THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1987 by The American Society of Biological Chemists, Inc. Vol. 262, No. 8, Issue of March 15, pp. 3690-3636,1987

Printed in U. S. A.

Isolation and Characterization of the Yeast Gene Coding for the CY Subunit of Mitochondrial Phenylalanyl-tRNA Synthetase*

(Received for publication, October 15, 1986)

T. J. KoernerS, Alan M. Myers§, Steven Lee, and Alexander Tzagoloff From the Department of Biological Sciences, Columbia University, New York, New York 10027

The respiratory defect of pet mutants of Saccharo- myces cerevisiae assigned to complementation group G120 has been ascribed to their inability to acylate the mitochondrial phenylalanyl tRNA. A fragment of wild type yeast genomic DNA capable of complementing the genetic lesion of G120 mutants has been cloned by transformation with a yeast genomic recombinant li- brary of a representative mutant from this complemen- tation group. The gene designated as MSFl has been subcloned on a 2.2-kilobase pair fragment and its nu- cleotide sequence determined. The predicted protein product of MSFl has a molecular weight of 55,314 and has several domains of high primary sequence homology to the a subunit of the Escherichia coli phen- ylalanyl-tRNA synthetase. Based on the phenotype of G120 mutants and the homology to the bacterial pro- tein, MSFl is proposed to code for the ct subunit of yeast mitochondrial phenylalanyl-tRNA synthetase. Disruption of the chromosomal copy of MSFl in the respiratory-competent haploid strain W303-1B in- duces a phenotype similar to G120 mutants but does not affect cell viability, indicating that the cytoplasmic phenylalanyl-tRNA synthetase of yeast is encoded by a separate gene. Although the E. coli and yeast mito- chondrial aminoacyl-tRNA synthetases are suffi- ciently similar in their primary sequences to suggest a common evolutionary origin, they have undergone sig- nificant changes as evidenced by the low homology in some regions of the polypeptide chains and the pres- ence in the mitochondrial enzyme of two domains that are lacking in the bacterial phenylalanyl-tRNA syn- thetase.

Mitochondria contain a complete protein synthetic appa- ratus distinct for the most part from that of the cytoplasm. Yeast mitochondrial DNA codes for all RNA components of the mitochondrial translation system including the 15 and 21 S rRNAs and 24 transfer RNAs (1-3). With the sole exception of the ribosomal protein varl, all proteins required for mito- chondrial translation are coded for by nuclear DNA and imported from the cytoplasm into the matrix (1-3). ""

*This research was supported by National Science Foundation Grant PCM-8116680 and by National Institutes of Health Research Service Award GM09109 (to A. M. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "aduertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted

502691. to the GenBankTM/EMBL Data Bank with accession number(s)

$ Present address: Dept. of Pathology, Duke University Medical Center, Durham, NC 27710.

5 Present address: Dept. of Biochemistry and Biophysics, Iowa State University, Ames, IA 50011.

Nuclear genes have been isolated which code for several components of the mitochondrial protein synthetic apparatus including elongation factor mEF-Tu (4), two ribosomal pro- teins ( 5 ) , and the tryptophanyl-, threonyl-I-, and histidinyl- tRNA synthetases (6-8). In all except one case, these proteins function exclusively within mitochondria, since inactivation of the genes blocks respiratory metabolism without impairing the ability of cells to grow on fermentable substrates (5-9). Evidence that single nuclear mutations can simultaneously prevent modification of both cytoplasmic and mitochondrial tRNAs suggested that nuclear genes are capable of encoding both mitochondrial and cytoplasmic forms of given enzymes (10). Direct evidence confirming this model has been obtained by molecule analysis of the HTSl gene coding for the cyto- plasmic and mitochondrial forms of histidinyl-tRNA synthe- tase (8). Thus, biogenesis of the mitochondrial translation machinery depends on expression of both organelle-specific genes and shared genes which are also required for cyto- plasmic protein synthesis.

We report here the identification of a nuclear respiratory- deficient mutant of yeast (pet)' blocked in mitochondrial protein synthesis due to an absence of phenylalanyl-tRNA synthetase. This enzyme has been characterized in numerous organisms and in most cases is composed of two different subunits in an az& configuration (11). Complementation of the pet mutant has allowed the isolation and characterization of the gene encoding the a subunit of the mitochondrial phenylalanyl-tRNA synthetase. This gene has been named MSFl (mitochondrial aminoacyl-tRNA synthetase, phenyl- alanine a subunit). The function of the protein encoded by MSFl is confined to mitochondria, being required for respi- ratory competence but not for cell viability.

MATERIALS AND METHODS

Strains and Media-The yeast strains used in this study are listed in Table I. Thepet mutants C233, C303, E255, and N126 were isolated following mutagenesis of the wild type haploid Saccharomyces cere- uisiae D273-10B/Al with nitrosoguanidine or ethyl methanesulfonate (16). Nonselective medium (YPD) contained 1% yeast extract, 2% peptone, and 2% glucose. Biochemical analyses were done on cells grown to early stationary phase in 1% yeast extract, 2% peptone, and 2% galactose (YPGal). Respiratory competency was scored as growth on medium containing 1% yeast extract, 2% peptone, and 3% glycerol (EG). Selection for auxotrophic markers was done on 0.67% nitrogen base without amino acids (Difco) and 2% glucose (WO) supplemented as needed with adenine, histidine, leucine, methionine, tryptophan, and uracil a t a final concentration of 20 pglml. All growth of yeast was a t 30 "C, and solid medium was supplemented with 2% agar. Plasmids were amplified in E. coli RR1 (pro leu thi lacy galK2 xyl-5 mtl-1 ara-14 rpsL20 supT44 hsdM hsdR X-) grown on 1% tryptone,

The abbreviations used are: pet, nuclear respiratory-deficient mutant; kb, kilobase pair(s); po, cytoplasmic petite mutant lacking mitochondrial DNA; p-, cytoplasmic petite mutant with a deleted mitochondrial genome; mit-, cytoplasmic petite mutant with a point mutation in mitochondrial DNA.

