Kobe University Repository : ThesisManduca sexta, two types of 5HTR were cloned and revealed that...
Transcript of Kobe University Repository : ThesisManduca sexta, two types of 5HTR were cloned and revealed that...
Kobe University Repository : Thesis
学位論文題目Tit le
Funct ions of serotonin receptors in integrat ion of physiology andbehavior in insects(昆虫の生理および行動の統合性におけるセロトニン受容体の機能)
氏名Author Wang, Qiushi
専攻分野Degree 博士(学術)
学位授与の日付Date of Degree 2014-03-25
公開日Date of Publicat ion 2015-03-01
資源タイプResource Type Thesis or Dissertat ion / 学位論文
報告番号Report Number 甲第6028号
権利Rights
JaLCDOI
URL http://www.lib.kobe-u.ac.jp/handle_kernel/D1006028※当コンテンツは神戸大学の学術成果です。無断複製・不正使用等を禁じます。著作権法で認められている範囲内で、適切にご利用ください。
PDF issue: 2021-05-25
Doctoral Dissertation
博士論文
Functions of serotonin receptors in integration of
physiology and behavior in insects
昆虫の生理および行動の統合性におけるセロトニン
受容体の機能
Qiushi Wang
Graduate School of Agricultural Science, Kobe University
神戸大学大学院農学研究科
January 2014
平成 26年 1月
i
CONTENT
CHAPTER 1 General Introduction
1.1 5HT and melatonin functions in insect nervous system…….…………………... 01
1.2 NAT in insect system……………………………………………………………. 05
1.3 References………………………………………………………..……………... 08
CHAPTER 2
Serotonin receptor B may lock the gate of PTTH release/synthesis in the Chinese
silk moth, Antheraea pernyi; a diapause initiation/maintenance mechanism?
2.1. Abstract……………………………………………………………………...….. 14
2.2. Introduction…………………………………………………………...…….….. 16
2.3. Material and Methods…………………………………………………...….…... 19
2.3.1 Insect………………………………………...…………………….…..….. 19
2.3.2 Primary antibodies……………………...…………………………….…… 19
2.3.3 Immunohistochemistry……………………………….………………...…. 20
2.3.4 RNA extraction and cDNA synthesis……………………..…………......... 22
2.3.5 Preparation and injection of dsRNA……………..……………………….. 23
2.3.6 qRT-PCR……………………………………………………………….….. 23
2.3.7 SDS-PAGE and Western blotting analysis…………………………….….. 24
2.3.8 5HT and luzindole injection………………………………...…….……..... 25
2.3.9 5,7-dihydroxytryptamine (5,7-DHT) injection…………………..……..…. 25
2.3.10 Statistical analysis………………………………………………..……… 26
ii
2.4. Results……………………………………………………………..…………… 26
2.4.1 mRNA level of 5HTRs……………………………………...…………….. 26
2.4.2 Co-localization of PTTH-ir and EH-ir with 5HTR-ir in adult and pupal
BR-SOG of A. pernyi…………………………………………..………… 28
2.4.3 Effects of RNAi against 5HTRA and 5HTRB on diapause……………...… 37
2.4.4 5HT Pharmacology on diapause determination………………………...… 38
2. 5. Discussions…………………………………………………………………….. 46
2.6. References……………………………………………………………………… 53
CHAPTER 3
Serotonin receptor 2a regulates polyethism in the honeybee, Apis mellifera
3.1. Abstract…………………………………………………………………...…….. 60
3.2. Introduction……………………………………………………………..……… 61
3.3. Material and Methods…………………………………………………...……… 63
3.3.1 Animals…………………………………………………………..………... 63
3.3.2 Isolation of total RNA and cDNA synthesis………..……………………... 64
3.3.3 Preparation and injection of dsRNA………………………………..…...... 64
3.3.4 qRT-PCR…………………………………………………………..………. 64
3.3.5 PCR……………………………………………………………………….. 65
iii
3.3.6 5HT, melatonin and 5,7-DHT injection…………………………………… 66
3.3.7 Statistical analysis………………………………………………………… 66
3.4 Results…………………………………………………………………………... 66
3.4.1 mRNA level of Am5HTRs in the brain and HG…………………….…….. 66
3.4.2 Effects of RNAi against Am5HTR2a on royalactin in the brain…………... 71
3.4.3 Effect of 5HT pharmacology on royalactin……………………………….. 72
3.5 Discussion………………………………………………………………………. 76
3.6 References………………………………………………………………………. 79
CHAPTER 4
Summary……………………………………………………………...……………. 86
Acknowledgements…………………………………………………...…………….. 90
1
Chapter 1 General Introduction
1.1 5HT and melatonin functions in insect nervous system
Intercellular communications are conducted and integrated either by neural
circuit or humoral factors in multicellular organisms. Neurotransmission is conducted
in such a way that action potential streaks along axon ending at the exonterminal
where chemical neurotransmitters are released to a synaptic cleft or electrical
excitation continues to the adjacent cell. The terminal structure of axon is called
synapse across which electrically or chemically the adjacent cells are stimulated via
tight junctions or receptors. To date six types of neurotransmitters are known, 1)
amino acids such as glutamate, aspartate, gamma-amino butyric acid (GABA) and
glycine; 2) monoamines derived aromatic amino acids phenylalanine, tyrosine and
tryptophan, 3) peptides, 4) polypeptide/protein, 5) choline ester and 6) adenosine
related compounds. These compounds are not always released into synaptic deft but
sometimes to general circulation. In the latter case, agents are called neurohormones.
In between releases are made into a close vicinity, a paracrine secretion.
Indolamines are derivative of tryptophan containing 5HT (5-hydroxytryptamine),
a typical neurotransmitter and melatonin, a neurohormone. In the brain, these
indolamines antagonize each other to switch-on or –off individual functions such as
sleep, aggression and metabolism. Serotonin system sometimes counteract
catecholamine system including dopamine, norepinephrine and epinephrine, or
phenolamine system including octopamine and tyramine particularly in invertebrate
2
systems. Catecholamines system is more specified via the ligand but serotonin system
has only one ligand but is regulated by multiple types of receptors. For example, the
number of serotonin receptors (5HTRs) is 13 (Hoyer et al., 2002; Kroeze et al., 2002)
in mammals, but little is known about 5HTRs in insects.
5HT was a penultimate substrate (Fig. 1) for melatonin synthesis. Melatonin is
an indoleamine that is synthesized form 5HT via N-acetylation reactions catalyzed by
arylalkylamine N-acetyltransferase (NAT) and 5-hydroxyindole-O-methyltransferase
(HIOMT). In mammals, serotonin controls and modulates important physiological
and behavioral processes such as learning, sleep, feeding, mood and so on (Weiger,
1997). It acts as a hormone (Erspamer and Asero, 1952), a neurotransmitter (Brodie
and Shore, 1957), and a mitogen (Mohammad et al., 2008).
3
Fig. 1 Synthesis of melatonin from serotonin.
5HT functions as a neurotransmitter, neuromodulator and neurohormone also, in
most insects. 5HT is responsible for the modulation of behaviors in insects, such as
foraging (Schulz et al., 2002), sensitivity to olfactory stimuli (Menzel et al., 1999).
5HT also affects feeding in ants (Falibene et al., 2012). Lines of evidence from
various experimental approaches show that 5HT plays important physiological roles
in the circadian system of insects (Pyza and Meinertzhagen, 1996; Tomioka, 1999).
4
Tomioka and Ikeda (1993) found that 5HT content in the optic lobe of the cricket
(Gryllus bimaculatus) fluctuates, depending on the time of day and the time course of
the fluctuation is similar to the circadian change in the sensitivity of visual
interneurons. In Drosophila melanaogaster, serotonergic neurons innervate optic
neuropils that overlap with dendritic arborization of ventral lateral neuron. This is
means that the pacemaker neurons may be modulated by serotonergic neurons
(Rodrguea Moncalvo and Campos, 2005). In the honeybee, 5HT affects motor
behavior and sensory responses (Blenau and Erber, 1998; Pribbenow and Erber, 1996).
In adult bee, the level in the brain increased with age, highest concentrations being
found in foragers (Taylor et al., 1992; Wagener-Hulme et al., 1999).
The effects of serotonin are mediated through interactions with guanine
nucleotide binding and regulatory proteins (G-protein)-coupled receptor proteins that
activate multiple effectors pathways, except the 5HT3 receptors (Raymond et al.,
2001). 5HT receptors in insects have been divided into seven subfamilies that depend
on sequence homology, gene organization, coupling to second-messenger pathways,
and pharmacological properties (Hannon and Hoyer, 2008; Nichols and Nichols,
2008). All the 5HTRs are coupled to G-proteins, except the 5HT3 receptors (Raymond
et al., 2001).
By recently knowledges of 5HTRs in insects are limited. In Drosophila, 5HT1A,
5HT1B, 5HT2 and 5HT7 were designated (Nichols, 2006) to be orthologous to the
mammalian 5HTR1A, 5HTR2 and 5HTR7, just 5HT1A. 5HT1B is involved in circadian
5
system (Yuan et al., 2005). Expression levels of Dm5HTR1A and Dm5HTR2 were
under circadian regulation. These genes were defined as clock-controlled genes on
microarray analysis (Claridge-Chang et al., 2001). There are some molecular
biological reports suggesting the existence of 5HTRs in lepidopteran insects. In
Manduca sexta, two types of 5HTR were cloned and revealed that these receptors in
antennae, thoracic ganglia and abdominal ganglia of adult (Dacks et al., 2006). In
Papilio xuthus, 5HTR was cloned and shown to exist in the antenna, brain, labellum,
thoracic ganglia and tarsus of adult or pharate adult (Ono and Yoshikawa, 2004). Two
5HTRs (Ap5HT1A and Ap5HT1B) were cloned from A. pernyi (Hiragaki et al., 2008).
However, there is no report about the role of 5HTRs in regulation of pupal diapause
of lepidopteran insects. The honeybee expresses four 5HTR subtypes (Am5HT1A,
Am5HT1B, Am5HT2 and Am5HT7) that are predicted to be orthologs of the
mammalian 5HT1, 5HT2 and 5HT7 receptors (Blenau and Thamm, 2011). Am5HT1A is
a likely mediator of serotonin that was involved in the regulation of honeybee
phototactic behavior (Thamm et al., 2010).
1.2 NAT in insect system
NAT constitutes a large family of enzymes, found a variety of organisms (David,
2007). In insect, it is also involved in many other physiological functions such as,
formation of puparium, tanning of oviposited eggs (Smith, 1990), formation of
N-acetyldopamine and N-acetyloctopamine, agents for sclerotization of the cuticle
(Karlson et al., 1962). NAT activity has been found in developing eggs, various
6
organs and hemolymph of cricket G. bimaculatus (Itoh et al., 1998). Takeda et al.
(2011) found NAT activity in the silkwoth A. pernyi. NAT activity changed during
cold storage and at least ten cycles of long-day in diapause pupal. The rise of NAT
activity and diapause termination were at the same time.
Melatonin is a neurohormone, involved in a variety of functions in vertebrates
and invertebrates (Zawilska, 1992; Vivien-Roels and Pevet, 1993). In invertebrates,
melatonin is synthesized also during in dark period (Gorbet and steel, 2003).
Melatonin has been identified in the compound eyes and brain of Gryllus bimaculatus
by HPLC with fluorometric detection (Itoh et al., 1994), and its levels peaked during
the dark period (Itoh et al., 1995). In A. pernyi, melatonin receptor (MT)-like
reactivity was co-existed with PTTH, suggesting that melatonin is involved PTTH
release (Ahmed unpublished data). Similarly to A. pernyi, the stimulation of PTTH
release has been documented by co-incubation of melatonin in the brain prothoracic
gland in vitro system Periplaneta americana (Richter et al., 2000). Therefore,
melatonin plays a role as a releasing factor of the glandotropic neuropeptide PTTH in
the brain. In the honeybee, melatonin was suggested to be involved in the regulation
of aging, behavior, polyethism and sleep or wake. High levels of melatonin appeared
in foragers and during day time in caged 30 days bee (Yang et al., 2007). Whether
5HT has some relationship with melatonin in the brain of honeybee at different ages
and its role in polyethism is unclear. In Bombyx mori, melatonin level in the head was
higher during dark than light period. The synthesis and release of melatonin in the
head shows a circadian rhythm. In crickets, melatonin rhythm was also observed (Itoh
7
et al., 1998.) In vertebrates, melatonin is produced in the pineal gland, retina, skin and
gastrointestinal tract and regulated by the light/dark cycle. When melatonin was
synthesized in the pineal, it was under control of circadian oscillator (Simonneaux and
Ribelayga, 2003) and it synthesized during dark period.
Melatonin binds to on the MTs. However until now, just three types of MTs were
found in mammals. MT1 and MT2 subtypes were found in humans and other
mammals (Reppert et al., 1996) and MT3 was identified in birds and amphibians
(Sugden et al., 2004). However, little is known about the function and distribution of
MT in the central nervous system of insects.
To clarify functional roles of 5HTR in insects, we focus on 5HTRs, in the
process of diapause termination silkmoth A.pernyi and in nurse specific royalactin
production in the honeybee A. mellifera by the asking following in the questions: (1)
Serotonin receptor B may lock the gate of PTTH release/synthesis in the Chinese silk
moth, Antheraea pernyi; a diapause initiation/maintenance mechanism? (2) Does
serotonin receptor 2a regulate royalactin in the honeybee, Apis mellifera.
This study revealed the presence of 5HTR in the brain, and its regulatory
mechanisms in some developmental events and behavior.
