Investigation of immunomodulatory properties of ...

Investigation of immunomodulatory

properties of neurovirulent viruses – in vitro

and in vivo effects of canine distemper virus

Visar Qeska

University of Veterinary Medicine, Hannover

Department of Pathology

Center for Systems Neuroscience

University of Veterinary Medicine Hannover

Department of Pathology

and

Center for Systems Neuroscience

Investigation of immunomodulatory properties of

neurovirulent viruses – in vitro and in vivo effects of canine

distemper virus

Thesis

Submitted in partial fulfillment of the requirements for the degree

Doctor of Philosophy (PhD)

awarded by the University of Veterinary Medicine Hannover

by

Visar Qeska

(Republic of Kosovo)

Hannover 2013

Supervisor: Prof. Dr. Wolfgang Baumgärtner

Supervision group: Prof. Dr. Wolfgang Baumgärtner

Prof. Dr. Andrea Tipold

Prof. Dr. Martin Stangel

1st Evaluation: Prof. Dr. Wolfgang Baumgärtner

Department of Pathology, University of Veterinary Medicine, Hannover

Prof. Dr. Andrea Tipold Small Animal Clinic, University of Veterinary Medicine, Hannover

Prof. Dr. Martin Stangel Department of Neurology, Hannover Medical School, Hannover 2

nd Evaluation: Prof. Dr. Susanne Alldinger

Department of Pathology, Faculty of Veterinary Medicine, Justus-Liebig University, Giessen

Date of final exam: 12.04.2013

Visar Qeska was supported by Young cell scheme VI, European Council and Kosovo

government, Department of Pathology, Veterinary University Hannover, Germany, and

Center for Systems Neuroscience (ZSN), Hannover . This study was in part supported

by the German Research Foundation (FOR 1103, BA 815/10-2 and BE 4200/1-2).

http://www.sciencedirect.com/science/article/pii/S0165242712001067#gs0005


To Lejla

.

“Truth is not a democracy”

(Neil deGrasse Tyson)

List of publications

Parts of the thesis have been published / submitted in peer-reviewed journals previously:

Qeska V, Baumgärtner W, Beineke A, 2013. Species-specific properties and translational aspects of

canine dendritic cells. Vet. Immunol. Immunopathol. 151, 181-192

Qeska V, Barthel Y, Iseringhausen M, Stein VM, Tipold A, Baumgärtner W, Beineke A. Depletion of

Foxp3+ regulatory T cells as a putative prerequisite for lesion initiation in canine distemper virus induced

demyelinating leukoencephalitis. Vet. Res. Submitted.

i

Table of content

Chapter 1: Aims of the study ..................................................................................................................... 1

Chapter 2: General introduction ................................................................................................................ 3

2.1 Canine distemper virus (CDV) ....................................................................................................... 3

2.1.1 Viral properties of canine distemper virus ................................................................................. 4

2.1.2 Canine distemper virus infection, receptors and cell tropism ................................................... 6

2.1.3 Pathogenesis and clinical manifestation of canine distemper .................................................. 7

2.1.4 Pathology of lymphoid organs and mechanism of immunosupression ..................................... 9

2.1.5 Neuropathology of canine distemper ...................................................................................... 11

2.1.6 Immune responses in canine distemper demyelinating leukoencephalitis ............................. 14

2.1.7 Cytokine expression in canine distemper ............................................................................... 15

2.2 Dendritic cells ................................................................................................................................ 16

2.2.1 Dendritic cells in dogs ............................................................................................................. 18

2.2.2 Dendritic cells in viral diseases ............................................................................................... 20

2.3 Regulatory T cells ......................................................................................................................... 23

2.3.1 Regulatory T cells in viral diseases ......................................................................................... 26

Chapter 3: Regulatory T cells in canine distemper infection . ............................................................. 29

Chapter 4: Canine dendritic cells ............................................................................................................ 67

Chapter 5: Dendritic cells in canine distemper infection ...................................................................... 69

Chapter 6: General discussion ................................................................................................................ 93

6.1 The role of innate immunity in demyelinating disorders .......................................................... 93

6.2 Role of regulatory T cells in neurological diseases .................................................................. 96

6.3 Role of dendritic cells in demyelinating disorders .................................................................... 98

6.4 Interaction of dendritic cells and regulatory T cells in demyelinating and chronic viral diseases ............................................................................ 100

6.5 Conclusion ................................................................................................................................... 103

Chapter 7: Summary ............................................................................................................................... 105

Chapter 8: Zusammenfassung .............................................................................................................. 109

Chapter 9: References ............................................................................................................................ 113

Chapter 10: Acknowledgements ........................................................................................................... 135

ii

List of abbreviations

APC antigen presenting cell

bmDCs bone marrow derived dendritic cells

CCL22 C-C motif chemokine 22

CCR4 C-C chemokine receptor type 4

CDV canine distemper virus

CNS central nervous system

DCs dendritic cells

DL demyelinating leukoencephalitis

EAE experimental autoimmune encephalitis

Flt3L Fms-related tyrosine kinase 3 ligand

Foxp3 forkhead box P3

FV Friend retrovirus

GM-CSF granulocyte macrophage-colony stimulating factor

HIV human immunodeficiency virus

IHC Immunohistochemistry

IFN interferon

IL interleukin

LC Langerhans cells

MHC II major histocompatibility complex class II

moDC monocyte-derived dendritic cells

MS multiple sclerosis

MV measles virus

PBMC peripheral blood mononuclear cells

PMS periodical microstructure

rc recombinant canine

rh recombinant human

SLAM signalling lymphocyte activation molecule

TME Theiler’s murine encephalomyelitis

TMEV Theiler’s murine encephalomyelitis virus

iii

List of figures

Figure 1 Schematic diagram of the morbillivirus genome

and cell receptors for canine distemper virus (CDV)………………5

Figure 2 Effects of canine distemper virus (CDV) upon immune cells…....10

Figure 3 Possible mechanisms of demyelination in canine distemper……13

Figure 4 Dendritic cell (DC) lineages of dogs………………………………..19

Figure 5 Proposed mechanisms of interaction between

measles virus (MV) and dendritic cells (DC)…………………..…..23

Figure 6 Schematic diagram of mechanisms involved

in regulatory T cell (Treg)-mediated immunosuppression……….25

Figure 7 Dualism of regulatory T cells (Treg) in virus infection……………26

Figure 8 Proposed homeostatic feedback loops between

dendritic cells (DCs) and regulatory T cells (Treg)……………….101

1

Chapter 1: Aims of the study

Chapter 1: Aims and hypothesis of the present study

Canine distemper virus (CDV) infection causes a long lasting immunosuppression in

dogs. Due to its profound lymphotropism and preferential infection of CD150-expressing

immune cells, generalized lymphoid depletion and severe lymphopenia can be found

during the acute distemper phase, which is similar to human measles virus (MV)

infection (von Messling et al. 2006; Beineke et al. 2009; Sellin et al. 2009). Moreover,

due to demyelination that occurs with disease progression, canine distemper represents

a spontaneous model for human myelin disorders such as multiple sclerosis (MS)

(Vandevelde and Zurbriggen, 2005; Sips et al. 2007). Several publications

demonstrated the important role of regulatory T cells (Treg) and dendritic cells (DC) for

the development of chronic central nervous system (CNS) disorders (Wu and Laufer,

2007; Zozulya and Wiendl, 2008). Interestingly, although a therapeutic effect of these

immunomodulatory cells can be observed in autoimmune disorders, both beneficial and

detrimental effects have been described in infectious disorders (Belkaid and Rouse,

2005; Schneider-Schaulies and Dittmer, 2006; Zozulya and Wiendl, 2008). Krakowka et

al. (1982) discussed the existence of a mononuclear suppressor cell population that

causes inhibition of immune responses in CDV-infected dogs. However, this cell

population, which potentially includes Treg and/or DCs, has not been identified yet.

During the chronic phase of CDV-infection, viral antigen can be found in cells with a DC-

like morphology in splenic germinal centers (Wünschmann et al. 2000). Thus, similar to

the proposed effects of MV upon human DCs, it is hypothesized that CDV also inhibits

the differentiation of canine DCs, which might subsequerntly lead to persistent

depressive effects upon the immune system (Beineke et al. 2009; Céspedes et al. 2010;

Reuter et al. 2010). Moreover, Treg have been demonstrated to cause long lasting

immunosuppression in human measles (Sellin et al. 2009; Griffin 2010). Since so far

none of the above mentioned cell populations have been investigated in canine

distemper infection, the aims of the project were to determine disease phase-dependant

phenotypical changes and the associated cytokine expression in lymphoid organs of

CDV-infected dogs and to testify the hypothesis that a peripheral depletion of Treg

2

Chapter 1: Aims of the study

causes a lack of CNS-infiltrating immunomodulatory cells in the predemyelinating phase

of CDV-infection. The latter might represent a potential prerequisite for immune

mediated demyelination. Moreover, the effect of CDV upon canine DCs was

investigated in vitro to depict further potential parallels between canine distemper and

human measles.

3

Chapter 2: General introduction

2 Chapter 2: General introduction

2.1 Canine distemper virus (CDV)

Morbilliviruses belong to the Paramyxoviradae family and include a number of highly

pathogenic viruses, such as measles virus (MV), rinderpest virus, canine distemper

virus (CDV), and peste-des-petits-ruminants virus, which cause devastating diseases in

humans and animals (Beineke et al. 2009; Langedijk et al. 2011). In the last decades,

morbilliviruses additionally emerged as causative agents of several mass-mortalities in

bottlenose dolphins, Siberian seals, harbor seals, and striped dolphins (Osterhaus et al.

1990; Lipscomb et al. 1994; Saliki et al. 2002; Beineke et al. 2010; Stimmer et al. 2010).

Canine distemper is a fatal disease of carnivores with a worldwide distribution which

affects mainly dogs. CDV-infection is also found in other animals including felidae,

mustelidae, procyonidae, phocidae, tayassuidae, and non-human primates (Macaca

fuscata; Pringle 1999; Sips et al. 2007; Beineke et al. 2009). Efforts to prevent the CDV

infection by vaccination are largely successful (Patel et al. 2012). However, even with a

broad vaccination regiment, distemper outbreaks have been reported in France,

Germany, USA, Japan and Finland (Mori et al. 1994; Johnson et al. 1995; Beineke et al.

2009). Moreover, canine distemper has been observed in vaccinated animals following

infection with genetically different CDV strains (Simon-Martínez et al. 2008). CDV-

infection represents a systemic disease which affects the respiratory and

gastrointestinal tract, skin, lymphoid tissues, and CNS (Krakowka et al. 1980;

Baumgärtner et al. 1989). Moreover, among other morbilliviruses, CDV-infection shows

a high incidence of CNS complications (Rudd et al. 2006). Pathological changes that

occur during CDV-induced demyelinating leukoencephalitis (DL) show remarkable

similarities with human multiple sclerosis (MS), making DL a naturally occurring

translational model for human demyelinating disorders (Baumgärtner and Alldinger,

2005). Additionally, the disease course and pathogenesis in canine distemper resemble

those of human MV infection including, fever, rash, respiratory signs, lymphopenia, and

4


profound immunosuppression with generalized depletion of lymphoid organs during the

acute disease phase (von Messling et al. 2006; Beineke et al. 2009; Sellin et al. 2009).

Thus, CDV-infection of dogs is further appreaciated as a model to investigate

morbillivirus induced alterations of the immune system.

2.1.1 Viral properties of canine distemper virus

CDV is an enveloped, negative-sense, single-stranded RNA virus. Similar to other

paramyxoviruses CDV contains six structural proteins: the nucleocapsid (N), phospho

(P), large (L), matrix (M), hemagglutinin (H) and fusion (F) protein, and two accessory

non-structural proteins (C and V) found as extratranscriptional units within the P gene

(Örvell, 1980; Dhiman et al. 2004; Röthlisberger et al. 2010) (Fig. 1). The lipid envelope

surrounding the virion contains two surface proteins (F and H), which mediate virus

entry into the cell. During morbillivirus infection, the initial interaction with the host cell is

mediated by the envelope-anchored attachment protein, the H protein, an essential viral

component, which, assisted by the viral fusion protein, initiates virus cell entry (Stern et

al. 1995; von Messling et al. 2001; Langedijk et al. 2011). The N, P and L proteins are

responsible for virus replication, while the M protein connects the surface glycoproteins

and N protein during viral maturation (von Messling et al. 2001; Röthlisberger et al.

2010). Co-expression of both H and F glycoprotein are sufficient and necessary to

induce cell fusion. Moreover, the H protein represents the major factor determining CDV

cell tropism (Stern et al. 1995; Plattet et al. 2005). The cell fusion in paramyxovirus

infection seems to be a complex process. The current model proposes that the H

protein undergoes conformational changes after binding with the host cell, which also

affects the structure of the F protein resulting in insertion of hydrophobic fusion peptide

into the cell membrane with the result of final binding to the host cell (Lamb 1993;

Plattet et al. 2005). On the other side, von Messling et al. (2001) reported that the

fusogenicity is solely determined by properties of the H protein. Moreover, the F protein

5


might have a key role in viral persistence (Plattet et al. 2005; Plattet et al. 2007).

Additionally, M and N proteins which are important for viral budding might represent co-

factors for the ability of CDV to induce persistent infection (Stettler et al. 1997; Plattet et

al. 2007). Additionally, the role of V proteins accounts for rapid viral multiplication in

lymphocytes and the inhibition of interferon signaling pathways (von Messling et al.

2006; Röthlisberger et al. 2010).

Figure 1. Schematic diagram of the morbillivirus genome and cell receptors for canine distemper

virus (CDV). A) The morbillivirus virion contains the RNA genome and six structural proteins: the

nucleocapsid (N), pospho (P), matrix (M), fusion (F), hemagglutinin (H) and large (L) protein. The H and F

proteins are associated with the envelope. The V and C proteins are non-structural proteins. Additionally,

CDV uses the signalling lymphocyte activation molecule (SLAM) as a receptor for cell entry. Additional

receptors which are supposed to support infection are CD9 and CD46 B) The non-segmented RNA

genome contains six genes. The P gene encodes for the P, C and V proteins. The P and C proteins are

translated from overlapping reading frames on a functionally bicistronic mRNA and the V protein is

translated from V mRNA, which is formed after insertion of a single nucleotide by RNA editing. Modified

from Yanagi et al. (2006).

After virus attachment, the virus replicates in the cytoplasm of the host cell, and

cytoplasmic as well as intranuclear inclusions can be found in many cell types

(Baumgärtner et al. 1989). Until now, only one serotype and several co-circulating CDV

6


genotypes with differences in virulence and cell tropism have been described (Haas et

al. 1999).

2.1.2 Canine distemper virus infection, receptors and cell tropism

For MV several proteins that serve as receptors for virus entry have been described.

The signaling lymphocyte activation molecule (SLAM), also known as CD150, has been

identified as an ultimate and universal morbillivirus receptor (Fig. 1) (Hahm et al. 2004;

von Messling et al. 2006; Sato et al. 2012). SLAM is a glycosylated transmembrane

protein that is constitutively expressed on immature thymocytes, DCs, CD45ROhigh

memory T cells and a proportion of B cells, and is rapidly induced on T and B cells after

activation (Cocks et al. 1995; Tatsuo et al. 2000; Beineke et al. 2009). The expression

of SLAM on leukocytes in MV and CDV-infection accounts for the preferential infection

of lymphoid organs (lymphotropism) with subsequent lymphoid depletion and

immunosuppression (Wünschmann et al. 2000; Minagawa et al. 2001; Wenzlow et al.