___"

3690

Mitochondrial Phenylalanyl-tRNA Synthetase a Subunit 3691

TABLE I Genotypes and sources of S. cereuisiae strains

Strain Genotype Source -

D273-10B/AI a,p+,met6 Ref. 12 CBll a,p+,adeI Ref. 13 KL14-4Bp0 a,pO,aux P. Slonimski"

51p0 a,pO,aux Ref. 15 LL20 (u,p+,leu2-3,I12,his3-11,~5 Ref. 14

W303-1A a,p+,ade2-l,his3-11,15,leu2- R. Rothstein' 3,112,trpl-l,ura.j"I

W303-1B c~,p+,ade2-1,his3-I1,15,leu2- R. Rothsteinb

C303 3,112,trpI-l,ura3-1

(u,p+,met6,msfl-l This study E255 a,p+,met6,msfl-3 This study N126 a,p+,met6,msfl-4 This study C233 a,p+,met6,msfl-2 This study B303 a,p+,adel,msfl-1 C303 X CB 11 aE255 a,pf,adel,msfl-3 E255 X CBll aN126 a,p+,adel,msfl-4 N126 X CBll aE255JAL a,p+,ade2-1,leu2-3,112,msfI-3 E255 X W303-1A N126/AHLMW oc,p+,ade2-l,his3-lI,15,leu2- N126 X W303-

C303/L2 oc,p+,leu2-3,112,msfl-l B303 X LL20 W303VMSF1 a,p-,ade2-l,his3-11,25,ku2- This study

3,112,trpl-I,ura3- 1,MSFI::HIS3

3,112,met6,trpl-l,msfl-4 1A

a Centre de Genetique Moleculaire du Centre National de la Re-

* College of Physicians and Surgeons, Columbia University, New cherche Scientifique, Gif-Sur-Yvette, France.

York.

0.5% yeast extract, 0.5% NaCl, 0.1% glucose, and 50 pg/ml ampicillin with 1.5% agar for solid medium.

Transformation of Yeast-The plasmid library used for transfor- mation of yeast consisted of partial Sau3A digestion products of nuclear DNA from wild type strain D273-10B cloned into the BamHI site of the shuttle vector YEpl3 (17). Transformations were according to published procedures (18-20).

Miscellaneous Procedures-Standard techniques were used for preparation of recombinant plasmids from E. coli, restriction enzyme mapping, subcloning of yeast genomic DNA, and radioactive labeling of DNA by nick translation (21). Mitochondria were isolated as described by Faye et al. (22). In vitro aminoacylation assays of mitochondrial extracts and separation of charged tRNAs by RPC-5 chromatography was performed according to Pape et al. (7). DNA sequences were determined by the method of Maxam and Gilbert (23) using 5' end-labeled single-stranded restriction fragments. All sites used for 5' end-labeling were crossed from distal sites. Characteriza- tion of respiratory-deficient strains by absorption spectra of mito- chondrial cytochromes and in vivo protein synthesis in the presence of cycloheximide was described by Tzagoloff et al. (16). Northern hybridization analysis of mitochondrial RNA using portions of the oxil and oxi2 genes as probes utilized the procedures of Bonitz et al. (24). Southern hybridization analysis of genomic DNA was according to Myers et al. (9).

Computer Analysis-The predicted amino acid sequence of the MSFl gene product was compared to amino acid sequences ofproteins collected in the Protein Identification Resource data base using the DFASTP program (25). The optimal alignment of the a subunits of mitochondrial and E. coli phenylalanyl-tRNA synthetases was com- puted using the MFALGO program (26).

RESULTS

Properties of msfl Mutants-Approximately 2000 inde- pendent respiratory deficient mutants isolated in our labora- tory have been grouped by genetic analysis into 207 comple- mentation groups. Complementation group GI20 contains four mutants designated C303, C233, E255, and N126 (Table 11). Each mutant forms respiratory-competent diploids when mated to a po strain with a wild type nuclear genome, indicat- ing that they contain wild type mitochondrial DNA and recessive nuclear mutations designated msfl-I, msfl-2, msfl- 3 , and msfl-4, respectively. The mutant strain C303 was chosen as a representative of group G120 for further analysis.

TABLE 11 Genetic complementation matrix

Cells of opposite mating type were mixed in patches on nonselective glucose plates (YPD), incubated for 18 h at 30 "C, and replica plated to minimal medium (WO) to select diploid cells. After 1 day, colonies of diploid cells were replica plated onto glycerol medium (EG) to assay respiratory competence. + indicates growth of respiratory- competent diploids on glycerol and - indicates lack of growth on this medium. Strain W303VMSF1 fails to complement the pa tester (cross marked by the asterisk) due to secondary generation of cytoplasmic petites caused by inactivation of MSFl.

Strain B303 aE255 aE255/AL aN126 51p0 CBll

C233 - + C303 - C303/L2

- + +

E255 N126

- + N126/AHLMW -

- + W303VMSF1 -

- + KL14-4Bp0 + + + + -

- - - - -

- - - - - - - - - -

- - - - - -* +

This mutant shows no growth on glycerol medium after 4 days, and reversion to respiratory competence occurs at a frequency of less than 1 X IO"'. Growth of a purified p+ colony for 30-40 generations in nonselective YPD medium results in conversion of 20% of the segregants to cytoplasmic petite mutants.

