ISOLATION CLONING AND CHARACTERIZATION OF LIGNIN...

Chapter 5

Chapter 5 Transformation studies of Leucaena

5. Transformation of Leucaena leucocephala with 4CL Gene and

its Analysis This chapter includes the different strategies used to transform the plant. The plant

transformation vector pCAMBIA1301 (harbouring the 4CL gene in antisense

orientation and genes for GUS (marker gene)) were used for the study. Three

different strategies i.e. Agrobacterium mediated, particle bombardment and co-

cultivation is described in detail in this chapter. Evaluation and analysis of

putative transformants and confirmation of integration of these genes in L.

leucocephala genome by GUS assay and by molecular techniques like PCR, DNA

sequencing and Slot blot.

5.1. Introduction (General aspects of genetic transformation of trees)

The genetic transformation protocols based on Agrobacterium-mediated and/or

direct gene transfers by biolistic bombardment have been successfully applied for

numerous woody angiosperm species (Merkle & Nairn, 2005), including Populus

and Betula. The introduction of transgenes have included both sense and antisense

strategies (referring to the orientation of the introduced gene into the plant

genome) (Strauss et al., 1995; Baucher et al., 1998) and RNAi technology

(Merkle & Nairn, 2005). In the antisense strategy, duplex formation between the

antisense transgene and the endogenous gene transcripts is proposed to induce the

degradation of duplexes and, correspondingly, lead to suppressed gene expression

(Strauss et al., 1995). The sense strategy was originally targeted for over-

expression of the genes but, as originally observed through the introduction of

chalcone synthase transgene into petunia (Napoli et al., 1990), the sense strategy

may also lead to silencing (down-regulation) of both the endogene and the

transgene due to co-suppression (i.e. post-transcriptional gene silencing, PTGS).

The molecular mechanism of the gene silencing was unclear for long time until

the discovery of RNA interference (RNAi) (Yu & Kumar, 2003: Matthew, 2004;

Chen, 2005; Bonnet et al., 2006; Zhang et al., 2006). In the RNAi silencing

process, the transgene gives rise to long double-stranded (ds) RNA molecules,

which are enzymatically cleaved into very small pieces of RNA (21 nt), referred

to as small interfering RNAs (siRNAs). siRNAs are then incorporated in an RNA

Sushim K Gupta Ph D Thesis University of Pune 148


silencing system (RISC: RNA induced silencing complex) which is able to

recognize, bind and induce cleavage or translation repression of complementary

mRNAs (Bonnet et al., 2006; Zhang et al., 2006). The RNAi technique is

currently being applied for the efficient production of down-regulated or knock-

out plants (Wesley et al., 2001), e.g. in genetic transformation of Betula pendula

for achieving sterility (Lannenpaa, 2005).

Plants are genetically engineered by introducing gene(s) into plant cells that are

growing in vitro or ex vitro. The development of transgenic plants is based on the

stable insertion of foreign DNA into the plant genome, regeneration of these

transformants to produce the whole plant and expression of the introduced

gene(s). Agrobacterium-mediated transformation has provided a reliable means of

producing transgenics in a wide variety of plant species that can be cultured and

regenerated in vitro. Recently, some plants such as Arabidopsis thaliana have also

been transformed by Agrobacterium-mediated transformation by dipping the

young buds of flowers of ex vitro grown plants (Rakoczy-Trojanowska, 2002).

This method is known as infiltration or, in general, in planta transformation. Other

methods of gene-transfer systems include particle bombardment, electroporation

and membrane permeabilization using chemicals. Of these, particle bombardment

has proved to be successful with plants that are less sensitive to Agrobacterium

infection, such as cereals and legumes (Walden & Wingender , 1995). However,

recently, Agrobacterium-mediated transformation has become the method of

choice for these plants (Nadolska-Orcyzyk, Orczyk & Przetakiewicz, 2000). The

development and optimization of several regeneration protocols, efficient vector

constructs and availability of defined selectable marker genes and different

methods of transformation have resulted in the production of transgenic plants in

more than 100 plant species (Babu et al., 2003; Wimmer, 2003). These transgenic

plants include many important crops, fruits and forest plants. The plant

transformation technology is not only used to improve plants but also a versatile

platform for studying gene function in plants. Plant genetic transformation

technology has a great potential in increasing productivity through enhancing

resistance to diseases, pests and environmental stresses and by qualitative changes

such as chemical composition of the plants. Plants can also be used for high



volume production of pharmaceuticals, nutraceuticals and other beneficial

chemicals. Transgenic plants might be used as drug delivery devices, with

vaccines being synthesised in plants (Hansen & Wright, 1999). Many plant

species previously considered to be recalcitrant to transformation, with advances

in tissue culture combined with improvements in transformation technology, have

now been transformed.

5.1.1. Agrobacterium mediated plant transformation

The natural ability of the soil microorganism Agrobacterium to transform plants is

exploited in the Agrobacterium-mediated transformation method. During infection

process, a specific segment of the plasmid vector, T-DNA, is transferred from the

bacterium to the host plant cells and integrates into the nuclear genome.

5.1.2. Biology and life cycle of Agrobacterium tumefaciens

Agrobacterium tumefaciens is a gram negative soil inhabiting bacteria that causes

crown gall disease in a wide range of dicotyledonous plants, especially in

members of the rose family such as apple, pear, peach, cherry, almond, raspberry

and roses. The strain, biovar 3, causes crown gall of grapevine. Although this

disease reduces the marketability of nursery stock, it usually does not cause

serious damage to older plants. Agrobacterium infection was first described by

Smith and Townsend in 1907. The bacterium transfers part of its DNA to the

plant, and this DNA integrates into the plant’s genome, causing the production of

tumors and associated changes in plant metabolism. The unique mode of action of

A. tumefaciens has enabled this bacterium to be used as a tool in plant

transformation. Desired genes, such as insecticidal or fungicidal toxin genes or

herbicide-resistance genes, can be engineered into the bacterial T-DNA and

thereby inserted into a plant. The use of Agrobacterium allows entirely new genes

to be engineered into crop plants. Agrobacterium-mediated gene transfer is known

to be a method of choice for the production of transgenic plants with a low copy

number of introduced genes (Hiei et al., 1997).



