Isolation and characterisation of a novel human gene (C9orf11) onchromosome 9p21, a region frequently deleted in human cancer

Anna Ruiz 1, Miguel Angel Pujana 1, Xavier Estivill *Medical and Molecular Genetics Centre ^ IRO, Hospital Duran i Reynals, Autovia de Castelldefels km 2,7, 08907 L'Hospitalet de Llobregat,

Barcelona, Catalonia, Spain

Received 1 August 2000; received in revised form 26 September 2000; accepted 26 October 2000

Abstract

The chromosome 9p21 region has been described to be frequently deleted in several neoplasias. The cyclin dependent kinase inhibitor 2A(CDKN2A or P16) gene was cloned in this region and identified as a tumour suppressor gene. However, much evidence indicates theexistence of another tumour suppressor gene located proximal to the CDKN2A gene, which could be involved in cutaneous malignantmelanoma (CMM) initiation. In the present report we have further investigated this 9p21 chromosomal region and cloned and characteriseda novel gene within it (C9orf11). This gene shares no similarities to any known gene or predicted protein representing a novel human gene.Nevertheless, a putative leucine zipper pattern is located at the C-terminal end of the predicted protein, suggesting that it could dimerise.C9orf11 encodes for a protein of 294 amino acids with a predicted molecular mass of 32.8 kDa. C9orf11 is organised in eight exons thatencompass a region of approx. 13 kb. Expression analysis demonstrates that C9orf11 is highly expressed in testis, although minor expressionwas seen in other tissues. Mutations in the C9orf11 gene were not detected in CMM families that were negative for CDKN2A mutations.Two SNPs for the C9orf11 gene have been identified, which could be used in segregation or association studies for other disorders. ß 2000Elsevier Science B.V. All rights reserved.

Keywords: Cutaneous malignant melanoma; 9p21; Loss of heterozygosity; C9orf11 ; Novel gene

1. Introduction

The 9p21 chromosomal region has been identi¢ed as acandidate region to harbour a tumour suppressor geneinvolved in cutaneous malignant melanoma (CMM) aswell as in several other neoplasias such as glioma, meso-thelioma, bladder carcinoma and leukaemia [1^3]. The cy-clin dependent kinase inhibitor 2A (CDKN2A) gene, whichencodes for the P16 protein, an inhibitor of the cyclindependent kinases 4 and 6 (CDK4/CDK6), was clonedin this region and shown to be homozygously deleted inseveral kinds of tumour cell lines [4,5]. The CDKN2A genehas been found to be mutated in at least 50% of the mel-anoma families with linkage to 9p21, signalling it as afamilial melanoma tumour suppressor gene [6].

Much evidence indicates that at least another melanomatumour suppressor gene is located on chromosome 9p21.A very low mutation rate of the CDKN2A gene has beenfound in sporadic melanoma tumours [7^9]. Expressionstudies of the CDKN2A gene in sporadic malignant mela-noma indicate that this gene is mainly involved in inva-siveness and metastasis, rather than in tumour initiation[10]. These two observations, together with the descriptionby loss of heterozygosity (LOH) of a minimal critical re-gion in melanoma [11] and in lung carcinoma [12,13],proximal to the CDKN2A gene, indicate the existence ofanother tumour suppressor gene in this region. In additionto this molecular evidence, functional chromosomal trans-fer has also identi¢ed two regions on 9p21 that would beimplicated in melanoma development [14]. Moreover, alocus modifying melanoma risk located proximal to theCDKN2A gene has been described in Dutch melanomafamilies carrying CDKN2A mutations [15]. Zhu et al.[16] have also described a major quantitative trait locusfor mole density linked to the CDKN2A gene.

Our group is interested in the identi¢cation of geneslocated at the 9p21 region proximal to the CDKN2A

0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved.PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 2 7 2 - 4

* Corresponding author. Fax: +34-93-260-7776;E-mail : estivill@iro.es

1 Both authors have contributed equally to this work.

BBAEXP 93487 6-12-00

Biochimica et Biophysica Acta 1517 (2000) 128^134

www.elsevier.com/locate/bba

gene, which could be involved in the initiation and/or pro-gression of malignant melanoma [17]. In order to identifynew genes implicated in melanoma we started the physicalcharacterisation of the 9p21 chromosomal region proximalto the CDKN2A gene, between the D9S171 and D9S1086markers, covering the minimal critical region described inmelanoma [11]. We present here the identi¢cation, charac-terisation and precise physical localisation of a novel gene(C9orf11) on human chromosome 9p21, a region fre-quently deleted in human cancer.