8
1.3 References
Blenau W, Thamm M (2011) Distribution of serotonin (5-HT) and its receptors in the
insect brain with focus on the mushroom bodies. Lessons from Drosophila
melanogaster and Apis mellifera. Arthropod Structure & Development 40: 381-394
Blenau W, Erber J (1998) Behavioural pharmacology of dopamine, serotonin and
putative aminergic ligands in the mushroom bodies of the honeybee (Apis
mellifera). Behav Brain Res 96: 115-124
Brodie B, Shore P (1957) A concept for a role of serotonin and norepinephrine as
chemical mediators in the brain. Ann New York Acad Sci 66: 631-642
Claridge-Chang A, Wijnen H, Naef F, Boothroyd C, Rajewsky N, Young MW (2001)
Circadian regulation of gene expression systems in the Drosophila head. Neuron 32:
657-671
Dacks AM, Dacks JB, Christensen TA (2006) The cloning of one putative octopamine
receptor and two putative serotonin receptors fromthe tobacco hawkmoth, Manduca
sexta. Insect Biochem Molec Biol 36: 741–747
David CK (2007) Arylalkylamine N-acetyltransferase: the timezyme. J Biol Chem
282: 4233-4237
Erspamer V, Asero B (1952) Identification of enteramine, specific hormone of
enterochromaffin cells, as 5-hydroxytrptamine. Nature 169: 800-801
9
Falibene A, Rossler W, Josens R (2012) Serotonin depresses feeding behaviour in
ants. J Insect Physiol 58: 7-17
Gorbet DJ, Steel CGH (2003) A miniature radioimmunoassay for melatonin for use
with small samples from invertebrates. General Comperative Endocrinology.
134:193-197
Hannon J, Hoyer D (2008) Molecular biology of 5-HT receptors. Behav Brain Res
195: 198-213
Hiragaki S, Kawabe Y, Takeda M (2008) Molecular cloning and expression analysis
of two putative serotonin receptors in the brain of Antheraea peryni pupa.
International Journal of Wild Silkmoths & Silk 13: 1–14
Hoyer D, Hannon JP, Martin GR (2002) Molecular, pharmacological and functional
diversity of 5-HT receptors. Pharmacol Biochem Behav 71: 533-554
Itoh MT, Hattori A, Surni Y, Suzuki T (1994) Identification of melatonin in different
organs of the cricket, Gryllus bimaculatus. Zool Sci 11: 577-581
Itoh MT and Sumi Y (1998) Melatonin and serotonin N-acetyltransferase activity in
developing eggs of the cricket Gryllus bimaculatus. Brain Res 781(1-2): 90-99.
Itoh MT, Hattori A, Nomura T, Sumi Y and Suzuki T (1995) Melatonin and
arylalkylamine N-acetyltransferase activity in the silkworm, Bombyx mori. Mol
Cell Endocrinol 115(1): 59-64.
10
Itoh MT, Sumi Y (1998) Circadian clock controlling arylkamine N-acetyltransferase
like activity in cricket (Gryllus bimacullatus) egg. Brain Res. 799: 172-175
Karlson P, Sekeris CE, Sekeri KE (1962) Zum Tyrosinstoffwechsel der Insecten: VI.
Identifizierung von N-Acetyl 3, 4-dihydroxy-β-phenäthylamin (N-Acetyldopamine)
als Tyrosinmetabolit. Z Phys Chem 327: 86-94
Kroeze WK, Kristiansen K, Roth BL (2002) Molecular biology of serotonin receptors
structure and function at the molecular level. Curr Top Med Chem 2: 507-528
Menzel R, Heyne A, Kinzel C, Gerber B, Fiala A, (1999) Pharmacological
dissociation between the reinforcing, sensitizing, and response-releasing functions
of reward in honeybee classical conditioning. Behavioral Neuroscience 113: 744–
754
Mohammad-Zadeh LF, Moses L, Gwaltney-Brant SM (2008) Serotonin: a review. J
vet Pharmacol Therap 31: 187-199
Nichols R, (2006) FMRFamide-related peptides and serotonin regulate Drosophila
melanogaster heart rate: mechanisms and structure requirements. Peptides 27:
1130–1137
Nichols DE, Nichols CD (2008) Serotonin receptors. Chem rev 108: 1614-1641
Ono H, Yoshikawa H (2004) Identification of amine receptors from a swallowtail
butterfly, Papilio xuthus L: cloning and mRNA localization in foreleg
11
chemosensory organ for recognition of host plants. Insect Biochem Mol Biol 34:
1247-1256
Pribbenow B, Erber J (1996) Modulation of antennal scanning in the honeybee by
sucrose stimuli, serotonin, and octopamine: behavior and electrophysiology.
Neurobiol Learn Mem 66: 109-120
Pyza E and Meinertzhagen I A (1996) Neurotransmitters regulate rhythmic size
changes amongst cells in the fly’s optic lobe. J. Comp.Physiol. A 178: 33–45
Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW, Grewal
JS, Garnovskaya MN (2001) Multiplicity of mechanisms of serotonin receptor
signal transduction. Pharmacology and Therapeutics 92: 179–212
Richter K, Peschke E D and Peschke E (2000) A neuroendocrine releasing effect of
melatonin in the brain of an insect, Periplaneta americana (L.) J. Pineal Res. 28:
129-135
Rodriguez Moncalvo VG, Campos AR (2005) Genetic dissection of trophic
interactions in the larval optic neuropil of Drosophila melanogaster. Dev Biol 286:
549-558
Schulz DJ, Elekonich MM, Robinson GE (2002) Biogenic amines in the antennal
lobes and the initiation and maintenance of foraging behavior in honey bees.
Journal of Neurobiology 54: 406–416.
12
Simonneaux V, Ribelayga C (2003) Generation of melatonin endocrine message in
mammals: a review of the complex regulation of melatonin synthesis by
norepinephrine, peptides and other pineal transmitters. Pharmacol Rev 55: 325-395
Smith TJ (1990) Phylogenic distribution and function of arylalkylamine
N-acetyltransferase. Bioassay 12: 30-33
Sugden D, Davidson K, Hough KA, Teh MT (2004) Melatonin, melatonin receptors
and melanophores: a moving story. Pigment Cell Res. 17 (5): 454–60
Reppert SM, Weaver DR, Godson C (1996) Melatonin receptors step into the light:
cloning and classification of subtypes. Trends Pharmacol. Sci. 17 (3): 100–2
Takeda M, Hiragaki S, Bembenek J, Tsugehara T, Tohno Y, Matsumoto M, Ichihara
N (2011) Photoperiodic system for pupal diapause in Antheraea pernyi: clock,
counter, endocrine switch and roles of indolamine pathways. Int. J. Wild Silkmoth
& Silk 16: 97-109
Taylor DJ, Robinson GE, Logan BJ, Laverty R, Mercer AR (1992) Changes in brain
amine levels associated with the morphological and behavioural development of the
worker honeybee. J Comp Physio A 184: 471-479
Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of
the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin
in phototactic behavior. Cell Mol Life Sci 67: 2467-2479
13
Tomioka K (1999). Light and serotonin phase-shift the circadian clock in the cricket
optic lobe in vitro. J. Comp. Physiol. A 185: 437–444.
Tomioka K and Ikeda M (1993) Involvement of serotonin in the circadian rhythm of
an insect visual system. Naturwissenschaften 80: 137-139
Vivien-Roels B, Pevet P (1993) Melatonin: presence and formation in invertebrates.
Experientia 49: 642-647
Wagener-Hulme C, Kuehn JC, Schulz DJ, Robinson GE (1999) Biogenic amines and
division of labor in honey bee colonies. J Comp Physio A 184: 471-479
Weiger WA (1997) Serotonergic modulation of behavior: a phylogenetic overview.
Biological Reviews 72: 61-95
Yang L, Qin Y, Li X, Song D, QI M (2007) Brain melatonin content and polyethism
in adult workers of Apis mellifera and Apis cerana. J Applied Entomo 131(9-10):
734-739
Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment
in Drosophlia. Neuron 47: 115-127.
Zawilska JB (1992) Melatonin in vertebrate retina: biosynthesis, receptors and
functions. Pol J Pharmacol Pharm 44: 62
14
Chapter 2: Serotonin receptor B may lock the gate of PTTH release/synthesis in
the Chinese silk moth, Antheraea pernyi; a diapause initiation/maintenance
mechanism?
2.1 Abstract
The release of prothoracicotropic hormone, PTTH, or its blockade is the major
endocrine switch regulating the developmental channel either to metamorphosis or to
pupal diapause in the Chinese silk moth, Antheraea pernyi. We have cloned cDNAs
encoding two types of serotonin receptors (5HTRA and B). 5HTRA-, and 5HTRB-like
immunohistochemical reactivities (-ir) were colocalized with PTTH-ir in two pairs of
neurosecretory cells at the dorsolateral region of the protocerebrum (DL). Therefore,
the causal involvement of these receptors was suspected in PTTH release/synthesis.
The level of mRNA5HTRB responded to 10 cycles of long-day activation, falling to 40%
of the original level before activation, while that of 5HTRA was not affected by
long-day activation. Under LD 16:8 and 12:12, the injection of dsRNA5HTRB resulted
in early diapause termination, whereas that of dsRNA5HTRA
did not affect the rate of
diapause termination. The injection of dsRNA5HTRB induced PTTH accumulation,
indicating that 5HTRB binding suppresses PTTH synthesis also. This conclusion was
supported pharmacologically; the injection of luzindole, a melatonin receptor
antagonist, plus 5TH inhibited photoperiodic activation under LD 16:8, while that of
5,7-DHT, induced emergence in a dose dependent fashion under LD 12:12. The
results suggest that 5HTRB may lock the PTTH release/synthesis, maintaining
15
diapause. This could also work as diapause induction mechanism.
Keywords: Prothoracicotropic hormone (PTTH), Serotonin 5-HTRA, and Serotonin
5-HTRB, Diapause
16
2.2 Introduction
Many living organisms can monitor day or night length to adjust their behavior,
metabolism, physiology and developmental course to maximally adapt for an adverse
or favorable season. This is called photoperiodism, which remains as a biological
mystery, at least at the molecular level. This system is complex, consisting of several
functional subunits; a photoreceptor, a clock/timer, a summation mechanism counting
effective photoperiodic cycles and an endocrine switch. The photoperiodism of
insects, poikilotherms with wide distributions and short life, shows overwhelming
sophistication (Danks, 2003; Danilevskii, 1965). It is important to understand the
photoperiodic mechanism and its effects on the seasonal demography of pest insects
from the pest management point of view, as well as scientific curiosity. Therefore,
many scientists have attempted to elucidate this mechanism. However, the molecular
mechanism still remains obscure and dispute over the mode of photoperiodic time
measurement continues, that is hourglass timer vs. circadian clock (Saunders, 2005)
vs. mixed type (Truman, 1971; Beck, 1974; Veerman and Vaznunes, 1980).
We chose Antheraea pernyi as a model animal to study this issue, since this is a
classical organism used for study of the endocrine mechanism for metamorphosis and
pupal diapause (Williams and Adkisson, 1964b). Other advantages of using this
species include the availability of circadian clock genes and the PTTH gene (Sauman
and Reppert, 1996). A. pernyi enters pupal diapause when raised under short days, but
diapause is averted under long days. Photoperiod affects the release of PTTH. When it
is released, diapause is terminated or averted, and when it is not released, diapause
17
results or is maintained. Diapause is also terminated after long storage at a low
temperature (Takeda et al., 2011). However, the question of what releases PTTH or
conversely what stops its release remains to be answered. We have monitored brain
neurotransmitter dynamics and enzymatic activity changes during diapause and
photoperiodic activation (Matsumoto and Takeda, 2002; Takeda et al., 2011).
Sauman and Reppert (1996) have shown the juxtaposion of PER (PERIOD)-ir to
PTTH-ir in A. pernyi and Ichihara (2000) have demonstrated the colocalization of
DBT-, NAT-, HIOMT-, and melatonin-ir with PER-ir. We continuted to carry out
immunohistochemical localization of circadian clock proteins, neurotransmitter
receptors, neuropeptides and neurotransmitter metabolic enzyme-like antigens, here
showing the colocalization of Cyc- and Clk-ir with PER-ir. The results suggest that the
indolamine metabolic pathway may mediate circadian output pathway to PTTH
release.
RIA showed that “immunoreactive melatonin” increased in the brain and
hemolymph of diapause pupa of A. pernyi under long-day condition and REA,
redioengymatic assay, showed that this activation was caused by the increased insect
anylalkylamine NAT (iaaNAT, aaNAT, NAT). We have retrieved cDNA encoding
NAT from A. pernyi on the PCR-based cloning and show enzymatic activity of
baculovirus expressed protein with serotonin (5-hydroxytryptamine, 5HT) as a
substrate (Tsugehara et al., 2013). These results suggest that melatonin stimulates
PTTH release and the mechanism that dictates circadian output involves the aaNAT
gene (Bembenek, 2004). The injection of dsRNAaaNAT
abolished photoperiodism
18
under LD 16:8. The upstream promotor region of this NAT contained multiple
E-boxes and melatonin receptor (MT), MT-ir was observed in PTTH neurons
(unpublished data). During this course of study, we noticed not only MT-ir but also
serotonin receptors (5HTRs)-ir in PTTH-ir cells. The neurosecretory cells (ns cells)
secreting PTTH were located in the dorsolateral protocerebrum (DL) of A. pernyi
(Sauman and Reppert, 1996), and this condition was also found in Bombyx mori and
Manduca sexta (Mizoguchi et al., 1990; Sedlak, 1981). cDNAs encoding PTTH from
B. mori, M. sexta and A. pernyi were successfully cloned and sequenced
(Adachi-Yamada et al., 1994; Shionoya et al., 2003; Williams and Adkisson, 1964).
