JOURNAL OF BACTERIOLOGY,0021-9193/00/$04.0010

Jan. 2000, p. 320–326 Vol. 182, No. 2

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Isolation of the MIG1 Gene from Candida albicans and Effectsof Its Disruption on Catabolite Repression

OSCAR ZARAGOZA, CRISTINA RODRIGUEZ, AND CARLOS GANCEDO*

Instituto de Investigaciones Biomedicas “Alberto Sols,” Consejo Superior de Investigaciones Cientıficas-UAM,Unidad de Bioquımica y Genetica de Levaduras, 28029 Madrid, Spain

Received 7 July 1999/Accepted 25 October 1999

We have cloned a Candida albicans gene (CaMIG1) that encodes a protein homologous to the DNA-bindingprotein Mig1 from Saccharomyces cerevisiae (ScMig1). The C. albicans Mig1 protein (CaMig1) differs from ScMig1,in that, among other things, it lacks a putative phosphorylation site for Snf1 and presents several long stretchesrich in glutamine or in asparagine, serine, and threonine and has the effector domain located at some distance(50 amino acids) from the carboxy terminus. Expression of CaMIG1 was low and was similar in glucose-,sucrose-, or ethanol-containing media. Disruption of the two CaMIG1 genomic copies had no effect in fila-mentation or infectivity. Levels of a glucose-repressible a-glucosidase, implicated in both sucrose and maltoseutilization, were similar in wild-type or mig1/mig1 cells. Disruption of CaMIG1 had also no effect on the ex-pression of the glucose-repressed gene CaGAL1. CaMIG1 was functional in S. cerevisiae, as judged by its abilityto suppress the phenotypes produced by mig1 or tps1 mutations. In addition, CaMig1 formed specific complexeswith the URS1 region of the S. cerevisiae FBP1 gene. The existence of a possible functional analogue of CaMIG1in C. albicans was suggested by the results of band shift experiments.

Candida albicans is an opportunistic pathogen able to pro-duce a variety of lesions in cutaneous surfaces or life-threat-ening systemic infections in immunocompromised hosts. Theorganism can grow as a yeast or in filamentous form; althoughthis point has not been definitely established, the filamentousform seems to be implicated in the invasiveness of the organ-ism (35). A number of mutations that produce changes inmorphology have been described; among those, disruptionsin the TUP1 gene give rise to filamentous morphology in allgrowth conditions (3). Tup1 has been characterized in Saccha-romyces cerevisiae as a repressor of the transcription of severalgenes regulated by glucose, oxygen, or cell type (13, 25, 49). InS. cerevisiae, Tup1 forms a complex with Cyc8 that is recruitedby Mig1 to glucose-sensitive promoters (44, 47). Mig1 is aC2H2 zinc finger protein (34) which in S. cerevisiae binds to thepromoters of many genes repressed by glucose (27). In the ab-sence of glucose, Mig1 is localized in the cytosol; in its pres-ence, it migrates to the nucleus (8). It is thought that thischange in localization is due to changes in phosphorylation,which in turn are regulated by the protein kinase Snf1, whoseactivity is necessary for derepression of glucose repressiblegenes. Curiously, SNF1 is apparently essential for the viabilityof C. albicans (40) or C. tropicalis (24), in contrast with thesituation in S. cerevisiae (5) or C. glabrata (41). Due to the dif-ferences in phenotype produced by mutations in similar genesin C. albicans and S. cerevisiae and taking into account therelationship between Mig1, Tup1, and Snf1, we became inter-ested in the MIG1 gene from C. albicans (CaMIG1). During astudy of the CaTPS1 gene, encoding trehalose-6-phosphatesynthase (51), we fortuitously isolated a fragment of DNA whosesequence presented similarity with that of the MIG1 gene fromS. cerevisiae (ScMIG1). We report in this work the isolationand characterization of the CaMIG1 gene and show that its dis-ruption has no effects on filamentation and infectivity or on the

expression of the CaMAL2 and CaGAL1 genes, encoding ana-glucosidase implicated in the utilization of sucrose and mal-tose (15) and galactokinase (30), respectively. Our results alsosuggest the existence of a CaMIG1 analogue.

MATERIALS AND METHODS

Yeast strains, growth, and transformation. The following strains were used inthis work: S. cerevisiae WDC-3A (MATa ade2-1 his3-11,15 ura3-1 leu2-1 trp1-1tps1::HIS3) (2), S. cerevisiae H190 (MATa ade2 ura3 leu2 trp1 his3 can1 mig1::LEU2) (34), C. albicans SC5314 (17), C. albicans RM1000 (ura3::imm434/ura3::imm434 his1::hisG/his1::hisG) (32), C. albicans LOZ123 (ura3::imm434/ura3::imm434 his1::hisG/his1::hisG MIG1/mig1::HIS1) (this work), and C. albicansLOZ124 (ura3::imm434/ura3::imm434 his1::hisG/his1::hisG mig1::hisG-CaURA3-hisG/mig1::HIS1) (this work). The yeasts were grown with shaking at 30°C in 1%yeast extract–2% peptone (YP) or in a synthetic medium (Difco yeast nitrogenbase) with adequate auxotrophic requirements. As carbon source, 2% glucose,galactose, sucrose, or ethanol, 3% raffinose or glycerol, or a mixture of 2%glucose plus 2% sucrose was added. For formation of hyphae, C. albicans strainswere grown at 30°C in YP containing glucose until stationary phase and thenshifted to the same medium containing 10% newborn calf serum (Gibco BRL)at 37°C. S. cerevisiae was transformed by the lithium acetate method (23), andC. albicans was transformed by electroporation (26).

