Investigation of Rab34 and Munc13 In The Secretory Pathway ... · Investigation of Rab34 and Munc13...

Investigation of Rab34 and Munc13 In The Secretory Pathway: Potential Roles In Diabetic Nephropathy

by

Neil Michael Goldenberg

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Institute of Medical Science University of Toronto

© Copyright by Neil Michael Goldenberg 2009

ii

Investigation of Rab34 and Munc13 In The Secretory Pathway:

Potential Roles In Diabetic Nephropathy

Neil Michael Goldenberg

Doctor of Philosophy

Institute of Medical Science University of Toronto

2009

Abstract

Constitutive secretion is responsible for the targeting of transmembrane proteins to the

plasma membrane, and for the secretion of extracellular matrix proteins, hormones, and other

cellular products. The basic steps of secretion are well understood – proteins synthesized in the

endoplasmic reticulum are transported in lipid-bound intermediates to the Golgi, and from the

Golgi to the plasma membrane or cell exterior. Dysfunction of the secretory pathway – either

constitutive or regulated – is involved in many disease states.

One such state is diabetic nephropathy (DN). DN is characterized by proteinuria, matrix

expansion, fibrosis and progression to kidney failure, and is the leading cause of renal failure

worldwide. Our lab had previously shown that munc13 is both upregulated and activated in the

diabetic kidney, and that munc13 is an effector of rab34. Study of rab34 in HeLa cells revealed

that rab34 is localized to the Golgi, and that it is required for the secretion of the Vesicular

Stomatitis Virus glycoprotein. Colocalization experiments, as well as the use of Brefeldin A,

localized the effect of rab34 to intra-Golgi transport. Further experiments indicated that glucose-

induced upregulation of munc13 in rat mesangial cells increased the rate of constitutive secretion

to the plasma membrane, and that this effect depended on its interaction with rab34. Finally,

iii

munc13 and rab34 were found to be required for the high glucose-mediated stimulation of

Transforming Growth Factor-β secretion from mesangial cells, placing these two proteins at a

key point in a pathway of physiological significance in the pathology of DN.

iv

Acknowledgments

I would like to thank Dr. Mel Silverman for being my supervisor and mentor for the past

five years. Dr. Silverman fostered my love of science and medicine, provided me with the

freedom to undertake a project of personal interest, and let me learn from my mistakes as I made

them. Most importantly, I have benefited from his open door and open mind throughout my time

in the lab. Dr. Silverman always had time for me, and was always there to provide perspective

when things looked the worst.

I would also like to thank my thesis committee, Dr. Reinhart Reithmeier and Dr. Sergio

Grinstein. There was never any doubt that my committee was on my side, and I have benefited

tremendously from the vast knowledge that Dr. Reithmeier and Dr. Grinstein have brought to my

project. A student couldn’t ask for better advisors, and they will always have my respect and

admiration.

Special mention must go to Dr. Sergio Grinstein and the Grinstein lab. Dr. Grinstein’s

generosity with his time, resources, and ideas are unparalleled. I always felt welcome in the

Grinstein lab, and was able to learn a great deal from the impressive group working there. Dr.

Grinstein has been a mentor in the truest sense of the word, and I feel lucky to have been able to

work with him – his lab is a model of what science should be.

Thank you to Sandy McGugan and the MD/PhD Program. You’re the only other people

who understand exactly what we all go through during this long program, and your support,

comic relief, and help in all facets of research life went above and beyond the call of duty.

Finally, none of this work would have been possible without the love and support of my

family. Mom, Dad, Jeff, Marnie, and Jackson – you’ve never questioned this odd path that I’ve

v

found myself walking, and you’ve been there for all the ups and downs along the way. You’ve

been my cheering section all these years. Vanessa – you’ve had to put up with all the mood

swings of a fledgling scientist, and you’ve done an incredible job. You always set me straight,

and I’m sure you always will.

vi

Table of Contents

Acknowledgments.......................................................................................................................... iv

Table of Contents ........................................................................................................................... vi

List of Figures ................................................................................................................................ ix

List of Abbreviations ..................................................................................................................... xi

List of Appendices ........................................................................................................................ xv

Chapter 1 ......................................................................................................................................... 1

1 Introduction ................................................................................................................................ 1

1.1 Cloning and Structural Analysis of munc13....................................................................... 1

1.2 Neurotransmitter docking and release ................................................................................ 5

1.3 Functional analysis of munc13 in the brain ........................................................................ 8

1.3.1 Munc13-1 binds syntaxin and is involved in vesicle priming ................................ 8

1.3.2 Munc13s are targeted to the active zone by RIM ................................................. 11

1.3.3 Munc13s mediate short-term plasticity................................................................. 12

1.3.4 Munc13 binds Calmodulin to regulate synaptic plasticity.................................... 13

1.4 Munc13 and PKC – Alternate targets of DAG signaling ................................................. 14

1.5 Munc13 is involved in pancreatic insulin secretion.......................................................... 17

1.5.1 Munc13-1 overexpression increases insulin secretion.......................................... 17

1.5.2 Munc13-1 deficiency reduces insulin secretion in vivo ........................................ 18

1.6 Munc13 is expressed in the kidney, and is implicated in diabetic nephropathy............... 19

1.6.1 Munc13 is upregulated in kidney cells during hyperglycemia ............................. 19

1.6.2 Munc13 is upregulated in a diabetic animal model, and may cause apoptosis in vivo ........................................................................................................................ 20

1.6.3 A polymorphism in the UNC13B locus is associated with diabetic nephropathy........................................................................................................... 21

1.7 Munc13 binds the small GTPase, rab34 ........................................................................... 22

vii

1.7.1 Munc13 is an effector of rab34............................................................................. 22

1.7.2 Rab structure and function .................................................................................... 22

1.7.3 Rab34 binds RILP and influences lysosomal positioning .................................... 25

1.7.4 Rab34 is involved in fluid-phase uptake at plasma membrane ruffles ................. 25

1.8 Rationale and hypothesis .................................................................................................. 26

1.8.1 General rationale ................................................................................................... 26

1.8.2 Part 1 – Investigation of rab34 function in HeLa cells ......................................... 26

1.8.3 Part 2 -- The role of the munc13-rab34 interaction in secretory pathway dynamics ............................................................................................................... 27

Chapter 2 ....................................................................................................................................... 29

2 Golgi-Bound Rab34 is A Novel Member of the Secretory Pathway ....................................... 29

2.1 Abstract ............................................................................................................................. 29

2.2 Introduction....................................................................................................................... 30

2.3 Materials and Methods...................................................................................................... 32

2.4 Results............................................................................................................................... 36

2.4.1 GFP-Rab34 is localized to the Golgi .................................................................... 36

2.4.2 Rab34 is not concentrated at membrane ruffles.................................................... 40

2.4.3 Rab34 does not participate in fluid-phase uptake ................................................. 43

2.4.4 Rab34 regulates lysosomal position, but does not effect the localization of the mannose 6-phosphate receptor.............................................................................. 43

2.4.5 Rab34 is required for secretion of VSVG-GFP at the Golgi ................................ 47

2.4.6 Rab34 depletion arrests intra-Golgi transport of VSVG-GFP, not Golgi to TGN transport ....................................................................................................... 56

2.4.7 Rab34 is not involved in ER to Golgi Transport .................................................. 60

2.5 Discussion ......................................................................................................................... 63

Chapter 3 ....................................................................................................................................... 68

3 Mesangial cell munc13 contributes to increased TGF-β secretion during hyperglycemia via a rab34-dependent pathway................................................................................................ 68

viii

3.1 Abstract ............................................................................................................................. 68

3.2 Introduction....................................................................................................................... 69

3.3 Materials and Methods...................................................................................................... 71

3.4 Results............................................................................................................................... 74

3.4.1 Culture of RMC in high glucose increases the rate of VSVG-GFP secretion ...... 74

3.4.2 The increased rate of VSVG-GFP secretion in HG-treated cells is due to upregulation of munc13 ........................................................................................ 75

3.4.3 The increase in the rate of VSVG-GFP secretion occurs via a rab34-dependent pathway ................................................................................................................. 80

3.4.4 Munc13-2 knockdown decreases TGF-β secretion .............................................. 86

3.5 Discussion ......................................................................................................................... 88

Chapter 4 ....................................................................................................................................... 92

4 Discussion And Future Directions ........................................................................................... 92

4.1 The subcellular localization of rab34................................................................................ 92

4.2 Potential roles for rab34 at the plasma membrane............................................................ 92

4.3 The role of rab34 in lysosomal position and function ...................................................... 93

4.4 The role of rab34 in constitutive secretion ....................................................................... 96

4.5 The role of munc13 in constitutive secretion.................................................................. 101

4.6 Munc13 in diabetic nephropathy .................................................................................... 103

References................................................................................................................................... 107

Appendices.................................................................................................................................. 115

Appendix A................................................................................................................................. 115

Appendix B ................................................................................................................................. 128

Copyright Acknowledgements.................................................................................................... 154

ix

List of Figures

Figure 1: MHD domain-containg proteins..................................................................................... 4

Figure 2: The synaptic vesicle cycle and the SNARE core complex.............................................. 6

Figure 3: The role of munc13 in vesicle priming ......................................................................... 10

Figure 4: Cellular DAG metabolism............................................................................................. 16

Figure 5: The rab GTPase cycle.................................................................................................... 24

Figure 6: Rab34 is localized to the Golgi in HeLa cells ............................................................... 38

Figure 7: Golgi-bound Rab34 is not concentrated at membrane ruffles and does not participate in

fluid-phase uptake ......................................................................................................... 42

Figure 8: Active Rab34 shifts lysosomes toward the MTOC, but does not effect the M6PR ...... 45

Figure 9: Dominant-negative rab34 or siRNA inhibit VSVG-Cherry transport from the Golgi to

the plasma membrane.................................................................................................... 50

Figure 10: Rab34 is necessary for exit of VSVG-GFP from the Golgi ........................................ 54

Figure 11: Rab34 is required for intra-Golgi transport of VSVG-GFP, not exit from the TGN .. 58

Figure 12: Rab34 is not involved in ER to Golgi transport .......................................................... 61

Figure 13: The rate of VSVG-GFP secretion is increased by high glucose ................................. 77

Figure 14: The increased rate of VSVG-GFP secretion in HG is due to munc13 upregulation... 78

Figure 15: The effect of munc13 on VSVG-GFP secretion is dependent on rab34 ..................... 82

Figure 16: Normal munc13 localization is required for it to exert its effect on VSVG-GFP

secretion......................................................................................................................... 84

Figure 17: Munc13 is involved in TGF-β secretion ..................................................................... 87

x

Figure 18: Munc13 transfection increases ceramide levels via rab34 and SPT.......................... 100

xi

List of Abbreviations

ACE: Angiotensin-converting enzyme

AGE: Advanced glycation end-product

AngII: Angiotensin II

ATP: Adenosine triphosphate

BFA: Brefeldin A

CA-GFP-Rab34: Constitutively active GFP-Rab34

DAG: Diacylglycerol

DDRT-PCR: differential-display reverse transcriptase polymerase chain reaction

DN-GFP-Rab34: Dominant-negative GFP-Rab34

ECM: Extracellular matrix

EndoH: Endoglycosidase H

ER: Endoplasmic reticulum

ERGIC: ER-Golgi intermediate compartment

EST: Expressed sequence tag

FACS: Fluorescence-activated cell sorting

FHL3: Familial hemophagocytic lymphohistiocytosis

xii

FISH: Fluorescence in situ hybridization

GAP: GTPase-activating protein

GDI: GDP dissociation inhibitor

GEF: Guanine nucleotide exchange factor

GFP: Green fluorescent protein

GGTase: Geranylgeranyl transferase

GPL: Glycerophospholipid

GS2: Griscelli Syndrome Type 2

GTP: Guanosine triphosphate

HA: Hemagglutinin

LAMP-1: Lysosome-associated membrane protein 1

LTP: Long-term potentiation

M6PR: Mannose 6-phosphate receptor

MC: Mesangial cell

MHC: Major histocompatibility complex

MHD: Munc13 homology domain

MTOC: Microtubule organizing centre

xiii

NCDZ: Nocodazole

NMJ: Neuromuscular junction

NSF: N-ethyl-maleimide-sensitive fusion protein

PDBu: Phorbol 12,13-dibutyrate

PDGF: Platelet-derived growth factor

PDMP: D-threo-1-Phenyl-2-decanoylamino-3-morpholino-1-propanol

PH: Pleckstrin homology

PI4K: Phosphatidylinositol 4-kinase

PI4P: Phosphatidylinositol 4-phosphate

PKC: Protein kinase c

PKD: Protein kinase d

PLC: Phospholipase c

REP: Rab escort protein

RFP: Red fluorescent protein

RILP: Rab7-interacting lysosomal protein

RNAi: RNA interference

siRNA: Short interfering RNA

xiv

SL: Sphingolipid

SNARE: Soluble NSF attachment protein receptor

SNP: Single nucleotide polymorphism

SPT: Serine palmitoyl transferase

STP: Short-term potentiation

STZ: Streptozotocin

TGF-β: Transforming growth factor β

TGN: Trans-Golgi network

TPA: 12-O-Tetradecanoylphorbol-13-acetate

TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labeling

VSVG: Vesicular stomatitis virus glycoprotein

wt-GFP-Rab34: Wild-type GFP-Rab34

xv

List of Appendices

Appendix A: Description of a PCR-based technique for DNA splicing and mutagenesis by

producing 5' overhangs with run through stop DNA synthesis utilizing Ara-C……………….. 115

Appendix B: The Inositol Phosphatase MTMR4 Is A Novel Target of The Ubiquitin Ligase

NEDD4…………........................................................................................................................ 128

1

Chapter 1

1 Introduction 1.1 Cloning and Structural Analysis of munc13 In C. elegans, unc-13 mutants exhibited uncoordinated movement and abnormal

pharyngeal pumping. While the musculature of the animals was unaffected, abnormal

connections existed between major interneurons, and immunohistochemistry revealed that motor

and sensory neurons were found in abnormal locations (Maruyama and Brenner, 1991; Ahmed et

al., 1992). Further, unc-13 mutants were resistant to acetylcholinesterase inhibitors even though

the enzyme itself was not altered. High levels of acetylcholine accumulated in the neurons as

well, in the absence of any changes in acetylcholine metabolism (Hosono et al., 1987; Siddiqui,

1990; Hosono and Kamiya, 1991). These observations lead to the hypothesis that the unc-13

gene product may somehow be involved in presynaptic neurotransmitter release within the

cholinergic system.

Molecular cloning of the C. elegans unc-13 gene by the laboratory of Sydney Brenner

lead to the characterization of the unc-13 gene product via expression of protein fragments in E.

coli. They found a 1734 amino acid protein containing areas of homology with the protein

kinase c (PKC) family that mapped to the C1 and C2 domains of PKC, and not to the kinase

domain (Maruyama and Brenner, 1991). Using purified protein from E. coli, they were able to

demonstrate phorbol ester binding in the presence of calcium, and put forward the idea that the

unc-13 product may be involved in a signal transduction pathway in the nervous system that

involved diacylglycerol (DAG), but was not part of the PKC pathway (Maruyama and Brenner,

1991). Further work by Brenner and others defined the phorbol ester binding properties of the

unc-13 product: phorbol ester binding was zinc- and phospholipid-dependent, stereospecific,

2

and high-affinity, with a Kd of 67 nM (Ahmed et al., 1992). These findings further suggested

that UNC-13 could be involved in DAG- and calcium-dependent neurotransmitter release. At

that time, the DAG- and calcium-dependent steps of neurotransmitter release had not been

determined, but it was known that these two second messengers had profound effects on this

pathway (Brose et al., 1995).

The first studies of a mammalian homologue of UNC-13 came from Nils Brose and

Thomas Sudhof, who began studying mammalian UNC-13 (named munc13) in the rat (Brose et

al., 1995). They screened a rat brain cDNA library, and found three distinct unc-13-related

proteins – all showing a high degree of sequence identity with the C. elegans protein -- that they

named munc13-1, munc13-2, and munc13-3 (Brose et al., 1995). The three isoforms of munc13

were found to have similar C-termini, and largely divergent N-termini. Their analysis confirmed

the presence of a C1 domain in all three proteins, as well as two separate C2 domains in each

(Brose et al., 1995). Like some other C2 domains, those present in munc13s were found to not

bind calcium or phospholipid in vitro. Brose also demonstrated that all three munc13 isoforms

were expressed specifically in the rat brain, and that munc13-1 appeared to be a peripheral

membrane protein associated with the synaptic plasma membrane (Brose et al., 1995).

As a final structural and genomic note, Brose’s laboratory defined two consensus

sequences found in all known munc13 isoforms, and named them munc13 homology domains

(MHD1 and MHD2) (Koch et al., 2000). Searching an expressed sequence tag (Mostov et al.)

library for these domains, they were able to identify several proteins containing MHD sequences

(Figure 1). Of note, two novel munc13 isoforms were found: one was a splice variant of

munc13-2 that was found to be ubiquitously expressed in all tissues tested. The second was a

novel munc13 isoform, munc13-4 (Koch et al., 2000). Munc13-4 seems to be a divergent family

3

member, lacking the C1 domain, but containing two C2 domains and both MHD domains.

While outside the scope of this review, munc13-4 was subsequently found to be mutated in the

blood disorder Familial Hemophagocytic Lymphohistiocytosis (FHL3) (Feldmann et al., 2003).

FHL3, like the related disease Griscelli Syndrome type 2 (GS2), is characterized by abnormal

immune function whereby cytotoxic T cells are unable to properly degranulate during the

immune response (Feldmann et al., 2003). In FHL3 patients, cytotoxic granules are normally

targeted and docked at the plasma membrane, but are unable to fuse with the plasma membrane

to release their contents to the extracellular space (Feldmann et al., 2003). Further work has

demonstrated that munc13-4 is an effector of rab27a on the granule membrane, and that the

munc13-4:rab27a interaction is critical for the cytotoxic T cell response, platelet degranulation,

and melanosome trafficking (Shirakawa et al., 2004; Neeft et al., 2005). Rab27a is a member of

the rab family of GTPases, to be discussed later in this thesis.

4

Figure 1. MHD-containing proteins. All munc13 family members contain a single C1 domain (except for munc13-4, not pictured), at least one C2 domain, and a single copy of the MHD1 and MHD2 domains. ubMunc13-2 is a synonym for hmunc13, and represents a ubiquitously expressed splice variant of brain-specific bMunc13-2. ce, C. elegans, r, rat. Taken from (Betz et al., 2001).

5

1.2 Neurotransmitter docking and release In order to further describe the function of munc13 in the brain, a brief description of the

events governing neurotransmitter vesicle release is required (Figure 2). Neurons store

neurotransmitter in pre-formed vesicles at the synaptic terminal. These vesicles dock at the

specialized active zone at the plasma membrane, where they undergo further maturation, termed

priming. Primed vesicles make up what is termed the readily releasable vesicle pool. When the

neuron is depolarized, the concentration of intracellular calcium increases, resulting in the

release of the contents of primed vesicles into the synapse via exocytosis. Subsequently, vesicle

membrane and proteins are recycled by endocytosis to an early endosomal compartment, from

where they can bud off to form vesicles for a new round of secretion (Sudhof, 1995). In

molecular terms, vesicle fusion and release rely upon the SNARE (soluble NSF attachment

protein receptor, where NSF is N-ethyl-maleimide-sensitive fusion protein) core complex,

consisting of synaptobrevin (on the vesicle membrane, also called VAMP), and syntaxin and

SNAP-25 (on the plasma membrane) (Sudhof, 1995). Each of these three proteins form coiled-

coils in their secondary structure, allowing them to adopt an extremely stable ternary complex,

which is resistant to heat, SDS denaturation, protease digestion, and cleavage with Clostridium

toxin (Chen and Scheller, 2001) (Figure 2). The stability of this complex means that ATP is

required to dissociate it, and this is achieved primarily by the small ATPase, NSF (Chen and

Scheller, 2001). Clearly, regulation of the formation and dissociation of the SNARE core

complex is of critical importance in a process as carefully coordinated as neurotransmitter

release.

7

Figure 2. The synaptic vesicle cycle and the SNARE core complex. A. Vesicles are loaded with neurotransmitter and are subsequently targeted to the active zone. After docking at the plasma membrane, a series of ATP-dependent steps, termed priming, occur in order to make the vesicle fusion-competent. Following an action potential, intracellular calcium spikes, resulting in exocytosis of the vesicle into the synaptic space. Neurotransmitter membrane proteins are then recycled via endocytosis for another round of the cycle. B. The SNARE core complex allows for the functional interaction of the vescile and target membranes. The coiled-coil structures of syntaxin, synaptobrevin, and SNAP-25 can be seen in interaction with each other as detailed in the text. Reprinted from (Chapman, 2002).

8

1.3 Functional analysis of munc13 in the brain

1.3.1 Munc13-1 binds syntaxin and is involved in vesicle priming

One of the first notable findings in determining the function of munc13 in the brain was

that munc13-1 interacts directly with syntaxin (Betz et al., 1997). Many proteins bind syntaxin,

but virtually all of these interactions occur near the C-terminal coiled-coil domain of the

molecule. In contrast, munc13-1 binds the N-terminal of syntaxin, and also co-

immunoprecipitates with the entire SNARE core complex (Betz et al., 1997). The only other

protein that was known to interact with the N-terminal of syntaxin was munc18, which produces

a similar phenotype in C. elegans as munc13 when disrupted (Hata et al., 1993). This finding

suggested that munc13 and munc18 might play a similar role in preparing vesicles for release at

the active zone. In fact, further work on the munc13-syntaxin interaction provided insight into a

potential mechanism for munc13-mediated vesicle priming. In order to form the SNARE core

complex, syntaxin must be available for pairing with VAMP and SNAP-25. Solution structures

of syntaxin showed that it is normally in a “closed” conformation that cannot pair with other

SNARE proteins (Dulubova et al., 1999). Richmond and others were able to show that in C.

elegans, mutant syntaxin that remained in an “open” conformation could bypass the need for

munc13-mediated vesicle priming (Richmond et al., 2001). From the other end of the complex,

Stevens and others were able to define the minimal domain of munc13-1 required for vesicle

priming. This domain contained, among other sites, the binding site for syntaxin (Stevens et al.,

2005). Together, these data led to the development of a model whereby syntaxin is normally

held in a closed conformation that cannot form the SNARE core complex. When munc13-1 is

recruited to the active zone membrane, it binds the N-terminal of syntaxin – potentially

9

displacing munc18 from this same site – stabilizing the open form of syntaxin which can then

form the core complex and initiate membrane fusion between the vesicle and the plasmalemma

(reviewed in (Martin, 2002)) (Figure 3). This model, with some modification, is still the

accepted standard for the mechanism of munc13-mediated vesicle priming.

The lab of Nils Brose went on to do the first functional studies of munc13-1 in

neurotransmission (Betz et al., 1998). They were able to show that munc13-1 was most highly

expressed in areas of high presynaptic density in the rat hippocampus. In light of this finding,

they proceeded to study munc13-1 function in Xenopus laevis neuromuscular junctions (NMJ)

that were overexpressing exogenous munc13-1 (Betz et al., 1998). Overexpression of wild-type

munc13-1 was found to greatly enhance the increase in evoked currents caused by phorbol ester

treatment as compared to wild-type NMJ. A munc13-1 H567K mutant that cannot bind phorbol

ester or translocate to the plasma membrane in response to phorbol ester had no effect on phorbol

ester-induced stimulation of NMJ activity, suggesting a direct role for munc13-1 in this

phenomenon (Betz et al., 1998). This was the first demonstration that munc13-1 expression

effects neurotransmitter release. Additionally, munc13-1 overexpression increased the basal

activity of NMJs, suggesting that endogenous DAG was capable of activating munc13-1 and

increasing neurotransmitter release at the active zone (Betz et al., 1998).

Knockout mice lacking endogenous munc13-1 died shortly after birth, even though

overall neural architecture remained normal (Augustin et al., 1999). Further investigation of

brain tissue from knockout animals revealed that while synapses formed normally in the absence

of munc13-1, the synaptic vesicle cycle was arrested at the maturation step in presynaptic

neurons. Glutaminergic neurons could not release neurotransmitter in response to action

potential, increased intracellular calcium, or hypertonic sucrose (Augustin et al., 1999). Similar

10

results were reported in double knock-out mice lacking munc13-1 and munc13-2, with the

double knock-out phenotype also including GABAergic neurons (Varoqueaux et al., 2002).

Figure 3. The role of munc13 in vesicle priming. One the left side, the resting state is shown. Syntaxin is maintained in a closed conformation via its interaction with munc18. Upon stimulation of the cell, there is an increase in the DAG content of the plasma membrane, which, in concert with RIM, recruits munc13 to the active zone. Munc13 then binds syntaxin (shown on the right half of the figure), displacing munc18 and stabilizing the open conformation of syntaxin. This allows for the formation of the SNARE core complex of syntaxin, synaptobrevin, and SNAP-25 so that vesicle fusion can occur. Reprinted from (Martin, 2002).

11

1.3.2 Munc13s are targeted to the active zone by RIM

How is munc13 targeted to the active zone? In 2001, an interaction between munc13-1

and the active zone protein, RIM was described (Betz et al., 2001). RIM is an effector of rab3,

which is a vesicle-associated rab protein (Wang et al., 1997). Interestingly, loss of the munc13-

1:RIM interaction phenocopies munc13-1 knockout, resulting in a marked loss of the readily

releasable vesicle pool and concomitant decreases in evoked potentials, suggesting a critical role

for this interaction in vesicle priming (Wang et al., 1997). This model is strengthened by data

showing that hippocampal neurons lacking endogenous RIM also display the same phenotype as

munc13-1 knockout cells (Calakos et al., 2004). The initial data detailing the interaction

between RIM and munc13-1 could be explained in one of three ways: (i) RIM targets munc13-1

to the active zone, (Yamamoto et al.) The interaction between RIM and rab3 provides a physical

link between munc13-1 and vesicles, allowing for increased vesicle priming, or (iii), RIM

interaction with munc13-1 somehow increases the intrinsic rate of munc13-1 “activity” (Betz et

al., 2001).

Further data from the Brose lab would shed light on this mechanism. By creating a

munc13-1 point mutant that does not bind RIM and expressing it in hippocampal neurons from

munc13-1/munc13-2 knockout mice, they were able to show that the point-mutant munc13-1

was not properly targeted to the active zone (Andrews-Zwilling et al., 2006). Additionally,

subcellular fractionation and immunoblotting showed that in RIM knockdown mice, munc13-1

and the ubiquitously expressed munc13-2 isoform are both downregulated and mistargeted in

hippocampal neurons (Andrews-Zwilling et al., 2006). Taken together, these data strongly

suggest that RIM is involved in the correct targeting of munc13-1 to the active zone. Additional

data has shown that, in fact, munc13-1, RIM, and Rab3 form a tripartite complex that is capable

of dictating the size of the readily releasable vesicle pool, and that this complex is involved in

12

bridging vesicle priming and a specific type of synaptic plasticity called long-term potentiation

(Dulubova et al., 2005).

1.3.3 Munc13s mediate short-term plasticity

Cortical neurons are capable of various adaptations to repeated stimuli that are thought to

form the basis of learning and memory (Malgaroli, 1999). One such change is long-term

potentiation (LTP), which is an activity-dependent enhancement of synaptic strength (Malgaroli,

1999). Another adaptation based on the use of the synapse is short-term plasticity (STP). This is

a presynaptic process by which a synapse adapts its transmitter release properties in response to

acute phase changes in activation patterns (Rosenmund et al., 2002). STP seems to depend on

the initial response of the synapse to stimulation: highly responsive synapses tend to depress

after repeated stimulation, while synapses with low initial release show increases in response in

the first stages of repeated stimulation (Rosenmund et al., 2002). These properties have to do

with the size of the readily releasable vesicle pool at a given synapse. The increases in

presynaptic efficacy are associated with increases in cytosolic calcium concentration at the

synaptic membrane (Zucker, 1999). Intriguingly, different synapses within one neuron can

exhibit different properties with respect to LTP and STP.

Within excitatory, glutaminergic neurons, this was found to be the case – some synapses

were dependent on munc13-1, while others depended on munc13-2. Further, munc13-1-

independent synapses use munc13-2 as a priming factor (Rosenmund et al., 2002). During high

frequency stimulation, these two types of synapses behave differently. Wild-type synapses

showed some depression during response to repeated stimulus. Munc13-1 knockout synapses,

on the other hand, exhibited a 200% increase in evoked potential over the same 10-pulse period

(Rosenmund et al., 2002). Since the wild-type cells contain munc13-1 and the knockout cells do

13

not, the different behaviour in the knockout cells can be attributed to munc13-2, suggesting that

the two isoforms affect different STP characteristics in synapses (Rosenmund et al., 2002).

Additionally, the two types of synapses behave differently following repeated

stimulation, not just during the stimulation phase. Wild-type synapses recover to normal levels

within seconds of the completion of a pulse sequence. Synapses from munc13-1 knockouts

exhibited augmentation of nearly 5-fold in comparison (Rosenmund et al., 2002). This was

specific to munc13, since rescue of the knockouts with virus-driven munc13-1 restored a wild-

type phenotype. These data, when taken together, suggest a model whereby munc13-1 is

depressing, and munc13-2 is augmenting, showing that the two proteins have significant, yet

differential roles in synaptic plasticity (Rosenmund et al., 2002). Further experiments directed at

munc13-2-dependent synapses demonstrated that augmentation is due to both an increase in the

readily releasable vesicle pool, and an increase in the concentration of intracellular calcium

(Rosenmund et al., 2002). Intrestingly, inhibitors of PKC failed to induce any change in the

phenotype of munc13-1 knockout synapses, but inhibition of phospholipase c (PLC) lead to an

almost complete loss of augmentation (Rosenmund et al., 2002). These results suggest that

augmentation occurs indepedently of PKC activation, and depends on DAG production,

presumably via binding to the munc13 C1 domain. Similarly, activation of munc13 isoforms

with phorbol ester resulted in differential increases in augmentation depending on the munc13

isoform involved at the synapse (Rosenmund et al., 2002).