In A. pernyi, PTTH release was a gated phenomenon under control of the circadian
clock that terminates pupal diapause under long-day conditions (Saunder, 2011;
Williams and Adkisson, 1964; Williams and Adkisson, 1964). The release of PTTH is
also under the regulation of the photoperiodic/circadian clock, and in Periplaneta
americana melatonin stimulates PTTH release and serotonin suppresses it (Shirai et
al., 1995). In B. mori, serotonin stimulates PTTH release (Sehadova et al., 2004) but
serotonin is an upstream precursor for melatonin. Therefore it cannot be determined
which of the two indolamines is the direct releaser of PTTH. The question to be asked
here is whether diapause is simply a default condition for melatonin activation
mechanism or it requires a special mechanism of developmental arrest. If the former
is the case, these were no need of 5HTR in PTTH neurons.
5HT is a major biogenic amine distributed in the insect central nervous system
(Nassel and Cantera, 1986). 5HT regulates behaviors such as mood, sleep, memory
19
and sex in humans (Lucki, 1998). It also plays important roles in the circadian system
of insects (Tomioka et al., 1993). Recently, studies on 5HTRs have progressed in
insects, especially in Lepidoptera and Diptera (von, Nickisch-Rosenegk et al., 1996).
5HTRs are now classified into 7 subfamilies in insects (Raymond et al., 2001). The
honey bee, for example, is known to express four 5HTR subtypes (Am5HT1A,
Am5HT1B, Am5HT2 and Am5HT7). Hiragaki et al., (2008) have cloned two putative
5HTR subtypes from the brain of A. pernyi (AP5HTRA and AP5HTRB). However, the
roles of these 5HTRs in the regulation of diapause are still unclear. This is thus the
focus of this investigation.
2.3 Material and methods
2.3.1 Insect
Diapause pupae of a univoltine strain of A. pernyi were either shipped or
personally carried by researchers from Henang Province, to Japan. The diapause
pupae were stored under LD 12:12 at 25oC for 2 weeks. Diapause pupae were used for
physiological experiments within 4 months, during which time photoperiodism was
securely maintained.
2.3.2 Primary antibodies
Antibodies against two Ap5HT receptors, 5HTRA and B, were raised by injecting
totally four New Zealand white rabbits with synthetic peptides conjugated with KLH.
The 18-amino-acid peptide from 447 to 464 of the deduced sequence of A. pernyi
20
5HTRA and another peptide corresponding to 20 amino acids from 429 to 448 of the
deduced sequence of A. pernyi 5HTRB were used as antigens. Immunizations were
performed using two groups rabbits (n=2 for each group). The antigens and TiterMax
Gold were mixed at a ratio of 1:1 (v:v) before injection. Blood samples of 10 mL
were harvested from ear vein, antibody detection was analyzed from 2 weeks to 4
weeks. The whole blood collected during general anesthesia by using sodium
pentobarbital. Their specificities and details of the antibody have been described
previously in Shao et al (2010). The two sequences have no overlap. A kind gift from
Drs. Ivo Sauman of the Czech Academy of Sciences, Ceske Budejovice and Steven
Reppert of antiserum against A. pernyi PTTH (ApPTTH) raised in rabbit (residues
132-152; GenBank accession no. AAB05259) was used. We raised antibodies against
B. mori PTTH (BmPTTH) in rat (antigen sequence: GNIQVENQAIPDPPCTCKYKK)
(Genmed, Taxas, USA). This antibody was also used for double-staining and
confirmation.
2.3.3 Immunohistochemistry
Immunohistochemistry was performed on the BR-SOG of male and female
adults and pupae of A. pernyi. Dissection was conducted during the daytime from
pupae 5 days after the activation by LD 16:8. The BR-SOG, frontal ganglion (FG),
corpora cardiaca (CC) and corpora allata (CA) were dissected from the
water-anesthetized animals in sterile saline. The tissues were fixed overnight at 4oC in
Bouin solution. Standard histochemical methods were used for tissue dehydration,
embedding in paraffin, sectioning (8 µm), deparaffinization and rehydration according
21
to a previous report (Sehadova et al., 2004). The sections were blocked with 1.5%
normal goat serum diluted in Tris-buffered saline (TBS; 135 mM NaCl, 2.6 mM KCl,
25 mM Tris-HCl, pH7.6) for 30 min at room temperature (RT). Subsequent overnight
incubation with primary antibodies diluted with blocking serum (Table 1) was
conducted in a humidified chamber at 4oC. In the controls, the primary antibodies
were replaced with normal serum. After 3 rinses with TBS, each for 10 min, the
sections were incubated for 90 min with a biotinylated secondary antibody, rinsed 3
times for 10 min with TBS and treated for 30 min with VECTASTAIN ABC kit
(Vector Laboratories, Burlingame, CA, USA). Following 3 rinses each for 10 min and
one with 0.1 M Tris-HCl, pH7.5 (5 min), the HRP enzymatic reaction was visualized
with hydrogen peroxide (0.005%) and 3,3’-diaminobenzidine tetrahydrochloride
(DAB, 0.25 mM in 0.1 M Tris-HCl, pH7.5). Stained sections were dehydrated and
mounted on Bioleit mounting medium (Kouken Rika, Osaka, Japan). The mounted
specimens were examined under a BX50F4 microscope (Olympus, Tokyo, Japan).
For the double labeling (with antibodies derived from the same animal),
experiments were performed according to the method of Hiragaki et al. (2009).
Anti-Ap5HTRA/B antibody (Table 1) was incubated overnight at 4oC. After rinsing (3×)
with TBS-Tw, the slides were incubated with secondary antibody for 60 min. After
rinsing (3×) with TBS-Tw, they were treated for 30 min with VECTASTAIN ABC
reagent. Then, sections were treated with TSA Biotin System (Perkin Elmer, MA, US),
which can induce covalent bonds between tissue and biotin on the position of first
color. Anti-Ap5HTRA/B antibody was stripped out of the sections for 24 hours at RT
22
in stripping buffer (100 mM 2-mercaptoethanol, 50 mM glycine-HCl, pH2.2) in a
horizontal electric field (40 V). The sections were then incubated with anti-ApPTTH
(Table 1) overnight at 4oC. The slides were treated for 30 min with VECTASTAIN
ABC reagent. After rinsing (3×) with TBS-Tw, the slides were incubated with Alexa
Fluor 488-conjugated (green) goat anti-rabbit IgG for 60 min at RT. After rinsing (3×)
with TBS-Tw, the biotin signal was visualized with green fluorophore using a TSA
Labeling Kit #42. Finally, the slides were rinsed (3×) with TBS-Tw, mounted in Aqua
Ploymount and observed using a BX50F4 microscope (Olympus, Japan).
For double labeling (with antibodies derived from different animals), we used a
combination of anti-Ap5HTRA/B (Antibody 2) with anti-BmEH (Antibody 1) or with
anti-BmPTTH (Antibody 1), as follows. Drop cocktail of both primary antibodies
(Table 1) diluted in TBS-Tw containing 1% BSA was used to incubate the sections
overnight at 4oC. After rinsing (3×) with TBS-Tw, the slides were incubated with
horse anti-goat IgG (H+L)-biotin or goat anti-mouse IgG (H+L)-biotin (Vector
Laboratories, CA, US) for 1.5 hours. After rinsing (3×) with TBS-Tw, the slides were
incubated with Alexa Fluor 488-conjugated goat anti-rabbit IgG for 60 min at RT
(Invitrogen, Tokyo, Japan). After rinsing (3×) with TBS-Tw, the biotin signal was
visualized with red fluorophore using TSA Labeling Kit #42 with Alexa Fluor 555.
Finally, the slides were rinsed (3×) with TBS-Tw, mounted in Aqua Ploymount and
observed using a BX50F4 microscope (Olympus, Japan).
2.3.4 RNA extraction and cDNA synthesis
The BR-SOG of A. pernyi was dissected and immediately transferred to liquid
23
nitrogen and total RNA was isolated by using the RNAiso Plus reagent (Takara,
Kyoto, Japan). Five hundred nanograms of total RNA with primers using ReverTra
Ace kit (Toyobo Co. Ltd., Osaka, Japan) was used for synthesizing the cDNA.
2.3.5 Preparation and injection of dsRNA
PCR products of 539 bp for 5HTRA (accession number EU402612.1) and 345 bp
for 5HTRB (accession number EU402613.1) were prepared by gene-specific primers
(5HTRA-T7-F, 5HTRA-T7-R and 5HTRB-T7-F, 5HTRB-T7-R) (Table 4) in which the
T7 promoter was attached to the 5’ end of each primer. dsRNAs were synthesized
after incubation of the purified PCR product at 37oC for 4 hours with MEGAscript
RNAi kit (Ambion, CA, USA) according to the manufacturer’s instructions. The
control dsRNA was generated from the GFP gene of jellyfish (dsRNAGFP
) that should
have no effect on the target gene (Tschuch et al., 2008). The dsRNA and Metafectene
PRO (Biontex, Planegg, Germany) were mixed at a ratio of 1:1 (v:v) before injection.
One μg of dsRNA was injected into individual pupae.
2.3.6 qRT-PCR
The qRT-PCR was performed with the SYBR® Green and THUNDERBIRD
TM
qPCR Mix (Toyobo Co. Ltd., Osaka, Japan), with the forward and reverse primers
designed as mentioned in Table 4. Cycling parameters were 95oC for 1 min to activate
DNA polymerase, then 40 cycles of the following PCR amplification with primers
were performed using the following temperature program 95oC for 15 sec and 60
oC
24
for 1 min. To confirm the specificity of the PCR products, melting curves were
determined using the software ABI 7000 Sequence Detection System (Applied
Biosystems, Foster City, CA, USA). Amounts of amplified products were calculated
from cDNA standard curves generated for each PCR run. For expression levels of
each transcript, the rp49 (accession number DQ296005.1) mRNA was used as the
internal control. For each gene, the primers used in qRT-PCR (Table 4) were designed
to correspond to outside the region of knocking down by RNAi. The sizes of the PCR
products were 180 bp for 5HTRA and 174 bp for 5HTRB.
2.3.7 SDS-PAGE and Western blotting analysis
Pupal BR-SOGs of A. pernyi under LD 16:8 were collected 72 h after injection
of nuclease-free water (control), dsRNAGFP
and dsRNA5HTRB. The samples were
homogenized in 200 µl of sample buffer (25% 0.5 M Tris-HCl, pH 6.8, 2.3% SDS, 10%
glycerol, 5% 2-mercaptoethanol, 0.8 mg/ml bromophenol blue, 37% Millipore water)
using Branson Sonic Power (CT 06810). The homogenate was centrifuged (10,000 g,
5 min at 4oC) to eliminate the cuticle and cell debris, and from that the supernatant
was collected and denatured at 95oC for 10 min before storage at -20
oC until use.
Fifteen µl sample was loaded per lane on 10% SDS-polyacrylamide, and SeeBlue
Plus2 Pre-stained Standard marker 4-250 kDa (Invitrogen, USA) was used to estimate
the molecular marker. The proteins were transferred onto a PVDF membrane (GE
Healthcare Bio-Science Co., Piscataway, NJ, USA). The membrane was treated with
commercial blocking solution (Blocking One, Nacalai Tesque, Japan) for 30 min at
25
room temperature. The membrane was incubated with primary antibodies for
ApPTTH (1:10,000) and BmEH (1:20,000) overnight at 4oC, followed by the
corresponding HRP-conjugated secondary antibody for 1 h at room temperature. The
immunoreaction was visualized using an ECL system. The image analysis software of
Image J was used to determine the densities of specific bands.
Table 1. Data of primary antibodies used in this study
Antibody used Immunized
Animal Dilution Source
Ap5HTRA and B Rabbit 1:1000 M. Takeda, Kobe
University, Japan
BmEH Rat 1:2000 Purchased (Santa Cruz;
at-34973)
ApPTTH Rabbit 1:2000 Sauman and Reppert,
1996
BmPTTH Rat 1:1500 M. Takeda, Kobe
University, Japan
2.3.8 5HT and luzindole injection
Ten pmol 5HT in 5 µl of distilled water (D.W.) and 10 pmol luzindole (TocRis,
USA) in 5 µl of DMSO were injected using a Hamilton syringe (Hamilton Company,
USA) into the intersegmental membrane between the thorax and the abdomen for
each pupa. The control was injected with 5 µl of D.W. and 5 µl of DMSO into each
pupa under LD 16:8.
2.3.9 5,7-dihydroxytryptamine (5,7-DHT) injection
26
0.1, 1 and 10 pmol of 5,7-DHT (Sigma, USA) in 10 µl of D.W. were injected by
using a syringe into each pupa as mentioned above. The same volume of D.W. was
injected into each pupa as a control group.
2.3.10 Statistical analysis
The results are expressed as mean ± S.E.M. p<0.05 was considered the level of
significant difference between means by one-way ANOVA (Fishers, LSD) and
Kaplan-Meier.
2.4 Results
2.4.1 mRNA level of 5HTRs
Since photoperiodism constitutes a long chain of reactions, we considered
whether the two types of 5HTR are the part of this chain reaction for photoperiodic
control. If so, which of the two? We tried to determine the proximity of these
receptors to photoperiodic mechanisms by quantifying the mRNA level of the two
receptors under different photoperiodic conditions. After diapause pupae were kept
under LD 16:8 for 0, 5 and 10 days, the relative levels of mRNAs of two 5HTRs were
examined. The level of 5HTRB mRNA after 10 days of incubation under LD 16:8 was
significantly lower than those after 0 and 5 days of incubation under LD 16:8.
However, the level of 5HTRA mRNA was almost constant among the treatments (Fig.
1). Only 5HTRB was affected by photoperiodic activation.
27
Fig. 1 Relative mRNA levels of 5HTR after long-day activation. Diapause pupae
were exposed to LD 16:8 for 0, 5 and 10 cycles at 25oC and mRNA level of 5HTRA
(gray bar) and 5HTRB (white bar) in the brain-SOG was determined by real time PCR.
The results are presented as the mean ± S.E.M. from three independent experiments.
Asterisks indicate significant difference from 0-day incubation by one-way ANOVA
(Fishers, LSD). p<0.05. [LSD provides multiple comparison, giving significance
between a series of paired test by alphabets].