2007; Langedijk et al. 2011). For instance, during early CDV-infection, SLAM is up-

regulated on lymphoid cells, which is supposed to enhance virus amplification in the

host (Wenzlow et al. 2007). Beside the SLAM receptor, certain strains of MV are able to

infect cells by interaction with the CD46 receptor (Naniche et al. 1993; Erlenhöfer et al.

2002). CD46 serves as a receptor predominantly for attenuated viruses and only for few

wild type strains in vitro (Erlenhöfer et al., 2002). Whether wild type MV in vivo interacts

with CD46 or not, and whether all MV-strains have the ability to use SLAM as a

receptor, is still not known (Dörig et al. 1993; Erlenhöfer et al. 2002; Yanagi et al. 2006).

The role of CD46 in CDV-infection has not yet been confirmed, although the lack of

SLAM in certain CDV-target cells supports the assumption of SLAM independent

infection pathways (Wenzlow et al. 2007, Beineke et al. 2009). So far, CD46 molecules

have been identified only in neoplastic lymphoid cells of dogs (Suter et al., 2005).

Additional receptors, such as CD9, are discussed as possible factors for CDV-infection

7


of Vero cells. CD9, a tetraspan transmembrane protein, was shown to induce cell-to-cell

fusion, but not virus-to-cell fusion (Löffler et al. 1997; Schmid et al. 2000). Since no

direct binding of the virus with CD9 can be demonstrated, this receptor is supposed to

represent a co-factor for viral infection as part of the receptor complex or by effecting

the expression of other receptor molecule (Löffler et al. 1997). Recently, nectin-4 was

identified as a new receptor for MV (Mühlebach et al. 2011). Its role in canine distemper

remains to be determined.

CDV is a pantropic virus that shows a broad cell tropism. Accordingly, CDV can be

found in cells of the respiratory, gastrointestinal and urinary tract, as well as in lymphoid

tissues, endocrine organs and the central nervous system (CNS; Baumgärtner et al.

1989; Gröne et al. 2004; Beineke et al. 2009). Moreover, infection of various cell types

can be found in canine distemper (Vandevelde and Zurbriggen, 2005; Seehusen et al.

2007). In the CNS, astrocytes, microglia, and oligodendrocytes, can get infected

regardless of the CDV strain, while the infection of neurons is strain dependent (Pearce-

Kelling et al. 1991; Orlando et al. 2008). During the acute disease stage, astrocytes

represent the main cell population infected by CDV (Alldinger et al. 2000; Seehusen et

al. 2007). Interestingly, even though CNS lesions are characterized by white matter

vacuolization and demyelination, only a limited number of oligodendrocytes can be

found to be infected (Zurbriggen et al. 1998; Vandevelde and Zurbriggen, 2005).

2.1.3 Pathogenesis and clinical manifestation of canine distemper

The disease course including the duration and severity of clinical signs depends mainly

on the virulence of the strain as well as on the age and immune status of the animal.

Transmission of the virus is facilitated by sneezing, coughing and close contact.

Accordingly, animals are infected primarily by inhalation of viruses and infective

droplets, respectively (Krakowka et al. 1980). Initially, virus replicates in lymphoid tissue

of the upper respiratory tract. Here, monocytes and macrophages are the first cells that

8


get infected and propagate the virus (Appel et al. 1970). The incubation period varies

from one to four weeks (Krakowka et al. 1980; Beineke et al. 2009). Animals display a

broad spectrum of clinical signs including lethargy, anorexia, dehydration, weight loss,

pneumonia, and neurological signs. Furthermore, development of a biphasic fever

represents a characteristic clinical finding (Wright et al. 1974). During the first viremic

phase (three to six days post-infection), generalized infection of all lymphoid tissues

with lymphopenia, profound immunosuppression and transient fever is observed. The

second viremia takes place several days later, and is associated with high fever and

infection of parenchymal tissues such as the respiratory tract, gastrointestinal tract, skin,

and CNS (Appel et al. 1969, Krakowka et al. 1980, Beineke et al. 2009). During this

disease stage, various signs such as conjunctivitis, nasal discharge, anorexia,

neurological disturbances, gastrointestinal signs and respiratory signs can be observed

(Krakowka et al. 1980; Beineke et al. 2009). Respiratory signs are a consequence of

virus-induced rhinitis and interstitial pneumonia, which can exceed to suppurative

bronchopneumonia due to secondary bacterial infection. Vomiting, diarrhea and

dehydration follow infection of the gastrointestinal tract (Greene and Apple, 1998;

Decaro et al. 2004;). Neurologic signs depend on viral distribution in the CNS and

include hyperesthesia, cervical rigidity, seizures, cerebellar and vestibular signs, as well

as paraparesis or tetraparesis with sensory ataxia (Deem et al. 2000; von Rüden et al.

2012). Neurological manifestations include encephalopathy, acute encephalitis,

subacute to chronic demyelinating encephalitis, and polioencephalitis (Nesseler et al.

1999; Rudd et al. 2010; Wyss-Fluehmann et al. 2010). Recovery depends on the

immune state of the animal. Particularly, a strong and effective cellular immune

response can eliminate the virus prior to the infection of parenchymal tissues, while

weak and delayed cellular and humoral immune responses lead to virus spread and

persistence, respectively

9


2.1.4 Pathology of lymphoid organs and mechanism of immunosupression

Systemic CDV-infection causes depletion of multiple lymphoid tissues such as spleen,

lymph nodes, thymus and mucosa associated lymphatic tissues (MALT) of dogs.

Microscopic changes in lymphoid organs include loss of B and T cell areas, formation of

giant cells, intracytoplasmic inclusion bodies in lymphoid cells, follicular necrosis, and

thymic atrophy (Fig. 2) (Iwatsuki et al. 1995; Wünschmann et al. 2000; Beineke et al.

2009). Moreover, syncytia formation and cell death of immune cells lead to complete

loss of secondary follicles (Iwatsuki et al. 1995). During the acute disease stage, CDV

antigen is found mostly in lymphocytes and macrophages, located predominantly in T

cell areas (Apple et al., 1969; Iwatsuki et al., 1995, Wünschmann et al., 2000;

Schobesberger et al., 2005). At this, CD4+ T cells are the primarily affected cell type and

the first population that gets depleted (Iwatsuki et al., 1995; Wünschmann et al., 2000).

Lymphopenia is associated with a rapid loss of CD4+ T helper cells, CD8+ cytotoxic T

cells, CD21+ B cells, and macrophages (Wünschmann et al. 2000). Changes in

lymphoid organs correlate with the amount of CDV antigen (Wünschmann et al. 2000).

During the chronic disease phase, the virus is cleared from lymphoid organs and

reconstitution of lymphoid cells takes place (Krakowka et al. 1980). However, despite

regeneration and lymphoid repopulation, long lasting phenotypical alterations are

observable in lymphoid organs in chronically infected dogs (Wünschmann et al. 2000).

During chronic infection, viral antigen can be found in germinal centers within

leukocytes with DC-like morphology (Wünschmann et al. 2000). Thus, similar to the

proposed effects of MV upon human DCs, it is hypothesized that CDV also modulates

the function of canine DCs, which leads to persistent immune depressive effects

(Wünschmann et al. 2000; Beineke et al., 2009). For instance, CDV-infection of thymic

DCs may result in impaired maturation of T cells with release of CD5-negative T cells.

The CD5-negative T cell population potentially contains autoreactive lymphocytes,

which might be responsible for the induction of myelin specific immunity in canine

distemper (Wünschmann et al. 2000). However, so far, functional properties of DCs in

10


canine distemper have not been investigated. Mechanisms of CDV-induced

immunosuppression remain largely undetermined (Beineke et al. 2009). In human

measles, apoptosis of immune cells is considered as one cause for severe leukopenia

(Okada et al. 2000). Similarly, apoptosis of infected and non-infected immune cells in

lymphoid organs contribute to lymphoid depletion and impaired immune responses in

CDV-infected dogs (Okada et al. 2000; Schobesberger et al. 2005). This indicates that

directly virus-mediated as well as virus-independent mechanisms might be involved in

leukocyte apoptosis. Proposed mechanisms for apoptotic cell death include an over-

activation of immune responses and activation of Fas-pathways, respectively

(Schobesberger et al. 2005; Beineke et al. 2009).

Figure 2. Effects of canine distemper virus (CDV) upon immune cells. CDV-infection of leukocytes is

supposed to cause an inhibition of plasma cell differentiation, reduced proliferation of lymphocytes,

increased lymphocyte apoptosis induction and diminished function of antigen presenting cells (APCs),

such as dendritic cells.

After viral elimination from the peripheral blood, decreased antigen presentation and

lymphocyte maturation is supposed to contribute to persistent immunosuppression

11


despite repopulation of lymphoid organs (Beineke et al. 2009; Carvalho et al. 2012).

CDV causes modulation of antigen presenting abilities of monocytes by the inhibition of

IL-1 (Krakowka et al., 1987). Furthermore, CDV-N protein potentially modulates antigen

presentation by inhibiting the production of IL-12 in DCs, as described for MV-infected

DCs (Schneider-Schaulies and Dittmer, 2006), while morbillivirus V proteins act as

interferon antagonists and cytokine inhibitors (von Messling, 2006). Krakowka et al.,

(1982) discussed the existence of a mononuclear suppressor cell population that

causes long lasting immunosupression. Interestingly, regulatory T cells (Treg) have

been demonstrated to cause long lasting immunosuppression in infectious diseases,

such as human measles (Piccirillo and Shevach 2001; Sellin et al. 2009; Reuter et al.

2012). However, until now the function of Treg in the pathogenesis of canine distemper

has not been investigated yet. Similarly, the role of DCs in CDV-induced

immunopathology remains enigmatic.

Further studies have to focus on CDV-dependent and independent mechanisms of

immunosuppression as well as upon the role of DCs and Treg for immune alteration and

neuroinflammation in canine distemper

2.1.5 Neuropathology of canine distemper

Infection of the CNS represents the a serious complication of canine distemper, often

with poor prognosis (Carvalho et al. 2012). Dependent upon the host immune response

and virus strain, polioencephalitis and demyelinating leukoencephalitis (DL) can be

discriminated (Pearce-Kelling et al. 1990; Orlando et al. 2008). Polioencephalitis is a

rare manifestation of CDV-infection and can be subclassified as old dog encephalitis,

inclusion body encephalitis and post vaccinal encephalitis (Bestetti et al. 1978;

Vandevelde et al. 1980; Nesseler et al. 1999). Grey matter lesions are predominantly

located in cortical areas and brain stem nuclei with neurons and astrocytes representing

the most affected cell populations (Nesseler et al. 1999). Histologically neuronal

degeneration and necrosis with gliosis, inclusion bodies and infiltration of macrophages

12


and lymphocytes can be found (Nesseler et al. 1997; Beineke et al. 2009).

Leukoencephalitis is the more common manifestation and shows a progressive disease

course. White matter lesions are subclassified as acute lesions, subacute lesions

without inflammation, subacute lesions with inflammation and chronic lesions with

inflammation (Alldinger et al. 1993; Wünschmann et al. 1999; Wünschmann et al. 2000;

Beineke et al. 2009). Demyelinating foci are located predominately in proximity to the

ventricles, cerebellar velum, cerebellar peduncles and optic tract (Summers and Appel,

1994). Acute DL is characterized by focal to multifocal or diffuse vacuolization of the

white matter which develops during the period of severe immunosuppression

(Wünschmann et al. 1999; Seehusen et al. 2007). Lesions consist of mild gliosis with

reactive astrocytes and few gemistocytes (Baumgärtner et al. 1989; Alldinger et al.

1993). Here, astrocytes represent the main target cells for CDV-infection (Alldinger et al.

2006; Seehusen et al. 2007; Carvalho et al. 2012). Spread of the virus among

astrocytes does not require infectious particles (Wyss-Fluehmann et al. 2010; Carvalho

et al. 2012). The usage of gap junctions of the astrocytic synapse-like network

represents a possible mechanism for CDV spread as described for herpes simplex virus

(Wyss-Fluehmann et al. 2010). Acute and subacute lesions without inflammation are

characterized by a lack of perivascular cuffing (Tipold et al. 1999; Wünschmann et al.

1999). The initial vacuolization might be caused by restricted infection of

oligodendrocytes. Experiments in vitro and in vivo revealed a down-regulation of myelin-

specific genes (Zurbriggen et al. 1998; Vandevelde and Zurbriggen, 2005). During the

subacute disease course astrocytic hypertrophy and hyperplasia (astrogliosis and

astrocytosis) with formation of gemistocytes and multinucleated astrocytes as well as

gitter cells can be observed, although mononuclear perivascular infiltrates are initially

still absent (Tipold et al. 1999; Seehusen et al. 2007; Seehusen and Baumgärtner,

2010). Subsequent inflammatory stages of DL coincide with recovery of the immune

system. CNS lesions are characterized by the presence of perivascular infiltrations of

lymphocytes, plasma cells and macrophages (Vandevelde et al. 1982). Chronic CNS

lesions are associated with prominent perivascular infiltrations (more than three layers

13


of monocytic inflammatory cells) and profound myelin loss (Vendevelde et al. 1982;

Beineke et al. 2009; Vandevelde and Zurbriggen, 2005). A correlation between

microglial activation and loss of myelin has been described (Stein et al. 2004). Virus-

activated microglia release myelinotoxic substances which leads to bystander

demyelination (Fig. 3; Alldinger et al. 1996; Vandevelde and Zurbriggen, 2005; Beineke

et al. 2009). Recent studies revealed the existence of oligodendrocytes in demyelinating

lesions, indicating that primary demyelination precedes the loss of myelin-forming cells

in DL (Schobesberger et al. 2002). Moreover, an increased apoptotic rate particularly in

the granular layer of the cerebellar grey matter in DL indicates the possibility of

demyelination as a secondary process following Wallerian degeneration or loss of

astrocytic support, respectively (Moro et al. 2003; Beineke et al. 2009; Del Puerto et al.

2010; Seehusen and Baumgärtner, 2010).

Figure 3. Possible mechanisms of demyelination in canine distemper. A) During early infection

demyelination is a consequence of direct and indirect effects (e.g. loss of trophic support) upon

oligodendrocyte which causes myelin alteration and loss. B) During advanced stages immune mediated

processes including the release of myelinotoxic substances by activated microglia (bystander

demyelination) contribute to progressive myelin damage. Modified from Carvalho et al. (2012).

14


2.1.6 Immune responses in canine distemper demyelinating leukoencephalitis

The host defense during CDV-infection initially relies on innate immune responses,

although for complete virus elimination the activation of humoral and cellular immune

responses are required (Carvalho et al. 2012). Protective humoral immunity in canine

distemper is achieved by the production of antibodies against viral nucleoproteins,

followed by the development of specific immunoglobulins against viral envelope proteins

(Miele and Krakowka, 1983; Rima et al. 1991).

Lesion development of DL represents a biphasic event with initial tissue damage directly

induced by the virus and subsequent immune mediated inflammation as a consequence

of viral persistence and delayed type hypersensitivity (Baumgärtner et al. 1989;

Alldinger et al. 1996). The infiltration of CD8+ T cells correlates with virus replication and

the appearance of early immune responses against the N-protein (Tipold et al. 1999).