1.3.4 Munc13 binds Calmodulin to regulate synaptic plasticity

While the role of DAG in augmentation and synaptic plasticity appears to be through

binding to the munc13 C1 domain, what is the role of increased intracellular calcium? An

additional layer was added to the role of munc13 in synaptic plasticity when it was found that

14

both munc13-1 and ubiquitous munc13-2 can bind calcium/calmodulin (Junge et al., 2004).

Munc13-1/munc13-2 double knockout neurons were rescued with either wild-type munc13, or a

mutant that cannot bind calmodulin to investigate the effect of calmodulin binding on synaptic

plasticity. It was found that calmodulin binding is induced during synaptic activity, and that this

interaction stimulates munc13 function, and controls the calcium dependence of STP (Junge et

al., 2004). The regulatory role of calcium/calmodulin appears to be through the modulation of

the size of the readily releasable vesicle pool (Junge et al., 2004). These studies provided critical

insight into a process that is at the heart of many cortical functions, and suggests that observed

phenotypes are due to the interplay between munc13 isoforms, intracellular calcium, and vesicle

priming mechanisms.

1.4 Munc13 and PKC – Alternate targets of DAG signaling DAG is produced by several pathways, including de novo synthetic routes, stimulations-

dependent pathways, and systems activated during pathological processes, such as the polyol

pathway during diabetes (Carrasco and Merida, 2007) (Figure 4). Phorbol esters, which are

pharmacological analogs of DAG, have long been studied as inducers of synaptic transmission

changes in neurons. Phorbol esters are capable of mimicking repetitive stimulation to cause

increased presynaptic efficacy through binding to C1 domain-containing proteins (Rhee et al.,

2002). Historically, studies using inhibitors of poor specificity had lead to the conclusion that

the effects of phorbol esters on neurotransmission were achieved via PKC-dependent pathways

(reviewed in (Silinsky and Searl, 2003)). Upon the discovery of munc13s, these studies were

called into question, since non-specific C1 domain inhibitors would have also affected munc13

proteins. To separate the roles of PKC and munc13, the Brose laboratory engineered munc13

knockout mice that expressed a mutant munc13-1 lacking a functional C1 domain (Rhee et al.,

15

2002). Experiments on neural tissue from these mice revealed that the phorbol ester receptor

responsible for the acute regulation of presynaptic neurotransmitter release is munc13 (Rhee et

al., 2002). These studies provided the first solid evidence that munc13s were solely responsible

for presynaptic adaptations to phorbol ester signaling, taking over from PKC as the prime

regulators of neurotransmitter release.

16

Figure 4. Cellular DAG metabolism. Shown above are schematic representations of cellular sources of DAG. De novo pathways arise from triglyceride metabolism and glycolysis. Stimulation-dependent pathways use PLC or PLD to metabolize membrane phospholipids into DAG, and include the largest source of DAG, namely metabolism of phosphatidic acid to DAG via phosphatidic acid phosphohydrolase enzymes. Shown at the top right is the polyol pathway, which becomes important during hyperglycemia in diabetes. Sphingomyelin synthase is found in the Golgi lumen and plasma membrane, and PLC and PLD are plasmalemmal. Other pathways take place in a variety of intracellular compartments.

17

1.5 Munc13 is involved in pancreatic insulin secretion

1.5.1 Munc13-1 overexpression increases insulin secretion

The role of munc13s in regulated secretion does not end at neurotransmission. Pancreatic

beta cells secrete insulin in a regulated fashion, and contain populations of docked and readily

releasable vesicles similar to those found in neurons (Eliasson et al., 1997). Insulin secretion

occurs in a biphasic pattern – the first, fast phase is triggered by calcium entry, and the second,

sustained phase is regulated by DAG and calcium (Straub and Sharp, 2002). The biphasic

secretion pattern is due to functionally separate pools of insulin granules – the first phase of

secretion results from exocytosis of docked, primed granules, which account for only 2-3% of

the total insulin granule pool within the cell (Barg et al., 2002). Patients with type 2 diabetes

lack the first phase of secretion, and display a decreased second phase (Barg et al., 2002). The

apparent role of regulated secretion and vesicle priming in insulin granule exocytosis makes

munc13 a candidate player in this pathway.

Studies performed on human, rat, and mouse pancreatic islets, as well as on the

insulinoma cell lines HIT and INS-1, demonstrated that munc13-1 is expressed in pancreatic

islets, and that maximal expression is found in insulin-secreting beta cells (Sheu et al., 2003).

However, in two models of diabetes – Zucker diabetic fatty rats and non-obese Goto-Kakizaki

rats – munc13-1 expression was reduced when compared to non-diabetic controls (Sheu et al.,

2003). Reduced expression of the munc13-1-binding partner syntaxin-1A was also found in

these animals. Interestingly, these diabetic animals exhibit abnormal insulin secretion,

suggesting that reduced munc13-1 levels may be involved in the pathology seen in these model

systems (Sheu et al., 2003).

18

Insulinoma cell lines transfected with munc13-1 exhibited an increased insulin response

to high glucose – transfected cells secreted 56% more insulin in response to glucose than

controls. Additionally, munc13-1-transfected cells exhibited a 166% increase in insulin

secretion in response to phorbol ester treatment as compared to controls (Sheu et al., 2003). In

single-cell patch-clamping experiments, munc13-1 overexpression was shown to result in a 3-

fold increase in the readily releasable pool of insulin granules. Munc13-1-transfected cells also

displayed an increase in secretion due to increased temperature, and this effect was shown to

depend on endogenous DAG production (Sheu et al., 2003). These experiments strongly suggest

a role for munc13-1 in a physiological response of great importance, extending the role of

munc13 in regulated secretion beyond the brain.

1.5.2 Munc13-1 deficiency reduces insulin secretion in vivo

Since munc13-1 knockout mice die shortly after death, munc13-1 heterozygotes, which

were shown to express less munc13-1 protein than wild-type animals, were used to study the role

of munc13-1 in insulin secretion in vivo (Kwan et al., 2006). While heterozygous mice had

normal fasting blood glucose levels, these animals showed impaired glucose tolerance when

compared to wild-type. Interestingly, mice heterozygous for mutant munc13-1 lacking a

functional C1 domain (H567K) exhibited normal glucose tolerance, suggesting that the C1

domain is not required for the effect of munc13-1 on glucose tolerance (Kwan et al., 2006).

Since all animals (wild-type and munc13-1 heterozygotes) responded similarly to insulin

injection, this defect is in insulin secretion, not peripheral insulin sensitivity. As expected, serum

insulin levels were reduced in heterozygous, munc13-1+/- mice after a glucose load when

compared to wild-type. At time points representative of both phases of insulin secretion, serum

levels were significantly lower in the heterozygous mice, while only the first phase was effected

in mice expressing the H567K mutant (Kwan et al., 2006). Further, islets isolated from the

19

munc13-1+/- mice exhibited nearly a 50% reduction in insulin secretion in response to glucose.

While some potentiation of insulin secretion was seen in islets from heterozygotes, it was

markedly less than that seen in wild-type islets, suggesting that the single allele of munc13-1 was

still partially functional (Kwan et al., 2006). Experiments carried out using the H567K mutant

showed that a functional C1 domain is required for full potentiation by phorbol esters.

Patch-clamping of single beta cells revealed that loss of munc13-1 expression resulted in

impairment of phorbol-ester potentiated secretion, and that this effect was due to a reduction in

the size of the readily releasable vesicle pool, and an impairment of the rate of the refilling of

this pool. Consistent with the in vivo results, patch-clamping of H567K-expressing beta cells

revealed an effect on the readily releasable vesicle pool size, but no effect on the rate of refilling

(Kwan et al., 2006). However, in the face of phorbol ester pretreatment, both parameters were

affected in beta cells expressing H567K. This set of experiments demonstrates that the 60%

reduction of munc13-1 expression seen in munc13-1+/- mice is sufficient to cause significant

insulin secretion defects. These results are consistent with the previous study showing secretory

defects in diabetic rat models (Sheu et al., 2003). The results in pancreatic tissue show that

munc13-1 regulates vesicle exocytosis in a critically important system in human health and

disease, and that munc13-1 function is generalizable beyond the nervous system.

1.6 Munc13 is expressed in the kidney, and is implicated in diabetic nephropathy

1.6.1 Munc13 is upregulated in kidney cells during hyperglycemia

Using differential-display RT-PCR (DDRT-PCR), our lab was able to show that

hmunc13 (an alternate name for munc13-2) was upregulated in human mesangial cells (MC) that

were cultured in high glucose (25 mM) (Song et al., 1998). Relative RT-PCR and Northern blot

20

analysis confirmed this result, showing a 70% increase in munc13-2 expression in MC cultured

in high glucose-containing medium (Song et al., 1998). This study also revealed that munc13-2

was expressed in rat MC and human renal cortical epithelial cells.

1.6.2 Munc13 is upregulated in a diabetic animal model, and may cause apoptosis in vivo

After cloning hmunc13 from a human kidney library, our lab sought to further

characterize the potential role of munc13-2 in diabetic nephropathy. In order to look at munc13

expression in vivo, the strepozotocin (STZ)-induced diabetic rat model was used. After

treatment with STZ, rats develop diabetes in a well-defined manner (Song et al., 1999). After 11

days of hyperglycemia, rats were sacrificed, and expression of munc13-1 and munc13-2 was

assayed using fluorescence in situ hybridization (FISH) on kidney sections. Compared to

controls, STZ-treated rats showed high expression of munc13-1 and munc13-2 in the renal

cortex, specifically in cortical epithelial cells and in some glomerular cells (Song et al., 1999).

While the precise identity of the glomerular cells expressing munc13 could not be determined,

our previous data suggest that these would be mesangial cells. These results complement the in

vitro data documenting the upregulation of munc13 in cultured MC.

To investigate the function of munc13 in these cells, cell culture systems were employed.

Hemagglutinin (HA)-tagged hmunc13 was constructed (munc13-HA), as well as a mutant

lacking the C1 domain (C1-less), and these constructs were expressed in opossum kidney (OK)

cells (Song et al., 1999). HA-tagged munc13 protein was found to be cytosolic, and treatment of

the cells with the phorbol ester, phorbol 12,13-dibutyrate (PDBu), resulted in the C1 domain-

dependent translocation of hmunc13 to the Golgi (Song et al., 1999). Strikingly, PDBu-treated

cells that expressed hmunc13 underwent apoptosis, as shown by TUNEL staining and genomic

DNA breakdown (Song et al., 1999).

21

These results set up an interesting model involving high glucose, DAG, munc13, and

apoptosis. In the diabetic state, high ambient glucose levels result in an increase in intracellular

DAG due to increased flux through the polyol pathway (Whiteside and Dlugosz, 2002).

Apoptosis of renal cells, especially in the glomerulus, is also thought to have an early role in the

pathogenesis of diabetic nephropathy (Shankland, 2006). Therefore, in diabetes, munc13 is

upregulated in the kidney, and is activated by increased levels of DAG, resulting in apoptosis

(Song et al., 1999). This model potentially places munc13 in a central role in a process of great

therapeutic interest.

1.6.3 A polymorphism in the UNC13B locus is associated with diabetic nephropathy

While diabetic nephropathy is highly prevalent, few reliable predictors of the disease

exist. A large case-control study sought to find single nucleotide polymorphisms (SNPs) that

associated with diabetic nephropathy in type 1 diabetes patients (Tregouet et al., 2008). 1,176

patients with diabetic nephropathy, and 1,323 controls were screened for SNPs in 127 candidate

genes. The only SNP with a significant association with nephropathy was mapped to intron 1 in

the UNC13B locus, which codes for munc13-2 (odds ratio of 1.63) (Tregouet et al., 2008).

While this SNP had no known functional significance, two SNPs with complete association to

the one in question affect binding sites for SP1 and Upstream Stimulating Factor at the UNC13B

promoter, suggesting a potential role for this SNP in gene expression (Tregouet et al., 2008).

Clearly, if differences in munc13-2 expression were associated with diabetic nephropathy,

munc13-2 would be a potential screening tool and therapeutic target for patients with the disease.

22

1.7 Munc13 binds the small GTPase, rab34

1.7.1 Munc13 is an effector of rab34

In an effort to determine the mechanism by which munc13 functions in the kidney, our

lab undertook a search for munc13 interacting partners in renal cells. To this end, a bacterial

two-hybrid system was used to probe a human kidney cDNA library for munc13 binding partners

(Speight and Silverman, 2005). This search yielded the small GTPase, rab34. Munc13 was

found to bind rab34 in a GTP-dependent manner, making it an effector of rab34. Treatment of

HEK-293 cells co-expressing HA-tagged munc13 and V5-tagged rab34 with PDBu resulted in

the colocalization of the two proteins at the Golgi (Speight and Silverman, 2005). Further, the

interaction of munc13 and rab34 was mapped to the MHD2 domain of munc13. These studies

demonstrated a novel interacting partner for munc13, setting up a potential signaling axis

involving DAG, munc13, and a rab protein (Speight and Silverman, 2005).

1.7.2 Rab structure and function

Rab proteins are soluble proteins that are synthesized in the cytosol and prenylated post-

translationally (Alory and Balch, 2000). Upon translation, nascent, GDP-bound rabs are bound

by the Rab Escort Protein (REP) (Goody et al., 2005). Two REP isoforms, REP-1 and REP-2,

exist in mammalian cells. Once bound by REP, the Rab-REP complex can be recognized by Rab

geranylgeranyltransferase (GGTase). GGTase then transfers lipid groups to the two C-terminal

cysteine residues on the nascent rab. The requirement for REP binding stems from the lack of a

consensus GGTase recognition sequence (Overmeyer et al., 2001). In other GTPases, such as

ras, a CAAX motif exists which is recognized by the prenylation machinery. In the case of rabs,

there is only a dicysteine motif, so the GGTase enzyme recognizes a complex of rab and REP.

23

Additionally, REP serves to shield the lipid groups bound to rabs from the aqueous environment

of the cytosol until it is delivered to its target membrane (Goody et al., 2005).

Upon delivery to its target membrane the rab protein is activated. A guanine nucleotide

exchange factor (GEF) replaces GDP with GTP, resulting in a conformational change at the

switch regions, and subsequent activation of the rab protein (Zerial and McBride, 2001) (Figure

4). At this point – membrane- and GTP-bound – the rab may interact with effector proteins.

Effector binding generally results in the transport of a rab to another target membrane

compartment (the acceptor compartment). At this time, a GTPase activating protein (GAP)

accelerates the slow intrinsic rate of rab GTP hydrolysis, resulting in the hydrolysis of GTP to

GDP (Zerial and McBride, 2001). Once GDP-bound, the rab can be removed from the

membrane by a GDP dissociation inhibitor (GDI), which is structurally very similar to REP.

GDI again shields the lipid groups of the rab, and recycles the protein back to its original

compartment for another round of activation (Overmeyer et al., 2001).

24

Figure 5. The rab GTPase cycle. GDP-bound rab proteins are held in the cytosol on complex with rab GDI. GEF proteins catalyze the exchange of GDP for GTP, at which time the active rab protein is deposited at its target membrane. This process is thought to involve the prenylated rab acceptor protein (PRA). The active rab can be acted upon by a GAP protein, which catalyzes the hydrolysis of GTP to GDP and the release of inorganic phosphate. Now, GDI can remove the rab protein from the membrane, and a new activation cycle can begin.

25

1.7.3 Rab34 binds RILP and influences lysosomal positioning

At the time that rab34 was identified as a munc13 effector, very little had been published

about rab34. One report demonstrated that rab34 was a Golgi-bound protein that was involved in

the repositioning of lysosomes toward the centre of the cell (Wang and Hong, 2002). Wang and

Hong found that both wild-type and constitutively active rab34 were capable of moving

lysosomes toward the juxtanuclear region of the cell, and showed that this phenomenon

depended on the interaction of rab34 with the rab7-interacting lysosomal protein (RILP) (Wang

and Hong, 2002). RILP had previously been shown to bind rab7 on the lysosomal membrane,

and tether it to microtubules via interaction with the dynein/dynactin motor system (Jordens et

al., 2001). It was speculated, therefore, that rab34 was interacting with RILP, which was bound

to lysosomes, and moving the organelles toward the microtubule-organizing centre (MTOC)

using dynein motors. However, a precise mechanism for this phenotype was difficult to define,

since it was clear that rab34 was acting upon lysosomes in an “interorganellar” manner, whereby

rab34 exerted its function on lysosomes while bound to the Golgi (Wang and Hong, 2002).

1.7.4 Rab34 is involved in fluid-phase uptake at plasma membrane ruffles

Another report in the literature at this time stated that rab34 was in fact a plasma

membrane protein, and that its function was to assist in macropinocytosis at membrane ruffles

(Sun et al., 2003). In this report, myc-tagged rab34 was found at sites of membrane ruffling,

colocalizing with actin, and on the membrane of dextran-containing macropinocytotic vesicles

(Sun et al., 2003). Additionally, overexpression of either wild-type or constitutively active rab34

resulted in an increase in the overall number of macropinosomes in cells, and enhanced the

stimulatory effect of both phorbol esters and platelet-derived growth factor (PDGF) on

macropinocytosis (Sun et al., 2003). In an attempt to determine the mechanism of rab34-

26

mediated enhancement of macropinocytosis, rab34 was coexpressed with dominant-negative

rac1 or WAVE. Coexpression of either of these proteins with rab34 inhibited the increase in

vesicle number seen with rab34 alone, suggesting that rab34 requires rac1/WAVE-mediated

membrane ruffling for its action (Sun et al., 2003).

1.8 Rationale and hypothesis

1.8.1 General rationale

Diabetic nephropathy (DN) is the leading cause of end stage renal disease in Canada,

Europe, the USA and Japan (Clark et al., 2000; Remuzzi et al., 2002). In Europe and the USA,

the incidence of DN has increased by 150% over the past 10 years, and diabetic patients have a

significantly increased mortality rate when compared to the dialysis population as a whole

(Remuzzi et al., 2002). Clearly, both the financial and medical implications of this shocking rise

in DN incidence warrant intense research into the mechanisms and treatment of DN. Up to 40%

of patients with type 2 diabetes will develop nephropathy (Dronavalli et al., 2008), and

developing sensitive and specific screening tools for nephropathy in diabetic patients will be

required in order to direct prevention and treatment resources efficiently in the face of a diabetic

population that is rapidly increasing in size.

1.8.2 Part 1 – Investigation of rab34 function in HeLa cells

As outlined previously, our lab has identified munc13 as a protein that is both

upregulated and activated in both cell culture systems and the renal cortex of diabetic rats (Song

et al., 1998, 1999). In vitro cell culture data suggest that munc13 may be involved in the

induction of apoptosis in the diabetic state, making it a potential therapeutic target in patients

with DN, potentially using a GTPase inhibitor, siRNA delivery, or other small molecules

designed to disrupt rab34 function (Song et al., 1999). Additionally, levels of munc13 protein

27

expression could prove to be a viable screening tool for the development and progression of DN.

Munc13 isoforms had previously shown to be involved in vesicle priming and secretion in

several organ systems, including the brain, pancreatic beta cell, and several blood cell lineages

(reviewed above). Consistent with this role in secretion, our lab found that munc13 interacts

directly with the small GTPase, rab34, in a GTP-depdendent manner (Speight and Silverman,

2005). At that time, little was known about the function of rab34. As outlined above, different

reports existed placing rab34 at either the Golgi or at the plasma membrane, and suggesting that

rab34 was involved in both macropinocytosis and the repositioning of lysosomes toward the cell

centre (Wang and Hong, 2002; Sun et al., 2003). Before a role for the munc13-rab34 interaction

could be defined, it was necessary to assess the role of rab34 in a useful cell culture system. To

this end, we sought to characterize both the localization and function of rab34 in HeLa cells. We

chose HeLa cells because of their ease of transfection, the presence of endogenous rab34, and

their consistent geometry that facilitates microscopic analysis of cell function. Our

investigations re-analyzed the claims made in the literature regarding rab34 function, and

proposed our own model for the role of rab34 in HeLa cells. Our assumption was that rab34

would be involved in an aspect of vesicle structure and function, like other rab proteins, and that

a possible functional interface for rab34 and munc13 would be revealed during the course of our

investigations.

1.8.3 Part 2 -- The role of the munc13-rab34 interaction in secretory pathway dynamics

Once we had shown that rab34 is involved in intra-Golgi transport within the secretory

pathway in HeLa cells, we sought to determine the role of the munc13-rab34 interaction in this

process, and to link this function back to our original observations made in models of DN. Using

our HeLa cell model, we investigated the effect of munc13 on the kinetics of transport of a

28

model protein cargo, temperature-sensitive VSVG-GFP, through the secretory pathway. This

model was chosen because of its wide use in the literature, and because it allows for rapid, easy

evaluation of the integrity of the secretory pathway. We then took this system into a cell culture

model of physiological relevance, investigating secretory pathway dynamics in rat mesangial

cells cultured in both normal and high (diabetic) concentrations of glucose. The effect of high

glucose on the secretory pathway, as well as on munc13 expression levels were assayed, and

siRNA technology was employed to assess the specific role of munc13 in constitutive secretion

in mesangial cells. We hypothesized that munc13 would effect secretion in a rab34-dependent

manner, and that munc13 expression levels would allow for the formation of a link between

diabetes, munc13 expression, and the dysregulation of the secretory pathway.

29

Chapter 2

2 Golgi-Bound Rab34 is A Novel Member of the Secretory Pathway

[Published previously as Goldenberg, N.M., Grinstein, S., and Silverman, M. (2007). Golgi-

bound Rab34 is a novel member of the secretory pathway. Mol Biol Cell 18, 4762-4771.

Copyright 2007.]

2.1 Abstract Golgi-localized Rab34 has been implicated in repositioning lysosomes and activation of

macropinocytosis. Using HeLa cells, we undertook a detailed investigation of Rab34

involvement in intracellular vesicle transport. Immunoelectron microscopy and

immunocytochemistry confirmed that Rab34 is localized to the Golgi stack and that active Rab34

shifts lysosomes to the cell center. Contrary to a previous report, we found that Rab34 is not

concentrated at membrane ruffles and is not involved in fluid-phase uptake in our HeLa cell

model. Also, Rab34-induced repositioning of lysosomes does not affect mannose 6-phosphate

receptor trafficking. Most strikingly, HeLa cells depleted of Rab34 by transfection with

dominant-negative rab34 or after RNA interference, failed to transport the temperature-sensitive

vesicular stomatitis virus G-protein (VSVG) fused to green fluorescent protein (VSVG-GFP)

from the Golgi to the plasma membrane. Transfection with mouse Rab34 rescued this defect.

Using endogenous major histocompatibility complex class I (MHCI) as a marker, an

endoglycosidase H resistance assay showed that endoplasmic reticulum (ER) to medial Golgi

traffic remains intact in knockdown cells, indicating that Rab34 specifically functions

downstream of the ER. Further, brefeldin A treatment revealed that Rab34 effects intra-Golgi

transport, not exit from the trans-Golgi network. Collectively, these results define Rab34 as a

novel member of the secretory pathway acting at the Golgi.

30

2.2 Introduction Rab GTPases and their effectors are involved in virtually all aspects of transport vesicle

budding, movement, targeting, and fusion (Zerial and McBride, 2001). Different rab proteins

have, in addition to a specific complement of effector proteins, a distinct compartmental

distribution allowing them to perform numerous functions within cells (Grosshans et al., 2006).

The array of rab effectors – which includes enzymes, cytoskeletal elements, SNARE proteins,

and vesicle coat proteins – combines with the tightly regulated intracellular distribution of rab

proteins to allow rabs to perform a wide variety of cellular functions.

Constitutive secretion is governed by a defined set of Rab GTPases. ER to Golgi

transport requires Rab1 and Rab2 (Tisdale et al., 1992; Allan et al., 2000), Rab6 has been linked

with intra-Golgi transport (Echard et al., 2000), and transport from the trans-Golgi network

(TGN) to the plasma membrane has been shown to involve Rab8 and Rab11 (Huber et al., 1993;

Chen et al., 1998). This list, however, is not exhaustive, and whether other Rab proteins and

their effectors are involved in constitutive secretion remains to be seen.

Little has been written about Golgi-bound rab, Rab34. Two effectors of Rab34 have been

identified – the Rab-interacting lysosomal protein (RILP), which links Rab34 to dynein

microtubule motors (Wang and Hong, 2002), and hmunc13, a PKC superfamily member, which

has been implicated in the induction of apoptosis at the Golgi in response to phorbol ester

treatment (Speight and Silverman, 2005). By transfecting cell lines with constitutively active or

dominant-negative forms of Rab34, Rab34 has been implicated in fluid-phase uptake of proteins

at membrane ruffles via macropinocytosis (Sun et al., 2003) and in the shifting of lysosomes

toward the microtubule organizing centre (MTOC) (Wang and Hong, 2002).

31

In order to clarify the role of Rab34 in mammalian cells, we have used transiently-

transfected HeLa cells as a model system. Using GFP fusions of wild-type (wt-GFP-Rab34),

constitutively active (CA-GFP-Rab34), or dominant-negative Rab34 (DN-GFP-Rab34), we have

re-examined the existing literature pertaining to Rab34, and investigated new functional roles for

Rab34 in HeLa cells. Since Rab34 is localized to the Golgi in our system, we sought to

investigate Rab34 function in the context of this organelle. To this end, we employed RNA

interference to knock down Rab34 expression in HeLa cells. Using this assay, as well as the

constitutively active and dominant-negative Rab34 constructs used in the studies mentioned

above, we re-evaluated the functions of Rab34 that have been described in the literature, and

examined the role of Rab34 in the secretory pathway. In our system, we are unable to observe

any enrichment of Rab34 at membrane ruffles, or any effect of Rab34 on fluid-phase uptake.

Active Rab34, however, did cause lysosomes to shift to a juxtanuclear position, consistent with a

previous report. The mechanism and functional implications of this phenotype are unclear, but

we have determined that trafficking of the mannose 6-phosphate receptor (M6PR) is unaffected

by Rab34. More strikingly, our data indicate that Rab34 is confined to the Golgi, where it is

required for the exit of transport carriers traversing the secretory pathway. Our data show

specifically that Rab34 is required for exit of VSVG-GFP from the Golgi stack, upstream of the

trans-Golgi network (TGN). This site of action places Rab34 upstream of several other known

players in the secretory pathway, including protein kinase D (PKD) and phosphatidylinositol 4-

phosphate (PI4P) (Liljedahl et al., 2001; Hausser A, 2005).

32

2.3 Materials and Methods Antibodies and Reagents: The following primary antibodies were used: rabbit anti-Rab34

(Santa Cruz), mouse anti-GM130 (BD Biosciences), mouse anti-mannose 6-phosphate receptor

(Calbiochem), rabbit anti-GFP (Molecular Probes), mouse anti-LAMP-1 (Developmental Studies

Hybridoma Bank, University of Iowa), mouse anti-Vinculin (Sigma), mouse anti-MHC Class I

W6/32 (a gift from Dr. D.B. Williams). Anti-mouse-Cy3 (Jackson ImmunoResearch) was used

as a secondary antibody for immunofluorescence, and anti-rabbit-HRP and anti-mouse-HRP

(Santa Cruz) were used for Western blotting. Rhodamine-conjugated wheat germ agglutinin

(WGA) was from Vector Laboratories, Alexa-647-conjugated WGA was from Molecular Probes.

Alexa-647-conjugated dextran was from Molecular Probes. Protein A-Sepharose (GE

Healthcare) was used for immunoprecipitation, and 35S-methionine was from Amersham

Biosciences. Nocodazole, TPA, and brefeldin A (BFA) were from Sigma. The ceramide analog

D-threo-1-Phenyl-2-decanoylamino-3-morpholino-1-propanol (PDMP) was from Bio-Mol.

Plasmids and siRNA: Wild-type Rab34 fused to the C-terminal of GFP (wt-GFP-Rab34) was

constructed using Gateway Technology (Invitrogen) with pcDNA-DEST40-Rab34wt (described

in (Speight and Silverman, 2005)) as donor, and pcDNA6.2/N-EmGFP-DEST as the destination

vector. Both the constitutively active, GTP-restricted, Q111L mutant and the dominant-negative,

GDP-restricted, T66N mutants were fused to GFP using the same method (CA-GFP-Rab34 and

DN-GFP-Rab34, respectively). The pEGFPdKA206K-N1-VSVG tsO45 vector encoding

VSVG-GFP and pEGFPdKA206K-N1-mCherry (VSVG-Cherry) were generous gifts from Dr. J.

Lippincott-Schwartz. Plasmids encoding the tail of H-Ras fused to RFP (HRas-tail-RFP), the PH

domain of phospholipase c-delta (PLCδ-PH-RFP), or GPI-linked RFP (GPI-RFP) have been

described previously (Varnai and Balla, 1998; Choy et al., 1999; Keller P, 2001). Stealth siRNA

33

directed against human Rab34 and appropriate scrambled control siRNA were synthesized by

Invitrogen. siRNA targeting Rab34 was the following annealed duplex: 5’

AAUCGUUCCAUCUCGAAGUCCACUC 3’ and 5’

GAGUGGACUUCGAGAUGGAACGAUU 3’.

Cell Culture and Transfection: HeLa cells were grown in MEM plus 10% FBS, and

maintained at 37°C in 5% CO2. Transfection of siRNA was performed using Lipofectamine

2000 (Invitrogen) according to manufacturer’s directions. Plasmid DNA was transfected using

FuGene 6 Reagent (Roche) according to manufacturer’s directions, using a DNA:FuGene ratio

of 3:1.

Cryo-Electron Microscopy: HeLa cells were grown in 10 cm dishes, and transfected with

GFP-Rab34-wt. 24 hours post-transfection, cells were washed in PBS, and fixed in 4% followed

by 8% paraformaldehyde. Cells were then washed in 0.15 M glycine, followed by 1% gelatin in

PBS. Cells were scraped, pelleted, and resuspended in 12% gelatin. The cells were then pelleted

again, and cooled to allow the gelatin to set. The pellets were cut into 1mm3 pieces and put in

2.3 M sucrose in PBS at 4°C over night. The sucrose pieces were put on metal pins, frozen in

liquid nitrogen, and sectioned at -120°C at a thickness of 75 nm. Sections were picked up in a

1:1 mixture of 2% methyl cellulose and 2.3 M sucrose and transferred to formvar-coated nickel

grids. For immunostaining, sections were blocked in 5% fish skin gelatin, and then incubated for

30 min. in anti-GFP. Sections were washed, and incubated with protein A-Gold, washed, and

fixed in 1% gluteraldehyde. Phosphate was removed in water, and the sections were stained in

methylcellulose and uranyl acetate on ice.