5.1.3. Infection process

Agrobacterium tumefaciens infects the plants through wounds, either naturally

occurring or caused by transplanting of seedlings and nursery stock. In natural

conditions, the motile cells of A. tumefaciens are attracted to wound sites by

chemotaxis. This is partly a response to the release of sugars and other common

root components. Strains that contain the Ti plasmid respond more strongly,

because they recognise wound phenolic compounds like acetosyringone even at

very low concentrations (10-7 M). Acetosyringone plays a further role in the

infection process by activating the virulence genes (Vir genes) on the Ti plasmid

at higher concentrations (10-5 to 10-4 M). These genes coordinate the infection

process. It is important to note that only a small part of the plasmid (T-DNA)

enters the plant and the rest of the plasmid remains in the bacterium to serve

further roles. When integrated into the plant genome, the genes on the T-DNA

code for auxins, cytokinins and synthesis and release of novel plant metabolites

(opines and agrocinopines).

These plant hormones upset the normal balance of cell division leading to the

production of galls. Opines are unique aminoacid derivatives and the

agrocinopines are unique phosphorylated sugar derivatives. All these compounds

can be used by the bacterium as the sole carbon and energy source.

5.1.4. Markers for Plant Transformation

5.1.4.1. Selectable markers

Genes conferring resistance to antibiotics like neomycin phosphotransferase II

(nptII) (Baribault et al., 1989), hygromycin phosphotransferase (hpt) (Le Gall et

al., 1994), phosphinothricin acetyl transferase / bialaphos resistance (pat/bar)

(Perl et al., 1996) are being used to select transgenic cells. Another selectable

marker gene, phosphomanoisomerase(pmi), which catalyzes mannose-6-

phosphate to fructose-6-phosphate, an intermediate of glycolysis that positively

supports growth of transformed cells, is also recently being used. Mannose

absorbed by the plant cells converts into mannose-6- phosphate, an inhibitor of

glycolysis, inhibits growth and development of nontransformed cells.

Transformed cells having PMI gene can utilize mannose as a carbon source.



5.1.4.2. Screenable markers

The oncogenes of Agrobacterium are replaced by reporter / screenable marker

genes like β-glucuronidase gene (gus) (Baribault et al., 1990), luciferase (luc)

gene for analyzing gene expression. Since the first demonstration of the green

fluorescent protein (gfp) gene from jellyfish Aequorea victiria as a marker gene

(Chalfie et al., 1994), gfp has attracted increasing interest and is considered

advantageous over other visual marker genes. Unlike other reporter proteins, GFP

expression can be monitored in living cells and tissues in a non-destructive

manner. This gene has been used as a visible reporter gene in genetic

transformation of both monocots and dicots (Haseloff et al., 1997; Reichel et al.,

1996; Kaeppler and Carlson, 2000). The fluorescence emission of GFP only

requires the excitation of living cells by UV or blue light (390 nm strong

absorption and 470 nm week absorption), which results from an internal p-

hydroxybenzylideneimidazolinine fluorophore generated by an autocatalytic

cyclization and oxidation of a ser-gly sequence at aminoacid residues. The other

advantage of gfp as a reporter gene is that no exogenously supplied substrate/

cofactors are needed for its fluorescence emission at 508 nm.

Red Fluorescent Protein marker (DsRed2, a mutant form of DsRed from

Discosoma sp.) was first used as a visual reporter gene for transient expression

and stable transformation of soybean (Nishizawa et al., 2006). DsRed2

fluorescence can be monitored with any fluorescence stereomicroscope equipped

with a filter set for excitation at 530–560 nm and emission at 590–650 nm.

5.1.5. Genetic Transformation of Plants with 4CL Gene(s)

Genetic and biochemical functions of 4-Coumarate Coenzyme A ligase (4CL)

genes have been clearly demonstrated in association with monolignol biosynthesis

(Lewis and Yamamoto, 1990; Lee et al., 1997; Hu et al., 1998, 1999; Harding et

al., 2002). As it provides precursor molecule for lignin biosynthesis pathway thus

directly regulate the total carbon flow towards the pathway to regulate the total

monolignols biosynthesis. Genetic manipulation of 4CL could be a promising

strategy for reducing lignin content to improve wood-pulp production efficiency.

Some of the most drastic changes in lignin quantity have been seen in transgenic



trees with modified expression of the 4CL (4-coumarate: coenzyme A ligase).

Transgenic plants with reduced 4CL activity have been produced in tobacco

(Kajita et al., 1996, 1997), Arabidopsis (Lee et al., 1997), and aspen (Hu et al.,

1999; Li et al., 2003). In tobacco, reduction of 4CL by over 90% resulted in 25%

less lignin. In poplar and Arabidopsis with a >90% reduced 4CL activity, lignin

content was reduced by 45–50%. In tobacco, the low 4CL activity was associated

with browning of the xylem tissue (Kajita et al., 1996). The monomeric

composition of lignin was altered and characterized by a 3-fold increase in the

amount of p-hydroxybenzaldehyde and an 80% and a 67% decrease in the amount

of syringaldehyde (Syr) and vanillin (Van), respectively, resulting in a 40%

reduction in the Syr/Van ratio (Kajita et al., 1997). The amount of the ester- and

ether-linked p-coumaric, ferulic, and sinapic acids increased dramatically in the

brown xylem tissue (as determined by alkaline hydrolysis of the cell walls

followed by gas chromatography and NMR of milled wood lignin). In contrast, in

transgenic Arabidopsis, the Sy/V (Sy is the sum of syringaldehyde and syringic

acid and V is the sum of vanillin and vanillic acid) ratio was increased because of

a 40% reduction in the amount of V units, suggesting that 4CL is required for the

synthesis of G, but not S units, as postulated (Lee et al., 1997; and Hu et al.,

1998). In transgenic aspen down-regulated for 4CL, Hu et al. (1999) also detected

an increase in nonlignin alkali-extractable wall-bound phenolics (p-coumaric acid,

caffeic acid, and sinapic acid), and showed by NMR that these acids were not

incorporated into the lignin polymer. However, they did not detect any difference

in lignin S/G composition using thioacidolysisi, in contrast to the data obtained for

