7/25/2019 Kaffir Lime Leaves Extract Inhibits Biofilm Formation by Streptococcus mutans

1/5

Basic nutritional investigation

Kaf r lime leaves extract inhibits bio lm formationby Streptococcus mutans

Nateelak Kooltheat M.Sc. a, L udthawun Kamuthachad B.Sc . a,Methinee Anthapanya B.Sc. a, Natt hapon Samakchan B.S c. a,Rungnapa Pankla Sranujit Ph. D. a , b , Pachuen Potup Ph.D. a, Antonio Ferrante Ph.D. c,Kanchana Usuwanthim Ph.D. a , *

a Cellular and Molecular Immunology Research Unit, Faculty of Allied Health Sciences, Naresuan University, Phitsanulok, Thailandb Thai Traditional Medicine College, Rajamangala University of Technology Thanyaburi, Pathum Thani, Thailandc Department of Immunopathology, SA Pathology at Women s and Children s Hospital, Robinson Research Institute, University of Adelaide, South Australia

a r t i c l e i n f o

Article history:Received 6 May 2015Accepted 12 October 2015

Keywords:Kaf r limeBio lm formationStreptococcus mutans

Minimum inhibitory concentration

a b s t r a c t

Objectives: Although kaf r lime has been reported to exhibit antioxidant and antileukemic activity,little is known about the antimicrobial effect of kaf r lime extract. Because Streptococcus mutanshas been known to cause bio lm formation, it has been considered the most important causativepathogen of dental caries. Thus, the effective control of its effects on the oral bio lm is the key tothe prevention of dental caries. The aims of the present study were to investigate the effect of kaf rlime leaves extract on bio lm formation and its antibacterial activity on S. mutans .Methods: We examined the effect of kaf r lime leaves extract on growth and bio lm formation of S.mutans . For the investigation we used a kaf r lime extract with high phenolic content. The min-imum inhibitory concentration of the extract was determined by broth microdilution assay. Theinhibitory effect of the test substances on bio lm formation was also investigated by bio lm for-mation assay and qRT-PCR of bio lm formation associated genes.Results: Kaf r lime leaves extract inhibits the growth of S. mutans , corresponding to the activity of an antibiotic, ampicillin. Formation of bio lm by S. mutans was also inhibited by the extract. Theseresults were con rmed by the down-regulation of genes associated with the bio lm formation.Conclusions: The ndings highlight the ability of kaf r lime leaves extract to inhibit S. mutansactivity, which may be bene cial in the prevention of bio lm formation on dental surface, reducingdental plaque and decreasing the chance of dental carries.

2016 Elsevier Inc. All rights reserved.

Introduction

Bio lm formation by Streptococcus mutans , a gram-positivebacterium, on tooth enamel is the foremost cause of dentalplaque and dental carries [1,2] . S. mutans has the ability to usesucrose from consumed food as a bio lm-forming factor. Manyenzymes are involved in the bio lm formed by S. mutans . Thisincludes sucrose phosphorylase, glucosyltransferase, and

fructosyltransferase. These enzymes can use sucrose to synthe-size water-insoluble glucan and fructan for the adherence andformation of bio lm by S. mutans [3] . S. mutans in the oral cavityis the main cariogenic agent. The bacterium synthesizes aninsoluble glucan layer, involving glucosyltransferase (GTFase),which accumulates in dental plaque and promotes formation of dental caries. The virulence factors of S. mutans associated withcariogenicity are a set of gtf genes. GTFase synthesizes glucanpolymers from sucrose that provide binding sites for bacterialadhesion on the tooth surface and contribute to the formation of dental plaque [2] .

The use of bio lm inhibitors such as sodium uoride againstS. mutans can effectively prevent the formation of its bio lm [4] ,but high levels of sodium uoride can be toxic. Some new agents

This work was supported by Naresuan University (R2556 C074) and the Na-tional Research Council of Thailand (R2557 B035).

Con icts of interest: The authors declare no con icts of interest.* Corresponding author. Tel.: 66 5596 6411; fax: 66 5596 6234.

E-mail address: ajkarn_9@hotmail.com (K. Usuwanthim).

http://dx.doi.org/10.1016/j.nut.2015.10.0100899-9007/ 2016 Elsevier Inc. All rights reserved.