28
2.4.2 Co-localization of PTTH-ir and EH-ir with 5HTR-ir in adult and pupal
BR-SOG of A. pernyi
Next, we localized these receptors immunohistochemically. Data on antibodies
against Ap5HTRs, Ap/BmPTTH and BmEH are listed in Table S1. The antibodies
recognized several immunoreactive neurons in the brain of less than one day-old adult
and early pupa of A. pernyi. Tables 1 and 2 summarize the loci and numbers of those
neurons.
Table 2. The number of immunopositive cells in both hemispheres in the cephalic
ganglia of female adult A. pernyi and intensity of their immunostaining
Antigen
targeted
Locus
DL PI DC SOG
Ap5HTRA 4++++ - - -
Ap5HTRB 4+++ - - 2+++
ApPTTH 4++++ - - -
BmPTTH 4++++ - - -
BmEH - - 4++++ 2++++
PI: pars intercerebralis; DL: dorsolateral region of the protocerebrum; DC:
deutocerebrum; SOG: subesophageal ganglion. Immunoreactivity was quantified as
strong (++++), considerable (+++), moderate (++), weak (+), and negative (-).
29
Table 3. The number of immunopositive cells in both hemispheres in the cephalic
ganglia of 5 days after the exposure to LD 16:8 of A. pernyi and intensity of their
immunostaining.
Antigen
targeted
DL PI DC SOG
Ap5HTRA 4++++ - - -
Ap5HTRB 4++ - 2+ -
ApPTTH 4++++ - - -
BmPTTH 4++++ - - -
BmEH - 2++ 2++++ -
PI: pars intercerebralis; DL: dorsolateral region of the protocerebrum; De:
deutocerebrum; SOG: subesophageal ganglion. Immunoreactivity was quantified as
strong (++++), considerable (+++), moderate (++), weak (+), and negative (-).
30
A pair of large neurosecretory (ns) cells showed ApPTTH-ir in the dorsolateral
(DL) region of protocerebrum of each hemisphere of adult brain (Fig. 2B) less than
one day after emergence and also in the BR-SOG of pupa 5 days after incubation
under LD 16:8 (Fig. 3B). Ap5HTRA-ir was observed in the same cell bodies as
ApPTTH-ir in the BR-SOG of adult and early pupa (Fig. 2C; Fig. 3C).
Ap5HTRB-ir was also found in the DL of new adult and early pupa, as well as
PTTH-ir cells. One pair of neurons were found in SOG of adult (Fig. 4I) and in
deutocerebrum (DC) of early pupa (Fig. 5J). BmPTTH-ir/ApPTTH-ir and
Ap5HTRA-ir/5HTRB-ir were co-localized in the DL of adult and pupa (Fig. 2D-F,
2G-I; Fig. 3D-F, 3G-I; Fig. 4C-E, 4F-H; Fig. 5D-F, 5G-I).
Two pairs of large ns cells showed BmEH-ir in the DC of adult (Fig. 4B) and one
pair did in the pars intercerebralis (PI) of pupal brain 5 days after incubation under
LD 16:8 (Fig. 5B), and a single cell did in DC per hemisphere (Fig. 5C). This DC cell
showed 5HTRB-ir. 5HTRB-ir and EH-ir were co-localized in the SOG of adult and in
the DC of 5-day-old pupa (Fig. 4I-K; Fig. 5J-L), but 5HTRA-ir was not co-localized
with EH-ir in the brain of adult and pupa.
31
Fig. 2 Colocalization of 5HTRA- and PTTH-ir in the adult brain-SOG of A.
pernyi. BmPTTH-ir/ApPTTH-ir was co-localized with Ap5HTRA-ir in the female
adult brain-SOG. (A) The topography of detected cells. Lower-case letters indicate
regions shown in the photographs (e.g., b is the site of B). (B) Two large PTTH-ir
neurons in the DL region. (C, D, H) Two large 5HTRA-ir neurons in the DL region. (E)
BmPTTH in the DL region. (F) Merged image of BmPTTH- and 5HTRA-ir in the DL
region. (G) ApPTTH-ir in the DL region. (I) Merged image of ApPTTH and 5HTRA in
the DL region. Scale bar = 100 µm.
32
Fig. 3 Colocalization of 5HTRA- and PTTH-ir in the early pupal brain-SOG of A.
pernyi. BmPTTH-ir/ApPTTH-ir was co-localized with Ap5HTRA-ir in the brain-SOG
of 5-day-old pupa under LD 16:8. (A) The topography of detected cells. Lower-case
letters indicate regions shown in the photographs (e.g., b is the site of B). (B) Two
large PTTH-ir neurons in the DL region. (C, D, H) Two large 5HTRA-ir neurons in
the DL region. (E) BmPTTH-ir in the DL region. (F) Merged image of BmPTTH- and
5HTRA-ir in the DL region. (G) ApPTTH-ir in the DL region. (I) Merged image of
ApPTTH-ir and 5HTRA-ir in the DL region. Scale bar = 100 µm.
33
34
Fig. 4 Colocalization of 5HTRB- and PTTH-ir in the adult brain-SOG of A.
pernyi. BmPTTH-ir/ApPTTH-ir in the DL region of protocerebrum of female adult
was co-localized with Ap5HTRB-ir (●). EH-ir in the adult brain of A. pernyi and its
colocalization with Ap5HTRB-ir (●) and unique distribution (○) of EH-ir in other
regions of the brain. (A) The topography of detected cells. Lower-case letters indicate
regions shown in the photographs (e.g., b is the site of B). (B) Two pairs BmEH-ir
cells in the DC region. (C, G) 5HTRB-ir in the DL region. (D) BmPTTH-ir in the DL
region. (E) Merged image of BmPTTH-ir and 5HTRB-ir in the DL region. (F)
ApPTTH-ir in the DL region. (H) Merged image of ApPTTH-ir and 5HTRB-ir in the
DL region. (I) A 5HTRB-ir cell in the SOG. (J) One BmEH-ir cell in the SOG. (K)
Merged image of BmEH-ir and 5HTRB-ir in the SOG region. Scale bar = 100 µm.
35
36
Fig. 5 Colocalization of 5HTRB- and PTTH-ir in the erly pupal brain-SOG of A.
pernyi. BmPTTH-ir/ApPTTH-ir in the 5-day-old pupal brain of A. pernyi under LD
16:8 and its colocalization with Ap5HTRB-ir (●). BmEH-ir in the 5-day-old pupa brain
and its colocalization with Ap5HTRB-ir (●) and unique distribution (○) of BmEH-ir in
other regions of the brain. (A) The topography of detected cells. Lower-case letters
indicate regions shown in the photographs (e.g., b is the site of B). (B) One BmEH-ir
neuron in the PI. (C) BmEH-ir in the DC region. (D, H) 5HTRB-ir in the DL region.
(E) BmPTTH-ir in the DL region. (F) Merged image of BmPTTH-ir and 5HTRB-ir in
the DL region. (G) ApPTTH-ir in the DL region. (I) Merged image of ApPTTH-ir and
5HTRB-ir in the DL region. (J) 5HTRB-ir in the DC region. (K) One EH-ir neuron in
the DC. (L) Merged image of BmEH-ir and 5HTRB-ir in the DC region. Scale bar =
100 µm.
37
2.4.3 Effects of RNAi against 5HTRA and 5HTRB on diapause
To identify the function of the two serotonin receptors, diapause pupae were
injected with dsRNAGFP
, dsRNA5HTRA and dsRNA
5HTRB and then kept under LD 16:8
or LD 12:12 at 25oC. The levels of 5HTRA and 5HTRB mRNAs were significantly
lower after 72 hours of injection of dsRNA5HTRA and dsRNA
5HTRB (Fig. 6A, 7A),
while the injection of dsRNA5HTRA or dsRNA
5HTRB did not alter the level of 5HTRB
mRNA and 5HTRA mRNA, respectively (Fig. 6B, 7B). The injection of dsRNAGFP
had no effect on the transcription level of both receptor genes. Therefore, it was
concluded that RNAi acted specifically. The adult emergence from pupae injected
with dsRNA5HTRA was the same as that of the control groups, that is, uninjected and
dsRNAGFP
-injected under LD 16:8 and LD 12:12 (Fig. 6C, D). However, adults
emerged from pupae that were injected with dsRNA5HTRB earlier than the control
groups under LD 16:8 (Fig. 7C, D), and the injection of dsRNA5HTRB terminated pupal
diapause even under LD 12:12 (Fig. 7E, F).
Seventy-two hours after dsRNA5HTRA
or dsRNA5HTRB injections, PTTH- and
EH-ir bands detected on western blots were examined. No change was detected in the
samples treated with dsRNA5HTRA from uninjected and dsRNA
GFP-injected controls
(Fig. 6E, F), while a significant increase was observed in the dsRNA5HTRB-treated
group (Fig. 7G, H). A single band around 30 kDa was detected in western blotting
with ApPTTH antibody, which had a molecular mass close to that of the predicted
size of PTTH of A. pernyi (GenBank: AAB05259.1, 221aa=24.56 kDa). A single
band around 9.7 kDa detected with BmEH antibody was close to the estimated values
38
of the EH of M. sexta (GenBank: AAA29311.1, 88aa=9.67 kDa) and B. mori
(GenBank: AAA29310.1, 88aa=9.67 kDa). dsRNA5HTRB intensified these bands by
more than 300% (Fig. 7G, H). This result suggests that 5HTRB suppresses not only
the release but also the synthesis of PTTH and EH.
2.4.4 5HT Pharmacology on diapause determination
We have shown that insect aaNAT is involved in the circadian regulation of
photoperiodic termination of regulation of pupal diapause in A. pernyi (under
submission). A melatonin receptor antagonist, luzindole, inhibited the release of
PTTH in cockroach (Adachi-Yamada et al., 1994). First, we did single injections of
5HT and luzindole. After injection, the time of emergence was delayed in both groups
(data unpublished). Since NAT metabolizes 5HT to melatonin via N-acetylserotonin
and the two terminal amines have opposite physiological functions, we made a double
injection of 5HT and luzindole. Effect of 5HT should thereby most properly evaluated,
since we cannot control NAT activity. When NAT activity is high, the injected 5HT
should be converted promptly to melatonin that should antagonist 5HT effect. We
showed that the co-injection of 5 pmoles 5HT and luzindole delayed diapause
termination under LD 16:8 (Fig. 8A). This suggests a dual mechanism of diapause.
5HT maintains diapause while melatonin terminates it. This notion is further
supported by the injection of 10 pmoles 5,7-DHT into diapause pupae, which induced
emergence in a dose-dependent manner under LD 12:12 (Fig. 8B).
39
Table 4. A list of primers used in the experiments. Underlined sequences are the T7
promoter and the highlighted sequences are the original primers.
Name Sequence of the primers
5HTRA-T7-F TAATACGACTCACTATAGGGAGAAATACCTCCCGACTGTGTAAATATG
5HTRA-T7-R TAATACGACTCACTATAGGGAGACGTAATGTCACTTAAACAACAGGTG
5HTRA-F GATAGTTGACGGTAAAATCGTCGT
5HTRA-R AGCAGTTCCCGTCGTACCAG
5HTRB-T7-F TAATACGACTCACTATAGGGAGAATCAGAGGATCTAAGATGTGTCGTC
5HTRB-T7-R TAATACGACTCACTATAGGGAGACTAGATTGTTTTTCCGGGCTAGTAT
5HTRB-F TATGGCTAGGTTACTTCAACTCCAC
5HTRB-R GTTTCAAACTAGACGAGGTCAGTCA
GFP-T7-F TAATACGACTCACTATAGGGAGACCTGAAGTTCATCTGCACCAC
GFP-T7-R TAATACGACTCACTATAGGGAGAACGAACTCCAGCAGGACCAT
RP49-F AAGACCCGTCACATGCTACC
RP49-R GCGTTCGACGATTAACTTCC
40
41
Fig. 6 RNAi against 5HTRA and the effect on photoperiodism. (A) Relative
mRNA level of 5HTRA in the brain-SOG of intact diapauses pupae (control) and
those in pupae injected either with dsRNAGFP
or dsRNA5HTRA
were measured by
q-PCR. The level of 5HTRA mRNA was measured by qPCR with total RNA extracted
from brains collected at 0, 24, 48 and 72 h under LD 16:8 at 25oC. (B) Relative
mRNA level of 5HTRB in the brain-SOG of the control pupae and those of pupae
injected either with dsRNAGFP
or dsRNA5HTRA under LD 16:8 at 25
oC. (C) Adult
emergence from the control, dsRNAGFP
- or dsRNA5HTRA-injected diapause pupae
under LD 16:8 at 25oC. (D) Adult emergence after injection of dsRNA to diapauses
pupae targeting either at GFP or 5HTRA under LD 12:12 at 25oC. Emergence was
analyzed up to 40 days after injection. (E) Diapause pupae were injected with
dsRNAGFP
and dsRNA5HTRA
or nuclease-free water as a control and 72 hours later the
brain-SOG was dissected. ApPTTH and BmEH were loaded and SDS-PAGE was run.
The gel was subjected to western blot analysis. Equal amounts of protein from each
group were loaded on each lane. A single band of around 30 kDa was detected with
ApPTTH antibody and a single band of around 9.7 kDa with BmEH antibody. (F) The
density of each band was quantified and the value in the control was set to 100%. The
filled columns, PTTH and open columns, EH. Cont., water was injection. G,
dsRNAGFP
was injected. A, dsRNA5HTRA was injected and pupae were kept under LD
12:12 at 25oC. The results are presented as the mean ± S.E.M. from three independent
experiments and the differences were not significant from control by one-way
ANOVA (Fishers, LSD).