Immunoblotting: Cells were lysed in 1% NP-40, and protein concentration in lysates was

determined using a Lowry assay (Bio-Rad). 50 µg of protein was run on a 10% polyacrylamide

34

gel. Following transfer to nitrocellulose, filters were blocked in 5% non-fat dry milk powder in

10 mM Tris–HCL (pH 8.0), 150 mM NaCl and 0.05% Tween 20 (TBST) overnight at 4 °C.

Primary and secondary antibodies were diluted in blocking buffer, and incubations were for 1 h

at room temperature. Detection was performed using an ECL Advance Western Blotting

Detection Kit (Amersham Biosciences).

Membrane Ruffling and Dextran Uptake: HeLa cells were cotransfected with wt-GFP-Rab34

and either HRas-tail-RFP or PLCδ-PH-RFP. After 24 hours, membrane ruffling was induced by

treatment with 100 nM TPA for 10 minutes in HEPES-buffered MEM, and the cells were imaged

live using a spinning disk confocal microscope (Leica), and the fluorescence intensity of GFP

both at a ruffle and non-ruffle, as well as for RFP at a ruffle and non-ruffle was measured using

ImageJ (Altan-Bonnet et al.). The ratio of ruffle to non-ruffle fluorescence for GFP was divided

by the ratio of ruffle to non-ruffle fluorescence for RFP to determine whether or not Rab34 was

specifically enriched at membrane ruffles.

To measure dextran uptake, HeLa cells transfected with GFP-Rab34 vectors, or with GFP alone

were exposed to 200 µg/ml Alexa-647 Dextran for 10 minutes. Cells were then rinsed in ice-

cold PBS, trypsinized, and analyzed by FACS. 10 000 transfected cells were counted for each

experimental condition. Data were analyzed using FlowJo (Tree Star), and Alexa-647-dextran

fluorescence was expressed as a percent of Alexa-647 fluorescence in cells transfected with GFP

alone.

Lysosomal Positioning Assay: HeLa cells were transfected with Rab34 vectors, and imaged 24

hours post-transfection. Cells were serum starved for 2 hours, then were fixed in 3.7 %

paraformaldehyde, permeabilized in 0.2% Triton-X-100, and blocked in 10% fat-free milk.

Fixed cells were stained using anti-LAMP-1 antibody, and Cy3-conjugated secondary antibody.

35

Cells were visualized by confocal microscopy. Analysis was performed using the Radial Plot

function in ImageJ (Altan-Bonnet et al.). Rab34 expressing cells were idenitified by GFP

fluorescence, and using Radial Plot, concentric circles were drawn from the cell centre to the cell

boundary, and integrated LAMP-1 fluorescence intensities were recorded for the area along each

circle. To normalize for cell size and fluorescence, the data were binned into the inner, middle,

and outer thirds of each cell, and expressed as a percent of total LAMP-1 fluorescence.

Dominant-negative and constitutively active Rab34 Assays: HeLa cells plated on glass

coverslips in 12 well plates were transfected with one of wt-GFP-Rab34, CA-GFP-Rab34, or

DN-GFP-Rab34. For M6PR experiments, cells were fixed in 3.7% paraformaldehyde 24 hours

post-transfection, permeabilized, and stained with anti-M6PR and anti-mouse-Cy3. Cells were

mounted and imaged using a spinning disk confocal microscope (Leica). For VSVG-Cherry

experiments, cells were cotransfected with GFP-Rab34 or its mutants, as well as VSVG-Cherry

at 40°C as described below.

VSVG-GFP Secretion Assay: HeLa cells were plated on glass coverslips in 12 well plates.

The following day, cells were transfected with either scrambled siRNA, or siRNA directed

against Rab34, and incubated for 48 hours. Following this, cells were transfected with VSVG-

GFP, and incubated at 40°C for a further 20 hours. All subsequent incubations were done in the

presence of 50 µg/ml cycloheximide (Sigma) to halt protein synthesis. For time t=0, cells were

rinsed in ice-cold PBS prior to fixation. Remaining cells were returned to an incubator at 32°C

for the indicated time. After incubation, cells were rinsed in ice-cold PBS, and fixed in 3.7%

paraformaldehyde. For treatment with WGA, cells were incubated with 0.01 mg/ml WGA on ice

for 10 minutes. For GM130 staining, cells were permeabilized with 0.2% Triton X-100, and

stained using anti-GM130, followed by a Cy3-anti-mouse antibod. Cells were mounted on slides

36

and imaged using a Zeiss LSM 510 Confocal microscope. Image analysis was performed using

Volocity (Improvision).

Endoglycosidase H Assay: HeLa cells were plated in 60 mm dishes, transfected with either

scrambled siRNA or siRNA against Rab34, and incubated for 72 hours. Metabolic labeling,

immunoprecipitation and EndoH digestion were performed as described (Kim et al., 1996).

Briefly, cells were incubated for 30 minutes in RPMI lacking methionine. Metabolic labeling

was performed using 150 µCi of 35S-Methionine per plate for 10 minutes. Chase incubations

were done in RPMI supplemented with methionine for the indicated times. Following chase,

cells were rinsed in ice-cold PBS, and lysed in buffer containing NP40. For

immunoprecipitation of MHC class I molecules, each lysate was incubated in anti-MHC class I

antibody W6/32, followed by Protein A-Sepharose. After washing, lysates were split, and some

were incubated with endoglycosidase H (NEB) for 3 hours at 37°C. Samples were then run on

10% polyacrylamide gels.

2.4 Results

2.4.1 GFP-Rab34 is localized to the Golgi

Wt-GFP-Rab34 was expressed in HeLa cells and several protocols were initiated to

evaluate the differing claims in the literature regarding Rab34 localization. When cells are fixed

and immunostained with the Golgi marker, GM130, wt-GFP-Rab34 and GM130 co-localize at

the Golgi (Figure 5). Moreover, the near-complete co-localization of wt-GFP-Rab34 and

GM130 persists after microtubule depolymerization with nocodazole (Figure 5). To determine

the precise localization of Rab34 in the Golgi stack, we used immunogold labeling of transfected

wt-GFP-Rab34 in ultrathin cryo-sections of fixed HeLa cells. Transmission electron microscopy

revealed that wt-GFP-Rab34 is present throughout the Golgi stack, both in the Golgi cisternae

37

and on a population of Golgi-associated vesicles (Figure 5B). Transfected wt-GFP-Rab34 is

seen on some cis-Golgi transport carriers, as well as on some peri-Golgi transport vesicles

(arrowheads in Figure 5B). The vast majority of labeling is observed in the Golgi cisternae

themselves, and there is no preference for cis-, medial-, or trans-Golgi stacks. Similarly, wt-

GFP-Rab34 is relatively evenly distributed within each cisterna, with no preference for central or

terminal membranes.

39

Figure 6. Rab34 is localized to the Golgi in HeLa cells. (A) HeLa cells transiently transfected with wt-GFP-Rab34 were treated with or without nocodazole (ncdz) to depolymerize microtubules, and were fixed and stained for the Golgi marker, GM130. Note the colocalization of wt-GFP-Rab34 and GM130 both in the absence (–ncdz) and presence (+ncdz) of nocodazole, suggesting Golgi localization. Scale bar, 10 µm. (B) HeLa cells transiently transfected with wt-GFP-Rab34 were fixed and processed for immunoelectron microscopy as described in Materials and Methods. Immunogold labeling shows wt-GFP-Rab34 is present throughout the Golgi stack (arrows), as well as on some cis-Golgi and peri-Golgi vesicular elements (arrowheads). Scale bar, 200 nm.

40

2.4.2 Rab34 is not concentrated at membrane ruffles

It has been reported previously that Rab34 is recruited to sites of membrane ruffling,

where it is involved in macropinocytosis (Sun et al., 2003). Membrane ruffles are accumulations

of lipid, protein, and cytoskeletal elements at the plasma membrane in response to several

stimuli, including phorbol esters and growth factors (Kurokawa and Matsuda, 2005). Because

membrane ruffles are such high density structures, and because membrane ruffles change the 3D

structure of cells, it can be difficult to ascertain by confocal microscopy whether a protein is

truly recruited to a membrane ruffle, or if this is an artifact that arises from an accumulation of

cell density at the ruffled region. In an effort to examine a potential role for Rab34 in membrane

ruffling in HeLa cells, we co-expressed wt-GFP-Rab34 with the tail of H-Ras fused to RFP

(HRas-Tail-RFP). HRas-Tail-RFP inserts into the plasma membrane by three palmitate

moieties, and is therefore a consistent marker for the plasma membrane (Roy et al., 2005).

These cells were then treated with 100nM TPA for 10 minutes to induce membrane ruffling, and

live cells were subsequently analyzed by spinning disk confocal microscopy (Figure 6). For

each of the GFP and RFP channels, a ratio of fluorescence intensity was taken at a membrane

ruffle (Figure 6, arrowheads), and compared with an area of the plasma membrane that has not

undergone ruffling (Figure 6, arrows). The Rab34 ratio was then divided by the HRas-Tail ratio

to correct for membrane density changes at the membrane ruffle. If Rab34 is truly recruited to

membrane ruffles, this ratio should be greater than 1. In our HeLa cell system, we found that

Rab34 is not recruited to membrane ruffles, since the ratio of Rab34 signals to HRas-Tail signals

was 0.98, which was not significantly different than 1 (p>0.5, n=20). To further demonstrate the

lack of Rab34 recruitment to membrane ruffles, this experiment was repeated with another

membrane marker. This time, the pleckstrin-homology domain of phospholipase c-delta fused to

RFP (PLCδ-PH-RFP), which binds phosphoinositides in the plasma membrane (Stauffer et al.,

41

1998), was co-expressed with wt-Rab34-GFP, and the same assay and quantification was

performed as described above. Similar to what was observed with HRas-Tail, the ratio of Rab34

to PLCδ-PH-RFP was not found to differ significantly from 1, strongly supporting the

observation that Rab34 is not concentrated at sites of membrane ruffling in HeLa cells

(ratio=1.10, p>0.3, n=20) (data not shown).

42

Figure 7. Golgi-bound Rab34 is not concentrated at membrane ruffles and does not participate in fluid-phase uptake. (A) HeLa cells coexpressing wt-GFP-Rab34 and HRas-Tail-RFP were treated with 100 nM TPA for 10 min, and the live cells were imaged using a spinning disk confocal microscope. Fluorescence intensities were measured for each channel at either membrane ruffles (arrowheads) or a nonruffled area of plasma membrane (arrows). Scale bar, 12 µm. (B) FACS analysis of dextran uptake. HeLa cells expressing CA-GFP-Rab34, DN-GFP-Rab34, or GFP alone were serum-starved and allowed to take up Alexa-647–labeled dextran for 10 min. Cells were harvested, and dextran uptake in Rab34-transfected cells was analyzed for 10,000 transfected (GFP-positive) cells per transfection condition. Dextran uptake was expressed as mean Alexa-647 fluorescence, normalized to Alexa-647 fluorescence for cells transfected with GFP alone (p > 0.1, n = 3). Data are shown ±SE.

43

2.4.3 Rab34 does not participate in fluid-phase uptake

It has also been previously reported that active Rab34 increases macropinocytosis in

mouse 10T1/2 fibroblasts, even in the absence of stimuli such as phorbol esters or PDGF (Sun et

al., 2003). To test whether Rab34 affects fluid-phase uptake in our HeLa cell system, we

transfected HeLa cells with CA-GFP-Rab34, DN-GFP-Rab34, or GFP alone. Cells were then

incubated for 10 minutes with Alexa-647-conjugated dextran as a tracer for fluid-phase uptake.

In order to perform a quantitative, high throughput analysis of dextran uptake, we used FACS to

determine the amount of dextran taken up by our transfected cells (Figure 6B). For each

transfection condition, 10 000 transfected cells were analyzed. Contrary to the previous report,

but consistent with our finding that Rab34 is not recruited to membrane ruffles in HeLa cells, we

found that Rab34 did not effect dextran uptake in HeLa cells, since neither CA-GFP-Rab34 nor

DN-GFP-Rab34 cells exhibited a significant change in dextran uptake when compared with

HeLa cells transfected with GFP alone – mean dextran fluorescence values of 111% and 103%

of uptake in cells expressing GFP alone, were found for CA-GFP-Rab34 and DN-GFP-Rab34,

respectively, and were not statistically significant (p>0.05, n=3). It is possible that the finding

observed by Sun et. al. (2003) represents a cell-specific phenomenon.

2.4.4 Rab34 regulates lysosomal position, but does not effect the localization of the mannose 6-phosphate receptor

The other phenotype previously associated with active Rab34 was its ability to shift

lysosomes toward the MTOC via its association with RILP and the dynein/dynactin system

(Wang and Hong, 2002). To test this phenomenon in our HeLa cell system, HeLa cells were

transfected with either CA-GFP-Rab34 or DN-GFP-Rab34, fixed, and stained with an anti-

LAMP-1 antibody to visualize lysosomes. To quantitate lysosomal position relative to the

nucleus, we used a system of concentric circles drawn from the cell centre, as described in

44

Materials and Methods (Figure 7). Lysosomal position was then calculated as the percent of

LAMP-1 fluorescence in a given cell within either the inner, middle, or outer third of the cell

itself. We found that CA-GFP-Rab34 caused a significant shift of LAMP-1 fluorescence to the

inner third of the cell as compared with DN-GFP-Rab34 – 63% of the LAMP-1 fluorescence was

found in the inner third of cells transfected with CA-GFP-Rab34, versus 35% for DN-GFP-

Rab34 (p<0.01). This finding suggests that the work of Wang and Hong in NRK cells (2002)

can be generalized into our HeLa cell system.

Since active Rab34 was able to reposition lysosomes in HeLa cells, we next asked

whether this positional change might be indicative of a change in TGN to lysosome trafficking.

To examine this possibility, we used an antibody to the cation-independent mannose 6-phosphate

receptor (M6PR). The M6PR is responsible for the trafficking of acid hydrolases from the TGN

to the endosome (Ghosh et al., 2003). Once in the endosome, the M6PR and its ligand travel to

the lysosomal compartment, where acidic pH results in the dissociation of ligand from the

receptor, at which time the M6PR recycles back to the TGN (Ghosh et al., 2003). HeLa cells

that had been transfected with either CA-GFP-Rab34 or DN-GFP-Rab34 were fixed and

immunostained with an M6PR antibody (Figure 7D). In untransfected cells, the M6PR resides in

both a juxtanuclear compartment as well as a punctate, endosomal compartment. This

localization did not significantly change in HeLa cells expressing either Rab34 mutant,

suggesting that Rab34 does not have a role in TGN to lysosome trafficking (Figure 7D).

Therefore, the repositioning of lysosomes by active Rab34 is unlikely to be involved in the

transport of acid hydrolases to the late endosome/lysosome.

46

Figure 8. Active Rab34 shifts lysosomes toward the MTOC, but does not effect the M6PR. (A) HeLa cells transfected with either CA-GFP-Rab34 or DN-GFP-Rab34 were fixed and stained with a mAb against LAMP-1 to mark lysosomes. Cells were imaged by confocal microscopy. Scale bar, 10 µm. (B) To quantitate the position of lysosomes relative to the cell center, the Radial Plot plugin was used, as described in Materials and Methods. This plugin records the integrated lysosomal fluorescence (black dots) along circles of increasing radius from the nucleus (N). To normalize for variable cell size and fluorescence intensities, these data were binned into one of the inner, middle, or outer thirds of the cell, and expressed as a percent of total LAMP-1 fluorescence. (C) Quantitated data from the method described in B. CA, CA-GFP-Rab34; DN; DN-GFP-Rab34. n = 20 cells were analyzed per condition; *p < 0.01, p < 0.05. Results are shown ±SE. Scale bar, 10 µm. (D) HeLa cells were fixed directly, or transiently transfected with either CA-GFP-Rab34 (CA-Rab34) or DN-GFP-Rab34 (DN-Rab34), serum-starved, fixed, and stained for M6PR. Cells were imaged using a spinning disk confocal microscope. The GFP signal was used to locate transfected cells, but is not shown for the purpose of clarity. All cells in these representative fields were transfected with the indicated GFP-Rab34 constructs. HeLa cells transfected with either CA- or DN-GFP-Rab34 showed no significant changes from controls, suggesting that Rab34 does not effect M6PR trafficking. Scale bar, 12 µm.

47

2.4.5 Rab34 is required for secretion of VSVG-GFP at the Golgi

Since Rab34 is localized to the Golgi, we wished to test whether Rab34 may be involved

in the secretory pathway. As a reporter for constitutive secretion, we used the ts045 temperature-

sensitive mutant of the VSV glycoprotein fused to one of GFP (VSVG-GFP), or monomeric

Cherry (VSVG-Cherry). The temperature-sensitive mutant is retained in the ER at 40°C, and is

released into the secretory pathway upon temperature shift to 32°C. To study the potential role

of Rab34 in the secretory pathway, HeLa cells were either transfected with VSVG-Cherry alone,

or cotransfected with VSVG-Cherry, and one of wt-GFP-Rab34, CA-GFP-Rab34, or DN-GFP-

Rab34 at 40°C. The following day, protein synthesis was inhibited with cycloheximide, and at

t=0 the cells were shifted to the permissive temperature of 32°C for various times. In cells

expressing VSVG-Cherry alone or in combination with wt-GFP-Rab34, the VSVG protein was

found in the ER at t=0, predominantly at the Golgi at t=30min, with a small amount of protein

still in the ER, and entirely at the plasma membrane at t=180min (Figure 8). Only a very small

number of cells co-expressing VSV-Cherry and wt-GFP-Rab34 exhibited a delay of VSVG-

Cherry transport to the plasma membrane. In contrast, HeLa cells expressing DN-GFP-Rab34

exhibited a marked decrease in VSVG-Cherry transport from the Golgi to the plasma membrane

(Figure 8). Only 17% of cells expressing DN-GFP-Rab34 had transported all VSVG-Cherry to

the plasma membrane, compared to 83% of cells expressing wt-GFP-Rab34, or 85% of cells

expressing VSVG-Cherry alone (p<0.001) (Figure 8B). These results strongly suggest that

Rab34 is required for secretion of VSVG-Cherry from the Golgi. Cells expressing CA-GFP-

Rab34 also exhibited limited inhibition of VSVG-Cherry secretion to the plasma membrane,

with 57% of cells completely transporting VSVG to the cell surface (Figure 8B). The effect of

CA-GFP-Rab34 on VSVG-Cherry secretion suggests that there is a requirement for Rab34 to

maintain the ability to cycle between the GTP- and GDP-bound states for normal trafficking of

48

VSVG-Cherry to the plasma membrane. This phenomenon has been observed for other small

GTPases as well, including Rac and Arf6 (Arrieumerlou et al., 2000; Klein et al., 2006).

To further study the role of Rab34 in the secretory pathway, we employed RNA

interference (Varnai and Balla) by transfecting HeLa cells with short interfering RNA (siRNA)

to deplete cells of endogenous Rab34. 72 hours post-transfection, significant knock down of

endogenous Rab34 was observed in HeLa cells transfected with siRNA targeting Rab34, as

compared to cells transfected with scrambled siRNA (Figure 8C). HeLa cells that had been

transfected with either siRNA targeting Rab34 or a scrambled control siRNA were then

transfected with VSVG-GFP, incubated at 40°C for 20 hours, and then treated with

cycloheximide. After 180 minutes at the permissive temperature of 32°C, control HeLa cells

transfected with scrambled siRNA had completely transported VSVG-Cherry to the plasma

membrane (Figure 8D). Strikingly, HeLa cells transfected with siRNA directed against Rab34

exhibited an arrest of VSVG-Cherry transport. The vast majority of VSVG-Cherry remained in

the Golgi, although there was a minor leak to the cell surface (Figure 8D). To further establish

the specificity of our siRNA treatments, we sought to rescue the defect seen in siRNA-

transfected cells. To this end, we used a GFP-fusion of wild-type mouse Rab34 (GFP-mRab34).

The mouse Rab34 cDNA sequence differs from that of human Rab34 over the region of our

siRNA, so this construct should be resistant to silencing by our siRNA transfection. HeLa cells

that had been treated with siRNA to deplete endogenous Rab34 were co-transfected with VSVG-

Cherry and GFP-mRab34 after 48 hours. Using our standard protocol, these cells showed a

marked rescue of VSVG-Cherry transport to the cell surface as compared to cells that were not

transfected with mRab34 (Figure 8D). While not all cells showed a complete rescue, it was clear

that the majority of VSVG-Cherry transport to the cell surface had been restored by GFP-

49

mRab34. Taken together, these results define Rab34 as a novel member of the secretory

pathway, acting at the Golgi.

51

Figure 9. Dominant-negative Rab34 or siRNA inhibit VSVG-Cherry transport from the Golgi to the plasma membrane. (A) HeLa cells were cotransfected with VSVG-Cherry and one of wt-, CA-, or DN-GFP-Rab3, and incubated overnight at 40°C. Cells were treated with cycloheximide and were shifted to 32°C at t = 0 min to allow VSVG transport to occur. Cells were fixed at the indicated times and imaged using a spinning disk confocal microscope. Scale bar, 12 µm. (B) Quantification of the results in A. Cells treated as in A were scored at t = 180 min for the proportion of cells showing complete transport of VSVG-Cherry to the plasma membrane. At least 20 cells were counted per condition for each of three independent experiments. The conditions examined were VSVG-Cherry alone (VSV), or VSVG-Cherry plus one of wt-GFP-Rab34 (WT), CA-GFP-Rab34 (CA), or DN-GFP-Rab34 (DN). Note the marked inhibition of Golgi to plasma membrane transport in cells expressing DN-GFP-Rab34 (p < 0.001 compared with wild type). (C) Knockdown of endogenous Rab34 in HeLa cells. HeLa cells were transfected with siRNA directed against human Rab34 or scrambled control siRNA. After 72 h, cells were lysed and analyzed by Western blot with a polyclonal anti-Rab34 antibody. Shown is a representative gel from three experiments. As a loading control, membranes were probed for vinculin. (D) HeLa cells transfected with scrambled siRNA (control) or siRNA against Rab34 (siRNA) were transfected with VSVG-Cherry 48 h later and incubated overnight at 40°C. Cells were shifted to the permissive temperature and fixed after 180 min. Note that Rab34 siRNA arrests VSVG-Cherry transport at the Golgi. In the third panel, cells transfected with Rab34 siRNA were then cotransfected with VSVG-Cherry and GFP-mRab34. Note that GFP-mRab34 is capable of rescuing the defect seen in siRNA cells, demonstrating the specificity of the Rab34 siRNA treatment. Scale bar, 12 µm.

52

To further define the precise site of action of Rab34, we performed a time course

experiment along with quantitative colocalization of VSVG-GFP at either the Golgi or the

plasma membrane. To this end, HeLa cells transfected with control siRNA or siRNA against

Rab34 were transfected with VSVG-GFP, and followed at the permissive temperature for either

0, 30, or 180 minutes. At each time point, cells were fixed and either immunostained for the

Golgi with an anti-GM130 antibody, or stained for the plasma membrane with rhodamine-

conjugated WGA. Immediately after a temperature shift to 32°C, all VSVG-GFP was found in

the ER in both control and knock down cells, and after 30 minutes, the majority of VSVG-GFP

had traveled to the Golgi (Figure 9A, panels i-iv, vii-x). In control cells, at 180 minutes post-

temperature shift, virtually all VSVG-GFP was found at the plasma membrane (Figure 9A, panel

v). In contrast, in cells depleted of Rab34, very little VSVG-GFP was found at the plasma

membrane, and the majority of the protein was retained in the Golgi (Figure 9A, compare panels

v and vi). At 180 minutes post-temperature shift, Pearson’s coefficients for VSVG-GFP and

WGA for control cells and knock-down cells of 0.82 and 0.44, respectively, show that while the

majority of VSVG-GFP in control cells colocalized with the plasma membrane, much less of the

GFP signal colocalized with WGA in cells depleted of endogenous Rab34 (p<0.001) (Figure

9B). Furthermore, while in control cells very little GFP signal was seen colocalizing with

GM130 at the Golgi (Pearson’s coefficient of 0.16), a significant amount of GFP signal remains

in the Golgi in cells depleted of Rab34 3 hours after release from the ER (Pearson’s coefficient

of 0.47, p<0.001) (Figure 9C, and 9B compare panels xi and xii). The large increase in

Pearson’s coefficients from 0 to 30 min post-temperature shift shows that VSVG-GFP is

efficiently transported to the Golgi in both control and knockdown cells (for example, Pearson’s

coefficient for GFP and GM130 increases from 0.23 to 0.73, and from 0.29 to 0.78 in control and

knock-down cells, respectively). Since Pearson’s coefficients for 0 min and 30 min time points

53

do not differ significantly between control cells and those lacking Rab34, it appears that ER to

Golgi transport is not affected by Rab34 knock-down, suggesting that Rab34 functions at a post-

Golgi step in the secretory pathway. The small proportion of VSVG-GFP that is still transported

to the plasma membrane in knock-down cells is probably due to either incomplete knock-down

of Rab34 in these cells, or the existence of both Rab34-dependent and Rab34-independent

pathways from the Golgi to the plasma membrane.

55

Figure 10. Rab34 is necessary for exit of VSVG-GFP from the Golgi. (A) VSVG-GFP secretion assay. HeLa cells were transfected with siRNA directed against Rab34 (siRNA) or scrambled control siRNA (control). Forty-eight hours later, cells were transfected with plasmid encoding VSVG-GFP and incubated at 40°C for 20 h. After cycloheximide treatment, the temperature was shifted to 32°C, and cells were fixed at the indicated time points and stained with a monoclonal anti-GM130 antibody to mark the Golgi or with WGA to mark the plasma membrane. Scale bar, 10 µm. Images are representative of greater than three experiments. (B) Colocalization of VSVG-GFP and WGA. Pearson's coefficients were calculated for 18 cells per condition from at least three experiments. Data are shown ±SE. *p < 0.001. (C) As in B, but for colocalization of VSVG-GFP and GM130.

56

2.4.6 Rab34 depletion arrests intra-Golgi transport of VSVG-GFP, not Golgi to TGN transport

Several molecules have been implicated in VSVG-GFP release from the TGN, including

PKD and PI4P (Liljedahl et al., 2001; Hausser A, 2005). Using conventional light microscopy

and colocalization techniques it is difficult to determine whether a protein is found in the trans-

Golgi cisternae or in the TGN, which lies distal to the trans-Golgi itself in the secretory pathway.

To explore the precise location of the effect of Rab34 on VSVG-GFP secretion, we exploited the

toxin Brefeldin A (BFA). BFA treatment is known to result in the retrograde transport of Golgi-

resident proteins into the ER (Lippincott-Schwartz J, 1990). The TGN, on the other hand, in

response to BFA treatment, condenses in the juxtanuclear region (Chege and Pfeffer, 1990).

This differential effect of BFA on trans-Golgi versus TGN-resident proteins allows for careful

dissection of these two compartments. To this end, we performed our VSVG-GFP secretion

assay in HeLa cells transfected with siRNA directed against Rab34 or the appropriate controls.

At either t=30min or t=180min, cells were treated with 5µg/ml BFA for 30 minutes prior to

fixation and imaging by spinning disk confocal microscopy (Figure 10). At t=30min, both

control cells (30 min ctrl) and knockdown cells (30 min siRNA) show VSVG-GFP to be in the

Golgi stack. BFA treatment confirms this, resulting in redistribution of VSVG-GFP to the ER

(Figure 10, top 4 panels). At t=180min, knockdown cells (180min-siRNA) show that VSVG-

GFP remains in the Golgi, and BFA treatment again results in the redistribution of the GFP

signal to the ER (Figure 10). These data suggest that Rab34 is required for intra-Golgi transport

of VSVG-GFP, not Golgi to TGN transport. As a control, cells were treated with the ceramide

analog, PDMP. PDMP has been shown to block VSVG-GFP transport at the TGN as a result of

defective protein ADP-ribosylation (De Matteisa et al., 1999). At t=180min, PDMP-treated cells

also contain VSVG-GFP in the Golgi, but BFA treatment fails to redistribute the GFP signal to

57

the ER (Figure 10, bottom panels). The VSVG-GFP protein condenses into a discrete pocket in

the juxtanuclear region, suggesting a TGN localization of VSVG-GFP in PDMP-treated HeLa

cells, demonstrating the differential effect of BFA on Golgi and TGN-resident proteins.

Collectively, the above experiments show that Rab34 is required for intra-Golgi transport of

VSVG-GFP in HeLa cells. This result places Rab34 upstream of PKD and PI4P in the secretory

pathway.

59

Figure 11. Rab34 is required for intra-Golgi transport of VSVG-GFP, not exit from the TGN. HeLa cells transfected with siRNA directed against Rab34 or scrambled control were transfected with VSVG-GFP at 40°C. At t = 0, cells were treated with cycloheximide and shifted to the permissive temperature of 32°C. At t = 30 or 180 min, cells were treated for 30 min with BFA at 32°C, fixed, and viewed using a spinning disk confocal microscope. At t = 30 min, cells transfected with control siRNA (30 min-ctrl) or Rab34 siRNA (30 min-siRNA) had VSVG-GFP in the Golgi. After 30-min BFA treatment (+BFA), GFP signal redistributed to the ER. At t = 180 min, Rab34 siRNA-treated cells (180 min-siRNA) retained VSVG-GFP in the Golgi, and BFA treatment (+BFA) redistributed the GFP signal to the ER. As a control, cells treated with PDMP retained VSVG-GFP in the TGN at t = 180 min (180 min-PDMP), as BFA treatment (+BFA) resulted in the condensation of the GFP signal in the juxtanuclear region. Scale bar, 10 µm.