Contents lists available at ScienceDirect

Nutrition

jo u rn a l h o mep ag e : w w w.n u t r i t io n j rn l . co m

Nutrition 32 (2016) 486 490

mailto:ajkarn_9@hotmail.comhttp://dx.doi.org/10.1016/j.nut.2015.10.010http://www.sciencedirect.com/science/journal/08999007http://www.nutritionjrnl.com/http://dx.doi.org/10.1016/j.nut.2015.10.010http://dx.doi.org/10.1016/j.nut.2015.10.010http://dx.doi.org/10.1016/j.nut.2015.10.010http://dx.doi.org/10.1016/j.nut.2015.10.010http://www.nutritionjrnl.com/http://www.sciencedirect.com/science/journal/08999007http://dx.doi.org/10.1016/j.nut.2015.10.010http://crossmark.crossref.org/dialog/?doi=10.1016/j.nut.2015.10.010&domain=pdfmailto:ajkarn_9@hotmail.com

7/25/2019 Kaffir Lime Leaves Extract Inhibits Biofilm Formation by Streptococcus mutans

2/5

have been of interest because of their ability to inhibit bio lmformation of periodontal pathogens, for example, the use of oxantel for the disruption of polymicrobial bio lm [5] or the useof the antimicrobial peptide Bac8c to control the formation of bio lm [6] . The use of natural products has also been proposedfor inhibition of bio lm formation, such as extracts of Araliacontinentalis (spikenard), Camellia sinensis (tea), and Curcuma

longa (turmeric) [7 9] .Kaf r lime ( Citrus hystrix ), a plant belonging to the citrus

family, is primarily grown in South Asia and Southeast Asia.Kaf r lime leaves and fruit have been used for cooking andtraditional medicine. Kaf r lime leaves contain various classes of phytochemical substances, including terpenoids [10] . Extract of kaf r lime leaves displays antioxidant, antimicrobial, antiin-

ammatory, and antiproliferative activity against cancer cells[11] . The aims of the present study were to investigate the effectof kaf r lime leaves extract on bio lm formation and its anti-bacterial activity on S. mutans , with the objective of providing analternative approach to prevent bio lm formation by S. mutans .

Materials and methods

Preparation of kaf r lime leaves extract

Fresh leaves of kaf r lime were collected in Phitsanulok, Thailand. An extractof the leaves was prepared with a modi cation of the method from Agwaramgboet al. [12] . One hundred grams of fresh kaf r lime leaves was homogenized withsterile deionized water at the proportion of 1:5. The extract was then ltered toremove the residue, and centrifuged at 3000 g for 15 min. The supernatant wascollected, lyophilized using a freeze dryer (Thermo Fisher Scienti c Inc., MA,USA), and stored at 20 C in an airtight container.

Determination of total phenolic content

The total phenolic content of the kaf r lime leaves extract was measuredusing the Folin-Ciocalteu method, modi ed from Chang et al. [13] . The extractwas dissolved in deionized water to a concentration of 100 mg/mL. Using a 96-well plate, 2.5 mL of the extract was diluted with 100 mL of deionized water,and 25 mL of the Folin-Ciocalteu reagent was added. After 5 min of incubation atroom temperature, 100 mL of 2% sodium carbonate solution was added and thenthemixturewas incubated for60 minat 50 C. Theabsorbanceof thereactionwasmeasured at 750 nm using a microplate reader (PerkinElmer Inc., Waltham, MA,USA). Total phenolic content was then determined as mg Pyrogallol equivalent/gof the extract.

Bacterial strain and growth conditions

S. mutans ATCC 25175 (Department of Medical Sciences, Ministry of PublicHealth, Thailand) was used in this study. S. mutans was grown onto the brain-heart infusion (BHI) agar plate (HiMedia Laboratories, Mumbai, India) afterincubation at 37 C with 5% CO2 for 24 h. A single isolated colony was then har-vested, and cultured in 3 mL of BHI broth under the same conditions. When thebacteria reached log-phase growth, the number of bacteria was estimated by

optical density reading at 600 nm using a microplate reader (PerkinElmer Inc.).The concentration of bacteria was adjusted with BHI broth before use inexperiments.