Arabidopsis and tobacco. Another discrepancy between the results published by

Kajita et al., (1997) and Hu et al., (1999) is that the transgenic tobacco lines with

the most severe reduction in lignin content (25%) were characterized by a collapse

of vessel cell walls and reduced growth (Kajita et al., 1997), whereas the

transgenic poplars with a 45% reduction in lignin content had a normal cell

morphology and a higher growth rate than the control (Hu et al., 1999). However,

the increased growth was probably due to pleiotropic effects caused by the

constitutive down-regulation of 4CL governed by the CaMV35S promoter,

because it was not observed in the transgenic aspen reported by Li et al., (2003),

in which the antisense Pt4CL was under the control of an aspen xylem-specific



promoter, Pt4CL1P. The increased level of hydroxycinnamic acids as non-lignin

cell wall constituents has been suggested to contribute to the cell wall strength in

transgenic poplar (Hu et al., 1999). Because several 4CL isozymes exist with

different cell-specific expression, down-regulation of several or all isozymes

simultaneously may perturb metabolite levels other than those involved in lignin,

with a secondary effect on growth as a consequence. Interestingly, antisense

inhibition of 4CL in aspen trees led to a 15% increase in cellulose content. These

results suggest that lignin and cellulose deposition are regulated in a

compensatory fashion and that a reduced carbon flow toward phenylpropanoid

biosynthesis increases the availability of carbon for cellulose biosynthesis (Hu et

al., 1999; Li et al., 2003). A combinatorial down-regulation of 4CL along with an

overexpression of F5H in xylem has been achieved by co-transformation of two

Agrobacterium strains in aspen (Li et al., 2003). Additive effects of independent

transformation were observed, in particular a 52% reduction in lignin content

associated with a proportional increase in cellulose and a higher S/G ratio. These

results show that stacking transgenes allows several beneficial traits to be

improved in a single transformation step (Halpin & Boerjan, 2003).

In the present study antisense construct of the partial fragment of Ll4CL1 gene

was transferred in to model plant system Nicotiana tobacum and Leucaena

leucocephala. Transfromants were analyzed using PCR, GUS assay and slot blot.

5.2. Materials and methods

5.2.1. Explant

Leaf discs of Tobacco (N. tabaccum var. Anand 119) were used as the ex plant for

the Agrobacterium-mediated transformation. Seeds of Leucaena, imbibed in

distilled water after the treatment with conc. sulphuric acid (7 min) and mercuric

chloride (0.1 % for 10 min), were used as source of embryo axes. Embryo axes

excised from the seeds and inoculated on regeneration medium (half strength MS+

TDZ (0.5 mg/L)) were used as the target material for the Agrobacterium-mediated

transformation and particle bombardment mediated transformation.



5.2.2. Agrobacterium strain and plasmids

Agrobacterium tumefaciens strain GV2260 was used. The strain carried plasmid

pCAMBIA1301, a binary vector harboring partial Ll4CL1 gene in antisense

orientation under the control of a constitutive promoter CaMV35S and a plant and

bacterial selectable marker gene ‘hygromycin phosphotransferase (hpt)’

responsible for hygromycin resistance in T-DNA region.

5.2.3. Construction of the vector

The Ll4CL1 gene has internal site for KpnI and SacI, thus Ll4CL1 was double

digested using these two enzymes. The released fragment was eluted from agarose

gel and was cloned in KpnI and SacI digested pCAMBIA 1300 MCS (Fig. 5.1).

The right and left hand T-border of pCAMBIA1300 vector harbours the

hygromycin gene (selectable marker) and multiple cloning sites. This vector does

not have any reporter gene thus the transformants using this vector can not be

analyzed by reporter gene. Selection of the transformants can not be done at the

beginning of the transformation and failure of the experiment would be noticed at

later stage. To avoid these short comings, pCAMBIA1301 vector was used for

transformation. The right and left hand T-border of pCAMBIA1301 vector

harbours the hygromycin gene (selectable marker), multiple cloning sites and

GUS (reporter gene) with axon and introns. The MCS of pCAMBIA1301 does not

have any promoter and terminator to drive and stop the gene respectively. EcoRI

and HindIII restriction site are present either site of MCS of pCAMBIA1301 and

same sites are also there in pCAMBIA1300 just before the 35S promoter and after

the nos terminator, thus pCAMBIA1300 was double digested using EcoRI and

HindIII enzymes. The digested cassette was eluted from agarose gel and cloned in

EcoRI and HindIII digested pCAMBIA1301 vector (Fig. 5.2).

(a) Ll4CL1 gene

Sac I 1.1Kb Kpn I



(b) MCS of pCAMBIA 1300

EcoRI 35S Kpn I Sac I Nos T HindIII

(c) Vector map of pCAMBIA 1300

Fig:5.1 Topographical representation of (a) Full length Ll4CL1 gene with restriction sites, (b) MCS of pCAMBIA1300 along with 35S promoter and Nos terminator, (c) Vector map of pCAMBIA 1300.

(a) MCS of pCAMBIA1301

EcoR I HindIII

(b) Cassette in pCAMBIA1300

EcoRI 35S Kpn I Ll4CL1(Partial) Sac I Nos T HindIII



(c) Constructed vector map of pCAMBIA1301

Fig 5.2: Topographical representation of (a) MCS of pCAMBIA1301 without 35S promoter and Nos terminator (b) Cassette of pCAMBIA1300 harbouring 35S promoter, Partial antisense Ll4CL1 gene and Nos terminator, (c) Constructed vector map of pCAMBIA1301.

The constructed vector was transferred in to E.coli for multiplication and the

integration of gene in to the vector was further confirmed by Kpn I and Sac I

digestion of the constructed vector (Fig: 5.3).

1 2 3 4 M

Fig: 5.3: KpnI/SacI digested 1.0 kb fragment of Ll4CL1 gene from pCAMBIA1301 vector. Lane M: 1 Kb Ladder, Lane-1& 2: Kpn I/ Sac I digested 1.1 Kb cloned fragment of Ll4CL1 gene. Lane 3: KpnI digested constructed vector, Lane 4: SacI digested constructed vector.

3.0 Kb 2.0 Kb 1.5 Kb 1.0 Kb

11.0 Kb 10.0

1.0 Kb



5.2.4. Agrobacterium tumefaciens transformation

A. tumefaciens GV2260 was transformed with the pCAMBIA1301 vectors

harboring 5’ 35SPro-AntiLl4CL1- NOS 3’ cassette (Chapter 2; section 2.9.5).

5.2.5. Agrobacterium mediated transformation of tobacco

Tobacco plants were transformed independently using the above A. tumefaciens

cultures, harboring the 5’ 35SPro-AntiLl4CL1- NOS 3’ cassette vectors (Chapter

2; section 2.17).

5.2.6. Genomic DNA extraction and polymerase chain reaction

Genomic DNA was extracted from plant leaves and PCR reactions set up as

described earlier (Chapter 2; section 2.10.3 and 2.10.12.3).

