Isolation and Characterization of Two Novel PhosphodiesterasePDE11A Variants Showing Unique Structure and Tissue-specificExpression*

Received for publication, April 11, 2000, and in revised form, June 29, 2000Published, JBC Papers in Press, July 20, 2000, DOI 10.1074/jbc.M003041200

Keizo Yuasa, Jun Kotera, Kotomi Fujishige, Hideo Michibata, Takashi Sasaki, and Kenji Omori‡

From the Discovery Research Laboratory, Tanabe Seiyaku Co. Ltd., 2-50, Kawagishi-2-chome, Toda,Saitama 335-8505, Japan

cDNAs encoding a novel phosphodiesterase, phospho-diesterase 11A (PDE11A), were isolated by a combina-tion of reverse transcriptase-polymerase chain reactionusing degenerate oligonucleotide primers and rapid am-plification of cDNA ends. Their catalytic domain wasidentical to that of PDE11A1 (490 amino acids) reportedduring the course of this study. However, the cDNAs weisolated had N termini distinct from PDE11A1, indicat-ing two novel N-terminal variants of PDE11A. PDE11A3cDNA encoded a 684-amino acid protein including onecomplete and one incomplete GAF domain in the N-terminal region. PDE11A4 was composed of 934 aminoacids including two complete GAF domains and shared630 C-terminal amino acids with PDE11A3 but had adistinct N terminus containing the putative phosphoryl-ation sites for cAMP- and cGMP-dependent protein ki-nases. PDE11A3 transcripts were specifically expressedin testis, whereas PDE11A4 transcripts were particu-larly abundant in prostate. Recombinant PDE11A4 ex-pressed in COS-7 cells hydrolyzed cAMP and cGMP withKm values of 3.0 and 1.4 mM, respectively, and the Vmaxvalue with cAMP was almost twice that with cGMP.Although PDE11A3 showed the same Km values asPDE11A4, the relative Vmax values of PDE11A3 were ap-proximately one-sixth of those of PDE11A4. PDE11A4,but not PDE11A3, was phosphorylated by both cAMP-and cGMP-dependent protein kinases in vitro. Thus, thePDE11A gene undergoes tissue-specific alternativesplicing that generates structurally and functionallydistinct gene products.

Cyclic nucleotide phosphodiesterases (PDEs)1 metabolizecAMP and cGMP, which are second messengers regulatingmany functions in various cells and tissues. Based on theiramino acid sequence homology, biochemical properties, andinhibitor profiles, many kinds of PDEs have been identified inmammalian tissues (1–3). The PDE1 family is Ca21/calmodulin-

dependent and hydrolyzes both cAMP and cGMP. PDE2 isstimulated by cGMP and hydrolyzes cAMP and cGMP, whilePDE3 is cGMP-inhibited. The cAMP-specific and rolipram-sen-sitive PDEs belong to the PDE4 family. PDE5 is a cGMP-binding, cGMP-specific PDE. The photoreceptor cGMP PDEsare in the PDE6 family. PDE7 is cAMP-specific and rolipram-insensitive. PDE8 is a cAMP-specific PDE, and PDE9 is acGMP-specific PDE (3–8). Recently, we revealed a new memberof the PDE group, PDE10A, which hydrolyzes both cAMP andcGMP (9).

Some of these PDEs constitute subfamilies encoded by dis-tinct genes. In each PDE family, alternative splice variantshave been reported (1, 10, 11). In many cases, different geneproducts and alternative splice variants in each PDE familyshow different expression patterns in tissues and differentsubcellular localization (1, 12–22). PDEs encoded by alterna-tively spliced mRNAs have been reported to differ in theirregulation by some kinases including cAMP-dependent proteinkinase (cAK) and cGMP-dependent kinase (cGK) and associ-ated proteins (19, 23). Thus, cyclic nucleotide levels are con-trolled by a complex system.

Each PDE is involved in controlling cyclic nucleotide levelsand probably plays a distinct physiological role in differenttissues and cells. The hydrolysis of cyclic nucleotides is multi-ply controlled by PDEs co-existing in the same cells. Therefore,the finding and characterization of novel PDEs could lead tobetter understanding of the complex regulatory mechanisms ofcyclic nucleotide-mediated cellular functions. Novel PDEs mayalso be valuable as pharmacologically significant targets.cDNA cloning of PDE8s, PDE9A, and PDE10A was done by anapproach using bioinformatics (4–9). A search of data bases ofexpressed sequence tags was performed using parts of PDEsequences, such as the catalytic domain. The approach wasshown to be effective, but not always successful, for the cDNAcloning of a novel PDE. Only the sequences submitted in theexpressed sequence tag data bases could be cloned by thisprocedure. To isolate novel PDE cDNAs, which have not yetappeared in the expressed sequence tag data bases, we em-ployed an approach using PCR (polymerase chain reaction)with degenerate primers designed from a conserved sequencein the PDE catalytic domain and rapid amplification of cDNAends (RACE) for the isolation of full-length cDNAs. UniqueN-terminal splicing variants of human PDE11A were obtained,and their tissue-specific expression patterns were examined.The expression plasmids encoding two PDE11A variants weretransfected into COS-7 cells, and the enzymatic properties ofthe recombinant proteins were investigated in detail.

EXPERIMENTAL PROCEDURES

Materials—Restriction endonucleases, DNA-modifying enzymes, 59-Full RACE Core Set, and LA PCRy Kit version 2.1 were obtained from

* The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

The nucleotide sequence(s) reported in this paper has been submittedto the GenBankTM/EBI Data Bank with accession number(s) AB036704and AB038041.

‡ To whom correspondence should be addressed. Tel.: 81-48-433-8069; Fax: 81-48-433-8159; E-mail: k-omori@tanabe.co.jp.

1 The abbreviations used are: PDE, phosphodiesterase; PDE11A3,testis-specific type PDE11A; PDE11A4, prostate-specific type PDE11A;RACE, rapid amplification of cDNA ends; PCR, polymerase chain reac-tion; RT, reverse transcriptase; ORF, open reading frame; cAK, cAMP-dependent protein kinase; cGK, cGMP-dependent protein kinase; kb,kilobase pairs.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 275, No. 40, Issue of October 6, pp. 31469–31479, 2000© 2000 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org 31469

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Takara Shuzo (Kyoto, Japan). [a-32P]dCTP, [g-32P]ATP, [3H]cAMP,[3H]cGMP, and Hybond-N1 nylon membrane were from AmershamPharmacia Biotech. The mammalian expression vector pcDNA4/HisMaxwas purchased from Invitrogen. The GeneAmp RNA PCR Core kit wasa product of PE Biosystems. SMARTy RACE cDNA amplification kit;Marathon-Readyy cDNA (human prostate and testis); human multiple-tissue expression (MTEy) array; human multiple-tissue cDNA (MTCy)panels I and II; Advantage 2 Polymerase Mix; and human mRNAs fromtestis, thyroid, prostate, and hippocampus were purchased from CLON-TECH. Dipyridamole, 3-isobutyl-1-methylxanthine, erythro-9-(2-hy-droxy-3-nonyl)-adenine, and zaprinast were from Sigma. SCH51866,milrinone, rolipram, and E4021 were synthesized at Tanabe SeiyakuCo. Ltd., Japan.

Nucleotide Sequencing Analysis—The nucleotide sequence was de-termined by an automated DNA sequencer ABI PRISMy 310 and aBigDye terminator cycle sequencing reaction kit (PE Biosystems). Nu-cleotide and amino acid sequence data were analyzed by the computerprograms GENETYX (Software Development, Tokyo, Japan).

PCR Amplification of Novel PDE cDNAs with Degenerate Primers—Two degenerate, oppositely oriented oligonucleotide PCR primers weredesigned based on actual nucleic acid sequences deduced from the mostprobable codons for the amino acid sequences in two highly conservedcatalytic domains of a variety of PDEs (Fig. 1A). First-strand cDNA wasprepared from the human testis and hippocampus mRNAs according tothe instructions of the GeneAmp RNA PCR Core kit. PCR was carriedout through 30 cycles of denaturation at 94 °C for 30 s, annealing at55 °C for 30 s, and extension at 72 °C for 30 s. The PCR products werecloned into the TA cloning vector pGEM-T Easy (Promega), and thenucleotide sequences were then determined and compared with those ofPDEs previously reported.