60

2.4.7 Rab34 is not involved in ER to Golgi Transport

While confocal microscopy suggested that Rab34 was not involved in the transport of

proteins from the ER to the Golgi, we sought to examine this step of the secretory pathway

biochemically using endogenous MHC class I protein as a reporter. HeLa cells transfected with

either scrambled siRNA or siRNA targeting Rab34 were metabolically labeled with a pulse of

35S-methionine, and then chased with cold methionine for 0 to 60 minutes. Total MHC class I

was immunoprecipitated from cell lysates, and subsequently digested with endoglycosidase H

(endoH). EndoH cleaves N-linked oligosaccharides on proteins in the ER, but cannot cleave the

high mannose oligosaccharides found on proteins that have progressed to the medial Golgi

(Orlean et al., 1991). Thus, proteins in the ER are endoH sensitive, and proteins that have

progressed to the Golgi are endoH resistant. This difference can be seen as a mobility shift on a

polyacrylamide gel. As seen by the rates of acquisition of endoH resistance by endogenous

MHC class I protein, depletion of endogenous Rab34 has no effect on ER to Golgi transport in

HeLa cells (Figure 11). Taken with the VSVG-GFP secretion data, these results show that

Rab34 specifically functions at a post-Golgi step of the secretory pathway. Further, since EndoH

resistance is acquired in the medial Golgi, Rab34 must function at a transport step at or beyond

the medial Golgi.

61

A

B

62

Figure 12. Rab34 is not involved in ER to Golgi transport. HeLa cells were transfected with either scrambled siRNA (control) or siRNA directed against Rab34 (siRNA). Cells were labeled with 35S-Methionine, and chased with cold methionine for the indicated times. Cells were lysed, and total MHC class I was immunoprecipitated and digested with endoH as indicated. Protein was then run on polyacrylamide gels. (A) Representative gel showing increase in endoH resistant (EndoHR) form of MHC I as compared to endoH sensitive (EndoHS), indicating progression of MHC I protein from the ER to the Golgi. (B) Rate of ER to Golgi transport of MHC I as shown by the acquisition of endoH resistance by MHC I protein (n=3). Results are shown +/- standard error.

63

2.5 Discussion Previous reports have proposed various roles and subcellular localizations for Rab34

(Wang and Hong, 2002; Sun et al., 2003; Speight and Silverman, 2005). In the face of several

published phenotypes, we sought to clarify the role of Rab34 first by re-evaluating the literature

in our HeLa cell system, then by depleting HeLa cells of endogenous Rab34 using RNAi. Our

findings limit Rab34 localization to the Golgi, and cast doubt upon its suggested role at the

plasma membrane. The use of both fluorescence microscopy and immunoelectron microscopy

have shown that wild-type GFP-Rab34 is localized to the Golgi stack, as well as to a population

of cis-Golgi elements and intra-Golgi transport carriers. The report by Sun et al. (2003) led us to

examine the potential role of Rab34 at membrane ruffles in HeLa cells. Our attempts to establish

this role using quantitative colocalization with plasma membrane markers in HeLa cells were not

successful. Clearly further work must be done before one can safely conclude that Rab34 is

recruited to membrane ruffles in a manner that can be generalized to multiple cell types. We also

found that Rab34 has no effect on fluid-phase uptake in HeLa cells. These results suggest that

the findings of Sun et al. (2003) may represent a cell-specific phenomenon.

From the Golgi, our data demonstrate two roles for Rab34, which need not be completely

independent of one another. First, we found that active Rab34 is capable of shifting lysosomes

to the juxtanuclear region, which is consistent with published literature (Wang and Hong, 2002).

Our finding with the greatest functional significance, however, is that Rab34 is required for the

intra-Golgi transport of the model protein cargo, VSVG-GFP, as it traverses the secretory

pathway. Using three separate methods – namely siRNA, dominant-negative Rab34, and rescue

of the siRNA-mediated defect – we have shown that Rab34 is a novel member of the secretory

pathway. HeLa cells depleted of Rab34 by RNAi or dominant-negative Rab34 expression

64

exhibited a marked decrease in transport of VSVG-GFP from the Golgi to the plasma membrane.

The defect seen in siRNA-transfected cells can be rescued by expression of mouse Rab34,

indicating that this phenomenon is specifically due to Rab34 depletion. This result establishes

Rab34 as an essential player in a ubiquitous cellular function.

Both fluorescence microscopy of VSVG-GFP transport and rates of acquisition of endoH

resistance of endogenous MHC showed that secretory transport from the ER to the medial Golgi

remains intact in the absence of Rab34, since the medial Golgi is the site of complex N-

glycosylation of transmembrane proteins (Orlean et al., 1991). This result, in combination with

those described above, shows that Rab34 acts either within or immediately after the Golgi stack.

Since Rab34 is involved in intra-Golgi protein transport, one would expect that an effect

would be seen on both the trafficking of VSVG and the trafficking of the M6PR, since this

transport step is upstream of TGN sorting. Since no clear effect was seen on the steady-state

distribution of the M6PR, two possibilities exist. One is that the effect on the M6PR is subtler

than the effect on VSVG. Our data in Figure 8D may provide clues that while a gross change in

M6PR distribution is not occurring, a smaller-scale change in M6PR trafficking may be present

in HeLa cells transfected with Rab34 mutants. Further work involving dynamic measurements

of M6PR trafficking to the endosomal system in the presence of Rab34 mutants and

compartmental markers is required in order to elucidate a potential function for Rab34 in this

pathway. A second possibility is that Rab34 exhibits cargo selectivity within the Golgi. While

this may be an intriguing possibility, much more work needs to be done to attempt to define a

mechanism by which this could occur.

While our data support the finding that Rab34 is capable of moving lysosomes toward the

MTOC, the functional implications of lysosomal position remain unknown. From the Golgi, at

65

least two pathways for vesicle traffic depart – the classic secretory pathway to the plasma

membrane, for which we have shown Rab34 to be necessary, and another pathway to the late

endosome/lysosome. This second pathway is necessary for the delivery of acid hydrolases to the

maturing lysosome (Ghosh et al., 2003). Since Rab34 appears to be involved in the transport of

proteins through the Golgi along the secretory pathway, it is tempting to hypothesize that it is

also involved in trafficking to the lysosome, and that increased Golgi-to-lysosome traffic by

active Rab34 may be occurring while lysosomes shift toward the Golgi. However, as discussed

above, dominant-negative and constitutively active Rab34 did not grossly affect the localization

of the M6PR in HeLa cells, although a more subtle effect could not be ruled out. Thus, the

significance of the phenotype characterized by Rab34 induced movement of lysosomes toward

the MTOC remains to be determined.

While the mechanism by which Rab34 affects lysosomal position has been shown to

require interaction with RILP, which links Rab34 to the dynein/dynactin microtubule motor

system (Wang and Hong, 2002), the mechanism by which Rab34 effects secretion from the

Golgi is less clear. To date, only two effectors have been identified for Rab34 – RILP, and

hmunc13, which is a well-described PKC superfamily member that is involved in both vesicle

priming and the induction of apoptosis at the Golgi in response to phorbol ester treatment

(Augustin et al., 1999; Song et al., 1999). To determine the mechanism of Rab34 function in

constitutive secretion, we first sought to define the precise site of action of Rab34 in the

secretory pathway. BFA treatment revealed that Rab34 depletion arrests VSVG-GFP transport

within the Golgi itself, not at the TGN. This result mechanistically separates the function of

Rab34 from that of known mediators of TGN exit.

66

The exit of proteins from the TGN has been reported to involve protein kinase D (PKD),

as well as Golgi-resident sphingolipids and PI4P (Rosenwald et al., 1992; Echard et al., 2000;

Liljedahl et al., 2001; Hausser A, 2005). Dominant-negative PKD inhibits the fission of

transport carriers from the TGN, and its expression results in extensive tubulation of the TGN,

indicative of a release failure of these extending tubules from the TGN (Liljedahl et al., 2001).

While it is known that Golgi-resident diacylglycerol is responsible for the recruitment of PKD to

the Golgi, the molecular mechanism of PKD-mediated transport carrier fission has not been

completely defined (Baron and Malhotra, 2002). It is known, however, that PKD can activate

phosphatidylinositol 4-kinase III-β, resulting in an increase in TGN PI4P, which is in turn

required for vesicle fission (Hausser A, 2005). It has also been shown that inhibition of de novo

sphingolipid synthesis inhibits VSVG transport along the secretory pathway (Rosenwald et al.,

1992). The importance of sphingolipids in this process is not known, but the Golgi is a key store

of ceramide and sphingolipids (Rosenwald et al., 1992). Our work establishes that Rab34

functions upstream of these components of the secretory pathway.

Rab6A is involved in transport of VSVG through the Golgi itself (Echard et al., 2000).

Interestingly, it is constitutively active Rab6A, not dominant-negative Rab6A, which inhibits

secretion through the Golgi. This sets up an intriguing possibility whereby Rab6A and Rab34

may act in opposition to one another, since active Rab6A or loss of Rab34 inhibit secretion. It is

possible that these two inputs could allow the cell to control constitutive secretion at the Golgi in

response to various stimuli. Future experiments will seek to define the precise molecular events

of Rab34-mediated transport, as well as defining cellular regulators of Rab34 activity.

Finally, it is interesting to examine our results in the light of the findings by Wang and

Hong (2002) showing that Rab34 regulates lysosomal positioning from the Golgi. Their data

67

describe a pathway whereby Rab7-positive lysosomes migrate along microtubules to the peri-

Golgi region via an association between Rab7, RILP, and Golgi-bound Rab34 (Wang and Hong,

2002). This region appears to be particularly active, housing the Golgi, TGN, recycling

endosomes, lysosomes, and various other components of the endomembrane system. In addition,

at this same location within the cell, our lab has previously shown that hmunc13 interacts with

GTP-bound Rab34 via its second munc homology domain (Speight and Silverman, 2005).

Although it is premature to indulge in significant speculation at this point, it seems possible that

a situation exists whereby regulated formation of a molecular platform occurs involving protein

interactions between Rab34, Rab7, RILP, hmunc13 and probably as yet other unidentified

proteins.

68

Chapter 3

3 Mesangial cell munc13 contributes to increased TGF-β secretion during hyperglycemia via a rab34-dependent pathway

3.1 Abstract The mesangial cell plays a key role in the development and maintenance of diabetic

nephropathy (DN). Hallmarks of the disease include cellular hypertrophy and renal fibrosis,

both of which are influenced by dysregulated mesangial cell function, particularly abberant

secretion of cytokines and matrix components. The cytokine transforming growth factor-beta

(TGF-β) is known to be important in many aspects of the pathology associated with DN, and

several current treatments for DN decrease TGF-β levels in both human subjects and animal

models of diabetes. Previous work has shown that the phorbol ester receptor, munc13 is

upregulated in the diabetic kidney. We undertook a detailed study of the role of munc13 in DN

within the context of its recently described interaction with rab34. Rab34 is a known member of

the secretory pathway acting at the Golgi, and is required for secretion of a model protein.

Hyperglycemic conditions resulted in upregulation of munc13 and a concurrent increase in the

rate of protein secretion. The effect on secretion dynamics was inhibited when endogenous

munc13 or rab34 were depleted, and could be mimicked by forced overexpression of munc13.

The observed phenotype required the rab34-interacting domain of munc13, and was dependent

on munc13 localization. Finally, knockdown of munc13 in mesangial cells decreased secretion

of TGF-β, a critical molecule in the pathogenesis of DN. This work suggests that upregulation of

munc13 during diabetes may contribute to the renal injury seen in DN via its interaction with

rab34 in the secretory pathway.

69

3.2 Introduction Diabetic nephropathy (DN) is the leading indication for dialysis in Canada, the USA,

Europe, and Japan (Clark et al., 2000; Remuzzi et al., 2002). While the incidence of DN is

increasing, the pathogenesis of the disease is not fully understood. Several important mediators

of DN have been identified, including transforming growth factor beta (TGF-β), and protein

kinase c (PKC), as well as extracellular matrix molecules such as collagen I and fibronectin

(Reeves and Andreoli, 2000; Schena and Gesualdo, 2005; Noh and King, 2007).

Previous work in our lab identified hmunc13 (also known as ubiquitous munc13-2, or

ubmunc13-2) as a protein that is upregulated in the renal cortex of rats with streptozotocin-

induced diabetes (Song et al., 1998). This upregulation was seen in the cortical epithelium as

well as in glomerular cells, and further work suggested that activated hmunc13 induced apoptosis

in cultured renal cell lines (Song et al., 1999). Munc13s comprise a small family of C1 domain-

containing proteins within the PKC super-family (Brose and Rosenmund, 2002). Munc13

proteins contain a single C1 domain, at least one C2 domain, and two munc13 homology

domains, named MHD1 and MHD2 (Koch et al., 2000). The four family members, named

munc13-1 through -4, have been studied to varying degrees – munc13-1 is expressed in the brain

and pancreas, and is necessary for neurotransmitter vesicle priming and a process termed long-

term potentiation, as well as for insulin secretion from pancreatic beta cells (Betz et al., 1998;

Sheu et al., 2003). Munc13-3 is involved in the normal development of the visual cortex (Yang

et al., 2002). Munc13-4, a distant relative lacking the C1 domain, is involved in degranulation of

specific blood cell lineages, and is mutated in the genetic disorder familial hemophagocytic

lymphohistiocytosis (Yamamoto et al., 2004). Munc13-2 has a ubiquitously expressed variant,

and its role in the brain is also well studied (Rosenmund et al., 2002). Further to our work on

70

hmunc13 in DN, a recent study has found that a single nucleotide polymorphism (SNP) in the

UNC13B locus is associated with the development of DN in patients with type 1 diabetes

(Tregouet et al., 2008). This SNP is completely associated with others at regulatory sites within

the promoter region, meaning that changes in munc13-2 expression may be associated with the

development of diabetic nephropathy (Tregouet et al., 2008). Taken together, these data suggest

that hmunc13 may play a crucial role in the pathogenesis of diabetic nephropathy.

Recently, our lab identified hmunc13 as an effector of the small GTPase, rab34 (Speight

and Silverman, 2005). Hmunc13 binds rab34 in a GTP-specific manner via its MHD2 domain

(Speight and Silverman, 2005). Rab34 is a member of the rab family of small GTPases, which

are involved in virtually every aspect of vesicle transport – including vesicle budding,

trafficking, targeting, and fusion (Zerial and McBride, 2001). Rabs are able to carry out these

many functions by virtue of their compartmental distribution, and their interaction with a host of

effector proteins, including enzymes, cytoskeletal proteins, SNAREs, and other molecules

(Grosshans et al., 2006). Previous work in our lab has shown that rab34 is required for

constitutive secretion of the model viral protein, vesicular stomatitis virus glycoprotein (VSVG),

working at the level of intra-Golgi transport (Goldenberg et al., 2007).

It is within this context that we investigated the function of the hmunc13-rab34

interaction. In light of our work on rab34, we sought to examine a potential role for hmunc13 in

the secretory pathway. Using a temperature-sensitive mutant of VSVG fused to GFP (VSVG-

GFP), we were able to show that overexpression of hmunc13 increases the rate of VSVG-GFP

transport to the cell surface in cultured rat mesangial cells (MC). Culture of MC in high glucose,

which causes the upregulation of hmunc13, increases the rate of VSVG-GFP transport, and this

increase can be inhibited by siRNA-mediated knockdown of endogenous munc13-2.

71

Knockdown of rab34 also decreased the rate of VSVG-GFP transport in MC. Mechanistically,

studies in HeLa cells suggested that the effect of hmunc13 on VSVG-GFP transport requires the

rab34-interacting MHD2 domain, and that sequestration of hmunc13 to the plasma membrane by

treatment with the phorbol ester, 12-O-Tetradecanoylphorbol-13-acetate (TPA), abolished the

hmunc13 effect. Perhaps most interestingly, knockdown of munc13-2 in rat MC decreased both

basal and high glucose-stimulated secretion of TGF-β, placing munc13- and rab34-mediated

secretion within the context of a clinically significant cellular process. To our knowledge, this is

the first description of a role for hmunc13 in constitutive secretion, and is one that could have

profound implications for the pathogenesis of DN.

3.3 Materials and Methods Antibodies and Reagents: The following primary antibodies were used: TKG, a mouse

monoclonal antibody raised against an extracellular epitope of VSVG, was a generous gift from

Dr. Ira Mellman (Genentech, USA); mouse monoclonal anti-HA (Covance). Anti-mouse-Cy3

and anti-mouse-Cy2 (Jackson ImmunoResearch) were used as secondary antibodies for

immunofluorescence. TPA, PDBu, and cycloheximide were from Sigma. VectaShield mounting

medium was used for microscopy (Vector Labs).

Plasmids: The pEGFPdKA206K-N1-VSVG tsO45 vector encoding VSVG-GFP was a generous

gift from Dr. J. Lippincott-Schwartz (NIH, USA). Plasmids encoding HA-tagged wild-type

munc13, a mutant lacking the C1 domain (C1-less), and a mutant lacking the MHD2 domain

(MHD2-less) have been described previously (Song et al., 1999; Speight and Silverman, 2005).

Cell Culture and Transfection: HeLa cells were grown in MEM plus 10% FBS, and

maintained at 37°C in 5% CO2. Primary rat mesangial cells (RMC) were a generous gift from

Dr. Catherine Whiteside (Toronto, Canada), and were used between passages 13 and 20.

72

Isolation of RMC has been described previously (Hurst et al., 1995). RMC were cultured in low

glucose DMEM plus 10% FBS, and maintained at 37°C in 5% CO2. Plasmid DNA was

transfected using FuGene 6 Reagent (Roche) according to manufacturer’s directions, using a

DNA:FuGene ratio of 3:1.

VSVG Secretion Assay and Surface Labeling: Cells were plated on coverslips in 24 well

plates overnight at 37°C. Transfections were performed, and cells were incubated a further 24

hours at 40°C. When VSVG-GFP and munc13 vectors were co-transfected, munc13 (wt, C1-

less, or MHD2-less) was added in a 2:1 excess over VSVG-GFP in order to ensure co-

transfection of munc13 constructs in all cells expressing VSVG-GFP. Cells were then treated

with 50 µg/ml cycloheximide to halt protein synthesis, and were either washed in ice-cold PBS

(t=0 min) or transferred to 32°C. For a 45 min chase, cells were either incubated at 32°C for

45min, or for 30min, followed by addition of either TPA or PDBu at 100 nM, and incubation at

32°C for a further 15 min (for a total of 45 min). Cells were then washed in ice-cold PBS,

blocked in 10% milk, and treated with anti-VSVG antibody on ice. After further washes in PBS,

cells were fixed in 3.7% paraformaldehyde, and quenched in 100 mM glycine. Cells were then

treated with an anti-mouse-Cy3 antibody, washed, and mounted for microscopy. Slides were

imaged using a spinning disk confocal microscope (Leica) and Volocity software (ImproVision).

At least 10 cells were imaged per condition, and n≥3. Image analysis was performed using

ImageJ (Altan-Bonnet et al.). Briefly, cells to be analyzed were selected, and mean pixel

intensities were obtained. After subtracting background surface labeling at t=0 min, a ratio of

surface to total VSVG-GFP staining (i.e. red versus green fluorescence) was calculated for each

cell. The mean ratio was calculated for each condition, and results were expressed relative to

VSVG-GFP alone at t=45 min.

73

RMC Glucose Treatments: For glucose response experiments using RMC, primary RMC were

cultured in DMEM containing either 5.5 mM D-glucose (LG), 25 mM D-glucose (Yamamoto et

al.), or 5.5 mM D-glucose plus 19.5 mM L-glucose as an osmotic control (OC). Cells were

cultured as such for 72 hours, with a medium change at 48 hours. After 72 hours, cells were

transfected as described, and incubated overnight at 40°C in LG, HG, or OC medium. VSV

assay was performed the following day as described above.

Real-Time RT-PCR: Total RNA was isolated using the TRIzol Reagent (Invitrogen) and cDNA

was synthesized from 1 µg of total RNA using the Omniscript RT (Qiagen) kit. Real-time PCR

was then performed using ABI SYBR green on the ABI-PRISM 7900HT using the standard

curve method. Munc13 primers were designed using ABI Primer Express Software and RPL32

was employed as a housekeeping gene for analysis of relative expression. Primers for rat

munc13-2 were 5’- GGACGATGCATGGAAGGTGTAC -3’ and 5’-

GGATGACAAACACGCAAAGTGC -3’. Primers for rat RPL32 were 5’-

AAGAAAACCAAGCACATGCTGCC –3‘ and 5’- CTCAGCACAGTAAGATTTGTTGC -3’.

siRNA Treatments: Rat MC were transfected with Stealth siRNA (Invitrogen) 24 hours after

plating. Transfections were performed in Opti-MEM (Gibco) using 20 pmol siRNA per well of a

12 well plate. Lipofectamine 2000 was used for transfections at a concentration of 2.5 µL per

well. After 5 hours, medium was aspirated and replaced with normal DMEM (LG or HG) for

further experiments. Transfection of VSVG-GFP, if required, was done 48 hours later as

described above. siRNA sequences used were: munc13-2 5’-

GGCCUGCUUGAACUCUACAUAUGAA -3’, and rab34 5’-

GGAAGACCUGUCUUAUUAAUAGGUU -3’.

74

Munc13 Immunofluorescence: HeLa or RMC were plated on coverslips in 24 well plates

overnight. Cells were transfected with Munc13-HA (wt, C1-less, or MHD2-less), and the

following day cells were treated with vehicle alone (DMSO), or with 100 nM TPA or PDBu for

the indicated times. Cells were then washed in ice-cold PBS, fixed in 3.7% paraformaldehyde,

and quenched with 100 mM glycine. Cells were then permeabilized in 0.2% Triton X-100, and

blocked with 10% non-fat milk. Munc13-HA was labeled using anti-HA, and secondary

antibody was added (anti-mouse-Cy2) following washing. Cells were washed again in PBS, and

mounted on slides. Cells were imaged using a spinning disk confocal microscope (Leica) and

Volocity software (ImproVision).

TGF-β Secretion: RMC were seeded in 24 well plates in either LG or HG medium. Cells were

transfected with either control siRNA, or siRNA directed against munc13-2 as described above.

The following day, medium was replaced with LG or HG medium containing 0.5% FBS. 48

hours later, supernatants were collected for TGF-β ELISA (R&D Systems). To assay total

secreted TGF-β, samples were acidified to convert to active form according to manufacturer’s

instructions. All samples were loaded in triplicate. Cells were lysed and assayed for total

protein content using the DC protein assay (Bio-Rad), and results were expressed as pg TGF-

β/mg protein in lysate.

3.4 Results

3.4.1 Culture of RMC in high glucose increases the rate of VSVG-GFP secretion

Our lab initially identified munc13 as a protein that is upregulated in the renal cortex of

rats with streptozotocin-induced diabetes, as well as in cultured human mesangial cells (Song et

al., 1998, 1999). In the context of our work on rab34, we hypothesized that munc13 may

75

modulate the effect of rab34 on the secretory pathway. Specifically, we sought to test whether

culture of RMC in conditions mimicking the hyperglycemic state could effect constitutive

secretion in a munc13-dependent manner. To test this hypothesis, we cultured primary RMC for

72 hours in medium containing 5.5 mM D-glucose (LG), 25 mM D-glucose (Yamamoto et al.) or

5.5 mM D-glucose plus 19.5 mM L-glucose as an osmotic control (OC). Medium was changed

after 48 hours to ensure that glucose levels remained stable throughout the test period. After 72

hours, cells were transfected with VSVG-GFP overnight at 40°C in the appropriate glucose-

containing medium. Following this incubation, cells were shifted to 32°C for 45 minutes in the

presence or absence of TPA for the final 15 minutes, and were surface-labeled with an antibody

raised against an extracellular epitope of VSVG-GFP. Strikingly, RMC cultured in 25 mM D-

glucose (Yamamoto et al.) exhibited a greater than 50% increase in the ratio of surface to total

VSVG-GFP as compared to LG or OC controls, indicating an increase in the rate of VSVG-GFP

transport to the plasma membrane (Figure 12).

3.4.2 The increased rate of VSVG-GFP secretion in HG-treated cells is due to upregulation of munc13

Previous work in our lab suggested that the increase in the rate of VSVG-GFP secretion

might be due to increased amounts of endogenous munc13 interacting with rab34 at the Golgi.

While our lab has shown that high glucose upregulates munc13 expression in various renal cell

systems, we confirmed this result using real-time RT-PCR. RMC were cultured in LG, OC, or

HG medium as before, and total mRNA was extracted from the cells for RT-PCR analysis. As

seen in a representative experiment, HG medium caused an approximately 1.8-fold increase in

munc13 expression in RMC versus cells cultured in LG or OC conditions relative to the

housekeeping gene, RPL32 (Figure 13).

76

This result shows that munc13 is upregulated in our experimental conditions, but still

does not directly indicate a role for munc13 in the secretory phenotype that was observed. To

address this issue, we examined the rate of VSVG-GFP secretion in RMC cultured in LG

medium in the presence or absence of exogenous munc13. RMC grown in LG medium were

transfected with VSVG-GFP, with or without HA-tagged munc13 (HA-munc13). Munc13-

transfected cells exhibited an over 3-fold increase in the rate of VSVG-GFP secretion as

compared to untransfected cells (Figure 13B). This result, taken together with those above,

suggests that upregulation of munc13 is responsible for the increase in VSVG-GFP secretion

observed in RMC cultured in high glucose.

To further demonstrate that increased munc13 expression is responsible for the increase

in VSVG-GFP secretion seen in HG-cultured RMC, we employed siRNA technology to knock

down endogenous munc13 expression in RMC. When compared to cells transfected with control

siRNA, cells transfected with munc13 siRNA displayed a modest decrease in the rate of VSVG-

GFP secretion when cultured in LG medium (Figure 13C). When cultured in HG medium,

munc13 knock down resulted in a dramatic decrease in the VSVG-GFP secretion rate – surface

to total VSVG-GFP ratios for munc13 knock down cells were approximately 0.2 versus 1.4 in

controls (Figure 13C). This result, along with the RT-PCR and munc13 overexpression data,

strongly suggests that increased munc13 expression in RMC during exposure to high glucose is

responsible for the increased rate of secretion of the model protein cargo, VSVG-GFP.

77

Figure 13. The rate of VSVG-GFP secretion is increased by high glucose. Primary RMC were incubated for 72 hours in 5.5 mM D-glucose (LG), 25 mM D-glucose (Yamamoto et al.), or 5.5 mM D-glucose plus 19.5 mM L-glucose (OC). Cells were then transfected with VSVG-GFP and surface transport of VSVG-GFP was assayed using our standard protocol. Note the increase in transport rate in cells treated with HG alone. The ratio of surface to total VSVG-GFP was calculated for 10 cells per condition, and was expressed relative to the ratio in cells expressing VSVG-GFP alone. Data are means of n=6 experiments +/- standard error. *, p<0.05, †, p<0.01.

78

A

B

C

79

Figure 14. The increased rate of VSVG-GFP secretion in HG is due to munc13 upregulation. A. Real time PCR data showing upregulation of munc13 in RMC cultured in high glucose. RMC were cultured in low glucose (LG), osmotic control (OC), or high glucose (Yamamoto et al.) as described in materials and methods. Gene specific primers were used to amplify munc13-2 from total cDNA. Results are expressed in arbitrary units as a function of the expression of the housekeeping gene, RPL32. Graph shows the results of a typical experiment. B. RMC were transfected with VSVG-GFP plus or minus munc13, and incubated over night. VSVG-GFP protein was released from the ER for 45 minutes, in the presence or absence of TPA for the final 15 minutes as indicated. Cells were then fixed and surface VSVG-GFP was immunostained. Data are means of n=3 experiments, +/- SE. *, p<0.05. C. RMC were transfected with either siRNA against munc13-2 or scrambled control siRNA (ctrl). Surface VSVG-GFP was labeled as per the standard protocol. Note the dramatic decrease in the rate of VSVG-GFP secretion in knockdown cells as compared to controls. Data are means of n=3 experiments, +/- SE. *, p<0.05, †, p<0.01.

80

3.4.3 The increase in the rate of VSVG-GFP secretion occurs via a rab34-dependent pathway

We have established that upregulation of munc13 in response to high glucose increases

the secretion kinetics of VSVG-GFP. We next sought to determine the mechanism by which this

occurs. Since the munc13 binding partner, rab34, is required for secretion of VSVG-GFP in

HeLa cells, it was hypothesized that munc13 acts through rab34 to influence secretion rates in

RMC. Rab34 has never been studied in RMC, so the role of rab34 in secretion in RMC was

confirmed by monitoring the rate of VSVG-GFP secretion in cells transfected with siRNA

against endogenous rab34. In cells cultured in LG medium, there was a modest block in VSVG-

GFP secretion in rab34 knock down cells as compared to controls (Figure 14). In HG-cultured

cells, rab34 knock down caused a near 50% decrease in the ratio of surface to total VSVG-GFP

when compared to cells transfected with scrambled control siRNA (Figure 14). These data show

that our previous results in HeLa cells can be generalized to the RMC system, and that VSVG-

GFP secretion in RMC occurs, at least in part, via a rab34-dependent pathway.

To further investigate the role of the rab34-munc13 interaction in the secretory pathway,

a culture model that lacked endogenous munc13 expression was desirable. Previous work had

shown that HeLa cells do not normally express munc13, as tested using RT-PCR (unpublished

results). Since we have thoroughly studied the rab34-mediated secretion of VSVG-GFP in HeLa

cells, they are a useful system to exploit for these purposes. As expected, overexpression of

munc13 in HeLa cells mimicked the result seen in HG-cultured RMC – the rate of VSVG-GFP

secretion increased in a munc13-dependent fashion (Figure 14B). To determine the mechanism

by which this occurs, HeLa cells were transfected with a mutant of munc13 lacking the rab34-

interacting MHD2 domain (MHD2-less). While transfection of wild-type munc13 increased the

rate of VSVG-GFP secretion, transfection of MHD2-less munc13 resulted in a modest decrease

81

in secretion of the model protein (Figure 14B). Since rab34 is the only known protein that binds

munc13 via the MHD2 domain, this result suggests that the effect of munc13 overexpression on

VSVG-GFP secretion occurs via its interaction with rab34.