42
43
Fig. 7 RNAi against 5HTRB and the effect on photoperiodism. (A) Relative
mRNA level of 5HTRB in the brain-SOG of diapause pupae (control) and in pupae
injected either with dsRNAGFP
or dsRNA5HTRB. The level of 5HTRB mRNA was
measured by q-PCR with total RNA extracted from brain-SOG 0, 24, 48 and 72 h
after injection. (B) Relative mRNA level of 5HTRA in the brain-SOG of diapause
pupae (control) and pupae injected either with dsRNAGFP
or dsRNA5HTRB. (C) Adult
emergence from the control, dsRNAGFP
- and dsRNB5HTRB-injected diapauses pupae
under LD 16:8 at 25oC. (D) Adult emergence from the control, dsRNA
GFP- and
dsRNA5HTRB-injected pupae at 25
oC under LD 16:8. Emergence was analyzed up to
40 days after injection. (E) Diapause pupae were injected with dsRNAGFP
and
dsRNA5HTRB and adult emergence was recorded at 25
oC under LD 12:12. (F)
Cumulatively 70% adults emerged in 40 days after injection. (G) The expression of
ApPTTH and BmEH was examined using western blot analysis 72 hours after dsRNA
injection against GFP and 5HTRB, or nuclease-free water as a control. ApPTTH and
BmEH were loaded and SDS-PAGE was run. The gel was subjected to western blot
analysis. Equal amounts of protein from each group were loaded on each lane. A
single band of around 30 kDa was detected with ApPTTH antibody and a single band
of around 9.7 kDa with BmEH antibody. (H) The densitometry of each band as the
control was set to 100% after dsRNA5HTRB injection. The filled columns, PTTH and
open columns, EH. Cont., water injection. G, dsRNAGFP
injection. B, dsRNA5HTRB
injection. The results are presented as the mean ± S.E.M. from three independent
experiments. Asterisks indicate significant difference from control by one-way
44
ANOVA (Fishers, LSD). ** p<0.01.
45
Fig. 8 Pharmacological confirmation of RNAi effect targeting at 5HTRB. Effect of
injections of 5HT, 5,7-DHT and luzindole on photoperiodism. (A) Diapause pupae
were injected either with 5 µl water and 5 µl DMSO (Mock injection) or 10 pmol
Luzindole plus 10 pmol 5HT in the same volume of solvent and thereafter placed
under LD: 16:8 at 25oC. Cumulatively 5% adults emerged in 40 days. Cont., untreated.
M, injection with distilled water and DMSO. Luzindole +5HT, luzindole and 5HT
co-injected. (B) Diapause pupae were injected with 5,7-DHT at three doses and
thereafter the pupae were kept under LD 12:12 at 25oC. Cont., untreated. M, mock
injection with 10 µl distilled water. 5,7-DHT, injected with 5,7-DHT dissolved in the
same volume as in the mock. 5%, 30% and 100% adults emerged in 40 days.
Asterisks indicate significant difference from control by Kaplan-Meier. ** p<0.01.
46
2.4 Discussion
This study focused on the roles of 5HTRs in photoperiodism that regulates pupal
diapause in A. pernyi. 5HTRs have been investigated in many insects, including
Drosophila melanogaster (Nichols, 2006), Apis mellifera (Thamm et al., 2010), two
crickets (Dianemobius. nigrofasciatus and Allonemobius. allardi) (Shao et al., 2010)
and M. sexta (Dacks et al., 2006). We have cloned cDNAs encoding two 5HTRs in A.
pernyi (Hiragaki et al., 2008). We then examined the distributions of 5HTR-ir in the
BR-SOG of A. pernyi. The two receptors have both shared and unique distributions:
5HTRA-ir and 5HTRB-ir were shared in the PTTH-ir neurosecretory cells but only
5HTRB was colocalized with EH-ir, which was therefore unique.
A. pernyi overwinters in pupal diapause under short-day conditions, while it
produces another generation under long-day conditions. This developmental switch is
controlled by the release or inhibition of release of PTTH. Once diapause is initiated,
it is terminated by ten cycles of long days or low temperature for several months
(Takeda et al., 1997).
PTTH-ir has been immunohistochemically investigated in some insects,
including B. mori (Mizoguchi et al., 1990), A. pernyi (Sauman and Reppert, 1996), M.
sexta (Sedlak, 1981) and P. americana (Hiragaki et al., 2009). 5HT also stimulated
PTTH release in vitro also in a BR-SOG culture co-incubated with prothoracic gland
in B. mori (Shirai et al., 1994), but 5HTR subtypes have not been characterized in this
species. Since 5HT is metabolized to melatonin, which of the indoleamines stimulates
PTTH release cannot be determined. Richer et al. (2000) have demonstrated that, in P.
47
americana, melatonin stimulates PTTH release in vitro, whereas 5HT inhibits this
release. Luzindole inhibited PTTH release (Richter et al., 2000), with a wide use of
inhibitors of these receptors.
We here demonstrated that BmPTTH-ir/ApPTTH-ir was co-localized with
5HTR-ir ns cells at DL of both adult and early pupa of A. pernyi. Two types of
Ap5HTR-ir have also been investigated in two ground crickets, D. nigrofasciatus and
A. allardi, where 5HTRA-ir was located in PI, DL, optic tract, optic lobe and midline
of SOG, whereas 5HTRB-ir was located in the PI, DL and weakly in optic lobe,
tritocerebrum and midline of SOG in both crickets. In A. allardi, both receptors may
be involved in circadian photo-entrainment or photoperiodism because they were
co-localized with CLK-ir; in D. nigrofasciatus, only 5HTRB was co-localized with
CLK-ir. Therefore, it may be involved in circadian photo-entrainment or
photoperiodism (Shao et al., 2010). In D. melanogaster, Dm5HTR1B is expressed in
clock neurons, and changed the molecular and behavioral responses of the clock to
light (Yuan et al., 2005). This effect of 5HT is mediated via Dm5HTR1B, but not
Dm5HTR1A. These results showed that Dm5HTR1A and Dm5HTR1B play different
roles (Yuan et al., 2006). Dm5HTR1A was modulated in the larval response to light
(Rodriguez et al., 2009). Dm5HTR1A also regulates sleep, learning and memory
(Yuan et al., 2006). In our results, the function of Ap5HTRA remains unresolved in
relation to the photoperiodic regulation of diapause, but the possibility remains that it
regulates PTTH release via routes other than the photoperiodic pathway. It may be
involved in the inhibition of activation by temperature. Am5HT1A was shown to be
48
involved in the regulation of honeybee phototactic behavior (Thamm et al., 2010). It
also affects olfactory learning in the honeybee (Blenau and Thamm, 2011). 5HTRA
may be involved in the regulation of PTTH release, but not via the photic route,
because the mRNA level did not react to long-day activation. Another possibility is
that it regulates bilateral coupling with contralateral PTTH ns cells, since PTTH-ir
fibers can be traced to the contralateral ns cells.
These data strongly suggest that melatonin and a related indolamine play a key
role in the release of PTTH (Richter et al., 2000). Then, the next question to ask
should be about what locks up the release of PTTH to initiate/maintain diapause. The
answer is 5HT/5HTRB binding. The expression of 5HTRB showing circadian
fluctuation in mRNA (Hiragaki et al., 2008) is photoperiodically controlled and the
injection of dsRNA5HTRB accelerated diapause termination under LD 12:12. This
notion was supported pharmacologically. After the melatonin receptor was shut down,
5HT injection inhibited diapause termination even under LD 16:8. The injection of
5HTR antagonist, 5,7-DHT, terminated diapause in a dose-dependent manner under
LD 12:12.
Fig. 9 is a projected over-all view of dual regulation mechanism of pupal
diapause in A. pernyi. Photoperiodic/circadian gear affects aaNAT via circadian
transcription factors, CYC and CLK (photic route). If 5HT is overproduced, diapause
is initiated and maintained via 5HTRB. If melatonin is overproduced, it activates MT
that stimulates PTTH release. A balance between the two indoleamines is regulated at
NAT. Non-photic environmental condition such as low temperature may inactivate
49
5HTRA.
At the end of molting, EH release responds to both circadian gate and 20E
decline (Roy et al., 2012). EH-ir has been investigated in some insects, including
Siphlonurus armatus (Zavodska et al., 2003), M. sexta (Hewes and Truman, 1991)
and B. mori (Uno et al., 2013). 5HTRB is not only involved in PTTH release but also
in EH release/synthesis. We have demonstrated co-localization of EH-ir and
5HTRB-ir. The injection of dsRNA5HTRB increased the EH synthesis/accumulation.
Therefore, it is likely that 5HTRB is involved in EH synthesis, if EH release is not
leaky but gated.
We have demonstrated that insect aaNAT constitutes a connecting gear between
circadian oscillation and the endocrine switch mechanism because 1) circadian
neurons showing PER-, CLK-, CYC- and DBT-ir juxtapose to PTTH-ir cells and
these cells also showed aaNAT, hydroxyindol O-methytransferase (HIOMT)-, 5HT-
and melatonin-ir (under submission); 2) aaNAT enzymatic activity, its mRNA and
melatonin content all showed circadian change and aaNAT activity rises after
long-day and low-temperature exposure (under submission); 3) the promoter sequence
of aaNAT had E-boxes and the injection of both CYC and CLK suppressed NAT
transcription most convincingly (under submission); 4) injection of dsRNAPER
up-regulated aaNAT and melatonin synthesis, transcription inducing early diapause
termination, and 5) the injection of aaNAT abolished photoperiodism (under
submission).
The role of 5HTRB in the diapause induction/maintenance mechanism in the
50
brain of A. pernyi is to lock the gate for PTTH release, because dsRNA5HTRB opened
the gate. Photoperiods therefore affect two ways 1) by changing relative abundance of
5HT and melatonin via circadian regulation of aaNAT and 2) by changing 5HTRB
expression via circadian system, since 5HTRB showed a day/night fluctuation and
responded to long-day activation. We still do not know photoperiodic/circadian
influence over MT. This is our next task. Since 5,7-DHT treatment induced early
emergence under LD 12:12, diapause is not only regulated by the release of PTTH but
the main mechanism to induce/maintain diapause is 5HTRB mechanism. This drug
poisons both 5HT and melatonin. If melatonin is the only regulator of PTTH release,
the injection would not induce early emergence under LD 12:12.
51
52
Fig. 9 Schematic illustration of 5HTRs role of diapause induction/maintenance in
pupal diapause of A. pernyi. The moth has two 5HTR subtypes, 5HTRA and
5HTRB.The former subtype shows no transcription rhythm and did not respond to
photoperiodic activation by long day, while the latter showed rhythmic expression and
responded to photoperiodic activation. Therefore, it is regulated by circadian system.
At the same time, the ligand metabolism is under circadian control via one type of
arylalkylamine N-acetyltransferase, aaNAT. This nat is a circadian-controlled gene
(ccg) since dsRNACYC
, and dsRNACLK
suppressed nat transcription and dsRNANAT
dysfunction photoperiodism. The other subtype was non-rhythmic and
non-photoperiodic. MT-binding closes the endocrine switch to PTTH release that
terminates diapauses, while 5HTRB opens the switch to enforce diapauses or initiate it.
Therefore diapause of A.penyi is under binary regulation and circadian system
regulates at least two points in this system, nat transcription and 5HTRB expression.
PER, Period protein, a negative regulator of transcription. CYC/CLK, heterodimeric
circadian transcription regulator. Mel, melatonin. MT, melatonin receptor. LD, long
day. SD, short day. PTTH, prothoracicotropic hormone. PTG, prothoracic gland. E,
ecdysone. 20E, 20 hydroxyecdysone.
53
2.6 References
Adachi-Yamada T, Iwami M, Kataoka H, Suzuki A, Ishizaki H (1994) Structure and
expression of the gene for the prothoracicotropic hormone of the silkmoth Bombyx
mori. Europ J Biochem 220: 633-643
Beck SD (1974) Photoperiodic determination of insect development and diapause. II.
The determination gate in a theoretical model. J Comp Physiol 90: 297-310
Bembenek J (2004) Structure and regulatory mechanisms of circadian and
photoperiodic clocks in insects with special references to indoleamine metabolic
pathway. D. Sc. Thesis, Kobe university, pp10
Blenau W, Thamm M (2011) Distribution of serotonin (5-HT) and its receptors in the
insect brain with focus on the mushroom bodies. Lessons from Drosophila
melanogaster and Apis mellifera. Arthropod Struct Dev 40: 381-394
Dacks AM, Dacks JB, Christensen TA (2006) The cloning of one putative octopamine
receptor and two putative serotonin receptors fromthe tobacco hawkmoth, Manduca
sexta. Insect Biochem Molec Biol 36: 741–747
Danks HV (2003) Studying insect photoperiodism and rhythmicity: components,
approaches and lessons. Eur J Entomol 100: 209-221
Danilevskii AS (1965) Photoperiodism and seasonal development of insects, (Oliver
and Boyd, Edinburgh)
54
Hewes RS, Truman JW (1991) The roles of central and peripheral eclosion hormone
release in the control of ecdysis behavior in Manduca sexta. J Comp Physio A 168:
697-707
Hiragaki S, Kawabe Y, Takeda M (2008) Molecular cloning and expression analysis
of two putative serotonin receptors in the brain of Antheraea pernyi pupa.
International Journal of Wild Silkmoths and Silk 13: 1-14
Hiragaki S, Uno T, Takeda M (2009) Putative regulatory mechanism of
prothoracicotropic hormone (PTTH) secretion in the American cockroach,
Periplaneta americana as inferred from co-localization of Rab8, PTTH, and protein
kinase C in neurosecretory cells. Cell Tiss Res 335: 607-615
Ichihara N (2000) Molecular biological study on the neuroendocrine mechanisms of
circadian and photoperiodic clocks in insects. Doctoral dissertation, Kobe
University. pp. 166
Lucki I (1998) The spectrum of behaviors influenced by serotonin. Biol Psychiat 44:
151-162
Matsumoto M, and Takeda M (2002) Changes in brain monoamine contents in
diapause pupae of Antheraea pernyi when activated under long-day and by
chilling. J Insect Physiol 48(8): 765-771
Mizoguchi A, Oka T, Kataoka H, Ngasawa H, Suzuki A, Ishizaki H (1990)
55
Immunohistochemical localization of prothoracicotropic hormone-producing
neurosecretory cells in the brain of Bombyx mori. Dev Growth & Differ 32:
591-598
Nassel DR, Cantera R (1986) Mapping of serotonin-immuno reactive neurons in the
larval nervous system of the flies Calliphora erythrocephala and Sarcophaga bullata.