These T cells contribute to viral clearance but also to initial tissue damage by antibody

independent cytotoxicity (Wünschmann et al. 1999). In subacute lesions prominent

numbers of CD4+ T cells and B cells can be found. While CD8+ T cells might function as

cytotoxic effectors, CD4+ T cells are supposed to contribute to delayed type

hypersensitivity reactions in advanced lesions (Wünschmann et al. 1999). Additionally,

major histocompatibility complex class II (MHC II) is upregulated within areas with low

or absent viral antigen in chronic foci, which indicates virus-independent, immune

mediated mechanisms of demyelination (Alldinger et al. 1996). Thus, while during the

acute phase myelin damage is ascribed as directly virus mediated, demyelination in

chronic lesions is a result of collateral damage, e.g. due to an over-activation of

microglia/macrophages (bystander demyelination; Beineke et al. 2009) (Fig 3).

Repopulation of peripheral lymphoid organs is supposed to be a prerequisite for CNS-

infiltration of immune cells during inflammatory stages (Wünschmann et al. 2000). For

instance, with recovery of the immune system an infiltration of CD4+ T cells, B cells and

IgG-producing plasma cells in the brain as well as CDV-specific humoral immune

responses in the cerebrospinal fluid can be observed (Vandevelde et al. 1982; Beineke

15


et al. 2009). The increased antibody production by plasma cells might enhance

demyelination by an antibody dependent T cell mediated cytotoxicity (Alldinger et al.

1996; Wünschmann et al. 1999).

2.1.7 Cytokine expression in canine distemper

Cytokines are important signalling molecules involved in cell communication and

orchestration of immune responses in infectious and immune mediated disorders

(Rothwell 1997). In DL, infiltration of immune cells and accompanied demyelination is

followed by a tremendous up-regulation of several cytokines (Spitzbarth et al. 2012).

Cytokine expression can be directly induced by the virus or by autocrine and paracrine

regulatory loops during CDV-infection (Gröne et al. 2002; Markus et al. 2002; Beineke

et al. 2009).

During early DL lesion development pro-inflammatory cytokines, such as IL-6, IL-12 and

TNF-α, are up-regulated, while the anti-inflammatory cytokines, IL-10 and TGF-β,

remain unchanged (Markus et al. 2002; Beineke et al. 2008). The pro-inflammatory

cytokine environment in the brain during acute CDV-infection is indicative of insufficient

counter regulatory mechanisms, potentially causing early immune over-activation and

initial tissue damage in the brain. Similarly, expression of neuroprotective and Treg

inhibitory cytokines such as IL-10 and TGF-β is insufficient in canine spinal cord injury,

potentially leading to an activation of CNS resident immune cells (Spitzbarth et al.

2011). Initial infiltration of CD8+ T cells in the brain is associated with the expression of

chemoattractant cytokines such as IL-8 (Gröne et al. 1998; Tipold et al. 1999). In

advanced stages of DL, production of IL-12 within the CDV-infected CNS might trigger

Th1-biased immune responses (Gröne et al. 2000; Wünschmann et al. 2000; Beineke et

al. 2009; Spitzbarth et al. 2012). In addition, IL-12 is known to play a role in

demyelinating diseases such as MS and experimental autoimmune encephalomyelitis

(EAE). IL-12 also accounts for the maturation of monocyte-derived dendritic cells

(moDCs) and probably the activation of microglia (Fox and Rostami, 2000; Sugiura et

16


al. 2010; Spitzbarth et al. 2012). In the cerebrospinal fluid of CDV-infected dogs,

independent of the disease course, pro-inflammatory cytokines (TNF and IL-6) and anti-

inflammatory cytokines (IL-10 and TGF-β) are often observed simultaneously (Frisk et

al. 1999; Beineke et al. 2009).

Cytokine analysis of whole blood samples of dogs with DL revealed an expression of IL-

2, IL-6, TNF and TGF-β. IL-6 can be detected in the blood of dogs with early CNS

lesions, while TGF-β is found predominately during late stages of the disease, indicative

of a delayed onset of peripheral immunomodulatory processes in advanced disease

stages (Gröne et al. 1998). IL-1, IL-6 and TNF affect the permeability of the blood brain

barrier and represent a prerequisite for infiltration of leukocytes and enhancement of

neuroinflammation (Gröne et al. 1998; Beineke et al. 2008; Beineke et al. 2009). The

lack of IFN-γ expression in peripheral blood leukocytes of CDV-infected dogs might

account for an inadequate antiviral immunity in affected dogs (Gröne et al. 1998).

Similarly, in experimental CDV-infection of ferrets, early infection (3 days post infection)

is characterized by a lack of significant cytokine responses, probably as a consequence

of virus-mediated immunosuppression (Svitek and von Messling, 2007). Interestingly, in

the same animal model, as reported in MV-infected children, with disease progression a

switch from Th1 to Th2 cytokine responses was observed (Svitek and von Messling,

2007). Referring to this, prolonged IL-10 expression of peripheral leukocytes is

supposed to cause long lasting immune alterations in measles patients (Svitek and von

Messling, 2007). However, so far, cytokine responses in lymphoid organs of CDV-

infected dogs have not been investigated.

2.2 Dendritic cells

The term DCs referred to a heterogeneous group of multifunctional leukocytes (Bodey

et al. 1997). They represent the most potent antigen-presenting cell (APC) population.

So far, no other functions of DCs then antigen presentation and regulation of immune

responses are known (Steinman, 2007). They serve as sentinels of the immune system

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Steinman%20RM%22%5BAuthor%5D

17


and initiate immune responses (Banchereau et al. 2000). DCs exist in at least two

states, the immature and mature stage (Banchereau et al. 2000). They are found in

various tissues, such as skin, lymphoid organs, airways and intestinal tract. The cells

are able to capture and process antigens, migrate to T cell areas of lymphoid organs

and present antigens on their cell surface via MHC molecules. The antigen uptake by

DCs is conducted by receptor-mediated endocytosis and phagocytosis using different

receptors such as Fc-receptors, lectin receptors, macrophage mannose receptors,

ICAM-3, and toll-like receptors (Bhardwaj, 2003). Following antigen uptake, DCs

undergo a process of maturation and migrate to the draining lymph node. After

recognition of the antigen by T cells, Th1 or Th2 immune responses are initiated. The

polarization of T cells depends on co-stimulatory molecules and cytokine expression of

the DC (Macatonia et al. 1995, Bhardwaj, 2003). DCs have a unique ability to present

antigens from non-replicating viruses to CD8+ T cells (Smed-Sörensen et al. 2012). In

comparison of other APCs (e.g. macrophages or B cells), DCs have a 1000 fold higher

efficiency to activate resting T cells, which demonstrates the pivotal role of DCs for the

initiation of adaptive immune responses against infectious agents (Klagge and

Schneider-Schaulies, 1999; Bhardwaj, 2003). In addition to antigen recognition by T cell

receptors, interaction between CD28 on the T cell surface with co-stimulatory molecules

on DCs is required for optimal T cell activation (Björck et al. 1997; Weis and Wardrop,

2010). Although all DCs share a common ability to process and induce immune

responses indirectly by activating T cells, they differ by the expression of surface

markers, localization and cytokine production (Wu and Liu, 2007). A deregulation of DC

function is involved in immune-mediated tissue damage and immunosuppression in

human and veterinary medicine such as histocytic tumours, leischmaniasis, atopic

dermatitis, inflammatory bowel disease (Vanloubbeeck et al. 2003; Moore, 2008;

Cerquetella et al. 2010; Ricklin et al. 2010; Silva et al. 2012).

18


2.2.1 Dendritic cells in dogs

Similar to other species, canine DCs generated in vitro are non-adherent cells with

characteristic cytoplasmic projections (dendrites). They form clusters in culture and

have the ability to induce mixed leukocyte reactions (Goodel et al., 1985). So far, two

subsets of DCs, myeloid and lymphoid lineage DCs (Fig.4), have been recognized in

dogs. Myeloid DCs express MHC II, CD34 and CD14 and derive from monocyte and

bone marrow cells, while lymphoid DCs are MHC II+, CD34+ and CD14- (Tizard, 2009).

Canine DCs can be generated in vitro from CD14+ peripheral blood mononuclear cells

(PBMC) and the bone marrow by separation of CD34+ progenitor cells. As in humans

and mice, differentiation of precursor cells into DCs is induced by stimulation with

different cytokines, such as recombinant GM-CSF and IL-4 (Hägglund et al. 2000;

Ibisch et al. 2005; Bonnefont-Rebeix et al. 2006; Wijewardana et al. 2006; Wang et al.

2007a,b; Bund et al. 2010; Sugiura et al. 2010; Mielcarek et al. 2011; Fitting et al.

2011).

Canine DCs show an abundant formation of the Golgi apparatus and endoplasmic

reticulum but lack large lysosomal organelles (Ibisch et al. 2005). A unique

ultrastructural feature of canine DCs is the presence of periodical microstructures in the

cytoplasm (Ibisch et al. 2005; Isotani et al. 2006). Additionally, in contrast to human and

mouse Langerhans cells canine Langerhans cells lack classical Birbeck granules

(Moore et al. 1996). Canine moDCs express CD14 which contrast with human and

murine moDCs (moDCs; Ibisch et al. 2005; Wijewardana et al. 2006; Ricklin Gutzwiller

et al. 2010). CD14 expression of bone marrow-derived DCs (bmDCs) is under debate

(Hägglund et al. 2000; Weber et al. 2003; Ricklin Gutzwiller et al. 2010).

Compared to monocytes and macrophages canine moDCs and bmDCs show high

expression levels of MHC II, CD1a, and CD40, as well as of the co-stimulatory

molecules CD80 and CD86 (Ibisch et al. 2005; Bonnefont-Rebeix et al. 2006; Wang et

al. 2007a; Ricklin Gutzwiller et al. 2010; Sugiura et al. 2010). Phenotypical analyses

also enable the discrimination between canine bmDCs and moDCs (Ricklin Gutzwiller et

al. 2010).

19


Figure 4. Dendritic cell (DC) lineages of dogs. Two DC lineages have been identified in dogs: the

myeloid and lymphoid lineage. The myeloid lineage consists of three different subsets which differ in

localization, function and phenotype (Langerhans cells, bone marrow derived DCs and monocyte derived

DCs). Plasmacytoid DCs originate from the lymphoid lineage.

Canine Langerhans cells express CD1c, CD11c, CD80, MHC II and E-cadherin in situ,

which parallels the surface molecule expression pattern of human cells. However, in

contrast to humans, canine Langerhans cells lack S100, ATPase and ICAM-1 (Moore et

al. 1996; Zaba et al. 2009; Baines et al. 2008; Ricklin-Gutzwiller et al. 2010). Different

subsets of canine DCs exhibit differences in the ability to induce mixed leukocyte

reactions and cytokine expression (Andrea et al. 1995; Syme et al. 2005; Wang et al.

2007b; Ricklin Gutzwiller et al. 2010).

Understanding species-specific properties of canine DCs is pivotal for future studies

upon the role of this cell type in infectious disorders.

20


2.2.2 Dendritic cells in viral diseases

The immune response to viruses is a complex interplay between the pathogen and

innate and adaptive immune responses which aims to eradicate the infectious agent

with minimal damage to the host (Lambotin et al. 2010). The interaction between

different viruses and DCs includes the alteration of DC functions, such as endocytosis,

vesicle trafficking, immunological synapse formation, apoptosis induction and cytokine

production (Harman et al. 2006; Cunningham et al. 2010). Virus infection of DCs can

lead to a productive infection and subsequent release of infectious particles, as

observed for human immunodeficiency virus (HIV), MV, Epstein-Barr virus, and human

cytomegalovirus (Li et al. 2002; Beck et al. 2003; Donaghy et al. 2003; Schneider-

Schaulies et al. 2003; Rinaldo and Piazza, 2004). Alternatively, virus particles can be

transferred from DCs directly to other cell types, as observed for HIV infection (Rinaldo

and Piazza, 2004). As demonstrated in murine models for Sendai virus-, Moloney

leukemia virus-, herpes simplex virus-, and influenza virus-infection, DC-mediated

priming of the immune response leads to viral elimination (Kast et al. 1998; Hengel et al.

1987; Nonacs et al. 1992; Klagge and Schneider-Schaulies, 1999). For instance, in

influenza virus infection, virus antigen can be found on all APCs, but only DCs are able

to induce effective immune responses (Hamilton-Easton and Eichelberger, 1995;

Klagge and Schneider-Schaulies, 1999). In contrast to macrophages, influenza virus-

infected DCs do not undergo rapid cell death. Interestingly, influenza virus-infected

monocytes are unable to differentiate into DCs, which leads to the assumption that

virus-mediated DC inhibition might account for an impairment of virus-specific immunity

(Boliar and Chambers, 2010). In addition, several other viruses that cause persistent

infection, such as human cytomegalovirus, murine cytomegalovirus and Epstein-Barr

virus are able to manipulate DCs, which leads to inadequate protective immune

responses (Rinaldo and Piazza, 2004).

Herpes simplex virus infection of DCs leads to productive infection with down-regulation

of the co-stimulatory molecules CD80, CD86 and CD40, but not of MHC I and MHC II,

21


which suggests that herpes simplex virus proteins target signal transduction pathways

that control the expression of co-stimulatory molecules (Mikloska et al. 2001). HIV has

been demonstrated to interact with DCs and modulate their function, which represents a

prototypical model of DC-virus interaction (Rinaldo and Piazza, 2004). DCs are

supposed to be the early targets of HIV and by the ability to cluster T cells they can

spread the virus within the host (Klagge and Schneider-Schaulies, 1999). In addition, in

advanced stages of HIV infection, DCs become the virus reservoir and therefore

contribute to virus persistence. Once the DCs incorporate the HIV, they transport the

virus to the draining lymph node to induce an immune response (Klagge and Schneider-

Schaulies, 1999). Subsequently, DCs undergo a killing process due to feedback

mechanisms that remove APCs after stimulation of T cell responses. Interestingly, only

immature DCs can get infected, while mature DCs do not support the replication of HIV

(Knight et al. 1997; Klagge and Schneider-Schaulies, 1999).

Previously it was shown that during MV infection epithelial cells of the upper respiratory

tract are the first cells to be infected (Esolen et al. 1993). Since epithelial cells express

only CD46, which is a receptor only for attenuated MV-strains, and lymphocytes, which

are one of the most affected cells in measles, are not present in large numbers in

respiratory epithelium, it was concluded that other cells might account for early MV entry

(Tatsuo et al. 2000; de Swart et al. 2007; de Witte et al. 2008). Moreover,

undifferentiated monocytes, which express CD46, are relatively resistant to MV

replication (Fugier-Vivier et al. 1997). CD150, which is necessary for virus entry, is

expressed in T cells, B cells, macrophages, and DCs (de Swart et al. 2007). In vivo

infection of DCs has been described in animal experiments using cotton rats, transgenic

mice and macaques. (de Swart et al. 2007) Thus, infection of DCs of the respiratory

tract and subsequent migration of these cells to draining lymph nodes is supposed to

contribute to virus spread in the organism. Furthermore, dysfunction of DCs following

MV infection is supposed to represent one of the factors for long lasting and profound

immune suppression in measles patients.(Servet-Delprat et al. 2000) However, DC

22


infection in human patients has not been confirmed until now (Hahm et al. 2005; de

Swart et al. 2007; Griffin, 2010).

