR with primers targeting the embryonic,

Molecularevolution of magellan, amaize Ty3/gypsy- like ... · (A) Structure of magellan giving approximate locations of PCR primers 1and2.Theregionbetween primers includesthe5' LTR,the

Molecularevolution of magellan, amaize Ty3/gypsy- like ... · (A) Structure of magellan giving approximate locations of PCR primers 1and2.Theregionbetween primers includesthe5' LTR,the

Supplemental Figures. Figure S1: Primers used for genotyping icp55 insertion lines, full length cDNA amplification and qRT-PCR. Primers for Genotyping:

Supplemental Figures. Figure S1: Primers used for genotyping icp55 insertion lines, full length cDNA amplification and qRT-PCR. Primers for Genotyping:

Quantitative Real-time PCR (qPCR) › media › 11375 › 9qpcr... · QF-PCR (quantitative fluorescence PCR) and qPCR? Introduction qPCR -Non labelled primers -Real time measurements

Quantitative Real-time PCR (qPCR) › media › 11375 › 9qpcr... · QF-PCR (quantitative fluorescence PCR) and qPCR? Introduction qPCR -Non labelled primers -Real time measurements

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

Specificity, Efficiency, and Fidelity of PCR...PCR generated a number of unspecific bands or if a different set of primers (i.e., internal primers) is to be utilized for the subsequent

PCR with arbitrary primers - Gene bank · uses a short primer ... Copyright: IPGRI and Cornell Univ ersity, 2003 PCR with arbitrary primers 15! Dominant!

PCR with arbitrary primers - Gene bank · uses a short primer ... Copyright: IPGRI and Cornell Univ ersity, 2003 PCR with arbitrary primers 15! Dominant!