Difference spectra of mitochondrial cytochromes from (2303 revealed strongly reduced levels of both cytochromes u,a3 and cytochrome b compared to a respiratory-competent strain (data not shown). This pleiotropic defect is due to a block in mitochondrial protein synthesis, which was demonstrated by the failure of C303 to incorporate [35S]methionine into mito- chondrial polypeptides during pulse labeling in the presence of cycloheximide. Analysis of mitochondrial RNA by North- ern blot hybridization showed accumulation of normal mRNAs from both the oxil and oxi2 genes, demonstrating that the pleiotropic phenotype of msfl mutants i s not caused by a defect in transcription of mitochondrial DNA (data not shown).

msfl Mutants are Deficient in Mitochondrial Phenylalanyl- tRNA Synthetase-Molecular analysis of a gene which com- plements three msfl alleles suggested that loss of mitochon- drial protein synthesis might be due to inactivation of the mitochondrial phenylalanyl-tRNA synthetase (see below). The activity of this enzyme was assayed in mitochondrial extracts from a wild type strain and two strains carrying different msfl alleles. Each extract was used to charge total tRNAs of wild type mitochondria in the presence of [3H] phenylalanine and [3H]tryptophan. The acylated tRNAs were separated by RPC5 chromatography to assess the activity of the two synthetases in the mitochondrial extracts (Fig. 1). The wild type extract charged three tRNA species, eluting at the positions of mitochondrial tRNAPhe, tRNATm, and a third at the position of cytoplasmic tRNAPhe.' The msfl-1 mutant charged the latter two tRNAs as well as wild type but was markedly deficient in charging mitochondrial tRNAPhe. The strain carrying a disrupted m s f l allele (MSFl::HZS.3, see below) was completely ineffective in charging mitochondrial tRNAPhe, although charging of mitochondrial tRNAT* or cytoplasmic tRNAPhe was unaffected. These data suggested that the absence of mitochondrial translation in msfl mutants is probably due to a mutation in the mitochondrial phenylal- anyl-tRNA synthetase. The presence of the charged cyto- plasmic tRNAPhe species presumably is due to contamination of the mitochondrial tRNA fraction with some cytoplasmic

G. Macino and A. Tzagoloff, unpublished results.

3692 Mitochondrial Phenylalanyl-tRNA Synthetase CY Subunit

(MSFI::HIS3)

40 60 80 FRACTION NUMBER

FIG. 1. Aminoacylation of the mitochondrial phenylalanyl- and tryptophanyl-tRNAs with mitochondrial extracts from wild type and mfl mutants. Mitochondria were lysed in 0.5% Triton X-100, and the resultant soluble enzyme fraction was used to aminoacylate a wild type mitochondrial tRNA fraction in the presence of [3H]phenylalanine and [3H]tryptophan as described by Pape et al. (7). The charged products were separated by chromatography on RPC-5, using a linear gradient of 0.38-0.75 M NaC1. Total acid precipitable counts in each fraction are plotted versus fraction num- ber. Under these conditions, charged tRNAPhe is known to elute within fractions 40-60 and tRNATv within fractions 70-80. The third charged tRNA species aminoacylated by these mitochondrial extracts (fractions 65-75) exhibits the elution properties of cytoplasmic tRNAPh? Strain W303VMSF1 containing the disrupted allele MSFI::HZS3 (see text) is completely unable to charge mitochondrial tRNAPhe, whereas the msfl-1 strain C303 exhibits only a trace of the wild type charging activity. Both strains show the same ability to charge mitochondrial tRNATv and the putative cytoplasmic tRNAPhe as do isogenic wild type strains.

tRNAs, and of the mitochondrial extracts with cytoplasmic aminoacyl-tRNA synthetases.

Isolation of MSFl-The wild type gene capable of comple- menting msfl-1 was selected by transformation of C303/L2 with a library of wild type yeast nuclear DNA inserted into the shuttle vector YEp13 (17). The respiratory-competent clone C303/L2/T1 was found to harbor the wild type MSFl gene as part of an autonomously replicating plasmid as dem- onstrated by cosegregation of the LEU2 gene of YEpl3 with the respiratory-competent phenotype during vegetative growth. This plasmid, pG120/T1, was isolated from C303/L2/ T1, amplified by transformation of E. coli, and analyzed by mapping of restriction enzyme recognition sites. Segments of the 8.0-kb yeast DNA fragment of pG12OITl were subcloned into the shuttle vector YEp351 (27) and tested for the ability to transform C303/L2 to respiratory competence (Fig. 2). The smallest recombinant plasmid capable of transforming msfl- 1 contained a 2.2-kb yeast DNA fragment bounded by Sac1 and KpnI sites (pG120/ST10).

Plasmid pG120/ST10 was tested for the ability to comple- ment other msfl mutants assigned to complementation group G120. Both aE255/AL and N126IAHLMW carrying the al- leles msfl-3 and msfl-4, respectively, were complemented for both leucine prototrophy and respiratory competence upon uptake of the plasmid. The newly acquired phenotypes coseg- regated during vegetative growth, indicating that transfor-

G. Macino and A. Tzagoloff, unpublished data.

NH2 COOH

S C H M K H S -

S

H

COMPLEMEN - PLASMID TATION OFmrfl

pGIZOITI + pGIZO/STI + pGIZO/STZ -

pGIZO/ST3 + pG120/ST4 -

~G120/ST5 + pG120/ST6 - pG120/ST7 - pGlZO/STIO i-

FIG. 2. Localization 'of MSFl within the yeast genomic DNA contained in pG12Op"l. A partial restriction map of the nuclear DNA insert in pG12O/T1 is presented in the upper part of the figure. Bars indicate regions of the original insert subcloned into YEp351 to form the plasmids pGl20/STl-pGl2O/STlO. The ability of each plasmid to complement the respiratory deficiency of the msfl- 1 strain C303/L2 is indicated by the + (complementation) and - (no complementation) signs. The locations of restriction enzyme recog- nition sites are indicated for Hind111 (H), KpnI ( K ) , Sac1 (C), SmaI (M), and SphI (S). The location and orientation of the MSFl gene determined by DNA sequence analysis (Fig. 4) is indicated by the solid box.