Bacterial strains and plasmids. Escherichia coli DH5a was used for transfor-mations and preparation of plasmid DNA. Plasmids pUC18 (50) and pGEM-T(Promega) were used in E. coli, and YEp352 (20) was used for constructions inS. cerevisiae. A genomic library from C. albicans in vector YEp352 was providedby C. Nombela and J. Pla (Madrid, Spain). Plasmid pOZ2-20, containing the 59noncoding region and the entire open reading frame (ORF) of CaMIG1, wasconstructed as follows. A 1,071-bp fragment from the 39 region of CaMIG1 (880bp from the ORF and 191-bp noncoding region) was obtained by PCR usingprimers O2 59CTTCAACTAGCCTATATTCCGATGG39 and O8 59-CTTTCTGTAGGTACCAACAACTAC39 and plasmid pOZ2-14 (Fig. 1A) as the tem-plate. O8 introduces a KpnI site (underlined). The PCR product was digestedwith BglII and KpnI, and the 841-bp fragment containing 650 bp of the codingregion and 191 bp of the 39 noncoding region was subcloned in pOZ2-8 digestedwith the same enzymes. Plasmid pOZ2-8 is a derivative of pOZ2-2 (Fig. 1) whichlacks the 600-bp XbaI-ClaI fragment and contains only the BglII site internal tothe ORF. Plasmid pOZ7, containing the ScMIG1 gene, was constructed by clon-ing the 2.2-kb SacI-SacI fragment from pMIG1 (34) in the SacI site of YEp352.

DNA and RNA manipulations. Recombinant DNA manipulations were doneby standard techniques. DNA probes were labelled as described elsewhere (11).Genomic DNA was obtained as described previously (21). Total RNA from C.albicans was extracted from 50-mg (wet weight) samples with the Gibco BRLTrizol reagent (7). The RNA samples were heated at 65°C for 15 min, fraction-ated on 1.5% agarose gels containing 2.2 M formaldehyde, and transferred to anylon membrane. rRNA in the membrane was visualized by staining with 0.02%

* Corresponding author. Mailing address: Instituto de Investiga-ciones Biomedicas, C/Arturo Duperier no. 4, E-28029 Madrid, Spain.Phone: 34-91-5854620. Fax: 34-91-5854587. E-mail: cgancedo@iib.uam.es.

320

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

methylene blue in 0.3 M sodium acetate and subsequent washing with 2 mMNa2HPO4 (pH 7.4)–30 mM NaCl–0.25 mM EDTA–1% sodium dodecyl sulfate.

The GAL1 probe used was isolated by PCR using the nucleotides 59GGTAATGTACCTACAGGAGG39 and 59GCTGCTGGTCTGTGTCGTTG39 as prim-ers and C. albicans genomic DNA as the template.

Colony screening. To screen the genomic library for DNA fragments with thecomplete CaMIG1 gene, E. coli was transformed with DNA from the library andthe transformed cells were treated basically as described elsewhere (18). Theprobe used was a 300-bp BglII-EcoRI fragment from pOZ2-2 (Fig. 1A).

DNA sequencing. Sequencing was performed by the dideoxy-chain terminationmethod (42). Computer analyses were carried out with the Wisconsin Package(Genetics Computer Group) software on a Digital 5000/200 workstation.

Chromosomal disruption of the CaMIG1 gene. To interrupt the CaMIG1 genewith CaURA3 and CaHIS1, we first constructed plasmid pOZ2-10, derived froma plasmid (pOZ2-9) developed for other purposes. To obtain pOZ2-9, plasmidpOZ2-2 (Fig. 1A) was digested with NcoI, blunt-ended, and digested with SacI;the resulting 2-kb fragment was ligated into YEp352 digested with SacI andSmaI. CaMIG1 was excised from pOZ2-9 as a 2-kb SacI-XbaI fragment andcloned into a derivative of pUC18 lacking the PstI site, to produce pOZ2-10.Disruption of CaMIG1 with CaURA3 was done as follows. A 4-kb BamHI-BglIIfragment from pCUB6K1 (a derivative of pCUB6 [12]) containing a hisG-CaURA3-hisG cassette was cloned in the BamHI site of plasmid Sac-KissLambda (46). The resulting plasmid was digested with PstI, and the 4-kb frag-ment containing the hisG-CaURA3-hisG region was inserted into pOZ2-10digested with PstI to give plasmid pOZ9 (Fig. 1B). To disrupt CaMIG1 withCaHIS1, the 1.5-kb SmaI-SmaI fragment from p34HHIS1 (provided by J. Pla),containing the CaHIS1 gene, was subcloned into pOZ2-10 digested with PstI andblunt ended. The resulting plasmid was called pOZ10 (Fig. 1B). To integrate thedisruptions in the genome of C. albicans RM1000, plasmids pOZ9 and pOZ10were digested with SacI and HindIII, and the digestion products were introducedinto the yeast by electroporation. Transformants were selected by growth in theabsence of uracil and histidine. Correct insertion of the disruption cassette waschecked by PCR using appropriate primers. Colonies producing the expectedPCR pattern were checked by Southern analysis (Fig. 1C).