5.2.7. GUS histochemical assay

GUS histochemical assay (Chapter 2; section 2.19) was performed on bombarded

embryo axes of L. leucocephala, leaves of putative transformants selected on

hygromycin and Agrobacterium mediated transformed Nicotiana leaves.

5.3. Results and discussion

In a preliminary study conducted to find out the optimum concentration of cefotaxime

for the control of Agrobacterium contamination after co-cultivation, it was observed

that cefotaxime at a minimum concentration of 250 mg/l could control the growth of

Agrobacterium completely. Cell density of the Agrobacterium strain carrying 5’

35SPro-AntiLl4CL1- NOS 3’ plotted against time showed a typical growth with lag

phase up to 4 h followed by log phase up to 16 h with intense cell division. After this,

the curve became stationary and later started declining indicating mortality of the

bacterium as per the growth curve, Agrobacterium culture during the log phase (4–16

h old) was used for transformation studies.

5.3.1. Antibiotic sensitivity

In hygromycin free treatment, freshly excised embryo axes from Leucaena seeds

showed normal proliferation, growth and germination (Fig: 5.4 a). There was a

gradual increase in necrosis of the embryo axis with the increase in hygromycin



concentration from 2 to 40mg/L. LD50 for hygromycin was observed at a

concentration 10 mg/L showing necrosis and death of the 50% of the inoculated

embryos(Fig: 5.4 b). Complete necrosis and mortality (100%) was observed at a

minimum concentration of 15 mg/L. Explants showing callusing, germination and

further proliferation became brownish and necrotic at later stages in most of the

hygromycin treatments.

In case of tobacco, LD50 for hygromycin was observed at a concentration 3 mg/L

showing necrosis and death of the 50% of the inoculated tobacco leaves.

Complete necrosis and mortality (100%) was observed for tobacco at a minimum

concentration of 5 mg/L.

a b

Fig: 5.4. Antibiotic sensitivity of embryo axes of L. leucocephala. (a) Embryo

axes cultured in hygromycin (0 mg/l) (b) embryo axes cultured in hygromycin (10

μg /ml).

5.3.2. Tobacco transformation

Tobacco (N. tabaccum var. Anand 119) leaf discs were transformed separately

with A. tumefaciens cultures harboring the partial Ll4CL1 gene in antisense

orientation along with 35S promoter and Nos terminator in pCAMBIA1301

vector. Shoots induction started after 2 weeks under selection pressure

(Hygromycin 3 mg/L) from the cut surface of the leaf disc and shoot (Fig. 5.5 a).

Proliferation of induced shoot started and noticed after 4 week (Fig. 5.5 b,c). The

regenerants were allowed to grow for 12 weeks and then shifted to root induction



medium. Roots were initiated within 2 weeks of shifting (Fig. 5.5 d). The

transformed plants were kept for hardening with continuous supply of light for

four weeks (Fig. 5.5 e) and then transferred to pots (Fig. 5.5 f).

5.3.3. Integration of antiLl4CL1 gene, and GUS in tobacco genome

The putative transformed plants were further analyzed for integration of the gene.

The first step to analyze the plants was the GUS assay, GUS assay was performed

using tender leaves taken from the non transformed and transformed plant. Non

transformed plants were taken as control plant. Blue color (Fig 5.6, b) was

observed in most of the transformed leaves of the tobacco plant and no color was

observed in non-transformed leaves (Fig 5.6, a).The transformed plant were

compared with the non transformed plant after 8 week of transfer into the green

house and following differences were observed.

• Transformed plants were more clustered (Fig 5.6 d) as compared to normal

tobacco palnt (Fig 5.6 c).

• The leaves were wider (17cm) and lengthier (40cm) in transformed plant

(Fig 5.6 f) as compared to non transformed plant (9cm & 30cm Fig 5.6 e).

• Stunted growth was observed in transformed plant when compared with

non transformed plant (Fig 5.6 i). Internodal distance was 1/3rd in

transformed plant (Fig 5.5 h) as compared to non transformed plant (Fig

5.6 g).

5.3.3.1. Analysis of integration of gene in transgenic tobacco through PCR

The right and left hand border of pCAMBIA1301 harbours 35 S promoter, a part

of Ll4CL1 gene in antisense orientation, hygromycin gene and GUS gene. If the

tobacco plants were transformed then these genes would have been integrated

somewhere in to the tobacco genome. To authenticate the transformed tobacco

plant we exploited this integration of different genes in the tobacco genome

through PCR.



d

f

e

c

b

a

Fig 5.5: Putative transformed tobacco shoots regenerated in vitro on selection medium. Shoot bud induction after 2 weeks (a), proliferation of shoot bud (b), shoots after 8 weeks (c), shoots transferred to root inducing media (d), regenerated plant kept for hardening (e) and transferred plant in green house (f).



d

e

c

b

f

a

(Cont.) (next page)



g

h

i

Fig 5.6: Comparision of transgenic tobacco plant with control tobacco plant. GUS assay of non transformed leaves (a) and transformed leaves (b), view of non transformed(c) and transformed (d) plant from top, leaf of non transformed (e) and transformed (f), non transformed (g) and transformed (h) tobacco plant. Normal grown (i) non transformed (Tall plant) and transformed plant (stunted growth).

5.3.3.1.1. Integration of hygromycin gene in transgenic tobacco genome

Genomic DNA was isolated from nontransformed control Nicotiana plant and

from several transformation events of antiLL4CL1 tobacco plants. Approximately

50ng gDNA was used as template for PCR based amplification of the hygromycin

gene using gene specific forward (HygAF) and reverse (HygAR) primers. Forward primer HygAF 5’ATTTGTGTACGCCCGACAGT 3’ Reverse primer HygAR 5’GGCGAAGAATCTCGTGCTTTC 3’

A fragment of ~800bp was amplified using genomic DNA as templates. There

was no amplification from the nontransformed tobacco plant (Figure 5.7). The

amplicons were gel eluted, cloned in pGEM-T Easy vector and sequenced. The

nucleotide sequence of the amplicons was confirmed to be same as that of the

hygromycin gene.



