THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Val. 266. No. 29, Issue of October 15, pp. 1975&19767,1991 Printed in U.S.A.

Chitinase Is Required for Cell Separation during Growth of Saccharomyces cerevisiae"

(Received for publication, February 28, 1991)

Michael J. KurandaS and Phillips W. Robbins From the Center for Cancer Research and the Department of Biology, Massachusetts Institute of Techrwbgy, Cambridge, Massachusetts 02139

The Saccharomyces cerevisiae chitinase described by Correa et al. (Correa, J. U., Elango, N., Polacheck, I., and Cabib, E. (1982) J. Biol. Chem. 257, 1392- 1397) has been cloned and sequenced. Analysis of the derived amino acid sequence suggests that the protein contains four domains: a signal sequence, a catalytic domain, a serine/threonine-rich region, and a car- boxyl-terminal domain with high binding affinity for chitin. Most of the enzyme produced by cells is secreted into the growth medium and is extensively glycosy- lated with a series of short O-linked mannose oligosac- charides ranging in size from Manz to Mans. Chitinase O-mannosylation was further examined in the temper- ature-sensitive secretion mutants secl8, sec7, and 8ec6. Oligosaccharides isolated from chitinase accu- mulating in cells at the nonpermissive temperature revealed Manl and Manz associated with the secl8 mutant. see6 and see7 accumulated Manz-Mans with a higher proportion of Mans relative to the secreted pro- tein. A significant amount of chitinase is also found associated with the cell wall through binding of COOH- terminal domain to chitin. Disruption of the gene for the enzyme leads to a defect in cell separation but does not substantially alter the level of cellular chitin.

Chitin, a homopolymer of 81-4-linked N-acetylglucosa- mine, is a fibrous cellulose-like material that is an important structural component of fungal cell walls. In Saccharomyces cereuisiae it represents only about 1% of the cell wall, but its specific deposition in the region of the septum is important for mechanical stability of this temporary junction between mother and daughter cells. The presence of an enzyme that hydrolyzes chitin, an endochitinase, in Saccharomyces was described in 1982 by Correa et al. (1). We reported cloning of the gene for this enzyme, CTSl, by a plasmid-based overex- pression in 1987 (2) and have subsequently isolated the en- zyme and sequenced the corresponding gene. In the present paper we discuss the structure of this interesting enzyme and show that it plays an important role in cell separation during growth.

* This work was supported by National Institutes of Health Grants CA14051 (to P. Sharp) and GM31318 (to P. W. R.) as well as by Postdoctoral Fellowship CA07901 (to M. K.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M74069 and M74070.

To whom correspondence should be addressed. Current address:

02139. Bldg. 700, Repligen Corp., One Kendall Square, Cambridge, MA

MATERIALS AND METHODS

Media and Strain Constructions-S. cereuisiae strains were grown in YPD medium (1% Bacto-yeast extract, 2% Bacto-peptone, 2% glucose) or SD medium (0.67% Bacto-yeast nitrogen base, 2% glucose) with nutritional supplements appropriate for selections and comple- mentation of strain auxotrophies. Escherichia coli was grown in Luria- Bertani (LB) medium containing 1% Bacto-tryptone, 0.5% Bacto- yeast extract, and 0.5% NaCl. LB medium was supplemented when appropriate with ampicillin (100 pglml). Conditions for crosses and sporulation used in strain constructions were standard (3). The strains used in this study are listed in Table I.

Cell Wall Suspensions-One milliliter of an overnight culture (ap- proximately 2 X 10' cells) was transferred to a 1.5-ml Microfuge tube and pelleted by centrifugation. The pellet was suspended in 200 pl of solution A (0.8% NaC1, 0.02% KCl, 0.12% Na2HP0, 0.02% KHPOJ containing 0.1% Triton X-100. Glass beads were added (0.45-0.5 mm diameter; Braun, Melsungen, Federal Republic of Germany) to a level approximately 2 mm below the meniscus, and the cells were mixed vigorously for 2 min. The broken cell slurry was recovered with a pipette, and the glass beads were washed two times with 0.5 ml of solution A with Triton. Washes were pooled with the original slurry, and the cell walls were pelleted. The walls were then washed two times with 1 ml of solution A and Triton and finally suspended in 200 pl of 0.1 M sodium citrate buffer, pH 3.0. Samples were assayed as described below.

Chitinase Assays-20 pl of culture media, cell wall, or whole cell suspensions were mixed with 80 pl of 250 pM 4-methylumbelliferyl j3- D-N,N',N"-triacetylchitotrioside (Carbohydrates International, Arlo, Sweden) in 0.1 M sodium citrate buffer, pH 3.0, and incubated at 30 ' C for 1 h. The reaction was then diluted into 2.9 ml of 0.5 M glycine, NaOH buffer, pH 10.4. Debris was removed by centrifugation, and the liberated 4-methylumbelliferone was measured with a fluo- rescence spectrophotometer (excitation at 350 nm, emission at 440 nm). Units of activity are defined as nanomoles of 4-methylumbelli- ferone released per h.

Isolation of Chitinuse from Culture Media by Chitin Biding- Native chitinase was isolated from saturated yeast cultures grown in YPD. Strains containing chitinase plasmids were initially grown overnight in 10 ml of SD medium with appropriate nutritional sup- plements at 30 "C. The cultures were then diluted into 500 ml of YPD medium and allowed to grow for an additional 16 h, after which the cells were pelleted and the supernatant collected. The medium was then filtered through a Millipore-Type HA membrane (0.45 pm). Chitin used in binding experiments was prepared from purified chitin (Sigma) which had been boiled in 1% SDS,' 1% j3-mercaptoethanol and then extensively washed with water.

For large scale purification of chitinase, 0.5 g of chitin (wet) was added per 500 ml of filtered culture supernatant. The suspension was swirled overnight on a rotary shaker a t 4 "C. The chitin was then collected by filtration through a Type HA membrane and washed with 500 ml of Solution A. A small volume of Solution A was added to the surface of the membrane and the chitin was resuspended with the aid of a Pasteur pipette. The suspension was transferred to a 12- ml disposable Poly-Prep column (Bio-Rad), and the column was drained of excess buffer. Chitin-protein conjugates were then stored in Solution A at 4 "C. For analysis, 50-mg (wet) samples of chitin were suspended in 100 pl of sample buffer (2% SDS, 5% j3-mercap-

'The abbreviations used are: SDS, sodium dodecyl sulfate; kb, kilobase pair(s); PCR, polymerase chain reaction.

19758

Chitinase Is Required for Cell Separation in Yeast 19759

TABLE I Yeast strains used in this study

Yeast strains Source DBY939 DBY918 DBY1315 DBY2068

NY 17 PRY294 MATa secl8-1 ade2-101 MKY1315 MKY2068

MATa ade2-101 suc2-215am D. Botstein

MATa urd-52 lys2-801 leu2-3,112 D. Botstein MATa urd-52 his4-619 leu2-3,112 D. Botstein MATa sec7 R. Schekman MATa urd-52 sec6-4 P. Novick

MATa urd-52 lys2-801 leu2-3,112 cts1::LEUZ This study MATa urd-52 his4-619 leu2-3,112 ctsl::LEU2 This study

MATa his4-38 D. Botstein

SF294-IC

P. W. Robbins

toethanol, 10% glycerol) and heated to 100 "C for 10 min. The samples were centrifuged and the supernatants analyzed by SDS-gel electro- phoresis. The bulk of protein was eluted by heating at 65 "C for 1 h in 1% 0-mercaptoethanol, 1% SDS. For immunization, the detergent was removed by gel filtration on a Superose S-200 column (Pharmacia LKB Biotechnology Inc.) in 50 mM NH4HC03, pH 8.0, and the preparation was then lyophilized. Approximately 1.0 mg of protein can be purified per liter of culture supernatant with the above technique.