Band shift assays. Band shift experiments were performed as described else-where (48). Nuclear extracts from S. cerevisiae were prepared as described pre-viously (43). Total extracts from C. albicans were prepared as described previ-

ously (6). As labelled probe, we used an oligonucleotide that contains the Mig1binding site located between positions 2201 and 2184 in the promoter of theFBP1 gene from S. cerevisiae (URS1FBP1) (31). When indicated, a 100-fold excessof unlabelled oligonucleotide was added as competitor to the incubation mix-ture. For nonspecific competition, we used an oligonucleotide that contains theUAS1FBP1 region from 2432 to 2415 (31). The probe was labelled with theKlenow fragment. A total of 40,000 cpm was used in each incubation.

Enzymatic assays. a-Glucosidase was assayed spectrophotometrically in cellextracts with an enzymatic coupled system. The assay mixture, at pH 7, consistedof 50 mM imidazole, 50 mM KCl, 1 mM MgCl2, 0.4 mM NADP, 0.5 U each ofglucose-6-phosphate dehydrogenase and hexokinase per ml, and the neededamount of extract. The reaction was started by the addition of 50 mM sucrose,and the increase in absorbance at 340 nm was monitored. Protein was deter-mined by using the Pierce reagent.

Infectivity test. Male Swiss CD-1 mice (specific pathogen free; Charles River),6 weeks old and weighing approximately 25 to 30 g, were used. They were inoc-ulated in the lateral caudal vein with 200 ml of a cell suspension containing thestrain being tested (107 viable C. albicans cells/ml) and were monitored for 1 week.

Nucleotide sequence accession number. The sequence obtained for CaMIG1has been submitted to the EMBL databank and assigned accession no. AJ238242.

RESULTSIsolation and characterization of the CaMIG1 gene. S. cerevi-

siae tps1 mutants, deficient in trehalose-6-phosphate synthase, donot grow in glucose (1). In a screen to isolate from C. albicansgenes that complemented this phenotype (51), we isolated oneplasmid, pOZ2-1, with a 7.7-kb insert of genomic DNA from C.albicans. A smaller insert of 3.8 kb (plasmid pOZ2-2) alsocomplemented the growth defect of the tps1 mutant. The levelsof trehalose in the yeast carrying this plasmid remained as lowas in the original tps1 mutant, indicating that the plasmidcarried a yeast DNA encoding a phenotypic suppressor ofthe tps1 mutation. The sequence of the C. albicans DNA in

FIG. 1. Map of the genomic region around CaMIG1, disruption strategy, and Southern blot of the CaMIG1 disruptants. (A) Restriction map of inserts of C. albicans DNAthat contain entire or truncated versions of CaMIG1. The CaMIG1 gene and direction of transcription are indicated by the arrow in pOZ2-14. Plasmid pOZ2-2 lacks 288 bpof the 39 region of the gene. pOZ2-14 and pOZ2-2 have identical polylinkers. Thick lines indicate genomic DNA from C. albicans. A region with high similarity with the 39regions of genes encoding xylose reductases is indicated without details of restriction sites. (B) Disruption of the CaMIG1 gene with CaURA3 and CaHIS1 (for details, seeMaterials and Methods). (C) Southern blot of the mig1/mig1 disruptants. Genomic DNA was digested with EcoRI. As probe, the 0.75-kb EcoRI-HindIII fragment indicatedin panel A was used. Sizes of the bands are indicated at the right. Relevant genotypes of the strains used for the Southern analysis are also indicated.

VOL. 182, 2000 MIG1 FROM C. ALBICANS 321

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

pOZ2-2 revealed similarity to the sequence of the ScMIG1gene (34), but no putative stop codon was found. Moreover, itlacked a 39 sequence that encodes a region of ScMIG1 appar-ently important for function (36). Therefore we screened theC. albicans library for a complete gene. In this way plasmidpOZ2-14 was isolated. This plasmid contained a completeORF with similarity to ScMIG1 and also a fragment with highsequence similarity to the 39 ends of genes encoding xylosereductase from other organisms (Fig. 1A). The similarity ofsequence and the fact that a truncated version of ScMIG1 insingle copy or, more efficiently, in multicopy suppresses thephenotype of a byp1-3 mutant, an allelic form of TPS1, inS. cerevisiae (22) made it likely that the cloned gene was theMIG1 gene from C. albicans. The nucleotide sequence re-vealed an ORF encoding a putative protein of 574 amino acidswith a calculated molecular mass of 63 kDa. At positions 37,941, and 1357 we found the triplet CTG, which usually encodesleucine but in C. albicans encodes serine. The amino acidsequence presents a series of characteristics that appear con-served among the Mig1 analogues from different organisms butshows some distinctive features that deserve consideration.The most characteristic feature is the existence of two zincfinger motifs of the type C2H2 located between positions 29and 84, similar to those present in other analogues (Fig. 2B).Like in other proteins of this type, a putative phosphorylationsequence for the cyclic AMP-dependent protein kinase(KRFS) is located in the second zinc finger. Near the N ter-minus, the known Mig1 proteins present a basic region withtwo lysines separated by four amino acids. In the C. albicans