1 2 3 4 5 C N Nt M

0.8 Kb

3.0 Kb 1.0 Kb 0.75 K0.50 K

b b

Fig 5.7: PCR amplification of hygromycin gene from transformed tobacco plant. Lane 1, 2, 3, 4 & 5 PCR amplified 0.8 Kb hygromycing gene from transgenic plant (Tobacco). Lane C Positive control using constructed pCAMBIA1301 vector. Lane N non transformed plant. Lane Nt No template control. M 1 Kb ladder

5.3.3.1.2. Integration of 35S promoter region in transgenic tobacco genome

PCR amplifications from the genomic DNA of the transformation events

antiLl4CL1 with 35S forward and 35S reverse primer of 35S promoter.

35SF 5’ ACAGTCTCAGAAGACCAAAGGGCT 3’ 35SR 5’ AGTGGGATTGTGCGTCATCCCTTA 3’

A fragment of ~ 0.30 kb was amplified from the genomic DNA used as templates.

There was no amplification from the untransformed tobacco plant (Figure 5.8).

The amplicons were gel eluted, cloned in pGEM-T Easy vector and sequenced.

The nucleotide sequence of the amplicons was confirmed to be that of 35S

promoter.

M 1 2 3 4 5 6 7 8 9 M N Nt

Fig 5.8: PCR amplification of 0.30 Kb of 35S promoter using 35SF and 35SR from transgenic tobacco plant. Lane 1 – 9: PCR amplified 0.30 Kb 35S promoter region from transgenic Plant (tobacco), Lane M: 100 bp ladder, Lane N: non transformed plant, Lane Nt: No template control.

1.0 Kb 0.5 Kb 0.3 Kb 0.1 Kb

0.30 Kb



5.3.3.1.3. Integration of Ll4CL1 gene in antisense orientation in transgenic

tobacco genome


antiLl4CL1 with forward primer of 35S promoter and forward primer from the

mid region of Ll4CL1 gene sequences (this forward primer from LL4CL1 gene

was used as reverse primer as the Ll4CL1 gene was in antisense orientation).

35SF 5’ ACAGTCTCAGAAGACCAAAGGGCT 3’ Lec5F 5’ GGATTTCGCTGACAAACGTGG 3’


There was no amplification from the non transformed (N) tobacco plant (Figure

5.9). The amplicons were gel eluted, cloned in pGEM-T Easy vector and

sequenced. The nucleotide sequence of the amplicons was confirmed to be that of

35S promoter and a part of Ll4CL1 gene.

.

3.0 Kb 2.0 Kb 1.0 Kb 1.2 Kb

M 1 2 3 4 5 C N Nt M

Fig 5.9: PCR amplification of 1.2 Kb 35S promoter and a part of Ll4CL1 gene from transgenic plant (Tobacco). Lane 1, 2, 3, 4 & 5: PCR amplified 1.2 Kb 35S promoter and a part of Ll4CL1 gene from transgenic plant (tobacco), Lane C: Positive control using constructed pCAMBIA1301 vector, Lane N: Non transformed plant, Lane Nt: No template control, Lane M: 1 Kb ladder.

5.3.3.2. Analysis of integration of gene in transgenic tobacco through slot blot

The right and left hand border of pCAMBIA1301 harbours 35 S promoters, a part

of Ll4CL1 gene in antisense orientation, hygromycin gene and GUS gene. Thus

except Ll4CL1 gene other nucleotides could be used as probe to analyze the

transgenic plant. Slot blot was done using various transgenic events of tobacco



and a non transformed plant (Fig 5.10). Blot was hybridized using hygromycin

gene. Very profound signals were observed in four transgenic events out of seven

and very low signals were observed in rest of blotted transgenic gDNA. No signal

was observed in non transformant tobacco plant. The difference in the signal

intensity in different transgenic events may be due to the presence of different

copy numbers of genes.

5 6 7 N

1 2 3 4

Fig 5.10: Slot blots analysis of transgenic Tobacco. Lane 1-7: +ve signal of gDNA of transgenic tobacco blotted on membrane. Lane N: No signal of gDNA of non transgenic tobacco.

5.3.4. Transformation of Leucaena leucocephala

One day old embryo axes without cotyledons were used as explants for

transformation. Seeds of Leucaena, imbibed in distilled water after the treatment

with conc. sulphuric acid (7 min) and mercuric chloride (0.1% for 10 min), and

were used as source of embryo axes. Embryo axes excised from the seeds and

inoculated on regeneration medium (1/2 MS + TDZ (0.5 mg/ L)). The embryos

were then used for transformation.

The transformation was carried out by three methods:

1) Particle bombardment

2) Particle bombardment followed by co-cultivation

3) Agro-infusion method

The method was described in detail in chapter 2, section 2.18.

5.3.4.1. Selection of transformed plant on hygromycin

The non transformed and transformed embryo axes (Particle bombardment /

Particle bombardment followed by co-cultivation /Agro-infusion) were kept on

plane 1/2 MS + TDZ (0.5 mg/L) regeneration medium for one week. Then the



embryo axes were shifted to selection medium containing Hygromycin (10 mg/L)

for 3 weeks. Transformed embryo axes were survived on selection medium

(Hygromycin (10 mg/L)) while non transformed embryo axes turn black on

selection medium (Fig 5.11). The survived embryo axes on hygromycin (10 mg/L)

were further selected on hygromycin 15 mg/L for another 3 weeks. The survived

explants on hygromycin (15 mg/L) were shifted to half strength MS without

hygromycin selection. Cytokinin 2ip (2-isopentenyl adenine @ 0.5 mg/L) was

used in the medium to have better elongation of transformed shoots.

a b

Fig 5.11: Antibiotic sensitivity of embryo axes of L. leucocephala. (a) Transformed embryo axes cultured in hygromycin (10 μg/mL) (b) Non transformed embryo axes cultured in hygromycin (10 μg/mL).