Purification of chitinase on a small scale for rapid analysis by SDS gels was accomplished by placing 15 ml of YPD medium containing chitinase or chitin binding domain fusions into 15-ml disposable centrifuge tubes followed by addition of 50 mg of chitin (wet). The tubes were mixed end-over-end at 4 "C for 3 h. The chitin was then pelleted by centrifugation and washed three times with 15 ml of cold Solution A (4 "C). The washed pellet was suspended in 1.0 ml of Solution A and transferred tb a 1.5-ml Microfuge tube and centri- fuged. Liquid was aspirated, and the pellet was suspended in 100 pl of SDS sample buffer, heated, and analyzed by electrophoresis.

DNA Manipulations-Plasmids in E. coli were isolated by the rapid minipreparation protocol according to standard methods (4). The lithium acetate procedure was used for transformation of S. cerevisiae (5). E. coli was transformed using standard procedures (4). Plasmid constructions were performed according to Crouse et al. (6). Chitinase coding regions were subcloned into both M13 mp18 and mp19 to facilitate DNA sequencing. Overlapping clones were generated using a Cyclone I Biosystem (IBI) to create nested deletions of the insert. Dideoxy DNA sequencing was carried out using Sequenase (U. S. Biochemical Corp.) as specified by the manufacturer. Conditions and reagents used in polymerase chain reactions were included in the GeneAmp DNA amplification reagent kit (Perkin-Elmer Cetus In- struments). Reactions were carried out in a Perkin-Elmer Cetus DNA thermal cycler. The sequence of synthetic oligonucleotides used to amplify genomic CTSl sequences were 5"ATTGCTGTTTATTGG- GGTCAAAACT-3' and 5'-AAAGTAATGCTTTCCAAATAAGAG-3'.

Construction ofpCT32-A 2.5-kb BamHIIEcoRI fragment contain- ing CTSl-2 was cloned into the E. coli vector, pUC19, yieldingplasmid pCT3O (Fig. 3). The plasmid was digested with BstEII which cut within the CTSl-2 coding sequences between the signal sequence and chitin binding domain (Fig. 4). The linearized plasmid was used as a template for in uitro amplification by the polymerase chain reaction which resulted in replication of vector sequences as well as deletion of the catalytic and Ser/Thr-rich regions. Restriction site "tails" present on the ends of the primers were used to introduce two unique restriction sites (NotI and XhoI) at the ends of the amplified frag- ment. NotI digestion followed by ligation joined the chitin binding domain and signal sequence, retaining reading frame, and circularized the plasmid. The sequence of oligonucleotides used were 5'- GGGCGGCCGCTAGCAGACCTATCAAAGGCATCGGTTGG- CAG-3' and 5'-GGGCGGCCGCCTCGAGTCAGACAGTACAGC- TCGTACATTGGCTAAA-3'.

The amplified product was first ethanol-precipitated and treated with alkaline phosphatase (calf intestine). The digest was extracted with phenol/chloroform and ethanol-precipitated. The pellet was suspended in restriction buffer and then digested with NotI. The resulting fragment was purified by electrophoresis on low melting point agarose, excised, and ligated. Transformation of E. coli and restriction analysis of plasmids obtained from transformants indi- cated that the majority of the clones had deleted the desired region and had incorporated the anticipated NotI and XhoI sites. The deleted BamHIIEcoRI inserts isolated from several independent transform- ants were cloned individually into the polylinker region of the yeast/

E. coli shuttle vector YEp352(7). The resulting set of constructions were used to transform yeast strain MKY1315. Yeast cell lysates from individual transformants were screened by Western blot analysis with anti-chitinase antibody for the production of the truncated CTSl gene product. Two of the three constructions analyzed produced an immunologically active peptide of the expected size. One of these (designated pCT32) was chosen for the fusion experiments described below.

Construction of pCT33 (SUC2-chitin Binding Domain Fusion&" precise segment of the yeast invertase coding sequences with NotI and XhoI cohesive ends was produced by in vitro DNA amplification. The SUC2 containing plasmid pRB576 (8) was linearized with EcoRI, which cut outside SUC2 coding sequences, and used as a template. The primers used were: 5'-GGGCGGCCGCACAAACGAAACT- AGCGATAGACCTTTGGTC-3' and 5"GGCTCGAGTTTTACT- TCCCTTACTTGGAACTTGTCAAT-3'. The region of amplification (1.5 kb) deleted the first 21 amino acids of the secreted message and extends to and includes the last amino acid of the coding sequence (9). Secretion of the protein is therefore dependant on utilization of the signal sequence of CTSI. The DNA was concentrated from the amplification reaction by ethanol precipitation. The pellet was then suspended in restriction buffer and simultaneously digested with NotI and XhoI. The invertase fragment was purified by electrophoresis in low melting point agarose and ligated with pCT32 which had been similarly digested and purified. E. coli tranformants were screened for incorporation of insert by restriction analysis of plasmid DNA. Five clones containing inserts were transformed into MKY1315. Four contained invertase activity and produced a protein product which reacted with both antiinvertase and antichitinase antibodies on West-

pCT33. ern blots. One of these was chosen for further analysis and designated

Radiolabeling and Immunoprecipitation-Conditions for radiola- beling yeast cells with [2-3H]mannose, isolation of radiolabeled chi- tinase by chitin binding, immunoprecipitation, and analysis of radi- olabeled oligosaccharides have been described in detail (10).

Antibody Production-Polyclonal antisera production in rabbits was by peri-lymph nodal immunization using Freund's complete adjuvant (BAbCO, Richmond, CA). Antisera were purified on an affinity column prepared by linking purified chitinase to cyanogen bromide activated Sepharose (Pharmacia).

Isolation of CTSl-&-The CTSl-disrupted strain MKY1315 was transformed with a YCp50 yeast genomic library prepared from strain DBY918 (11). Transformants with restored chitinase activity were identified as described previously (2). In brief, colony replicas for screening were made by pressing sterile filter paper discs onto the surface of agar plates containing the transformants. The replicas were then incubated in 0.1 M sodium citrate, 200 p~ 4-methylumbelliferyl- 0-D-N,N',N"-triacetylchitotrioside, pH 3.0, for 30 min at 30 "C. After transfer to 0.5 M glycine, NaOH, pH 10.4, positive transformants were identified as blue fluorescent spots when viewed by a hand-held long wavelength UV lamp. CTSl-2 plasmids were then isolated from yeast (3) and characterized.

In Vivo Chitin Levels-Chitin levels were determined in stationary phase cells according to Bulawa et al. (12). Cells were extracted with 6% KOH at 80 "C for 90 min followed by sequential digestion with Serratia chitinase and cytohelicase. Liberated N-acetylglucosamine was quantitated colorimetrically by the Morgan-Elson reaction.