2. Materials and methods

2.1. Isolation of human genomic clones

D9S169 and D9S1086 markers were used to hybridisethe human RPCI-1 PAC library purchased from the Hu-man Genome Mapping Project Resource Centre-UK(http://www.hgmp.mrc.ac.uk/). Positive clones were veri-¢ed by PCR analysis. PAC ends were sequenced usingPAC vector primers (5P-CACCGGAAGGAGCTGACT-GGGTTG-3P and 5P-GATGTTCATGTTCATGTCTCC-TTCTGTATGTACTGT-3P, T7 and SP6 primers) in orderto assemble the contig. From PAC end sequences, primerswere designed to develop new STSs.

YAC clones 942F10 and 922G2 mapping to the 9p21chromosomal region had been previously isolated from theCEPH library [17]. End sequences from clone 942F10 wereisolated using vectorette PCR ampli¢cation [18] and prim-ers were designed to develop new STS.

BLASTN [19] and NIX programs (G.W. Williams, P.M.Woollard and P. Hingamp, NIX: a Nucleotide Identi¢ca-tion System at the HGMP-RC) were used to analyse ge-nomic sequences at the HTGS database division of Gen-Bank.

2.2. cDNA isolation

Image clones obtained from the Human Genome Map-ping Project Resource Centre-UK were sequenced by Big-Dye Terminator RR Mix and analysed on an ABI 377automated sequencer (Applied Biosystems).

2.3. Expression pro¢le

A human multiple tissue expression array, which con-tained mRNA from di¡erent human tissues (cat. No.7775-1), and a human multiple tissue Northern blot (cat.No. 7766-1), which contained mRNA from eight di¡erentsources, were purchased from Clontech. These blots werehybridised with a 562 pb probe ampli¢ed from genomicDNA with primers 731147.1 (5P-CCACAGAAAGGA-GGCTCTGG-3P) and 731147.2 (5P-TAAGTGAAACC-AGGATAATCAAC-3P), at conditions recommended bythe manufacturer. Total RNA was extracted from lym-phocytes and skin samples using the Tripure isolationreagent (Boehringer Mannheim) according to the manu-facturer's instructions. Total RNA (2^5 Wg) was retrotran-scribed using 500 ng of random hexamers and 200 U ofSuperscript II reverse transcriptase (Gibco, Life Technol-ogies) in a 20 Wl reaction volume using conditions recom-mended by the manufacturer. C9orf11 expression analysisin human blood and skin samples, and in human foetalbrain and pancreas Marathon-Ready cDNAs purchasedfrom Clontech (cat. No. 7402-1 and cat. No. 7410-1, re-spectively), was performed by PCR with primers 163070(5P-CATACTCCCAATTATG-3P) and 163070.1 (5P-AGG-GTAGCACTACAGAATGC-3P).

2.4. Protein sequence analysis

Protein analysis was carried out using PSORT II

Table 1Intron-exon boundary sequences of the C9orf11 gene

Exon Size(bp)

5P splice donor Intron Size(bp)

3P splice acceptor Primers for SSCP analysis(forward and reverse) (5PC3P)

I ATTGAAGgtgagagagcattta I 241 atacttttttttagCATTGCC

II 126 AAACAATgtaagtctttaaagtga II v 2400 gcttttgtttttagATGTGTT CCACAGAAAGGAGGCTCTGG

TAAGTGAAACCAGGATAATCAAC

III 87 AAAAACGgtaagaagtgaaagg III 1827 ttcccttttcctagATAAAAC TCCAGGTATGAATACAGTGTAG

ACATGCTGATAATTCTTTTTCC

IV 87 ATTCAAAgtatttaaattactacact IV v 1500 ttttgttttaacagGATCAAC GCAATGGGGCCTTTCACTTC