Determination of minimum inhibitory concentrations

The broth dilution antimicrobial test was performed according to the stan-dard guidelines [14] . Twofold serial dilution of test substances was prepared,including 0.24 to 500 mg/mL of ampicillin sodium, 0.49 to 1000 mg/mL of sodium

uoride, and 12.21 to 250 000 mg/mL of kaf r lime leavesextract. Using a 96-wellplate, 50 mL of each concentration of the diluted substances was added into1 10 5 cfu/mL of S. mutans . After 24 h of incubation at 37 C with 5% CO2 , theabsorbance of the samples was measured at 600 nm using the microplate reader.The minimum inhibitory concentration (MIC) was de ned as the rst concen-tration of test substances that can inhibit bacterial growth. Percentage of growthinhibition was calculated relative to the untreated control.

Bio lm formation assay

Inhibitory activity of kaf r lime leaves extract on the bio lm formation of S.mutans was examined along with a gram-positive antibiotic, ampicillin, and abio lm inhibitor, sodium uoride. Using 24-well plates, planktonic culture of S.mutans in MHI broth containing 0.1% sucrose was plated at the concentration of 5 10 5 cfu/mL in either the presence or absence of the test substances. After 24 hof incubation at 37 C with 5% CO2, planktonic cells and culture media wereremoved [7] . The plate was washed twice with 500 mL of PBS and taped on apaper towel to remove excess buffer. Bio lm-forming cells were stained with100 mL/well of 0.1% crystal violet for 15 min. Then the staining solution wasdiscarded,and theplatewas washedtwice with 500 mL of PBSand air-dried. Then100 mL/well of acid-alcohol solution was added to dissolve the crystal violet dyefrom stained cells. Absorbance of each well was measured at 550 nm using themicroplate reader, and the degree of bio lm formation was determined [15] .

Bacterial RNA extraction

Total RNA from S. mutans of each condition was extracted using TRIzol re-agent, according to protocol described by the manufacturer (Life TechnologiesCorporation, Grand Island, NY, USA). Bacterial cells from each experimentalcondition were lysed using 1.5 mL of TRIzol reagent with several times of up-down pipetting after incubation at room temperature for 5 min. For phase sep-aration, 300 mL of chloroform was added to the sample tubes. After vigorouslymixing, samples were separated into aqueous colorless and organic fractions.Then tubes were centrifuged at 12000 g for15 min, and theaqueous phase wastransferred to a new tube. This was mixed with 750 mL of isopropanol, followedby centrifugation at 12 000 g for 10 min at 4 C. The precipitated RNA pelletswere collected, washed once with 1.5 mL of 75% ethanol, vortex mixed, and

centrifuged at 7500 g for 5 min at 4 C. Finally, the RNA was resuspended inribonucleases-free water. Total RNA of each sample was quanti ed by measuringabsorbance at 260 and 280 nm using a NanoDrop ND-1000 spectrophotometer(Thermo Fisher Scienti c Inc.).

Gene expression analysis

Expression of genes associated with bio lm formation of S. mutans wasanalyzed by one-step qRT-PCR assay using EXPRESS One-Step SYBR GreenER kitsaccording to the protocol described by the manufacturer (Life TechnologiesCorporation). RNAs of bacterial conditions were converted to their complemen-tary DNAs by reverse transcription followed by real-time PCR, along withquantitation of bio lm formation associated genes using 16s rRNA as qPCR signal normalization. Brie y, 20 mL of reaction contains 10 mL of EXPRESS Su-perScript qPCR SuperMix, 0.4 mL of 10 mmol/Lforward primer, 0.4 mL of10 mmol/L reverse primer as shown in Table 1 [16,17] , 5 mL of 1 ng/ mL of template RNA,0.5 mL of EXPRESS SuperScript Mix for One-Step qPCR, and 4.7 mL of RNase-free

water. With CFX96 Touch Real-Time PCR Detection System (Bio-Rad Labora-tories, Inc., USA), qRT-PCR started with the cDNA synthesis at 50 C for 5 minfollowed by the denaturation of template cDNA at 95 C for 2 min. For the

Table 1

Oligonucleotide primers used in this study

Gene Forward primer (5 0 / 3 0) Reverse primer (5 0 / 30)