59- and 39-RACE of the Novel PDE cDNA—59-RACE was performedusing 59-Full RACE Core Set and Marathon-Readyy cDNA (humanprostate and testis). First, PCR template was prepared with the humantestis mRNA, a specific antisense primer (59-CTGCTTCAAAAGCTG-39)designed from the nucleotide sequence of clone t21, and 59-Full RACECore Set. PCR was carried out using the LA PCR Kit and two primersets, 59-ATGATCCTTCAAAGTGAGGGTCAC-39 plus 59-GGTAGCAGA-GGTTCCATAGAGTTG-39 for first amplification and 59-GGTCACAAT-ATCTTTGCTAACCTG-39 plus 59-CTTAGCTTGGAAGGCATTGTTGG-T-39 for second amplification. The PCR products were cloned and de-termined for the nucleotide sequence as described above. Further 59-upstream regions were obtained using Marathon-Readyy cDNA (hu-man prostate and testis). For the amplification of the 59-region ofPDE11A3 (nucleotides 45–468), Marathon-Readyy cDNA (human tes-tis) and primer sets A (AP1 primer plus 59-GTCAGTCTGTTCTTCAAA-GAGGTC-39 for first amplification and AP2 primer plus 59-TGAG-GCAGCAAAGAGCTGAGCGTT-39 for second amplification) were used.For the cloning of further 59-upstream region (nucleotides 1–309 ofPDE11A3), primer sets B (AP1 primer plus 59-AGCGTTAGATATGGC-GATTCCACA-39 for first amplification and AP2 primer plus 59-TGTCT-TGTATCCAGTTAGCTTGTC-39 for second amplification) were em-ployed. For the amplification of the 59-region of PDE11A4 (nucleotides1–1524), Marathon-Readyy cDNA (human prostate) and primer sets(AP1 primer plus 59-TCTGACACCAGAGGGATGTTGGCT-39 for firstamplification and AP2 primer plus 59-GTCAGTCTGTTCTTCAAAGAG-GTC-39 for second amplification) were used.

39-RACE was performed using the SMARTy RACE cDNA Amplifi-cation kit with human thyroid mRNA according to the instructions.PCR was performed with 39-SMART cDNA, two primer sets (UPMprimer plus 59-ACCAACAATGCCTTCCAAGCTAAG-39 for first PCRand NUP primer plus 59-TTCCAAGCTAAGAGTGGCTCTGCC-39 forsecond PCR), and Advantage 2 Polymerase Mix. Finally, two splicevariants of PDE11A were obtained as shown in Fig. 1B.

In all RACE, reaction cycles were as follows: 94 °C for 1 min; fivecycles of 94 °C for 30 s, 72 °C for 3 min; five cycles of 94 °C for 30 s, 70 °Cfor 30 s, 72 °C for 3 min; and 25 cycles of 94 °C for 30 s, 68 °C for 30 s,72 °C for 3 min. The PCR products were cloned into pGEM-T Easy andsequenced.

Reverse Transcriptase (RT)-PCR Analyses—To detect the mRNAscoding for PDE11A3 and PDE11A4 in human testis and prostate, re-spectively, and to isolate the PCR error-free PDE11A cDNAs, RT-PCRwas performed. First strand cDNA was synthesized from human testisor prostate mRNAs using random hexamers at 42 °C for 60 min accord-ing to the manufacturer’s instructions for the Gene Amp RNA PCR Corekit. The cDNA synthesized from human testis mRNAs and the primerset (the 59-primer 59-GCGCTTGCAGCCCAGGGC-39 and 39-primer 59-TCAGGCTGTAGTCATTTTGCAGC-39 (covering nucleotides 1–2195 ofPDE11A3 cDNA)) were used for PCR of PDE11A3. The cDNA synthe-

sized from human prostate mRNAs and the primer set (the 59-primer59-TGGCGCTGAACTGGGAATACTGGTG-39 and 39-primer 59-TCAG-GCTGTAGTCATTTTGCAGC-39 (covering nucleotides 204–3164 ofPDE11A4 cDNA)) were used for PCR of PDE11A4. PCR was carried outwith conditions of denaturation at 94 °C for 30 s, annealing at 55 °C for30 s, and extension at 72 °C for 5 min. The amplified DNA fragment wascloned into pGEM-T Easy. Six independent PCR clones of PDE11A3 orPDE11A4 were sequenced to verify the correct cDNA sequence. One ofthe clones, pGEM-PDE11A3F or pGEM-PDE11A4F, was used for fur-ther experiments.

Northern Blot and Dot Blot Analyses—Human MTEy Array (CLON-TECH) and Gene Huntery (TOYOBO, Osaka, Japan) were hybridizedwith a 32P-labeled DNA probe prepared using cDNA encoding a com-mon region of PDE11As (nucleotides 1237–1801 of PDE11A4). Hybrid-ization and washing were performed as described previously (24). Themembranes were exposed to x-ray film at 280 °C for 3 days.

PCR and Southern Blot Analyses—To examine expression patternsof human PDE11A3 and PDE11A4 transcripts in human tissues, PCRwas performed using MTC panels (CLONTECH) as templates andAdvantage 2 Polymerase Mix. The cDNA fragments encoding PDE11A3(amino acid residues 21–272) were produced using the 59-primer 59-AAGGTGAAAATCACAAGACTGGTC-39 and the 39-primer 59-GTGGT-TGCTATTCCAAATAGGGAC-39. The cDNA fragments encoding hu-man PDE11A4 (amino acid residues 271–522) were produced using the59-primer 59-AGCACAGAGAACTCAAATGAGGTG-39 and the 39-primer 59-GTGGTTGCTATTCCAAATAGGGAC-39. PCR was carriedout through 32 or 27 cycles of denaturation at 95 °C for 30 s andextension at 68 °C for 1 min. The PCR products were subjected to 1.5%agarose gel electrophoresis, and the fractions were transferred ontoHybond-N1 nylon membrane. To confirm that PCR products werederived from human PDE11A transcripts, we detected both PCR prod-ucts by Southern blot analysis using a 32P-labeled DNA probe preparedfrom an oligonucleotide (TGTGGAATCGCCATATCTAACGCT) codingfor a common region of the human PDE11A cDNAs. Hybridization wasperformed in 63 SSC, 0.5% SDS, 53 Denhardt’s solution, 100 mg/mlsalmon sperm DNA, and the 32P-labeled probe at 55 °C for 2 h. All blotswere washed finally in 63 SSC and 0.5% SDS at 55 °C for 15 min. Themembranes were exposed to x-ray film at 280 °C for 1 day. All of thePCR reactions were performed under conditions in which each ampli-fication did not reach saturation.

Construction of Expression Plasmids—To generate an expressionplasmid of PDE11A3, PCR was performed using the 59-primer 59-GG-ATCCATGCTGAAGCAGGCAAG-39, the 39-primer 59-TTCATCATCTT-CAGTAAATGG-39 (covering amino acid residues 1–106 of PDE11A3),and pGEM-PDE11A3F as a template. The amplified cDNA fragmentwas cloned into pGEM-T Easy, resulting in pGEM-PDE11A3BM, andthen confirmed by sequencing. The SacI–EcoRV and EcoRV–SalI DNAfragments of pGEM-PDE11A3F, and the BamHI–SacI DNA fragmentof pGEM-PDE11A3BM were subcloned into the BamHI and XhoI sitesof pcDNA4/HisMax (pHis), resulting in pHis-PDE11A3. To generate amammalian expression plasmid of human PDE11A4, PCR was per-formed using the 59-primer 59-GGATCCATGGCAGCCTCC-39, the 39-primer 59-CCTTAGCTCTTTCTGAGAAGCTC-39 (covering amino acidresidues 1–122 of PDE11A4), and pGEM-PDE11A4F as a template. Theamplified DNA fragment was cloned into pGEM-T Easy, resulting inpGEM-PDE11A4BM, and then confirmed by sequencing. The KpnI–SalI DNA fragment of pGEM-PDE11A4F and the BamHI–KpnI DNAfragment of pGEM-PDE11A4BM were subcloned into the BamHI andXhoI sites of the mammalian expression vector, the pHis, resulting inpHis-PDE11A4.