To further demonstrate the importance of the rab34-munc13 interaction, we used phorbol

esters to relocalize munc13 away from rab34. Rab34 is found at the Golgi, and munc13 is

largely cytosolic, allowing the two proteins to contact one another at the cytosolic face of the

Golgi stack. Short-term treatment (15 minutes) of cells with the phorbol ester 12-O-

Tetradecanoylphorbol-13-acetate (TPA) results in the relocalization of munc13 to the plasma

membrane. Conversely, 15 minute treatment with the short-chain phorbol ester, phorbol 12,13-

dibutyrate (PDBu) does not relocalize munc13 at all (Figure 15). Further, this localization effect

is the result of the direct interaction of the phorbol ester and munc13, since mutant munc13

lacking the C1 domain (C1less) does not translocate in response to TPA or PDBu treatment

(Figure 15B). We exploited the differential effects of these two phorbol esters to investigate the

role of the munc13-rab34 interaction on VSVG-GFP secretion. When TPA was added to cell

cultures for the final 15 minutes of VSVG-GFP secretion in HeLa cells expressing munc13, there

was a marked decrease in the rate of VSVG-GFP secretion, which was not seen in untransfected

cells (Figure 15). This was not seen following similar treatment with PDBu, which does not

result in munc13 relocalization (Figure 15). Taken together, these data suggest that the ability of

munc13 to interact with rab34 is critical for its influence on protein secretion.

82

A

B

83

Figure 15. The effect of munc13 on VSVG-GFP secretion is dependent on rab34 A. RMC were transfected with either siRNA against rab34 or scrambled control siRNA (ctrl). Surface VSVG-GFP was labeled as per the standard protocol. Note the decrease in the rate of VSVG-GFP secretion in knockdown cells as compared to controls when cultured in HG medium. Data are means of n=3 experiments, +/- SE. *, p<0.05. B. HeLa cells were transfected with VSVG-GFP either alone (VSV 45min), or in combination with wild-type munc13 (Munc13 45min) or MHD2-less munc13 (MHD2-less 45min). Surface VSVG-GFP was labeled by the standard protocol. Note that while full-length munc13 increases the rate of VSVG-GFP transport, MHD2-less does not. Data are means of n=6 experiments, +/- SE. *, p<0.05.

85

Figure 16. Normal munc13 localization is required for it to exert its effect on VSVG-GFP secretion. A. HeLa cells transfected with either wild-type munc13, C1-less munc13, or MHD2-less munc13 were treated for 15 minutes with 100 nM TPA or vehicle (DMSO), and were fixed and stained with an anti-HA antibody. Note the C1 domain-dependent translocation of munc13 to the plasma membrane in the presence of TPA. B. HeLa cells transfected with wild-type munc13 were treated for 15 minutes with 100 nM PDBu, and were processed as in A. Note that PDBu does not relocalize munc13 to the plasma membrane, as seen with TPA. Scale bar = 20mm. C. HeLa cells were transfected with VSVG-GFP plus or minus wild-type munc13, and incubated over night. VSVG-GFP protein was released from the ER for 45 minutes, in the presence or absence of TPA or PDBu for the final 15 minutes as indicated. Cells were then fixed and surface VSVG-GFP was immunostained. Data are means of n=6 experiments, +/- SE. *, p<0.05, †, p<0.01, NS=not significant.

86

3.4.4 Munc13-2 knockdown decreases TGF-β secretion

Since we have determined that munc13 plays an important role in the secretion of a

model protein, we wished to evaluate the potential effect of munc13 expression on the secretion

of a physiologically important molecule. In DN, many pathological processes depend on the

glucose-stimulated secretion of TGF-β by MC and other cell types (Ziyadeh, 2004). Because of

this, we chose to assay the secretion of TGF-β by MC in response to high glucose. Using a

commercially available ELISA, total TGF-β secretion (both active and latent forms) was assayed

in cells transfected with either control siRNA, or siRNA directed against munc13-2. In

agreement with the literature, culture of MC in high glucose stimulated TGF-β secretion by

RMC by 10% (Figure 16). Strikingly, knockdown of munc13-2 resulted in a decrease in TGF-β

secretion in cell culture in either LG or HG medium when compared to controls (Figure 16).

This decrease was larger in cells cultured in HG – when cultured in LG, munc13-2 knockdown

resulted in 80% of control TGF-β secretion, while knockdown of munc13-2 in HG-cultured cells

resulted in 70% of control TGF-β secretion. These data show that our results using VSVG-GFP

as a model protein cargo can be generalized to an endogenous molecule of clear clinical

relevance.

87

Figure 17. Munc13 is involved in TGF-β secretion. RMC cultured in HG or LG medium were transfected with control siRNA, or siRNA targeting munc13-2. Cells were then serum-starved, and incubated a further 48 hours. Supernatants were collected, and were assayed for total TGF-β secreted, as described in Materials and Methods. Results are expressed as pg TGF-β in the supernatant normalized to mg cellular protein present in whole cell lysates. Data are means of n=2 experiments.

0

100

200

300

400

500

600

700

800

900

1000

LG HG

pg

TG

F/m

g p

rote

in

ctrl

munc13-2

88

3.5 Discussion Our lab has previously shown that rab34 is required for the intra-Golgi transport of the

model cargo, VSVG-GFP, and that munc13 is an effector of rab34 (Speight and Silverman,

2005; Goldenberg et al., 2007). In light of these findings, we wished to examine the functional

significance of the munc13-rab34 interaction in the context of known roles of each of these

proteins. Since prior work identified that munc13 is upregulated in renal MC, we undertook

experiments to investigate a role for munc13 in the secretory pathway in this cell system. We

have demonstrated that culture of RMC in high glucose increases the rate of VSVG-GFP

transport through the secretory pathway, and that this phenomenon occurs in the face of glucose-

dependent upregulation of the munc13-2 gene. To address the munc13-specificity of this effect

on protein secretion, we have shown that overexpression of munc13 in RMC mimics the effect of

high glucose on VSVG-GFP secretion, and that siRNA-mediated knockdown of munc13

abolishes the effect of high glucose. Additionally, munc13 acts through a rab34-dependent

pathway, since knockdown of rab34 in RMC reduces secretion of VSVG-GFP, and experiments

carried out in HeLa cells have shown that the effect of munc13 on secretion relies on both the

rab34-interacting MHD2 domain of munc13, and the subcellular localization of munc13. Taken

together, these data allow us to hypothesize that a pathway exists linking high glucose, the

increased transcription of munc13, its subsequent interaction with rab34, and increased protein

transport through the secretory pathway. This is a pathway of great potential significance for DN.

First, munc13 is a molecule that has been shown to be upregulated in the face of hyperglycemia

(Song et al., 1998, 1999). In addition to its upregulation, munc13 is also activated in the diabetic

state, since hyperglycemia is known to elevate levels of intracellular DAG via metabolic

shunting into the polyol pathway (Whiteside and Dlugosz, 2002). Second, constitutive secretion

is a system of critical importance in DN – dysregulation of extracellular matrix (ECM) protein

89

secretion, as well as regulators of matrix synthesis, is a hallmark of the diabetic kidney (reviewed

in (Mason and Wahab, 2003). Our proposed model links the sensing of high glucose to the

potentially increased secretion of various ECM components.

It is worth speculating about the precise mechanism by which munc13 and rab34

influence secretion at the Golgi. Recent work has reslted in a new model for Golgi function,

whereby both Golgi-resident proteins and proteins traversing the secretory pathway dynamically

partition between two microdomains within the Golgi membrane (Patterson et al., 2008). These

microdomains are characterized by the presence of sphingolipids (SL), or glycerophospholipids

(GL). Additionally, several studies have demonstrated the importance of DAG in Golgi

function. The enzyme protein kinase D (PKD) is required for the scission of transport

intermediates from the Golgi, and is recruited to the Golgi by locally produced DAG (Baron and

Malhotra, 2002). Furthermore, a recent publication describes how the formation of tubules and

vesicles at the Golgi requires DAG (Asp et al., 2008). All of these findings together suggest

important roles for lipid organization within the Golgi membrane. Since munc13 is a C1

domain-containing protein with no catalytic activity, it is possible that munc13 at the Golgi

membrane is involved in clustering DAG to specific sites. The interaction of rab34 and munc13

would then result in the local accumulation of rab34 at Golgi regions of high DAG

concentration, which could be placing rab34 at its desired site of activity, or at a site where it will

be brought into contact with other binding partners. Further work will seek to determine the

validity of this model, and will examine the dynamics of rab34 and munc13 association.

TGF-β has emerged as a critically important player in the pathogenesis of DN. The

hallmark fibrotic, hypertrophic renal injury of DN is largely accounted for by increased TGF-β

expression and action in the diabetic kidney. Sustained production of TGF-β is known to result

90

in fibrosis, with the kidney being the most susceptible site (Border and Noble, 1994), and

specific transgenic expression of TGF-β in the rat kidney has been shown to cause

glomerulosclerosis (Isaka et al., 1993). Many of the mechanisms of TGF-β action during DN are

known; TGF-β activity stimulates ECM accumulation via several routes – ECM protein

production is increased in glomerular epithelia, MC, and renal fibroblasts (reviewed in (Isaka et

al., 1993; Sakharova et al., 2001), production of ECM-degrading proteases is decreased (Wilson

et al., 1993), and the production of ECM protease inhibitors is increased (Wilson et al., 1993).

Additionally, hypertrophic changes in renal cell types can also be linked to increased TGF-β

production; TGF-β influences cell proliferation and increases protein synthesis in several renal

cell types, and treatment with antibody against TGF-β has been shown to reduce ECM

production and renal hypertrophy in animal models (Sakharova et al., 2001).

Overproduction of TGF-β in diabetes is a result of several metabolic changes that occur

in the course of the disease. Hyperglycemia itself has been shown to upregulate TGF-β

expression via several pathways, including angiotensin II (AngII) production, and the formation

of advanced glycation end-products (Rossner et al.) (Ziyadeh et al., 1994; Hoffman et al., 1998;

Sakharova et al., 2001). Further, mechanical stress on the MC as a result of altered glomerular

hemodynamics results in an increase in TGF-β production (Sakharova et al., 2001). Finally,

proteinuria, which is itself a key factor in the progression of DN, causes an increase in NF-κB

expression, which in turn increases production of TGF-β (Cohen et al., 2003).

Clinically, several drugs used in the treatment of DN have been shown to effect the

expression of TGF-β. ACE inhibitor therapy is capable of reducing serum TGF-β levels in both

animal models and human trials (Border and Noble, 1998; Sharma et al., 1999). It is worth

noting that ACE inhibition alone cannot completely decrease TGF-β production to normal levels.

91

This points to the complex interplay between TGF-β signaling and the renin angiotensin system.

Additionally, treatment with thiazolidinediones can also decrease TGF-β levels in animal models

of diabetes (Ohtomo et al., 2007).

All of these factors clearly outline the pivotal role of TGF-β in DN. Future work will

seek to identify the mechanism of glucose-mediated upregulation of munc13, and to evaluate the

role of the munc13-rab34 pathway in animal models of diabetes. It would be an interesting

result if munc13 expression were found to be TGF-β-responsive: this would set up a feedback

loop whereby increased TGF-β secretion upregulates munc13, which then enhances the further

secretion of TGF-β.

92

Chapter 4

4 Discussion And Future Directions 4.1 The subcellular localization of rab34 Our work to date has focused on two main areas: defining the cell biology of rab34, and

elucidating the functional significance of the interaction between rab34 and munc13. Both of

these paths of study have been carried out within the context of DN, and our goal of increasing

our understanding of the pathogenesis of DN.

The role of rab34 was poorly defined at the outset of this project. Published reports

placed rab34 at both the Golgi and at the plasma membrane, and suggested that rab34 was

involved in the repositioning of lysosomes as well as plasma membrane ruffling and

macropinocytosis (Wang and Hong, 2002; Sun et al., 2003). As a general rule, rab proteins have

a specific subcellular localization, so these results were potentially at odds with one another. To

clarify the existing literature, we chose the HeLa cell as an appropriate, generalizable, and simple

model system in which to study rab34 function. In our hands, GFP-tagged rab34 was expressed

at the Golgi, as seen in both fluorescence and cryoelectron microscopy. The distribution of

rab34 within the Golgi was not immediately instructive as to its function – rab34 seemed to show

no preference for specific subdomains of the Golgi stack, and it was also seen on transport

intermediates in the close vicinity of the Golgi.

4.2 Potential roles for rab34 at the plasma membrane To complete our localization studies, we re-investigated the hypothesis that rab34 was

also found at plasma membrane ruffles. In live cells undergoing membrane ruffling, we used

quantitative fluorescence microscopy to show that when normalized per unit area of membrane

93

rab34 is not significantly recruited to membrane ruffles. It is our supposition that previous data

from Sun et al. (2003) may have represented an artifact of the morphological changes of a

ruffling cell, or that they could have represented a cell-specific phenomenon. Interestingly, a

recent report has again placed rab34 at the plasma membrane (Coyne et al., 2007). Rab34 was

found to be expressed at tight junctions in polarized monolayers of intestinal Caco-2 cells, and

expression of rab34 was found to be necessary for the entry of coxsackievirus into these cells via

macropinocytosis (Coyne et al., 2007). This report also identifies Rab5 as a critically important

rab in the process of occluding internalization (Coyne et al., 2007). It is tempting to speculate

about fitting these data in with both ours and those of Sun et al. Again, it is possible that specific

cell types are using rab34 for specific functions. Polarized cells are known to behave differently

than non-polarized monolayers – non-polarized, non-confluent cells lack tight junctions

altogether – and several molecular differences have been reported between polarized and non-

polarized cells (Mostov et al., 2003). In fact, entire trafficking routes exist in polarized epithelia

that do not in non-polarized systems – sorting between the apical and basolateral membrane

domains, and transcytotic transport – suggesting the potential for different roles for the

trafficking machinery in these two systems (Mostov et al., 2000). Future work should focus on

defining the role of rab34 in both types of systems, and analyzing the physiological relevance of

the data collected to various mammalian systems. For instance, one could envision a scenario

whereby rab34 had specialized functions in a polarized epithelium or neuron that did not exist in

non-polarized cells like the renal mesangial cell or fibroblast lineages.

4.3 The role of rab34 in lysosomal position and function Once we had defined rab34 as a Golgi-resident protein in HeLa cells, we sought to

determine the function of rab34 within the cell biology of the Golgi stack. To start, we revisited

94

the finding that rab34 was involved in the interorganellar relocalization of lysosomes toward the

Golgi (Wang and Hong, 2002). These data were reproduced in our HeLa cell system. Two

interesting questions arise from these findings – What is the precise molecular mechanism of this

phenotype, and what is the functional significance of this finding? The answer to the first

question is not clear. It is known that rab34 binds RILP, and that RILP binds to both rab7 on the

lysosomal membrane and to microtubule motors within the dynein/dynactin system (Wang and

Hong, 2002). It is also clear from the work of Wang and Hong that rab34 is exerting its

influence on lysosomes without leaving the Golgi membrane. So how does this occur? One

possible model is that RILP binds rab7, and begins to move lysosomes toward the minus end of

microtubules via dynein motors. Once adjacent to the Golgi, RILP can then bind rab34, resulting

in a tripartite complex between rab34, RILP, and rab7. Shifting the equilibrium of active rab34 –

as was achieved by expressing constitutively active rab34 – provides more binding sites for

RILP, as well as the capacity for a more stable rab34-RILP interaction, resulting in a mass action

effect of shifting lysosomes toward the Golgi. The drawbacks of this model are that such a

tripartite complex would certainly be beyond the resolution of light microscopy, so if this were

the case, lysosomes (or at least RILP) should be seen to colocalize with rab34 at the Golgi, not to

simply appose rab34.

To address the second question – what is the functional relevance of lysosomal

repositioning – further work is required. Wang and Hong have shown that the repositioned

lysosomes retain normal functionality (Wang and Hong, 2002). Additionally, caution must

always be used when interpreting the results gathered using overexpression of a constitutively

active protein. In this case, high levels of active rab34 were introduced to the cells, providing

many ectopic binding sites for endogenous RILP. From these experiments alone, one cannot rule

out the possibility that the observed phenotype is an artifact induced by forced expression of

95

active rab34. With this caveat in mind, it is still possible to speculate about a potential

physiological role for the rab34 effect on lysosomal position. Transport between the Golgi and

late endosome/lysosome follows a well-studied pathway. The M6PR transports sugar-containing

acid hydrolases directly from the trans-Golgi to the developing lysosome, and then is recycled

back to the trans-Golgi after delivering its cargo (Bonifacino and Rojas, 2006). The positioning

of lysosomes near the Golgi could have an effect on the dynamics of this transport pathway. Our

preliminary examination of this pathway revealed no gross changes in M6PR dynamics as a

result of active or dominant-negative rab34 expression, but careful dissection of the pathway

may reveal a more subtle involvement of rab34 in this system (Goldenberg et al., 2007).

A recent publication has revealed a correlation between mycobacterial infection and

rab34 expression (Gutierrez et al., 2008). In this study, infection of a mouse macrophage cell

line with Mycobacterium smegmatis resulted in transient upregulation of rab34 expression at

both the mRNA and protein levels, and this upregulation was dependent upon NF-κB (Gutierrez

et al., 2008). Infection of cells with M. avium did not cause the same rab34 changes, and

inhibition of NF-κB signaling reduced lysosomal killing of M. smegmatis in infected cells

(Gutierrez et al., 2008). M. smegmatis is non-pathogenic, and is routinely killed in the

lysosomes of infected cells, while M. avium is not. These results suggest that rab34 upregulation

by NF-κB – along with a host of other gene expression changes documented in this study – may

be critically important for the killing of intracellular pathogens. If so, this would tend to support

the model whereby the relocalization of lysosomes by rab34 is either functionally important for

proper or enhanced lysosomal killing, or that maybe this phenotype is observed secondary to

some other functional change due to rab34 activation, such as increased transport of lysosomal

enzymes to the late endosome. Follow-up work from this study and the initial finding by Wang

96

and Hong could yield interesting and important information on the role of rab34 in lysosomal

structure and function.

4.4 The role of rab34 in constitutive secretion After establishing the localization of rab34 in our system, and re-evaluating the existing

literature, we focused on determining the function of rab34 within the context of the Golgi itself.

Our results have shown that rab34 is required for the secretion of a model protein, VSVG-GFP.

Using dominant-negative rab34, siRNA-mediated knockdown of endogenous rab34, and rescue

of the knockdown phenotype with rab34, we have established rab34 as a Golgi-resident member

of the secretory pathway. Further mechanistic dissection of this phenotype revealed that rab34

works within the Golgi stack itself, and not in either the TGN, or the ER or ERGIC

compartments, as evidenced by experiments using BFA and endoH resistance assays. Several

lines of questioning stem from these results, many of which seek to further define the molecular

mechanisms of rab34 function, and to place rab34 into the overall context of the secretory

pathway and Golgi dynamics as a whole.

As described in Chapter 2, many key players in intra-Golgi transport and Golgi exit have

already been defined. Critical roles have been assigned to PKD, PI4 kinase, and rab6a, as well

as lipid signals from sphingolipids, DAG, and PI4P (Rosenwald et al., 1992; Echard et al., 2000;

Liljedahl et al., 2001; Baron and Malhotra, 2002; Hausser A, 2005). Further, COPI coats are

required for vesicle budding during intra-Golgi transport, and clathrin coat-mediated budding

controls exit from the TGN (reviewed in (Bonifacino and Glick, 2004)). Like clathrin coats,

COPI coats are multi-subunit complexes, with tight coordination with respect to assembly and

disassembly, as well as lumenal domains involved in cargo selection (Bonifacino and Glick,

2004). The precise mechanisms governing both cargo selection and the determination of vesicle

97

budding sites are under intense investigation. The precise point at which rab34 fits into this

puzzle is difficult to say using our current data. It is possible to speculate that it could play a role

in coat protein recruitment, or that it could be involved in regulating the activity of Arf proteins,

which are the activators of COPI coat assembly (Bannykh et al., 2005). Defining further protein-

protein interactions for rab34, as well as additional studies looking specifically at cargo

movement through the Golgi in the face of rab34 manipulation will be required to further define

the role of rab34 in this process.

The Golgi stack is a site of massive transport movement and enzymatic flux. Lipid

content turns over at a high rate, and vesicle traffic is constantly traversing the stack in both

directions. Adding to the complexity of Golgi processes is the need to define molecules that are

traversing the Golgi versus molecules that are Golgi resident. For many years, two competing

models have dominated the debate surrounding intra-Golgi transport – cisternal maturation and

vesicle transport (Pelham, 2001). The vesicle transport theory states that both anterograde and

retrograde movement of cargoes through the Golgi occur by sequential budding and fusion of

vesicles to the cisternae of the Golgi stack (Pelham, 2001). Cisternal maturation postulates that

cargoes traversing the Golgi remain in the cisternae, and that each compartment matures over

time from cis to trans – therefore, a picture of the Golgi stack represents a snapshot of transport

through the organelle over time, with the cis-face containing newly synthesized cargo, and the

trans-face containing older molecules awaiting export from the Golgi (Patterson et al., 2008). In

this model, COPI-mediated vesicle transport serves to recycle Golgi-resident proteins to their

preferred site, and does not participate in anterograde traffic. Currently, the cisternal maturation

model has been the model of choice, largely due to both kinetic analysis and data suggesting that

large cargoes like procollagen – which are too large to fit in transport vesicles – still traverse the

Golgi at a predictable rate without ever leaving the cisternae (Bonfanti et al., 1998). More recent

98

work has used fluorescence microscopy to examine transport of VSVG-GFP, and a short pulse of

VSVG-GFP is shown to move through the Golgi without ever leaving its cisterna – that is, only

one cisterna contains VSVG-GFP at any given time (Mironov et al., 2001). While these studies

do not rule out the use of vesicles for anterograde transport of Golgi cargoes, they certainly

suggest that vesicular transport is not absolutely required.

Even more recently, the group of Jennifer Lippincott-Schwartz has put forward a new

model for transport through the Golgi and retention of Golgi-resident proteins. This model

involves rapid partitoning of proteins between a two-phase membrane system (Patterson et al.,

2008). Using VSVG-GFP as a model, electron microscopy, inverse fluorescence recovery after

photobleaching (iFRAP), and computer modeling were employed to observe transport kinetics

within the Golgi in real time. In brief, the model describes two lipid domains within each of the

seven Golgi cisternae: one is enriched in sphingolipids (SL) and contains proteins destined for

export, and the other is enriched in glycerophospholipids (GPL) containing resident Golgi

enzymes (Patterson et al., 2008). Both types of protein traverse both microdomains, but prefer

one to the other. From cis to trans, the ratio of SL to GPL increases, suggesting that more

exported proteins will eventually arrive at later cisternae. Additionally, resident proteins with

different SL/GPL affinities will preferentially segregate to a given cisterna (Patterson et al.,

2008). This model satisfies all observations of Golgi dynamics, and also unifies some other

principles from the literature. For instance, protein effectors of various Golgi lipids, such as

PI4P and PKD, could be recruited to various domains as a result of SL/GPL ratios (Patterson et

al., 2008).

How does this all relate to rab34? First, while our EM studies showed no clear

subcompartmental organization of rab34 in the Golgi, it is possible that rab34 preferentially

99

partitions to SL or GPL enriched areas – due to its role in transport through the Golgi, one would

assume a preference for SL. Research on other rab proteins has shown a feedback loop involved

in rab partitioning to specific membrane domains. Specifically, rab5 has been shown to

segregate into a domain enriched for various protein and lipid components involved in its proper

function (Zerial and McBride, 2001). As an example, active rab5 recruits PI3-Kinase, resulting

in local production of PI3P. The combination of active rab5 and PI3P recruits the rab5 effector,

EEA1 via its interaction with rab5 and with PI3P via its FYVE domain (Zerial and McBride,

2001). Several loops like this exist, resulting in the establishment of a functional rab5 domain.

It is possible that a similar feedback system exists with rab34, whereby recruitment of rab34 to a

specific lipid-enriched domain of the Golgi allows rab34 to enter an environment that is similarly

enriched for its effectors and other partners. Interestingly, rab34 has been shown in our lab to

bind the enzyme serine palmitoyltransferase (SPT) in a bacterial two-hybrid system (unpublished

data). SPT catalyzes the rate-limiting step of de novo ceramide synthesis, and is a part of the

sphingolipid synthesis pathway at the ER and Golgi (Hanada, 2003). Preliminary work carried

out in our lab suggests that munc13 can increase the level of intracellular ceramide through SPT,

and that this effect is dependent on the munc13 C1 domain, and the munc13 interaction with

rab34 (Figure 17). It is tempting to speculate that a system could exist whereby recruitment of

rab34 could lead to the recruitment of munc13 along with SPT, leading to an increase in local SL

production, contributing to the SL/GPL gradients reported by Patterson et al. (2008).

100

Figure 18. Munc13 transfection increases ceramide levels via rab34 and SPT. HEK cells were transfected with either full length (hmunc13) or MHD2-less munc13, and treated as indicated with vehicle (DMSO), PDBu, or myriocin (a specific inhibitor of SPT). Ceramide levels were assayed, and normalized against total cellular protein. Note that PDBu treatment of munc13-expressing cells increases ceramide levels, and that the increase can be blocked by SPT inhibition. MHD2-less munc13 has no effect on ceramide levels. Data are means of n=2 experiments. This work was completed by Pam Speight.

A B

101

4.5 The role of munc13 in constitutive secretion Work in Chapter 3 defined a novel role for munc13 in constitutive secretion. Work in

both HeLa cells and cultured rat MC showed that munc13 overexpression increased the rate of

VSVG-GFP transport to the plasma membrane, and that this effect required the MHD2 domain

of munc13. To date, the only known binding partner of the munc13 MHD2 domain is rab34,

suggesting that the munc13-rab34 interaction is critical for inducing this phenotype.

Additionally, relocalization of munc13 to the plasma membrane abrogates this effect, showing

that the ability of munc13 to interact with rab34 at the Golgi may be required for its influence on

secretion kinetics. The precise molecular mechanism of this phenomenon remains to be

determined, but one can formulate a model based on current data. As outlined in the previous

section, an interesting potential scenario exists whereby the interaction of munc13 and rab34 at

the Golgi is involved in a feedback loop resulting in local production of sphingolipid species and

the concomitant increase in secretion of proteins from the Golgi. Further work would be

required to test this hypothesis, including detailed measurement of SL content in the Golgi in

response to munc13 overexpression, and real-time imaging of protein movement through the

Golgi to further define the site of action of munc13 on the secretory pathway. It is also possible

that the effect of munc13 on secretion occurs through a previously undefined protein-protein or

protein-lipid interaction. Munc13 is a large protein, with many potential interacting domains and

no catalytic domain of its own. As an adaptor protein, munc13 could be scaffolding several

molecules together to form a functional complex that is involved in protein trafficking. This

proposed complex could be found using a proteomics approach and mass spectroscopy on

proteins co-precipitating with munc13. As we learn more about secretion from the Golgi and

about protein networks involving munc13, further mechanistic details of this pathway will be

defined.

102

Based on the roles of rab34 and DAG in the secretory pathway, it is interesting to

speculate on several potential models for the function of munc13 in the secretion at the Golgi.

Clearly, DAG is a key molecule involved in the activation of C1 domain-containing proteins. It

is known that vesicle budding mediated by PKD requires local DAG production at the Golgi in

order for PKD to be recruited to the Golgi membrane (Baron and Malhotra, 2002). Additionally,

the highest concentration of DAG in biological membranes is thought to be present in the Golgi

itself (Gomez-Fernandez and Corbalan-Garcia, 2007). Finally, while DAG is required for

vesicle budding via recruitment of PKD, DAG is also known to promote fusion of membranes,

and as such DAG may also be involved in the fusion of transport carriers within the Golgi itself,

or between the Golgi and the TGN (Gomez-Fernandez and Corbalan-Garcia, 2007). Within this

context, we can attempt to place munc13 into the known pathways existing at the Golgi

membrane. As stated previously, munc13 lacks any catalytic activity of its own; munc13

functions are therefore carried out via interaction with known binding partners at the Golgi, such

as rab34 or SPT. One possibility is that recruitment of munc13 to the Golgi by DAG serves to

concentrate DAG to specific membrane subdomains. This type of function for an adaptor

protein has been described in other systems. For instance, the protein Annexin A2 has been

shown to bind phosphatidylinositol 4,5-bisphosphate (PIP2) via its PH domain (Gerke and Moss,

2002). Interaction between the PH domain and PIP2 results in the clustering of PIP2 within

biological membranes, creating localized regions of PIP2 enrichment that then influence various

cellular functions, such as exocytosis via recruitment of other PIP2 binding proteins (Grishanin

et al., 2004; Chasserot-Golaz et al., 2005). One intriguing possibility is that munc13 is recruited

to the Golgi by DAG, and perhaps active rab34 as well, where it triggers the clustering of DAG

to specific microdomains via its C1 domain. The clustering of DAG could then be involved in

the recruitment of other proteins that are required for secretion, such as PKD, or DAG itself

103

could then promote the fusion of membranes at sites of munc13-mediated DAG enrichment.

This model would provide the mechanism by which munc13 influences secretion at the Golgi,

and the interaction of active rab34 and munc13 would help explain our data showing modulation

of secretion kinetics by munc13 overexpression in an MHD2 domain-dependent manner. In this

model DAG and active rab34 recruit munc13 to the Golgi membrane, where clustering of DAG

and potentially the recruitment of other DAG-binding proteins occurs. This cascade then results

in an increase in membrane budding or fusion at specific sites. Experiments using in vitro

membranes, or high-resolution fluorescence microscopy could be used to examine this

hypothesis by searching for DAG clusters in the presence of munc13 or its C1 domain. When

added to the Lippincott-Schwartz model of two-phase lipid partitioning at the Golgi membrane,

it appears that sub-organellar clustering of specific lipids and lipid-binding proteins could be the

driving force of trafficking through the Golgi stack.