COOH

"- "+"* +"J t-l "tLj

L J c " - l

200 bp u

w

FIG. 3. Restriction fragments used to determine the DNA sequence of the genomic DNA insert of pG120/ST10. The location of restriction enzyme recognition sites used for 5' end- labeling are denoted by the symbols: MnoI (a), BglII (m), Hind111 (0), S m I (+), Hue111 (V), TuqI (V), SalI (e), DdeI (0). The direction and approximate extents of the sequences obtained are indicated by the arrows. The open box indicates the location of the open reading frame proposed to code for the MSFl gene product.

mation was due to the autonomously replicating plasmid. These data confirm the genetically defined allelism of the msfl mutants and demonstrate that complementation by the cloned gene is not allele-specific.

Characterization of MSFl-The nucleotide sequence of the 2.2-kb DNA insert in pG120/ST10 was determined by the method of Maxam and Gilbert (23) using the strategy depicted in Fig. 3. The sequence revealed an open reading frame beginning at an ATG initiation codon and extending for 1422 nucleotides before terminating at an amber stop codon (Fig. 4). This reading frame contains all the restriction sites delim- iting the region required for transformation of msfl mutants (Fig. 2) and is therefore likely to represent the wild type MSFl gene. The protein encoded by this reading frame con- sists of 474 amino acid residues with a calculated molecular weight of 55,314. The net charge of the predicted polypeptide is -1 with 28% of the residues being charged. There are no regions of hydrophobic amino acids that would suggest that the MSFl product is a membrane protein. The first 30 resi- dues contain 1 acidic residue (at position 2) and 5 basic residues, consistent with the observation that most other previously reported sequences for mitochondrial proteins have

Mitochondrial Phenylalanyl-tRNA Synthetase CY Subunit 3693

FIG. 4. Nucleotide sequence of MSFl and flanking regions. The se- quence shown begins 21 bp downstream of the Sac1 site and ends at the KpnI site (see Fig. 2). The amino acid sequence of the protein coded for by the open reading frame initiated by the methionine codon at nucleotide +1 and ending with the termination codon at nucleotide +1423 is shown above the DNA sequence. The locations of HindIII, BglII, and SmI recognition sites have been underlined for reference to Figs. 2,3, and 6.

-400 TGCTCAATClTCATTGCACAAAiAGTTGATTfiAATCAAl~AGCAGAACGCGACGAATT6ATGTCAAAACTGATTGAGTTATCGTCGAAGTTTCCCAAACCA

-700 ACTATACCGCCAGACGACGGTGATACTGCAG~~AMCAGGTTGA~GTAGAAAAGGAAAATGAAAC6ATAC~AGAATTT,ATGATTGCTTTACAGATACACl

-703 C~GGATATACAAACATATCCTACACAATTTGATTTTTATCTTCTAATGCTATTTATATATTCMATAATTTTMTACTGACAACGCTAATAATAATAGTT

-100 ACTTARTTAAGGTTTGAATCTTCGAGAAAAAAAAAGTTAGGMAATTAAGGAACTACTCACAAATTCAGAGGGAGAGAAGAGATMAACAAT~TC6GCCA

+1 ATG GAG GTA ACT TCA A T G TTT CTC AAT AGA ATG ATG AAG ACC AGG ACT GGT CTT TAT CGC TTPi TAT TCA ACC CTT M e t Glu V.11 T h r S e r M e t P h p L m A<" Prq Met Met Lys T h r A r g T h r G l y L e l r T y r A r g L e u T y r S e r T h r L e u

+76 A n n G T T CCA cnr GTA GAA A T C A A T r.Gc A i A .w TAC AAG ACC GAC CCA CAG A C T ACC A A T GTT ACA GAT TCA A T A L y s V a l rr-o t i i s V a l G l u I l e Acn G l y l l e Lv: T y r L y s T h r A s p P r o G l n T h r T h r A s n V a l T h r Asp Spr I l e

' 1 5 1 ATA e ACC GAC AGA T C A TTA CAI 1'1; AAA GAA Tcn CAT CCA GTA CCG PTT CTT CGC GAT CTA ATT GAA RAG I ~ P Lyi LPU T h r A s p nrrl S e r l e u P i s ILPU Lys G l u Vr H i s P r o V a l G l v Ilp Leu A r q A c p Lev I l e M U L y s

I I i n d l l I

L y s L Q U A s n Ser V a l A s p Asn T h r P ! w L y s T I C P h e A m 4 s n P h e C l u P r o V a l V a l T h r T h r M e t 6111 A s n P h e '276 AAA I T A AAC TCA r,TC GAC AAC A C A Tli AAG ATC T I T AAT AAT TTC TvAG CCC CTG GTA ACC ACA ATG CAA AAC TTC

B g l I I

+ 3 m GAT T C T T T A rm. T I T CCT A A G G A T C A T C S T GI.A AGA TCA AAA T C T GAC ACA TAT T A T ATA AAT GAG ACG CAC CTA A z p S e r i v ! t G l y Phr Pro 1 . ~ 5 A c p H i e P r o C : y A r g S e r L y s S w A c p T h r T y r T y r l i e A s n G l u T h r H i s L e u

'376 CTG AGA PCA C A T A C T TCA G C C ~ A C Gna T T A GAG TGC TTT CAA AM A T A AGA AAC GAT TCA GAT AAT ATT AAA AGT Leu Arq T h r H i < Tllr ' ,cr A l n t l i c G l u lLeu C l u C y s P h e Gln I.ys 11e A r q Asn A s p S e r A s p A s n Ile ~ y c S e r

' 4 5 1 GGA T I T I T A RTR TCC W \ ( A T GlG TAG A M ACA GAT GAA ATT LAC AAA ACT CAC T A T CCG GTA TTC CAC CAA ATG G l y P t i r 1 . m Ile Ser Ala Azp V a l T y r Arq A r q A s p Glu Ile A s p L y e Thr Ills T y r P r o V a l P h e H i s G l n M e t