Expression of Human PDE11A3 and PDE11A4 in COS-7 Cells—COS-7 cells were grown in Dulbecco’s modified Eagle’s medium (LifeTechnologies, Inc.) supplemented with 10% heat-inactivated fetal bo-vine serum, 100 units/ml penicillin, and 100 mg/ml streptomycin at37 °C with 5% CO2 and were serially passaged before reaching conflu-ence. The expression plasmid pHis-PDE11A3 or pHis-PDE11A4 wastransfected into COS-7 cells by LipofectAMINE PLUS (Life Technolo-gies, Inc.), according to the manufacturer’s instructions. 24 h aftertransfection, cells were washed with ice-cold phosphate-buffered salineand scraped in ice-cold homogenization buffer (40 mM Tris-HCl, pH 7.5,15 mM benzamidine, 5 mg/ml pepstatin A, and 5 mg/ml leupeptin). Thecell suspension was disrupted by a sonicator (TOMY Seiko, Japan) for15 s (three times with 1-min intervals), and the homogenates werecentrifuged at 100,000 3 g for 1 h. The resultant supernatant wasadded to a plastic tube containing nickel nitrilotriacetate resin (QIA-GEN), equilibrated with the homogenization buffer, and incubated byrotation at 4 °C for 4 h. The nickel nitrilotriacetate resin was pouredinto a plastic column (0.8 3 5 cm) and allowed to drain. The packed

Two Novel PDE11A Splice Variants31470

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

resin was washed with wash buffer (40 mM Tris-HCl, pH 7.5, 15 mM

benzamidine, 200 mM NaCl, 5 mM imidazole, 5 mg/ml pepstatin A, and5 mg/ml leupeptin), and the proteins were then eluted by elution buffer(40 mM Tris-HCl, pH 7.5, 15 mM benzamidine, 200 mM NaCl, 200 mM

imidazole, 5 mg/ml pepstatin A, and 5 mg/ml leupeptin). After PDEassay, the PDE11A fractions were diluted with glycerol at a finalconcentration of 50% and stored at 225 °C until use.

PDE and Protein Assays—The PDE assay was performed by theradiolabeled nucleotide method as described previously (9). RelativeVmax values were determined according to the methods of McPhee et al.

(14). Relative concentrations of PDE11A proteins expressed in COS-7cells were calculated by immunoblotting with anti-Xpress polyclonalantibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), as wedescribed previously (25). The membranes were incubated with ECLreagents at room temperature for 1 min and then exposed to x-ray filmfor 2–10 s, under conditions in which each exposure to x-ray film did notreach saturation. The resultant films were scanned by ARCUS II (Agfa-Gevaert), and quantitated using the Quantity One program (PDI, Inc.).The optical densities versus the amount of pHis-encoded protein wereplotted to measure the relative concentrations of PDE11A proteins.

FIG. 1. Degenerate PCR primersand the PCR products amplified. A,the nucleotide and the deduced aminoacid sequences of two highly conservedregions in the catalytic domain of previ-ously reported human PDEs are listed.Degenerate nucleotide sequences are in-dicated below. The nucleotide sequence ofthe novel PDE cloned by us (PDE11A),and its deduced amino acid sequence areindicated below the nucleotide sequence.Accession numbers of the human PDE se-quences are as follows: PDE1A, P54750;PDE1B, Q01064; PDE1C, Q14123;PDE2A, O00408; PDE3A, Q14432;PDE4A, P27815; PDE4B, Q07343;PDE4C, Q08493; PDE4D, Q08499;PDE5A, D89094; PDE6A, P16499;PDE7A, Q13946; PDE8A, AF056490;PDE8B, AF079529; PDE9A, AF048837;PDE10A, AB020593. B, the structure andcloning strategy of PDE11A3 andPDE11A4 variants are schematically il-lustrated. The coding region is repre-sented by a box. The GAF domain isshown as a shaded box, and the catalyticdomain is indicated as a black box. The 59-and 39-untranslated regions are denotedby lines. cDNA fragments isolated arerepresented by bars. Putative phosphoryl-ation sites of cAK and cGK are indicatedby arrows. The position of the PDE11A1sequence start site is shown with anarrow.

Two Novel PDE11A Splice Variants 31471

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

FIG. 2. Nucleotide and deduced amino acid sequences of the human PDE11A cDNA. A, DNA and amino acid sequences of humanPDE11A4. The deduced amino acid sequences are shown in three-letter designations below the nucleotide sequence. The termination codon at the

Two Novel PDE11A Splice Variants31472

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Relative Vmax values were calculated from Lineweaver-Burk plots (26),using proteins that provided relatively equal enzymatic activity. Theprotein concentration of the cytosolic fractions of transfected COS-7cells was determined by a protein assay kit (Bio-Rad) using bovineserum albumin as a standard.

In Vitro Kinase Assay—The full-length bovine cGK Ia cDNA was agift from Dr. Thomas M. Lincoln (University of Alabama at Birming-ham). The full-length human cGK Ib cDNA and mouse cAK catalyticsubunit a cDNA were obtained by standard PCR protocol as we de-scribed previously (25) and subcloned into pHis. To prepare truncatedand constitutively active cGK I (cGK ID) (27), the PstI–SalI DNAfragment of human cGK Ib (covering amino acid residues 322–685) wassubcloned into the PstI and XhoI sites of pHis. Site-directed mutagen-esis was performed using the QuickChangey site-directed mutagenesiskit (Stratagene) according to the protocol of the manufacturer. Tointroduce the desired mutations, the following primers were used: 59-CTGCAGCGGAGAGCTGCTCAGAAAGAGCTAAGG-39 plus 59-CCTT-AGCTCTTTCTGAGCAGCTCTCCGCTGCAG-39 (PDE11A4 S117A);and 59-CTTCTCCGGAAGGCAGCCTCCCTGCCCCCCACC-39 plus 59-GGTGGGGGGCAGGGAGGCTGCCTTCCGGAGAAG-39 (PDE11A4S162A). In each case, the mutation was confirmed by DNA sequencinganalysis.

The full-length cGK Ia, cGK Ib, cAK, or truncated cGK I cDNAs inthe expression vector pHis were transiently expressed in COS-7 cells.24 h after transfection, cells were washed with ice-cold phosphate-buffered saline twice and scraped in an ice-cold TNE buffer (10 mM

Tris-HCl at pH 7.5, 1% Nonidet P-40, 0.15 M NaCl, 1 mM EDTA, 10mg/ml aprotinin, 10 mM leupeptin, and 1 mM dithiothreitol). Cell ex-tracts were centrifuged at 16,000 3 g for 15 min at 4 °C to removecellular debris. The supernatants were incubated with anti-Xpress an-tibody and protein G-Sepharose overnight at 4 °C by rotation. Thebeads were washed three times with TNE buffer, and the immunopre-cipitated samples were used for the in vitro kinase assay. Likewise, cellextracts of COS-7 cells transfected with either pHis-PDE11A3 or pHis-PDE11A4 were immunoprecipitated with anti-Xpress antibody. In vitrokinase assays were performed as described previously (25). Reactionswere performed in the presence or absence of cGMP (5 mM final concen-tration). Phosphorylation by cAK was performed in the same buffer butin the presence or absence of 5 mM PKI (5–24).

Cyclic Nucleotide Binding Assay—The cyclic nucleotide binding as-say was performed in a total volume of 200 ml by a modified version ofthe methods described previously (10, 28). 100 ml of the cytosolic extractof COS-7 cells transfected with pHis-PDE11A4 was mixed with 100 mlof a cyclic nucleotide binding assay buffer to a final concentration of 10mM sodium phosphate, pH 7.2, 4 mM EDTA, 25 mM 2-mercaptoethanol,and 2 mM [3H]cGMP or [3H]cAMP (10,000,000 or 30,000,000 cpm/assay),followed by incubation at 0 °C for 2 h. The reaction was stopped by theaddition of 1 ml of ice-cold wash buffer (10 mM sodium phosphate, pH7.2, and 1 mM EDTA), and then applied to a Millipore HAWP filter (poresize 0.45 mm). The filters were washed three times with 5 ml of ice-coldwash buffer and then counted on a scintillation counter. As a positivecontrol, pHis-PDE5A, a human PDE5A1 cDNA (29) subcloned into theEcoRI and NotI sites of the mammalian expression vector pHis, wascreated and transfected into COS-7 cells. In all experiments, nonspecificbinding was measured by incubation in the presence of 2 mM unlabeledcGMP or cAMP.