A comparison with ventral ganglia in adult animals. Cell and Tissue Research 239:
423-434
Nichols R (2006) FMRFamide-related peptides and serotonin regulate Drosophila
melanogaster heart rate: mechanisms and structure requirements. Peptides 27:
1130–1137
Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW, Grewal
JS, Garnovskaya MN (2001) Multiplicity of mechanisms of serotonin receptor
signal transduction. Pharmacol Therap 92: 179-212
Richter K, Peschke E, Peschke D (2000) A neuroendocrine releasing effect of
melatonin in the brain of an insect, Periplaneta americana (L.) J. Pineal Res. 28:
129-135
Richter K, Peschke E, Peschke D (1999) Effect of melatonin on the release of
prothoracicotropic hormone from the brain of Periplaneta americana (Blattodea:
Blattidae). Eur J Entomol 96: 341-345
56
Rodriguez Moncalvo VG, Campos AR (2009) Role of serotonergic neurons in the
Drosophila larval response to light. BMC Neurosci 10: 66
Roy A, Shimizu S, Kiya T, Mita K, Iwami M (2012) Identification of
20-hydroxyecdysone-inducible genes from larval brain of the silkworm, Bombyx
mori, and their expression analysis. Zoolog Sci 29(5): 333-339
Saunders DS (2005) Erwin Bunning and Tony Lees, two giants of chronobiology, and
the problem of time measurement in insect photoperiodism. J Insect Physiol 51(6):
599-608
Sauman I, Reppert SM (1996) Molecular characterization of prothoracicotropic
hormone (PTTH) from the giant silkmoth Antheraea pernyi: developmental
appearance of PTTH-expressing cells and relationship to circadian clock cells in
central brain. Dev Biol 178: 418-429
Sedlak BJ (1981) An ultrastructural study of neurosecretory fibers within the corpora
allata of Manduca sexta. Gen Comparat Endocrinol 44: 207-218
Sehadova H, Markova EP, Sehnal F, Takeda M (2004) Distribution of circadian
clock-related proteins in the cephalic nervous system of the silkworm, Bombyx
mori. J Biol Rhythms 19(6): 466-82
Shao QM, Fouda MMA, Takeda M (2010) Serotonin and two putative serotonin
receptors-like immunohistochemical reactivities in the ground crickets
57
Dianemobius nigrofasciatus and Allonemobius allardi. J Insect Physiol 56:
1576-1586
Shirai Y, Shimazaki K, Iwasaki T, Matsubara F, Aizono Y (1995) The in vitro release
of prothoracicotropichormone (PTTH) from the brain-corpus cardiacum-corpus
allatum complex of silkworm, Bombyx mori. Comp Biochem Physiol C 110:
143-148
Shirai Y, Iwasaki T, Matsubara F, Aizono Y (1994) The carbachol-induced release of
prothoracicotropic hormone from brain-corpus cardiacum-corpus allatum complex
of the silkworm, Bombyx mori. J Insect Physiol 40: 469-473
Shionoya M, Matsubayashi H, Asahina M, Kuniyoshi H, Nagata S, Riddiford LM
(2003) Molecular cloning of the prothoracicotropic hormone from the tobacco
hornworm, Manduca, sexta. Insect Biochem Molec Biol 33: 795-801
Takeda M, Hiragaki S, Bembenek J, Tsugehara T, Tohno Y, Matsumoto M, Ichihara
N (2011) Photoperiodic system for pupal diapause in Antheraea pernyi: clock,
counter, endocrine switch and roles of indolamine pathways. Int. J. Wild Silkmoth
& Silk 16: 97-109
Takeda M, Matsumoto M, Tohno Y (1997) Diapause intensity and ecdysiotroph:
comparisons between two Antheraea species (Lepidoptera: Saturniidae) having
summer and winter diapause at pupae. Eur J Entomol 94: 67-73
58
Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of
the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin
in phototactic behavior. Cell Mol Life Sci 67: 2467-2479
Tschuch, C., Schulz, A., Pscherer, A., Werft, W., Benner, A., Hotz-Wagenblatt, A.,
Barrionuevo, L.S., Lichter, L., Mertens, D. (2008). Off-target effects of siRNA
specific for GFP. BMC. Mol. Biol. 9, 60.
Truman JW (1971) The role of the brain in the ecdysis rhythm of silkmoths:
comparison with the photoperiodic termination of diapause. In Biochronometry, M.
Menaker, ed. (Washington: National Academy of Sciences press). pp. 483-504
Tomioka K, Ideka M, Nagao T, Tamotsu S (1993) Involvement of serotonin in the
circadian rhythm of an insect visual system. Naturwissenschaften. 80: 137-139
Uno T, Sakamoto K, Isoyama Y, Hiragaki S, Uno Y, Kanamaru K, Yamagata H,
Takagi T, Mizoguchi A, Takeda M (2013) Relationship between the expression of
Rab family GTPases and neuropeptide hormones in the brain of Bombyx mori.
Histochem. Cell Biol 139: 299–308
Veerman A, Vaznunes M (1980) Circadian rhythmicity participates in the
photoperiodic determination of diapause in spider mites. Nature 287: 140-141
von Nickisch-Rosenegk E, Krieger J, Kubick S, Laage R, Strobel J, Strotmann J, Beer
H (1996) Cloning of biogenic amine receptors from moths (Bombyxi mori and
59
Heliothis virescens). Insect Biochem Molec Biol 26: 817-827.
Williams CM, Adkisson PL (1964a) Photoperiodic control of pupal diapause in the
silkworm, Antheraea pernyi. Science 144: 569
Williams CM, Adkisson PL (1964b) Physiology of insect diapause. XIV. An
endocrine mechanism for the photoperiodic control of pupal diapause in the oak
silkworm, Antheraea pernyi. Biol Bull 127: 511-525
Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment
in Drosophila. Neuron 47: 115-127
Yuan Q, Joiner WJ, Sehgal A (2006) A sleep-promoting role for the Drosophila
serotonin receptor 1A. Curr Biol 16: 1051-1062
Zavodska R, Sauman I, Sehnal F (2003) Distribution of PER protein,
pigment-dispersing hormone, prothoracicotropic hormone, and eclosion hormone in
the cephalic nervous system of insects. J Biol Rhythms 18: 106-122
60
Chapter 3: Serotonin receptor 2a regulates royalactin production in the
honeybee, Apis mellifera
3.1 Abstract
The proportion of royal jelly (RJ) to honey-pollen mixture determines the fate of
females for two reproductive castes: the queen and worker. A 57-kDa protein
(designated as royalactin, RA), a main RJ protein component, induces queen
production. It increases adult body size and induces ovarian development and
shortened developmental time in honey bees. However, it is not known what regulates
royalactin production in worker bees and how abundant the RJ production is when the
workers reach the age of 20 days. We examined the hypothesis that indolamine
metabolism may regulate this shift. A genome database showed four types of 5HTR in
Apis mellifera. qPCR results showed that only Am5HTR2a mRNA level fluctuated in
parallel with RA mRNA fluctuation, but that other Am5HTRs (5HTR1, 5HTR2b and
5HTR7) did not change, not only in the brain but also in the hypopharyngeal gland
(HG). This means that Am5HTR2a is also present in the HG. The injection of
dsRNA5HTR2a reduced mRNA
RA in the brain, indicating that Am5HTR2a is essential for
RA synthesis. This conclusion was supported by the findings upon injection of
5,7-DHT. After the injection of melatonin and 5,7-DHT, the level of RA was also
pharmacologically reduced, but after the injection of 5HT, it was increased.
Keywords: royal jelly, royalactin, serotonin receptor (5HTR), serotonin (5HT)
61
3.2 Introduction
The honey bee was the first animal to be domesticated, enriching human life by
its products. It has also enriched plant diversity via its role as a pollinator. (Michener,
2000). It is a highly social animal with an elaborate communication system among
hive mates, dance language, for precise sun-oriented navigation and memory aided by
the circadian system, namely Zeitgedachtnis. It has a unique sex determination system,
haplodiploidy. Haploids become males and diploids females (Naito and Suzuki, 1991).
Females further undergo caste differentiation either to a queen or to non-reproducing
workers. This caste differentiation is determined by the composition of the diet that
young workers prepare for nursing the young. When the larvae are fed a diet with
high royal jelly (RJ) content, they are destined to become queens, but when they are
fed a low-RJ-content diet, they become workers (Tublitz et al., 1991; Nassel, 1993).
An inhibitor of DNMT2 blocks worker production. Therefore, an epigenetic
mechanism makes workers. The major RJ protein (MRJP) is called royalactin (RA).
RJ is secreted by the hypopharyngeal gland (HG) of nurse bees at an age of 3 through
20 days (Knecht and Kaatz, 1990; Albert et al., 1999; Kamakura, 2011). However, the
RA production is turned off when the nurse reaches the age of 20 days, after which
these workers become foragers. Behavioral repertoires gradually change with age: cell
cleaning, capping brood, queen tending, comb building, RJ production, pollen
processing, hive cleaning, honey processing, guarding and foraging, in this sequence.
This is called age polyethism or division of labor (Roesch, 1952; Lindauer, 1952;
Ribbands, 1952; Sakagami, 1953; Sekiguchi and Sakagami, 1966; Seeley, 1982;
62
Winston and Punnett, 1982). Conventionally, this was considered to be under JH
control, but recently Gene Robinson’s group showed that CA removal in the early
stage did not change this pattern (Fahrbach, 2003), which refuted the JH control
hypothesis. We focus on the mechanism that controls RJ production since foragers
never produce RJ and the nurse/forager transition is most clearly and quantitatively
recognized to be associated with this production.
RA is a monomeric protein that reduces developmental time and increases the
weight of an adult and ovary size (Kamakura, 2011). It exhibits epidermal growth
factor (EGF)-like effects on rat hepatocytes (Kamakura et al., 2001; Kamakura, 2002).
Royalactin and recombinant royalactin (E-royalactin; 47 kDa) were shown to increase
the juvenile hormone titer that commits the fourth larval instar to develop into a queen
(Wirta and Beetsma, 1972). This notion was supported by the finding that, in
Drosophila, RA increased the body size, cell size and fecundity, extended the lifespan
and reduced developmental time (Kamakura, 2011). However, the mechanism of
accelerated development remains unclear.
In our precious investigation, exogenous melatonin connected nurse bees to
foragers (unpublished data). A logical extension of this, we focused on serotonin
(5-hydroxytryptamine, 5HT) receptors for endocrine factor that makes the worker be
engaged in nursing tasks. 5HT acts as a neurotransmitter in most animal phyla. It
controls and modulates a variety of important physiological and behavioral processes
(Weiger, 1997), and dysfunction in the serotonergic system has been linked to several
63
human disease states (Blenau and Thamm, 2011). Serotonergic neurons regulate
physiological functions and changes in behavior in insects and related phyla (Kravits,
2000; Blenau and Baumann, 2001; Orchard, 2006; Scheiner et al., 2006; Kloppenburg
and Mercer, 2008) including the honey bee (Schurmann and Klemm, 1984; Seidel and
Bicker, 1996). The 5HT level changes with aging (Taylor et al., 1992;
Wagener-Hulme et al., 1999), as does the melatonin level (Yang et al., 2007)
The invertebrate serotonergic system might be complex (Blenau and Baumann,
2001; Hauser et al., 2006). In Drosophila melanogaster, four 5HTRs are considered to
be orthologs of the mammalian 5HTR1A, 5HTR2 and 5HTR7 (Thamm et al., 2010).
Dm5HTR1A regulates sleep, learning and memory (Yuan et al., 2006). Dm5HTR1B is
expressed in clock neurons and alterations of its levels affect molecular and
behavioral responses of the clock to light (Yuan et al., 2005). We have also
demonstrated that 5HT/serotonin receptor B (5HTRB) locks the ecdysiotroph in the
silkmoth, Antheraea pernyi (Wang et al., 2013).
3.3 Materials and Methods
3.3.1 Animals
The honey bee (A. mellifera) used in the biochemical assay were collected at the
Kobe University’s experimental garden. Newly emerged adults were sampled from
the main hive and transferred to an observation hive, marked with number tag.
Bees were dissected in phosphate buffered saline (PBS), brain and HG were
64
removed during dissection and stored at -800C until 5HTR mRNA was quantified.
3.3.2 Isolation of total RNA and cDNA synthesis
Total RNA was isolated from the brains of A. mellifera with RNAiso Plus
reagent (Takara, Japan), according to manufacturer’s instruction. Total RNA from the
brain (1 μg) was reverse-transcribd in 7 microlitre Nuclease-free water and 2
microlitre 5xRT Master Mix using ReverTra Ace kit (Toyobo co. Ltd., Osaka, Japan).
Reverse transcription was carried out at 65oC for 5 minutes, 37
oC for 15 minutes, 50
oC for 5minutes, 98
oC for 5minutes and then incubated at 4
oC.