protein this sequence is KMPPK, which appears in severalproteins with presumed nuclear localization (19) (Fig. 2A).Close to the Zn fingers there is a region rich in basic aminoacids, but CaMig1 has less positive charges than proteins ofother yeasts (Fig. 2C). This region appears more similar to S.cerevisiae Mig2 and to the Mig1 homologues from Schizosac-charomyces pombe and other fungi. Another peculiarity ofCaMig1 is the absence of a putative phosphorylation site forSnf1 that is found in the proteins of S. cerevisiae or Kluyvero-myces lactis in the so-called regulatory domains (4). CaMig1presents several stretches rich in glutamine, around aminoacids 179 and 265, and in serine (around 347) or asparagine,serine, and threonine (NST region), around 380 to 400 (Fig.2D). Although in S. cerevisiae stretches of polyglutamine andglutamine alternating with asparagine have been described(34), the frequency of glutamine residues is higher in the pro-tein from C. albicans. Between the serine-rich and NTS re-gions, the sequence LAGLQRLTPL has a structure reminis-cent of that proposed for the Mig1 effector domain at the Cterminus (Fig. 2F). The position of a putative effector domainat the 39 end also differs between the protein of C. albicans andthose of other organisms. In S. cerevisiae and in two Kluyvero-myces species, this effector domain, important for cataboliterepression (36), is located within the 26 carboxy-terminal aminoacids, whereas in CaMig1 this region is located 50 amino acidsbefore the carboxy terminus. The 59 upstream noncoding re-gion of CaMIG1 did not show any conspicuous feature.

Expression of the CaMIG1 gene. Since the capacity of Mig1to repress transcription in S. cerevisiae varies depending on the

FIG. 2. Multiple alignment of important regions of CaMig1. The numbers in parentheses indicate amino acid positions. Boldface letters highlight identities ordifferences in the sequences. (A) Basic residues in the N-terminal region. (B) Zinc finger regions. Cysteine and histidine residues are in boxes. A putativephosphorylation site for cyclic cAMP-dependent protein kinase is underlined. (C) Differences in the basic region. (D) The two glutamine-rich stretches. (E) Betweenthe serine-rich and NTS regions, a potential effector domain with the sequence LxxLxxLxxL is boxed. (F) Effector domain. A putative effector domain in CaMig1 issituated 50 amino acids before the C-terminal amino acid.

322 ZARAGOZA ET AL. J. BACTERIOL.

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

growth conditions (44), we studied the expression of CaMIG1in C. albicans grown in different media. As shown in Fig. 3,expression was not significantly affected by the carbon sourceor growth phase. RNA from a strain with both chromosomalcopies of MIG1 disrupted did not show hybridization with theMIG1 probe (Fig. 3).

Effects of disruption of the CaMIG1 gene. To determine therole of CaMIG1 in the physiology of C. albicans, we disrupt-ed both chromosomal copies of the gene. The disruptionwas checked by Southern analysis (Fig. 1B and C; Materialsand Methods), and additional proof for its correctness wasprovided by the results of the Northern analysis (Fig. 3).Growth rates of the wild type and the double disruptant in YPcontaining glucose were not significantly different (genera-tion time of around 80 min). Also, no significant differencesin growth rate were found when glycerol or galactose was usedas a carbon source. When challenged with serum, the wild-typeand mig1/mig1 strains formed hyphae in similar manners. Also,no significant changes in mortality were seen when mice wereinjected with the same amount of viable cells of a wild-type ora mig1/mig1 strain.

CaMIG1 is not required for repression of a-glucosidase orCaGAL1. The most conspicuous effects of mig1 mutations inS. cerevisiae are seen in the pathways involved in sucrose (34)or galactose utilization (33). Therefore we examined the effectsof CaMIG1 disruption in these pathways in C. albicans. Su-crose and maltose are utilized in C. albicans after hydrolysis byan a-glucosidase repressed by glucose (15). As shown in Table1, the levels of a-glucosidase were strongly repressed by glu-cose, both in the wild type and in a CaMIG1-disrupted strain.

Expression of CaGAL1 was induced by galactose and re-pressed by glucose (Fig. 4). A low basal level of CaGAL1 mRNAwas observed in glucose- or glycerol-grown cells. Disruption ofCaMIG1 did not relieve significantly the repression by glucose.

These results indicate either that expression of CaMAL2 andCaGAL1 is independent of CaMIG1 or that there is a func-tional analogue of it.

Functionality of CaMIG1 in S. cerevisiae. CaMIG1 appearsto be functional in S. cerevisiae, as shown by its complementa-tion of the tps1 mutation. We observed that a truncated formof CaMig1 lacking the 89 C-terminal amino acids (insert ofplasmid pOZ2-2) complemented a tps1 mutant for growth onglucose but not for growth on fructose. Transformation ofthe tps1 mutant with plasmid pOZ2-20, carrying the completegene, allowed growth on both sugars (Fig. 5A).

FIG. 3. Expression of CaMIG1 during growth in different conditions. C.albicans SC5314 (wild type) and LOZ124 (mig1/mig1) were grown in the indi-cated carbon sources and harvested at the phases of growth shown; 15 mg ofRNA was applied to each lane. The probe used was the 0.8-kb fragment PstI-EcoRI (the latter site from the polylinker) from pOZ2-2 (Fig. 1A). Bands in thelower row correspond to the 26S rRNA used as a control for the charge of RNA.