RESULTS

cDNA Cloning of a Novel Human PDE—To isolate novelhuman PDE cDNAs, PCR was performed using cDNA tem-

plates from several human tissues with degenerate PCR prim-ers designed from two highly conserved regions in the catalyticdomain (Fig. 1A). PCR products of the appropriate size (approx-imately 200 base pairs) were detected, subcloned into the TA-cloning vector pGEM-T Easy, and sequenced. Of 50 clonesobtained from human testis PCR products, one clone, t21, wasrevealed to contain deduced amino acid sequence similar to butdistinct from 10 PDE families previously described. It showed52, 51, and 54% identity in amino acid sequences with PDE2A,PDE5A, and PDE10A, respectively. The insert DNA was usedas a probe for human Northern blot and mRNA dot blot anal-yses, and the preliminary data suggested that the correspond-ing transcripts were rich in prostate, testis, and thyroid (datanot shown). To obtain a full-length cDNA, 59- and 39-RACEreactions were performed using human testis, prostate, andthyroid mRNAs and primers designed from the clone t21 se-quence. Two kinds of extended products having distinct 59-sequences were obtained. One was isolated from human pros-tate RT products, and the other was from those of human testis.The nucleotide sequence analysis demonstrated that our clonescontained a catalytic sequence identical to that of PDE11A1(30), which was revealed during the course of this study, butincluded two distinct N-terminal sequences, indicating twonovel N-terminal splice variants of PDE11A. As shown in Fig.1B, the shorter clone obtained from human testis was desig-nated as PDE11A3 and the longer clone from prostate asPDE11A4, according to the nomenclature of the 1994 AmericanSociety of Pharmacology and Experimental Therapeutics Con-ference (31). PDE11A2, which has an N-terminal sequencedistinct from both PDE11A3 and PDE11A4, was described byothers.2

Sequence Analysis of Two Splice Variants of HumanPDE11A—The nucleotide sequence of the full-length PDE11A4cDNA (4476 base pairs) is shown in Fig. 2A. An open readingframe (ORF) of 2802 nucleotides spanned from the first initia-tion codon ATG to the termination codon TGA (nucleotides319–3120), and an in-frame stop codon was located 66 basepairs upstream of the initiation codon. The complete ORF en-coded a protein of 934 amino acids with a predicted molecularmass of 104,809 Da. The first methionine is surrounded by aKozak consensus sequence, ACCATGG (32). A putative poly-adenylation site, AATAAA (33), was found in the 39-noncodingregion of the cDNA (nucleotides 4165–4170). The presence ofthe transcripts encoding the protein was confirmed by RT-PCR,using specific primers for the sequence and human prostatemRNA as a template (see “Experimental Procedures”). A spe-cific DNA fragment of 3 kb was amplified, and the length of thefragment agreed with that predicted (data not shown). Theamplified DNA fragment was cloned into pGEM-T Easy, and

2 Dr. J. A. Beavo, personal communication.

FIG. 2—continued

end of the ORF is represented by asterisks. Two GAF domains (upper) and a catalytic domain (lower) are boxed. The in-frame termination codonupstream of the initiation codon of the ORF is double-underlined. The primer sequences for RT-PCR are underlined. The boxed AATAAA sequencerepresents a putative polyadenylation signal. The position of the amino acid sequence in common with PDE11A3 is shown by an arrow. Theinitiation Met of PDE11A1 is boxed. B, DNA and amino acid sequences of the 59-end of human PDE11A3. The in-frame termination codon upstreamof the initiation codon of the ORF is double-underlined. The position of the amino acid sequence in common with PDE11A4 is shown by an arrow.

Two Novel PDE11A Splice Variants 31473

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

six independent PCR clones were sequenced to verify the cor-rect cDNA sequence for the full coding region. The C-terminalmoiety of PDE11A4 (Met445–Asn934) was identical to the entirePDE11A1 sequence (Met1–Asn490).

The nucleotide sequence encoding the N-terminal region ofPDE11A3 is shown in Fig. 2B. The presence of the transcriptscoding for the PDE11A3 ORF was also confirmed by RT-PCRanalysis, using the specific primers for the PDE11A3 sequenceand human testis mRNA as a template. Specific PCR productsof approximately 2.2 kb, which were in good agreement withthe length of the predicted product, were obtained (data notshown). The amplified DNA fragment was cloned into pGEM-TEasy and sequenced to confirm the PDE11A3 sequence.PDE11A3 was composed of 684 amino acids with a predictedmolecular mass of 78,713 Da. As shown in Fig. 1B, the C-terminal sequence (630 amino acids) of PDE11A3 (Asp55–Asn684) was identical to that of PDE11A4 (Asp305–Asn934),except for the unique N-terminal portion. The PDE11A3 pro-tein was 194 amino acids longer than the PDE11A1 protein.

The deduced amino acid sequences of the ORFs weresearched using SMART (Simple Modular Architecture Re-search Tool) (34), and compared with those of human PDEsreported. PDE11A4 was revealed to contain two complete GAF(cGMP binding and stimulated phosphodiesterases, Anabaenaadenyl cyclases, and Escherichia coli FhlA) domains (aminoacid residues 217–380 and 402–568) (35) and a catalytic do-main (amino acid residues 640–881), whereas PDE11A3 wasshown to include one complete (amino acid residues 152–318)and one incomplete (amino acid residues 1–130) GAF domain.The complete GAF domains of PDE11A4 showed 19–47% iden-tity with those of PDEs including human PDE2A, PDE5A,PDE6s, and PDE10A (Fig. 3). The catalytic domain sequence ofPDE11As showed high identity (42–51%) with those of PDEshaving GAF domains (data not shown). We also found thatPDE11A4, but not PDE11A3, had typical phosphorylation sites(RRA117S and RKA162S) for cAK (RRXS) and cGK (RKX(S/T)),respectively, in the N-terminal region (36).

Tissue Distribution of Human PDE11A Transcripts—Dotblot analysis of human mRNA was performed using a 32P-labeled PDE11A cDNA probe corresponding to the commonregion of PDE11A3 and PDE11A4 transcripts (Fig. 4A). Theamounts of the mRNAs loaded were normalized using cDNAs

for human ubiquitin and major histocompatibility complexclass Ic as probes (described in the instructions from CLON-TECH). PDE11A transcripts were particularly abundant inprostate. Moderate expression was observed in testis, salivarygland, pituitary gland, thyroid gland, and liver. Northern blotanalysis of multiple human tissues was performed with thesame 32P-labeled probe (Fig. 4B). A band of approximately 3 kbwas detected in testis, and a major band of approximately 6 kband minor bands of 2 and 10 kb were observed in prostate.

In some cases, alternative splice variants in each PDE familyshow different expression patterns in tissues. The expressionpatterns of each PDE11A3 and PDE11A4 transcript in humantissues were examined by a combination of PCR and Southernblot analysis. To know the relative amounts of PDE11A3 andPDE11A4 transcripts, the efficiency of PCR amplification usingspecific primer sets for PDE11A3 and PDE11A4 was first ex-amined as follows. PCR was performed using the sameamounts of pHis-PDE11A3 and pHis-PDE11A4 DNAs as atemplate under the same conditions, revealing that amplifica-tion using the primer set for PDE11A3 was more efficient thanthat using the primer set for PDE11A4 (data not shown). Con-sidering the degree of efficiency and the condition that PCR didnot reach saturation, PCR was carried out and Southern blotanalysis was performed using an oligonucleotide probe from acommon sequence. The ratio of the two PCR products amplifiedusing specific primer sets and MTC panels as templates re-flects the amounts of their transcripts. Interestingly, PDE11A3transcripts were specific in testis, whereas PDE11A4 tran-scripts were particularly abundant in prostate (Fig. 5).

Expression of Human PDE11A3 and PDE11A4 in COS-7Cells—To produce recombinant human PDE11A3 andPDE11A4 proteins, full-length cDNAs for these variants weresubcloned into the N-terminal histidine tag mammalian ex-pression vector pcDNA4/HisMax and transfected into COS-7cells. Cytosolic fractions were prepared from COS-7 cells trans-fected with an expression vector encoding histidine-taggedPDE11A3 or PDE11A4 (pHis-PDE11A3 or pHis-PDE11A4).The proteins were analyzed by immunoblotting using anti-Xpress polyclonal antibody, which reacts with histidine-taggedproteins. While no signal was observed in the mock-transfectedcells, specific bands of approximately 78 and 100 kDa, whichwere in reasonable agreement with the molecular masses pre-

FIG. 3. Alignment of two GAF domains of PDE11A4 with human PDEs. The sequence alignment of GAF domains is shown. The regioncorresponding to a consensus GAF sequence (35) is shown by bars above the sequences. Amino acid sequences are shown in one-letter designations.The positions of amino acid residue are shown at each side of the sequence. Identical amino acid residues that are conserved over 50% among thesequences are boxed in the alignment. Accession numbers of the human PDE sequences are as follows: PDE2A, O00408; PDE5A, D89094; PDE6B,P35913; PDE10A, AB020593.