4.6 Munc13 in diabetic nephropathy DN is the most common indication for dialysis in the developed world (Clark et al.,

2000; Remuzzi et al., 2002). With the overall number of patients with diabetes increasing at an

alarming rate, the total burden of DN on the health care system will continue to expand. As

such, developing effective treatment and screening tools for DN will be a critical challenge for

medical research for years to come. Much is known about the molecular mechanism of the

pathogenesis of DN – TGF-β, advanced glycation end-products (Rossner et al.), nitric oxide, the

renin-angiotensin system, PKC activation, and dysregulated ECM homeostasis all play critical

roles in the development and maintenance of diabetic renal injury (Friedman, 1999; Reeves and

Andreoli, 2000; Whiteside and Dlugosz, 2002; Schena and Gesualdo, 2005; Noh and King,

2007; Cherney et al., 2008). Current treatment strategies are aimed at many of these mediators,

104

and further elucidation of the precise involvement of each of them will be required before a

definitive treatment is identified.

Our lab has identified munc13 as a player in DN. Diabetic rat models, as well as cell

culture models, indicate that munc13 is upregulated in response to hyperglycemia, and that this

upregulation occurs along with the activation of munc13 by DAG and an increase in apoptosis in

cells overexpressing munc13 (Song et al., 1998, 1999). Further work defined munc13 as an

effector of rab34, and our most recent data suggested a role for munc13 in the regulation of

protein secretion via the munc13-rab34 interaction. Most strikingly, rat MC cultured in

hyperglycemic conditions upregulated endogenous munc13 expression, and the rate of protein

secretion was increased in these cells. Forced downregulation of munc13 or rab34 using siRNA

blocked this effect, showing that munc13 and rab34 were specifically required for this

phenomenon. These data represent a first demonstration of the importance of munc13 and rab34

in a culture system of physiological importance in a significant medical condition. The precise

role of this phenomenon in DN will be the subject of future investigations. However, our current

data are consistent with a scenario whereby hyperglycemia induces munc13 expression, which

occurs alongside increased TGF-β secretion. This results in increased expression of ECM

molecules, which are now readily secreted into the extracellular space because of increased

munc13 expression. If this scenario holds true, one could see that inhibition of munc13 could be

of value in the treatment of DN. Furthermore, as stated above, rab34 expression is upregulated

by NF-κB, which is also stimulated during diabetes. These factors could converge to upregulate

both rab34 and munc13, leading to significant dyfunction of the secretory pathway.

During the time this work was being completed, a European group was independently

completing a clinical study looking for SNPs that associated with the development of DN in

105

patients with type 1 diabetes (Tregouet et al., 2008). The only SNP found to have a significant

association with the development of DN was found in the first intron in the UNC13B gene locus.

This SNP was associated with other SNPs found within regulatory regions in the locus,

suggesting a potential association between munc13 expression and the development of DN.

These data provide a potential link between our findings and the development of DN.

Increased secretion of various cellular products is a hallmark of diabetic nephropathy. As

indicated above, secretion of fibronectin, collagen, TGF-β, and other cytokines and ECM

components is increased in the diabetic kidney. As such, targeting munc13 activation, or the

munc13-rab34 interface could prove to be a significant therapeutic target in the treatment of DN.

To test the efficacy of such a strategy, future directions will include testing in vivo siRNA-

mediated knockdown of munc13 in diabetic animal models, as well as functional analysis of the

secretory pathway in MC isolated from munc13-2 knockout mice. Specifically, the development

of a kidney-specific munc13-2 knockout animal would provide a powerful tool in the

investigation of this hypothesis.

One line of current investigation in the treatment of DN is pharmacological inhibition of

PKC-β. Ruboxistaurin, a specific inhibitor of PKC-β, is being investigated for the treatment of

both diabetic nephropathy and retinopathy (Tuttle et al., 2005; Tuttle et al., 2007). In a one year,

multi-centre pilot study, ruboxistaurin was shown to improve renal function in patients with DN

that was unresponsive to ACE inhibitor therapy (Tuttle et al., 2005). It is our hypothesis that

current data regarding munc13 and DN may suggest that caution be taken in using PKC

inhibition as a DN treatment. Our data show that munc13 is upregulated in the diabetic kidney,

and that this upregulation comes along with physiological consequences on the secretory

pathway and apoptosis. Munc13 and PKC isoforms are members of the PKC superfamily of C1

106

domain-containing proteins. Munc13 isoforms have been shown to bind phorbol esters and

DAG with similar affinities to PKC isoforms, making them alternate effectors of DAG signaling

(Ahmed et al., 1992). Furthermore, it is known that prolonged hyperglycemia increases

intracellular DAG via sugar flux through the polyol pathway (Whiteside and Dlugosz, 2002).

What will the consequences be of munc13 activation in the face of PKC inhibition? It is clear

that diabetes creates a highly favourable environment for munc13 activation – both DAG content

and munc13 levels are increased – and that this would normally be joined by PKC activation.

When PKC-β activation is specifically blocked, what is the effect of munc13 activation in this

new context? One could envision a scenario whereby PKC and munc13 pathways act in

opposition of one another – PKC signals for cell survival, and munc13 signals for apoptosis,

among other phenomena (Song et al., 1999). Additionally, PKC and munc13 signaling are both

important in normal brain function and neurotransmitter vesicle priming (Brose and Rosenmund,

2002). It is entirely possible that PKC inhibition will have significant off-target effects on

neurotransmission in patients due to unopposed DAG signaling through munc13 in hippocampal

neurons. Finally, the role of munc13 in insulin secretion has also been well documented (Sheu et

al., 2003). It is also possible, therefore, that PKC inhibition will perturb munc13 signaling in the

beta cell and lead to altered insulin secretion in patients taking ruboxistaurin. It is reasonable to

suggest, therefore, that these types of off-target effects should be studied in depth prior to the

large-scale adoption of PKC-β inhibition as a treatment for DN.

107

References Ahmed, S., Maruyama, I.N., Kozma, R., Lee, J., Brenner, S., and Lim, L. (1992). The Caenorhabditis elegans unc-13 gene product is a phospholipid-dependent high-affinity phorbol ester receptor. Biochem J 287 ( Pt 3), 995-999. Allan, B.B., Moyer, B.D., and Balch, W.E. (2000). Rab1 Recruitment of p115 into a cis-SNARE Complex: Programming Budding COPII Vesicles for Fusion. Science 289, 444-448. Alory, C., and Balch, W.E. (2000). Molecular basis for Rab prenylation. J Cell Biol 150, 89-103.

Altan-Bonnet, N., Sougrat, R., and Lippincott-Schwartz, J. (2004). Molecular basis for Golgi maintenance and biogenesis. Current Opinion in Cell Biology 16, 364-372.

Andrews-Zwilling, Y.S., Kawabe, H., Reim, K., Varoqueaux, F., and Brose, N. (2006). Binding to Rab3A-interacting molecule RIM regulates the presynaptic recruitment of Munc13-1 and ubMunc13-2. J Biol Chem 281, 19720-19731. Arrieumerlou, C., Randriamampita, C., Bismuth, G., and Trautmann, A. (2000). Rac Is Involved in Early TCR Signaling. J Immunol 165, 3182-3189. Asp, L., Kartberg, F., Fernandez-Rodriguez, J., Smedh, M., Elsner, M., Laporte, F., Barcena, M., Jansen, K.A., Valentijn, J.A., Koster, A.J., Bergeron, J.J., and Nilsson, T. (2008). Early Stages of Golgi-Vesicle and -Tubule Formation Require Diacylglycerol. Mol Biol Cell.

Augustin, I., Rosenmund, C., Sudhof, T.C., and Brose, N. (1999). Munc13-1 is essential for fusion competence of glutamatergic synaptic vesicles. Nature 400, 457-461.

Bannykh, S.I., Plutner, H., Matteson, J., and Balch, W.E. (2005). The role of ARF1 and rab GTPases in polarization of the Golgi stack. Traffic 6, 803-819.

Barg, S., Eliasson, L., Renstrom, E., and Rorsman, P. (2002). A subset of 50 secretory granules in close contact with L-type Ca2+ channels accounts for first-phase insulin secretion in mouse beta-cells. Diabetes 51 Suppl 1, S74-82. Baron, C.L., and Malhotra, V. (2002). Role of diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science 295, 325-328. Betz, A., Ashery, U., Rickmann, M., Augustin, I., Neher, E., Sudhof, T.C., Rettig, J., and Brose, N. (1998). Munc13-1 is a presynaptic phorbol ester receptor that enhances neurotransmitter release. Neuron 21, 123-136.

Betz, A., Okamoto, M., Benseler, F., and Brose, N. (1997). Direct interaction of the rat unc-13 homologue Munc13-1 with the N terminus of syntaxin. J Biol Chem 272, 2520-2526.

Betz, A., Thakur, P., Junge, H.J., Ashery, U., Rhee, J.S., Scheuss, V., Rosenmund, C., Rettig, J., and Brose, N. (2001). Functional interaction of the active zone proteins Munc13-1 and RIM1 in synaptic vesicle priming. Neuron 30, 183-196. Bonfanti, L., Mironov, A.A., Jr., Martinez-Menarguez, J.A., Martella, O., Fusella, A., Baldassarre, M., Buccione, R., Geuze, H.J., Mironov, A.A., and Luini, A. (1998). Procollagen traverses the Golgi stack without leaving the lumen of cisternae: evidence for cisternal maturation. Cell 95, 993-1003.

108

Bonifacino, J.S., and Glick, B.S. (2004). The mechanisms of vesicle budding and fusion. Cell 116, 153-166.

Bonifacino, J.S., and Rojas, R. (2006). Retrograde transport from endosomes to the trans-Golgi network. Nat Rev Mol Cell Biol 7, 568-579.

Border, W.A., and Noble, N.A. (1994). Transforming growth factor beta in tissue fibrosis. N Engl J Med 331, 1286-1292.

Border, W.A., and Noble, N.A. (1998). Interactions of transforming growth factor-beta and angiotensin II in renal fibrosis. Hypertension 31, 181-188.

Brose, N., Hofmann, K., Hata, Y., and Sudhof, T.C. (1995). Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J Biol Chem 270, 25273-25280. Brose, N., and Rosenmund, C. (2002). Move over protein kinase C, you've got company: alternative cellular effectors of diacylglycerol and phorbol esters. J Cell Sci 115, 4399-4411. Calakos, N., Schoch, S., Sudhof, T.C., and Malenka, R.C. (2004). Multiple roles for the active zone protein RIM1alpha in late stages of neurotransmitter release. Neuron 42, 889-896. Carrasco, S., and Merida, I. (2007). Diacylglycerol, when simplicity becomes complex. Trends Biochem Sci 32, 27-36. Chapman, E.R. (2002). Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Nat Rev Mol Cell Biol 3, 498-508. Chasserot-Golaz, S., Vitale, N., Umbrecht-Jenck, E., Knight, D., Gerke, V., and Bader, M.F. (2005). Annexin 2 promotes the formation of lipid microdomains required for calcium-regulated exocytosis of dense-core vesicles. Mol Biol Cell 16, 1108-1119.

Chege, N.W., and Pfeffer, S.R. (1990). Compartmentation of the Golgi complex: brefeldin-A distinguishes trans- Golgi cisternae from the trans-Golgi network. J. Cell Biol. 111, 893-899.

Chen, W., Feng, Y., Chen, D., and Wandinger-Ness, A. (1998). Rab11 Is Required for Trans-Golgi Network-to-Plasma Membrane Transport and a Preferential Target for GDP Dissociation Inhibitor. Mol. Biol. Cell 9, 3241-3257. Chen, Y.A., and Scheller, R.H. (2001). SNARE-mediated membrane fusion. Nat Rev Mol Cell Biol 2, 98-106. Cherney, D.Z., Scholey, J.W., and Miller, J.A. (2008). Insights into the regulation of renal hemodynamic function in diabetic mellitus. Curr Diabetes Rev 4, 280-290. Choy, E., Chiu, V.K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D., Ivanov, I.E., and Philips, M.R. (1999). Endomembrane trafficking of ras: the CAAX motif targets proteins to the ER and Golgi. Cell 98, 69-80.

Clark, W.F., Churchill, D.N., Forwell, L., Macdonald, G., and Foster, S. (2000). To pay or not to pay? A decision and cost-utility analysis of angiotensin-converting-enzyme inhibitor therapy for diabetic nephropathy. CMAJ 162, 195-198. Cohen, M.P., Shea, E., Chen, S., and Shearman, C.W. (2003). Glycated albumin increases oxidative stress, activates NF-kappa B and extracellular signal-regulated kinase (ERK), and stimulates ERK-dependent transforming growth factor-beta 1 production in macrophage RAW cells. J Lab Clin Med 141, 242-249.

109

Coyne, C.B., Shen, L., Turner, J.R., and Bergelson, J.M. (2007). Coxsackievirus entry across epithelial tight junctions requires occludin and the small GTPases Rab34 and Rab5. Cell Host Microbe 2, 181-192. De Matteisa, M.A., Lunab, A., Di Tullioa, G., Cordaa, D., Kokc, J.W., Luinia, A., and Egeab, G. (1999). PDMP blocks the BFA-induced ADP-ribosylation of BARS-50 in isolated Golgi membranes. FEBS Letters 459, 310-312.

Dronavalli, S., Duka, I., and Bakris, G.L. (2008). The pathogenesis of diabetic nephropathy. Nat Clin Pract Endocrinol Metab 4, 444-452.

Dulubova, I., Lou, X., Lu, J., Huryeva, I., Alam, A., Schneggenburger, R., Sudhof, T.C., and Rizo, J. (2005). A Munc13/RIM/Rab3 tripartite complex: from priming to plasticity? EMBO J 24, 2839-2850. Dulubova, I., Sugita, S., Hill, S., Hosaka, M., Fernandez, I., Sudhof, T.C., and Rizo, J. (1999). A conformational switch in syntaxin during exocytosis: role of munc18. EMBO J 18, 4372-4382. Echard, A., Opdam, F.J.M., de Leeuw, H.J.P.C., Jollivet, F., Savelkoul, P., Hendriks, W., Voorberg, J., Goud, B., and Fransen, J.A.M. (2000). Alternative Splicing of the Human Rab6A Gene Generates Two Close but Functionally Different Isoforms. Mol. Biol. Cell 11, 3819-3833.

Eliasson, L., Renstrom, E., Ding, W.G., Proks, P., and Rorsman, P. (1997). Rapid ATP-dependent priming of secretory granules precedes Ca(2+)-induced exocytosis in mouse pancreatic B-cells. J Physiol 503 ( Pt 2), 399-412. Feldmann, J., Callebaut, I., Raposo, G., Certain, S., Bacq, D., Dumont, C., Lambert, N., Ouachee-Chardin, M., Chedeville, G., Tamary, H., Minard-Colin, V., Vilmer, E., Blanche, S., Le Deist, F., Fischer, A., and de Saint Basile, G. (2003). Munc13-4 is essential for cytolytic granules fusion and is mutated in a form of familial hemophagocytic lymphohistiocytosis (FHL3). Cell 115, 461-473.

Friedman, E.A. (1999). Advanced glycation end-products in diabetic nephropathy. Nephrol Dial Transplant 14 Suppl 3, 1-9.

Gerke, V., and Moss, S.E. (2002). Annexins: from structure to function. Physiol Rev 82, 331-371.

Ghosh, P., Dahms, N.M., and Kornfeld, S. (2003). Mannose 6-phosphate receptors: new twists in the tale. Nat Rev Mol Cell Biol 4, 202-212.

Goldenberg, N.M., Grinstein, S., and Silverman, M. (2007). Golgi-bound Rab34 is a novel member of the secretory pathway. Mol Biol Cell 18, 4762-4771.

Gomez-Fernandez, J.C., and Corbalan-Garcia, S. (2007). Diacylglycerols, multivalent membrane modulators. Chem Phys Lipids 148, 1-25.

Goody, R.S., Rak, A., and Alexandrov, K. (2005). The structural and mechanistic basis for recycling of Rab proteins between membrane compartments. Cell Mol Life Sci 62, 1657-1670.

Grishanin, R.N., Kowalchyk, J.A., Klenchin, V.A., Ann, K., Earles, C.A., Chapman, E.R., Gerona, R.R., and Martin, T.F. (2004). CAPS acts at a prefusion step in dense-core vesicle exocytosis as a PIP2 binding protein. Neuron 43, 551-562. Grosshans, B.L., Ortiz, D., and Novick, P. (2006). Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci U S A 103, 11821-11827.

110

Gutierrez, M.G., Mishra, B.B., Jordao, L., Elliott, E., Anes, E., and Griffiths, G. (2008). NF-kappa B activation controls phagolysosome fusion-mediated killing of mycobacteria by macrophages. J Immunol 181, 2651-2663. Hanada, K. (2003). Serine palmitoyltransferase, a key enzyme of sphingolipid metabolism. Biochim Biophys Acta 1632, 16-30. Hata, Y., Slaughter, C.A., and Sudhof, T.C. (1993). Synaptic vesicle fusion complex contains unc-18 homologue bound to syntaxin. Nature 366, 347-351. Hausser A, S.P., Martens S, Link G, Toker A, Pfizenmaier K. (2005). Protein kinase D regulates vesicular transport by phosphorylating and activating phosphatidylinositol-4 kinase IIIbeta at the Golgi complex. Nat Cell Biol 7, 851-853.

Hoffman, B.B., Sharma, K., Zhu, Y., and Ziyadeh, F.N. (1998). Transcriptional activation of transforming growth factor-beta1 in mesangial cell culture by high glucose concentration. Kidney Int 54, 1107-1116. Hosono, R., and Kamiya, Y. (1991). Additional genes which result in an elevation of acetylcholine levels by mutations in Caenorhabditis elegans. Neurosci Lett 128, 243-244. Hosono, R., Sassa, T., and Kuno, S. (1987). Mutations affecting acetylcholine levels in the nematode Caenorhabditis elegans. J Neurochem 49, 1820-1823. Huber, L.A., Pimplikar, S., Parton, R.G., Virta, H., Zerial, M., and Simons, K. (1993). Rab8, a small GTPase involved in vesicular traffic between the TGN and the basolateral plasma membrane. J. Cell Biol. 123, 35-45.

Hurst, R.D., Stevanovic, Z.S., Munk, S., Derylo, B., Zhou, X., Meer, J., Silverberg, M., and Whiteside, C.I. (1995). Glomerular mesangial cell altered contractility in high glucose is Ca2+ independent. Diabetes 44, 759-766. Isaka, Y., Fujiwara, Y., Ueda, N., Kaneda, Y., Kamada, T., and Imai, E. (1993). Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 92, 2597-2601.

Jordens, I., Fernandez-Borja, M., Marsman, M., Dusseljee, S., Janssen, L., Calafat, J., Janssen, H., Wubbolts, R., and Neefjes, J. (2001). The Rab7 effector protein RILP controls lysosomal transport by inducing the recruitment of dynein-dynactin motors. Curr Biol 11, 1680-1685. Junge, H.J., Rhee, J.S., Jahn, O., Varoqueaux, F., Spiess, J., Waxham, M.N., Rosenmund, C., and Brose, N. (2004). Calmodulin and Munc13 form a Ca2+ sensor/effector complex that controls short-term synaptic plasticity. Cell 118, 389-401.

Keller P, T.D., Diaz E, White J, Simons K. (2001). Multicolour imaging of post-Golgi sorting and trafficking in live cells. Nat Cell Biol 3, 140-149.

Kim, J.H., Lingwood, C.A., Williams, D.B., Furuya, W., Manolson, M.F., and Grinstein, S. (1996). Dynamic measurement of the pH of the Golgi complex in living cells using retrograde transport of the verotoxin receptor. J Cell Biol 134, 1387-1399. Klein, S., Franco, M., Chardin, P., and Luton, F. (2006). Role of the Arf6 GDP/GTP Cycle and Arf6 GTPase-activating Proteins in Actin Remodeling and Intracellular Transport. J. Biol. Chem. 281, 12352-12361.

111

Koch, H., Hofmann, K., and Brose, N. (2000). Definition of Munc13-homology-domains and characterization of a novel ubiquitously expressed Munc13 isoform. Biochem J 349, 247-253.

Kurokawa, K., and Matsuda, M. (2005). Localized RhoA activation as a requirement for the induction of membrane ruffling. Mol Biol Cell 16, 4294-4303.

Kwan, E.P., Xie, L., Sheu, L., Nolan, C.J., Prentki, M., Betz, A., Brose, N., and Gaisano, H.Y. (2006). Munc13-1 deficiency reduces insulin secretion and causes abnormal glucose tolerance. Diabetes 55, 1421-1429. Liljedahl, M., Maeda, Y., Colanzi, A., Ayala, I., Van Lint, J., and Malhotra, V. (2001). Protein kinase D regulates the fission of cell surface destined transport carriers from the trans-Golgi network. Cell 104, 409-420.

Lippincott-Schwartz J, D.J., Schweizer A, Berger EG, Hauri HP, Yuan LC, Klausner RD. (1990). Microtubule-dependent retrograde transport of proteins into the ER in the presence of brefeldin A suggests an ER recycling pathway. Cell 60, 821-836. Malgaroli, A. (1999). Silent synapses: I can't hear you! Could you please speak aloud? Nat Neurosci 2, 3-5. Martin, T.F. (2002). Prime movers of synaptic vesicle exocytosis. Neuron 34, 9-12.

Maruyama, I.N., and Brenner, S. (1991). A phorbol ester/diacylglycerol-binding protein encoded by the unc-13 gene of Caenorhabditis elegans. Proc Natl Acad Sci U S A 88, 5729-5733.

Mason, R.M., and Wahab, N.A. (2003). Extracellular matrix metabolism in diabetic nephropathy. J Am Soc Nephrol 14, 1358-1373.

Mironov, A.A., Beznoussenko, G.V., Nicoziani, P., Martella, O., Trucco, A., Kweon, H.S., Di Giandomenico, D., Polishchuk, R.S., Fusella, A., Lupetti, P., Berger, E.G., Geerts, W.J., Koster, A.J., Burger, K.N., and Luini, A. (2001). Small cargo proteins and large aggregates can traverse the Golgi by a common mechanism without leaving the lumen of cisternae. J Cell Biol 155, 1225-1238. Mostov, K., Su, T., and ter Beest, M. (2003). Polarized epithelial membrane traffic: conservation and plasticity. Nat Cell Biol 5, 287-293. Mostov, K.E., Verges, M., and Altschuler, Y. (2000). Membrane traffic in polarized epithelial cells. Curr Opin Cell Biol 12, 483-490. Neeft, M., Wieffer, M., de Jong, A.S., Negroiu, G., Metz, C.H., van Loon, A., Griffith, J., Krijgsveld, J., Wulffraat, N., Koch, H., Heck, A.J., Brose, N., Kleijmeer, M., and van der Sluijs, P. (2005). Munc13-4 is an effector of rab27a and controls secretion of lysosomes in hematopoietic cells. Mol Biol Cell 16, 731-741. Noh, H., and King, G.L. (2007). The role of protein kinase C activation in diabetic nephropathy. Kidney Int Suppl, S49-53. Ohtomo, S., Izuhara, Y., Takizawa, S., Yamada, N., Kakuta, T., van Ypersele de Strihou, C., and Miyata, T. (2007). Thiazolidinediones provide better renoprotection than insulin in an obese, hypertensive type II diabetic rat model. Kidney Int 72, 1512-1519.

Orlean, P., Kuranda, M.J., and Albright, C.F. (1991). Analysis of glycoproteins from Saccharomyces cerevisiae. Methods Enzymol 194, 682-697.

112

Overmeyer, J.H., Wilson, A.L., and Maltese, W.A. (2001). Membrane targeting of a Rab GTPase that fails to associate with Rab escort protein (REP) or guanine nucleotide dissociation inhibitor (GDI). J Biol Chem 276, 20379-20386. Patterson, G.H., Hirschberg, K., Polishchuk, R.S., Gerlich, D., Phair, R.D., and Lippincott-Schwartz, J. (2008). Transport through the Golgi apparatus by rapid partitioning within a two-phase membrane system. Cell 133, 1055-1067.

Pelham, H.R. (2001). Traffic through the Golgi apparatus. J Cell Biol 155, 1099-1101. Reeves, W.B., and Andreoli, T.E. (2000). Transforming growth factor beta contributes to progressive diabetic nephropathy. Proc Natl Acad Sci U S A 97, 7667-7669. Remuzzi, G., Schieppati, A., and Ruggenenti, P. (2002). Clinical practice. Nephropathy in patients with type 2 diabetes. N Engl J Med 346, 1145-1151. Rhee, J.S., Betz, A., Pyott, S., Reim, K., Varoqueaux, F., Augustin, I., Hesse, D., Sudhof, T.C., Takahashi, M., Rosenmund, C., and Brose, N. (2002). Beta phorbol ester- and diacylglycerol-induced augmentation of transmitter release is mediated by Munc13s and not by PKCs. Cell 108, 121-133. Richmond, J.E., Weimer, R.M., and Jorgensen, E.M. (2001). An open form of syntaxin bypasses the requirement for UNC-13 in vesicle priming. Nature 412, 338-341. Rosenmund, C., Sigler, A., Augustin, I., Reim, K., Brose, N., and Rhee, J.S. (2002). Differential control of vesicle priming and short-term plasticity by Munc13 isoforms. Neuron 33, 411-424. Rosenwald, A.G., Machamer, C.E., and Pagano, R.E. (1992). Effects of a sphingolipid synthesis inhibitor on membrane transport through the secretory pathway. Biochemistry 31, 3581-3590. Rossner, S., Fuchsbrunner, K., Lange-Dohna, C., Hartlage-Rubsamen, M., Bigl, V., Betz, A., Reim, K., and Brose, N. (2004). Munc13-1-mediated vesicle priming contributes to secretory amyloid precursor protein processing. J Biol Chem 279, 27841-27844.

Roy, S., Plowman, S., Rotblat, B., Prior, I.A., Muncke, C., Grainger, S., Parton, R.G., Henis, Y.I., Kloog, Y., and Hancock, J.F. (2005). Individual palmitoyl residues serve distinct roles in H-ras trafficking, microlocalization, and signaling. Mol Cell Biol 25, 6722-6733. Sakharova, O.V., Taal, M.W., and Brenner, B.M. (2001). Pathogenesis of diabetic nephropathy: focus on transforming growth factor-beta and connective tissue growth factor. Curr Opin Nephrol Hypertens 10, 727-738.

Schena, F.P., and Gesualdo, L. (2005). Pathogenetic mechanisms of diabetic nephropathy. J Am Soc Nephrol 16 Suppl 1, S30-33.

Shankland, S.J. (2006). The podocyte's response to injury: role in proteinuria and glomerulosclerosis. Kidney Int 69, 2131-2147.

Sharma, K., Eltayeb, B.O., McGowan, T.A., Dunn, S.R., Alzahabi, B., Rohde, R., Ziyadeh, F.N., and Lewis, E.J. (1999). Captopril-induced reduction of serum levels of transforming growth factor-beta1 correlates with long-term renoprotection in insulin-dependent diabetic patients. Am J Kidney Dis 34, 818-823.

Sheu, L., Pasyk, E.A., Ji, J., Huang, X., Gao, X., Varoqueaux, F., Brose, N., and Gaisano, H.Y. (2003). Regulation of insulin exocytosis by Munc13-1. J Biol Chem 278, 27556-27563.

113

Shirakawa, R., Higashi, T., Tabuchi, A., Yoshioka, A., Nishioka, H., Fukuda, M., Kita, T., and Horiuchi, H. (2004). Munc13-4 is a GTP-Rab27-binding protein regulating dense core granule secretion in platelets. J Biol Chem 279, 10730-10737. Siddiqui, S.S. (1990). Mutations affecting axonal growth and guidance of motor neurons and mechanosensory neurons in the nematode Caenorhabditis elegans. Neurosci Res Suppl 13, S171-190.

Silinsky, E.M., and Searl, T.J. (2003). Phorbol esters and neurotransmitter release: more than just protein kinase C? Br J Pharmacol 138, 1191-1201.

Song, Y., Ailenberg, M., and Silverman, M. (1998). Cloning of a novel gene in the human kidney homologous to rat munc13s: its potential role in diabetic nephropathy. Kidney Int 53, 1689-1695. Song, Y., Ailenberg, M., and Silverman, M. (1999). Human munc13 is a diacylglycerol receptor that induces apoptosis and may contribute to renal cell injury in hyperglycemia. Mol Biol Cell 10, 1609-1619.

Speight, P., and Silverman, M. (2005). Diacylglycerol-activated Hmunc13 serves as an effector of the GTPase Rab34. Traffic 6, 858-865.

Stauffer, T.P., Ahn, S., and Meyer, T. (1998). Receptor-induced transient reduction in plasma membrane PtdIns(4,5)P2 concentration monitored in living cells. Curr Biol 8, 343-346.

Stevens, D.R., Wu, Z.X., Matti, U., Junge, H.J., Schirra, C., Becherer, U., Wojcik, S.M., Brose, N., and Rettig, J. (2005). Identification of the minimal protein domain required for priming activity of Munc13-1. Curr Biol 15, 2243-2248. Straub, S.G., and Sharp, G.W. (2002). Glucose-stimulated signaling pathways in biphasic insulin secretion. Diabetes Metab Res Rev 18, 451-463. Sudhof, T.C. (1995). The synaptic vesicle cycle: a cascade of protein-protein interactions. Nature 375, 645-653. Sun, P., Yamamoto, H., Suetsugu, S., Miki, H., Takenawa, T., and Endo, T. (2003). Small GTPase Rah/Rab34 is associated with membrane ruffles and macropinosomes and promotes macropinosome formation. J Biol Chem 278, 4063-4071.

Tisdale, E.J., Bourne, J.R., Khosravi-Far, R., Der, C.J., and Balch, W.E. (1992). GTP-binding mutants of rab1 and rab2 are potent inhibitors of vesicular transport from the endoplasmic reticulum to the Golgi complex. J. Cell Biol. 119, 749-761. Tregouet, D.A., Groop, P.H., McGinn, S., Forsblom, C., Hadjadj, S., Marre, M., Parving, H.H., Tarnow, L., Telgmann, R., Godefroy, T., Nicaud, V., Rousseau, R., Parkkonen, M., Hoverfalt, A., Gut, I., Heath, S., Matsuda, F., Cox, R., Kazeem, G., Farrall, M., Gauguier, D., Brand-Herrmann, S.M., Cambien, F., Lathrop, M., and Vionnet, N. (2008). G/T substitution in intron 1 of the UNC13B gene is associated with increased risk of nephropathy in patients with type 1 diabetes. Diabetes 57, 2843-2850. Tuttle, K.R., Bakris, G.L., Toto, R.D., McGill, J.B., Hu, K., and Anderson, P.W. (2005). The effect of ruboxistaurin on nephropathy in type 2 diabetes. Diabetes Care 28, 2686-2690. Tuttle, K.R., McGill, J.B., Haney, D.J., Lin, T.E., and Anderson, P.W. (2007). Kidney outcomes in long-term studies of ruboxistaurin for diabetic eye disease. Clin J Am Soc Nephrol 2, 631-636.