Sucrose phosphorylase ( gtfA) AGGAAGTGAAGCGGCCAGT TCAATACGGCCATCCAAATCAGlucosyltransferase B ( gtfB) AGCAATGCAGCCAATCTACAAAT ACGAACTTTGCCGTTATTGTCAGlucosyltransferase-I ( gtfD) ACAGCAGACAGCAGCCAAGA ACTGGGTTTGCTGCGTTTGHistidine kinase two-component regulatory system ( vicR) TGACACGATTACAGCCTTTGATG CGTCTAGTTCTGGTAACATTAAGTCCAATACompetence-stimulating system ( comDE ) ACAATTCCTTGAGTTCCATCCAAG TGGTCTGCTGCCTGTTGCFructosyltransferase ( ftf ) AAATATGAAGGCGGCTACAACG CTTCACCAGTCTTAGCATCCTGAAGuanosine tetra (penta)-phosphatesynthetase ( relA) ACAAAAAGGGTATCGTCCGTACAT AATCACGCTTGGTATTGCTAATTGBio lm-regulation protein ( brpA) GGAGGAGCTGCATCAGGATTC AACTCCAGCACATCCAGCAAG16 S ribosomal RNA, normalizing internal standard ( 16s rRNA) CCTACGGGAGGCAGCAGTAG CAACAGAGCTTTACGATCCGAAA

N. Kooltheat et al. / Nutrition 32 (2016) 486 490 487

7/25/2019 Kaffir Lime Leaves Extract Inhibits Biofilm Formation by Streptococcus mutans

3/5

ampli cation of the DNA, 40 cycles of denaturation at 95 C for 15 s andannealing-polymerization at 60 C for1 minwereperformed. Cycle threshold (C T)of the reaction was measured by detecting the uorescence intensity of SYBR Green dye at the end of polymerization steps. Gene expression was analyzed bynormalized gene expression using the 2 DD CT method [18] .

Experimental design and statistical analysis

All experiment conditions were performed in triplicate and three indepen-dent sets of experiment were conducted. All the values are expressed asmean SEM. Results were statistically analyzed for their signi cance usingGraphPad Prism (GraphPad Software, Inc., La Jolla, CA, USA) with a con denceinterval of 99% ( P 0.01). One-way ANOVA was used for data comparison be-tween experimental conditions.

Results

Kaf r lime leaves extract

One hundred grams of fresh kaf r lime leaves was extractedwith deionized water, and 7.35 g was recovered in the aqueousfraction. The total phenolic content of the extract was52.45 0.41 mg Pyrogallol equivalent/g of dry extract. The totalphenolic content of the extract was determined by the Folin-Ciocalteu method.

Minimum inhibitory concentration

MIC was determined by the broth microdilution method us-ing 1 105 cfu/mL of S. mutans . The result showed that 250 mg/mL of ampicillin sodium, 500 mg/mL of sodium uoride, and 125000 mg/mL of kaf r lime leaves extract inhibited the growth of S.mutans (Fig. 1A). Percentages of inhibition at the MIC of sub-stances are shown in Figure 1 B.

Inhibition of bio lm formation

Inhibitory activity on bacterial bio lm was assessed bybio lm formation assay using S. mutans in MHI broth culturesupplemented with 0.1% sucrose. Ampicillin sodium, sodium

uoride, and kaf r lime leaves extract were used in the studyfor inhibitory activity. The result showed that the MIC was

62.50 mg/mL for ampicillin sodium, 500 mg/mL for sodiumuoride, and 62 500 mg/mL for kaf r lime leaves extract

(Fig. 2A). The percentages of inhibition of these MIC concen-trations are shown in Figure 2 B.

0.1 1 10 100 1000 10000 1000000

20

40

60

80

100

Ampicillin

Kaffir Lime

Sodium Fluoride

MIC MIC MIC

A

Substance Concentration ( g/ml)

P e r c e n

t a g e o

f G r o w

t h I n h i b i t i o n

U n t r e

a t e d C

o n t r o

l

g / m l A

m p i c i

l l i n

2 5 0

g / m l S

o d i u m

F l u o

r i d e

5 0 0

g / m l K

a f f i r L

i m e

1 2 5 0

0

0

20

40

60

80

100

120 ns

** *

B

P e r c e n

t a g e o

f G r o w

t h I n h i b i t i o n

Fig. 1. Minimum inhibitory concentration (MIC) and percentage of growth inhibition against Streptococcus mutans of ampicillin sodium, sodium uoride, and kaf r limeleaves extract, as determined by the broth microdilution method. Results were calculated from triplicate data representing three independent experiments, presented asmean SEM. Statistical analyses:

*

P < 0.01 by ANOVA, compared with non-treated control. ns, not signi cant.