GCTAGTTGCTGAAGACTTTCG

V 45 GCTAAAGgtaaagtcatacagct V 1285 atttgttttaacagCTATAAA CTAACAAACGAATGTTCCTCAAAC

GGTATTTAGACTGATCTTAGC

VI 60 ATTCCAGgtaagaacaaaatattt VI 3309 ctctttcttttcagAGTCTGA AGTAAGTGAACGTTGTTTACC

ATTATAGGCATTAGCCACTGC

VII 154 ATCTGAGgtaagtctgcagacct VII 1234 atttccttcttcagTTATAAA CAATCTTTACTCCTTCAGGAG

GAGAGAATGCGATGTCATGC

VIII 271 aacccggtgaagaatcttatt AGTTATAAAAGTTGTGAGAGTC

CCGCTCGAGGGTTCCTTGATTTCTTCACC

Intron sequences are shown in lowercase and exon sequences in uppercase. Exons I and II have been ampli¢ed in the same fragment.

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134 129

(http://psort.nibb.ac.jp/form2.html), SMART (http://coot.embl-heidelberg.de/SMART) and ScanProsite programs(http://www.isrec.isb-sib.ch/software/PFSCAN).

2.5. Mutational analysis of the C9orf11 gene in CMMfamilies

DNA samples were obtained from 29 CMM patientsbelonging to 17 CMM families. These families have beenpreviously described and they do not present mutations inthe CDKN2A gene [20]. Fifteen families presented mela-noma associated to dysplastic nevi. Primers were designedto amplify the di¡erent exons (except for exons 1 and 2that were ampli¢ed in the same fragment) (Table 1). Thesamples were run in 10% PAGE gels on a Multiphor IIElectrophoresis Unit (Pharmacia Biotech) at 18 W at 4³Cand silver stained.

3. Results

3.1. Isolation of human genomic clones and ESTidenti¢cation

In the process of the characterisation of the 9p21 chro-mosomal region involved in melanoma, we identi¢edRPCI-1 PAC clones 121K20, 168F19 and 286E19 byscreening with probes derived from markers D9S169 and

D9S1086. End sequencing of two of these clones (168F19and 286E19) provided us two new STSs (286E19A and168F19A ; GenBank accession No. AJ278502 andAJ278503, respectively). PCR analysis of marker286E19A showed that the three PACs isolated overlap(Fig. 1).

By BLASTN analysis of public databases we identi¢ed agenomic sequence belonging to BAC clone RPCI-11-57P14 (GenBank accession No. AL13341), which includedmarkers D9S169, 286E19A and 942F10R (GenBank acces-sion No. AJ278480). This sequence deposited at the HTGSdatabase division contains 25 unordered contigs, expand-ing approx. 180 kb of human genomic DNA on 9p21.NIX analysis of this genomic sequence revealed the pres-ence of at least nine EST/UniGene clusters apart from thetyrosine endothelial kinase (TEK) gene, which was previ-ously mapped to this chromosomal region [21]. The ¢rstintron of the TEK gene contains a copy (98% identity) ofthe ¢rst 750 bp of the Man-9 mannosidase (HUMM9) gene(GenBank accession No. X74837). This sequence includesthe 5P-untranslated region and the ¢rst 60 bp of theHUMM9 coding region.

We located the Image clones corresponding to the EST/UniGene clusters within PAC clones 121K20, 286E19 and168F19, and within YAC clones 942F10 and 922G2 byPCR, Southern hybridisation and comparison to contigsin the RPCI-11-57P14 genomic sequence (Fig. 1). FourUniGene clusters (Hs.76605, Hs.261512, Hs.128905 and

Fig. 1. Physical localisation of ESTs and UniGene clusters to the 9p21 chromosomal region where C9orf11 is located. (A) Physical map of the 9p21chromosomal region with the localisation of genes and markers to overlapping YACs. The melanoma minimal critical region (MMCR) is indicated. Po-sitions of markers are not in scale. (B) Localisation of ESTs and UniGene clusters to overlapping PACs is shown in bold. Genomic distances are indi-cated in kb. Localisation of PAC clone 121K20 was deduced by restriction enzyme analysis (data not shown). The genomic structure of the C9orf11gene is presented. Introns are not in scale with exons.