Two Novel PDE11A Splice Variants31474

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

dicted for the histidine-tagged PDE11A3 and PDE11A4, weredetected in cytosolic fractions of cells transfected with theexpression plasmids pHis-PDE11A3 and pHis-PDE11A4, re-spectively (data not shown). The cytosolic fractions were as-sayed for cyclic nucleotide hydrolytic activities using either 1mM cAMP or 1 mM cGMP. Both cytosolic fractions from COS-7cells transfected with pHis-PDE11A3 or pHis-PDE11A4 exhib-ited ;20- and ;75-fold higher levels of cAMP and cGMP hy-

drolytic activities, respectively, than those from the mock-transfected COS-7 cells (data not shown).

Kinetic Properties of Human PDE11A Enzyme—To deter-mine Km and Vmax values, the histidine-tagged PDE11A3 andPDE11A4 proteins were partially purified by using a nickelaffinity column. The eluate prepared from PDE11A-expressingcells, but not from mock-transfected cells, exhibited cAMP andcGMP PDE activities. The relative concentrations of the par-tially purified histidine-tagged PDE11A3 and PDE11A4 pro-teins were measured by immunoblotting (Fig. 6A). The Km

values of PDE11A3 and PDE11A4 were derived from Line-weaver-Burk plots (26) of activities using cGMP or cAMP assubstrate (0.1–10 mM) for the partially purified histidine-taggedPDE11A3 and PDE11A4 proteins. The Km values of the humanPDE11A4 for cAMP and cGMP were 3.0 6 0.26 and 1.4 6 0.06mM, respectively. Vmax values of PDE11A4 for cAMP and cGMPhydrolysis were 270 6 28 and 120 6 4.7 pmol/min/mg with thepartially purified recombinant protein, respectively. As shownin Table I, both cAMP and cGMP Km values of PDE11A3 werealmost the same as those of PDE11A4 (cAMP and cGMP Km

values of PDE11A3 were 3.0 6 0.28 and 1.5 6 0.07 mM, respec-tively). Relative Vmax values were calculated to compare theVmax of PDE11A3 with that of PDE11A4. The Vmax values ofPDE11A3 relative to PDE11A4 (i.e. Vmax 5 1.0) were 0.16 60.01 for cAMP and 0.17 6 0.03 for cGMP. However, the Vmax

ratio (cAMP/cGMP) of PDE11A4 (2.2 6 0.40) was very similar

FIG. 4. Analysis of expression of human PDE11A transcripts in various tissues by dot blot and Northern blot. Hybridization wascarried out with a 32P-labeled fragment of human PDE11A cDNA under the conditions described under “Experimental Procedures.” A, dot blot ofmRNAs from various human tissues obtained from CLONTECH was hybridized with the 32P-labeled probe. RNA sources are shown in thediagram. B, Northern blot analysis of mRNAs from several human tissues. The PDE11A transcripts were detected using the same 32P-labeledprobe. The sizes (in kb) and positions of mRNA size markers are shown on the left.

FIG. 5. Detection of two spliced transcripts of human PDE11A3and PDE11A4 by PCR. PCR was performed using MTC panels(CLONTECH) as templates. PCR amplification was carried out through32 cycles for human PDE11A3 (756 base pairs) and 27 cycles for humanPDE11A4 (756 base pairs), under conditions in which PCR amplifica-tion did not reach saturation. The PCR products of PDE11As weresubjected to Southern blot analysis using the 32P-labeled DNA probe todetect both PCR products. As a control, PCR was performed using 0.01ng/ml pHis-PDE11A3 or pHis-PDE11A4 plasmid DNA. The same re-sults have been obtained with two separate PCR analyses.

Two Novel PDE11A Splice Variants 31475

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

to that of PDE11A3 (2.4 6 0.37).The effects of various PDE inhibitors on PDE11A3 and

PDE11A4 activities were examined using the partially purifiedproteins described above (Table II). The nonspecific PDE inhib-itor, 3-isobutyl-1-methylxanthine, showed a weak inhibitoryeffect on PDE11A4 (IC50 values were 65 6 13 mM for cAMP and81 6 16 mM for cGMP). Vinpocetine, erythro-9-(2-hydroxy-3-nonyl)-adenine, milrinone, and rolipram, which are PDE1,PDE2, PDE3, and PDE4 inhibitors, respectively, were inactiveup to 100 mM. Compounds that inhibit PDE5 showed inhibitoryeffects on PDE11A4. Zaprinast demonstrated moderate inhibi-tion (IC50 5 26 6 6.8 mM for cAMP and 33 6 5.3 mM for cGMP).SCH51866, a PDE1 and PDE5 inhibitor (37), inhibitedPDE11A4 with IC50 values of 22 6 1.8 mM for cAMP and 25 65.8 mM for cGMP. E4021, a more potent PDE5 inhibitor (38),showed IC50 values of 1.8 6 0.33 mM for cAMP and 1.8 6 0.25mM for cGMP. Among the PDE inhibitors tested, dipyridamolewas the most effective antagonist for PDE11A4, with IC50

values of 0.82 6 0.28 mM for cAMP and 0.72 6 0.08 mM for

cGMP. The inhibitory effects of PDE inhibitors on PDE11A3activity were 2–3-fold more potent than those on PDE11A4.

The inhibitory effects of cGMP on cAMP hydrolysis and viceversa were also examined using the partially purifiedPDE11A3 and PDE11A4. cAMP hydrolysis was measured inthe presence of 3.5 mM cAMP and a range of cGMP concentra-tions of 0.01–100 mM. The reverse was also performed in thepresence of 1.3 mM cGMP and a range of cAMP concentrationsof 0.01–100 mM. Neither cGMP nor cAMP stimulated hydrolyticactivity (data not shown). cAMP and cGMP inhibited the ac-tivities of cGMP and cAMP hydrolysis of PDE11A4 with IC50

values of 9.0 6 0.38 and 3.1 6 0.16 mM, respectively (Table II).Other Characteristics of PDE11A4: Phosphorylation by cAK

and cGK and Cyclic Nucleotide Binding—Some PDEs havebeen reported to be regulated by phosphorylation by kinasesincluding cAK and cGK (1). Human PDE11A4, but notPDE11A3, also contains typical phosphorylation sites(RRA117S and RKA162S) of both cAK (RRXS) and cGK (RKX(S/T)) in its N terminus (36). To determine whether PDE11A4 isphosphorylated by cAK, cGK, or both, an in vitro kinase assaywas performed using the recombinant histidine-taggedPDE11A4 protein. PDE11A4, but not PDE11A3, was phospho-rylated by cAK catalytic subunit a (Fig. 7A), and its phospho-rylation was almost completely inhibited by cAK inhibitor pep-tide (Fig. 7B). Phosphorylation of PDE11A4 by cGK I wasexamined using a truncated form of cGK Ib, cGK ID (aminoacid residues 322–685 of human cGK Ib), because the molecu-lar sizes of autophosphorylated cGK I subunits are similar tothat of PDE11A3. cGK ID as well as cAK phosphorylatedPDE11A4 but not PDE11A3, although the phosphorylationlevels of PDE11A4 by cGK ID were lower than those by cAK. Inaddition, both full-length cGK Ia and cGK Ib also phosphoryl-ated PDE11A4 in a cGMP-dependent manner. The phosphoryl-ation of potential residues Ser117 and Ser162 by cAK and/or cGKwas further examined using site-directed mutagenesis. Themutant PDE11A4 S117A/S162A carrying double substitutionsof Ser117 and Ser162 with Ala, showed significant reduction incAK- and cGK-mediated 32P incorporation compared with wildtype PDE11A4 (Fig. 7C).

Cyclic nucleotide binding activity was also examined usingcytosolic fractions from COS-7 cells transfected with pHis-PDE11A4. The expression level of the histidine-taggedPDE11A4 protein in the transfected COS-7 cells was shown tobe equal to that of the histidine-tagged PDE5A1 used as a posi-tive control by immunoblot analysis using anti-Xpress antibody.The cyclic nucleotide binding activity was performed at a concen-tration of 2 mM [3H]cAMP or [3H]cGMP. Under these conditions,the cGMP binding activity of PDE11A4 was not significant com-pared with that of PDE5A1 used as a positive control (data notshown). In regard to cAMP binding, no binding activity wasdetected on either PDE11A4 or PDE5A1 protein.