FIG. 4. Effect of disruption of CaMIG1 on the expression of CaGAL1. TotalRNA was extracted (see Materials and Methods) from C. albicans SC5314 (wildtype) or LOZ124 (mig1/mig1) grown in the indicated carbon sources and har-vested at mid-log phase. The CaGAL1 probe was a 746-bp fragment isolated byPCR as described in Materials and Methods. The lower row shows bands cor-responding to the 26S rRNA.

FIG. 5. Functionality of truncated and complete versions of CaMIG1 in S. cer-evisiae. (A) S. cerevisiae tps1 strain WDC-3A was transformed with plasmid pOZ2-2,carrying a truncated version of CaMIG1 encoding a protein lacking the 89 C-terminal amino acids, or with plasmid pOZ2-20, carrying a complete version of thegene, and spread on plates with glucose or fructose as the carbon source. As controls,growth of the tps1 mutant strain on galactose plates and of the same mutant trans-formed with a void plasmid are shown. (B) S. cerevisiae mig1 strain H190 wastransformed with plasmid pOZ2-2 or pOZ2-20 and streaked on plates with 2%raffinose and with 2% raffinose–0.04% 2-deoxyglucose. As a control, the strain wastransformed with plasmid pOZ7 carrying the complete ScMIG1.

TABLE 1. a-Glucosidase activity in C. albicans strainsgrown in different conditionsa

Relevantgenotype

Sp act (mU/mg of protein)

Glucose Glucose 1 sucrose Sucrose

MIG1/MIG1 2 2 400mig1/mig1 3 4 390

a The yeasts were grown in YP with glucose, glucose plus sucrose, or sucroseand harvested at 15 to 20 mg/ml. a-Glucosidase activity was measured as de-scribed in Materials and Methods.

VOL. 182, 2000 MIG1 FROM C. ALBICANS 323

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

To test more broadly the functionality of CaMIG1 in S. cer-evisiae, we used two different approaches. In one, we examinedthe ability to restore catabolite repression of the SUC2 gene toan Scmig1 mutant. In the other, we observed whether CaMig1was able to form specific complexes with the URS1FBP1 regionof S. cerevisiae, which binds ScMig1 (31).

An Scmig1 mutant transformed with a plasmid carrying ei-ther the complete CaMIG1 gene or the truncated version didnot grow on raffinose–2-deoxyglucose, indicating that in bothcases, repression of SUC2 by the glucose analogue was re-stored (Fig. 5B). This result together with those for growthcomplementation of the tps1 mutant indicates that the C-ter-minal fragment is not absolutely required for all of its func-tions.

As shown in Fig. 6A, nuclear extracts from an S. cerevisiaestrain expressing ScMIG1 formed one main specific complexand two weaker ones with the URS1 of ScFBP1. Nuclear ex-tracts from an Scmig1 mutant transformed with CaMIG1 pro-duced a major complex. This complex was specific, as shown bycompetition assays (Fig. 6A).

These results from two different approaches indicate thatCaMIG1 is active in S. cerevisiae in a variety of functions.

Is there a functional CaMIG1 analogue? If there is someanalogue of CaMig1 in C. albicans, it could likely form specificcomplexes with the URS1 of ScFBP1 as CaMig1 does. As shownin Fig. 6B, in assays using extracts of wild-type C. albicans cells,five specific complexes are seen. Disruption of CaMIG1 did notabolish the formation of specific complexes but changed theirpattern. The intensity of the complexes A1 and B1 decreased,that of C1 increased, and C3 disappeared; in contrast, two newcomplexes, A2 and A3, were formed. This result shows theexistence in C. albicans of a protein able to bind to the sameDNA sequence as CaMig1, which may function as a CaMig1analogue.

DISCUSSION

We have isolated and characterized the gene encoding theDNA-binding protein Mig1 from the opportunistic pathogen

C. albicans. This protein has been implicated in the glucoserepression of several genes in S. cerevisiae (14) and in the re-pression of lactose metabolism in K. lactis (9). Although thesequence of the putative protein encoded by CaMIG1 bears anoverall resemblance to those of the yeasts mentioned andother analogues from fungi (10), some particular characteris-tics merit consideration. One of them is the lack of a putativephosphorylation sequence for the protein kinase Snf1. InS. cerevisiae, Mig1 switches its localization between the nucleusand the cytoplasm in response to a phosphorylation (8) con-trolled by the protein kinase Snf1 (38, 45). The lack of aphosphorylation sequence for Snf1 in CaMig1 suggests thateither its control is different or Mig1 has different roles inC. albicans than in S. cerevisiae. A peculiar characteristic is theexistence of the sequence KMPPK, which is identical to one inthe N-terminal region of hexokinase 2 of S. cerevisiae, involvedin targeting the protein to the nucleus and instrumental incatabolite repression (19). Another sequence that could directCaMig1 to the nucleus is HKKSR, found at position 428. InS. cerevisiae a similar motif, RKKSR, in position 364 is impli-cated in this function (M. Johnston, personal communication).However, in the case of CaMig1, deletion of this sequence didnot reduce markedly the complementation of the growth onglucose of an S. cerevisiae tps1 mutant (unpublished results).Therefore, this sequence seems in this case to be not absolutelyrequired for nuclear import.