RESULTS

Enzyme Purification

Correa et al. (1) identified a periplasmic chitinase in S. cereuisiae which could be extracted from intact cells. In exten-

19760 Chitinase Is Required for Cell Separation in Yeast

sions of these experiments utilizing 4-methylumbelliferyl-~- D-N,N‘,N-triacetylchitotriose as a substrate, we found that the majority of chitinase activity produced in yeast cultures (90%) is secreted into the growth medium when cells are grown in the nutrient rich medium, YPD. As shown in Fig. 1, chitinase secretion in YPD exactly parallels culture growth.

Unlike radiolabeled chitin, the substrate used by Correa et al. (l) , the fluorescent oligosaccharide substrate is soluble and can enter the cell wall, allowing direct assay of enzyme in the periplasm. Consistent with this, chitinase activity can be detected in washed whole cells. Following washing and dis- ruption of the cells with glass beads, most of the cell-associ- ated chitinase activity remains sequestered in the cell wall (60%) and is roughly equal to the activity measured with intact cells.

As described under “Materials and Methods,” the secreted enzyme activity can be quantitatively adsorbed from culture supernatants by addition of insoluble chitin. This interaction is stable in high salt (5 M NaCl), over a wide range of pH (3- lo), and to many common denaturants, including 8 M urea. For the purposes of obtaining protein for antibody production or analysis on SDS gels, the chitinase-chitin conjugate can be dissociated by heating in 1% SDS, 1% @-mercaptoethanol. The solubilized chitinase can be recovered as a single poly- peptide of approximately 130 kDa. Yields in the range of 1 mg of purified protein per liter are typically recovered from a saturated stationary phase YPD culture. Less than 10% of this level is secreted into the medium when cells are grown in minimal SD medium.

Strain Variation of Chitinase Analysis of the secreted chitinase from haploid strains used

in our laboratory revealed measurable variations in chitinase size on SDS gels even though all strains have an “S288C” genetic background. Analysis of several representative strains is shown in Fig. 2. Chitinase clones were isolated from two strains displaying size variation in the secreted protein using an activity based filter screen method as described previously (2).

The original CTSl gene was isolated from the Carlson YEp24 yeast genomic library (13). The source of DNA for this library was DBY939, a strain producing a low molecular weight chitinase. A second genomic clone corresponding to a

l C 2 e l o 3

10-1 0 5 10 15

Time (h) FIG. 1. Growth and chitinase secretion from S. cereuisiae

growing on YPD. Cells from an exponentially growing yeast culture (DBY2068) were centrifuged, washed with fresh YPD medium, and then diluted to a final OD,, of 0.25 in 200 ml. The culture was incubated a t 30 “C with agitation. At the indicated times 1-ml samples of the culture were taken and the OD6m determined. Cells were removed by centrifugation, and secreted chitinase activity was meas- ured as described under “Materials and Methods.”

m m m

130 KD - FIG. 2. SDS-polyacrylamide gel electrophoresis of secreted

chitinase from various strains of S. cerevisiae. Secreted chiti- nase was isolated from the medium of saturated cultures of the indicated strains by chitin binding. Bound protein was eluted by boiling in sample buffer, and samples were then analyzed on 6% polyacrylamide gels. The amount loaded corresponds to material bound from 5 ml of culture medium.

slightly higher molecular weight chitinase was isolated from a CEN plasmid bank (DBY918). The two clones have only slightly different restriction maps (Fig. 3) and differ only by about 5% in nucleotide sequence (Fig. 4). To confirm the fact that the restriction site polymorphisms found in the two chitinase plasmids are not due to cloning artifacts, oligonu- cleotides (see “Materials and Methods”) were synthesized corresponding to conserved regions at the 5’ and 3’ ends of the CTSl gene. These primers were then used in polymerase chain reactions to amplify the chitinase coding regions from genomic DNA isolated from library strains DBY918 and DBY939. Both amplifications yielded the anticipated DNA product of 1.6 kb. Restriction sites unique to each clone predicted to be present in each amplified fragment were observed (Fig. 5). The DBY918 PCR fragment was resistant to HindIII digestion but cut with SphI yielding a major product of 1.32 kb as predicted from Figs. 4 and 5. The amplified fragment from DBY939 cut with HindIII yielding the expected 1.30-kb product. Digestion of the DBY939 PCR product with SphI, however, yielded a resistant fragment and the 1.46-kb fragment corresponding to the second clone. The resistant fragment may represent a gene duplication in the DBY939 strain.

The two chitinase genomic clones isolated from DBY939 and DBY918 by activity screens likely represent allelic var- iants of a unique chitinase locus. DBY939 chitinase sequences can be used to direct disruption of resident chitinase se- quences in a diploid strain (DBY1315 x DBY2068) which contains only chitinase sequences characteristic of DBY918 by PCR analysis. Crosses with haploid strains DBY2068 (DBY918 chitinase) and DBY939 followed by tetrad analysis reveals a 4:O segregation of a chitinase plus to chitinase minus phenotype, whereas crosses of both haploid parents with a strain disrupted for chitinase gave a 2:2 segregation. This indicates that each of these strains contains a distinct allele of a single chitinase gene locus termed CTSl. We have since designated the chitinase genomic clone from DBY939 as CTS1-1 and the clone isolated from DBY918 as CTSI-2. CTSl-2 is larger than CTSl-1 as a result of two 15-base pair direct nucleotide repeats which flank a serine/threonine-rich region in the protein (Fig. 4). Both alleles have equal specific activities with either chitin or 4-methylumbelliferyl oligosac- charide substrates.

Domain Structure of Chitinase The deduced amino acid sequence of the Saccharomyces

chitinase clearly suggests that the protein is divided into four

Chitinase Is Required for Cell Separation in Yeast 19761

CTS1-1 - CTSI-2 - 1 kb

U RI RI

pCT1Z VEp952 pCT20

pCT18 ’?”! 7 ~,,,,, pCT30

K ; $? +$;“cl,

pCT19 pCT32

P C T S qkG-p;w.z FIG. 3. Restriction endonuclease maps of CTSl-1 and CTSl-2. Chitinase coding regions and direction of

transcription are indicated for pCT12 and pCT2O by arrows. The CTSl-1 plasmid pCT12 was constructed from the 7.0-kb BarnHI-SalI fragment of previously described pCT2 (2). CTSI-2 (pCT2O) was isolated from a YCp50- based yeast genomic library with the same activity-based filter screen used to clone CTSI-1. pCT18 and 30 are subclones of these plasmids constructed by standard cloning methods. Disruption of CTSl was performed using the 5.5-kb BarnHI-Hind111 fragment of pCT19 which contains a LEU2 insertion that blocks chitinase expression. pCT32 encodes a site-specific deletion that results in the secretion of only the COOH-terminal chitin binding region of CTSI-2. pCT33 contains yeast invertase sequences fused in frame to the chitin binding domain. B, BarnHI; Bg, BglII; RZ, EcoRI; H , HindIII; K, KpnI; N , NotI; P, PstI; S , SalI; Sp, SphI; X , XhoI.

domains. We describe these below and suggest a function for each. Amino acid numbers refer to the CTSl-2 sequence.