The putative transformed plants were further analyzed using molecular tools to

confirm the integration of the gene. The first step to analyze the plant was the

GUS assay. It was performed using transformed embryo axes and non transformed

embryo axes. Blue color (Fig 5.12: a, b & c) spots were observed in most of the

transformed embryo axes of Leucaena and no color was observed in non-

transformed embryo axes. The transformed embryo axes were selected on

hygromycin 10mg/L after one week of transformation. Necrosis was observed just

after ten day of transfer and the embryo axes started sprouting (Fig 5.12 d). The

sprouted embryo axes were transferred to further selection on hygromycin

(15mg/L) after three weeks (Fig 5.12, e). The survived explants on hygromycin

(15 mg/L) were further elongated till two weeks (Fig 5.12, f) and then further

branching started (Fig 5.12, g). The survived explants on hygromycin (15 mg/L)

were further shifted to half strength MS without hygromycin selection. Cytokinin



2IP (2-isopentenyl adenine, 0.5 mg/L) was used in the medium to have better

elongation of transformed shoots (Fig 5.12, h & i). The plants were kept in

Cytokinin 2IP medium for 6-8 week and then transferred to root inducing media

(Chapter2: section 2.6.9, Fig 5.13, a). The elongated plants were transfer for

hardening (Fig 5.13, b) and later transferred to pots (Fig 5.14).

d

b c

f

a

d

g i h

e

Fig 5.12: Putative transformed Leucaena shoots regenerated in vitro on selection medium. Transient GUS expression on bombarded embryo axes (a,b and c), Transformed embryo axes on selection medium after two weeks (d), five weeks (e),eight weeks (f), twelve weeks (g), regenerated plant on nutrient media (h & i).



i

a b

Fig 5.13: a) regenerated plant on root inducing media and b) Hardening of

transformed and regenerated Leucaena plant.

a b

Fig 5.14: Transformed Leucaena plant in pots (a & b).



5.3.5. Integration of antiLl4CL1 gene and GUS in Leucaena genome


of Ll4CL1 gene in antisense orientation, hygromycin and GUS gene. So if the

plant were transformed then these genes would have been integrated somewhere

in the Leucaena genome. To authenticate the transformed Leucaena plant we

exploited this integration of different gene in to the Leucaena genome through

PCR.

5.3.5.1. Integration of hygromycin gene in transgenic Leucaena genome

Genomic DNA was isolated from nontransformed control Leucaena plant and

from the several transformation events of antiLL4CL1 plants. Approximately

50ng gDNA was used as template for PCR based amplification of the hygromycin

gene using gene specific forward (HygAF) and reverse (HygAR) primers.

Forward primer HygAF 5’ATTTGTGTACGCCCGACAGT 3’ Reverse primer HygAR 5’-GGCGAAGAATCTCGTGCTTTC-3’

A fragment of ~800bp was amplified from the genomic DNA used as templates.

There was no amplification from the non transformed control Leucaena plant

(Figure 5.15). The amplicons were gel eluted, cloned in pGEM-T Easy vector and

sequenced. The nucleotide sequences were aligning with the hygromycin gene

sequences of pCAMBIA1301 using CLUSTAL W (1.8) multiple sequence

alignment and it shows almost 100% match with hygromycin gene (Fig 5.16).

M 1 2 3 4 5 6 C

Fig 5.15: PCR amplification of hygromycin gene from transformed Leucaena plant. Lane 1, 2, 3, 4, 5 & 6: PCR amplified 0.8 Kb hygromycin gene from transgenic plant (Leucaena), Lane C: Positive control using pCAMBIA vector, Lane M: 100 bp ladder.

0.8 Kb 0.9 Kb 0.7 Kb 0.5 Kb



CLUSTAL W (1.8) multiple sequence alignment pCam.1301.hyg CTATTTCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTCCACTATCGGCGAGTACTTC

Transgenicplant --------------------AGGTGGGGGGGCGTGGGTT--CACTATCGGCGAGTACTTC

*** ******* **** *******************

pCam.1301.hyg TACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTGTGTACGCCCGACAGT

Transgenicplant TACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTGTGTACGCCCGACAGT

************************************************************

pCam.1301.hyg CCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAA

Transgenicplant CCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAA

************************************************************

pCam.1301.hyg ATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCG

Transgenicplant ATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCG

************************************************************

pCam.1301.hyg GAGTCGTGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTC

Transgenicplant GAGTCGTGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTC

************************************************************

pCam.1301.hyg CATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGACCTCGTATTGGGAATCCCC

Transgenicplant CATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGACCTCGTATTGGGAATCCCC

************************************************************

pCam.1301.hyg GAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGCCATTGTCCGTCAGGACATT

Transgenicplant GAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGCCATTGTCCGTCAGGACATT

************************************************************

pCam.1301.hyg GTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAG

Transgenicplant GTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAG

************************************************************

pCam.1301.hyg CATCAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTG

Transgenicplant CATCAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTG

************************************************************

pCam.1301.hyg CCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTG

Transgenicplant CCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTG

************************************************************

pCam.1301.hyg ACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCTGGCTAAGATCGGCCGCAGC

Transgenicplant ACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCTGGCTAAGATCGGCCGCAGC

************************************************************

pCam.1301.hyg GATCGCATCCATAGCCTCCGCGACCGGTTGTAGAACAGCGGGCAGTTCGGTTTCAGGCAG

Transgenicplant GATCGCATCCATAGCCTCCGCGACCGGTTGTAGAACAGCGGGCAGTTCGGTTTCAGGCAG

************************************************************



pCam.1301.hyg GTCTTGCAACGTGACACCCTGTGCACGGCGGGAGATGCAATAGGTCAGGCTCTCGCTAAA

Transgenicplant GTCTTGCAACGTGACACCCTGTGAACGGCGGGAGATGCAATAGG-CAGGGGGGATCCAG-

*********************** ******************** **** * *

pCam.1301.hyg CTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCGATGCAAAGTGCCGATAAAC

Transgenicplant ------------------------------------------------------------

pCam.1301.hyg ATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCCGCAGGACATATCCACGCCC

Transgenicplant ------------------------------------------------------------

Fig 5.16: CLUSTAL W (1.8) multiple sequence alignment of Hygromycin gene shaded region shown are the sequence of forward primer.

5.3.5.2. Integration of 35S promoter region in transgenic Leucaena genome


antiLl4CL1 with 35S forward and 35S reverse primer of 35S promoter.

35SF 5’ ACAGTCTCAGAAGACCAAAGGGCT 3’ 35SR 5’ AGTGGGATTGTGCGTCATCCCTTA 3’



The amplicons were gel eluted, cloned in pGEM-T Easy vector and sequenced.

The nucleotide sequence of the amplicons was confirmed to be that of 35S

promoter. The nucleotide sequences were aligning with the 35S promoter of

pCAMBIA1301 using CLUSTAL W (1.8) multiple sequence alignment and it

shows almost 100% similar with 35S promoter sequences (Fig 5.18).

1 2 3 4 5 6 7 8 M 9 10 11 12 13 14 C 15 N

Fig 5.17: PCR amplification of 0.30 Kb of 35S promoter using 35SF and 35SR from transgenic Leucaena plant. Lane 1 – 15: PCR amplified 0.30 Kb 35S promoter region from transgenic Plant (Leucaena), Lane C: positive control, Lane M: 1 kb ladder, Lane N: 100 bp ladder.