0.1 1 10 100 1000 10000 1000000

20

40

60

80

100 Ampicillin

Kaffir Lime

Sodium Fluoride

BIC BICBIC

A

Substance Concentration ( g/ml)

P e r c e n

t a g e o f

B i o f i l m

I n

h i b i t i o n

U n t r e

a t e d C

o n t r o

l

g / m l A

m p i c i

l l i n

6 2 . 5

g / m l S

o d i u m

F l u o

r i d e

2 5 0 0

g / m l K

a f f e r

L i m e

6 2 5 0

0

20

40

60

80

100 ns

** *

B

P e r c e n

t a g e o

f B i o f i l m

I n

h i b i t i o n

Fig. 2. Bio lm inhibitory concentration (BIC) and percentage of bio lm inhibition of ampicillin sodium, sodium uoride, and kaf r lime leaves extract, as determined bybio lm formation assay. Results were calculated from triplicate data representingthree independent experiments, presented as mean SEM. Statistical analyses:*

P < 0.01 by ANOVA, compared with non-stimulated control. ns, not signi cant.

N. Kooltheat et al. / Nutrition 32 (2016) 486 490488

7/25/2019 Kaffir Lime Leaves Extract Inhibits Biofilm Formation by Streptococcus mutans

4/5

Gene expression analysis

Expression of genes associated with bio lm formation of S.mutans was determined by one-step qRT-PCR. Expression of genes, including g tfA, gtfB, gtfD, vicR, comDE , f tf , RelA, and brpA,was signi cantly down regulated ( P < 0.01) in S. mutans that hadbeen treated with ampicillin sodium, sodium uoride, or kaf rlime leaves extract. The expression of gtf genes after kaf r limetreatment was of the order of vefold relative to the untreatedcontrol, and this effect was comparable to that of both ampicillinsodium and sodium uoride. There was a similar inhibition of other genes by all substances ( Fig. 3).

Discussion

Although antibiotics play a major role in combating manybacterial infections, the increasing emergence of antibiotic-resistant strains presents a major burden to the community.Ampicillin can kill S. mutans by inhibited bacterial cell wallsynthesis. Using bio lm inhibitors such as sodium uorideagainst S. mutans can prevent the formation of bio lm, but highlevels of sodium uoride can be toxic and cause skeletal uo-

rosis. This has generated interest in the development of alter-native antimicrobial agents. Kaf r lime is a naturally occurringpolyphenolic compound that is an alternative antimicrobial.Polyphenol can interact with microbial membrane proteins,enzymes, and lipids altering cell permeability and cause loss of protons, ions, and macromolecules [19] . Moreover, phenoliccompounds can inhibit bacterial adherence to the tooth surfaceby reducing hydrophobicity and inhibition of glucosyltransferase[20] . Here we demonstrate that fresh kaf r lime leave extractwith high phenolic content inhibited the growth and bio lmformation of S. mutans , a bacterium responsible for dental caries.A marked decrease in bacterium-induced bio im formations bykaf r lime leave extract was seen at a twofold lower concen-tration of the bacterial growth MIC. The result suggests that

antimicrobial activity of kaf r lime leave extract has potentialclinical application for preventing and treating dental caries.

Todetermine the effectof kaf r lime leave extract on bacterialvirulence gene expression, qRT-PCR was performed to evaluatethe in uence of the extract on the genes related to bio lm for-mation of S. mutans . The results showed that the expression of gtfA, gtfB, gtfD, f tf , vicR, relA, brpA, and comDE was down regu-lated by kaf r lime leave extract. This result indicates that theextract can inhibit bio lm formation by S. mutans through theinhibition of virulence factors.

Among numerous virulence factors, the gtfA gene, a sucrosephosphorylase gene, was down regulated by kaf r lime leaveextract, which is likely to cause reduced use of sucrose forproduction of extracellular glucan and fructan polysaccharidein bio lm formation by S. mutans [17] . Glucosyltransferase-encoding genes, gtfB and gtfD, as well as fructosyltransferase-encoding genes, ftf gene families, were down regulated. Thiswould affect the ability of S. mutans to produce a -1,3-linked,a -1,6-linked glucans and fructan from sucrose. These resultsindicate that kaf r lime leave extract can reduce the extra-cellular polysaccharide matrix necessary for bio lm formation[16,21] .