114

Varnai, P., and Balla, T. (1998). Visualization of phosphoinositides that bind pleckstrin homology domains: calcium- and agonist-induced dynamic changes and relationship to myo-[3H]inositol-labeled phosphoinositide pools. J Cell Biol 143, 501-510. Varoqueaux, F., Sigler, A., Rhee, J.S., Brose, N., Enk, C., Reim, K., and Rosenmund, C. (2002). Total arrest of spontaneous and evoked synaptic transmission but normal synaptogenesis in the absence of Munc13-mediated vesicle priming. Proc Natl Acad Sci U S A 99, 9037-9042.

Wang, T., and Hong, W. (2002). Interorganellar regulation of lysosome positioning by the Golgi apparatus through Rab34 interaction with Rab-interacting lysosomal protein. Mol Biol Cell 13, 4317-4332. Wang, Y., Okamoto, M., Schmitz, F., Hofmann, K., and Sudhof, T.C. (1997). Rim is a putative Rab3 effector in regulating synaptic-vesicle fusion. Nature 388, 593-598. Whiteside, C.I., and Dlugosz, J.A. (2002). Mesangial cell protein kinase C isozyme activation in the diabetic milieu. Am J Physiol Renal Physiol 282, F975-980. Wilson, H.M., Reid, F.J., Brown, P.A., Power, D.A., Haites, N.E., and Booth, N.A. (1993). Effect of transforming growth factor-beta 1 on plasminogen activators and plasminogen activator inhibitor-1 in renal glomerular cells. Exp Nephrol 1, 343-350.

Yamamoto, K., Ishii, E., Sako, M., Ohga, S., Furuno, K., Suzuki, N., Ueda, I., Imayoshi, M., Yamamoto, S., Morimoto, A., Takada, H., Hara, T., Imashuku, S., Sasazuki, T., and Yasukawa, M. (2004). Identification of novel MUNC13-4 mutations in familial haemophagocytic lymphohistiocytosis and functional analysis of MUNC13-4-deficient cytotoxic T lymphocytes. J Med Genet 41, 763-767. Yang, C.B., Zheng, Y.T., Li, G.Y., and Mower, G.D. (2002). Identification of Munc13-3 as a candidate gene for critical-period neuroplasticity in visual cortex. J Neurosci 22, 8614-8618. Zerial, M., and McBride, H. (2001). Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 2, 107-117. Ziyadeh, F.N. (2004). Mediators of diabetic renal disease: the case for tgf-Beta as the major mediator. J Am Soc Nephrol 15 Suppl 1, S55-57. Ziyadeh, F.N., Sharma, K., Ericksen, M., and Wolf, G. (1994). Stimulation of collagen gene expression and protein synthesis in murine mesangial cells by high glucose is mediated by autocrine activation of transforming growth factor-beta. J Clin Invest 93, 536-542.

Zucker, R.S. (1999). Calcium- and activity-dependent synaptic plasticity. Curr Opin Neurobiol 9, 305-313.

115

Appendices

Appendix A Description of a PCR-based technique for DNA splicing and mutagenesis by producing 5' overhangs with run through stop DNA synthesis utilizing Ara-C

[Previously published as Ailenberg, M., Goldenberg, N.M., Silverman M. (2005). Description of

a PCR-based technique for DNA splicing and mutagenesis by producing 5' overhangs with run

through stop DNA synthesis utilizing Ara-C. BMC Biotechnology 5:23.]

My contribution to this paper included carrying out several of the experiments, as well as

preparing several figures and the manuscript itself.

Abstract

Background: Splicing of DNA molecules is an important task in molecular biology that

facilitates cloning, mutagenesis and creation of chimeric genes. Mutagenesis and DNA splicing

techniques exist, some requiring restriction enzymes, and others utilize staggered reannealing

approaches.

Results: A method for DNA splicing and mutagenesis without restriction enzymes is described.

The method is based on mild template-dependent polymerization arrest with two molecules of

cytosine arabinose (Ara-C) incorporated into PCR primers. Two rounds of PCR are employed:

the first PCR produces 5' overhangs that are utilized for DNA splicing. The second PCR is based

on polymerization running through the Ara-C molecules to produce the desired final product. To

illustrate application of the run through stop mutagenesis and DNA splicing technique, we have

carried out splicing of two segments of the human cofilin 1 gene and introduced a mutational

deletion into the product.

116

Conclusion: We have demonstrated the utility of a new PCR-based method for carrying out

DNA splicing and mutagenesis by incorporating Ara-C into the PCR primers.

Background

Splicing of DNA molecules is an important task in molecular biology that facilitates cloning,

mutagenesis and the creation of chimeric genes. While the advent of restriction enzymes

substantially advanced DNA splicing techniques, they cannot be applied universally, and their

use is limited to enzyme-specific loci. Other techniques like site-directed mutagenesis by overlap

extension [SOE; [1]], insertional mutagenesis with the megaprimer technique [2] and staggered

reannealing [3,4] have further improved DNA mutagenesis and splicing. Each method offers

advantages and inherent drawbacks. Another cloning approach involving the formation of 5'

overhangs utilizes incorporation of nucleotide derivatives into PCR primers [5-7] that stall

polymerization. These techniques are dependent on an established set of optimal conditions for

strong polymerization arrest, including the correct choice of polymerase or the incorporation of

three ribonucleotide derivatives in the primer [7]. Furthermore, chimeric DNA/RNA primers

need to be removed and reverse-transcribed in order for the splicing to be completed. Although

in the past we have successfully used the SOE technique for mutagenesis and splicing, we

encountered difficulties while constructing larger genes. That led us to develop the staggered

reannealing method [3,4]. This method proved to be useful as well, however, its efficiency

declined as the gene to be mutagenized exceeded 1000 bp. Although these techniques allow

splicing of any two DNA fragments without the need for restriction enzymes, their efficiency is

inversely related to the length of the DNA fragments involved, since these techniques rely on the

117

successful melting and reannealing of DNA to create matching overhangs. We sought to offer an

alternative approach to facilitate the splicing of any two DNA segments for mutagenesis and

construction of chimeric genes. Our technique utilizes two rounds of PCR, and is based on

moderate template-dependent polymerization arrest using cytosine arabinose (Ara-C). Ara-C is a

nucleotide derivative (Fig A1) that is widely used in cancer therapeutics [8]. It is a competitive

inhibitor of DNA polymerase and also affects polymerization initiation [9,10]. Ara-C exerts it

therapeutic action on cellular DNA polymerase after phosphorylation by an endogenous kinase.

Once phosphorylated, Ara-C facilitates inhibition of DNA replication in cancer cells. Sanger et

al, in their search for polymerization terminating agents for use in sequencing techniques, found

that while dideoxynucleotides were strong polymerase terminators, Ara-C only weakly halted

polymerization [11]. Therefore, even today, dideoxynucleotides remain the terminators of choice

in sequencing reactions. Previous studies have shown that while Ara-C could serve as a substrate

for mammalian polymerases, it terminates polymerization by some prokaryotic polymerases

[11]. Here we used Ara-C both as DNA polymerase inhibitor and template for DNA

mutagenesis and splicing.

118

Figure A1: Structure of cytidine and its derivatives. The derivatives featured in this figure vary in their sugar substitutes. Note that in Cytosine Arabinose (Ara-C), the arabinose sugar contains hydroxyl groups in positions 3 and 5 in a similar orientation to native ribose, thus permitting reaction with other nucleotides in DNA synthesis. However, the hydroxyls in positions 2 and 3 are in the trans orientation. Comparing position 2 on the arabinose ring to that of 2-deoxyribose reveals that the hydrogen in 2-deoxyribose, that is in trans configuration to hydroxyl 3, is replaced by the

119

hydroxyl group found on arabinose. It should be emphasized that there are two types of polymerization arrest: a. Chain termination- the nucleotide is incorporated into the nascent DNA strand and synthesis is stalled because no new nucleotide is added. Dideoxy derivatives stall elongation after incorporation into the nascent DNA strand because they do not have hydroxl in position 3. Arabinose nucleotides also belong to this group, but they offer only partial stalling [11]. b. Template-dependent termination-nucleotides already incorporated in the DNA (e.g. in primers) are able to stall polymerization when the polymerase reads the template. It is believed that due to stereo restraints, the polymerase falls off the template. The frequency of this event determines the efficiency of the stalling. Arabinose derivatives belong to this group. The property of template-dependent termination of Ara-C was utilized in this study to create 5' overhangs in the first PCR. However, since the template-dependent termination by Ara-C is moderate, it was utilized for the amplification in the second PCR.

Results and discussion

We were searching for a mild template-dependent polymerization terminator. The rationale for

mild termination is as follows: Termination must be strong enough to create 5' overhangs in the

first PCR reaction, but weak enough to allow the polymerase to continue through the modified

nucleotide during the second round of PCR (Fig A2). For the reasons mentioned above, Ara-C

was chosen for use in the present study. As proof of principal, a 20 bp deletion in the human

cofilin 1 gene was created. We tried to splice together two segments of the gene: one 5' (237 bp)

and one 3' (309 bp) segment (Fig A2). Primers were designed with one or two Ara-C molecules

replacing native deoxycytidine nucleotides. When two Ara-C molecules were incorporated into

the primer (Hospital for Sick Children, Toronto, Canada), template-dependent termination can

potentially occur before, after one, or after two Ara-C molecules. Therefore, to determine the

termination location, we designed one side of the overhang to accommodate termination after

two Ara-C molecules, and the other side of the overhang to accommodate termination after one

Ara-C molecule (Fig A3). There were a total of 8 PCR reactions that included two Ara-C

primers for each of the two segments, and the two polymerases (Taq and Pfu) for each set of

primers. PCR products were gel-isolated. At this stage, gel-isolation is essential in order to

remove any of the original plasmid that might serve as a template in the second PCR reaction.

Alternatively, the original plasmid may be eliminated by digestion with DpnI, although this

option is less recommended, since traces of undigested plasmid could affect the outcome of the

120

second PCR reaction. Corresponding segments to be spliced were combined (total of four tubes)

and ligated. As indicated above, the rationale for this technique is that Ara-C is a mild

polymerization terminator, and therefore it will produce a mixture of cohesive and blunt ends.

Hence, the reaction is expected to both terminate (producing sticky ends essential for the splicing

phase) and run through the Ara-C (producing blunt ends; this feature is essential to the second

PCR reaction). Therefore, lowered concentration of ligase and reduced ligation time were used to

optimize conditions to favor cohesive end ligation. The products of the ligase reaction were

amplified by the second PCR with Taq or Pfu polymerases using the sense primer A, and the

anti-sense primer B, which span the cofilin 1 gene. This PCR reaction produced the expected 552

bp product (blunt end ligation, is expected to produce an extra duplicated piece of DNA of 15

bp). The PCR products were either sequenced directly, or cloned into a plasmid and then

sequenced. Based on sequencing results, we observed that incorporation of two Ara-C

nucleotides into the PCR primers yielded the expected product. This suggests that the two

molecules of Ara-C provided the desired mild termination to produce a product with 5'

overhangs, but also allowed the polymerase to run through during the 2nd PCR. Furthermore,

based on the design of the primers, the polymerization stalled both after the first and the second

Ara-C molecule. Both 5 and 30 min incubations with DNA Ligase were sufficient to

preferentially ligate the cohesive ends. This further suggests that two adjacent molecules of Ara-

C produce 5' overhangs. Even though both 5 and 30 min ligations were successful in producing

the desired product, it is not recommended to allow the reaction to proceed for a prolonged time,

nor is it recommended to use high levels of ligase, since these conditions may facilitate blunt end

ligation that may produce a mixture of the blunt and cohesive end products. Both Pfu and Taq

polymerases were equally capable of producing termination products in the first PCR, while still

running through the Ara-C in the second PCR. When one molecule of Ara-C was incorporated in

121

the PCR primers, no termination could be observed, as seen by the addition of a 15 bp segment

in the PCR product indicative of blunt end ligation. Even ligation for 5 min in reduced

concentration of ligase failed to produce cohesive end ligation when only one Ara-C was

employed. The run through stop method utilizes a novel approach for DNA splicing and

mutagenesis. While other mutagenesis techniques like SOE, megaprimer and staggered

reannealing create matching overhangs after melting and reannealing, the run through stop

method creates matching overhangs by polymerization arrest with Ara-C. We were motivated to

design the Ara-C approach because we were not successful in creating gene mutations with the

other techniques. Hence, the run through stop offers a good alternative to these techniques. It has

been previously demonstrated that utilizing abasic or RNA nucleotides like tetrahydrofuran

derivative or 2-o- methyl ribonucleotide in PCR primers produced 5' overhangs that facilitated

cloning of DNA fragments into plasmids [5-7]. These approaches were dependent on strong

polymerization termination by the nucleotides. Our technique established the conditions for mild

termination of DNA polymerization with two Ara-C molecules. This enables us to use the Ara-

C-containing primers in two steps of PCR for DNA splicing and mutagenesis. Although in the

present study we used relatively short segments of DNA for proof of principal (~500 bp of the

human cofilin gene), this technique, unlike the staggered reannealing technique, is not limited to

short DNA fragments. Since both rounds of PCR in the present study are based on conventional

PCR, the length limit of the DNA fragments to be mutagenized is that of the PCR technique.

122

Figure A2: Schematic representation of run through stop DNA mutagenesis and splicing technique with Ara-C. In this example two pieces of DNA are to be spliced (5' and 3' DNA segments) and mutated with an insertion of additional DNA. The 5' segment is amplified using PCR primers A (sense) and Ara-C2-A (anti-sense). Primer Ara-C2-A is designed to contain hybrid DNA with two adjacent molecules of Ara-C to stall polymerisation and produce a 5' overhang. Mutational addition is also incorporated into this primer. (Note that in this paper we created a mutational deletion in the human cofilin 1 gene, but here for illustration purpose, we describe a mutational addition). The 3' segment is amplified using PCR primers Ara-C2-B (sense) and B (anti-sense). Primer Ara-C2-B contains overlapping sequence with primer Ara-C2-A, and 2 molecules of Ara-C are incorporated to stall polymerization and produce a 5' overhang that is complementary to the overhang in Ara-C2-A. Both Ara-C primers are phosphorylated for down stream ligation. Since two adjacent Ara-C molecules produce moderate termination, PCR products contain a mixture of 5' overhang and blunt end DNA. Each PCR product is gel-isolated and subjected to short ligation, where cohesive end ligation is predominant. A portion of the ligation reaction is then subjected to a second PCR reaction, using

123

primers A and B that span the entire mutated chimeric DNA. As mentioned above, 2 Ara-C molecules are moderate polymerization terminators. This assures that at the first round of the second PCR, the polymerase will run through the Ara-C in the template and incorporate native dGMP, that will ensure in turn proper polymerization in the next rounds and a product that will contain the native dCMP. For cloning purposes of the final PCR product, primers A abd B can include restriction sites (as used in this study). Alternatively, by using Taq polymerase in the second PCR reaction, the product can be cloned into TA cloning plasmids. Another alternative is to design primers A and B to contain at least 2 molecules of Ara-C to produce 5' overhangs to match cloning plasmids.

Figure A3: Ara-C primer assignment. Shown is the double-stranded DNA segment of human cofilin 1 gene that was used for mutagenesis. Capital letters and arrows represent primers containing Ara-C molecules. Lower case letters represent deleted nucleotides, achieved with primer Ara-C2-A (broken line). Xs in primers denote Ara-C molecules that replace the original deoxycytidine molecules. Note that the 5' end of primer Ara-C2-A was designed to produce an overhang, that restricts ligation to the 3' segment of the PCR product (see also Fig 2) only if termination occurred after the first Ara-C molecule. The 5' segment of primer Ara-C2-B was designed to produce an overhang that restricts ligation to the 5' segment of the PCR product (see Fig 2) only if termination occurred after two Ara-C molecules. Additionally, two primers containing only one Ara-C molecule insertion were synthesized (not shown).

124

Conclusion

The run through stop method can be summarized in four steps: 1. Amplify two segments of DNA

to be spliced using PCR, with phosphorylated primers containing two adjacent molecules of

Arabinose nucleotide with overlapping sequence. 2. Gel-isolate the two DNA products, combine

and ligate. 3. Amplify the spliced product with flanking primers using PCR. 4. Clone the product

into a plasmid.

Methods

First PCR

For the first PCR, 4 primers were designed: Primers A and B flanking the human cofilin 1 gene

(Fig 2) and two primers containing Ara-C molecules (Figs 2 and 3)). Primer A- 5'-

ATActgcagATGGCCGCTGGTGTGGCTGTCTGTG-3'- sense primer of human cofilin 1.

Lower case letters represent Pst I sequence and bold letters represent Ala to Ser mutagenesis for

down stream usage. Primer Ara-C2-A-5'-

GGCATAGCGGCAGTCXXAAAGGTGGCGTAGGGATCG- 3'-anti-sense primer that contains

two Ara-C molecules (XX) and designed to delete a 20 bp segment from the human cofilin 1

gene (Fig 3). Primer Ara-C2-B-5'- ACTGCCCGTTATGCXXTCTATGATGCAACCTATGAG-

3'- sense primer that contains two Ara-C molecules (Fig 3). Additionally, two primers containing

only one Ara-C molecule insertion were synthesized. Primer B-5'-

CAActcgagGGCTGCCAGATGCTCCAGGCAGG-3'-anti-sense primer of the 3' end of human

125

cofilin 1 gene. Lower case letters represent the sequence for the Xho I gene. In the first PCR,

Primer A was used with primer Ara-C2-A, and Primer Ara-C2-B was used with primer B. In the

second PCR, primer A was used with primer B (see also Fig 2). Ara-C primers were

phosphorylated for 30 min at room temperature using T4 polynucleotide kinase (Invitrogen,

Burlington, ON), followed by inactivation at 65°C for 10 min, and used for PCR with no further

purification. PCR was performed with corresponding primers (see above and Fig 2, 3) using 1 U

Pfu polymerase (Stratagene, La Jolla, CA) or 1 U of Taq polymerase (Sigma, Oakville, ON), and

plasmid pOTB7 containing the human cofilin 1 gene as template (ATCC, Manassas, VA). PCR

conditions were as follows: heating to 94°C for 5 min; 40 cycles of: 94°C, 55°C and 72°C each

for 30 seconds; final elongation for 7 min. PCR products were gel-isolated using Min-Elute

Plasmid Purification Kits (Qiagen, Mississauga, ON). Corresponding segments to be spliced

were combined (total of four tubes) and ligated for 30 min with 400 U, or five min with 200 U of

T4 ligase (NEB, Pickering, ON) followed by inactivation for 10 min at 65°C.

Second PCR

Two µl of the ligase reaction were amplified by the second PCR with Taq or Pfu polymerase

using the sense primer A, and the anti-sense primer B. Conditions for the second PCR were

similar to those of the first PCR. The PCR products were purified (Qiagen). Alternatively, the

PCR products were subjected to double digestion with PstI and XhoI followed by ligation into

plasmid pcDNA3.1Zeo+ (Invitrogen). One µl of ligation reaction was used to transform 20 µl

competent cells (DH5α; Invitrogen), using a short procedure: competent cells were incubated for

5 min on ice, and heat-shocked by immediate plating on pre-warmed (37°C) agar plates.

Plasmids were prepared using Fast Plasmid Mini Kit (Eppendorf, Mississauga, ON), and

sequenced using the T7 primer.

126

DNA sequencing

The products of PCR, as well as the products that were cloned into plasmid pcDNA3.1Zeo+

were sequenced in both directions, utilizing primers A and B, or primer T7, respectively

(Hospital for Sick Children).

Authors' contributions

MA conceived and designed the study, performed the experiments and drafted the manuscript.

NMG carried out some of the experiments, participated in critical evaluation and drafted the

manuscript. MS provided general guidance, coordination and funding for the study, and drafted

the manuscript.

Acknowledgements

This study was supported by CIHR grant MOP-15071. NMG was supported by a CIHR

M.D./Ph.D. studentship.

References

1. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR: Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989, 77:51-59.

2. Kammann M, Laufs J, Schell J, Gronenborn B: Rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR). Nucleic Acids Res 1989, 17:5404.

3. Ailenberg M, Silverman M: Description of a one step staggered reannealing method for directional cloning of PCR-generated DNA using sticky-end ligation without employing restriction enzymes. Biochem Molec Biol Int 1996, 39:771-779.

127

4. Ailenberg M, Silverman M: Site-directed mutagenesis using a one step staggered reannealing method without employing restriction enzymes. BioTechniques 1997, 22:624-630.

5. Gal J, Schnell R, Szekeres S, Kalman M: Directional cloning of native PCR products with performed sticky ends (Autosticky PCR). Mol Gen Genet 1999, 260:569-573.

6. Coljee VW, Murray HL, Donahue WF, Jarrel KA: Seamless gene enginnering using RNA- and DNA- overhang cloning. Nat Biotechnol 2000, 18:789-791.

7. Donahue WF, Turczyk BM, Jarrell KA: Rapid gene cloning using terminator primers and modular vectors. Nucleic Acids Res 2002, 30:e95.

8. Gee TS, Yup K-P, Clarkson BD: Treatment of adult acute leukemia with arabinosylcytosine and thioguanine. Cancer 1969, 23:1019-1032.

9. Furth JJ, Cohen SS: Inhibition of mammalian DNA polymerase by the 5'-triphosphate of 1-beta arabinofuranosylcytosine and the 5'-triphosphate of 9-beta-d-arabinofuranoxylade-

nine. Cancer Res 1968, 28:2061-2067.

10. Fridland A: Inhibition of deoxyribonucleic acid chain initiation: a new mode of action for 1-b-D arabinofuranosylcytosine in human lymphoblasts. Biochemistry 1977, 16:5308-5312.

11. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 1977, 74:5463-5467.

128

Appendix B The Inositol Phosphatase MTMR4 Is A Novel Target of The Ubiquitin Ligase

NEDD4

[Accepted manuscript, Biochemical Journal, Pamela J. Plant, Judy Correa, Neil Goldenberg,

James Bain and Jane Batt]

My contribution to this paper was the microscopy work for Figure B2.

Abstract

The inositol phosphatase, MTMR4, was identified as a novel interactor of the ubiquitin ligase

Nedd4. hMTMR4 and Nedd4 co-immunoprecipitated and co-localized to late endosomes. The

PY-motif of hMTMR4 binds to WW domains of hNedd4. MTMR4 expression was decreased in

atrophying muscle while Nedd4 expression was increased and hMTMR4 was ubiquitinated by

hNedd4, suggesting this novel interaction may underlie the biological process of muscle

breakdown.

129

Introduction:

Cellular ubiquitination is a vital process regulating protein stability, internalization and

endosomal trafficking [1-3]. It is a multi-enzyme cascade whereby ubiquitin moieties are

selectively transferred onto target molecules which, in many cases, tags them for degradation by

the 26S proteosome. Specificity, in large part, is determined by the HECT and RING type

ubiquitin ligases that interact with their substrates via specific protein-protein interaction

domains. Nedd4 is a ubiquitously expressed HECT domain containing E3 ubiquitin-protein

ligase that has been shown to regulate the stability and/or localization of several membrane

proteins through interactions of its WW domain with substrate PY motifs [4-9]. Nedd4 has

previously been shown to increase in models of skeletal muscle atrophy [10-12] and has been

shown to target Notch1 in skeletal muscle [11] , although the mechanisms by which Nedd4

contributes to the biological process of muscle breakdown are unknown. We sought to identify

novel protein substrates of Nedd4 in muscle. Using a bioinformatics approach, we identified a

PY motif-containing protein expressed in skeletal muscle, myotubularin related protein 4

(MTMR4), that belongs to the family of tyrosine/dual specificity phosphatases (PTP/DSP) [13].

Myotubularins are specific 3’-phosphatases for phosphoinositol 3-monophosphate (PI3P) and

phosphatidylinositol 3,5-bisphosphate (PI3,5P2). It has been proposed that myotubularins

regulate endosome trafficking by dephosphorylation of PI3P [14]. Interestingly, MTMR4 is the

only family member possessing a PY motif [15] and having a unique distribution to endosomes

[14], the major site of substrate lipid accumulation. In this study we found that MTMR4 and

Nedd4 co-immunoprecipitate, interact via a WW domain-PY motif interaction and co-localize in

130

cells to the PI3P-rich late/recycling endosomes. Using a rat model of denervation atrophy we

have confirmed the increase in Nedd4 expression in atrophying muscle (versus control muscle) is

coincident with a decrease of MTMR4 in atrophying muscle. We demonstrate that Nedd4

ubiquitinates MTMR4 and mutation of the MTMR4 PY motif inhibits Nedd4 binding and

MTMR4 ubiquitination, suggesting that MTMR4 is a bona fide Nedd4 target. We propose that

MTMR4 may play an important role in the progression of Nedd4 mediated skeletal muscle

atrophy.

Materials and Methods

Cell Culture

All cells were cultured at 370C in 5% CO2. For biochemical characterization of the

Nedd4/MTMR4 interaction, plasmids expressing wild-type (human) hNedd4 (accession number

NM006154), catalytically inactive hNedd4 C-S and human MTMR4 (accession number

NM004687), a gift from Dr. Joe Zhang (Vanderbilt-Ingram Cancer Center, Nashville,

Tennessee), either untagged or HA-tagged, wild-type or PY motif mutant (whereby the second

invariant proline of the XPPXY motif was mutated to alanine using Quik Change mutagenesis

kit; Stratagene), were transfected into Phoenix 293 or HeLa cells grown in DMEM, 10% FBS,

Pen/Strep using standard CaCl2 transfection. 48 hours post-transfection, cells were harvested and

lysed in lysis buffer (150 mM NaCl, 50 mM HEPES, 1% Triton X-100, 10% glycerol, 1. mM

MgCl2, 1 mM EGTA) vortexed for 10 sec. and incubated on ice for 10 min. Lysate was then

cleared by centrifugation at 12,000 xg for 10 min. and the protein concentrations in the

supernatant were quantitated using Pierce BCA protein assay.

Immunoprecipitation and Western blotting

131

For co-immunoprecipitation of MTMR4 and Nedd4, equal amounts of lysate from hMTMR4 or

HA- hMTMR4 wild-type or PY mutant transfected or untransfected HeLa cells were incubated

with 2µg anti- MTMR4 or anti-Nedd4 antibodies for 1 hour on ice. 50 ul of Protein-A sepharose

beads (50% slurry) was then added to the lysate and incubated for 1 hr. at 40C while spinning.

Beads were then precipitated by centrifugation (10,000xg 1 min. 40C) and washed 2x in high salt

HNTG (500 mM NaCl, 20 mM HEPES pH 7.5, 10% glycerol, 0.1% Triton X-100) and 3x in low

salt HNTG (same with 150 mM NaCl). The beads were mixed with 45 µl 1x Sample Buffer and

boiled at 950C for 5 min to elute proteins. Protein eluate was resolved on 8% SDS-PAGE and

transferred onto Protran 0.2 µm nitrocellulose (PerkinElmer, Boston, USA). Western blotting

was performed using the following primary antibodies: polyclonal anti-Nedd4 WW2 antibodies

(Upstate Biotechnology, Lake Placid, NY) at a 1:1000 dilution; polyclonal anti-MTMR4

antibodies (Abgent, San Diego, CA.), 1:200 dilution; monoclonal anti-α-tubulin antibodies

(Sigma-Aldrich, St Louis, MO), 1:10,000 dilution; monoclonal anti-HA antibodies (Covance,

Berkeley, CA), 1:1,000 dilution; monoclonal anti-ubiquitin antibodies (Covance), 1:1000

dilution and polyclonal anti-HPRT antibodies (Abcam, Cambridge, MA), 1:1000 dilution.

Protein bands were detected with Horse Radish Peroxidase-linked goat anti-rabbit or anti-mouse

secondary antibodies (Cell Signaling Technology, Inc., Beverly, MA.) used at a 1:20,000

dilution.

Immunostaining

HeLa cells grown in MEM were plated on coverslips. After 24 hours, cells were transfected as

indicated using FuGene 6 reagent (Hoffmann-LaRoche Ltd, Mississauga, ON). After a further

24 hours, cells were fixed in 3.7% paraformaldehyde, permeabilized in 0.2% Triton X-100, and

blocked in 10% milk in PBS. Primary antibodies were incubated for 1 hour at room temperature,

132

and then were washed in PBS. Secondary antibodies conjugated to fluorophores were added for

45 minutes, washed and coverslips were mounted on slides in Vectashield mounting medium

(Vector Labs Canada, Burlington, ON). Images were acquired using a spinning-disc confocal

microscope (Zeiss Canada Ltd, Toronto, ON) and Volocity software (Improvision, Perkin Elmer,

Waltham, MA). Primary antibodies used were: mouse anti-GM130 (BD Biosciences,

Mississauga, ON), mouse anti-LAMP-1 (Developmental Studies Hybridoma Bank, University of

Iowa), mouse anti-Transferrin Receptor (Zymed, San Fransico, CA), and mouse anti-HA

(Covance). Secondary antibodies used were anti-mouse-Cy3 and anti-mouse-Cy2 (Jackson

ImmunoResearch, West Grove, PA). In addition to HA-tagged MTMR4, some cells were

transfected with either GFP-tagged Rab5, GFP-tagged Rab7, PX-mCherry (generous gifts from

Dr. Sergio Grinstein, Hospital for Sick Children, Toronto) and/or GFP-hNedd4. For quantitation

of co-localization, images were analyzed with the Volocity software (Improvision) co-

localization feature that calculates measurement statistics including the Manders correlation

coefficient.