1.0 Kb 0.6 Kb 0.4 Kb 0.30 Kb



CLUSTAL W (1.8) multiple sequence alignment pCAM130135Sprom ACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAAC pCAM35SF&R ACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAAC

************************************************************

pCAM130135Sprom CTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAA

pCAM35SF&R CTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAA

************************************************************

pCAM130135Sprom GGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT

pCAM35SF&R GGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT

************************************************************

pCAM130135Sprom GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGAC

pCAM35SF&R GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGAC

************************************************************

pCAM130135Sprom GTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGAT

pCAM35SF&R GTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGAT

************************************************************

pCAM130135Sprom GACGCACAATCCCACT

pCAM35SF&R GACGCACAATCCCACT

****************

Fig 5.18: CLUSTAL W (1.8) multiple sequence alignment of 35S promoter region. The shaded regions shown are the region of forward and reverse primer.

5.3.5.3. Integration of Ll4CL1 gene in antisense orientation in transgenic

Leucaena genome


antiLl4CL1 with forward primer of 35S promoter and forward primer from the

mid region of Ll4CL1 gene sequences (this forward primer from LL4CL1 gene

was used as reverse primer as the Ll4CL1 gene was in antisense orientation).

35SF 5’ ACAGTCTCAGAAGACCAAAGGGCT 3’ Lec5F 5’ GGATTTCGCTGACAAACGTGG 3’



The amplicon were gel eluted, cloned in pGEM-T Easy vector and sequenced. The

nucleotide sequence of the amplicons was confirmed to be that of 35S promoter

and a part of Ll4CL1 gene. The nucleotide sequences were aligning with the 35S



promoter of pCAMBIA1301 using CLUSTAL W (1.8) multiple sequence

alignment and it showed almost 100% similarity with 35S promoter and a part of

Ll4CL1 gene (Fig 5.20).

3. 1.1. 0.

0 Kb

5 Kb 0 Kb

5 Kb

1.2 Kb

M 1 2 3 4 5 6 7 N Nt C

Fig 5.19: PCR amplification of 1.2 Kb 35S promoter and a part of Ll4CL1 gene from transgenic Leucaena plant. Lane 1, 2, 3, 4, 5, 6 & 7: PCR amplified 1.2 Kb 35S promoter and a part of 4CL gene from transgenic plant (Leucaena), Lane C: Posiive conrol using pCAMBIA vecor, Lane N: non transformed plant, Lane Nt: No template control, Lane M: 1 Kb ladder. CLUSTAL W (1.8) multiple sequence alignment