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134130

Hs.15286) map in the same contig of 18 018 nucleotidesfrom the RPCI-11-57P14 sequence, approx. 3 kb proximalto the 942F10R marker. All the UniGene clusters, exceptfor Hs.163070, expanded continuously in the genomicRPCI-11-57P14 clone sequence. Moreover none of them,except for Hs.163070, seem to have an open readingframe.

EST corresponding to GenBank accession No.AA582081 was single, expanded continuously in the ge-nomic sequence and part of it presented some identity tothe KIAA1138 protein (Japan Database accession No.BAA86452). ESTs with accession Nos. AA347750 andD61852 were located by BLASTN analysis in two humangenomic sequences from the HTGS database, one map-ping to 9q and the other to 9p21.

3.2. C9orf11 gene identi¢cation and characterisation

The Image clones 1292487, corresponding to Hs.163070,and 731147 were completely sequenced. BLASTN searchof these sequences showed identity with patent US5723315-A 18, the RPCI-11-57P14 clone and with a mouseEST (GenBank accession No. I89942, AL133411 and

C81058, respectively). Analysis of the complete sequenceof the longest transcript, clone 1292487, revealed that itcontained an open reading frame (ORF) of 882 bp, encod-ing for a protein of 294 amino acids with a predictedmolecular mass of 32.8 kDa (Fig. 2). The Image clone731147 corresponded to a shorter alternative transcriptwith an open reading frame of 240 bp and encoding fora protein of 80 amino acids, with a predicted molecularmass of 9.3 kDa (Fig. 3). No signi¢cant protein identitieswere found in public databases. Detection of functionaldomains and motifs by ScanProsite and PSORT revealeda leucine zipper pattern (PS00029) between amino acids184 and 205 in the longest transcript. C9orf11 nucleotideand predicted protein sequences are available at EMBLaccession No. AJ278482. The Human Gene NomenclatureCommittee (http://www.hgmp.mrc.ac.uk/nomenclature/)has approved the name.

The genomic structure of C9orf11 gene was obtainedcomparing the cDNA sequence with the RPCI-11-57P14genomic sequence, leading to the identi¢cation of eightexons. The two detected transcripts identi¢ed from Imageclones corresponded to alternative splice site usage at exonthree (Fig. 3). Image clone 731147 corresponds to a tran-script consisting in exons 1^6, with a longer exon 3 derivedfrom an alternative 3P splice site acceptor. As a result ofthis, the ORF is shorter than that of clone 1292487. Theintron-exon boundary sequences are described in Table 1.The C9orf11 gene spans approx. 13 kb of genomic DNA.

3.3. Expression pro¢le of C9orf11

Analysis of a Northern dot-blot revealed that theC9orf11 gene is highly expressed in testis with minor ex-pression in amygdala, heart, jejunum, kidney, pituitarygland, placenta, salivary gland and thymus (not shown).No expression was seen in the rest of the tissues. Northernblot hybridisation detected a band in testis of approx. 0.9kb, which corresponds to the longest ORF described (Fig.4). Although we hybridised with a probe derived from the5P of the gene, shared by both transcripts (Image clones1292487 and 731147), we could only detect the longestone, indicating that it represents most of the mRNA pop-ulation of the C9orf11 gene.

In order to detect possible C9orf11 expression in humanblood and skin tissues, we performed RT-PCR analysiswith primers designed from the cDNA sequence. Expres-sion of C9orf11 was seen in these tissues, with a smallerfragment ampli¢ed in skin and blood when compared totestis. This smaller transcript cannot be detected on aNorthern blot, suggesting that it is expressed at lowerlevels. Sequence analysis showed that it corresponded toan alternative transcript of the C9orf11 gene, which hadlost the fourth exon and resulted in a transcript of 795 bp,encoding for a predicted protein of 265 amino acids. RT-PCR ampli¢cation of brain and pancreas cDNA librarieswith the same primers only detected this alternative tran-

Fig. 2. Nucleotide and deduced amino acid sequences for the C9orf11gene. The putative start and stop codons are shown in bold. The puta-tive polyadenylation signal is doubly underlined. The predicted leucinezipper pattern is underlined.