We found that the expression of CaMIG1 was unchanged indifferent conditions, a result different from that reported forS. cerevisiae (28). Using a fusion of the ScMIG1 promoter tolacZ, these authors reported that the expression of MIG1 wasdecreased during growth in glucose in that yeast. This discrep-ancy could be due to differences in the regulation of MIG1expression between the two species. To our knowledge thereare no reports on levels of MIG1 mRNA in S. cerevisiae or onthe expression of MIG1 in other yeasts.

Disruption of MIG1 in S. cerevisiae relieves glucose repres-sion of the GAL genes (33) and partially relieves that of SUC2(29) but has little or no effect on other genes whose promoterscontain Mig1 binding sites (14). Disruption of CaMIG1 had noeffect on the levels of the a-glucosidase-hydrolyzing sucrose inC. albicans or upon the expression of CaGAL1. An analysisof the promoters of these genes revealed that they do not pre-sent consensus sites for Mig1 binding. Expression of the K. lac-tis gene INV1, encoding invertase, is also insensitive to thefunctionality of the corresponding MIG1 (16). Expression ofCaTPS1, which has a putative Mig1 binding site in its promoter(51), was also unaffected by the disruption of CaMIG1 (resultsnot shown).

In S. cerevisiae, there are two other genes encoding homo-logues of Mig1: MIG2 and Yer028c (28, 29). SUC2 is repressedby both Mig1 and Mig2, but no role has been established forYer028c (28). Our results of band shift experiments show thatin C. albicans, proteins different from CaMig1 are able to bindto a Mig1 binding site, suggesting the existence of functionalanalogues of CaMIG1.

In S. cerevisiae, the Tup1-Cyc8 complex is recruited by Mig1to repress glucose-sensitive promoters. Since in C. albicans dis-ruption of TUP1 gives rise to filamentous growth, disruption ofCaMIG1 could have produced a similar phenotype. Howeverthis was not the case, indicating that the filamentous phenotypeof Catup1 mutants cannot be accounted for by a relief of in-hibition by Mig1. Tup1 may therefore allow growth in the yeastform through its interaction with proteins different fromCaMig1. In fact, in S. cerevisiae, Tup1 is also involved in Mig1-independent pathways (47).

It is not clearly understood how overexpression of MIG1

FIG. 6. Band shift analysis using the URS1 fragment from the ScFBP1 pro-moter. (A) Five-microgram aliquots of protein of nuclear extracts from anScmig1 mutant transformed with a void plasmid (YEp352) or the same plasmidcarrying the ScMIG1 or CaMIG1 gene were used. (B) Fifteen-microgram ali-quots of protein of total extracts from either C. albicans SC5314 (wild type) orLOZ124 (mig1/mig1) were applied to the gel. Labelling and experimental con-ditions were as described in Materials and Methods. The samples in lanes 1 wereincubated without added protein. In lanes 3, 6, and 9, an excess of unlabelledURS1 was added; in lanes 4, 7 and 10, the DNA fragment UAS1FBP1 (seeMaterials and Methods) was used as the nonspecific competitor.

324 ZARAGOZA ET AL. J. BACTERIOL.

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

suppresses phenotypically the growth defects of the tps1 mu-tation in S. cerevisiae. In a tps1 mutant, an excessive flux in theinitial steps of sugar utilization produces a metabolic imbal-ance and depletes the cell of ATP. Lack of inhibition of hex-okinase by trehalose-6-phosphate is one important cause ofthis imbalance (2). Overexpression of MIG1 could decreaseglucose influx by repressing some of the genes encoding glu-cose transporters (39). The differences in complementation forgrowth on glucose or fructose observed with a truncated and afull version of CaMIG1 contrast with the similar abilities ofboth versions for repression of SUC2. These differences indi-cate that the C-terminal region is important for some functionsbut dispensable for others. The importance of this region washighlighted by the observation that the 24 C-terminal aminoacids of ScMig1 fused to a DNA-binding fragment could sub-stitute for the Mig1 protein in S. cerevisiae (36). However,recent results indicate that mutations in this region decreasebut do not abolish repression (37); another part of the proteinmust therefore provide the ability to block transcription. A po-tential candidate could be the region where a stretch of severalleucines mimics the sequence in the effector domain (4, 37). Inthe case of CaMig1, a stretch with leucines is located aroundposition 366 and could be the reason for the functionality ofthe truncated version in S. cerevisiae.

Although C. albicans SNF1 and MIG1 can complement snf1and mig1 mutants in S. cerevisiae (reference 40 and this work),their roles in C. albicans are not completely equivalent to theroles of the corresponding analogues in S. cerevisiae. Thus, theability of a regulatory protein to complement functions in het-erologous organisms does not allow conclusions to be drawndirectly about its mode of action in the original organism.

ACKNOWLEDGMENTS

We thank J. Pla and C. Nombela (Madrid, Spain) for strains andplasmids, M. A. Blazquez (La Jolla, Calif.) for critical reading of themanuscript, and Juana M. Gancedo for her interest in this work andhelp in composition of the manuscript.

This work was supported by grant PB97-1213-CO2-01 from theSpanish Direccion General de Ensenanza Superior e InvestigacionCientıfica. O.Z. had a fellowship from the Spanish PFPI, and C.R. hada fellowship from the Fundacion Ramon Areces (Spain).