Different studies have demonstrated MV infection of different subtypes of myeloid DCs

in vitro (Fugier-Vivier et al. 1997; Murabayashi et al. 2002; Ohgimoto et al. 2007). Here,

the increased susceptibility of mature DCs for MV infection is in part a consequence of

higher CD150 expression levels (Klagge et al. 2004). The H protein of MV determines

the tropism for moDCs. The induction of syncytia formation of infected DCs is a

characteristic feature of MV wild type strains (Fugier-Vivier et al. 1997; Murabayashi et

al. 2002; Griffin 2010), while vaccine strains can indeed infect and replicate in DCs,

although only small amounts of infectious virus are produced due to an instability of the

M protein (Ohgimoto et al. 2007; Griffin 2010). Interference of MV with APCs represents

an important cause for immunosuppression. During MV infection of cultured immature

DCs, infected and non-infected cell undergo a maturation process (Zilliox et al. 2006).

This maturation is associated with an up-regulation of CD40, CD80, CD86 and MHC II,

while CD1a and CD34 are down-regulated (Fig. 5) (Schnorr et al. 1997; Servet-Delprat

et al., 2000; Zilliox et al. 2006).

The infection also results in rapid production of type I interferon (IFN) which also

contributes to DC maturation, but without the ability to prevent viral spread (Schneider-

Schaulies et al. 2002;Schneider-Schaulies and Meulen, 2002; Zilliox et al. 2006).

Moreover, in murine models, MV infection impairs the differentiation of DCs in vivo,

characterized by a down-regulation of co-stimulatory molecules, MHC class I and MHC

II (Oldstone et al. 1999; Hahm et al. 2005; Trifilo et al. 2006). In addition to the

modulation of antigen presenting function of DCs, MV infection suppresses the

production of IL-12 (Fugier-Vivier et al. 1997). Impairment of IL-12 expression in MV-

infected DCs coincides with a high percentage of apoptotic DCs and inhibition of CD40

signalling (Fugier-Vivier et al. 1997; Servet-Delprat et al. 2000). Inhibition of IL-12

secretion can be observed with disease progression predominantly in the late stage of

the disease, which might lead to insufficient Th1 immune responses in measles patients

(Schneider-Schaulies et al. 2002)

23


Figure 5. Proposed mechanisms of interaction between measles virus (MV) and dendritic cells

(DC). MV induces maturation of DCs, characterized by an up-regulation of co-stimulatory molecules

(CD80/86), CD40 and MHC II, while impairing the production of IL-12 and T cell stimulatory ability.

Modified from Kerdiles et al. (2006).

2.3 Regulatory T cells

Immune homeostasis is mainly regulated by Treg (Vignali et al. 2009). Treg are

essential for maintaining immune tolerance and therefore prevent autoimmune diseases

and limit chronic inflammatory processes (Vignali et al. 2009). Expression of the

forkhead-winged helix transcription factor Foxp3 regulates the transcription of genes

involved in immune modulation and represents a Treg-specific marker molecule

(Brunkow et al. 2001; Hori et al. 2003; Biller et al. 2007; Feuerer et al. 2009).

Additionally Treg are characterized by the expression of CD25, CTLA-4, and GITR

(Zheng and Rudensky, 2007). Foxp3+ Treg use the αβ T cell antigen receptor (TCR) for

antigen recognition and have a broad TCR repertoire (Feuerer et al. 2009; Relland et al.

24


2012). So far, two main sources of Tregs have been described: thymic Foxp3+ Treg

generated in the thymus (natural Treg) and Treg which are induced in the periphery by

different T cell derived factors (adaptive Treg; Mills 2004; Feuerer et al. 2009; Miyara

and Sakaguchi, 2007). For example, adaptive Tregs can originate from CD4+ effector T

cells due to IL-2 and TGF-β stimulation. These T cells, although unstable, show an

expression of Foxp3 and immunosuppressive properties (Chen et al. 2003; Fantini et al.

2004; Floess et al. 2007; Feuerer et al. 2010). Immature and mature DCs have the

ability to induce proliferation of Treg in vitro and in vivo (Yamazaki et al. 2007). In the

CNS, activated microglia and DCs have the ability to attract thymic Treg via the

production of CCL22, which interacts with CCR4 on Treg (Vulcano et al. 2001; Kipnis et

al. 2004).

Treg can also be induced under inflammatory conditions by astrocytes and neurons

(Lowther and Hafler, 2012). A novel population of natural Treg has recently been

identified in the peripheral blood of human beings. These cells express CD4 or CD8 but

lack Foxp3-expression (Feger et al. 2007; Zozulya and Wiendl, 2008).

Several mechanisms are involved in Treg-mediated immunosuppression, which can be

grouped as suppression by cytokines, suppression by cytolysis, suppression by

metabolic disruption, and suppression by the modulation of DC function (Fig. 6) (Vignali

et al. 2009; Miyara and Sakaguchi, 2007). Treg can inhibit the proliferation and function

of Natual Killer T cells, CD4+ T cells, CD8+ T cells, and B cells, as well as the maturation

and antigen presenting capacity of DCs (Piccirillo and Shevach, 2001; Azuma et al.

2003; Misra et al. 2004; Lim et al. 2005). A major function of Treg is to respond to

signals associated with tissue destruction and to minimize collateral tissue damage

(Belkaid and Rouse, 2005). Treg are involved in gastrointestinal immune homeostasis,

as demonstrated in mouse colitis models (Belkaid and Rouse, 2005). Similar beneficial

effects have been observed in mouse models of Leishmania major infection (Aseffa et

al. 2002; Liu et al. 2003; Belkaid and Rouse, 2005; Rai et al. 2012). Here, the disease

severity is enhanced in the absence of Treg, while application of CD4+CD25+ Treg

reverses pathological lesions (Liu et al. 2003; Rai et al. 2012)

25


Figure 6. Schematic diagram of mechanisms involved in regulatory T cell (Treg)-mediated

immunosuppression. Treg-mediated mechanisms of immunosuppression can be grouped in the

following categories: (i) suppression of immune responses by inhibitory cytokines (IL-10, IL-35 and TGF-

β); (ii) cytolysis by the release of granzymes (Grz); (iii) metabolic disruption by cytokine deprivation via IL-

2 receptor α (CD25) with subsequent lymphocyte apoptosis, cyclic AMP-mediated inhibition, or

CD39/CD73 and adenosine receptor (A2A)-mediated immunosuppression; (iv) modulation of dendritic

cells (DC) by down-regulation of MHC II and CD80/86 which leads to a reduced antigen presenting

capacity as well as via cytotoxic T lymphocyte antigen-4 (CTLA4)–CD80/CD86-mediated induction of

indoleamine 2,3-dioxygenase (IDO) which is a potent immunosuppressive molecule. Modified from

Vignali et al. (2008) and Miyara and Sakaguchi, (2007).

26


2.3.1 Regulatory T cells in viral diseases

Immunologic self tolerance is critical for the prevention of autoimmunity and

maintenance of immune homeostasis in the CNS (Valencia et al. 2006). However, the

role of Treg during different infectious diseases remains dubious, since both beneficial

(reduction of immune mediated tissue damage) and detrimental effects (reduction of

protective immune responses) of Treg have been described in infectious disorders (Fig.

7; Lund et al. 2008; Göbel et al. 2012; Herder et al., 2012)

In contrast to this, Treg exhibit beneficial effects by reducing bystander tissue damage

in the CNS during the acute phase of coronavirus infection of mice (Cecere et al. 2012).

For instance, depletion of Treg increases the mortality of mice infected with in

neurotropic mouse hepatitis virus, while the adoptive transfer of Tregs increases the

rate of survival in infected animals (Anghelina et al. 2009). The clinical outcome of

coronavirus-induced encephalitis depends on the balance between pro-inflammatory

modalities required for virus clearance and anti-inflammatory factors to prevent

deleterious immune responses (Anghelina et al. 2009). Treg-mediated

immunosuppresion in coronavirus-infected mice is associated with the production of

TGF-β or IL-35 (Anghelina et al. 2009; Vignali et al. 2009).

Figure 7. Dualism of regulatory T cells (Treg) in virus infection. With increasing immune responses

during the disease course the number of Treg increases in the inflamed tissue in order to limit excessive

inflammation and tissue damage. The suppressive function of Treg also reduces protective immune

responses which favors virus persistence and probably enhances immunopathology in the chronic

disease phase. Modified from Belkaid and Rouse, (2005).

27


In persistent viral infection (e.g. HIV), where an equilibrium between viral proliferation

and the immune response is established, viral removal becomes difficult, which leads to

life threatening diseases (Dittmer et al. 2004). Induction and/or expansion of Treg cells

by viruses is a highly efficient strategy to prevent effector T cell activation (Mills, 2004;

Schneider-Schaulies and Dittmer, 2006). The role of Treg in MV infection is under

debate, since differing findings have observed in animal experiments and human

patients (Yu et al. 2008; Li et al. 2008; Sellin et al. 2009). Probably the interplay

between the immunoregulatory and effector response during MV infection could be

critical for pathogenesis, and the adequate balance between these two arms of

immunity may play an essential role for the disease outcome (Sellin et al. 2009).

29

Chapter 3: Regulatory T cells in CDV infection

3 Chapter 3: Regulatory T cells in canine distemper

virus infection

Depletion of Foxp3+ regulatory T cells as a putative prerequisite for

lesion initiation in canine distemper virus induced demyelinating

leukoencephalitis

Visar Qeska1,2*, Yvonne Barthel1*, Maximilian Iseringhausen1*, Andrea Tipold2,3,

Veronika M. Stein3, Wolfgang Baumgärtner1,2, Andreas Beineke1,

1Department of Pathology, University of Veterinary Medicine Hannover, Bünteweg 17,

D-30559 Hannover, Germany

2Center for Systems Neuroscience, Hannover, Germany

3Department of Small Animal Medicine and Surgery, University of Veterinary Medicine

Hannover, Bünteweg 9, D-30559 Hannover, Germany.

*Authors have contributed equally

Corresponding author:

Prof. Dr. Andreas Beineke

Department of Pathology, University of Veterinary Medicine Hannover

[email protected]

Vet. Res. 2013, submitted

mailto:[email protected]

30


Abstract

Canine distemper virus (CDV) infection causes demyelinating leukoencephalitis in dogs,

sharing similarities with human myelin disorders and is therefore appreciated as a

translational animal model for multiple sclerosis (MS). In viral neurological diseases, an

ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing

immunopathology and detrimental effects by inhibiting antiviral immunity, has been

described. However, the role of Treg in the pathogenesis of canine distemper has not

been investigated yet. The aim of the present study was to testify the hypothesis that

peripheral lymphoid depletion influences immunomodulatory mechanisms in the brain of

CDV-infected dogs. Immunohistochemistry revealed a lack of Foxp3+ Treg in

predemyelinating and early demyelinating lesions which was associated with the

accumulation of CD3+ T cells, L1+ macrophages/microglia and GFAP+ astrocytes.

Together with CD79α+ B cells, a delayed infiltration of Foxp3+ Treg was observed in

chronic demyelinating lesions. Splenic depletion of Foxp3+ Treg was associated with an

increased mRNA-expression of tumor necrosis factor in the acute disease phase,

indicative of a pro-inflammatory microenvironment and lack of immunological counter

regulation in peripheral lymphoid organs. In conclusion, disturbed immune regulatory

mechanisms represent a potential cause for excessive neuroinflammation and early

lesion development in canine distemper leukoencephalitis, as discussed for immune

mediated myelin disorders such as MS.

Introduction

Distemper in dogs is caused by the canine distemper virus (CDV), a morbillivirus which

is closely related to the human measles virus [1–3]. The disease course and

pathogenesis of canine distemper are similar to human measles, including fever, rash,

respiratory signs, lymphopenia, and profound immunosuppression with generalized

31


depletion of lymphoid organs during the acute disease phase [4–6]. Central nervous

system (CNS) infection and neurological complications can be observed more

frequently in infected dogs compared to measles patients, usually affecting children [7–

9]. Depending on CDV strain, host immune status, and age, naturally infected dogs

develop demyelinating leukoencephalomyelitis, which shares similarities with human

myelin disorders, such as multiple sclerosis (MS) as well as measles virus associated

post-infectious encephalomyelitis and subacute sclerosing panencephalitis [2,10,11].

Regulatory T cells (Treg), characterized by expression of the transcription factor

forkhead box P3 (Foxp3), play a key role in the maintenance of immunological tolerance

and therefore prevent autoimmune CNS disease [12–17]. However, in infectious CNS

diseases Treg exhibit both beneficial effects by reducing immune mediated tissue

damage and detrimental effects due to their immunosuppressive properties, causing

disease exacerbation or persistence, respectively [18,19]. For instance, Treg reduce

antiviral immunity in experimental Theiler’s murine encephalomyelitis [20,21], a rodent

model for demyelinating disorders as well as in Friend retrovirus mouse model [22] and

experimental herpesvirus infection of mice [23,24]. However, the impact of Treg upon

morbillivirus-induced immunological alterations during early infection and CNS

manifestation remains enigmatic [25], since reports that Treg are increased in measles

patients [26,27] have been contradicted by others [28]. Moreover, different rodent

models for measles virus infection came to ambiguous conclusions regarding Treg-

related effects upon immune responses, probably attributed to disease course-

dependant effects or mouse strain-specific responses to virus infection [5,29–31]. Thus,

in addition to rodent models, there is an increasing interest in spontaneous and

experimental canine diseases as translational large animal models for human CNS

disorders [32–34].

Demyelination in canine distemper represents a biphasic process with directly virus

induced neurodegeneration, microglial activation and CD8-mediated cytotoxicity during

the early phase [35–37]. In comparison, during the chronic phase, reconstitution of

http://en.wikipedia.org/wiki/Fork_head_domain

32


peripheral lymphoid organs facilitates immune mediated mechanisms with delayed type

hypersensitivity and progressive myelin loss in the CNS of CDV-infected dogs [4,38,39].

A proinflammatory cytokine environment in the brain during acute CDV-infection is

indicative of insufficient counter regulatory mechanisms, potentially causing early

immune over-activation and initial tissue damage in the brain [40–43]. Similarly,

expression of neuroprotective and Treg-specific cytokines such as IL-10 and TGF-β is

insufficient in canine spinal cord injury, leading to an activation of CNS resident immune

cells [44]. Similar to the mechanisms in demyelinating leukoencephalomyelitis in CDV-

infection, an early stimulation of microglia and lack of immunoregulation is discussed as

a requirement for myelin damage in MS patients [45–48]. However, so far, the role of

immunomodulatory cells, especially Treg, in the pathogenesis of canine distemper has

not been investigated.

Since the initiation of inflammation in myelin disorders is influenced by an

immunological imbalance of the peripheral immune system [49–51], the aim of the

present study was to determine disease phase-dependant phenotypical changes and

cytokine expression in lymphoid organs in canine distemper. Special emphasis was

given to testify the hypothesis that peripheral depletion of Treg causes a lack of CNS-

infiltrating immunomodulatory cells in the predemyelinating phase of CDV infection,

which has the ability to enhance early neuroinflammation and represents a potential

prerequisite for immune mediated demyelination.

Materials and Methods

Animals and tissue selection

A total of 23 dogs of different breeds and age with spontaneous CDV-infection and five

control animals were selected for this study (Table 1). Animals were clinically examined

at the Small Animal Clinic of the University of Veterinary Medicine Hannover (Germany)

and sacrificed by by an overdose of pentobarbital (100 mg/kg intravenously) on the

33


owner’s request due to worsening of clinical signs related to CDV-infection, such as

neurological (seizures), respiratory (coughing, sneezing) and intestinal signs (diarrhea),

respectively, and poor prognosis. Infected dogs which died spontaneously as a

consequence of systemic distemper, showed seizures prior to death and were directly

submitted to necropsy by pet owners (animals 16, 17, 21, 27; Table 1). Main

pathological findings in the brain and extra-neuronal tissues of affected animals are

listed in table 1. All dogs were examined for research purposes at the Department of

Pathology of the University of Veterinary Medicine Hannover (Germany) with the

permission by the owners. Five non-infected healthy animals (beagles) without

neurological signs were obtained from an animal experiment performed at the Institute

for Parasitology of the University of Veterinary Medicine Hannover, which was approved

and authorized by the local authorities (Niedersächsisches Landesamt für

Verbraucherschutz- und Lebensmittelsicherheit (LAVES), Oldenburg, Germany,

permission number 08A580) and used as controls (Table1).