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134 131

script (Fig. 3). In none of the tissues studied we coulddetect both transcripts.

3.4. C9orf11 mutational analysis

SSCP analysis of the C9orf11 gene in the CMM familiesrevealed two variants in the coding region (not shown).One of the variants was a silent change at codon 36 (nu-cleotide variant 108T/C). The other was located at codon274 (nucleotide variant 821C/A) and changed a lysine for athreonine (T274K). These changes were also present inhealthy controls.

4. Discussion

The human chromosome 9p21 region has been impli-cated in CMM and several other types of malignancies[3]. The CDKN2A gene has been described in this regionas a tumour suppressor gene. Nevertheless, the proximalregion to the CDKN2A gene has been described to containanother tumour suppressor gene implicated in melanomaand in other neoplasias [11^14]. We started the physicalcharacterisation of the 9p21 CDKN2A proximal region inorder to identify a gene which could be involved in theinitiation and/or progression of CMM [17]. For this pur-pose we analysed a public sequence of approx. 200 kb,that spans from the TEK gene to the D9S1086 marker.

We have mapped several EST/UniGene clusters to thisregion, although only one of them was spliced in the ge-nomic sequence and contained an ORF. The rest of theEST/UniGene clusters span continuously in the genomicsequence, being the result of spurious transcription fromcryptic tracks, ESTs with unspliced introns or transcribed

Fig. 3. (A) Genomic structure of the C9orf11 gene based on cDNA and genomic sequence comparison. The Image clone 1292487 represents the tran-script most abundantly expressed in testis. The Image clone 713347 is probably a rare transcript. The third transcript is expressed in other tissues exam-ined such as blood, brain, pancreas and skin and lacks the fourth exon. Coding exons are shown in dark boxes. Untranslated exon regions are shownin white. (B) cDNA sequence of the alternative exon 3 present in Image clone 731147 and derived from an alternative 3P splice site acceptor.

Fig. 4. Expression pro¢le of the C9orf11 gene. Hybridisation results fora multiple tissue Northern blot. A mRNA transcript of approx. 0.9 kbsize can be detected in testis (18 h exposure). A L-actin probe suppliedby the manufacturer was used as a loading control.

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134132

pseudogenes [21^24]. The NIX program identi¢ed in the¢rst intron of the TEK gene a 750 bp sequence with 98%of identity to the 5P sequence of the Man-9 mannosidase(HUMM9) gene. We could not identify further HUMM9sequence in the public genomic sequence analysed, sug-gesting that this HUMM9 fragment probably arose byduplication, representing an untranscribed pseudogene[25].

The unique UniGene cluster that was spliced in thegenomic sequence was Hs.163070. Complete sequence ofthese clones revealed an ORF that encodes for a protein of294 amino acids. Analysis of protein motifs revealed thepresence of a putative leucine zipper at the C-terminus ofthe predicted protein. Leucine zippers consist of a periodicrepetition of leucine residues at every seventh positionover a distance covering eight helical turns [26^28]. Leu-cine zippers have been described in many gene regulatoryproteins such as Myc, c-Jun and c-Fos oncogenes wherethey mediate homo- and heterodimerisation critical for theDNA binding properties of these transcription factors [27].Nevertheless, transcription factors also require basic do-mains for DNA binding. The C9orf11 predicted proteindoes not contain these types of basic domains and there-fore probably does not bind to DNA. Moreover, leucinezipper domains are not speci¢c of nuclear DNA bindingproteins. Dimerisation mediated by leucine zippers is nec-essary for the activity of a variety of enzymes such as thequiescent cell proline dipeptidase [29] or mixed lineage ki-nase-3 (MLK3) [30].

The US patent 5723315-A 18 presents 98% identity withthe C9orf11 gene sequence. It was isolated through theidenti¢cation of cDNA sequences that encode for secretedproteins [31]. Using this system, 83% of the recoveredsequences encode for proteins known to contain sequencesthat mediate transport of proteins into the secretion path-way. Seventeen per cent of the isolated clones were falsepositives, encoding for proteins known to be non-secreted.The authors suggested that this 17% of false positives isdue to the presence of amino acid sequences that mimic asecretion signal, derived either from the 3P-untranslatedregion or from coding regions employing a di¡erent read-ing frame. The C9orf11 gene presents in its 3P-untranslatedregion a sequence encoding a putative polypeptide of 64amino acids, beginning with a methionine, which couldmimic a putative secretion signal. This predicted polypep-tide is identical to sequence 19 from the same US patentbased in the same work [31]. This observation could ex-plain the isolation of the C9orf11 gene by this approach.