Signal Sequence (Amino Acids 1-2O)”The first 20 amino acids serve as a typical cleavable signal sequence. Amino- terminal analysis of the secreted CTSl-1 gene product gives a clean sequence for 18 amino acids (Phe-Asp-Ser-Ser-Ala Asn-Thr-Asn-Ile-Ala-Val-Tyr-Trp-Gly-Gln-Asn-Ser-Ala) which exactly corresponds to the deduced sequence for CTSl- I starting at amino acid 21.

Catalytic Domain (Amino Acids 21-327)”Three lines of evidence support the hypothesis that this region contains the hydrolytic domain of the enzyme.

1) A HindIII deletion of CTSl-1 (Fig. 3), pCT18, eliminat- ing 80 amino acids from the COOH terminus of the protein results in secretion of a smaller chitinase protein that retains full catalytic activity toward both chitin and oligosaccharide substrates, yet displays an apparent decreased affinity toward insoluble chitin (Fig. 2 , lane ACTS1 -1 ).

2 ) The proposed catalytic domain is homologous with a plant chitinase. The CTSI-2 sequence was compared with available chitinase, cellulase, and lysozyme sequences from Genbank and Protein Identification Resource data bases as well as those from the recent literature by dot plot comparison, Most significant was the relationship between CTS1-2 and a cucumber chitinase (14) produced in response to pathogen invasion (Fig. 6). The roughly 30% similarity at the protein level extends over the entire length of the plant sequence. Interestingly, the similarity is limited to the first 300 amino acid residues of CTSl-2 and ends at the start of a region rich in serine and threonine.

3) Two small regions are conserved in the Saccharomyces chitinase, the cucumber chitinase (14), several bacterial chi- tinases (15), endoglycosidase H (16), and a mammalian lyso- somal chitobiase. All cleave the @l-4 glycosidic bond between adjacent N-acetylglucosamine residues. The conserved re- gions are highlighted in Fig. 6 and are shown in detail in Fig. 7. These common residues could obviously play an important role in the catalytic function of these enzymes.

SerlThr-rich Domain (Amino Acids 328-480)”Greater than 50% of the amino acid residues in this region are serine or threonine which potentially can act as acceptor sites for 0- glycosylation. Mannose labeling of the protein followed by treatment with mild alkali to facilitate @-elimination demon- strates that the enzyme carries the typical array of short mannose oligosaccharides containing 2-5 mannose residues (see “Chitinase Secretion Pathway”). Both the CTSl-1 and

CTSl-2 secreted gene products have the same oligosaccharide profiles. When the enzyme is expressed in a conditional mutant in which synthesis of dolichol-P-mannose (the donor of the first 0-linked mannose residue) can be blocked, the protein migrates with the predicted molecular weight for the unglycosylated protein (60 kDa) (10) on SDS gels. Assuming that each oligosaccharide adds roughly 600 daltons (a trisac- charide) to the molecular mass of the protein, it follows that most if not all of the serines and threonines (approximately 90) in this region must carry sugar chains to account for the apparent 130 kDa size observed on SDS gels. It should be pointed out, however, that this is probably an overestimate, since carbohydrate chains bind less SDS per unit weight than does the protein portion of the molecule and additionally may interfere with SDS binding to the polypeptide. A single po- tential site for N-glycosylation (Asn-Phe-ser) is present near the COOH terminus which is apparently not utilized since the mobility of the protein is insensitive to digestion with either endoglycosidase H or N-glycanase.

High Affinity Chitin Binding Domain (Amino Acids 481- 562)“The last 80 amino acids of CTSl encodes a noncatalytic peptide capable of high affinity binding to chitin. This hy- pothesis is supported by the following data.

1) The carboxyl-terminal deletion of CTSI-1 mentioned above does not bind with high affinity to chitin or to cell walls (Fig. 2). The truncated enzyme expressed and secreted in a chitinase-disrupted strain cleaves both soluble 4 MU oligosaccharides and radiolabeled chitin. Also, cell wall prep- arations produced by disruption of cells carrying this mutant have less than 10% of the wild-type levels of activity when assayed with 4-methylumbelliferyl trisaccharide. Surpris- ingly, the COOH-terminal deletion shows an enhanced rate of chitin hydrolysis (Fig. 8).

2) Controlled proteolysis of the wild-type enzyme bound to chitin resulted in the production of an undigested chitin bound fragment. This peptide had an apparent molecular mass of 18 kDa (Fig. 9) and gave a clean amino-terminal analysis (Ser-Asp-Ser-Thr-Ala-Arg-Thr-Leu-Ala-Lys-Glu- Leu-Asn-Ala-Gln-Tyr) which corresponds exactly to the se- quence which starts at amino acid 480 of the CTSl-2 sequence (Fig. 4).

3) A precise deletion was constructed of CTSI-2 using synthetic oligonucleotides to remove amino acids 21-481. This resulted in direct fusion of the signal sequence to the proposed chitin binding domain. Expression of this construction in a chitinase-deficient strain resulted in secretion of an 18-kDa

19762 CTSI-1 CTSI-2

-329

-209

-89

31

151

271

391

511

631

751

811

991

1111

1231

1351

Chitinase Is Required for Cell Separation in Yeast A

T A T G T G T T T C A G A T G T T W \ G T I W L C A T T I \ G U T T G G T G T A R G A R C T ~ C C ~ G A T f f i T T C ~ ~ T T C ~ A R C ~ A R T A ~ A C ~ T A T T T ~ C A T """"-+""""-+""""-+""""t""""-t""""+""""-t""""+""""-t""""t""""~""""+

C A G G C A T T U ; T C ~ A T A T A A T ~ f f i G T A ~ ~ ~ ~ T G G A T G G ~ ~ T C ~ T A C C ~ C ~ ~ A T A R T T T A T A G A A T ~ ~ ~ T ~ A ~ A C A ~ A R G """"-+""""-+""""-t"""""t""""+""""-+"""""""""t""""+""""-t""""+""""-+

Bgl I1

~ T T ~ T ~ ~ ~ ~ C ~ ~ T T T T T T C A T ~ ~ T T ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ - ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ """"-+""""-+""""-+""""t""""+""""-~""""+""""-t""""+""""-+""""-~""""+

T C T C G C T C G T T T C A C M C C T A C C T T T T T T ~ C C A C T C T T T T T C C A R T A C A T T ~ T T C T A A T T T I W L T A T ~ T A R T T A A T A A T A ~ ~ ~ T A C A ~ C A T T ~ A ~ A

T C C

""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-~""""+

H S L L Y I I L L F T +1

C T C A C M T T C T T A C T A C T G C C A R C C G A T G C C T T T G A T A G G T C T G C T M C A C ~ T A T T ~ G T T T A T T G ~ C ~ ~ C ~ C ~ A R C ~ ~ T C ~ T ~ ~ T T A C T G T ~ T C T T

G . . . . . . . . . . . . . . . . . . . . . . . . .