'576 GAA GGn GCC Arb ATT TGG PAA CGA ACT MC K T GAT GTG GGC GTA AAG GAG CCA ATG TAT ATC GAG AAA ATC CGT G l u G I Y A l a T h r 11- Tr[ l :vc Arx~ T h r L y c A l a R e p V a l Oly V a l L y s G l u Pro Met T y r I l e Glu L y s I le A r g

+ h n l G A A CAT A T C A C A CAr. G T A I A G AAr f T T T T A RAT AAA GAA AAT GTA A A G A T 1 ACG 6 T T G W GAT GAT A C T ATA T C T Glu Asp llr Rrq Gln V a l 1,111 Asn I . e u Leu Asn L y s T21u Asn V a l Ivs I l e T h r V a l A s p A z p A s p T h r I l e P r o

1676 TTG AAA GAA A A T C C T Ann CAA GAG T A T ATG TCC GAT CTG GAG GTT GAT TTG TGC TCT CAA CAT TTT, AAG AGG Lou 1.y~ C l u A 5 n As,! Pvo ILyi G l n G l u T y r k t S e r A s p L e u G l u V a l Asp l e u Cys S e r G l n H i s Leu L y s A r q

+ 7 5 1 TCC A T T GAA CT[z ATA GTT T C l GAA GTT TTC AAC MA AAA ATA TCT ACL ATG A T r AAG APT AAA GCG AAT AAT ACA 5 c r I!r G l u I.ell l l e Vn1 :er CIII V,>1 P&P Asn Lys 1.~9 I I P S e r Ser ?bt l l e L y s A s n L y s A l a A s n A s n T h r

+ w h cci. PAP I;K C T G AAA r;Tc CI;T TIX A T T AA(, K T TAC TTC ccc TGG A r c GCG crc TCA TGG CAA ATA GAG GTT TCG Prr, L y s G l u I.I'I( lye. V * l Arc1 Trp l l e A c n A l a T y r P h e P r o Trp T h r A l a P r o S e r T r p G l u I l e Glu V a l T r p

t 9 0 1 TGG C A L G6C GAA TIX, C T L 6AA CTC iGl KGP TI,L GGA TTG ATT CGT CAA r,AI GTG CTA CTA AGA GCC GGA TAT AAA Trp Gln Gly 1 ' 1 1 1 i r p LPIJ L l u LPU Cys T.ly Cyc G l y ILeu I l e A r l Gln A s p V a l ILeu Leu A r q A l a G l y T y r L y s

P r o 5rr 1,111 T h r Ile C!y T rp A l a P h e G l y LPU G l y Leu Asp A r q I l e A l a Met L e u Leu P h e C l u l l e P r o A s p *976 r;rT TLI MA ACA m SCT T I T GI;C T T G GGT TTG GAC CGC ATT GCT ATG CTT CTT TTT GAA ATT CCA GAT

' I n 5 1 A T 1 AGA CTG i T T TGG A C i C G i 141 GAP1 OCA TTT TCA AGA C M TTC TCC AAG GGA T T A A T 1 ACT TCC TTC AAA CCG [ l e Arc! Lrll l .r l~ T r p +r fir,; ncrJ C l u Arq P h e S e r A m G l n P h e S e r Ly5 G l y I.PU I l e T h r S e r P h e L y s Pro

* l l ? f i TAT TCA A A A CAC CCC !&,I TCP T i l K G GAT C,TT GCG TTT TGG TTA CCA GAA GAT AAA CCA GAT ATT CAT CAP GTT Tyr Ser 1.vs Hi< P r o rs!y (et Phe Ary A l p V a l A l a P h e T r p Leu P r o G l u A c p L y e P r o ASP Ile His r,ln V a l

Sma I

H i s Glu Asn liqr L P U Met G l u 1 1 ~ l l e A n ] Asn I l e A l a G l y A c p L e u V a l 6 1 u S e r V a l L y s L e u V a l Aqp S e r 11701 C A T GAA A A T (;r,: r T G A T G GAA A T T A T C AGA AAT ATA GrT GGC GAT TTG GTA GAG AGT GTC RAG CTA GTC GAT AGC

P h e r h r H i s Pr-r> L y s T h r C l y A r q L y s S e r Met C y s T y r A r q I l e A r n T y r G l n S e r Met A s p A r g A s n L e u T h r '1P:h TTT ACG CAT LCf. AAA ACT 6GG AGA AAA TCT ATG TGC TAC AGG ATC AAC TAT CAA TCA ATG LAC AGA AAT TTG ACA

AI^ G I ~ Y ~ I nsn Thr L W t i l n Asp M F ~ VSI CYS ser L Y S L ~ U V a l Ly5 G l u Tyr Ser Val C l u Leu n r g *** t l J 5 1 AAC GCC GAA GTT M C ACT TTG CAA GAC ATG GTC TCT TCT AAA TTti tilA AAA GAA TAC AGC GTA GAA CTC ALA TAG

+I426 6 G A T A C ~ L A C T ~ A ~ C l A G ~ T ~ C A G G T G ~ ? T T A C C G C A G C T G T A T A T A l C ~ T ~ l A A A l A C T T T G T C A G ~ T T C l l T G T A T C A C T T C A A ~ C ~ A T ~ T T C ~ ~ C ~