anti4CLinpCAMBIA1301 ACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAAC

pCAMampli35SF&Lec5F ACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAAC

************************************************************

anti4CLinpCAMBIA1301 CTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAA

pCAMampli35SF&Lec5F CTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAA

************************************************************

anti4CLinpCAMBIA1301 GGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT

pCAMampli35SF&Lec5F GGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCT

************************************************************

anti4CLinpCAMBIA1301 GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGAC

pCAMampli35SF&Lec5F GCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGAC

************************************************************

anti4CLinpCAMBIA1301 GTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGAT

pCAMampli35SF&Lec5F GTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGAT

************************************************************



anti4CLinpCAMBIA1301 GACGCACAATCCCACTATCCTTTCGCAAGACCATCCCTCTATATAAGGAAGTTCATTTCA

pCAMampli35SF&Lec5F GACGCACAATCCCACTATCCTTTCGCAAGACCATCCCTCTATATAAGGAAGTTCATTTCA

************************************************************

anti4CLinpCAMBIA1301 TTTGGAGAGAACACGGGGGACTCTAGATCTGCAGTCGAGGTACCCTTTCATAACTTGATT

pCAMampli35SF&Lec5F TTTGGAGAGAACACGGGGGACTCTAGATCTGCAGTCGAGGTACCCTTTCATAACTTGATT

************************************************************

anti4CLinpCAMBIA1301 TCCTCTAATGCAGATTTCACCAGCCCTGTTTCTTGGAAGCGAAGCTCCCGTCTCAATGTC

pCAMampli35SF&Lec5F TCCTCTAATGCAGATTTCACCAGCCCTGTTTCTTGGAAGCGAAGCTCCCGTCTCAATGTC

************************************************************

anti4CLinpCAMBIA1301 AACAATCTTCATCTCTGCGTTTCTTATCACGCTCCCGCACGCGCCTGATTTCATCTCCAC

pCAMampli35SF&Lec5F AACAATCTTCATCTCTGCGTTTCTTATCACGCTCCCGCACGCGCCTGATTTCATCTCCAC

************************************************************

anti4CLinpCAMBIA1301 CGGCTCCTTCGCGAACGACAAGCTTATCGACAGAGGACCACCCTCCGTCATCCCATATCC

pCAMampli35SF&Lec5F CGGCTCCTTCGCGAACGACAAGCTTATCGACAGAGGACCACCCTCCGTCATCCCATATCC

************************************************************

anti4CLinpCAMBIA1301 CTGTCCAAGTATGGCGTGTGGAAGCTTAGCCCTCAGGGCTTGTTCCAGCTCCACGCTCAC

pCAMampli35SF&Lec5F CTGTCCAAGTATGGCGTGTGGAAGCTTAGCCCTCAGGGCTTGTTCCAGCTCCACGCTCAC

************************************************************

anti4CLinpCAMBIA1301 CGGCGCTGCTCCGGTGACGATCGTCCTTATGGACGACAGGTCGTGCCGGTCAACTTCCTC

pCAMampli35SF&Lec5F CGGCGCTGCTCCGGTGACGATCGTCCTTATGGACGACAGGTCGTGCCGGTCAACTTCCTC

************************************************************

anti4CLinpCAMBIA1301 ACTCTTCACGATGTTTAATAGGATCGGAGGCACAAACGACGCCATTGTCACCTTGTAAGT

pCAMampli35SF&Lec5F ACTCTTCACGATGTTTAATAGGATCGGAGGCACAAACGACGCCATTGTCACCTTGTAAGT

************************************************************

anti4CLinpCAMBIA1301 CTTGATCATCTTCAACAACGTGGCGATGTCGTACTTACCCATCGTCAGAATGGCGGCTCC

pCAMampli35SF&Lec5F CTTGATCATCTTCAACAACGTGGCGATGTCGTACTTACCCATCGTCAGAATGGCGGCTCC

************************************************************

anti4CLinpCAMBIA1301 GGCTCGGATGCAGCAGAGCAAAATGGAGTTCAGCGCATAGATATGGAACATTGGAAGAAC

pCAMampli35SF&Lec5F GGCTCGGATGCAGCAGAGCAAAATGGAGTTCAGCGCATAGATATGGAACATTGGAAGAAC

************************************************************

anti4CLinpCAMBIA1301 GCAGATATGTACGTCGTCGCTAGTGGTGTACTGGTTCGGGTTTTCGCCGTCGACGAGCTG

pCAMampli35SF&Lec5F GCAGATATGTACGTCGTCGCTAGTGGTGTACTGGTTCGGGTTTTCGCCGTCGACGAGCTG

************************************************************

anti4CLinpCAMBIA1301 AGCCACGGAGGTCACCAGATTCTTGTGCGTTAGCATCACGCCCTTGGGAAAGCCGGAGGT

pCAMampli35SF&Lec5F AGCCACGGAGGTCACCAGATTCTTGTGCGTTAGCATCACGCCCTTGGGAAAGCCGGAGGT

************************************************************



anti4CLinpCAMBIA1301 GCCGGAGGAATACGGCAGTGCCACAACGTCGTCGGGGCTGATCTTGACGGCCGGCATACA

pCAMampli35SF&Lec5F GCCGGAGGAATACGGCAGTGCCACAACGTCGTCGGGGCTGATCTTGACGGCCGGCATACA

************************************************************

anti4CLinpCAMBIA1301 AGCTTCGTCGGCTTGGGTGAGTAAAGAAAAATGTGAAATACCTTCCGTTTCTGGGAAAGT

pCAMampli35SF&Lec5F AGCTTCGTCGGCTTGGGTGAGTAAAGAAAAATGTGAAATACCTTCCGTTTCTGGGAAAGT

************************************************************

anti4CLinpCAMBIA1301 AGAATCAATGCACATCAAAGAAACGCCACGTTTGTCAGCGAAATCC

pCAMampli35SF&Lec5F AGAATCAATGCACATCAAAGAAACGCCACGTTTGTCAGCGAAATCC

**********************************************

Fig 5.20: CLUSTAL W (1.8) multiple sequence alignment of 35S promoter region. The shaded regions shown are the region of forward and reverse primer

5.3.6. Slot blot analysis of integration of gene in transgenic Leucaena


of Ll4CL1 gene in antisense orientation, hygromycin gene and GUS gene. Thus

except Ll4CL1 gene other nucleotides could be used as probe to analyze the

transgenic plant. Slot blot was done using various transgenic events of Leucaena

and a non transformed Leucaena plant (Fig 5.21). Genomic DNA was isolated

from 24 transgenic plants and approximately 200ng of DNA after treatment was

blotted on the membrane. Blot was hybridized using hygromycin gene. Very

profound signals were observed in all twenty four transgenic events. The positive

control and negative control was also blotted and there was no signal on negative

control non transformed Leucaena.

P 1 2 3 4 5 6 7 8 9 10 11 12

N 13 14 15 16 17 18 19 20 21 22 23 24

Fig 5.21: Slot blot analysis of transgenic Leucaena plant. Lane1-24: positive

signal of gDNA of transgenic Leucaena blotted on membrane, Lane P: Positive

signal with constructed pCAMBIA1301 vector, Lane N: Lane N: no signal with

the non transformed Leucaena control plant.




5.3.7. Total transformation event

The total 400 transgenic (Tab: 1) events were done with excised embryo axes of

Leucaena. 77.50% of plants (310) survived on selection medium. 51.25% of

plants (205) elongated on selection medium, 66.66% of plants were elongated

from the bombarded embryo axes. 46.19% of plants were elongated from the

bombarded and followed by co cultivation of embryo axes and 3.33% of

transformed plants were elongated from agro-infused embryo axes. The highest

transformation efficiency (64.39) was obtained with bombarded plant and lowest

efficiency was observed in agro infused (3.33%) embryo axes.


Table 5.1: Details of the number of embryo axes used for transformation studies and the PCR positives

Gene

4CL1

Method used Number

of

embryo

axes used

Number of

explants

survived on

selection (hyg

15 mg/L)

medium

Number

of shoots

elongated

Av.

Shoot

length

(cm)

Range

(cm)

Number of

shoots used

for DNA

extraction

and PCR

Number

of samples

shown

PCR

positive

Transformation

efficiency

confirmed

through PCR

(%)

Particle

bombardment

231 205

(88.75%)

154

(66.66%)

3.72 0.5-12.0 154 92

(39.83%)

59.74%

Particle

bombardment

+ Co

cultivation

109 83

(76.15%)

47

(45.19%)

3.41 1.5-7.0 47 38

(34.86%)

80.85%

Agro infusion 60 22

(36.67%)

04

(3.33%)

1.17 0.5-5.0 4 2

(3.33%)

50.00%

Total 400 310

(77.50%)

205

(51.25%)

205 132

(33.00%)

64.39%


Chapter 5 Transformation studies of Leucaena 5.4. Conclusion

• Approximately 1.0 kb fragment of Ll4CL1 was cloned in antisense

orientation in pCAMBIA1301.

• Agrobacterium tumefaciens strain GV2260 was transformed with the

constructed pCAMBIA1301 vector.

• Agrobacterium tumefaciens strain GV2260 was used to transform

tobacco. GUS assay were done to analyze transgenic events.

• Embryo axes of Leucaena were transformed by three different methods i.e.

particle bombardment, particle bombardment followed by co-cultivation

and agro-infusion method.

• Bombarded embryo axes were analyzed for transient GUS expression.

• Survived putative transformed plants were further grown on elongation

media followed by root induction media.

• Transgenic events were further confirmed by PCR using hygromycin gene

specific primer, 35S promoter specific primers and 35S forward and gene

specific forward primer.

• Integration of gene was further confirmed by slot blot using hygromycin

gene fragment as probe.

• Putative transformed embryo axes of the cultivars K-636 survived on

selection medium developed into plantlets, which were kept for hardening

and then transferred to green house for further growth.


ISOLATION CLONING AND CHARACTERIZATION OF LIGNIN...

Documents

Transcript of ISOLATION CLONING AND CHARACTERIZATION OF LIGNIN...