Infected animals were grouped according to the most advanced and dominating brain

lesion (SI-SIII, see below). For morphological and phenotypical characterization,

paraffin embedded spleen tissue was available from all CDV-infected and control

animals. Out of these, immunohistochemical analyses of paraffin embedded brain tissue

were performed in 15 CDV-infected and 5 control dogs. For cytokine expression

analyses by reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR),

frozen spleen tissue was available from 11 CDV-infected and five control dogs (Table

1).

Histology and phenotyping

Paraffin embedded tissue slices (4μm thickness) from the spleen and brain were

stained with hematoxylin and eosin (HE) for morphological examination. The brain

tissue was additionally stained with luxol fast blue (LFB) for detecting myelin loss and

myelinophagia (active demyelination). Antigen detection was performed by the avidin-

34


biotin-peroxidase complex method as previously described [35,52]. In brief, paraffin

embedded tissues were deparaffinized in Roticlear (Carl Roth GmbH, Karlsruhe,

Germany) and rehydrated through graded alcohols. Endogenous peroxidase activity

was suppressed with 0.5% H2O2 in methanol, followed by incubation with primary

antibody overnight at 4°C. Specificity controls included substitution of the respective

monoclonal antibody with ascitic fluid from nonimmunized BALB/cJ mice or rabbit

normal serum and in the case of the anti-Foxp3 antibody, a rat immunoglobulin isotype

control, was used. Spleen tissue of a healthy dog was used as positive control for the

detection of lymphoid cells. Except for the lectin BS-1, incubation with primary

antibodies was followed by incubation with biotinylated secondary antibodies for 30

minutes at room temperature. Subsequently, the avidin-biotin-peroxidase complex

(VECTASTAIN Elite ABC Kit; Vector Laboratories, PK 6100, Burlingame, CA) was

added and incubated for 30 minutes at room temperature. Antigen-antibody reactions

were visualized by incubation with 3,3’-diaminobenzidine-tetrahydrochloride-H2O2 in 0.1

mol/L imidazole, pH 7.1 for 5 minutes, followed by counterstaining with hematoxylin.

Histological evaluation and phenotypical characterization of white matter lesions

in the cerebellum

HE- and LFB-staining of white matter lesions of dogs suffering from CDV-infection and

of control dogs were evaluated morphologically by light microscopy. The cerebellar

white matter of 15 naturally infected dogs and five control dogs were examined and

lesions were classified as described by Wünschmann et al. (1999) with slight

modifications [37]. Briefly, groups were classified as acute non-inflammatory

encephalitis (SI), subacute non-inflammatory encephalitis (SII) and subacute to chronic

inflammatory encephalitis (SIII). Acute white matter lesions (SI) were characterized by

hypercellularity and vacuolization whereas SII and SIII lesions showed active

demyelination as demonstrated by decreased intralesional LFB-staining and the

presence of LFB+-myelinophages (gitter cells).

35


Table 1. Characteristics of dogs used in the study.

Dog no.

Brain lesion (group)

Age [month]

Sex Breed Main pathological findings in extra-neuronal tissues

1 Control

4.5 n.d. Beagle §†‡

None

2 Control 4.5

n.d. Beagle §†‡

None

3 Control 4.5


None

4 Control 4.5


None

5 Control 4.5


None

6 SI

3 ♀ mongrel §‡

Interstitial pneumonia, catarrhal enteritis

7 SI 72

♂ mongrel §†

Catarrhal rhinitis

8 SI 3

♂ mongrel §


9 SI 3.5

♀ Jack Russel Terrier §†‡


10 SI n.d.

♀ n.d. §†‡

n.d.

11 SI 2

♀ n.d. §†‡


12 SI

10 ♂ mongrel §‡

Interstitial pneumonia, catarrhal enteritis, catarrhal rhinitis

13 SI n.d.

♀ mongrel §†‡

n.d.

14 SII 7

♀ Husky §†‡

Interstitial pneumonia

15 SII 2

♀ Labrador Retriever §†‡


16 SII 3

♂ Shih Tzu §†‡


17 SII 5

♀ Chihuahua §†‡


18 SII 12

♀ Basset Hound §

Catarrhal enteritis

19 SII 4

♂ Mongrel §‡


20 SII 3

♀ Jack Russell Terrier §‡

None

21 SII 6

♂ mongrel §†‡


22 SIII 5

♀ mongrel §

n.d.

23 SIII 12

♀ mongrel §†‡


24 SIII 7

♂ mongrel §†‡


25 SIII 8

♀ Retriever §†

None

26 SIII 5.5

♂ German Shepherd Dog§†

n.d.

27 SIII 24

♀ mongrel §†

None

28 SIII 4

♀ Dachshund §†


36


n.d. = not determined; SI = acute non-inflammatory encephalitis; SII = subacute non-inflammatory encephalitis; SIII =

subacute to chronic inflammatory encephalitis; ♀ = female; ♂ = male; §paraffin embedded spleen tissue available;

†used for immunohistochemical analyses of brain tissue;

‡frozen spleen tissue available

While SII lesions were dominated by glial responses (microgliosis and astrogliosis)

without perivascular cuffing, SIII lesions displayed marked lymphohistiocytic infiltration

within the neuroparenchyma and perivascular spaces, indicative of an advanced

disease process. The control group (C) showed no histopathological alterations.

Immunohistochemistry and lectin histochemistry for quantifying inflammatory cell

infiltrations and glial responses in the brain were evaluated by using a morphometric

grid at a high power field resolution (number of cells/0.0625 mm²). The absolute number

of labeled cells was counted in white matter lesions (SI-SIII) and controls (C). Small

lesions were counted in total, otherwise a maximum of ten randomly distributed high

power fields within large lesions were counted [53].

Histological scoring of lymphoid depletion and characterization of

phenotypical changes in the splenic white pulp

The degree of lymphoid depletion in spleen sections of CDV-infected and control

animals, expressed as the cellularity score, was evaluated semi-quantitatively by light

microscopy as described by Wünschmann et al. (2000) [38]: 4 = normal architecture, 3

= mild, 2 = moderate, 1 = severe depletion. In a normal spleen (cellularity score 4; Fig.

S1A), the white pulp areas showed a regular architecture, with numerous primary and

secondary follicles. Mildly depleted spleens (cellularity score 3; Fig. S1B) were

characterized by a reduced size of primary follicles and loss of secondary follicles,

whereas marked reduction of the white pulp size and loss of secondary follicles were

indicative of moderate depletion (cellularity score 2; Fig. S1C). In severely depleted

spleens, the white pulp was no longer recognizable (cellularity score 1; Fig. S1D).

37


Table 2. List of markers used for immunohistochemistry and lectin histochemistry

Antibody

specificity Target Primary antibody

Pretreatment /

dilution

Secondary

antibody

CDV 3991 CDV-NP Monoclonal, mouse anti-CDV-NP

(C. Örvell, Stockholm, Sweden) None / 1:6000 GaM-b

CDV D110 CDV-NP Monoclonal, mouse anti-CDV-NP

(A. Zurbriggen, Bern, Switzerland)

Citrate buffer /

1:1000 GaM-b

CD3 T cells Polyclonal, rabbit anti-human

(A0452; Dako)

Citrate buffer /

1:1000 GaR-b

CD79α B cells Monoclonal, mouse anti-human

(HM57, Dako)

Citrate buffer /

1:60 GaM-b

Foxp3 Regulatory

T cells

Monoclonal, mouse anti-rat

(FJK-16s; eBioscience)

Citrate buffer /

1:10 RaRt-b

L1 Macrophages Monoclonal, mouse anti-human

(MAC387; Dako)

Citrate buffer /

1:200 GaM-b

MHC II APC Monoclonal, mouse anti-human

(TAL.1B5; Dako)

Citrate buffer /

1:80 GaM-b

GFAP Astrocytes Polyclonal, rabbit anti-bovine

(Z0334; Dako) None / 1:2000 GaR-b

BS-1 Microglia /

macrophages Lectin (L 3759; Sigma) None / 1:300 -

GaM-b, goat anti-mouse; GaR-b, goat anti-rabbit; RaRt-b, rabbit anti-rat; b, biotinylated; CDV-NP, canine

distemper virus-nucleocapsid protein; APC, antigen presenting cells; GFAP, glial fibrillary acidic protein;

BS-1, lectin from Bandeiraea simplicifolia.

The quantity of different cell subsets within the white pulp determined by leukocyte-

specific immunohistochemistry was evaluated semi-quantitatively (immunoreactivity

score) as described previously [38]. In brief, 10 randomly chosen areas of the white pulp

were counted in follicles, PALS and marginal zones. The immunoreactivity score was

38


determined as follows: 1 = 1-25% positive cells, 2 = 26-50% positive cells, 3 = 51-75%

positive cells, and 4 = 76-100% positive cells. The immunoreactivity index was

calculated by multiplying the cellularity score by the immunoreactivity score [38].

To determine virus load and distribution in splenic follicles, PALS and marginal zones by

CDV-specific immunohistochemistry, the following scale was used: 0 = no virus

detected, 1 = few infected cells, 2 = some infected cells, 3 = numerous infected cells; 4

= almost all cells infected [38].

Cytokine expression analysis by reverse transcriptase-quantitative

polymerase chain reaction

Primer design

Primers for the generation of standards and primers for measuring the quantity of

specific cytokines are listed in tables 2 and 3. PCR primer sequences for detecting

glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor-1α (EF-1α),

hypoxanthine-guanine phosphoribosyltransferase (HPRT), tumor necrosis factor (TNF),

transforming growth factor-β (TGF-β), interleukin (IL)-2, IL-6, IL-8, and IL-10 as well as

for CDV were taken from the literature [42,44,54–57]. Primers were designed using

Beacon Designer software version 2.1 (Premier Biosoft International, Palo Alto, CA) or

the primer-blasting tool of basic local alignment search tool (BLAST). All primers were

purchased from Eurofins MWG Operon (Ebersberg, Germany).

Nucleic acids isolation

Total RNA was isolated from spleens using the RNeasy Mini Kit (Qiagen) as previously

described [44,54]. For the generation of serial standards dilution, total RNA was

extracted from the canine macrophage cell line DH82 (for GAPDH, EF-1α, TGF-β, TNF,

IL-6, IL-8, and IL-10), persistently CDV-infected DH82 cells (for CDV and HPRT) and a

canine lymph node (for IL-2) using TRIZOL (Invitrogen). To isolate total RNA from

spleen tissue of CDV-infected dogs and control animals, 10 sections (thickness 25µm)

39


from frozen spleen tissue were cut on a cryostat (Microm, Heidelberg, Germany). Total

RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s

instructions. RNA concentrations were calculated by measuring the optical density at

260 nm (GeneQuantTM pro, Amersham Biosciences Europe GmbH, Freiburg, Germany).

Subsequently, total RNA was reversely transcribed to complementary DNA using the

Omniscript kit (Qiagen) with RNase Out (Invitrogen) and Random Primers (Promega,

Mannheim, Germany) following the manufacturers’ instructions

Polymerase chain reaction for the generation of standard dilutions

For the production of standards, PCR was performed using a Biometra TProfessional

basic thermocycler (Biometra GmbH, Göttingen Germany), as described before

[44,54,57]. Annealing temperature was adjusted to 50°C (IL-2), 56°C (HPRT), 57°C

(TGF-β), 58°C (TNF, IL-6), 59°C (GAPDH, IL-10, CDV), 60°C (EF-1α, IL-8) for two

minutes, and amplification was achieved using AmpliTaq DNA Polymerase (Applied

Biosystems, Carlsbad, CA) in 1 x GeneAmp PCR Buffer II (Applied Biosystems), with

1.25 mmol/L MgCl2, 0.2 mmol/L dNTP mix (Biosystems, Carlsbad, CA), and 300 nmol/L

of each primer. Polymerase chain reaction products of standards were subsequently

analyzed by agarose gel electrophoresis and extracted using NucleoSpin Extract II Kit

(Macherey-Nagel, Düren, Germany) for production of a standard dilution from 102 to 108

copies per microliter.

Reverse transcriptase-quantitative polymerase chain reaction

RT-qPCR and data analysis were performed using the Mx3005P QPCR System (Agilent

Technologies, Waldbronn, Germany) [44,54,57,58]. In addition to the standard dilution,

complementary DNA of spleen samples and negative controls were measured in

duplicate on the same run. Quantification was carried out in 25μl of Brilliant SYBR

Green qPCR Core Reagent Kit (Agilent Technologies). Amplification was performed

using 0.05 U/μl SureStart Taq DNA Polymerase in 1 x Core PCR buffer, with 2.5

mmol/L (CDV, GAPDH, TNF, IL-6, IL-10) or 5 mmol/L (EF-1a, HPRT, IL-2, IL-8, TGF-β)

MgCl2, 8.0% glycerol, 3% dimethyl sulfoxide (4% for TNF-α, IL-2), 150 nmol/L of each

40


primer (Table 4), 30 nmol/L Rox as reference dye, and 200 μmol/L dNTP mix.

Specificity of the products was assessed by melting curve analysis. Calculated copy

numbers of each gene were normalized to an amount of 100ng of transcribed RNA and

gene expression values were normalized against the three housekeeping genes,

GAPDH, EF-1α, and HPRT, using the software geNorm (Ghent University Hospital

Center for Medical Genetics; available at http://medgen.ugent.be/~jvdesomp/genorm/)

[59]. In brief, the software detects the most stable reference genes of which the

geometric means were used to calculate a normalization factor for the genes of interest.

Statistics

To determine distribution of data, a Shapiro-Wilk test and visualization assessment

were performed. If data were not normally distributed, non-parametrical tests (Mann-

Whitney U-test) were applied and data between two groups were compared. For

statistical analyses and graph development, SPSS software was used.

http://medgen.ugent.be/~jvdesomp/genorm/

41


Table 3. Gene expression analyzed by polymerase chain reaction

Gene / primer direction

Primer sequence Genebank accession no., position

GAPDH S1

AAGGTCGGAGTCAACGGATT AB038240, 7-26

GAPDH AS1

GCAGAAGAAGCAGAGATGATG AB038240, 371-351

EF-1α S1

AGCCCTTGCGCCTGCCTCTC X03558, 784-803

EF-1α AS1

CAGACACATTCTTGACATTGAAGC X03558, 1002-979

HPRT S 1

TAAAAGTAATTGGTGGAGAT CFU16661, 2-21

HPRT AS1

ATTATACTGCGCGACCAAG CFU16661, 123-105

IL-2 S3

ACCTCAACTCCTGCCACAAT D30710, 14-33

IL-2 AS3

GCACTTCCTCCAGGTTTTTG D30710, 302-283

IL-6 S1

TCTCCACAAGCGCCTTCTCC U12234, 68-87

IL-6 AS1

TTCTTGTCAAGCAGGTCTCC U12234, 385-366

IL-8 S 1

ACTTCCAAGCTGGCTGTTGC U10308, 10-29

IL-8 AS1

GGCCACTGTCAATCACTCTC U10308, 181-162

IL-10 S1

CCTGGGTTGCCAAGCCCTGTC U33843, 235-255

IL-10 AS1 ATGCGCTCTTCACCTGCTCC U33843, 446-427

TNF S 1

CCAAGTGACAAGCCAGTAGC Z70046, 32-51

TNF AS1 TCTTGATGGCAGAGAGTAGG Z70046, 305-286

TGF-β S1

AAGAAAAGTCCGCACAGCAT NM_001003309, 430-450

TGF-β AS1 CAGGCAGAAGTTAGCGTGGT NM_001003309, 1026-1006

CDV S2

ACAGGATTGCTGAGGACCTAT AF378705, 769-789

CDV AS2

CAAGATAACCATGTACGGTGC AF378705, 1055-1035

1 [44];

2 [54];

3 [57].