The vicR gene, a regulatory gene of the gtf gene family, wasalso down regulated, resulting in the inhibition of bio lm for-

mation [7] . Similarly, relA, a gene associated with the physiologyof the bacteria, was also depressed. Lastly, brpA, a regulatorygene responsible for sucrose-dependent bio lm formation, andcomDE , a gene that encodes the quorum-sensing cascade-asso-ciated competence-stimulating peptides, were also down regu-lated. These results indicated that the inhibition of the bio lmformation of S. mutans by the extract was through the regulatorygenes and the quorum-sensing cascade [16] . Thus, kaf r limeleaves extract contains naturally occurring substances with ananti bio lm formation activity. Our data suggest that the kaf rlime extract, most likely through its high phenolic content,prevents bio im formation of S. mutans by two mechanisms:

rst, by a direct antimicrobial effect and, second, by inhibitingbacterial gtf genes, such as GTFase required for the glucan layer

formation, which promotes bacterial accumulation to dentalplaque and cariogenicity.

gtfA gtfB gtfD vicR comDE ftf relA brpA

0.0

0.2

0.4

0.6

0.8

1.0

1.2

*62.50 g/ml Ampicillin 500 g/ml Sodium FluorideControl 6250 g/ml Kaffer Lime Extract

* ** *

**

**

*

*

**

*

*

*

*

*

*

*

**

** E x p r e s s

i o n

F o

l d C h a n g e ,

R e

l a t i v e

t o C o n

t r o

l

Fig. 3. Expression of genes associated with bio lm formation of S. mutans as determined by qRT-PCR. Results were from triplicates, representing three independent ex-periments.

*

P < 0.01 by ANOVA, compared with non-treated control.

N. Kooltheat et al. / Nutrition 32 (2016) 486 490 489

7/25/2019 Kaffir Lime Leaves Extract Inhibits Biofilm Formation by Streptococcus mutans

5/5

Kaf r lime, a citrus fruit, has been widely used for dailycooking in South Asia and Southeast Asia, especially in Thai andMalaysian recipes such as soups and curries. Our ndings sug-gest that kaf r lime leaves have high phenolic content, whichacts as an antimicrobial substance and inhibits bio lm forma-tion. Thus, kaf r lime leaves may be used as an alternativetreatment for bio lm formation on dental surface to reduce

dental plaque and decrease the chance of dental carries. How-ever, the use of kaf r lime leaves extract may change the bac-terial ora, and the consequence of this will need to beconsidered.

Conclusions

The ndings reveal the inhibitory activity of kaf r lime leavesextract on growth and bio lm formation of S. mutans . This is the

rst demonstration that a phenolic-rich kaf r lime leaves extractinhibits GTFase-encoding genes, virulence factors, and regula-tory genes vicR, relA, brpA, and comDE associated with bio lmformation and physiology of S. mutans .

References

[1] Li MY, Huang RJ, Zhou XD, Gregory RL. Role of sortase in Streptococcusmutans under the effect of nicotine. Int J Oral Sci 2013;5:206 11.

[2] Zhao W, Li W, Lin J, Chen Z, Yu D. Effect of sucrose concentration onsucrose-dependent adhesion and glucosyltransferase expression of S.mutans in children with severe early-childhood caries (S-ECC). Nutrients2014;6:3572 86 .

[3] Bitoun JP, Nguyen AH, Fan Y, Burne RA, Wen ZT. Transcriptional repressorRex is involved in regulation of oxidative stress response and bio lm for-mation by Streptococcus mutans . FEMS Microbiol Lett 2011;320:110 7.

[4] Pandit S, Kim HJ, Song KY, Jeon JG. Relationship between uoride con-centration and activity against virulence factors and viability of a cario-genic bio lm: in vitro study. Caries Res 2013;47:539 47.

[5] Dashper S, O Brien-Simpson N, Liu SW, Paolini R, Mitchell H, Walsh K, et al.Oxantel disrupts polymicrobial bio lm development of periodontal path-

ogens. Antimicrob Agents Chemother 2014;58:378

85 .

[6] Ding Y, Wang W, Fan M, Tong Z, Kuang R, Jiang W, et al. Antimicrobial andanti-bio lm effect of Bac8 c on major bacteria associated with dental cariesand Streptococcus mutans bio lms. Peptides 2013;52C:61 7.