+ I 5 2 6 ATCTATCTGTTTTfCTTAATTACTMGCATTTGCGtiCAATGCGATGACTACATAAMAAAAAAAATTCGMAMT~CATCAt iCCTTATTAACATC~GA

+I616 TTCTAGTCAACAGTAGGCCATCTGTGTTTCCATTAATCGCTGCATGTCATCGAGCAAGMAATCCTCATCCTCTATGGATCCGAGACAGWAACGCGCAT

t 1 7 Z 6 GATTTT~CTACnATCTTATCCCATCGACTAcATCGcTGGCATlTcTCCCATACATTTTGCTCCATCGGTtiATiATGUCC~ACAGGATATCTTGAAA~~tA

basic leader peptides (28). There is no bias of codon usage for alunyl-tRNA Synthetase cy Subunit-Use of the DFASTP this protein (Table 111) as there is for a number of highly program (25) to compare the predicted product of MSFl to expressed yeast genes (29), suggesting that the MSFl product available amino acid sequences of proteins revealed a signifi- is not an abundant protein. cant homology to the cy subunit of E. coli phenylalanyl-tRNA

Homology of the MSFl Gene Product with E. coli Phenyl- synthetase (30). A computer-generated alignment of the two

3694 Mitochondrial Phenylalanyl-tRNA Synthetase LY Subunit

TABLE 111 Codon usage in and amino acid composition of MSFl

UUUPhe12 UCUSer 8 UAUTyr10 UGUCys 1 UUCPhe 7 UCCSer 5 UACTyr 5 UGCCys 5 UUALeu 9 UCASer 14 UAA*** 0 UGA*** 0 UUGLeu 12 UCGSer 0 UAG * * * 1 UGGTrp10 CUU Leu 8 CCU P r o 5 C A U H i s 9 CGUArg 4 CUCLeu 4 CCCPro 4 C A C H i s 5 CGCArg 3 CUALeu 5 CCAPro 7 CAAGln 9 CGAArg 1 CUG Leu 5 CCG P r o 4 CAGGln 3 CGG Arg 0 AUUIle16 ACUThr 9 AAUAsn17 AGUSer 3 A U C I l e 8 ACCThr 7 AACAsn10 AGCSer 3 A U A I l e 11 ACAThr 9 AAALys 26 AGAArg 16 AUGMet 14 ACG Thr 4 AAG Lys 14 AGG Arg 4 GUUVa1 10 G C U A l a 5 GAUAsp23 GGUGly 2 GUC Val 4 GCCAla 4 GAC Asp 9 GGC Gly 6 GUAVa1 11 GCAAla 1 GAAGlu24 GGAGly 8 GUGVa1 5 GCGAla 3 GAGGlu12 GGGGly 3

proteins shows 23% identical residues over the amino-termi- nal 365 amino acids of the MSFl product with the introduc- tion of six insertion/deletions (Fig. 5). Local regions show a much higher extent of homology; 32 residues beginning at amino acid 99 of MSFl are 48% identical, 36 residues begin- ning a t amino acid 141 of MSFl are 38% identical, and 86 residues beginning a t amino acid 279 of MSFl are 41% identical. The amino termini of the two proteins are divergent, possibly due to the presence of a mitochondrial targeting sequence at the beginning of the MSFl protein. The mito- chondrial protein contains 109 residues at its carboxyl ter-

minus that are absent from the bacterial protein. The sub- clone pG120/ST6 contains the entire MSFl coding sequence except for the carboxyl-terminal 93 residues and yet is unable to complement msfl-1 (Fig. 2), indicating that the carboxyl- terminal region unique to the mitochondrial phenylalanyl- tRNA synthetase is required for enzyme activity.

Disruption of the Chromosomal Copy of MSFl-The chro- mosomal copy of MSFl was inactivated by the method of one-step gene disruption (31). Plasmid pG120/ST10 was di- gested at the unique BglII site within MSFI and ligated to a 1.7-kb BarnHI fragment of yeast DNA containing the wild type HZS3 gene (32). A 3.9-kb Sad-BamHI fragment contain- ing the disrupted copy of MSFl was purified from this recom- binant plasmid and used to transform the his3 strain W303- 1B to histidine prototrophy. The free ends of this linear fragment are expected to direct recombination a t homologous sites in the chromosome, resulting in replacement of the wild type copy of MSFl with the disrupted allele MSFl::HZS3. Ten transformants tested were all found to be respiratory deficient. One transformant, W303VMSF1, was shown to contain HIS3 integrated into its genome as evidenced by 100% retention of both the histidine prototrophy and respi- ratory deficiency among mitotic segregants.

The site of integration of HIS3 in the genome of W303VMSF1 was determined by Southern hybridization analysis of genomic DNA (Fig. 6). Total DNA from W303VMSF1 and the parent strain W303-1B was digested with EcoRI or HindIII, separated by agarose gel electropho-

Y. mit. 1- E.c. 1-

-209 -214

Y.mit. 210- L N K E N V K I T V D D D T I P L K E N N P K Q E Y M S D L E V D L C S Q H L K R S I E L I V S E V -259 E. c . 215- D T N I S F T N L K G T L H D F L R N F -234

~ . m i t . 359- E R F S R Q F S K G L I T S F K P Y S K H P G S F R D V A F ~ L P E ~ K P D I ~ Q V H E N D L M E I -408 E . c . 320- K a K -327

Y.mit. 409- I R N I A G D L V E S V K L V D S F T H P K T G R K S M C Y R I N Y Q S M D R N L T N A E V N T L Q -458

Y.mit.459- D M V C S K L V K E Y S V E L R -474

FIG. 5. Primary sequence alignment of the a subunits of E. coli (E. c.) and yeast mitochondrial (Y. mit.) phenylalanyl-tRNA synthetases. The amino acid sequence of the MSFl gene product was aligned with that of E. coli phenylalanyl-tRNA synthetase 01 subunit (30) using the MFALGO program (26). Positions with identical amino acids have been boxed. Conserved domains of greater than 30 residues which are identical a t 40- 50% of the positions are marked a t their amino-terminal borders by arrows.