3.3.3 Preparation and injection of dsRNA
PCR product of 202bp for Am5HTR2a (accession number NM_001202460.1)
was prepared by gene specific primers (Am5HTR2a-T7-F, Am5HTR2a-T7-R) (Table 1)
in which T7 promotor was attached to the 5’ end of each primer. Incubation of the
purified PCR product at 370C for 4 hours with MEGAscript RNAi kit (Ambion, CA,
USA) according to the manufacturer’s instructions, and then dsRNA was synthesized
from that. The control dsRNA was generated from GFP gene of jellyfish
(dsRNAGFP
). The dsRNAGFP
should have no effect on the target gene (Tschuch et al.,
2008). The dsRNA and Metafectene PRO (Biontex, Planegg, Germany) were mixed
in the ratio of 1:1 (v : v) before injection. 750 ng of dsRNA was injected per bee.
3.3.4 qRT-PCR
65
The qRT-PCR was performed with the SYBR® Green and THUNDERBIRD
TM
qPCR Mix (Toyobo Co. Ltd., Osaka, Japan). The forward and reverse primers were
designed as mentioned in Table 1. To confirm the specificity of the PCR products,
melting curves were determined using the software ABI 7000 Sequence Detection
System (Applied Biosystems, Foster City, CA, USA). Amplification reaction
contained 2.5 µl cDNA and 22.5µl PCR master mix (MIX, nuclease-free water,
primers and ROX dye). Cycling parameters were 95°C for 1 min to activate DNA
polymerase, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. For
expression levels of each transcript, the rp49 (accession number AF441189) mRNA
was used as the internal control. For Am5HTR2a gene, the primers used in qRT-PCR
(Table 1) were designed outside the region of knocking down for RNAi. The size of
PCR product was 222 bp for 5HTR1, 209 bp for Am5HTR2a, 212 bp for Am 5HTR2b,
and 208 bp for Am5HTR7.
3.3.5 PCR
For analysis of the Am5HTR2a at different ages, bees of particular age groups
were caught. For current study on the Am5HTR2a effect on the RJ synthesis, bees
were also caught to that dsRNA5HTR2a or 5,7-dihydroxytryptamine (5,7-DHT) were
injected by a microsyringe (Hamilton 10µl). Quantitative analysis of RA gene
expression was conducted by PCR with the primers shown in Table 1. PCR reactions
were performed using the kit of KOD FX (Toyobo co. Ltd., Japan, KFX-101)
according to the manufacturer’s instructions. The PCR products were
66
size-fractionated in a 1% agar gel.
3.3.6 5HT, melatonin and 5,7-DHT injection
0.1, 1 and 10 pmol of 5HT in 5 µl of D.W. and melatonin in 5µl of ethanol were
injected using a micro-syringe into each bee. 0.1, 1 and 10 pmol of 5,7-DHT (Sigma,
USA) in 5 µl of distill water were injected using a micro-syringe into each bee as
mentioned above. The same volume of D.W. or ethanol was injected into a bee as a
control group. Insects were dissected 24 hour after injection and total RNA was
extracted from the brain and HG, then gene expression was analyzed by using PCR.
3.3.7 Statistical analysis
The results are expressed as mean ± S.E.M. p<0.05 was considered as the level
of significant difference between means by one-way ANOVA (Fisher’s LSD).
3.4 Results
3.4.1 mRNA level of Am5HTRs in the brain and HG
Our focus here is to clarify the role and mechanism of 5HTR2a binding in the RA
production in A. mellifera. We first retrieved sequences of four 5HTRs, for each of
which we quantified the mRNA level at different ages after adult emergence. The
bees were marked from the first day of adult life and, 3, 6, 11, 16, 21 and 23 days
thereafter, the relative levels of mRNAs of the four Am5HTRs were examined. In the
brain, the levels of Am5HTR2a mRNA in 11- and 16-day-old bees were significantly
67
higher than in those aged 3, 21 and 23 days old. However, the levels of Am5HTR1,
Am5HTR2b and Am5HTR7 mRNAs showed no change among the different age groups
(Fig. 1A).
Subsequent analysis by PCR revealed that the highest level of Am5HTR2a
expression was also found in the HG of 6-, 11- and to a less or extent 16-day-old bees.
However, thereafter, no detection occurred (Fig. 1B). In the brain and HG, 5HTR2a
expression was increased by 5HT injection, in contrast, melatonin injection decreased
5HTR2a expression (Fig. 2A, B).
68
Table 1. A list of primers used in the experiments. Underlined sequences are the T7
promoter.
Name Sequence of the primers
5HTR2A-T7-F TAATACGACTCACTATAGGGAGACTACGGAGGATCTGACTATCTCTTG
5HTR2A-T7-R TAATACGACTCACTATAGGGAGAAGAGACAAAAGGAAGTAATTGGTGA
5HTR1A-F CTACCCCTGTTGGTTATTCTATTCC
5HTR1A-R GTTGTAAGACGACGATTTCTCAGG
5HTR2a-F TCTTCATGTTCGTGCTCTGC
5HTR2a-R CCTGGAACACTTGCACTTCA
5HTR2b-F ACGAGCTGAATTCCGTTGTC
5HTR2b-R GCTGCGTACTGTCGTTTGGT
5HTR7-F GTGATGTGATAGTTCATTGCGTTAC
5HTR7-R AGTCATTATCCGGATTGAACGTGT
GFP-T7-F TAATACGACTCACTATAGGGAGACCTGAAGTTCATCTGCACCAC
GFP-T7-R TAATACGACTCACTATAGGGAGAACGAACTCCAGCAGGACCAT
Royalactin-F AATGTAAACGAATTGATATTGAACA
Royalactin-R ATTCATAATGGAAAGAAATTTCGAG
RP49-F TCGTCACCAGAGTGATCGTT
RP49-R CCCATGAGCAATTTCAGCAC
69
Fig. 1 Relative mRNA levels of Am5HTRs in the brain after adult emergence and
expression analysis of Am5HTR2a gene transcription in the HG. (A) mRNA level
of Am5HTRs in the brain as determined by real time PCR 3, 6, 11, 16, 21 and 23 days
after adult emergence. PCR products were subjected to agarose gel electrophoresis,
and the image is representative of 3 independent expriments. The primers are listed in
Table 1. The results are presented as the mean ± S.E.M. from three independent
experiments. Asterisks indicate significant difference from 3-day incubation by
one-way ANOVA (Fisher's LSD). p<0.05. (B) Expression analysis of Am5HTR2a
gene transcription in the HG.
70
Fig. 2 Relative mRNA level of 5HTR2a after injection of 5HT/melatonin. (A)
Relative mRNA level of 5HTR2a in the brain. (B) Relative mRNA level of 5HTR2a in
the HG.
71
3.4.2 Effects of RNAi against Am5HTR2a on royalactin in the brain
To identify the function of Am5HTR2a, 11-day-old honeybees were injected with
dsRNA5HTR2a and transferred to an observation hive. The level of Am5HTR2a mRNA
was significantly lower 24 hours after the injection of dsRNA5HTR2a (Fig. 3). The
injection of dsRNAGFP
had no effect on the transcription level of Am5HTR2a genes
(Fig. 3). This result indicates that RNAi acted specifically. RA level was gradually
reduced 24 hours, 48 hours and 72 hours after the bees were injected with
dsRNA5HTR2a (Fig. 4A).
Fig. 3 RNAi against Am5HTR2a. Relative mRNA level of Am5HTR2a in the brain of
11-day-old intact bee (control) and in bee injected with either dsRNAGFP
or
dsRNA5HTR2a. The level of Am5HTR2a mRNA was measured by q-PCR with total
RNA extracted from brains collected at 0, 24, 48 and 72 h. The results are presented
as the mean ± S.E.M. from three independent experiments and the differences were
not significant from the control by one-way ANOVA (Fisher's LSD).
72
Fig. 4 Expression analysis of royalactin gene after injection of dsRNA5HTR2a. PCR
amplification of RA repetitive region was performed with different templates (after
injection of dsRNA5HTR2a): lane 1, 0 hours, lane 2, 24 hours, lane 3, 48 hours, lane 4,
72 hours.
3.4.3 Effect of 5HT pharmacology on royalactin
The injection of 0.1-10 pmoles 5HT also up-regulated RA transcription, not only
in the brain but also in the HG of 11-day-old bees. However, the injection of 0.1-10
pmol melatonin shut down the RA expression (Fig. 5A, B). RA transcription in the
brain and HG also increased after the injection of 5HT to 21-day-old bees (Fig. 6A,
B). This shows that the effect of 5HT is reversible, but not that it is due to low
melatonin content. In addition, 10 pmol 5,7-DHT injected into 11-day-old nurse bees
decreased the RA transcript in the brain (Fig. 7A). In the HG, RA transcription clearly
decreased in a dose-dependent manner (Fig. 7B).
73
Fig. 5 PCR amplification of RA. Eleven-day-old bees were injected with 5HT and
melatonin at three doses. Cont., untreated. M, mock injection with 5 µl of distilled
water or 1% ethanol. 5HT, injected with 5HT dissolved in the same volume as in the
mock. Melatonin, injection with melatonin dissolved in the same volume as the mock.
(A) Relative mRNA level of RA in the brain. (B) Relative mRNA level of RA in the
HG.
74
Fig. 6 Relative mRNA level of RA after injection of 5HT. Twenty-one-day-old
bees were injected with 5HT at three does. Cont., untreated. M, mock injection with 5
µl of distilled water. 5HT, injected with 5HT dissolved in the same volume as in the
mock. (A) Relative mRNA level of RA in the brain. (B) Relative mRNA level of RA
in the HG.
75
Fig. 7 PCR amplification of RA after depletion of indolamines. Eleven-day-old
bees were injected with 5,7-DHT at three doses. Cont., untreated. M, mock injection
with 5 µl of distilled water. 5,7-DHT, injected with 5,7-DHT dissolved in the same
volume as in the mock. (A) PCR amplification of RA in the brain. (B) PCR
amplification of RA in the HG.
76
3.5 Discussion
5HT modulates physiological states and behaviors such as motor behavior and
sensory responses in the honeybee (Erber et al., 1993; Erber and Kloppenburg, 1995;
Blenau and Erber, 1998). The present focused on the relationship between the
Am5HTR2a and RA production in A. mellifera. To test the hypothesis that 5HT
regulates RA production via Am5HTR2a, we analyzed the mRNA level of Am5HTR2a
and royalactin in the brain and HG of different ages nurse bees.
The HG in the head of honey bees (Deseyn and Billen, 2005) and most of the
major royal jelly proteins (MRJPs) were secreted from here in the head of nurse bees
(Klaudiny et al., 1994; Kubo et al., 1996). However, Peixoto et al. (2009) also showed
MRJP1 in the mushroom bodies, optic lobe and antennal lobe. It is known that the
mushroom bodies are centers for olfactory and visual perception. And the localization
of MRJP1 in the optic lobe suggests multiple functions of MRJP1 in the nervous
system. In antennal lobe, the glomerule-receive impulses from chemosensory axons
and then transmit to terminal olfactory receptors, which finally carry it to the
mushroom bodies (Kloppenburg, 1995; Galizia and Menzel, 2000; Menzel and Giurfa,
2001). However, the effect MRJP transcript in the brain remains unknown.
Four kinds of Am5HTRs were known from the bee genome (Blenau and Thamm,
2011). In the nurse bee, our results showed a fluctuation only in the level of
Am5HTR2a mRNA in the HG.
77
In the honeybee, Am5HTR1A (Thamm et al., 2010) and Am5HTR7 (Schlenstedt et
al., 2006) have been characterized at the molecular level. Am5HTR1A is a receptor that
is almost exclusively expressed in the central nervous system (CNS). It is involved in
phototactic behavior, learning and memory (Thamm et al., 2010). Am5HTR7, was the
first 5HTR in the honeybee to be molecularly characterized, of that expression was
investigated by RT-PCR, in situ hybridization and western blotting (Schlenstedt et al.,
2006). Am5HTR7 was not only detected in the brain but also in the Malpighian
tubules (Schlenstedt et al., 2006). Recently, Am5HTR2a and Am5HTR2b were cloned
from A. mellifera (Hauser et al., 2006). Current knowledge of Am5HTR2 in the
honeybee is limited.
In the brain, mRNA level of Am5HTR2a was changed, and the same fluctuations
also occur in the HG. After injection dsRNA5HTR2a, RA mRNA decreased. All these
finding indicates that Am5HTR2a may be involved in the regulation of RA production.
During insect development, 5HT-like immunoreactivity was detectable in many
outgrowing serotonergic neurons, such as pars intercerebralis neurons before the
neuritis reached their target neuropils (Seidel and Bicher, 1996). The presence of 5HT
in outgrowing neurites suggests that it modulates neural outgrowth. In second instar D.
melanogaster, serotonergic varicosities selectively decreased by the addition of
exogenous 5HT (Sykes and Condron, 2005). The serotonergic down neurons
innervating D. melanogaster gut show an increase in branching in the dopa
decarboxylase mutant (Budnik et al., 1989). Therefore, 5HT had influence on
morphogenesis in the insect nervous system. In our results, after injection 5,7-DHT
78
lead to the reduction of RA. This means that 5HT also influences RA production, and
therefore exerts indirect effects on morphogenesis.
In conclusion, 5HT regulates RA production via 5HTR2a in the brain and HG of
A. mellifera. Melatonin injection shuts down RA expression, suggesting the critical
role of arylalkylamine N-acetyltransferase (aaNAT) in the regulation of polyphenism
in A. mellifera. This is indeed the efficient mechanism to convert between discrete
phenotypes that are mutually exclusive, since aaNAT affects the relative dominance
of 5HT and melatonin in an antagonistic fashion.