DISCUSSION

Two kinds of full-length cDNAs of PDE11A were isolated byan approach using PCR with degenerate primers designed fromhighly conserved regions in catalytic domains of PDE familiesand RACE. The application of this strategy to cloning a novelPDE cDNA has already been reported (39), but by selecting thesequences for designing the PCR primer sets, it was also effec-tive to isolate cDNA encoding a novel class of PDE. The twoclones obtained included a catalytic domain identical toPDE11A1, which was quite recently isolated from a humanskeletal muscle cDNA library during the course of this study(30), but they had two distinct and unique N termini, indicatingtwo novel N-terminal splice variants of PDE11A. PDE11A1was composed of 490 amino acids, whereas PDE11A3 andPDE11A4 were 784 and 934 amino acids, respectively. It is

FIG. 6. Kinetic analysis of partially purified human PDE11A4.A, expression of recombinant PDE11A3 and PDE11A4 proteins wasexamined by immunoblot analysis. COS-7 cells were transfected witheither pHis-PDE11A3 or pHis-PDE11A4. After cytosolic fractions of thetransfected COS-7 cells were prepared, the histidine-tagged PDE11A3and PDE11A4 were partially purified by using a nickel affinity column.Partially purified PDE11A3 and PDE11A4 were separated by SDS-polyacrylamide gel electrophoresis and then immunoblotted with anti-Xpress antibody. B, Lineweaver-Burk plots at concentrations of 0.1–10mM cAMP (closed circles) and cGMP (open circles) are shown. Partiallypurified PDE11A4 was prepared as described above. Km and Vmaxvalues are the means of triplicate assays 6 S.D. A plot typical of threeindependent experiments is shown.

Two Novel PDE11A Splice Variants31476

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

intriguing that two novel PDE11A variants have distinct Ntermini from PDE11A1. A search using SMART revealed thatPDE11A4 contains two complete GAF domains (amino acidresidues 217–380; E 5 7.1 3 10230 and amino acid residues402–568, E 5 3.6 3 10225), whereas PDE11A3 has one com-plete (amino acid residues 152–318, E 5 3.6 3 10225) and oneincomplete GAF domain (amino acid residues 1–130, E 5 7.4 31027). On the other hand, PDE11A1 has an incomplete GAFdomain, which lacks the N-terminal part of the GAF consensussequence (E 5 2.0 3 1026). Alterations of the calmodulin-binding domain and upstream conserved regions have beenreported in N-terminal variants of PDE1 and PDE4. However,no report has described the alteration of the GAF domain insplice variants of PDEs containing the GAF domain, althoughmany splice variants of PDEs containing the GAF domain havebeen reported (10, 11, 40–43). Thus, PDE11A constitutes aunique family distinct from other PDEs including the GAFsequence.

In PDE5A, the motif N(K/R)XnFX3D in the GAF domain hasbeen known to be necessary for the support of cGMP binding(44, 45). PDE11A4 also contains all of four residues of thismotif in both GAF domains. However, unexpectedly, the cGMPbinding activity of PDE11A4, which was expressed as a histi-dine-tagged protein in COS-7 cells, was much lower than thatof PDE5A1 under the conditions used in this study (see “Ex-perimental Procedures”). No significant cAMP binding activitywas observed under those conditions. Although PDE2A,PDE5A, and PDE6s proteins show apparent cGMP bindingfunction, that of PDE10A has been reported to be insignificant(3, 9). As shown in the case of PDE11A4, it is likely that cGMPbinding is not the function of the GAF domain in all cases. Forexample, E. coli FhlA, a transcriptional regulatory protein, isshown to bind formate within the N terminus, which contains

two GAF domains (46). Further study will elucidate the func-tion of the GAF domain in PDE11A variants, includingPDE11A1 and PDE11A3.

The differences in the biochemical characteristics of thePDE11A variants are intriguing. The first difference concernsenzymatic characteristics. The catalytic domain of PDE11Aswas the most homologous to that of PDE5A in the PDE fami-lies, and vice versa. In addition, the structure of PDE11A4,including two complete GAF domains, was very similar to thatof PDE5A. Interestingly, although PDE5A is highly specific forcGMP, both PDE11A variants demonstrated hydrolytic activitynot only for cGMP but also for cAMP when expressed in COS-7cells, indicating that PDE11As resemble PDE2A and PDE10A.However, PDE11As were activated by neither cAMP norcGMP, and the Km values of PDE11A for cAMP and cGMP werealmost the same, being distinguishable from PDE2A andPDE10A. These characteristics supported the position thatPDE11A is a distinct family from other PDEs containing theGAF domain. Patterns of the inhibitory effects of PDE inhibi-tors used on PDE11A3 and PDE11A4 activities were similar tothose of PDE11A1. Dipyridamole was the most effectiveagainst these PDE11A variants. We found differences in therelative Vmax and in the sensitivity to PDE inhibitors ofPDE11A3 and PDE11A4, suggesting that the N-terminal re-gion of PDE11A affects the conformation of the protein, leadingto the change of enzymatic profile. Similar effects of N-terminalsplicing variability have been demonstrated for some PDEsincluding PDE1A, PDE1C, PDE4A, PDE4B, and PDE7A (15,16, 18, 20, 47). For example, rat PDE4A isoforms have beenreported to exhibit 2–5-fold differences in their Vmax values andin their sensitivity to the PDE4-specific inhibitor, rolipram(16). Distinct N termini derived from alternative splicing mayprovide PDE11A variants with different enzymatic profiles.

The second difference lies in the presence of phosphorylationsites. PDE11A4, but not PDE11A3, contains typical phospho-rylation sites (RRA117S and RKA162S) for cAK (RRXS) and cGK(RKX(S/T)) in the N terminus (36). In vitro kinase assayssuggested that PDE11A4, but not PDE11A3, is a good sub-strate for both cAK and cGK, although the phosphorylation bycGK I was weaker than that by cAK. The double mutant(PDE11A4 S117A/S162A) was still phosphorylated by both cAKand cGK I, at a lower level, indicating that additional phospho-rylation sites may be present in PDE11A4. However, its addi-tional phosphorylation sites would be located in the N terminusof PDE11A4, because no phosphorylation of PDE11A3 by cAKand cGK I was observed. Modifications of PDE activity byphosphorylation have been reported in some PDEs. For exam-ple, PDE1A is phosphorylated by cAK, and thus its affinity forcalmodulin is reduced (48). PDE3 and PDE4 are actually phos-phorylated by cAK and activated in response to agents thatincrease cAMP levels in intact cells and by cAK in vitro (49–51). Binding of cGMP to noncatalytic binding sites in the reg-ulatory domain of PDE5A enhances the phosphorylation ofPDE5A by cGK (52, 53). Further work is needed to determinewhether phosphorylation of PDE11A4 occurs in vivo and also to

TABLE IKm and relative Vmax values of PDE11A3 and PDE11A4

Km values for partially purified histidine-tagged PDE11A3 and PDE11A4 proteins were determined from Lineweaver-Burk plots. Relative Vmaxvalues were calculated as described under “Experimental Procedures”. Data are the means of three separate determinations 6 S.D. All assays wereperformed in duplicate.

Km Relative Vmax Vmax ratio(cAMP/cGMP)cAMP cGMP cAMP cGMP

mM

PDE11A4 3.0 6 0.26 1.4 6 0.06 1.0 1.0 2.2 6 0.40PDE11A3 3.0 6 0.28 1.5 6 0.07 0.16 6 0.01 0.17 6 0.03 2.4 6 0.37

TABLE IIInhibitory effect of the various PDE inhibitors on human PDE11A

variantsPartially purified PDE11A3 and PDE11A4 produced in COS-7 cells

were used for the assay. The concentrations of cAMP and cGMP usedwere 3.5 and 1.3 mM, respectively. IC50 values were calculated by linearregression. Data are the means of three separate determinations 6 S.D.All assays were performed in duplicate. IBMX, 3-isobutyl-1-methylxan-thine; EHNA, erythro-9-(2-hydroxy-3-nonyl)-adenine; ND, not deter-mined.

InhibitorIC50 values for PDE11A3 IC50 values for PDE11A4

cAMP cGMP cAMP cGMP

mM mM

IBMX 30 6 3.9 38 6 3.5 65 6 13 81 6 16Vinpocetine 49 6 9.2 68 6 4.0 .100 .100EHNA .100 .100 .100 .100Milrinone .100 .100 .100 .100Rolipram .100 .100 .100 .100Zaprinast 18 6 10 11 6 3.6 26 6 6.8 33 6 5.3Dipyridamole 0.36 6 0.11 0.34 6 0.09 0.82 6 0.28 0.72 6 0.08SCH51866 11 6 4.8 8.6 6 2.7 22 6 1.8 25 6 5.8E4021 0.88 6 0.13 0.66 6 0.19 1.8 6 0.33 1.8 6 0.25cAMP ND 8.2 6 0.43 ND 9.0 6 0.38cGMP 5.1 6 0.12 ND 3.1 6 0.16 ND

Two Novel PDE11A Splice Variants 31477

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

determine what effect is brought out by the phosphorylation ofPDE11A4.