Mitochondrial Phenylalanyl-tRNA Synthetase a Subunit 3695

s 1 2 3 4

bp 3,054 - 4,072 -

2,036 - 1,636- 1,018-

506 -

+P-

W303- IB

H c HWB HH GIB M K H d--C??>--L' W303VMSFI

MSFI+HIS3+ MSFI+ n

800 bp FIG. 6. Disruption of the chromosomal copy of MSFI. Ge-

nomic DNAs from the respiratory-competent parent W303-1B and the isogenic respiratory-deficient mutant W303VMSF1 were digested with HindIII or EcoRI, separated on a 1% agarose gel, and transferred to a nitrocellulose sheet. The 2.2-kb Sad-KpnI fragment containing MSFl (marked P) was radioactively labeled by nick translation and hybridized to the Southern blot under conditions of high stringency

W303VMSFl DNA digested with EcoRI. Lane 3, W303-1B DNA (9). Lane I, W303-1B DNA digested with EcoRI. Lane 2,

digested with HindIII. Lane 4, W303VMSF1 DNA digested with HindIII. Lane S, 5' end-labeled molecular weight standards (1-kb ladder, Bethesda Research Laboratories). The lower part of the figure shows restriction maps of the region of the chromosome containing MSFl in W303-1B and W303VMSFl. Solid lines represent native chromosomal DNA and dotted lines the inserted DNA containing HIS3. The MSFl and HIS3 genes are indicated by the solid and dashed bars, respectively, with the direction of transcription shown by the arrows. The positions of restriction enzyme recognition sites are indicated for HindIII (H), Sac1 (C), BgZII (G) , SmaI ( M ) , and KpnI (M. The probe is seen to hybridize with Hind111 fragments from W303-1B of 1.2 and 2.2 kb ( l a n e 3), in agreement with the restriction map of the region containing the wild type MSFl gene. The higher molecular weight bands of greater than 3 kb (lane 3) are due to incomplete digestion with HindIII. Genomic DNA from W303VMSF1 also contains the 1.2-kb band, but not the 2.2-kb band which is replaced in this mutant by a fragment of 2.8 kb ( l a n e 4). A second novel band of 0.8 kb is also detected in the mutant upon longer exposure of the autoradiograph (data not shown). The rear- rangement of the chromosomal region containing MSFl can be explained by replacement of the wild type allele with the disrupted gene MSFl::HlS3, as diagrammed in the lower part of the figure. The EcoRI fragment containing MSFI has also been enlarged in the mutant compared to the wild type strain, consistent with the replace- ment of the chromosomal MSFl gene with the disrupted mutant allele (lanes I and 2).

resis, and transferred to a nitrocellulose sheet. Hybridization with the radioactively labeled 2.2-kb insert of pG120/ST10 revealed that the overlapping EcoRI fragment is larger in the mutant than in the wild type parent, and the mutant contains three HindIII fragments that overlap the probe compared to two in the wild type (Fig. 6). The HIS3 gene contains two HindIII recognition sites, and the sizes of the HindIII frag- ments which overlap the probe are consistent with integration of HIS3 into the chromosomal copy of MSFl at the BglII site (Fig. 6). We conclude that the wild type MSFl allele has been replaced in W303VMSF1 by the mutant allele MSFl::HIS3.

As expected, W303VMSF1 forms respiratory-competent diploids when mated to a wild type strain, but fails to com-

plement any strain carrying a msfl mutation (Table 11). Thus, MSFl::HIS3 is recessive and is located within the same genetic element as the other msfl alleles. 9 of 10 transformant clones containing MSFl::HZS3 were unable to complement a po tester strain but were able to complement strains contain- ing mit- point mutations in various mitochondrial genes. Therefore, complete inactivation of MSFl results in the rapid loss of intact mitochondrial DNA and accumulation of p- genomes characteristic of null mutations in other genes re- quired for mitochondrial protein synthesis (9). Inactivation of MSFl does not render the cell inviable, indicating that the a subunit of the yeast cytoplasmic phenylalanyl-tRNA syn- thetase is encoded by a separate gene.

DISCUSSION

In this communication we present evidence that pet strains comprising complementation group G120 are blocked in mi- tochondrial protein synthesis due to an inability to acylate the mitochondrial tRNAPhe. The wild type gene (MSFl) af- fected in this group of mutants has been cloned and its nucleotide sequence determined. The predicted primary se- quence of the MSFl gene product shows a high degree of homology to the a subunit of the phenylalanyl-tRNA synthe- tase of E. coli. Based on this homology and the mutant phenotype, we propose that MSFI codes for the a subunit of mitochondrial phenylalanyl-tRNA synthetase. The predicted molecular weight of the MSFl gene product is 55,314, in good agreement with the estimated molecular weight of the purified a subunit of yeast mitochondrial phenylalanyl-tRNA synthe- tase (33).

Since disruption of MSFl does not lead to loss of cell viability, the a subunit of the yeast cytoplasmic phenylalanyl- tRNA synthetase must be encoded by a separate gene. This observation confirms previous biochemical data indicating distinct cytoplasmic and mitochondrial forms of this enzyme (33-35). Distinct genes also encode the mitochondrial and cytoplasmic forms of threonyl-1, tryptophanyl-, aspartyl-, and tyrosinyl-tRNA synthetase (6, 7, 36). At present, therefore, histidinyl-tRNA synthetase is the only yeast tRNA amino- acylase known to be coded for by a gene with a dual function (8).

The a subunit of mitochondrial phenylalanyl-tRNA syn- thetase contains several long regions of divergence from its E. coli counterpart. This observation is in contrast to the mitochondrial tryptophanyl- and tyrosinyl-tRNA synthe- tases, both of which show significant homology to the corre- sponding E. coli enzyme over the entire lengths of the mito- chondrial proteins (6, 36). Even though there is considerable sequence divergence between the yeast mitochondrial and E. coli proteins, several regions spanning 32, 36, and 86 residues share approximately 40-50% homology. The strong evolution- ary conservation of these amino acid sequences identifies portions of the enzyme likely to be required for catalytic activity. The MSFl product also contains two regions of approximately 60 (residues 181-240) and 109 (residues 366- 474) amino acids, respectively, which are not represented in the homologous E. coli protein. Computer searches fail to reveal significant homology of these regions with the p subunit of phenylalanyl-tRNA synthetase of E. coli or any other aminoacyl-tRNA synthetases whose primary sequences are known. The carboxyl-terminal stretch of 109 residues, how- ever, appears to be essential for mitochondrial phenylalanyl- tRNA synthetase activity, since a truncated gene lacking codons 380-474 is incapable of complementing msfl mutants.