The C9orf11 gene is located between the new developedmarkers 286E19A and 942F10R, in a region frequentlydeleted in several human cancers. This location is approx.50 kb from the D9S169 marker that delimits the minimalmelanoma deleted region implicated in the initiation ofmelanoma. The analysis of the C9orf11 sequence in 17melanoma families that do not have mutations in theCDKN2A gene revealed no variants that segregated with

the disease, indicating that this gene is probably not asusceptibility gene for melanoma in these families.

In spite of the fact that the C9orf11 gene has no muta-tions in CMM families and is outside the minimal regiondeleted in melanoma, its location still makes it a goodpositional candidate for the development of other malig-nancies mapped in the 9p21 chromosomal region, aroundmarker D9S171. These diseases are autosomal dominantdiaphyseal medullary stenosis with malignant ¢brous his-tiocytoma and the multiple familial trichoepithelioma [32^34].

In summary, we have isolated, characterised and ¢nelymapped a new human gene, C9orf11, within the 9p21chromosomal region proximal to CDKN2A. No signi¢cantsimilarities have been found to known genes and proteinsindicating that C9orf11 represents a novel gene. Its chro-mosomal location targets C9orf11 as a positional candi-date for known diseases mapping to chromosome 9p21.

Acknowledgements

This work was supported by the Fundacio Pi i Sunyer/La Marato de TV3 and the EU Biomed Project No.BMH4-CT97-2284 to X.E. We would like to thank HelenaKruyer for help with the manuscript.

References

[1] L.A. Cannon-Albright, D.E. Goldgar, L.J. Meyer, C.M. Lewis, D.E.Anderson, J.W. Fountain, M.E. Hegi, R.W. Wiseman, E.M. Petty,A.E. Bale et al., Assignment of a locus for familial melanoma, MLM,to chromosome 9p13-p22, Science 258 (1992) 1148^1152.

[2] J.W. Fountain, M. Karayiorgou, M.S. Ernsto¡, J.M. Kirkwood,D.R. Vlock, L. Titus-Ernsto¡, B. Bouchard, S. Vijayasaradhi, A.N.Houghton, J. Lahti et al., Homozygous deletions within human chro-mosome band 9p21 in melanoma, Proc. Natl. Acad. Sci. USA 89(1992) 10557^10561.

[3] O.I. Olopade, S.K. Bohlander, H. Pomykala, E. Maltepe, E. VanMelle, M.M. Le Beau, M.O. Diaz, Mapping of the shortest regionof overlap of deletions of the short arm of chromosome 9 associatedwith human neoplasia, Genomics 14 (1992) 437^443.

[4] A. Kamb, N.A. Gruis, J. Weaver-Feldhaus, Q. Liu, K. Harshman,S.V. Tavtigian, E. Stockert, R.S. Day III, B.E. Johnson, M.H. Skol-nick, A cell cycle regulator potentially involved in genesis of manytumor types, Science 264 (1994) 436^440.

[5] T. Nobori, K. Miura, D.J. Wu, A. Lois, K. Takabayashi, D.A. Car-son, Deletions of the cyclin-dependent kinase-4 inhibitor gene inmultiple human cancers, Nature 368 (1994) 753^756.

[6] F.G. Haluska, F.S. Hodi, Molecular genetics of familial cutaneousmelanoma, J. Clin. Oncol. 16 (1998) 670^682.

[7] M. Ohta, H. Nagai, M. Shimizu, D. Rasio, D. Berd, M. Mastrangelo,A.D. Singh, J.A. Shields, C.L. Shields, C.M. Croce et al., Rarity ofsomatic and germline mutations of the cyclin-dependent kinase 4inhibitor gene, CDK4I, in melanoma, Cancer Res. 54 (1994) 5269^5272.