79
3.6 References
Albert S, Klaudiny J, Simuth J (1999) Molecular characterization of MRJP3, highly
polymorphic protein of honeybee (Apis mellifera) royal jelly. Insect Biochem Mol
Bio 29: 427-434
Blenau W, Baumann A (2001) Molecular and pharmacological properties of insect
biogenic amine receptors: lessons from Drosophila melanogaster and Apis
mellifera. Archives Insect Biochem Physio 48: 13-38
Blenau W, Erber J (1998) Behavioural pharmacology of dopamine, serotonin and
putative aminergic ligands in the mushroom bodies of the honeybee (Apis
mellifera). Behav Brain Res 96: 115-124
Blenau W, Markus T (2011) Distribution of serotonin (5-HT) and its receptors in the
insect brain with focus on the mushroom bodies. Lessons from Drosophila
melanogaster and Apis mellifera. Arthropod Struct Dev 40: 381-394
Budnik V, Wu CF, White K (1989) Altered branching of serotonin-containing
neurons in Drosophila mutants unable to synthesize serotonin and dopamine. J
Neurosci 9: 2577-2866
Deseyn J, Billen J (2005) Age-dependent morphology and ultrastructure of the
hypopharyngeal gland of Apis mellifera workers (Hymenoptera, Apidae).
Apidologie 36: 49-57
80
Erber J, Kloppenburg P (1995) The modulatory effects of serotonin and octopamine
in the visual system of the honey bee (Apis mellifera L.). I. Behavioral analysis of
the motion-sensitive antennal reflex. J Comp Physiol A 176: 111-118
Erber J, Kloppenburg P, Scheidler A (1993) Neuromodulation by serotonin and
octopamine in the honeybee: behavior, neuroanatomy and electrophysiology.
Experientia 49: 1073-1083
Fahrbach SE, Farris SM, Sullivan JP, Robinson GE (2003) Limits on volume changes
in the mushroom bodies of the honey bee brain. J Nurobiol 57: 141-151.
Galizia CG, Menzel R (2000) Odour perception in honeybees: coding information in
glomerular patterns. Curr opini Neurol 10: 504-510
Hauser F, Cazzamali G, Williamson M, Blenau W, Grimmelikhuijzen CJ (2006) A
review of neurohormone GPCRs present in the fruitfly Drosophila melanogaster
and the honey bee Apis mellifera. Prog Neurobio 80:1-19
Kamakura M (2002) Signal transduction mechanism leading to enhanced proliferation
of primary cultured adult rat hepatocytes treated with royal jelly 57-kDa protein. J
Biochem 132: 911-919
Kamakura M (2011) Royalactin induces queen differentiation in honeybees. Nature
473: 478-483.
Kamakura M (2011) Royalactin induces queen differentiation in honeybees. Nature
81
473:478-483.
Kamakura M, Suenobu N, Fukushima M (2001) 57-kDa protein in royal jelly
enhances proliferation of primary cultured rat hepatocytes and increases albumin
production in the absence of serum. Biochem Biophys Res Commun 282: 865-874
Kloppenburg P (1995) Anatomyof the antennal motoneurons in the brain of the
honeybee (Apis mellifera). J Comp Neurol 363: 333-343
Kloppenburg P, Mercer AR (2008) Serotonin modulation of moth central olfactory
neurons. Annual Review of Entomology 53: 179-190
Knecht D, Kaatz HH (1990) Patterns of larval food production by hypopharyngeal
gland in adult worker honey bees. Apidologie 27: 457-468
Kravitz EA (2000) Serotonin and aggression: insights gained from a lobster model
system and speculations on the role of amine neurons in a complex behavior. J
Comp Physio A 186: 221-238
Lindauer M (1952) Ein beitrag zur frage der arbeitsteikung im bienenstaat. Z Vergl
Physiol 34: 299-345.
Menzel R, Giurfa M (2001) Cognitive architecture of a mini-brain: the honeybee.
trends cogn sci 5: 62-71
Michener CD (2000) The bee of the world. Baltimore: Johns Hopkins Univerisity
82
Press
Naito T, Suzuki H (1991) Sex determination in the sawfly, Athalia rosae ruficornis
(Hymenoptera): occurrence of triploid males. J Hered 82,: 101-104.
Nassel R (1993) Neuropeptides in the insect brain: a review. Cell Tissue Res 273:
1-29
Orchard I (2006) Serotonin: a coordinator of feeding-related physiological events in
the blood-gorging bug, Rhodnius prolixus.Comp Biochem Physiol A 144: 316-324
Peixoto LG, Calabria LK, Garcia L, Capparelli FE, Goulart LR, Sousa MV, Espindola
FS (2009) Identification of major royal jelly proteins in the brain of the honeybee
Apis mellifera. J Insect Physiol 55(8): 671-677
Ribbands CR (1952) Division of labour in the honeybee community. Proc Roy Soc
London (B) 140: 32-42.
Roesch GA (1925) Untersuchungen ueber die arbeitsteilung im bienenstaat, I. Teil:
Die taetigkeiten im normalen bienenstaate und ihre beziehungen zum Alter der
Arbeitsbienen. Z Vergl Physiol 2: 571-631.
Sakagami SF (1953) Untersuchungen ueber die Arbeitsteilung in einem Zwergvolk
der Honigbiene: Beitraege zue Biologie des Bienenvolkes, Apis mellifera L. I. Jap J
Zool 11: 117-185.
83
Scheiner R, Baumann A, Bienau W (2006) Aminergic control and modulation of
honeybee behavior. Curr Neuropharmacol 4: 259-276
Schlenstedt J, Balfanz S, Baumann A, Blenau W (2006) Am5-HT7: molecular and
pharmacological characterization of the first serotonin receptor of the honeybee
(Apis mellifera). J Neurochemi 98: 1985-1998
Schurmann FW, Klemm N (1984) Serotonin-immunoreactive neurons in the brain of
the honeybee. J Comp Neurol 225: 570-580
Seeley TD (1982) Adaptive significance of the age polyethism schedule in honeybee
colonies. Behav Ecol Sociobiol 11: 287-293.
Seidel C, Bicker G (1996) The developmental expression of
serotonin-immunoreactivity in the brain of the pupal honeybee. Tissue Cell 28:
663-672
Sekiguchi K, Sakagami SF (1966) Structure of foraging population and related
problems in the honeybee, with considerations on the dividion of labor in the bee
colonies. Hokkaido Nat Agric Exp Sta Rep 69: 1-65.
Sykes PA, Condron BG (2005) Development and sensitivity to serotonin of
Drosophila serotonergic varicosities in the central nervous system. Develop Biol
286: 207-216
Taylor DJ, Robinson GE, Logan BJ, Laverty R, Mercer AR (1992) Changes in brain
84
amine levels associated with the morphological and behavioural development of the
worker honeybee. J Comp Physio A 170:715-721
Thamm M, Balfanz S, Scheiner R, Baumann A, Blenau W (2010) Characterization of
the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin
in phototactic behavior. Cell Mol Life Sci 67: 2467-2479
Tschuch C, Schulz A, Pscherer A, Werft W, Benner A, Hotz-Wagenblatt A,
Barrionuevo LS, Lichter L, Mertens D (2008) Off-target effects of siRNA specific
for GFP. BMC Mol Biol 9: 60
Tublitz N, Brink D, Broadie KS, Loi PK, Sylwester AW (1991) From behavior to
molecules: an integrated approach to the study of neuropeptides. Trends Neurosci
14: 254-259.
Wagener-Hulme C, Kuehn JC, Schulz DJ, Robinson GE (1999) Biogenic amines and
division of labor in honey bee colonies. J Comp Physio A 184: 471-479
Wang QS, Mohamed AAM, Takeda M (2013) Serotonin receptor B may lock the gate
of PTTH release/synthesis in the Chinese silk moth, Antheraea pernyi; a diapause
initiation/maintenance mechanism? Plos One 8: e79381.
Winston ML (1987) The biology of the honey bee. Cambridge, Mass, Harvard
University Press, 281pp.
Winston ML, Punnett, E.N. Factors determining temporal division of labor in bees.
85
Can J Zool 60: 2947-2952.
Wirtz P, Beetsma J (1972) Induction of caste differentiation in the honeybee (Apis
mellifera L.) by juvenile hormone. Entomol. Exp. Appl. 15: 517-520
Yang L, Qin Y, Li X, Song D, Qi, M (2007) Brain melatonin content and polyethism
in adult workers of Apis mellifera and Apis cerana (Hym., Apidae). J Appl
Entomol 131: 734-739.
Yuan Q, Joiner WJ, Sehgal A (2006) A sleep-promoting role for the Drosophila
serotonin receptor 1A. Current Bilology 16: 1051-1062.
Yuan Q, Lin F, Zheng X, Sehgal A (2005) Serotonin modulates circadian entrainment
in Drosophila. Neuron 47: 115-127.
86
Chapter 4: Summary
Serotonin is an important biogenic amine that plays a key role in the regulation
and modulation of many physiological and behavioural processes in vertebrates and
invertebrates. These functions are mediated through the binding of serotonin to its
receptors. In vertebrates, the serotonin receptors (5HTRs) were classified into seven
groups on the basis of sequence homology, signaling properties, gene organization
and pharmacological properties. These receptors play different roles in the nervous
system. In insects, the serotonergic system seems to be similarly complex. Most of
5HTRs evolved before the divergence of invertebrate and vertebrate branches. Most
of 5HTRs were located in the brain of insects. The apparent role of 5HTRs can be
related to physiological functions and behavior, such as sleep, learning, memory,
circadian light sensitivity and so on. Here, we showed 5HTR plays important roles in
photoperiodism of Antheraea pernyi and polyethism in Apis mellifera.
The experiment in chapter 2 provides evidence that 5HTRB may lock the gate of
PTTH release/synthesis in the A. pernyi. First, we showed that 5HTRB-like
immunohistochemical reactivities (-ir) were co-localized with prothoracicotropic
hormone (PTTH)-ir at the dorsolateral region of the protocerebrum (DL) and eclosion
hormone (EH)-ir at DC and SOG. Transcription of 5HTRB gene is under
photoperiodic regulation: it was higher under LD 12:12 than under LD 16:8.
Therefore 5HTRB may affect the PTTH release/synthesis. Second, dsRNA5HTRB was
injected into pupa under LD 16:8 and LD 12:12. The result showed that dsRNA5HTRB
87
induced early diapause termination. Furthermore, we showed that the injection of
dsRNA5HTRB induced PTTH and EH accumulation. Therefore, we conclude that
5HTRB binding suppresses PTTH and EH synthesis and release.
Luzindole and serotonin (5HT) were co-injected under LD 16:8, the results show
that 5HT maintains diapause. This conclusions was supported by the injection of
5,7-dihydroxytryptamine (5,7-DHT) into diapause pupae under LD 12:12. This
pharmacological treatment result in earily diapause termination even under LD 12:12.
This may be the mechanism of diapause induction and maintenance at pupal stage.
The experiments described in chapter 3 showed that Am5HTR2a mRNA level
fluctuated in honeybee A. mellifera while, other Am5HTRs (5HTR1, 5HTR2b and
5HTR7) did not change along aging, not only in the brain but also in the
hypopharygeal gland (HG). This is the first demonstration of 5HT in the HG. By
injection of dsRNA5HTR2a into nurse bees, royalactin mRNA accumulation was
reduced in the brain, indicating that Am5HTR2a binding stimulates royalactin
synthesis. It means that 5HT regulates royalactin synthesis. This conclusion was
supported by injection of 5,7-DHT. After injection of 5,7-DHT, the level of royalactin
transcript was also reduced, in the brain and HG. However, the royalactin transcript
was increased, when after injection 5HT. Melatonin injection also suppressed
royalactin production.
The present study strongly suggests that 5HTRs regulate a variety of
physiological functions and behaviors in insects. Our data demonstrated that 5HTRB
88
binding induced pupal diapause in A. pernyi. However, the roles of 5HTRA were still
unclear. In A. mellifera, 5HTR binding regulates polyphenism. However, it is unclear
how 5HTR2a controls the royalactin.
In summary, 5HT and 5HTR play regulatory roles in the shift between two
phenotypes not only in the brain but also in the other tissues both in A. pernyi and A.
mellifera (Fig. 1). Therefore, this may be a general switch mechanism in
polyphenism.
89
Fig. 1 5HT and 5HTR regulate of royalactin and wax in A. mellifera.
90
Acknowledgments
First of all, I would like to express my deepest appreciation to Kobe University
and JGC-S scholarship foundation for exempting me from tuition and providing
scholarship, respectively. I have been benefited tremendously from the comments and
suggestions of my supervisor Prof. Makio Takeda, who gave me the chance to study
in Japan. Without his inspiration and explaining things clearly, this thesis would have
never been completed. He is not like other people. He is not to teach and tell us how
to do it, but inspired us how to think. This laid an important foundation for us to
become a really good self-standing researcher. I want thank associate Prof. Katsuhiko
Sakamoto, who taught me kindly about experimental techniques, giving wise advices,
helping, and encouragement, without his help I could not obtained these results. I
would like to express my profound appreciation to Prof. Ohtani who taught me
marking and observing the honeybee.
I also want to thank Drs. Qimiao Shao, Moon Soo Park, Yoshiki Nagaba, Mr.
Zhuqing He and Mr. Yuichi Egi, for their helps. I would like to express my deepest
appreciation to Dr. Maged Mohammad Ali Fauda for teaching immunohistochemistry,
Mr. Ahmed Abdulfattah Mohammad for teaching RNAi, Mr. Hiroyuki Nobada for
teaching qRT-PCR. Special thanks go to Dr. Azam Mikani, Ms. Naznin Nahar, Ms.
Xiaoting Li, Ms. Yangfan and Mr. Ahmed who played important roles along the time
when I am steady in Japan. We are providing encouragement to each other at those
times. I will always be in mind with their friendship.
Here I want to mention that I have spent very diverse life in Japan, that also due
91
to my friends: Mr. Songyan Jiang, Mr. Ryouhei Nishio and my “Japanese mother”.
At last, I want to express my thanks to my parents, without them I will have no
chance in doing anything. Then I would like to express my deepest gratitude to my
husband, Tianshun Zhang, who is now a doctor course student in the laboratory of
Biochemistry Frontiers of Kobe University. Due to his kind, patience, love,
understanding and support, I could complete my doctor course study.