Joanna Klein, Ph.D. Northwestern Scholarship Symposium May 10, 2013 Cellulophaga lytica Marine bacterium of the CFB group Isolated from beach mud near Limon, Costa Rica in limon_vacations-i Cellulophaga lytica Gram negative Filamentous Yellow pigmentation Exhibits gliding motility Degrades cellulose Cellulophaga lytica Target organism in the Genomic Encyclopedia of Bacteria and Archaea (GEBA) Research Program of the Department of Energy/Joint Genome Institute GEBA organisms 100 representative organisms from each of the branches Organisms with potential energy applications C. lytica: Northwesterns microbial mascot Interpret a genome for education JGI Genome Annotation Workshop, Walnut Creek, CA, January 2011 Why study C. lytica? Model organism to understand the CFB group better Contribute to biofuel research and applications Unique method of motility: Gliding Biofuel production C. lytica produces a variety of enzymes that may have applications in biotechnology and biofuel production Ethanol production Ethanol produced as a byproduct of starch degradation and subsequent fermentation Well developed technology Enzymes digest starch into simple sugars which are readily fermented by known microorganisms to produce ethanol Issues Cellulosic ethanol production Goal is to use the cellulose biomass found in plant cell walls of leaves and wood to produce ethanol Problems to overcome: Lignin, also found in cell wall, hinders digestion of cellulose from wood Enzymes that digest cellulose into simple sugars are poorly understood Organisms that ferment these simple sugars to produce ethanol are poorly understood Can C. lytic help achieve this goal? Predicted to encode 3 cellulase enzymes 3 Cellulase genes of C. lytica Cellulase 1 Cellulase 2 Cellulase 3 Plant Cell Wall Cellulase Enzymes in C. lytica Purpose: To determine if the predicted cellulase enzymes in C. lytica are capable of degrading cellulose. Method: Evaluate an assay for cellulose degradation in C. lytica Transfer a cellulase gene from C. lytica to E. coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose. Grow bacteria on agar plates for 48 hours Cover with top agar containing 1% carboxymethylcellulose (CMC) and incubate 24 hours Flood with Congo Red Congo red binds to CMC Areas where CMC has been degraded will not be stained zone of clearance Cellulase Degradation Assay - Congo-Red Plate Assay Congo Red Assay: E. coli TOP10 and C. lytica were grown on a TSA plate containing 2% Salt + 1% carboxymethylcellulose. After flooding with Congo Red and fixing the stain, a zone of clearing was observed around C. lytica but not around E. coli. Method Transfer a cellulase gene from C. lytica to E. coli, which does not degrade cellulose, and determine if E. coli can now degrade cellulose. PCR amplify a cellulase gene from C. lytica Insert the cellulase gene into the TOPO-TA plasmid Transfer the recombinant plasmid into E. coli TOP10 Expresses cellulase enzyme in E. coli Determine if E. coli can degrade cellulose using the congo red plate assay PCR Amplification PCR amplification of cellulase 1 gene from C. lytica (lane 3) 3 of 5 clones had cellulase activity Fugure Work Clone 2 remaining cellulase genes and test for activity Cellulase 3 gene was PCR amplified and cloned into TOPO-TA vector None of the 10 clones exhibited cellulase activity Verify correct plasmid construction Cellulase 2 failed in PCR amplification Troubleshoot PCR procedure Perform similar experiments with additional polysaccharide degrading enzymes from C. lytica Gliding motility in C. lytica Gliding allows bacteria to move across surfaces Gliding Motility in C. lytica Gliding Motility Research in Flavobacterium indicates over 20 proteins are involved in gliding cell membrane localization 6 are lipoproteins Many make motor that propels the cell sprB is thought to be a surface protein and adhesin propelled along surface by motor Genome Annotation of gliding motility genes of Cellulophaga lytica Genetics students annotated 11 of these predicted gliding motility genes gldAAlyssa/Emily gldFNot annotated gldGNot annotated gldHKait/Alannah gldDIsaac/Sam gldIBrittany/Kristen gldBKayla/Josh gldCDavid/Andy gldEDrew/Aaron/Joey gldKNaomi/Taylor gldLMac/Bri gldMElla/Nyemo gldNAnna/Alyssa What is annotation? One way to understand more about the life processes of C. lytica is through a study of its genome. Genome All of the genetic material, DNA, of an organism DNA is made up 4 smaller molecules known as the bases A,C,G &T Genome projects We can easily determine the entire DNA sequence of an organism its genome. Currently, there are more than 3000 complete or nearly complete genome sequences of microbes available. The complete genome of Cellulophaga lytica was sequenced by the DOE and published in ,765,936 bases Genome Projects Determine the genome sequence Annotate genome: Process of attaching biological information to sequences Study function of genes TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGG TGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC Cellulase Process of annotation Automatic annotation - done automatically using computer software 35% of computer generated annotations are wrong or are missing information due to limitations of computer algorithms Manual Annotation humans analyze the information generated by computers and make corrections as necessary. Labor intensive and time consuming Solution: Train students to participate in the process IMG-ACT is a toolkit of online gene and genome analysis programs. Using IMG-ACT, students annotate genomes provide human expertise necessary for accurate, up- to-date, reliable annotation Students contribute to the scientific community and learn biological concepts through participating in original research Annotation of Gliding Motility Genes in C. lytica The computer based annotation of all 11 genes was confirmed through manual annotation by students Genome annotation of C. lytica at NWC 64 NWC students have participated in this research project Science Research Institute, Summer 2011 Genetics, Fall 2011 Microbiology, Spring 2012 Genetics, Fall 2012 Research Students 29 genes have been fully annotated 10 genes have been partially annotated Future work 3,334 genes left to annotate! Study the function of interesting genes in the lab Acknowledgements NWC students who have participated in this research. Genetics, Microbiology and SRI courses Research students: Steven Erickson, Andy Jaeger, Silas Baalke, Hannah Bardwell, Rachel Blesi, Trevor Diercks Funding received from a 2012 Faculty Development Grant to purchase research supplies Questions?