P S O F L L L P T D A F D R S A N T N I A V Y W G O N S A G T Q E S L A T Y C E S S

SIGNAL SEQUENCE--CATALYTIC -IN Sph I

40

G T C T G A T G C T G A T A T T T T C C T A T T A T C T T T C T T G I \ I \ C C A R T T T C C A A C C C T T ~ T T T ~ T T T ~ C A A C ~ T C T G A T A C T T T T T C T W \ ~ ~ ~ ~ ~ ~ C C ~ A T ~ G """"-+""""-+""""-+""""t""""-+""""-+""""-+""""-+""""-t""""t""""t""""+

D A D I F L L S f L N Q F P T L G L N F A N A C S D T f S D G L L H C T Q I A E 60 80

A A G A T A T T G I W L C T T G C C f f i T C C C T A G G A R I \ W V L A G T T C T """"-+""""-+""""-+""""t""""-+""""-+""""-+""""-t""""t""""t""""+""""-+

D I E T C Q S L G K K V L L S L G G A S G S Y L F S D D S Q A E T F A Q T L W D 100 120

A T A C T T T C G G T G A A G G T A C I U ; G T G C C A G T G A G A G A C C A T ~ G A C T C ~ f f i T C G T T G A T ~ T T ~ ~ T G A T A T T G ~ C ~ ~ ~ ~ T A T f f i T ~ G ~ ~ ~ C ~ T """"-+""""-+""""-+""""-t""""+""""-+""""-+""""-+""""-t""""+""""-t""""+

T F G E C T G A S E R P F D S A V V D G F D F D I E N N N E V G Y S A L R T K L 140 160

T A A G A A C T T T G T T T G C C G A R G G T ~ I W L G C A R T A T T A C C T T T C T G C C G C A C C ~ C A R T G T C C A T A C C C ~ T ~ G T T ~ T G A C T T G ~ T ~ ~ A T T G A T ~ T ~ G ~ C A """"-+""""-+""""-+""""-+""""-+""""~+""""-+""""-*""""-~""""t""""+""""-+

R T L F A E G T K O Y Y L S A A P Q C P Y P D A S V G D L L E N A D I D F A F I 180 200

T C C R R T T T T A C A R T A A T T A C T G C R G T G T W K ; T G G T C A A T C T G G T T """"-+""""-+""""-+""""-+""""-+""""-t""""+""""-+""""-+""""-+""""-t""""+

O F Y N N Y C S V S G O F N W D T W L T Y A Q T V S P N K N I K L F L G L P G S 220 240

R S A A G S G Y I S D T S L L E S T I A D I A S S S S F G G I A L H D A S Q A F 260 280

G T T T C C A A C G A G C T I W L T G G T G A R C C A T A T G T T T """"-+"""""""""-+""""+""""-+""""-+""""-+""""-+""""-t""""+""""-t""""+

S N E L N G E P Y V E I L K N L L T S A S Q T A T T T V A T S K T S A A S T S S

.tt****tt*

S

300 320 CATALYTIC DMR1N"SERITWI

*+*.* A C T G C T T C A A C T T C A T C T G C T T C A A C T T C T C A G ~ A C C A C A C A A T C T A C G A C R T ~ A C A C ~ T ~ ~ ~ G T T ~ T T A T C T C C ~ T ~ A R G C A G C ~ T A ~ ~ C A ~ A A """"-+""""-+""""-+""""t""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-+

T G

RICH W I N R S T S S A S T S Q K K T T O S T T S T Q S K S K V T L S P T A S S A I K T S I

340 360

A G TTACTC~CTAC~CATTTGRCGACGRGTAGCACC~AC~TCTAGTCTAGGTRCCACCRCAACAGAGAGCACTTT~TTC~~~TT~TATCACAAGT~TG~CTACT~ATCTT """"-+""""-+""""-+""""t""""-+""""-+""""-+""""-+""""-+""""-+""""-+""""-+

T O T T K T L T S S T K T K S S L G T T T T E S T L N S V A I T S M K T T L S S A

380 400 BstEII

A - CCCRAATAACCAGTGCTGCCTTGGTGACCCCTC~CAACTACTACTAGCATAGTTTCTTCGGCCCCMTTCIWLCA~TATCA~AGTACTCTTTC~CA~ARCGAA~TTCTTCTG

T C

O I T S A A L V T P O T T T T S I V S S A P I Q T A I T S T L S P A T K S S S V S L

420 Hind 111 L

440

TCGTTTCCCTACAGACAGCTACTACTAGTACGCTTTCCCCAACMCGACCAGTACAA~TCAGGTAGTA~~CAGGTAGTACAAGCTCAGACAGTACA~CGTACA~GGCTIWLG ***t**f*,.***t*

""""-+""""-+""""-+""""'""""~+""""~+""""~+""""~+""""~+""""~+""""-+ K

V S L O T A T T S T L S P T T T S T S S G S T S S G S T S S D S T A R T L A K E 460 SERITHR RICH -IN--CHITIN BINDING -IN

sph I T

A R T T G A R T G C T C A R T A T G C G G C T G G T A R R T T G A R C G G T ~ T C T A C ~ G T A C T G A R ~ T G I W L T T ~ A ~ C T ~ G A T G G G A R G T T C G C C ~ G T G A T ~ T A ~ ~ T ~ ~ A C A ' 4 7 1 """"~+""""~+""""~+""""~+""""~+""""~+""""~+""""~+""""~~""""-+""""-~---------+

L N A Q Y A A G K L N G K S T C T E G E I A C S A D G K F A V C D H S A ~ V Y ~ 500 520

T~GAATGTGCTTCTGGAACCACATGTTATGCTTATGACTCC~CGACTCAGTCTATACCCARTGTARTTTCTC~ATTT~~ARTTACTTTT~GTTA~~~GATT~TA <'<<<<<<<<C(~(<<<<<C(((((

1591 """"~+""""~+""""~+""""~+""""~+""""~+""""~+""""~+""""~*""""-+""""-+---------+

E C A S G T T C Y A Y D S G D S V Y T Q C N F S Y L E S N Y F . 540 560

1111

C G ATCTATARCGAATTATTTRATTTTCTTCGATTTACTGTGTTTCTACCATTTT

1831 """"-+""""-+""""-t"""""*""""-+" 1882

-330

-210

- 90

30

150

270

390

510

630

750

870

990

1110

1230

1350

1470

1590

1110

1830

FIG. 4. Nucleotide and derived amino acid sequences of CTSI-I and CTSl-2. The entire DNA sequence of CTSI-2 is shown with the corresponding amino acid sequence printed below it. Differences in the CTSI-1 allele are printed above the C T S l - 2 sequences. Nucleotides deleted in CTSI-1 are indicated by asterisks. The common BglII site near the 5' end of both genes is underlined. HindIII, BstEII, and SphI sites within the coding regions are also indicated. Positions corresponding to PCR primers ("Materials and Methods") used to amplify genomic

Chitinase Is Required for Cell Separation in Yeast 19763

c o g m m

HIND 111 SPH I

Z c 9 - 0 I 0) 'V

m m m m

- 2.03

- 1.35 - 1.08 - 0.87

FIG. 5. PCR amplification of CTSl from library strains used in this study. Genomic DNA from DBY918 and DRY939 was used as templates for PCR reactions. Primers ("Materials and Meth- ods") directed amplification of greater than 90% of the C T S I coding sequence. Reaction products were analyzed on 1% agarose gels and visualized by staining with ethidium bromide. Restriction site poly- morphisms indicated in Figs. 3 and 4 are illustrated.

peptide which displayed high affinity binding to chitin (Fig. 10, lane 3 ) .

4) Expression of a portion of the yeast invertase gene, SUC2, fused in frame with the CTSI-2 signal sequence and chitin binding domain resulted in secretion of invertase activ- ity into the culture medium. This material was glycosylated, enzymatically active, and bound efficiently to chitin (Fig. 10, lanes 4 and 5). The chitin-invertase fusion complex retains the ability to hydrolyze sucrose.