REFERENCES1. Bell, W., P. Klaasen, M. Ohnacker, T. Boller, M. Herweijer, P. Schoppink, P.

van der Zee, and A. Wiemkem. 1992. Characterization of the 56 kDa subunitof yeast trehalose-6-phosphate synthase and cloning of its gene reveal itsidentity with the product of CIF1, a regulator of carbon catabolite inactiva-tion. Eur. J. Biochem. 209:951–959.

2. Blazquez, M. A., R. Lagunas, C. Gancedo, and J. M. Gancedo. 1993. Tre-halose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexoki-nases. FEBS Lett. 329:51–54.

3. Bukhard, R. B., and A. D. Johnson. 1997. Control of filament formation inCandida albicans by the transcriptional repressor TUP1. Science 277:105–108.

4. Cassart, J. P., J. Ostling, H. Ronne, and J. Vandenhaute. 1997. Comparativeanalysis in three fungi reveals structurally and functionally conserved regionsin the Mig1 repressor. Mol. Gen. Genet. 255:9–18.

5. Celenza, J. L., and M. Carlson. 1986. A yeast gene that is essential forrelease from glucose repression encodes a protein kinase. Science 233:1175–1180.

6. Chaves, R. S., P. Herrero, and F. Moreno. 1999. Med8, a subunit of themediator CTD complex of RNA polymerase II, directly binds to regulatoryelements of SUC2 and HXK2 genes. Biochem. Biophys. Res. Commun. 254:345–350.

7. Chomczynscki, P., and N. Sacchi. 1987. Single-step method of RNA isola-tion by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Bio-chem. 162:156–159.

8. DeVit, M. J., J. A. Waddle, and M. Johnston. 1997. Regulated nucleartranslocation of the Mig1 glucose repressor. Mol. Biol. Cell 8:1603–1618.

9. Dong, J., and R. C. Dickson. 1997. Glucose represses the lactose-galactoseregulon in Kluyveromyces lactis through a SNF1 and MIG1-dependent path-way that modulates galactokinase (GAL1) expression. Nucleic Acids Res. 25:3657–3664.

10. Dowzer, C. E. A., and J. M. Kelly. 1991. Analysis of the creA gene, a regulatorof carbon catabolite repression in Aspergillus nidulans. Mol. Cell. Biol. 11:5701–5709.

11. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNAfragments to high specific activity. Anal. Biochem. 132:6–13.

12. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and genemapping in Candida albicans. Genetics 134:717–728.

13. Fujita, A., S. Matsumoto, S. Kuhara, Y. Misumi, and H. Kobayashi. 1990.Cloning of the yeast SFL2 gene: its disruption results in pleiotropic pheno-types characteristic for tup1 mutants. Gene 89:93–99.

14. Gancedo, J. M. 1998. Yeast carbon catabolite repression. Microbiol. Mol.Biol. Rev. 62:334–361.

15. Geber, A., J. H. R. Williamson, E. C. Sweeney, and J. E. Bennett. 1992.Cloning and characterization of a Candida albicans maltase gene involved insucrose utilization. J. Bacteriol. 174:6992–6996.

16. Georis, I., J. P. Cassart, K. D. Breuning, and J. Vandenhaute. 1999. Glucoserepression of the Kluyveromyces lactis invertase gene KIINV1 does not re-quire Mig1p. Mol. Gen. Genet. 261:862–870.

17. Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candidaalbicans gene for orotidine-59-phosphate decarboxylase by complementationof S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179–182.

18. Grunstein, M., and D. S. Hogness. 1975. Colony hybridization: a method forthe isolation of cloned DNAs that contain a specific gene. Proc. Natl. Acad.Sci. USA 72:3961–3965.

19. Herrero, P., C. Martınez-Campa, and F. Moreno. 1998. The hexokinase 2protein participates in regulatory DNA-protein complexes necessary forglucose repression of the SUC2 gene in Saccharomyces cerevisiae. FEBS Lett.434:71–76.

20. Hill, J. E., A. M. Myers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. colishuttle vectors with multiple unique restriction sites. Yeast 2:163–167.

21. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation fromyeast efficiently releases autonomous plasmids for transformation of E. coli.Gene 57:266–272.

22. Hohmann, S., K. Huse, E. Valentın, K. Mbonyi, J. M. Thevelein, and F. K.Zimmermann. 1992. Glucose-induced regulatory defects in the Saccharomy-ces cerevisiae byp1 growth inhibition mutant and identification of MIG1 as apartial suppressor. J. Bacteriol. 174:4183–4188.

23. Ito, H., Y. Fukada, K. Murata, and A. Kimura. 1983. Transformation ofintact yeast cells treated with alkali cations. J. Bacteriol. 153:163–168.

24. Kanai, T., K. Ogawa, M. Ueda, and A. Tanaka. 1999. Expression of the SNF1gene from Candida tropicalis is required for growth on various carbonsources, including glucose. Arch. Microbiol. 172:256–263.

25. Keleher, C. A., M. J. Redd, J. Schultz, M. Carlson, and A. D. Johnson. 1992.Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709–719.

26. Kohler, G. A., T. C. White, and N. Agabian. 1997. Overexpression of a clonedIMP dehydrogenase gene of Candida albicans confers resistance to thespecific inhibitor mycophenolic acid. J. Bacteriol. 179:2331–2338.