3696 Mitochondrial Phenylalanyl-

REFERENCES 1. Dujon, B. (1980) in The Molecular Biology of the Yeast Saccha-

romyces, Life Cycle and Inheritance (Strathern, J. N., Jones, E. W., and Broach, J. R., eds) pp. 505-635, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

2. Tzagoloff, A., and Myers, A. M. (1986) Annu. Rev. Biochem. 5 5 ,

3. Wallace, D. C. (1982) Microbwl. Rev. 46,208-240 4. Nagata, S., Tsunetsugo-Yokota, Y., Naito, A., and Kaziro, Y.

5. Myers, A. M., Crivellone, M. D., and Tzagoloff, A. (1986) J. Biol.

6. Myers, A. M., and Tzagoloff, A. (1985) J. Biol. Chem. 2 6 0 ,

7. Pape, L. K., Koerner, T. J., and Tzagoloff, A. (1985) J. Biol.

8. Natsoulis, G., Hilger, F., and Fink, G. R. (1986) Cell 46,235-243 9. Myers, A. M., Pape, L. K., and Tzagoloff, A. (1985) EMBO J. 4 ,

10. Hopper, A. K., Furukawa, A. H., Pham, H. D., and Martin, N. C. (1982) Cell 28,543-550

11. Rauhut, R., Gabius, H.-J., Kuhn, W., and Cramer, F. (1984) J. Bwl. Chem. 259,6340-6345

12. Tzagoloff, A., Akai, A., and Foury, F. (1976) FEBS Lett. 65,391- 396

13. Federoff, H. J., Cohen, J. D., Eccleshall, T. R., Needleman, R. B., Buchferer, B. A., Giacalone, J., and Marmur, J. (1982) J. Bacterid. 149,1064-1070

14. Orr-Weaver, J. L., Szostak, J. W., and Rothstein, R. J . (1981) Proc. Natl. Acad. Sci. U. S. A. 78.6354-6358

15. Wolf, K., Dujon, B., and Slonimski, P. P. (1973) Mol. Gen. Genet.

249-285

(1983) Proc. Natl. Acad. Sci. U. S. A. 80, 6192-6196

Chem., in press

15371-15377

Chem. 260,15362-15370

2087-2092

125,53-90 16. Tzagoloff, A., Akai, A., and Needleman, R. B. (1975) J. Bid.

Chem. 250,8228-8235 17. Broach, J. R., Strathern, J. N., and Hicks, J. B. (1979) Gene 8,

18. Hinnen, A., Hicks, J. B., and Fink, G. R. (1978) Proc. Natl. Acad. 121-133

Sei. U. S. A. 75, 1929-1934

-tRNA Synthetase LY Subunit 19. Dieckmann, C. L., and Tzagoloff, A. (1983) Methods Enzymol.

20. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Boc- terwl. 153,163-165

21. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning, A Laboratory Man& Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

22. Faye, G., Kujawa, C., and Fukuhara, H. (1974) J. Mol. Biol. 88,

23. Maxam, A. M., and Gilbert, W. (1977) Proc. Natl. Acad. Sci. U.

24. Bonitz, S. G., Homison, G., Thalenfeld, B. E., Tzagoloff, A., and

25. Lipman, D. J., and Pearson, W. R. (1985) Science 227 , 1435-

26. Woodbury, N. W., and Doolittle, R. F. (1980) J. Mol. Euol. 15,

27. Hill, J. E., Myers, A. M., Koerner, T. J., and Tzagoloff, A. (1986) Yeast, 2, 163-167

28. Horwich, A. L., Fenton, W. A., Williams, K. R., Kalousek, F., Kraus, J . P., Doolittle, R. F., Koningsberg, W., and Rosenberg, L. E. (1984) Science 2 2 4 , 1068-1074

29. Bennetzen, J . L., and Hall, B. D. (1982) J. Bwl. Chem. 257,

30. Fayat, G., Mayaux, J.-F., Sacerdot, C., Fromant, M., Springer, M., Grunberg-Manago, M., and Blanquet, S. (1983) J. Mol.

97,355-360

185-203

S. A. 7 4 , 560-564

Nobrega, F. G. (1982) J. Biol. Chm. 257,6268-6274

1441

129-148

3026-3031

BWl. 171,239-261 31. Rothstein, R. J. (1983) Methods in Enzymology 101,202-210 32. Struhl, K. (1985) Nucleic Acids Res. 13,8587-8601 33. Diatewa, M., and Stahl, A. J. C. (1980) Biochem. Biophys. Res.

Commun. 94,189-198 34. Gabius, H.-J., and Cramer, F. (1982) Biochem. Biophys. Res.

Commun. 106,325-330 35. Schneller, J. M., Schneller, C., and Stahl, A. J. C. (1976) in

Genetics and Biogenesis of Chloroplusts and Mitochondria (Bucher, T., Neupert, W., Sebald, W., and Warner, S., eds) pp. 773-778, Elsevier-North Holland Press, Amsterdam

36. Tzagoloff, A., Crivellone, M., Gampel, A., Hill, J., Koerner, T. J., Myers, A., and Pape, L. (1985) in Achievements and Perspec- tives of Mitochondrial Research (Quagliariello, E., Slater, E. C., Palmieri, F., Saccone, C., and Kroon, A. M., eds) Vol. I1 pp. 371-378, Elsevier, Amsterdam