It is striking that analogous noncatalytic high affinity cel- lulose binding domains have been found in bacterial and fungal cellulases (17). It has been demonstrated recently that a synthetic peptide (34-mer) from the binding domain of a Trichoderma reesi cellulase binds with high affinity to cellu- lose (18). Comparison of this 34-mer with the chitin binding domain reveals conservation of many amino acids including an exact match of a block of 7 amino acids flanked by 2 cysteines (Fig. 7). The chitin binding domain, however, does not display significant affinity for cellulose.

The Chitinase Secretion Pathway-A series of temperature- sensitive mutants have been used to define the pathway of protein secretion in yeast (19). Previously, transit through this pathway has been defined in terms of events that occur in Asn-linked glycoprotein assembly. I t was therefore of in- terest to examine the glycosylation state of chitinase, an 0- mannosylated protein, blocked a t comparable points in the secretion pathway. Strains containing secl8, sec7, or sec6 mutations were initially examined for chitinase secretion a t the permissive temperature (24 "C). All strains produced a chitinase of similar size as determined by SDS-gel electropho- resis. On shift to the nonpermissive temperature (37 "C), chitinase secretion was blocked and the enzyme accumulated within the cells. The trapped chitinase was metabolically labeled with [2-'H]mannose and isolated by immunoprecipi- tation. Secreted enzyme was isolated by chitin binding. The intracellular and secreted forms were resolved by SDS-gel

electrophoresis, blotted to nitrocellulose, and visualized by autoradiography. All three sec mutants accumulated a form of the enzyme which was clearly different than the one that is normally secreted. A wild-type strain produced a cell- associated chitinase identical to the secreted form (Fig. 11A). Sections of the blot corresponding to radiolabeled bands were excised and treated with mild base to remove the oligosaccha- rides which were subsequently resolved by paper chromatog- raphy (10).

The size of the accumulated sec/chitinase intermediates on SDS gels correlates with the size distribution of attached 0- linked oligosaccharides (Fig. 12). A wild-type strain produces a 130-kDa enzyme which contains a series of oligosaccharides ranging in size from Mann to Mans. The sed8 strain accu- mulates a 110-kDa intermediate containing only mannobiose and mannose. Sec6 and sec7 strains produce a 180-kDa inter- mediate which contains a significantly higher proportion of Mann than does the secreted form of the enzyme. The same biosynthetic intermediates with similar oligosaccharide pro- files are observed in wild-type strains following a short pulse labeling with [2-:'H]mannose (Fig. 11R).

Chitinase Disruption-To investigate the possible function of the chitinase, a plasmid was constructed with the Saccha- romyces LEU2 gene inserted into CTS1-1 170 base pairs upstream from the chitinase start codon a t a convenient RglII site (Fig. 4). A purified restriction fragment containing the auxotrophic marker and flanking chitinase sequences was used to transform a diploid strain (DBY1315 x DBY2068) resulting in disruption of the resident CTSI allele by homol- ogous recombination (20). In these experiments, both haploid parents were found to secrete a similar size chitinase (Fig. '2) and to contain restriction sites characteristic of the CTSI-2 allele as determined by PCR analysis. Diploid transformants were sporulated. Dissection followed by germination generally produced four viable spores per ascus. As expected, growth on leucine-deficient media co-segregated with a lack of chitinase activity in a 2:2 distribution in analyzed asci. Integration at the CTSl locus was confirmed in several chitinase minus strains by Southern blot analysis (data not shown).

The lack of chitinase activity results in a clear inability of the cells to separate normally. This block in cell separation was manifest in large aggregates of cells attached by their cell septum regions. Two patterns of cell aggregation were ob- served in the chitinase-disrupted strains which were later traced to an independently segregating gene contributed by DBY1315 which affected bud placement. As shown in Fig. 13, a disrupted strain which displayed an axial budding pattern typical of haploid cells grew as tightly packed clusters, whereas cells with an apparently random budding pattern formed larger branched arrays of cells. Sites of attachment were confirmed by staining with Calcofluor to be at the septum region of the cells. I t is striking that Sakuda et a1. (21) have recently shown that dimethylallosamidin, a potent in- hibitor of yeast chitinase, produces the same defect in cell separation displayed by chitinase deletion strains.

The separation phenotype can be complemented with a plasmid containing either CTSl-1 or CTSl-2. The COOH- terminal deletion without the chitin binding region, however, only partially complements the defect on a multicopy plasmid.

DISCUSSION

The CTSI gene encodes an endochitinase which hydrolyzes both insoluble chitin and soluble substrate analogs. We de-

CTSI sequences are indicated by >>>>. Amino acid residue numbers for the CTSI-2 sequence as well as proposed domain junctions are printed helow the deduced amino acid sequence.

19764 Chitinase Is Required for Cell Separation in Yeast

scribe here the domain structure of the CTSl protein which is summarized schematically in Fig. 14. Since most of the endochitinase activity in yeast cultures is found free in the medium or localized to the cell wall, the enzyme must traverse the usual cellular secretion pathway. The signal sequence is cleaved, and the serine/threonine-rich domain is glycosylated with sugar chains containing from 2 to 5 mannose residues. Addition of the first mannose residue probably occurs in the endoplasmic reticulum by a transfer of sugar from dolichol- P-mannose. Subsequent elongation of the mannose chains is thought to occur in the Golgi with GDP-mannose serving as donor (22).

With respect to this scheme we have made some intriguing observations by examining chitinase that accumulates in sec mutants blocked at different stages in the secretion process. Two distinct biosynthetic intermediates were identified. One had a lower apparent molecular weight than the fully proc- essed secreted enzyme and was found to accumulate in a s e d 8 strain, whereas the other had a higher molecular weight and accumulated in both sec7 and sec6 strains. These forms are probably physiologically relevant since they can also be ob- served in wild-type cells at short labeling times (15 min).

Greater than 50% of the carbohydrate label found on the low molecular weight s e d 8 chitinase intermediate was found to be mannobiose with the remainder being mannose. Mono-

Sional Sequence

H Ser, Thr Rich ReOiDn -

YEAST CHlTlNASE

FIG. 6. Sequence similarity of Saccharomyces and cucum- ber chitinases. The deduced amino acid sequences of Saccharomyces and Cucurnis satiuis (14) chitinases are compared using dot matrix computer analysis. Points represent identity in 8 out of 30 amino acids.

REGION I

and disaccharides were also found to accumulate in s e d 8 when bulk cell mannan was examined (23). This result is at variance with the prediction that 0-mannosylated proteins accumulating in the endoplasmic reticulum should contain mannose but not oligosaccharide moieties. One explanation for accumulation of disaccharide would be leakiness in the s e d 8 mutation. However, we did not observe an intermediate which might correspond to chitinase glycosylated with only single mannose residues. The possibilities that the second mannose residue is added co-translationally in the endo- plasmic reticulum or that the s e d 8 block defines a compart- ment that includes limited “post-endoplasmic reticulum” processing must also be considered.