[8] E. Healy, S. Sikkink, J.L. Rees, Infrequent mutation of p16INK4 insporadic melanoma, J. Invest. Dermatol. 107 (1996) 318^321.

[9] A. Ruiz, S. Puig, M. Lynch, T. Castel, X. Estivill, Retention of theCDKN2A locus and low frequency of point mutations in primary

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134 133

and metastatic cutaneous malignant melanoma, Int. J. Cancer 76(1998) 312^316.

[10] J.A. Reed, F. Loganzo Jr., C.R. Shea, G.J. Walker, J.F. Flores, J.M.Glendening, J.K. Bogdany, M.J. Shiel, F.G. Haluska, J.W. Fountainet al., Loss of expression of the p16/cyclin-dependent kinase inhibitor2 tumor suppressor gene in melanocytic lesions correlates with inva-sive stage of tumor progression, Cancer Res. 55 (1995) 2713^2718.

[11] S. Puig, A. Ruiz, C. Lazaro, T. Castel, M. Lynch, J. Palou, A.Vilalta, J. Weissenbach, J.M. Mascaro, X. Estivill, Chromosome 9pdeletions in cutaneous malignant melanoma tumors: the minimaldeleted region involves markers outside the p16 (CDKN2) gene,Am. J. Hum. Genet. 57 (1995) 395^402.

[12] S.K. Kim, J.Y. Ro, B.L. Kemp, J.S. Lee, T.J. Kwon, K.M. Fong, Y.Sekido, J.D. Minna, W.K. Hong, L. Mao, Identi¢cation of threedistinct tumor suppressor loci on the short arm of chromosome 9in small cell lung cancer, Cancer Res. 57 (1997) 400^403.

[13] J.S. Wiest, W.A. Franklin, J.T. Otstot, K. Forbey, M. Varella-Gar-cia, K. Rao, H. Drabkin, R. Gemmill, S. Ahrent, D. Sidransky, G.Saccomanno, J.W. Fountain, M.W. Anderson, Identi¢cation of anovel region of homozygous deletion on chromosome 9p in squa-mous cell carcinoma of the lung: the location of a putative tumorsuppressor gene, Cancer Res. 57 (1997) 1^6.

[14] C.N. Parris, J.D. Harris, D.K. Gri¤n, A.P. Cuthbert, A.J. Silver,R.F. Newbold, Functional evidence of novel tumor suppressor genesfor cutaneous malignant melanoma, Cancer Res. 59 (1999) 516^520.

[15] P.A. van der Velden, L.A. Sandkuijl, W. Bergman, E.T. Hille, R.R.Frants, N.A. Gruis, A locus linked to p16 modi¢es melanoma risk inDutch familial atypical multiple mole melanoma (FAMMM) syn-drome families, Genome Res. 9 (1999) 575^580.

[16] G. Zhu, D.L. Du¡y, A. Eldridge, M. Grace, C. Mayne, L. O'Gor-man, J.F. Aitken, M.C. Neale, N.K. Hayward, A.C. Green, N.G.Martin, A major quantitative-trait locus for mole density is linkedto the familial melanoma gene CDKN2A: a maximum-likelihoodcombined linkage and association analysis in twins and their sibs,Am. J. Hum. Genet. 65 (1999) 483^492.

[17] A. Ruiz, M. Nadal, S. Puig, X. Estivill, Cloning of the human phos-pholipase A2 activating protein (hPLAP) gene on the chromosome9p21 melanoma deleted region, Gene 239 (1999) 155^161.

[18] J. Riley, R. Butler, D. Ogilvie, R. Finniear, D. Jenner, S. Powell, R.Anand, J.C. Smith, A.F. Markham, A novel, rapid method for theisolation of terminal sequences from yeast arti¢cial chromosome(YAC) clones, Nucleic Acids Res. 18 (1990) 2887^2890.

[19] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, Basiclocal alignment search tool, J. Mol. Biol. 215 (1990) 403^410.

[20] D.J. Dumont, L. Anderson, M.L. Breitman, A.M. Duncan, Assign-ment of the endothelial-speci¢c protein receptor tyrosine kinase gene(TEK) to human chromosome 9p21, Genomics 23 (1994) 512^513.