In vitro binding assays

Human Nedd4-1 WW domains in pQE-30 (Qiagen) were a gift from Daniela Rotin (Hospital for

Sick Children, Toronto). The WW domains were cloned with the following boundaries: WW I

638-760 bp; WW II 1112-1231 bp; WW III 1318-1425 bp; WW IV 1487-1606 bp. 6x His-tagged

proteins were produced in M15 [pREP4] bacteria and purified following manufacturers

instructions (Qiagen). GST fusion proteins of hMTMR4 were produced by PCR of the PY-motif

containing region (2965-3081 bp) and a proline-rich region (1972-2091 bp), TA cloning into

pCR2.1-TOPO (Invitrogen), subsequent cloning into pGEX 5X1 and expression in BL21 (DE3)

pLys S bacteria according to manufacturers protocol (Promega). GST fusion proteins were

133

bound on glutathione agarose beads (50% slurry) by incubating 1 hr at 40C. Proteins were eluted

with 30 mM reduced glutathione by incubating 1 hr at 40C. Eluted GST proteins and bound 6x-

His proteins were quantitated and equal amounts of GST-PY (PY motif) and GST-Pro (proline-

rich region) hMTMR4 fusion proteins were incubated with equal amounts of 6x-His bound

proteins for 2 hr at 40C. The beads and bound proteins were washed 3x with high salt HNTG (as

above) and 2x with low salt HNTG. Beads were then mixed with 20 µl 1x sample buffer and

boiled at 950C for 5 min. to elute proteins. Protein eluate was resolved on 15% SDS-PAGE and

transferred onto Protran 0.2 um nitrocellulose and subjected to Western blotting with anti-Penta

His (Qiagen) and anti-GST antibodies (Sigma).

Experimental denervation model and muscle preparation

The model of muscle breakdown/atrophy was the gastrocnemius muscle denervation model

previously described [16, 17]. Briefly, the right tibial nerve of eighteen male Lewis rats (200g

each) was transected under inhalational Halothane anaesthesia completely denervating the

gastrocnemius muscle. The contralateral leg served as an internal control in each animal. Rats

were maintained under conditions of routine care for 30 days after which they were sacrificed

and the gastrocnemius muscles were harvested from the operated experimental limb and non-

operated control limb. After rapid, atraumatic dissection, the muscle was snap frozen in liquid

nitrogen. Half of the muscle was used for total RNA isolation and the other half was used to

extract soluble and insoluble cellular protein. Total protein was extracted by homogenizing

(Polytron PT 1200E, Kinematica, Lucerne, Switzerland) the muscle in Muscle Lysis Buffer (5

mM Tris-HCl pH 8.0, 1 mM EDTA, 1 mM EGTA, 1mM β-mercaptoethanol, 1% glycerol,

PMSF (1 mM), leupeptin, aprotinin (10 ug/ml each) for 3x 30sec. and homogenates were

centrifuged at 1600xg for 10 min at 40C. The supernatant (soluble fraction) was centrifuged

134

further for 10 min at 40C, 10,000xg. The pellet (insoluble fraction) was washed with phosphate

buffered saline (PBS), resuspended, dissolved by sonication in 200 µl muscle lysis buffer

containing 0.5% sodium dodecyl sulfate (SDS) and further centrifuged at 10,000xg at 40C for 10

min. and the supernatant designated as the insoluble fraction. All fractions were quantitated

using Pierce (Rockford, IL) BCA Protein Assay Kit and normalized for equal loading. 25 µg of

the muscle lysate was separated on 8% SDS-PAGE and Western blotting was performed using

anti-MTMR4, anti-Nedd4 and anti-HPRT antibodies (Abcam Inc.). The chemilluminescent

signal was acquired using a CCD camera (BioRad Fluor-S Max) and the total signal quantified

using Quantity One software (Biorad Laboratories, Hercules, CA) with volume analysis.

Statistical Analyses

Continuous data are reported as a mean and standard deviation and were compared using

ANOVA, followed by Tukey post-analysis to compare multiple means if p < 0.05. Statistical

significance was assumed if p < 0.05.

Results

Myotubularin related protein 4 (MTMR4) is a PY motif containing protein expressed in

muscle that interacts with Nedd4. As Nedd4 over-expression was correlated with the

progression of atrophic processes in muscle cells, we sought potential substrates in muscle that

may be targeted by Nedd4 to elicit its effects. To this end, we took a bioinformatics approach to

elucidate PY-motif containing proteins that were expressed in skeletal muscle. Nedd4 consists of

an N terminal C2 domain, 3 or 4 WW domains and the ubiquitin ligase HECT domain and in

many cases, engages in interactions with its substrates via a WW domain-PY motif interaction

[4-9]. Searching a SIDNET MGC clone database (http://www.sickkids.ca/sidnet/) for PY motif

containing proteins that were expressed in skeletal muscle limited potential substrates of Nedd4

135

to several proteins, including myotubularin related protein 4 (MTMR4) which belongs to a

family of lipid tyrosine phosphatases with specificity towards PI3P and PI(3,5)P2 [14] 15].

MTMR4 possesses several protein-protein and protein-lipid interaction domains (Figure B1A)

including the FYVE domain, shown to mediate its localization to endosomes through its

interaction with PI3P and PI3,5P2 [14] and is the only family member possessing a PY motif.

The MTMR4 PY-motif (VPPLY) at the C-terminus (positions 1000-1003) is conserved across

mammalian species (data not shown), adhering to the canonical L/XPPXY consensus sequence

for WW domain type I binding. To verify that Nedd4 and MTMR4 can interact, cDNA for

human MTMR4 (hMTMR4) was transfected into 293 cells and lysate from these cells was

subjected to immunoprecipitation with anti-MTMR4 antibodies. Immunoprecipitates were

separated on SDS-PAGE and probed with anti-MTMR4 anti-Nedd4 antibodies to determine if

the two proteins interacted and anti-tubulin as control. Immunoprecipitated transfected hMTMR4

interacted with endogenous Nedd4 but no band was detected in untransfected lysate (Figure

B1B). Similarly, cell lysate transfected with HA-tagged hMTMR4 wild-type and PY-motif

mutant was immunoprecipitated with anti-Nedd4 antibodies, and subjected to Western blotting

with anti-Nedd4, -HA and –tubulin antibodies. Endogenous Nedd4 was able to

immunoprecipitate transfected wild-type hMTMR4 but not the MTMR4 PY mutant suggesting

that the endogenous association of the two proteins is likely mediated through the WW-domain

PY-motif interaction (Figure B1C).

137

Figure B1: Myotubularin related protein 4 (MTMR4) is a PY motif containing protein expressed in muscle that

interacts with Nedd4. (A) Schematic of human MTMR4, modified from [33]. Protein domains predicted with SMART

(http://smart.embl-heidelberg.de/) and PFSCAN (http://hits.isb-sib.ch/cgi- bin/PFSCAN) include GRAM

(Glucosyltransferase, Rab-like GTPase Activator of Myotubularins) domain, RID (Rac-Induced recruitment domain),

PTP/DSP (phosphotyrosine phosphatase/dual-specificity phosphatase) domain, SID (SET-interacting domain), PY

motif (XPPXY), CC (coiled-coil) domain and FYVE (Fab1p, YO1B, Vac1p and EEA1) domain. (B) Western blot of

hMTMR4, Nedd4 and tubulin from transfected (MTM tx) or untransfected (untx) 293 lysate immunoprecipitated with

anti-MTMR4 antibodies (MTM I.P.). Equal amounts of whole lysate were run as control. (C) Lysates (lysate) and

immunoprecipitates using anti-Nedd4 antibodies (Nedd4 I.P.) or anti-p70 S6 kinase antibodies (p70 S6 I.P.)

138

Nedd4 and MTMR4 co-localize in cells: Previous studies have found MTMR4 having unique

distribution to endocytic compartments [14]. We examined co-localization of transfected

hMTMR4 and hNedd4 in HeLa cells. In a representative image, the two proteins show a striking

overlap with a punctate distribution (Figure B2A). Examination and counting of cells in 14 fields

of view at 63x magnification showed that Nedd4 and MTMR4 co-localized in 72% of cells that

were co-expressing both transfected proteins. Quantitative analysis of co-localization yielded

high Manders correlation coefficients, indicative of significant overlap of the Nedd4 and

MTMR4 signal [r(20) = 0.93, p<0.05]. To verify that these punctae are endosomal in nature, we

examined the co-localization of hMTMR4 in HeLa cells with several markers of early, late and

recycling endosomes as well as Golgi and lysosomal markers (Figure B2B). No co-localization

was observed of hMTMR4 and the early endosomal marker Rab5 [r(13) = 0.19], nor was there

significant overlap in MTMR4 signal with the lysosomal marker LAMP [r(9) = 0.16] or the

Golgi marker GM130 [r(8) = 0.09] (data not shown). There was significant overlap between

MTMR4 and Rab7/Transferrin (Figure B2B) indicative of localization to late and recycling

139

endosomes, an impression that was validated quantitatively, r(10) = 0.81, p<0.05 and r(13) =

0.78, p<0.05, respectively. Since PI3P is a major lipid substrate of MTMR4, we co-transfected

hMTMR4, GFP-hNedd4 and PXmCherry (the PX domain of NADPH oxidase binds to PI3P with

high specificity [19]) to determine localization. hMTMR4 and hNedd4 co-localized specifically

to areas of PX (PI3P) staining (Figure B2C) consistent with endosomal localization, r(10) =

0.85, p<0.05 and r(8) = 0.91, p<0.05, respectively.

141

Figure B2: MTMR4 and Nedd4 co-localize to late endosomes/recycling endosomes in living cells. (A)

Immunofluorescence of HeLa cells transfected with HA-tagged hMTMR4 (Klein et al.) and GFP-hNedd4 (green).

Overlay shows merging of the two images. (B) Co-localization of HA-hMTMR4 with markers of late endosomes (Rab

7) and recycling endosomes (Transferrin Receptor). HA-hMTMR4 does not co-localize with markers of early

endosomes (Rab5) (C). Triple labeling of HeLa cells transfected with HA-hMTMR4 (blue), GFP-Nedd4 (green) and

PX-mCherry (Klein et al.) to represent PI3P localization. Arrowheads point to examples of co-localization. Mander’s

co-localization coefficients, r (degrees of freedom), are shown for each set of co-staining. Scale bars represent 11

µm.

142

Nedd4 and MTMR4 interact via a WW domain-PY motif interaction: To verify that the

interaction between the two proteins was mediated by a WW domain-PY motif interaction, we

expressed 6x His-tagged versions of the four WW domains of human Nedd4 and incubated equal

amounts of the fusion proteins (on Ni2+ beads) with GST fusion proteins of regions of hMTMR4

encompassing the PY motif (GST-PY) and a proline rich region N-terminal to the PY motif

(GST-Pro) as a control. We found that the GST-PY consistently bound to WW III and IV of

hNedd4 (n=3) but GST-Pro did not bind to any of the 6x His-WW fusion proteins (Figure B3),

verifying that the interaction between hMTMR4 and hNedd4 is mediated through a PY-WW

domain interaction. This finding with MTMR4 is consistent with other substrates of Nedd4, as

hNedd4 WW IV corresponds to the high affinity WW III in rat, which was found to bind to the

PY-motif of a subunit of the epithelial sodium channel, β-ENaC[20]. Mutation or deletion of the

ENaC PY motif obliterates Nedd4 binding, resulting in in Liddle’s Syndrome [20].

143

Figure B3: MTMR4 and Nedd4 binding is mediated through a PY-motif WW-domain interaction. GST

fusion proteins of the area encompassing the PY motif of hMTMR4 (GST-hMTMR4 PY) and of a non-PY

containing proline rich region of hMTMR4 (GST- hMTMR4 PRO) as control were generated in bacteria as

described in Materials and Methods. Soluble 0.3 µg of GST-PY and GST-Pro were incubated with 0.5 ug

His-tagged hNedd4-WWI, -WWII, -WWIII, -WWIV immobilized on Ni2+ beads (His-hNedd4 WW domain

I-IV) or His beads alone (His). Following thorough washes of the beads, bound proteins were eluted with

sample buffer, separated on SDS-PAGE and Western blotting was performed with anti-GST and anti-His

antibodies.

144

Nedd4 protein is increased in muscle atrophy: As we, and others, have shown that Nedd4

expression increases upon denervation induced atrophy, we hypothesized that any potential

targets of Nedd4-mediated ubiquitination (and subsequent degradation) would be decreased. To

determine if MTMR4 protein levels are affected by denervation induced atrophy, we performed

Western blot analysis of protein lysate from experimental (denervated atrophied muscle) and

control (contralateral innervated rat muscle) with anti-MTMR4 antibodies. We found that the

antibody recognized several bands of different size (data not shown); many were differentially

expressed in experimental versus control limbs. 293 cell lysate, transfected with hMTMR4

cDNA was run alongside the control and experimental insoluble muscle lysates to confirm the

identity of MTMR4 in these fractions. A faint band (approximately 160 kDa) was recognized by

the anti-MTMR4 antibodies in the control lysate, corresponding to what has been reported in

previous studies with hMTMR4 [15] (Figure B4A). The intensity of the band decreased in the

experimental (denervated) lysate versus control, whereas Nedd4 expression increased in the

denervated muscle lysates versus control. The expression of HPRT remained unchanged.

Quantitation of the blots with CCD acquisition of the chemilluminescent signal shows that

MTMR4 decreases approximately 90% with a 3-fold increase in Nedd4 expression (Figure

B4B). These date suggest that decreased levels of MTMR4 protein correlate with increased

levels of Nedd4 protein, supporting the notion of MTMR4 being a target of Nedd4-mediated

degradation.

145

Figure B4: MTMR4 and Nedd4 are differentially regulated in atrophied muscle. (A) Representative Western blot of MTMR4, Nedd4 and HPRT (as loading control) from gastrocnemius muscle insoluble protein fractions from denervated (Den) and contralateral control (Con) limbs. MTM tx is positive control lysate from MTMR4 transfected or untransfected (untx) 293 cells. (B) Bar graph of quantitation of the chemilluminescent signal from Western blots performed using BioRad Fluor-S Max acquisition system and Quantity One software. Each bar represents 8 muscles (mean+SE). P-value < 0.05 denote statistically significant differences between mean values.

146

MTMR4 ubiquitination is dependent on an intact PY motif: MTMR4 co-precipitates with

Nedd4 and has a differential expression pattern in muscle compared to Nedd4, so we

hypothesized that it is a potential substrate for ubiquitination and degradation by Nedd4.

Conjugation of ubiquitin moieties tags proteins for degradation by the proteosome, so we

rationalized that if MTMR4 was a bona fide target for degradation by Nedd4, then Nedd4 would

ubiquitinate MTMR4. Mutation of the MTMR4 PY motif prevents Nedd4 binding and thus

would spare the mutant MTMR4 from ubiquitination and subsequent degradation. Cellular

lysates from HeLa cells transfected with HA-tagged hMTMR4, HA-tagged PY mutant hMTMR4

(both transfected together with hNedd4) or untransfected lysate were subjected to

immunoprecipitation with anti-MTMR4 antibodies (Figure B5). Immunoprecipitates were

separated on SDS-PAGE and probed with anti-ubiquitin and anti-HA antibodies to detect the

expression of the protein. Ubiquitinated MTMR4 (seen as a high molecular weight smear) was

detected in immunoprecipitates only when wild-type MTMR4 was transfected, but not in

immunoprecipitates from the PY mutant transfected or untransfected lysate (Fig. B5). These

data suggest that the MTMR4 PY motif is necessary for Nedd4 interaction and subsequent

ubiquitination.

147

Figure B5: MTMR4 ubiquitination is dependent on an intact PY motif. (A) HeLa cell lysate transfected with HA tagged-hMTMR4 or HA tagged-hMTMR4 PY motif mutant, together with hNedd4 or untransfected lysate (untx) were subjected to immunoprecipitation with anti-MTMR4 antibodies. Beads were washed and separated by SDS-PAGE with total lysate and then subjected to Western blotting with anti-ubiquitin antibodies to detect ubiquitinated MTMR4 and anti-HA antibodies to detect transfected hMTMR4. Aliquots of whole cell lysate were subjected to immunoblotting with anti-HA and anti-Nedd4 antibodies. Blots were stripped and re-probed with anti-α tubulin antibodies as a loading control. Ubiquitinated MTMR4 is seen as a high molecular weight smear (top left panel) in only the hMTMR4 transfected lysate.

148

Discussion

In this report, we describe a novel interaction between the ubiquitin ligase Nedd4 and the dual

specificity phosphatase MTMR4, a regulator of phosphoinositide metabolism and thus, of

endosomal function. While this interaction has not been previously identified, it is not

unexpected, as previous studies have shown an association of Nedd4 with phosphoinositides and

an involvement in endocytosis. The N-terminal C2 lipid-binding domain of Nedd4 has been

shown to mediate Ca2+-dependent phospholipid binding and membrane association [21] in

addition to mediating its own protein-protein interactions that serve to localize it to apical rafts

[22]. The Nedd4 C2 domain displayed no preferences towards lipid composition in an in vitro

binding assay but was shown to bind phosphoinositides, and this binding was partially

augmented in the presence of Ca2+. In addition, the yeast Nedd4 homologue, Rsp5, has a well-

defined role in endocytosis; the C2 domain of Rsp5 localizes it to the plasma membrane, where

Rsp5 directly binds membrane phosphotidylinositides and directs ubiquitination of endosomal

cargo [23-25]. Little is known of the regulation and physiologic role of MTMR4 but studies

show a unique distribution to endosomal structures, the major site of substrate lipid (PI3P)

accumulation [14]. In this report, we show MTMR4 co-localized with the late endosomal

marker, Rab7 in addition to the Transferrin Receptor, a marker for recycling endosomes. In

addition, MTMR4 and Nedd4 both localize to areas of PI3P staining, all suggesting that MTMR4

and Nedd4 are co-localized to late endosomes. Phosphatase inactive forms of MTMR4 or over

expression of WT MTMR4 were shown to inhibit EGF receptor degradation [14]. This effect

was abrogated if the MTMR4 FYVE-domain was mutated, and was recapitulated by the

expression of the FYVE domain alone at very high levels, promoting the notion that this family

member mediates endosomal trafficking by engaging in specific interactions between its FYVE

149

domain and endosomal phosphoinositides, thus affecting the balance of PI3P synthesis and

degradation. Mutations in other MTM family members are associated with muscle dysfunction.

This is not unexpected since muscle is the predominant location of MTM expression. In humans,

MTM1 mutations are associated with a myotubular myopathy (XLMTM), which is a congenital

myopathy associated with major hypotonia at birth [26, 27]. The histopathology of skeletal

muscle reveals small rounded fibres with central nuclei. Mtm1 knockout mice recapitulate the

histological signs of XLMTM and show a progressive myopathy starting at a few weeks after

birth, while muscle histology appears normal at birth [26]. Adenoviral mediated replacement of

MTM1 reverses the myopathy completely, restoring muscle mass and contractility [28]. This

suggests that the defect in the muscle fibres is due to a defect in structural maintenance rather

than an impairment of myogenesis, as was previously hypothesized. Furthermore, knockdown of

C. elegans MTMR3, the closest relative of MTMR4 and the only other family member to

contain a FYVE domain, results in severe impairment of body movement revealing a critical role

for MTMR3 in maintaining muscle function [29]. In this current study, the finding that increased

levels of Nedd4 in atrophied muscle correlate with a decrease in the levels of MTMR4, supports

the notion of MTM family regulation of muscle structure and function.

The role of the Nedd4/MTMR4 interaction in the physiologic progression of muscle

atrophy can be speculated upon. Phosphoinositides (PIs) are important membrane lipids that

regulate cell growth and survival, cell division, and membrane trafficking through recruiting and

activating effector proteins and enzymes that contain PI binding domains, to specific membrane

micro domains [30]. The MTM substrate PI(3)P, which is highly enriched in early endosomes

and internal vesicles of multi-vesicular endosomes late in the endosome pathway, plays a major

role in endocytic trafficking [30, 31]. Depletion of PI(3)P results in inefficient sorting and

delayed trafficking of a number of proteins (such as internalized growth factor receptors) through

150

the endocytic pathways to the late endosome and lysosome. A main function of the other MTM

substrate, PI(3,5)P2 is to catalyze the budding of vesicles from the late endosome as yeast

mutations in Fab1p/PIKfyve kinase, (the enzyme that phosphorylates PI(3)P to PI(3,5)P2) results

in enlarged, poorly acidified vacuoles and late endosomes [32]. Thus, decreased levels of MTM

expression, or alternatively MTM loss of function mutants, likely result in cellular dysfunction

because of inadequate dephosphorylation of PI(3)P and PI(3,5)P2 and dys-regulation of the lipid

signaling within the endocytic pathway. Experimental models examining the status of endosomal

trafficking and receptor recycling in the absence of MTMR4 and /or mutants that are defective in

its ubiquitination can address the contribution of Nedd4 to these processes and the participation

of endosomal trafficking to the progression of muscle atrophy.

In conclusion, we have identified a novel Nedd4 target in muscle, the inositol phosphatase

MTMR4, which further implicates a role for Nedd4 regulating endosomal signalling and

distinguishes a candidate for future studies examining the physiological role of Nedd4 action in

atrophying muscle.

Acknowledgements

This work was supported by the Canadian Institutes for Health Research (CIHR); Jane Batt was

recipient of CIHR Movement Operating Grant and Pamela Plant was recipient of CIHR post-

doctoral fellowship. We gratefully acknowledge Lucy Osbourne (University of Toronto), Chris

Fladd (Hospital for Sick Children – SIDNET) and Brent Steer (University of Toronto), for their

technical expertise and assistance.

References 1 Staub, O. and Rotin, D. (2006) Role of ubiquitylation in cellular membrane transport. Physiol Rev 86, 669-707

151

2 Pickart, C. M. (2001) Mechanisms underlying ubiquitination. Annu Rev Biochem 70, 503-533

3 Katzmann, D. J., Odorizzi, G. and Emr, S. D. (2002) Receptor downregulation and multivesicular- body sorting. Nat Rev Mol Cell Biol 3, 893-905

4 Bouamr, F., Melillo, J. A., Wang, M. Q., Nagashima, K., de Los Santos, M., Rein, A. and Goff, S. P. (2003) PPPYVEPTAP motif is the late domain of human T-cell leukemia virus type 1 Gag and mediates its functional interaction with cellular proteins Nedd4 and Tsg101 [corrected]. J Virol 77, 11882-11895

5 Henry, P. C., Kanelis, V., O'Brien, M. C., Kim, B., Gautschi, I., Forman-Kay, J., Schild, L. and Rotin, D. (2003) Affinity and specificity of interactions between Nedd4 isoforms and the epithelial Na+ channel. J Biol Chem 278, 20019-20028

6 Kanelis, V., Bruce, M. C., Skrynnikov, N. R., Rotin, D. and Forman-Kay, J. D. (2006) Structural determinants for high-affinity binding in a Nedd4 WW3* domain-Comm PY motif complex. Structure 14, 543-553

7 Pak, Y., Glowacka, W. K., Bruce, M. C., Pham, N. and Rotin, D. (2006) Transport of LAPTM5 to lysosomes requires association with the ubiquitin ligase Nedd4, but not LAPTM5 ubiquitination. J Cell Biol 175, 631-645

8 Staub, O., Dho, S., Henry, P., Correa, J., Ishikawa, T., McGlade, J. and Rotin, D. (1996) WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle's syndrome. Embo J 15, 2371-2380

9 Leykauf, K., Salek, M., Bomke, J., Frech, M., Lehmann, W. D., Durst, M. and Alonso, A. (2006) Ubiquitin protein ligase Nedd4 binds to connexin43 by a phosphorylation-modulated process. J Cell Sci 119, 3634-3642

10 Batt, J., Bain, J., Goncalves, J., Michalski, B., Plant, P., Fahnestock, M. and Woodgett, J. (2006) Differential gene expression profiling of short and long term denervated muscle. Faseb J 20, 115- 117

11 Koncarevic, A., Jackman, R. W. and Kandarian, S. C. (2007) The ubiquitin-protein ligase Nedd4 targets Notch1 in skeletal muscle and distinguishes the subset of atrophies caused by reduced muscle tension. Faseb J 21, 427-437

12 Stevenson, E. J., Koncarevic, A., Giresi, P. G., Jackman, R. W. and Kandarian, S. C. (2005) Transcriptional profile of a myotube starvation model of atrophy. J Appl Physiol 98, 1396-1406

13 Nandurkar, H. H. and Huysmans, R. (2002) The myotubularin family: novel phosphoinositide regulators. IUBMB Life 53, 37-43

14 Lorenzo, O., Urbe, S. and Clague, M. J. (2006) Systematic analysis of myotubularins: heteromeric interactions, subcellular localisation and endosome related functions. J Cell Sci 119, 2953-2959

152

15 Zhao, R., Qi, Y., Chen, J. and Zhao, Z. J. (2001) FYVE-DSP2, a FYVE domain-containing dual specificity protein phosphatase that dephosphorylates phosphotidylinositol 3-phosphate. Exp Cell Res 265, 329-338

16 Bain, J. R., Veltri, K. L., Chamberlain, D. and Fahnestock, M. (2001) Improved functional recovery of denervated skeletal muscle after temporary sensory nerve innervation. Neuroscience 103, 503- 510

17 Hynes, N. M., Bain, J. R., Thoma, A., Veltri, K. and Maguire, J. A. (1997) Preservation of denervated muscle by sensory protection in rats. J Reconstr Microsurg 13, 337-343

18 (2005) Ubiquitin-proteasome protocols: Methods in molecular biology. Humana Press

19 Kanai, F., Liu, H., Field, S. J., Akbary, H., Matsuo, T., Brown, G. E., Cantley, L. C. and Yaffe, M. B. (2001) The PX domains of p47phox and p40phox bind to lipid products of PI(3)K. Nat Cell Biol 3, 675-678

20 Kanelis, V., Rotin, D. and Forman-Kay, J. D. (2001) Solution structure of a Nedd4 WW domain-ENaC peptide complex. Nat Struct Biol 8, 407-412

21 Plant, P. J., Yeger, H., Staub, O., Howard, P. and Rotin, D. (1997) The C2 domain of the ubiquitin protein ligase Nedd4 mediates Ca2+-dependent plasma membrane localization. J Biol Chem 272, 32329-32336

22 Plant, P. J., Lafont, F., Lecat, S., Verkade, P., Simons, K. and Rotin, D. (2000) Apical membrane targeting of Nedd4 is mediated by an association of its C2 domain with annexin XIIIb. J Cell Biol 149, 1473-1484

23 Dunn, R. and Hicke, L. (2001) Domains of the Rsp5 ubiquitin-protein ligase required for receptor-mediated and fluid-phase endocytosis. Mol Biol Cell 12, 421-435

24 Dunn, R. and Hicke, L. (2001) Multiple roles for Rsp5p-dependent ubiquitination at theinternalization step of endocytosis. J Biol Chem 276, 25974-25981

25 Dunn, R., Klos, D. A., Adler, A. S. and Hicke, L. (2004) The C2 domain of the Rsp5 ubiquitin ligase binds membrane phosphoinositides and directs ubiquitination of endosomal cargo. J Cell Biol 165, 135-144

26 Buj-Bello, A., Biancalana, V., Moutou, C., Laporte, J. and Mandel, J. L. (1999) Identification of novel mutations in the MTM1 gene causing severe and mild forms of X-linked myotubular myopathy. Hum Mutat 14, 320-325

27 Laporte, J., Biancalana, V., Tanner, S. M., Kress, W., Schneider, V., Wallgren-Pettersson, C., Herger, F., Buj-Bello, A., Blondeau, F., Liechti-Gallati, S. and Mandel, J. L. (2000) MTM1 mutations in X-linked myotubular myopathy. Hum Mutat 15, 393-409

28 Buj-Bello, A., Fougerousse, F., Schwab, Y., Messaddeq, N., Spehner, D., Pierson, C. R., Durand, M., Kretz, C., Danos, O., Douar, A. M., Beggs, A. H., Schultz, P., Montus, M., Denefle, P. and Mandel, J. L. (2008) AAV-mediated intramuscular delivery of myotubularin corrects the

153

myotubular myopathy phenotype in targeted murine muscle and suggests a function in plasma membrane homeostasis. Hum Mol Genet 17, 2132-2143

29 Ma, J., Zeng, F., Ho, W. T., Teng, L., Li, Q., Fu, X. and Zhao, Z. J. (2008) Characterization and functional studies of a FYVE domain-containing phosphatase in C. elegans. J Cell Biochem 104, 1843-1852

30 Robinson, F. L. and Dixon, J. E. (2006) Myotubularin phosphatases: policing 3-phosphoinositides. Trends Cell Biol 16, 403-412

31 Simonsen, A., Wurmser, A. E., Emr, S. D. and Stenmark, H. (2001) The role of phosphoinositides in membrane transport. Curr Opin Cell Biol 13, 485-492

32 Odorizzi, G., Babst, M. and Emr, S. D. (1998) Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95, 847-858

33 Laporte, J., Bedez, F., Bolino, A. and Mandel, J. L. (2003) Myotubularins, a large disease- associated family of cooperating catalytically active and inactive phosphoinositides phosphatases. Hum Mol Genet 12 Spec No 2, R285-292

154

Copyright Acknowledgements Figure 1 is reprinted from Neuron, 30, Betz, A., Thakur, P., Junge, H.J., Ashery, U., Rhee, J.S.,

Scheuss, V., Rosenmund, C., Rettig, J., and Brose, N. Functional interaction of the active zone

proteins Munc13-1 and RIM1 in synaptic vesicle priming. 183-196. Copyright 2001, with

permission from Elsevier.

Figure 2 is reprinted by permission from Macmillan Publishers Ltd: Nature Reviews Molecular

Cell Biology. Chapman, E.R. Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Vol 3,

498-508. Copyright 2002.

Figure 3 is reprinted from Neuron, 34, Martin, T.F. Prime movers of synaptic vesicle exocytosis.

9-12. Copyright 2002, with permission from Elsevier.

Investigation of Rab34 and Munc13 In The Secretory Pathway ... · Investigation of Rab34 and Munc13...

Documents

Transcript of Investigation of Rab34 and Munc13 In The Secretory Pathway ... · Investigation of Rab34 and Munc13...