27. Lundin, M., J. O. Nehlin, and H. Ronne. 1994. Importance of a flankingAT-rich region in target site recognition by the GC box-binding zinc fingerprotein MIG1. Mol. Cell. Biol. 14:1979–1985.

28. Lutfiyya, L. L., V. R. Iyer, J. DeRisi, M. J. DeVit, P. O. Brown, and M.Johnston. 1998. Characterization of three related glucose repressors andgenes they regulate in Saccharomyces cerevisiae. Genetics 150:1377–1391.

29. Lutfiyya, L. L., and M. Johnston. 1996. Two zinc-finger-containing repres-sors are responsible for glucose repression of SUC2 expression. Mol. Cell.Biol. 16:4790–4797.

30. Magee, B. B., Y. Koltin, J. A. Gorman, and P. T. Magee. 1988. Assignmentof cloned genes to the seven electrophoretically separated Candida albicanschromosomes. Mol. Cell. Biol. 8:4721–4726.

31. Mercado, J. J., O. Vincent, and J. M. Gancedo. 1991. Regions in the pro-moter of the yeast FBP1 gene implicated in catabolite repression may bindthe product of the regulatory gene MIG1. FEBS Lett. 291:97–100.

32. Negredo, A., L. Monteoliva, C. Gil, J. Pla, and C. Nombela. 1997. Cloning,analysis and one-step disruption of the ARG5,6 gene of Candida albicans.Microbiology 143:297–302.

33. Nehlin, J. O., M. Carlberg, and H. Ronne. 1991. Control of yeast GAL genesby MIG1 repressor: a transcriptional cascade in the glucose response.EMBO J. 10:3373–3377.

34. Nehlin, J. O., and H. Ronne. 1990. Yeast MIG1 repressor is related to themammalian early growth response and Wilm’s tumour finger proteins.EMBO J. 9:2891–2898.

35. Odds, F. C. 1988. Candida and candidosis. Bailliere-Tindall, London, En-gland.

36. Ostling, J., M. Carlberg, and H. Ronne. 1996. Functional domains in theMig1 repressor. Mol. Cell. Biol. 16:753–761.

37. Ostling, J., J. P. Cassart, J. Vandenhaute, and H. Ronne. 1998. Four hydro-phobic amino acid residues in the C-terminal effector domain of the yeastMig1p repressor are important for its in vivo activity. Mol. Gen. Genet. 260:269–279.

38. Ostling, J., and H. Ronne. 1998. Negative control of the Mig1p repressor by

VOL. 182, 2000 MIG1 FROM C. ALBICANS 325

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Snf1p-dependent phosphorylation in the absence of glucose. Eur. J. Bio-chem. 252:162–168.

39. Ozcan, S., and M. Johnston. 1995. Three different regulatory mechanismsenable yeast hexose transporter (HXT) genes to be induced by differentlevels of glucose. Mol. Cell. Biol. 15:1564–1572.

40. Petter, R., Y. C. Chang, and K. J. Kwon-Chung. 1997. A gene homologousto Saccharomyces cerevisiae SNF1 appears to be essential for the viability ofCandida albicans. Infect. Immun. 65:4909–4917.

41. Petter, R., and K. J. Kwon-Chung. 1996. Disruption of the SNF1 geneabolishes trehalose utilization in the pathogenic yeast Candida glabrata.Infect. Immun. 64:5269–5273.

42. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

43. Schneider, R., I. Gander, V. Muller, R. Mertz, and E. L. Winnacker. 1986. Asensitive and rapid assay for nuclear factor I and other DNA-binding pro-teins in crude nuclear extracts. Nucleic Acids Res. 14:1303–1317.

44. Treitel, M. A., and M. Carlson. 1995. Repression of SSN6-TUP1 is directedby MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. USA 92:3132–3136.

45. Treitel, M. A., S. Kuchin, and M. Carlson. 1998. Snf1 protein kinase regu-

lates phosphorylation of the Mig1 repressor in Saccharomyces cerevisiae.Mol. Cell. Biol. 18:6273–6280.

46. Tsang, T. C., D. T. Harris, E. T. Akporiaye, S. F. Schluter, G. T. Bowden, andE. H. Hersh. 1996. Simple method for adapting DNA fragments and PCRproducts to all of the commonly used restriction sites. BioTechniques 20:51–52.

47. Tzamarias, D., and K. Struhl. 1995. Distinct TPR motifs of Cyc8 are in-volved in recruiting the Cyc8-Tup1 corepressor complex to differentiallyregulated promoters. Genes Dev. 9:821–831.

48. Vincent, O., and J. M. Gancedo. 1995. Analysis of positive elements sensitiveto glucose in the promoter of the FBP1 gene from yeast. J. Biol. Chem. 270:12832–12838.

49. Williams, F. E., and R. J. Trumbly. 1990. Characterization of TUP1, amediator of glucose repression in Saccharomyces cerevisiae. Mol. Cell. Biol.10:6500–6511.

50. Yanisch-Perron, C., J. Vieira, and J. M. Messing. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18 andpUC19 vectors. Gene 33:103–109.

51. Zaragoza, O., M. A. Blazquez, and C. Gancedo. 1998. Disruption of the Can-dida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairsformation of hyphae and decreases infectivity. J. Bacteriol. 180:3809–3815.

326 ZARAGOZA ET AL. J. BACTERIOL.

on January 30, 2020 by guesthttp://jb.asm

.org/D

ownloaded from