The third difference involves tissue expression patterns. Inmany cases, alternative splice variants in each PDE familyshow different expression patterns in tissues and differentsubcellular localization (1, 12–20). Human PDE11A transcriptswere highly expressed in prostate and moderately in testis.PCR and Southern blot analyses demonstrated that PDE11Avariants also showed different tissue expression patterns, al-though it is not yet known whether there is a difference insubcellular localization. PDE11A3 transcripts were specificallyexpressed in testis, whereas PDE11A4 transcripts werestrongly expressed in prostate. Testis-specific expression ofPDE11A3 variants implies the production of PDE11A3 tran-scripts under the control of a testis-specific promoter. Thegenomic origin of PDE11A variants is interesting from the viewof the formation of multiple variants and their specificregulation.

In regard to the physiological function of PDE11A, the fol-lowing factors should be considered. Many PDEs have beenreported to exist in the testis. Several works have focused onthe cAMP-signaling pathway during sperm differentiation(54–58), whereas cGMP has been shown to control the Ca21

entry into sperm through a cyclic nucleotide-gated channel,suggesting that the cGMP signaling pathway may be involvedin sperm motility (59, 60). In prostate, PDEs have been littlestudied, but several reports have described the physiologicalroles of cAMP and cGMP. The elevation of intracellular cAMPin human prostate cancer cells has been demonstrated to in-

duce neuroendocrine differentiation (61–63). The PDE inhibi-tors, 3-isobutyl-1-methylxanthine and papaverine, also initiatemorphologic differentiation in human prostate cancer cells andinhibit the proliferation and invasive potential of the cells (61,62). Furthermore, withdrawal of the agents that increasecAMP causes rapid loss of the neuroendocrine phenotype, in-dicating that chronic cAMP signaling is required to block theproliferation of prostate tumor cells and to induce neuroendo-crine differentiation (63). On the other hand, nitric oxide,which produces cGMP via the activation of soluble guanylcyclase, has been shown to play a role in the regulation of thecontractile function of smooth muscle cells and the growth ofseveral types of cells. In prostate, nitric oxide has been reportedto function as a mediator of prostate smooth muscle activity(64). In addition, a recent study has demonstrated that bothnitric oxide donors and cGMP analogs exert antiproliferativeactions in human prostatic smooth muscle cells (65). Thesereports suggest that the involvement of a cAMP and cGMPPDE, PDE11A, in controlling prostate or testis functions isplausible. The precise localization of PDE11A in prostate andtestis and further analysis will clarify the physiological roles ofPDE11A.

In conclusion, we revealed the structure and tissue-specificexpression patterns of transcripts of a novel human PDE,PDE11A. Presently, the physiological role of this enzyme re-mains unknown. Analysis of tissue distribution in detail bymeans of in situ hybridization and immunohistochemical anal-yses will be informative in revealing the role of this enzyme.Pharmacological analysis using selective inhibitors for this en-

FIG. 7. Phosphorylation of PDE11A4by cAK and cGK. Phosphorylation ofPDE11A3 and PDE11A4 variants by cAKand cGK I was examined by an in vitrokinase assay. Whole cell lysates of trans-fected COS-7 cells were mixed and immu-noprecipitated by anti-Xpress antibody,and the immunoprecipitates were usedfor an in vitro kinase assay (see “Experi-mental Procedures”). A, PDE11A4 but notPDE11A3 was phosphorylated by bothcAK and cGK I. The 32P incorporation ofthe proteins was examined by SDS-poly-acrylamide gel electrophoresis and auto-radiography (32P-ATP). To monitor theexpression levels of each protein, wholecell lysates were immunoblotted with an-ti-Xpress antibody (IB: a-Xpress). B, phos-phorylation of PDE11A4 by full-lengthcGK Ia and cGK Ib in a cGMP-dependentmanner. cGK activity was measured inthe absence (2) or presence (1) of 5 mM

cGMP, and cAK activity was measuredwith (1) or without (2) of 5 mM cAK in-hibitor peptide (PKI). C, phosphorylationof mutant PDE11A4 lacking potentialphosphorylation sites. The 32P incorpora-tion of wild-type PDE11A4 (PDE11A4WT) and PDE11A4 mutant (PDE11A4S117A/S162A) was examined by an invitro kinase assay using cAK and cGK ID.The samples were separated by SDS-poly-acrylamide gel electrophoresis and blot-ted onto polyvinylidene difluoride mem-brane. The membrane was first exposedto autoradiography (32P-ATP) and thenanalyzed by immunoblotting with anti-Xpress antibody (IB: a-Xpress). All exper-iments were independently carried outthree times, and almost the same resultswere obtained.

Two Novel PDE11A Splice Variants31478

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

zyme will elucidate new physiological functions of cAMP orcGMP in prostate and testis.

Acknowledgments—We thank Dr. T. M. Lincoln for the generous giftof bovine cGK Ia cDNA. We are grateful to Drs. S. Komatsubara and N.Nakanishi for continuous interest and Dr. N. Yanaka for helpful dis-cussion. We also thank Dr. J. A. Beavo for kind advice on the nomen-clature of the PDE11A variants and for sharing unpublished data.

REFERENCES

1. Beavo, J. A. (1995) Physiol. Rev. 75, 725–7482. Burns, F., Zhao, A. Z., and Beavo J. A. (1996) Adv. Pharmacol. 36, 29–483. Soderling, S. H., and Beavo, J. A. (2000) Curr. Opin. Cell Biol. 12, 174–1794. Soderling, S. H., Bayuga, S. J., and Beavo, J. A. (1998) Proc. Natl. Acad. Sci.

U. S. A. 95, 8991–89965. Fisher, D. A., Smith, J. F., Pillar, J. S., St. Denis, S. H., and Cheng, J. B. (1998)

Biochem. Biophys. Res. Commun. 246, 570–5776. Soderling, S. H., Bayuga, S. J., and Beavo, J. A. (1998) J. Biol. Chem. 273,

15553–155587. Fisher, D. A., Smith, J. F., Pillar, J. S., St. Denis, S. H., and Cheng, J. B. (1998)

J. Biol. Chem. 273, 15559–155648. Hayashi, M., Matsushima, K., Ohashi, H., Tsunoda, H., Murase, S., Kawarada

Y., and Tanaka, T. (1998) Biochem. Biophys. Res. Commun. 250, 751–7569. Fujishige, K., Kotera, J., Michibata, H., Yuasa, K., Takebayashi, S., Okumura,

K., and Omori, K. (1999) J. Biol. Chem. 274, 18438–1844510. Kotera, J., Fujishige, K., Akatsuka, H., Imai, Y., Yanaka, N., and Omori, K.

(1998) J. Biol. Chem. 273, 26982–2699011. Kotera, J., Fujishige, K., Yuasa, K., and Omori, K. (1999) Biochem. Biophys.

Res. Commun. 261, 551–55712. Yan, C., Bentley, J. K., Sonnenburg, W. K., and Beavo, J. A. (1994) J. Neurosci.