[21] A. Ruiz, S. Puig, J. Malvehy, C. Lazaro, M. Lynch, A.M. Gimenez-

Arnau, L. Puig, J. Sanchez-Conejo, X. Estivill, T. Castell, CDKN2Amutations in Spanish cutaneous malignant melanoma families andpatients with multiple melanomas and other neoplasia, J. Med. Gen-et. 36 (1999) 490^493.

[22] L.D. Hillier, G. Lennon, M. Becker, M.F. Bonaldo, B. Chiapelli, S.Chissoe, N. Dietrich, T. DuBuque, A. Favello, W. Gish, M. Haw-kins, M. Hultman, T. Kucaba, M. Lacy, M. Le, N. Le, E. Mardis, B.Moore, M. Morris, J. Parsons, C. Prange, L. Rifkin, T. Rohl¢ng, K.Schellenberg, M. Marra et al., Generation and analysis of 280,000human expressed sequence tags, Genome Res. 6 (1996) 807^828.

[23] T.G. Wolfsberg, D. Landsman, A comparison of expressed sequencetags (ESTs) to human genomic sequences, Nucleic Acids Res. 25(1997) 1626^1632.

[24] L.C. Bailey Jr., D.B. Searls, G.C. Overton, Analysis of EST-drivengene annotation in human genomic sequence, Genome Res. 8 (1998)362^376.

[25] A.J. Mighell, N.R. Smith, P.A. Robinson, A.F. Markham, Verte-brate pseudogenes, FEBS Lett. 468 (2000) 109^114.

[26] W.H. Landschulz, P.F. Johnson, S.L. McKnight, The leucine zipper:a hypothetical structure common to a new class of DNA bindingproteins, Science 240 (1988) 1759^1764.

[27] E.K. O'Shea, R. Rutkowski, P.S. Kim, Evidence that the leucinezipper is a coiled coil, Science 243 (1989) 538^542.

[28] F.K. Junius, S.I. O'Donoghue, M. Nilges, A.S. Weiss, G.F. King,High resolution NMR solution structure of the leucine zipper domainof the c-Jun homodimer, J. Biol. Chem. 271 (1996) 13663^13667.

[29] M. Chiravuri, H. Lee, S.L. Hurta, B.T. Huber, Homodimerizationvia a leucine zipper motif is required for enzymatic activity of quies-cent cell proline dipeptidase, J. Biol. Chem. (2000).

[30] I.W. Leung, N. Lassam, Dimerization via tandem leucine zippers isessential for the activation of the mitogen-activated protein kinasekinase kinase, MLK-3, J. Biol. Chem. 273 (1998) 32408^32415.

[31] K.A. Jacobs, L.A. Collins-Racie, M. Colbert, M. Duckett, M. Gold-en-Fleet, K. Kelleher, R. Kriz, E.R. LaVallie, D. Merberg, V.Spaulding, J. Stover, M.J. Williamson, J.M. McCoy, A genetic selec-tion for isolating cDNAs encoding secreted proteins, Gene 198 (1997)289^296.

[32] J.A. Martignetti, B.D. Gelb, H. Pierce, P. Picci, R.J. Desnick, Malig-nant ¢brous histiocytoma: inherited and sporadic forms have loss ofheterozygosity at chromosome bands 9p21-22 ^ evidence for a com-mon genetic defect, Genes Chromosomes Cancer 27 (2000) 191^195.

[33] J.A. Martignetti, R.J. Desnick, E. Aliprandis, K.I. Norton, P. Hard-castle, S. Nade, B.D. Gelb, Diaphyseal medullary stenosis with ma-lignant ¢brous histiocytoma: a hereditary bone dysplasia/cancer syn-drome maps to 9p21-22, Am. J. Hum. Genet. 64 (1999) 801^807.

[34] H. Harada, K. Hashimoto, M.S. Ko, The gene for multiple familialtrichoepithelioma maps to chromosome 9p21, J. Invest. Dermatol.107 (1996) 41^43.

BBAEXP 93487 6-12-00

A. Ruiz et al. / Biochimica et Biophysica Acta 1517 (2000) 128^134134