S = sense; AS = antisense; bp = base pair; EF-1α = elongation factor-1α; GAPDH =

glyceraldehyde-3-phosphate dehydrogenase; HPRT = hypoxanthine-guanine phosphoribosyltransferase;

IL = interleukin; TGF-β = transforming growth factor-β; TNF = tumor necrosis factor.

42


Table 4. . Gene expression analyzed by reverse transcriptase quantitative polymerase

chain reaction

Gene /

primer direction Primer sequence

Genebank accession no.,

position

GAPDH S1

GTCATCAACGGGAAGTCCATCTC AB038240, 196-218

GAPDH AS1

AACATACTCAGCACCAGCATCAC AB038240, 279-257

EF-1α S1

CAAAAACGACCCACCAATGG AY195837, 770-789

[EF-1α AS1

GGCCTGGATGGTTCAGGATA AY195837, 837-818

HPRT S 1

GAGATGACCTCTCAACTTTAACTGAAAA CFU16661, 17-44

HPRT AS1

GGGAAGCAAGGTTTGCATTG CFU16661, 105-86

IL-2 S2

CCAACTCTCCAGGATGCTCAC D30710, 196-216

IL-2 AS2

TCTGCTAGACATTGAAGGTGTGTGA D30710, 276-252

IL-6 S1

TGATGCCACTTCAAATAGTCTACCA U12234, 156-180

IL-6 AS1

TCAGTGCAGAGATTTTGCCGAGGA U12234, 244-221

IL-8 S1

AAGAACTGAGAGTGATTGAC D28772, 184-203

IL-8 AS1

TTTATACACTGGCATCGAA D28772, 149-130

IL-10 S1

GGTGGGAGCCAGCCGACACCAG U33843, 49-70

IL-10 AS1

AAGAAGATCTTCACCCACCCGAAGG U33843, 168-144

TNF S1

GGAGCTGACAGACAACCAGCTGA Z70046, 133-155

TNF AS1 GGAAGGGCACCCTTGGCCCT Z70046, 223-204

TGF-β S1

TGGCGCTACCTCAGCAACCG NM_001003309.1, 592-611

TGF-β AS1 AGCCCTCGACTTCCCCTCCA NM_001003309.1, 706-687

CDV S3

GCTCTTGGGTTGCATGAGTT AF378705, 954-973

CDV AS3

GCTGTTTCACCCATCTGTTG AF378705, 1036-1017

1 [44];

2 [54];

3 [57]. S = sense; AS = antisense; bp = base pair; EF-1α = elongation factor-1α; GAPDH =

glyceraldehyde-3-phosphate dehydrogenase; HPRT = hypoxanthine-guanine phosphoribosyltransferase;

IL = interleukin; TGF- β = transforming growth factor beta; TNF = tumor necrosis factor.

43


Results

Characterization of white matter lesions in the cerebellum of canine

distemper virus infected dogs

Detection of canine distemper virus in brain lesions

The CDV-NP was detected in all investigated cerebellar lesions by

immunohistochemistry. The virus amount was most prominent in SII lesions (Fig. 1). In

agreement with previous studies [37,53], with disease progression, the number of CDV-

infected cells significantly decreased in SIII lesions compared to non-inflammatory SII

lesions (p=0.019).

Results of statistical analyses (comparison between controls and infected animals) are

listed in table S1.

Phenotypical analyses of inflammatory responses in brain lesions

Progressive hypercellularity was observed in white matter lesions during the disease

course. According to the scheme described in material and methods, 28 brain lesions

were classified as acute non-inflammatory (SI; Fig. 2), 17 plaques as subacute non-

inflammatory (SII) and 25 plaques as subacute to chronic inflammatory (SIII; Fig. 2). A

significant infiltration of CD3+ T cells was found in all lesion types (SI-SIII), whereas a

significant number of infiltrating Foxp3+ cells was found only in advanced inflammatory

brain lesions (SIII; Fig. 3B), indicative of delayed infiltration of Treg. With the onset of

active demyelination (presence of LFB+ gitter cells) and perivascular lymphohistiocytic

inflammation in SIII lesions, the amount of CD3+ T cells significantly increased

compared to SI (p≤0.001) and SII lesions (p=0.006), respectively (Fig. 3A). Similar to

Foxp3+ Treg, CD79α+ B cells were found only in SIII lesions (Fig. 3C). As a

consequence of continuous leukocyte infiltration and glial activation, MHC II was

significantly up-regulated in all lesion types (SI-SIII) compared to control brains (Fig.

44


3D). In addition, a significantly elevated MHC II expression was found in SIII compared

to SI lesions (p=0.001). A similar kinetic was observed for BS-1+ macrophages/microglia

(Fig. 3E), while the number of GFAP+ astrocytes was only transiently significantly

increased in acute (SI) and subacute non-inflammatory lesions (SII) compared to the

controls.

Figure 1. Detection of canine distemper virus nucleoprotein (CDV-NP) in the cerebellum. The

number of infected cells significantly increases in acute and subacute non-inflammatory brain lesions (SI

and SII), followed by a significant decrease of infected cells in subacute to chronic inflammatory lesions

(SIII). = significant difference to control (C). = significant difference to SII.


listed in table S1.

Results demonstrate a virtual lack of Treg in predemyelinating lesions (SI) and early

demyelinating lesions (SII) during the acute and subacute phase of canine distemper

leukoencephalitis, which is in agreement with previous reports about dominating

proinflammatory properties of early infiltrating T cells and resident glial cells in canine

distemper leukoencephalitis [42]

45


46


Figure 2. Characterization of white mater lesions in canine distemper virus infected dogs. A) Mild

vacuolization and cellularity in acute white matter lesions (SI). A’) Increased perivascular and

parenchymal infiltration of immune cells in subacute to chronic demyelinating brain lesions (SIII);

hematoxylin and eosin (HE) staining. B) Low numbers of CD3+ T cells in early predemyelinating lesions.

B’) Prominent CD3+ T cells infiltrates in advanced inflammatory lesions, immunohistochemistry. C) Few

individual Foxp3+ regulatory T cells in SI lesions. C’) Increased Foxp3-expression in advanced

inflammatory brain lesions, immunohistochemistry. D) Few CD79α+ B cells in SI lesions. D’) Increased

influx of CD79α+ B cells in SIII lesions, immunohistochemistry. E) Early MHC II-upregulation of glial cells

in predemyelinating lesions. E’) Additional infiltration of MHC II+ leukocytes in advanced inflammatory

lesions, immunohistochemistry. F) Low numbers of BS-1+ macrophages/microglia in SI lesions. F’)

Significant increase of BS-1+ microglia and infiltrating BS-1

+ macrophages in SIII lesions, lectin

histochemistry. G) Early prominent increase of GFAP-expression in astrocytes in predemyelinating

lesions. G’) Loss of intralesional GFAP+ astrocytes in advanced lesions, immunohistochemistry. Scale

bars: A, A’, E, E’, F, F’, G, G’ = 200μm; B, B’, C, C’, D, D’ = 20μm

.

To testify the hypothesis that the delayed onset Treg infiltration in the brain is a

consequence of peripheral Treg depletion, phenotypical changes and the associated

cytokine expression in the spleen, as a lymphoid organ consistently affected in systemic

distemper, were investigated [38].

Characterization of immunological changes in the spleen of canine

distemper virus infected dogs

Detection of canine distemper virus in the spleen

The quantity and distribution of CDV protein in the spleen were determined by

immunohistochemistry. In addition, the amount of virus RNA was measured by RT-

qPCR. Similar to the brain, virus load in the spleen was highest during early infection

phases. Using immunohistochemistry, CDV-infected cells were found in animals with

early brain lesions (SI and SII) with most prominent virus expression in SII group

animals.

47


Figure 3. Phenotyping of white matter lesions in the cerebellum of canine distemper virus infected

dogs. A) CD3+ T cells show a significant increase in acute (SI) and subacute non-inflammatory lesions

(SII) compared to controls (C). Note prominent CD3-expression in subacute to chronic inflammatory

lesions (SIII). B) In comparison to CD3+ T cells, significant accumulations of CD79α

+ B cells and C)

Foxp3+ regulatory T cells are only observed in advanced inflammatory brain lesions (SIII). D) Continuous

increase of MHC II-expression and E) BS-1+ macrophages/microglia with disease progression F) GFAP

+

astrocytes are significantly increased in acute non-demyelinated lesions (SI) and subacute non-

inflammatory demyelinating lesions (SII), followed by a decrease in advanced demyelinating lesions (SIII).

= significant difference to controls (C). ▲ = significant difference to SI . = significant difference to SII.

With disease progression, in animals showing subacute to chronic demyelinating

lesions (SIII group animals), the virus load was significantly reduced and restricted

mainly to germinal centers. Results were confirmed by RT-qPCR, demonstrating that

virus RNA in the spleen was most abundant in dogs with SI and SII brain lesions (Fig.

4), while only small quantities of CDV-RNA were detected in animals with advanced

disease phases (SIII group animals).

48



listed in table S1.

Morphological evaluation and phenotypical characterization in the spleen

Lymphoid depletion, which was most prominent in the PALS and follicles, was found in

all infected animals (Fig. 5). In order to detect more subtle changes associated with

virus infection, phenotypical analyses were performed. As expected, CD3+ T cells in the

PALS and CD79α+ B cells in follicles were predominantly affected. The degree of CD3-

depletion in the PALS was identical in all stages (SI-SIII; Fig. 6A). Similarly, Foxp3+

Treg were significantly decreased in all groups (SI-SIII) compared to control spleens.

Figure 4. Detection of canine distemper virus (CDV) in the spleen by reverse transcriptase-

quantitative polymerase chain reaction. The amount of viral RNA in the spleen is elevated in animals

with acute (SI) and subacute non-inflammatory brain lesions (SII) compared to controls (C). In animals

with subacute to chronic inflammatory lesions (SIII) only small amounts of CDV-RNA are detected =

significant difference to controls (C).

However, in contrast to CD3+ T cells, Foxp3+ Treg were totally absent in the spleen of

SI and SIII group animals, and only very few individual Foxp3+ cells were observed in

SII group animals (Fig. 6B). Follicular CD79α+ B cells were significantly depleted in all

49


infected animals (SI-SIII) compared to controls. Suggestive of B cell repopulation, a

statistical tendency (p=0.054) of increased CD79α+ B cell numbers in the spleen of SIII

compared to SI group animals was observed (Fig. 6C). L1+ macrophages were

significantly depleted in the splenic marginal zone of SII group animals (Fig. 6D).

Associated with lymphoid depletion a reduced expression of MHC II in all compartments

of the white pulp (follicle, PALS and marginal zone) was detected in all CDV-infected

dogs. However, a significant increase of total MHC II+ cells in SIII group compared to

SII, was found in follicles (p=0.029; Fig. 6E), PALS (p=0.040; Fig. 6F) and marginal

zones (p=0.021; data not shown), indicative of partial repopulation of lymphoid organs in

advanced stages of canine distemper as previously described [38].


listed in table S1.

50


Figure 5. Phenotypical changes in the spleen of canine distemper virus infected dogs. Marked

lymphoid depletion in SII group animals is associated with a decrease of CD3+ T cells (A, A’) , Foxp3

+

regulatory T cells (B, B’), CD79α+ B cells (C, C’) , L1

+ macrophages (D, D’) and MHC II

+ antigen

presenting cells (E, E’). = central artery. F = follicle. P = PALS. MZ = marginal zone. Scale bars =

200μm.

51


Figure 6. Phenotypical changes in the spleen of canine distemper virus infected dogs. A) Depletion

of CD3+ T cells and B) Foxp3

+ regulatory cells in the periarteriolar lymphoid sheath (PALS) in infected

animals. C) Decrease of CD79α+ B cells in splenic follicles. Note statistical tendency (▲, p=0.054) of

increased CD79α+ B cell numbers in SIII group animals compared to SI group animals. D) Significant

drop of L1+ macrophages in marginal zones of SII group animals. E, F) MHC II

+ cells are depleted in the

spleen of infected dogs. Note significant increase of MHC II expression in follicles and PALS of SIII

animals, indicative of lymphoid repopulation. = significant difference to control (C). = significant

difference to SII group.

Cytokine expression in the spleen

Expression of IL-2 mRNA was significantly reduced in the spleen of SI and SII group

animals compared to control animals, as a presumed consequence of reduced T cell

function (Fig. 7A). Strikingly, despite reduced IL-2 transcription, gene expression of TNF

was significantly elevated in the spleen of SI and SII group dogs compared to controls

(Fig. 7B) indicative of peripheral M1 polarization of macrophages and/or Th1 biased

52


immune responses of residual lymphocytes. Gene expression of IL-6, IL-8, IL-10 and

TGF-β showed no statistical significant changes at different disease phases compared

to the controls.


listed in table S1.

Figure 7. Cytokine expression in the spleen of canine distemper virus infected animals. A)

Expression of interleukin (IL)-2 mRNA is significantly decreased in non-inflammatory stages (SI, SII)

compared to controls (C). B) Significantly increased tumor necrosis factor (TNF) mRNA expression in SI

group animals and statistical tendency (p=0.052) of cytokine expression in SII group animals. =

significant difference compared to control (C).

Discussion

The comparative analysis of immune responses in the brain and spleen demonstrates

the occurrence of a delayed CNS-infiltration of Treg in canine distemper, associated

with immune dysregulation in peripheral lymphoid organs. The paucity of functional Treg

is implicated in immune mediated demyelinating disorders, including experimental

autoimmune encephalomyelitis (EAE) and MS [60–62]. Thus, an inadequate immune

53


homeostasis as a consequence of Treg depletion is assumed to allow excessive glial

and T cell responses during the predemyelinating and early demyelinating phase of

CDV-induced leukoencephalitis as previously described [36,42].

Manipulation of Treg in the periphery has significant consequences for the fate of viral

infection in the brain. In agreement with the idea of a misbalanced CNS immune

response in canine distemper, insufficient expansion of peripheral Treg leads to strong

immunopathology in acute severe dengue fever and West Nile virus infection [63,64].

The protective role of Treg against an overwhelming immune response in the CNS also

becomes obvious in animal models of stroke and EAE [65,66] and in human

immunodeficiency virus-1-associated neurodegeneration, where they reduce

astrogliosis and microglia-mediated inflammation [67]. Furthermore, functional deficits

or reduced numbers of Treg are suspected to contribute to demyelination in acute MS

lesions [68]. Silencing of microglia by Treg is mediated by IL-4 which leads to reduced

production of toxic factors such as nitric oxide [69]. Moreover, interaction with Treg

induces a M2 phenotype of microglia/macrophages which exhibit immunomodulatory

properties and potentially promote regeneration in the injured CNS [70,71]. Accordingly,

the observed absence of CNS-infiltrating Treg is in agreement with the previous findings

of low anti-inflammatory cytokine expression [42] and release of myelinotoxic molecules

by microglia in early distemper brain lesions [43].