A secretion block at the Golgi stage (sec7) or in post-Golgi secretion vesicles (sec6) results in accumulation of an inter- mediate that appears to be Uover-mannosylated.” As compared with the secreted enzyme, a higher proportion of Man5 is found in this intermediate with a corresponding reduction of Man4. These data suggest that outer chain mannose residues are removed concurrent to secretion of the enzyme. This reaction could occur in the periplasm since the same high proportion of Man5 is observed even as late as the sec6 block. A minor band of overmannoslyated material also appears to accumulate in the s e d 8 strain (Fig. 1lA). This may represent protein just transferred to the Golgi at the time of temperature shift where it is further elongated with labeled mannose. None of this material, however, is further converted to the final secreted form during this period, suggesting that the s e d 8 mutation may have secondary effects on the later stages in secretion. These observations will require further investiga- tion before a definitive interpretation is possible.

Following fusion of secretion vesicles with the plasma mem- brane, chitinase has two potential fates: incorporation into the cell wall or release into the growth medium. That portion of the enzyme that becomes associated with the cell wall apparently functions in cell separation as evidenced by the phenotype of the chitinase disruption. This association with the cell wall is dependent upon the COOH-terminal chitin binding domain. Deletion of this domain from a CTSl plasmid results in a decreased ability of the gene to complement the separation defective phenotype of a CTSl disruption. These data suggest that the chitin binding region functions in local- izing the enzyme to cell wall chitin where it hydrolyzes chitin fibers which join mother and daughter cells. Analysis of eight chitinase minus and eight chitinase plus segregants from the gene disruption experiment, however, reveals chitin levels to

REGION 2

s. CerWLside 102 K V L L S L G G A S G S Y L ~ 150 D G F D F D I E N N ~ E V ~ s. c. p l f ca tus saffvus 26’ 335 98 H I I W K V L L S I G G G A G S Y S L K I L Y S F G G W T W S G G F T!$P[ l45 377 3 0 8 [ V a F D G V D F D I E S G S G Q F D G I D L D W E Y P B A C G P G G K B

s. linKKesv3ls

S. pl ica tus ET&-H v. pzmhemlytlcus 266 K I I P S I G G W T L S D P F 307 D G V D I D W E F P G G G G

128 K V L L S V L G N H Q G A G F 168 D G V D F D D E Y A E Y G N x. lact i s~ l lwtaxin 441 K K I P S F G G W D F ~ T S P 488 D G I D L D W E Y P G A P D Rat- CNMbiaSe 121 D G I N I D I E Q E V D C S

CELLULOSE BINDING PEPTIDE - Trichoderma reesei

CHlTIN BINDINQ DOMhIN - Saccharomyces ccreviriac

FIG. 7. Sequence comparisons of Saccharomyces chitinase with other chitinases and glycosidases. Regions 1 and 2 of the yeast chitinase shown in Fig. 6 are aligned with other chitinases or related sequences. Identities with the yeast enzyme are enclosed by rectangles. Also shown is similarity between the COOH-terminal chitin binding domain of the yeast enzyme and a portion of a fungal cellulase reported to display high affinity binding to cellulose. Sequences for rat liver chitobiase, Streptomyces plicatw, and Vibrio chitinases represent unpublished data from Dr. N. N. Aronson, Jr., Dr. Janice Pero, and Dr. Rodger Laine, respectively.

Chitinase Is Required for Cell Separation in Yeast 19765

12000 1 1

10000 i C T S l - 1

DISRUPTION - 0 Y .., d

I I I I 0.0 1 .o 2.0 3.0

TIME (HR)

FIG. 8. ['HIChitin solubilization by CTSZ-2, CTSZ-2, and by the CTSZ-1 deletion enzyme. Medium from a CTSI-disrupted strain (MKY1315) transformed with the chitinase plasmids pCT12 (intact CTSZ-I), pCT18 (CTSZ-I deletion), pCT20 (intact CTSI-2), or YEp352 (vector control) were used for sources of chitinase. Medium containing 300 units of enzyme (4-methylumbelliferyl substrate) was concentrated to approximately 0.1 ml in a Centricon 30 microconcen- trator (Amicon). For the vector control (disruption) a volume of medium equal to the CTSI-2 sample was processed. Concentrated samples were assayed and volumes were adjusted to give 2000 units/ ml. 0.1 ml of chitinase preparation was then added to 0.9 ml of 0.1 M citrate buffer, pH 3.0, containing 3 mg of ['HI chitin. Radiolabeled chitin was prepared by acetylation of chitosan with tritiated acetic anhydride according to Molano et al. (31). Reactions were continu- ously mixed by rotation at 30 "C. At the indicated times 0.1-ml samples of the suspensions were removed, centrifuged, and assayed for radioactivity.

97- 66 -

43-

31-

Proteinase K Added h a )

I o I lo3 I 102 I 10' I

22-

14-

FIG. 9. Partial proteolysis of chitin-chitinase complexes. 25 mg of chitin-chitinase complex (wet) was suspended in 50 pl of 50 mM Tris, pH 8.0, and the indicated amount of proteinase K was added to each reaction. Digests were then incubated for 16 h a t 24 "C. The samples were centrifuged, supernatants removed (S), and 1.25 pl of phenylmethylsulfonyl fluoride (40 mM in isopropyl alcohol) was added. After 30 min a t room temperature a second aliquot of phenyl- methylsulfonyl fluoride was added followed by another 30-min incu- bation. The samples were dryed under vacuum and suspended in 30 pl of sample buffer, boiled, and loaded on a 12% polyacrylamide gel. Material still bound to chitin (CB) was eluted with sample buffer and loaded on the polyacrylamide gel following three washes with 50 mM Tris, pH 8.0.

1 2 3 4 5 199 - 104- 66 -

42-

25-

18-

15-

FIG. 10. Expression and secretion of a chitin binding do- main-invertase fusion. The CTSZ-disrupted strain MKY1315 was transformed with pCT2O (CTSI-2 lune I ) , YEp352 (vector control: lune 2), pCT32 (CTSI-2 deletion expressing only the chitin binding domain: lane 3 ) , and pCT33 (invertase chitin binding domain fusion: lune 4 ) . Protein was isolated from the culture medium by chitin binding and analyzed on 12% polyacrylamide gels. Lune 5 shows the eluted invertase-chitinase fusion after treatment with endo-0-N- acetylglucosaminidase H.

104-

66-

SEC 8,7 - LFElEO-

SEC18 - FIG. 11. Synthesis of chitinase in secretion mutants. A, chi-

tinase was isolated from wild-type (DBY2068), secl8, sec7, and sec6 strains by immunoprecipitation after labeling with [2-"H]mannose for 90 min at 37 "C. Chitinase secreted into the growth medium was isolated by chitin binding. The labeled samples were separated by SDS-PAGE, transferred to nitrocellulose by electroblotting, and then visualized by autoradiography using tritium-sensitive film (10). B, chitinase was isolated from DBY2068 by immunoprecipitation after a 15-min labeling with [2-'H]mannose at 30 "C and processed as above. Mobility of chitinase forms observed in A are indicated.

be relatively constant at 0.2% (wet weight) with a variation of less than 20% in all strains analyzed. I t is possible that only internal chain cleavage reactions occur in vivo, yielding a net conservation of total cellular chitin but a decrease in average chain length. A suggestion has been made that yeast chitinase may under some circumstances "overdigest" and damage the cell wall and that this damage can be repaired by chitin synthase I (24). Before this hypothesis can be accepted or even interpreted in detail we must obtain further infor- mation concerning localization of chitinase and the normal restrictions that are made on its action in the cell wall.