14, 973–98413. Reinhardt, R. R., Chin, E., Zhou, J., Taira, M., Murata, T., Manganiello, V. C.,

and Bond, C. A. (1995) J. Clin. Invest. 95, 1528–153814. McPhee, I., Pooley, L., Lobban, M., Bolger, G., and Houslay, M. D. (1995)

Biochem. J. 310, 965–97415. Yan, C., Zhao, A. Z., Bentley, J. K., and Beavo, J. A. (1996) J. Biol. Chem. 271,

25699–2570616. Bolger, G. B., McPhee, I., and Houslay, M. D. (1996) J. Biol. Chem. 271,

1065–107117. Huston, E., Pooley, L., Julien, P., Scotland, G., McPhee, I., Sullivan, M.,

Bolger, G., and Houslay, M. D. (1996) J. Biol. Chem. 271, 31334–3134418. Han, P., Zhu, X., and Michaeli, T. (1997) J. Biol. Chem. 272, 16152–1615719. Degerman, E., Belfrage, P., and Manganiello, V. C. (1997) J. Biol. Chem. 272,

6823–682620. Huston, E., Lumb, S., Russell, A., Catterall, C., Ross, A. H., Steele, M. R.,

Bolger, G. B., Perry, M. J., Owens, R. J., and Houslay, M. D. (1997)Biochem. J. 328, 549–558

21. Scotland, G., and Houslay, M. D. (1995) Biochem. J. 308, 673–68122. Shakur, Y., Pryde, J. G., and Houslay, M. D. (1993) Biochem. J. 292, 677–68623. O’Connell, J. C., McCallum, J. F., McPhee, I., Wakefield, J., Houslay, E. S.,

Wishart, W., Bolger, G., Frame, M., and Houslay, M. D. (1996) Biochem. J.318, 255–262

24. Yuasa, K., Omori, K., and Yanaka, N. (2000) J. Biol. Chem. 275, 4897–490525. Yuasa, K., Michibata, H., Omori, K., and Yanaka, N. (1999) J. Biol. Chem. 274,

37429–3743426. Lineweaver, H., and Burk, D. (1934) J. Am. Chem. Soc. 56, 658–66627. Gudi, T., Lohmann, S. M., and Pilz, R. B. (1997) Mol. Cell. Biol. 17, 5244–525428. McAllister-Lucas, L. M., Sonnenburg, W. K., Kadlecek, A., Seger, D., Trong,

H. L., Colbran, J. L., Thomas, M. K., Walsh, K. A., Francis, S. H., Corbin,J. D., and Beavo, J. A. (1993) J. Biol. Chem. 268, 22863–22873

29. Yanaka, N., Kotera, J., Ohtsuka, A., Akatsuka, H., Imai, Y., Michibata, H.,Fujishige, K., Kawai, E., Takebayashi, S., Okumura, K., and Omori, K.(1998) Eur. J. Biochem. 255, 391–399

30. Fawcett, L., Baxendale, R., Stacey, P., McGrouther, C., Harrow, I., Soderling,S., Hetman, J., Beavo, J. A., and Phillips, S. C. (2000) Proc. Natl. Acad. Sci.U. S. A. 97, 3702–3707

31. Beavo J. A., Conti, M., and Heaslip, R. J. (1994) Mol. Pharmacol. 46, 399–40532. Kozak, M. (1986) Cell 44, 283–29233. Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263, 211–21434. Schultz, J., Milpetz, F., Bork, P., and Ponting, C. P. (1998) Proc. Natl. Acad.

Sci. U. S. A. 95, 5857–586435. Aravind, L., and Ponting, C. P. (1997) Trends Biochem. Sci. 22, 458–45936. Wang, X., and Robinson, P. J. (1997) J. Neurochem. 68, 443–45637. Vemulapalli, S., Watkins, R. W., Chintala, M., Davis, H., Ahn H. S., Fawzi, A.,

Tulshian, D., Chiu, P., Chatterjee, M., Lin, C. C., and Sybertz E. J. (1996)J. Cardiovasc. Pharmacol. 28, 862–869

38. Saeki, T., Adachi, H., Takase, Y., Yoshitake, S., Souda, S., and Saito, I. (1994)J. Pharmacol. Exp. Ther. 284, 25–33

39. Repaske, D. R., Swinnen, J. V., Jin, S.-L. C., Van Wyk, J. J., and Conti, M.(1992) J. Biol. Chem. 267, 18683–18688

40. Yang, Q., Paskind, M., Bolger, G., Thompson, W. J., Repaske, D. R., Cutler,L. S., and Epstein, P. M. (1994) Biochem. Biophys. Res. Commun. 205,1850–1858

41. Rosman, G. J., Martins, T. J., Sonnenburg, W. K., Beavo, J. A., Ferguson, K.,and Loughney, K. (1997) Gene (Amst.) 191, 89–95

42. Fujishige, K., Kotera, J., and Omori, K. (1999) Eur. J. Biochem. 266,1118–1127

43. Lin, C. S., Lau, A., Tu, R., and Lue, T. F. (2000) Biochem. Biophys. Res.Commun. 268, 628–635

44. McAllister-Lucas, L. M., Haik, T. L., Colbran, J. L, Sonnenburg, W. K., Seger,D., Turko, I. V., Beavo, J. A., Francis, S. H., and Corbin, J. D. (1995) J. Biol.Chem. 270, 30671–30679

45. Turko, I. V., Haik, T. L., McAllister-Lucas, L. M., Burns, F., Francis, S. H., andCorbin, J. D. (1996) J. Biol. Chem. 271, 22240–22244

46. Korsa, I., and Bock, A. (1997) J. Bacteriol. 179, 41–4547. Snyder, P. B., Florio, V. A., Ferguson, K., and Loughney, K. (1999) Cell. Signal.

11, 535–54448. Florio, V. A., Sonnenburg, W. K., Johnson, R., Kwak, K. S., Jensen, G. S.,

Walsh, K. A., and Beavo, J. A. (1994) Biochemistry 33, 8948–895449. Macphee, C. H., Reifsnyder, D. H., Moore, T. A., Lerea, K. M., and Beavo, J. A.

(1988) J. Biol. Chem. 263, 10353–1035850. Sette, C., Iona, S., and Conti, M. (1994) J. Biol. Chem. 269, 9245–925251. Sette, C., and Conti, M. (1996) J. Biol. Chem. 271, 16526–1653452. Thomas, M. K., Francis, S. H., and Corbin, J. D. (1990) J. Biol. Chem. 265,

14971–1497853. Turko, I. V., Francis, S. H., and Corbin, J. D. (1998) Biochem. J. 329, 505–51054. Nantel, F., Monaco, L., Foulkes, N. S., Masquilier, D., LeMeur, M., Henriksen,

K., Dierich, A., Parvinen, M., and Sassone-Corsi, P. (1996) Nature 380,159–162

55. Blendy, J. A., Kaestner, K. H., Weinbauer, G. F., Nieschlag, E., and Schutz, G.(1996) Nature 380, 162–165

56. Gautier-Courteille, C., Salanova, M., and Conti, M. (1998) Endocrinology 139,2588–2599

57. Salanova, M., Chun, S.-Y., Iona, S., Puri, C., Stefanini, M., and Conti, M.(1999) Endocrinology 140, 2297–2306

58. Vijayaraghavan, S., Goueli, S. A., Davey, M. P., and Carr, D. W. (1997) J. Biol.Chem. 272, 4747–4752

59. Weyand, I., Godde, M., Frings, S., Weiner, J., Muller, F., Altenhofen, W., Hatt,H., and Kaupp, U. B. (1994) Nature 368, 859–863

60. Wiesner, B., Weiner, J., Middendorff, R., Hagen, V., Kaupp, U. B., andWeyand, I. (1998) J. Cell Biol. 142, 473–484

61. Bang, Y.-J., Pirnia, F., Fang, W.-G., Kang, W. K., Sartor, O., Whitesell, L., Ha,M. J., Tsokos, M., Sheahan, M. D., Nguyen, P., Niklinski, W. T., Myers,C. E., and Trepel, J. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5330–5334

62. Goto, T., Matsushima, H., Kasuya, Y., Hosaka, Y., Kitamura, T., Kawabe, K.,Hida, A., Ohta, Y., Simizu, T., and Takeda, K. (1999) Int. J. Urol. 6,314–319

63. Cox, M. E., Deeble, P. D., Lakhani, S., and Parsons, S. J. (1999) Cancer Res. 59,3821–3830

64. Takeda, M., Tang, R., Shapiro, E., Burnett, A. L., and Lepor, H. (1995) Urology45, 440–446

65. Guh, J.-H., Hwang, T.-L., Ko, F.-N., Chueh, S.-C., Lai, M.-K., and Teng, C.-M.(1998) Mol. Pharmacol. 53, 467–474

Two Novel PDE11A Splice Variants 31479

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from

OmoriKeizo Yuasa, Jun Kotera, Kotomi Fujishige, Hideo Michibata, Takashi Sasaki and Kenji

Showing Unique Structure and Tissue-specific ExpressionIsolation and Characterization of Two Novel Phosphodiesterase PDE11A Variants

doi: 10.1074/jbc.M003041200 originally published online July 20, 20002000, 275:31469-31479.J. Biol. Chem. 

  10.1074/jbc.M003041200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/275/40/31469.full.html#ref-list-1

This article cites 65 references, 37 of which can be accessed free at

by guest on April 12, 2019

http://ww

w.jbc.org/

Dow

nloaded from