Interestingly, the increase of Foxp3+ Treg in the CNS during advanced stages of canine

distemper coincides with the persistent infection, which corresponds to findings in

experimental measles virus infection of mice [5,30]. Different explanations about the

origin of Treg in the brain during chronic CDV-infection have to be considered. Since

prominent depletion of Treg was observed in the spleen of chronically infected dogs,

brain infiltration might result from an accumulation of residual Treg in other peripheral

organs. In addition, it has been shown that the inflammatory environment critically

influences the balance of Treg versus effector T cell differentiation which might lead to

local induction and expansion of Foxp3+ Treg within the brain of CDV-infected animals.

54


For instance, virus-specific CD4+ T cells can acquire a Treg phenotype including Foxp3

expression in the CNS during mouse hepatitis virus infection [72]. Moreover, neurons

and activated astrocytes are able to induce Treg as a mechanism for decreasing

excessive inflammation and demyelination in EAE [73,74]. However, as observed in the

present study, Treg seem to be unable to terminate neuroinflammation in chronic

demyelinating lesions of CDV-infected dogs, indicative of an insufficient amount or

dysfunction of these cells. Comparably, large numbers of brain-infiltrating Treg are

present in EAE, but their function is impaired by the elevated expression of

proinflammatory molecules, such as IL-6 and TNF [85, 86]. As demonstrated in previous

studies, the presence of these cytokines in the cerebrospinal fluid is associated with

disease exacerbation in CDV-infected dogs [77]. Thus, it is tempting to speculate that

the pro-inflammatory milieu in the canine brain inhibits the neuroprotective efficacy of

Treg in advanced stages. Alternatively, in spite of a potential beneficial effect upon

immune mediated brain damage in chronic distemper, immunosuppression by Treg

might contribute to viral persistence triggering progressive myelin loss as observed in

coronavirus-induced demyelination of mice [78].

Similar to human measles, a striking feature of CDV-infection of dogs is a marked loss

of immune cells and impaired immune response which favors viral persistence in

lymphoid organs and CNS [4,38,79,80]. Lymphoid depletion in canine distemper is

induced by necrosis and apoptosis directly mediated by the virus as well as by virus

independent mechanisms, probably by an over-activation of the innate immune

response [79]. Accordingly, the observed increased TNF expression might enhance

splenic depletion by induction of lymphocyte apoptosis in acutely infected dogs.

Moreover, TNF has been shown to downregulate the suppressive function of Treg by

decreasing Foxp3 expression [81]. Thus, the pro-inflammatory microenvironment might

contribute to the observed depletion of Foxp3+ cells in the spleen and, in addition,

potentially foster Th1-biased immune responses and/or M1 polarization of macrophages

[82,83]. Such primed immune cells lead to antiviral immunity, but might also account for

55


early lesion development by promoting excessive neuroinflammation in canine

distemper [36,37,42].

As shown in previous studies, the low number of inflammatory cells in early non-

inflammatory CNS lesions coincided with the degree of peripheral lymphoid depletion,

whereas CNS-infiltration of inflammatory cells during the chronic demyelinating phase is

associated with reconstitution of lymphoid organs [38]. Partial repopulation in chronically

infected dogs in the present survey was demonstrated by an increase of MHC II+

lymphoid cells in splenic T and B cell areas, associated with a statistical trend of

elevated numbers of CD79α+ B cells in follicles. Following measles virus infection of

children, an early Th1 response is quickly succeeded by a prolonged Th2 or mixed

Th1/Th2 response [84]. Th2 cytokine predominance after resolution of measles rash

produces an environment favoring B cell maturation which facilitates humoral immunity

important for lifelong protection against reinfection, while depressing macrophage

activation and Th1 responses which are required for combating pathogens [85]. The

importance of a robust Th1 immunity for virus elimination has also been demonstrated

in CDV-infected ferrets, a model for morbillivirus-induced immunosuppression [86].

Taken together, B cell immunity and Th1/Th2 imbalance rather than mounting Treg

responses might contribute to prolonged immune alteration in canine distemper, which

contrasts with the currently discussed role of Treg in human measles [24,25]. However,

further studies of advanced disease stages are needed to depict further similarities and

differences between canine distemper and human measles.

Interestingly, according to the currently discussed role of B cells and antibodies in the

pathogenesis of demyelinating disorders [47,75,76] an increased intrathecal antibody

production is suspected to accelerate myelin destruction in chronic canine distemper

[89]. Thus, besides its impact on virus-specific immunity, observed reconstitution of

splenic B cells and recruitment of peripheral CD79α+ B cells to the brain might also

represent an initiator for CNS-restricted plasma cell differentiation and subsequent

myelin loss in dogs during the chronic distemper phase. Referring to this, a

56


compartmentalization of immune responses in the brain with local antigen presentation,

plasma cell formation and antibody production behind a closed blood brain barrier is

currently discussed for progressive MS [90,91].

In conclusion, for the first time the interplay between Treg in peripheral lymphoid tissue

and brain of CDV-infected dogs has been demonstrated. Results of the present study

are indicative of inadequate immunoregulation which represents a potential prerequisite

for early lesion development. As suggested for MS [75], the development of novel

therapies targeting Treg represent a promising strategy in canine CNS disorders.

However, further studies are needed to determine disease phase-specific and probably

ambiguous functions of Treg in the pathogenesis of canine distemper, which might also

have relevance for the understanding of human demyelinating diseases.

Acknowledgements

The authors would like to thank Danuta Waschke, Bettina Buck and Petra Grünig for

their excellent technical support during the laboratory work and Dr. Karl Rohn for

statistical analyses. This study was supported by the German Research Foundation

(FOR 1103, BA 815/10-2 and BE 4200/1-2).




57


References

1. Pringle CR (1999) Virus taxonomy at the XIth International Congress of Virology, Sydney,

Australia, 1999. Arch Virol 144: 2065–2070.

2. Sips GJ, Chesik D, Glazenburg L, Wilschut J, Keyser JD, et al. (2007) Involvement of

morbilliviruses in the pathogenesis of demyelinating disease. Rev Med Virol 17: 223–244.

3. Wyss-Fluehmann G, Zurbriggen A, Vandevelde M, Plattet P (2010) Canine distemper virus

persistence in demyelinating encephalitis by swift intracellular cell-to-cell spread in astrocytes is

controlled by the viral attachment protein. Acta Neuropathol 119: 617–630.

4. Beineke A, Puff C, Seehusen F, Baumgärtner W, (2009) Pathogenesis and immunopathology of

systemic and nervous canine distemper. Vet Immunol Immunopathol 127: 1–18.

5. Sellin CI, Jégou JF, Renneson J, Druelle J, Wild TF, et al. (2009) Interplay between virus-specific

effector response and Foxp3 regulatory T cells in measles virus immunopathogenesis. PloS one

4: e4948.

6. von Messling V, Svitek N, Cattaneo R (2006) Receptor (SLAM [CD150]) recognition and the V

protein sustain swift lymphocyte-based invasion of mucosal tissue and lymphatic organs by a

morbillivirus. J Virol 80: 6084–6092.

7. Confer AW, Kahn DE, Koestner A, Krakowka S (1975) Comparison of canine distemper viral

strains: an electron microscopic study. Am J Vet Res 36: 741–748.

8. Young VA, Rall GF (2009) Making it to the synapse: Measles virus spread in and among neurons.

Curr Top Microbiol Immunol 330: 3–30.

9. Summers A, Greisen AH, Appel GJM (1984) Canine Distemper Encephalomyelitis: Variation With

Virus Strain. J Comp Pathol 94: 65–75.

10. Ishizaki Y, Yukaya N, Kusuhara K, Kira R, Torisu H, et al. (2010) PD1 as a common candidate

susceptibility gene of subacute sclerosing panencephalitis. Hum Genet 127: 411–419.

11. Vandevelde M, Zurbriggen A (2005) Demyelination in canine distemper virus infection: a review.

Acta Neuropathol 109: 56–68.

12. Feuerer M, Hill JA, Kretschmer K, von Boehmer H, Mathis D, et al. (2010) Genomic definition of

multiple ex vivo regulatory T cell subphenotypes. Proc Natl Acad Sci U S A 107: 5919–5924.

13. Sakaguchi S, Ono M, Setoguchi R, Yagi H, Hori S, et al. (2006) Foxp3+ CD25+ CD4+ natural

regulatory T cells in dominant self-tolerance and autoimmune disease. Immunol Rev 212: 8–27.

14. Feuerer M, Hill JA, Mathis D, Benoist C, (2009) Foxp3+ regulatory T cells: differentiation,

specification, subphenotypes. Nat Immunol 10: 689–695.

15. MacDonald AJ, Duffy M, Brady MT, McKiernan S, Hall W, et al. (2002) CD4 T helper type 1 and

regulatory T cells induced against the same epitopes on the core protein in hepatitis C virus-

infected persons. J Infect Dis 185: 720–727.

58


16. Sakaguchi S (2003) Regulatory T cells: mediating compromises between host and parasite. Nat

Immunol 4: 10–11.

17. Vignali AAD, Collison WL, Workman JC (2009) How regulatory T cells work. Nat Rev Immunol 8:

523–532.

18. Lund MJ, Hsing L, Pham TT, Rudensky Y (2008) Coordination of Early Protective Immunity to

Viral Infection by Regulatory T Cells. Science 320: 1220–1224.

19. Göbel K, Bittner S, Melzer N, Pankratz S, Dreykluft A, et al. (2012) CD4(+) CD25(+) FoxP3(+)

regulatory T cells suppress cytotoxicity of CD8(+) effector T cells: implications for their capacity to

limit inflammatory central nervous system damage at the parenchymal level. J Neuroinflammation

9: 41.

20. Herder V, Hansmann F, Stangel M, Schaudien D, Rohn K, et al. (2012) Cuprizone inhibits

demyelinating leukomyelitis by reducing immune responses without virus exacerbation in an

infectious model of multiple sclerosis. J Neuroimmunol 244: 84–93.

21. Richards MH, Getts MT, Podojil JR, Jin Y, Kim S, et al. (2012) Virus Expanded Regulatory T

Cells Control Disease Severity in the Theiler’s Virus Mouse Model of MS. J Autoimmun 36: 142–

154.

22. Zelinskyy G, Dietze K, Sparwasser T, Dittmer U (2009) Regulatory T Cells Suppress Antiviral

Immune Responses and Increase Viral Loads during Acute Infection with a Lymphotropic

Retrovirus. PLoS Pathog 5: e1000406.

23. Toka FN, Suvas S, Rouse BT (2004) CD4+ CD25

+ T Cells Regulate Vaccine-Generated Primary

and Memory CD8+ T-Cell Responses against Herpes Simplex Virus Type 1. J Virol 78: 13082–

13089.

24. Fernandez MA, Puttur FK, Wang YM, Howden W, Alexander SI, et al. (2008) T Regulatory Cells

Contribute to the Attenuated Primary CD8+ and CD4+ T Cell Responses to Herpes Simplex Virus

Type 2 in Neonatal Mice. J Immunol 180: 1556–1564.

25. Aydin OF, Ichiyama T, Anlar B (2010) Serum and cerebrospinal fluid cytokine concentrations in

subacute sclerosing panencephalitis. Brain Dev 32: 463–466.

26. Yu X, Cheng Y, Shi B, Qian F, Qi T, et al. (2008) Measles Virus Infection in Adults Induces

Production of IL-10 and Is Associated with Increased CD4 + CD25 + Regulatory T Cells. J

Immunol 181 : 7356–7366.

27. Moss WJ, Ryon JJ, Monze M, Griffin DE (2002) Differential regulation of interleukin (IL)-4, IL-5,

and IL-10 during measles in Zambian children. J Infect Dis 186: 879–887.

28. Li MZ, Xu FD, Huang XH, Chen XC, Deng QW, et al. (2008) [Immunosuppression induced by

measles virus in adult patients is not related to CD4+ CD25+ regulatory T cell induction].

Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 22: 211–213.

59


29. Wu XM, Liao YW, Wang HY, Ji KQ, Li GF, et al. (2012) Integrin alphavbeta6 is involved in

measles protein-induced airway immune suppression. Cytokine 59: 59–64.

30. Reuter D, Sparwasser T, Hünig T, Schneider-Schaulies J (2012) Foxp3+ Regulatory T Cells

Control Persistence of Viral CNS Infection. PLoS ONE 7: e33989.

31. Koga R, Ohno S, Ikegame S, Yanagi Y (2010) Measles virus-induced immunosuppression in

SLAM knock-in mice. Journal of virology 84: 5360–5367.

32. Kling J (2007) Biotech for your companion? Nat Biotechnol 25: 1343–1345.

33. Paoloni M, Khanna C (2008) Translation of new cancer treatments from pet dogs to humans. Nat

Rev Cancer 8: 147–156.

34. Spitzbarth I, Baumgärtner W, Beineke A (2012) The role of pro- and anti-inflammatory cytokines

in the pathogenesis of spontaneous canine CNS diseases. Vet Immunol Immunopathol 147: 6–

24.

35. Alldinger S, Wünschmann A, Baumgärtner W, Voss C, Kremmer E (1996) Up-regulation of major

histocompatibility complex class II antigen expression in the central nervous system of dogs with

spontaneous canine distemper virus encephalitis. Acta Neuropathol 92: 273–280.

36. Tipold A, Moore P, Zurbriggen A, Burgener I, Barben G, et al. (1999) Early T cell response in the

central nervous system in canine distemper virus infection. Acta Neuropathol 97: 45–56.

37. Wünschmann A, Alldinger S, Kremmer E, Baumgärtner W (1999) Identification of CD4+ and

CD8+ T cell subsets and B cells in the brain of dogs with spontaneous acute, subacute-, and

chronic-demyelinating distemper encephalitis. Vet Immunol Immunopathol 67: 101–116.

38. Wünschmann A, Kremmer E, Baumgärtner W (2000) Phenotypical characterization of T and B

cell areas in lymphoid tissues of dogs with spontaneous distemper. Vet Immunol Immunopathol

73: 83–98.

39. Alldinger S, Baumgärtner W, Orvell C (1993) Restricted expression of viral surface proteins in

canine distemper encephalitis. Acta Neuropathol 85: 635–645.

40. Beineke A, Markus S, Borlak J, Thum T, Baumgärtner W (2008) Increase of pro-inflammatory

cytokine expression in non-demyelinating early cerebral lesions in nervous canine distemper.

Viral Immunol 21: 401–410.

41. Imbschweiler I, Seehusen F, Peck C-T, Omar M, Baumgärtner W, et al. (2012) Increased p75

neurotrophin receptor expression in the canine distemper virus model of multiple sclerosis

identifies aldynoglial Schwann cells that emerge in response to axonal damage. Glia 60: 358–

371.

42. Markus S (2002) Increased expression of pro-inflammatory cytokines and lack of up-regulation of

anti-inflammatory cytokines in early distemper CNS lesions. J Neuroimmunol 125: 30–41.

60


43. Stein VM, Czub M, Schreiner N, Moore PF, Vandevelde M, et al. (2004) Microglial cell activation

in demyelinating canine distemper lesions. J Neuroimmunol 153: 122–131.

44. Spitzbarth I, Bock P, Haist V, Stein VM, Tipold A, et al. (2011) Prominent microglial activation in

the early proinflammatory immune response in naturally occurring canine spinal cord injury. J

Neuropathol Exp Neurol 70: 703–714.