[7] Jeong SI, Kim BS, Keum KS, Lee KH, Kang SY, Park BI, et al. Kaurenoic acidfrom Aralia continentalis inhibits bio lm formation of Streptococcus mutans .Evid Based Complement Alternat Med 2013;2013:160592 .

[8] Wang Y, Lee SM, Dykes GA. Potential mechanisms for the effects of teaextracts on the attachment, bio lm formation and cell size of Streptococcusmutans . Biofouling 2013;29:307 18.

[9] Hu P, Huang P, Chen MW. Curcumin reduces Streptococcus mutans bio lmformation by inhibiting sortase A activity. Arch Oral Biol 2013;58:1343 8.[10] Norkaew O, Pitija K, Pripdeevech P, Sookwong P, Wo S. Supercritical uid

extraction and gas chromatographic-mass spectrometric analysis of ter-penoids in fresh kaf r lime leaf oil. Chiang Mai J Sci 2012;40:240 7.

[11] Chueahongthong F, Ampasavate C, Okonogi S, Tima S, Anuchapreeda S.Cytotoxic effects of crude kaf r lime ( Citrus hystrix , DC.) leaf fractionalextracts on leukemic cell lines. J Med Plant Res 2011;5:3097 105 .

[12] Agwaramgbo L, Okegbe T, Wright T, Igwe S, Ogburie V. Inhibition of theoxidation of acetophenone by aqueous extracts of edible fruits and vege-tables. Mod Chem Appl 2013;1:105 .

[13] Chang CL, Lin CS, Lai GH. Phytochemical characteristics, free radical scav-enging activities, and neuroprotection of ve medicinal plant extracts. EvidBased Complement Alternat Med 2012;2012:984295 .

[14] Clinical and Laboratory Standards Institute. Methods for dilution antimi-crobial susceptibility tests for bacteria that grow aerobically; approvedstandard d ninth edition. Pennsylvania: Clinical and Laboratory StandardsInstitute; 2012 .

[15] O

Toole GA. Microtiter dish bio lm formation assay. J Vis Exp; 2011:e2437 .[16] Steinberg D, Moreinos D, Featherstone J, Shemesh M, Feuerstein O. Geneticand physiological effects of noncoherent visible light combined withhydrogen peroxide on Streptococcus mutans in bio lm. Antimicrob AgentsChemother 2008;52:2626 31.

[17] Shemesh M, Tam A, Steinberg D. Differential gene expression pro ling of Streptococcus mutans cultured under bio lm and planktonic conditions.Microbiology 2007;153:1307 17.

[18] Van Peer G, Mestdagh P, Vandesompele J. Accurate RT-qPCR gene expres-sion analysis on cell culture lysates. Sci Rep 2012;2:222 .

[19] Ferrazzano GF, Amato I, Ingenito A, Zarrelli A, Pinto G, Pollio A. Plantpolyphenols and their anti-cariogenic properties: a review. Molecules2011;16:1486 507 .

[20] Rao S, Gruber JV, Brooks GJ. Personal care composition containing yeast/resveratrol ferment extract. U.S. Pat Appl Pub 2010;WO2010011885 A1.

[21] Youse B, Ghaderi S, Rezapoor-Lactooyi A, Amiri N, Verdi J, Shoae-Hassani A. Hydroxy decenoic acid down regulates gtfB and gtfC expressionand prevents Streptococcus mutans adherence to the cell surfaces. Ann ClinMicrobiol Antimicrob 2012;11:21 .

N. Kooltheat et al. / Nutrition 32 (2016) 486 490490

http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref18http://refhub.elsevier.com/S0899-9007(15)00416-5/sref18http://refhub.elsevier.com/S0899-9007(15)00416-5/sref18http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref21http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref19http://refhub.elsevier.com/S0899-9007(15)00416-5/sref18http://refhub.elsevier.com/S0899-9007(15)00416-5/sref18http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref17http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref16http://refhub.elsevier.com/S0899-9007(15)00416-5/sref15http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref14http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref13http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref12http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref11http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref10http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref9http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref8http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref7http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref6http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref5http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref4http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref3http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref2http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1http://refhub.elsevier.com/S0899-9007(15)00416-5/sref1