Available data indicate that several classes of chitinases exist in nature. For example, bacterial chitinases (15,25) have been characterized which are secreted and degrade chitin for use as a carbon source. Numerous other chitinases have been studied from plant sources (14,26-28) which exhibit antibac- terial or anti-fungal activity and are produced in response to

19766 Chitinase Is Required for Cell Separation in Yeast

1000 7 1

E

0 1 0 20 30 2000

E 1000 V

0

600

500

400

300

200

! 30

3

0 1 0 20 30

0 70 2 0 30

Dnstance (cml

FIG. 12. Profiles of mannooligosaccharides attached to chi- tinase blocked at different stages in secretion. Regions of the nitrocellulose filter corresponding to the major bands seen in Fig. 11B were excised using the autoradiogram as a template. Filter segments were treated with 0.1 N NaOH overnight a t room tempera- ture. The released oligosaccharides were neutralized with acetic acid and were resolved by descending paper chromatography on Whatman No. 1 with ethyl acetate/butanol/acetic acid/water (3:4:2.5:4) as the solvent. Lanes were cut into 1 X 2-cm strips, added to the bottom of 10-ml scintillation vials, and radioactive oligosaccharides were eluted by addition of 1 ml of H20. Scintillation fluid was added prior to counting.

wounding or pathogen infection. The Saccharomyces chitinase described here is functionally unique in that it apparently acts physiologically to selectively modify the yeast cell wall. Interestingly, the hydrolytic domain is clearly homologous to a pathogenesis-related plant chitinase. Recently, it has been shown that a Kluyveromyces yeast killer toxin shares homol- ogy with chitinases from both plant and bacterial sources (29, 301. As shown in Fig. 7 this relationship extends to the Saccharomyces enzyme and other chitinase-like glycosidases. Perhaps the secreted Saccharomyces chitinase plays a dual role by also suppressing the growth of other microorganisms through hydrolysis of cell wall chitin or related polysaccha- rides.

Detailed physical study of the association of the small chitin binding domain with the essentially hydrophobic surface of insoluble chitin fibers should be extremely interesting. As mentioned above, we have already shown that other peptides fused to the chitin binding domain develop high affinity for

FIG. 13. Phase contrast microscopy of CTSI-disruptedcells. A: chitinase plus, axial budding pattern (DHY206X); 13: chitinase minus, axial budding pattern (MKYZOfX); C: chitinase minus, random budding pattern (MKY1315).

FIG. 14. Schematic representation of yeast chitinase.

the polymer. We have not measured the dissociation constants for these complexes, but in practical terms they can only be disrupted by denaturation of the protein. It is noteworthy that a number of cellulose and starch-degrading enzymes have recently been found to carry noncatalytic high affinity binding domains (17) for their respective substrates. One hypothesis is that these domains play roles in increasing the catalytic efficiency of these glycosidases. In Saccharomyces we have shown that the presence of the chitin binding domain does not increase the rate of chitin hydrolysis but rather may decrease its catalytic efficiency. On the other hand, the bind- ing domain clearly is required for localization of the enzyme to the yeast cell wall. Apparently, this general structural motif

Chitinase Is Required for Cell Separation in Yeast 19767

can be used to either enhance or limit the action of glycosi- dases toward insoluble carbohydrates.

Acknowledgments-We would like to thank C. E. Bulawa, S. C. Hubbard, P. Orlean, and K. D. Kuranda for useful discussions and suggestions. We also wish to thank E. Bothwell for assistance pre- paring the figures.

REFERENCES 1. (1982) J. Biol. Chem. 267,1392-1397 2. Kuranda, M. J., and Robbins, P. W. (1987) Proc. Natl. Acad. Sci.

3. Sherman, F., Fink, G. R., and Hicks, B. J. (1986) Methods in Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

4. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

5. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bac- teriol. 163,163-168

6. Crouse, G. F., Frischauf, A., and Lehrach, H. (1983) Methods Enzymol. 101,202-211

7. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast 2,163-167

8. Kaiser, C. A., Preuss, D., Grisafi, P., and Botstein, D. (1987) Science 236,312-317

9. Taussig, R., and Carlson, M. (1983) Nucleic Acids Res. 11,1943- 1954

10. Orlean, P., Kuranda, M. J., and Albright, C. F. (1991) Methods Enzymol. 194,682-697

11. Rose, M., Novick, P., Thomas, J., Botstein, D., and Fink, G. (1987) Gene (Amst.) 6 0 , 237-243

12. Bulawa, C. E., Slater, M., Cabib, E., Au-Young, J., Sburlati, A., Adair, W. L., and Robbins, P. W. (1986) Cell 4 6 , 213-225

13. Carlson, M., and Botstein, D. (1982) Cell 2 8 , 145-154

U. S. A. 84,2585-2589

14.

15.

16.

17.

18.

19.

20. 21.

22.

23. 24.

25.

26.

27.

28.

29. 30.

31.

Metraux, J. P., Burkhart, W., Moyer, M., Dincher, S., Middle- steadt, W., Williams, s., Payne, G., Carnes, M., and Ryals, J. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,896-900

Jones, J., Grady, K., Suslow, T., and Bedbrook, J. (1986) EMBO

Robbins, P. W., Trimble, R. B., Wirth, D. F., Hering, C., Maley, F., Maley, G. F., Das, R., Gibson, B. W., Royal, N., and Biemann, K. (1984) J. Biol. Chem. 259,7577-7583

Knowles, J., Lehtovaara, P., and Tuula, T. (1987) Trends Bio- technol. 5,255-261

Johansson, G., Stahlberg, J., Lindeberg, G., Engstron, A., and Pettersson, G. (1989) FEBS Lett. 2 4 3 , 389-393

Schekman, R., and Novick, P. (1982) Metabolism and Gene Expression, pp. 361-398, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

J. 5,467-473

Rothstein, R. J. (1983) Methods Enzymol. 101 , 202-211 Sakuda, S., Nishinato, Y., Ohi, M., Watanabe, M., Takayama, S.,

Isogai, A., and Yamada, Y. (1990) Agric. Biol. Chem. 54,1333- 1335

Tanner, W., and Lehle, L. (1987) Biochim. Biophys. Acta 9 0 6 ,

Haselbeck, A., and Tanner, W. (1983) FEBS Lett. 168,335-338 Cabib, E., Sburlati, A., Bowers, B., and Silverman, S. J. (1989) J.

Robbins, P. W., Albright, C., and Benfield, B. (1988) J. Biol.

Parsons, T. J., Bradshaw, H. D., and Gordon, M. P. (1989) Proc.

Shinshi, H., Mohnen, D., and Meins, F. (1987) Proc. Natl. Acad.

Broglie, K. E., Gaynor, J. J., and Broglie, R. M. (1986) Proc. Natl.

Bradshaw, H. D. (1990) Nature 345,299 Stark, M. J. R., Mileham, A. J., Romanos, M. A., and Boyd, A.

Molano, J., Duran, A., and Cabib, E. (1977) Anal. Biochem. 8 3 ,

81-89

Cell Biol. 108,1665-1671

Chem. 263,443-447

Natl. Acad. Sci. U. S. A. 8 6 , 7895-7899

S C ~ . U. S. A. 84.89-93

Acad. Sci. U. S. A. 83,6820-6824

(1984) Nucleic Acids. Res. 12, 6011-6030

648-656