45. Gay FW, Drye TJ, Dick GW, Esiri MM (1997) The application of multifactorial cluster analysis in

the staging of plaques in early multiple sclerosis. Identification and characterization of the primary

demyelinating lesion. Brain 120 : 1461–1483.

46. Barnett MH, Prineas JW (2004) Relapsing and remitting multiple sclerosis: pathology of the newly

forming lesion. Ann Neurol 55: 458–468.

47. Barnett MH, Sutton I (2006) The pathology of multiple sclerosis: a paradigm shift. Curr Opin

Neurol 19: 242–247.

48. Marik C, Felts PA, Bauer J, Lassmann H, Smith KJ (2007) Lesion genesis in a subset of patients

with multiple sclerosis: a role for innate immunity? Brain 130: 2800–2815.

49. Navarrete-Talloni MJ, Kalkuhl A, Deschl U, Ulrich R, Kummerfeld M, et al. (2010) Transient

peripheral immune response and central nervous system leaky compartmentalization in a viral

model for multiple sclerosis. Brain Pathol 20: 890–901.

50. Tsunoda I, Libbey JE, Kuang L-Q, Terry EJ, Fujinami RS (2005) Massive apoptosis in lymphoid

organs in animal models for primary and secondary progressive multiple sclerosis. Am J Pathol

167: 1631–1646.

51. De Vos AF, van Riel DA, van Meurs M, Brok HPM, Boon L, et al. (2005) Severe T-cell depletion

from the PALS leads to altered spleen composition in common marmosets with experimental

autoimmune encephalomyelitis (EAE). J neuroimmunol 161: 29–39.

52. Gröters S, Alldinger S, Baumgärtner W (2005) Up-regulation of mRNA for matrix

metalloproteinases-9 and -14 in advanced lesions of demyelinating canine distemper

leukoencephalitis. Acta Neuropathol 110: 369–382.

53. Seehusen F, Orlando EA, Wewetzer K, Baumgärtner W (2007) Vimentin-positive astrocytes in

canine distemper: a target for canine distemper virus especially in chronic demyelinating lesions?

Acta Neuropathol 114: 597–608.

54. Puff C, Krudewig C, Imbschweiler I, Baumgärtner W, Alldinger S (2009) Influence of persistent

canine distemper virus infection on expression of RECK, matrix-metalloproteinases and their

inhibitors in a canine macrophage/monocytic tumour cell line (DH82). Vet J 182: 100–107.

55. von Smolinski D, Leverkoehne I, von Samson-Himmelstjerna G, Gruber AD (2005) Impact of

formalin-fixation and paraffin-embedding on the ratio between mRNA copy numbers of differently

expressed genes. Histochem Cell Biol 124: 177–188.

61


56. Matsumoto Y, Mohamed A, Onodera T, Kato H, Ohashi T, et al. (1994) Molecular cloning and

expression of canine interleukin 8 cDNA. Cytokine 6: 455–461.

57. Schwartz M, Puff C, Stein VM, Baumgärtner W, Tipold A (2011) Pathogenetic factors for

excessive IgA production: Th2-dominated immune response in canine steroid-responsive

meningitis-arteritis. Vet J 187: 260–266.

58. Schwartz M, Puff C, Stein VM, Baumgärtner W, Tipold A (2010) Marked MMP-2 transcriptional

up-regulation in mononuclear leukocytes invading the subarachnoidal space in aseptic

suppurative steroid-responsive meningitis-arteritis in dogs. Vet Immunol Immunopathol 133: 198–

206.

59. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist

programmers. Methods Mol Biol 132: 365–386.

60. Huan J, Culbertson N, Spencer L, Bartholomew R, Burrows GG, et al. (2005) Decreased FOXP3

levels in multiple sclerosis patients. J Neurosci Res 81: 45–52.

61. Viglietta V, Baecher-Allan C, Weiner HL, Hafler DA (2004) Loss of functional suppression by

CD4+CD25+ regulatory T cells in patients with multiple sclerosis. J Exp Med 199: 971–979.

62. Tischner D, Weishaupt A, van den Brandt J, Müller N, Beyersdorf N, et al. (2006) Polyclonal

expansion of regulatory T cells interferes with effector cell migration in a model of multiple

sclerosis. Brain  129: 2635–2647.

63. Lanteri MC, Brien KMO, Purtha WE, Cameron MJ, Lund JM, et al. (2009) Tregs control the

development of symptomatic West Nile virus infection in humans and mice. J Clin Invest 119:

3266-3277.

64. Lühn K, Simmons CP, Moran E, Dung NTP, Chau TNB, et al. (2007) Increased frequencies of

CD4+ CD25(high) regulatory T cells in acute dengue infection. J Exp Med 204: 979–985.

65. Liesz A, Suri-Payer E, Veltkamp C, Doerr H, Sommer C, et al. (2009) Regulatory T cells are key

cerebroprotective immunomodulators in acute experimental stroke. Nat Med 15: 192–199.

66. Beyersdorf N, Gaupp S, Balbach K, Schmidt J, Toyka KV, et al. (2005) Selective targeting of

regulatory T cells with CD28 superagonists allows effective therapy of experimental autoimmune

encephalomyelitis. J Exp Med 202: 445–455.

67. Liu J, Gong N, Huang X, Reynolds AD, Mosley RL, et al. (2009) Neuromodulatory activities of

CD4+CD25+ regulatory T cells in a murine model of HIV-1 associated neurodegeneration. J

Immunol 182: 3855–3865.

68. Fritzsching B, Haas J, König F, Kunz P, Fritzsching E, et al. (2011) Intracerebral human

regulatory T cells: analysis of CD4+ CD25+ FOXP3+ T cells in brain lesions and cerebrospinal

fluid of multiple sclerosis patients. PloS one 6: e17988.

62


69. Zhao W, Beers DR, Liao B, Henkel JS, Appel SH (2012) Regulatory T lymphocytes from ALS

mice suppress microglia and effector T lymphocytes through different cytokine-mediated

mechanisms. Neurobiol Dis 48: 418–428.

70. Beers DR, Henkel JS, Zhao W, Wang J, Huang A, et al. (2011) Endogenous regulatory T

lymphocytes ameliorate amyotrophic lateral sclerosis in mice and correlate with disease

progression in patients with amyotrophic lateral sclerosis. Brain 134: 1293–1314.

71. Tiemessen MM, Jagger AL, Evans HG, Herwijnen MJCV, John S, et al. (2007) CD4+ CD25+

Foxp3+ regulatory T cells induce alternative activation of human monocytes / macrophages. Proc

Natl Acad Sci U S A 104: 19446–19451.

72. Zhao J, Zhao J, Fett C, Trandem K, Fleming E, et al. (2011) IFN-γ- and IL-10-expressing virus

epitope-specific Foxp3(+) T reg cells in the central nervous system during encephalomyelitis. J

Exp Med 208: 1571–1577.

73. Liu Y, Teige I, Birnir B, Issazadeh-Navikas S (2006) Neuron-mediated generation of regulatory T

cells from encephalitogenic T cells suppresses EAE. Nat Med 12: 518–525.

74. Trajkovic V, Vuckovic O, Stosic-Grujicic S, Miljkovic D, Popadic D, et al. (2004) Astrocyte-induced

regulatory T cells mitigate CNS autoimmunity. Glia 47: 168–179.

75. Korn T, Reddy J, Gao W, Bettelli E, Awasthi A, et al. (2007) Myelin-specific regulatory T cells

accumulate in the CNS but fail to control autoimmune inflammation. Nat Med 13: 423–431.

76. Pasare C, Medzhitov R (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated

suppression by dendritic cells. Science 299: 1033–1036.

77. Frisk AL, Baumgärtner W, Gröne A (1999) Dominating interleukin-10 mRNA expression induction

in cerebrospinal fluid cells of dogs with natural canine distemper virus induced demyelinating and

non-demyelinating CNS lesions. J Neuroimmunol 97: 102–109.

78. Anghelina D, Zhao J, Trandem K, Perlman S (2009) Role of regulatory T cells in coronavirus-

induced acute encephalitis. Virology 385: 358–367.

79. Schobesberger M, Summerfield A, Doherr MG, Zurbriggen A, Griot C (2005) Canine distemper

virus-induced depletion of uninfected lymphocytes is associated with apoptosis. Vet Immunol

Immunopathol 104: 33–44.

80. Gröne A, Frisk AL, Baumgärtner W (1998) Cytokine mRNA expression in whole blood samples

from dogs with natural canine distemper virus infection. Vet Immunol Immunopathol 65: 11–27.

81. Valencia X, Stephens G, Goldbach-Mansky R, Wilson M, Shevach EM, et al. (2006) TNF

downmodulates the function of human CD4+CD25hi T-regulatory cells. Blood 108: 253–261.

82. Hunt PW, Landay AL, Sinclair E, Martinson J a, Hatano H, et al. (2011) A low T regulatory cell

response may contribute to both viral control and generalized immune activation in HIV

controllers. PloS one 6: e15924.

63


83. Lin J, Li M, Wang Z, He S, Ma X, et al. (2010) The role of CD4+CD25+ regulatory T cells in

macrophage-derived foam-cell formation. J Lipid Res 51: 1208–1217.

84. Ryon JJ, Moss WJ, Monze M, Griffin DE (2002) Functional and Phenotypic Changes in

Circulating Lymphocytes from Hospitalized Zambian Children with Measles. Clin Diagn Lab

Immunol 9: 994–1003.

85. Carsillo M, Klapproth K, Niewiesk S (2009) Cytokine imbalance after measles virus infection has

no correlation with immune suppression. J Virol 83: 7244–7251.

86. Svitek N, von Messling V (2007) Early cytokine mRNA expression profiles predict Morbillivirus

disease outcome in ferrets. Virology 362: 404–410.

87. Cross AH, Waubant E (2011) MS and the B cell controversy. Biochim Biophys Acta 1812: 231–

238.

88. Ulrich R, Kalkuhl A, Deschl U, Baumgärtner W (2010) Machine learning approach identifies new

pathways associated with demyelination in a viral model of multiple sclerosis. J Cell Mol Med 14:

434–448.

89. Vandevelde M, Zurbriggen A, Steck A, Bichsel P (1986) Studies on the intrathecal humoral

immune response in canine distemper encephalitis. J Neuroimmunol 11: 41–51.

90. Meinl E, Krumbholz M, Derfuss T, Junker A, Hohlfeld R (2008) Compartmentalization of

inflammation in the CNS: a major mechanism driving progressive multiple sclerosis. J Neurol Sci

274: 42–44.

91. Massacesi L (2002) Compartmentalization of the immune response in the central nervous system

and natural history of multiple sclerosis. Implications for therapy. Clin Neurol Neurosurg 104:

177–181.

64


Supporting Information

Figure S1. Histological grading of lymphoid depletion in the spleen. A) White pulp of control animal

with normal architecture of white pulp. B) Mildly depleted spleen with reduced size of follicle. C)

Moderately depleted spleen, characterized by continuous reduction of white pulp size and hypocellular

follicle. D) Severely depleted spleen with nearly complete loss of white pulp architecture. Bar size 200μm.

65


Table S1: Results of statistical analyses (comparison between controls and

infected animals)

SI SII SIII

Immunohistochemical analyses of brain lesions

CDV-NP 0.001↑ 0.008↑ 0.001↑

CD3 0.002↑ 0.008↑ 0.001↑

Foxp3 0.335 0.151 0.002↑

CD79α 1.000 0.069 0.003↑

MHC II 0.001↑ 0.008↑ 0.001

BS-1 0.001↑ 0.008↑ 0.001↑

GFAP 0.046↑ 0.016↑ 0.779

Immunohistochemical analyses of spleen tissue

Cellularity index 0.001↓ 0.001↓ 0.036↓

CDV-NP (PALS) 0.524 0.284 0.755

CD3 (PALS) 0.002↓ 0.003↓ 0.721

Foxp3 (PALS) 0.002↓ 0.002↓ 0.003↓

CD79α (PALS) 0.724 0.724 0.268

L1 (PALS) 0.524 0.065 0.268

MHCII (PALS) 0.002↓ 0.002↓ 0.003↓

CDV-NP (follicle) 0.065 0.030↑ 0.755

CD3 (follicle) 0.724 0.524 0.879

Foxp3 (follicle) 0.284 0.284 0.268

CD79α (follicle) 0.002↓ 0.002↓ 0.003↓

L1 (follicle) 0.284 0943 0.530

MHC II (follicle) 0.002↓ 0.002↓ 0.003↓

CDV-NP (marginal zone) 0.524 0.284 1.000

CD3 (marginal zone) 0.622 0.622 0.876

Foxp3 (marginal zone) 0.724 1.000 1.000

CD79α (marginal zone) 0.019↓ 0.030↓ 0.048↓

L1 (marginal zone) 0.171 0.019↓ 0.755

MHC II (marginal zone) 0.002↓ 0.006↓ 0.010↓

Molecular analyses of spleen tissue

CDV RNA 0.004↑ 0.004↑ 0.190

IL-2 0.017↓ 0.017↓ 1.000

IL-6 0.662 0.662 0.857

IL-8 0.329 0.429 1.000

IL-10 0.329 0.729 0.190

TGF-β 0.126 0.662 0.095

TNF 0.017↑ 0.052↑* 0.857

66


Table S1. Bold values display significant changes compared to control, ↑= significantly increased,↓=

significantly decreased compared to control; ↑* = statistical tendency compared to control; CD3 = T cells;

Foxp3 = regulatory T cells; CD79α = B cells; L1 = macrophages; MHC II = antigen presenting cells; IL =

interleukin; TNF = tumor necrosis factor; TGF-β = transforming growth factor-β

67

Chapter 4: Canine dendritic cells

4 Chapter 4: Canine dendritic cells

Review paper doi -10.1016/j.vetimm.2012.12.003

Species-specific properties and translational aspects of canine

dendritic cells

Qeska V.1,2, Baumgärtner W. 1,2, Beineke A. 1,*


30559 Hannover, Germany

2Center for Systems Neuroscience Hannover

Abstract

Dogs are affected by spontaneously occurring neoplastic and inflammatory diseases

which often share many similarities with pathological conditions in humans and are thus

appreciated as important translational animal models. Dendritic cells (DCs) represent

the most potent antigen presenting cell population. Besides their physiological function

in the initiation of primary T cell responses and B cell immunity, a deregulation of DC

function is involved in immune-mediated tissue damage, immunosuppression and

transplantation complication in human and veterinary medicine. DCs represent a

promising new target for cancer immunotherapy in dogs. However, the therapeutic use

of canine DCs is restricted because of a lack of standardized isolation techniques and

limited information about dog-specific properties of this cell type. This article reviews

current protocols for the isolation and in vitro generation of canine monocyte- and bone

68

Chapter 4: Canine dendritic cells

marrow-derived DCs. DCs of dogs are characterized by unique morphological features,

such as the presence of cytoplasmic projections and periodic microstructures. Canine

DCs can be discriminated from other hematopoietic cells also based on phenotypic

properties and their high T cell stimulatory capability in mixed leukocyte reactions.

Furthermore, the classification of canine DC-derived neoplasms and the role of DCs in

the pathogeneses of selected infectious, allergic and autoimmune diseases, which

share similarities with human disorders, are discussed. Future research is needed to

expand the existing knowledge about DC function in canine diseases as a prerequisite

for the development of future therapies interfering with the immune response.

Keywords: dendritic cells, cytokines, phenotyping, functional assays, translational

research

69

Chapter 5: Dendritic cells in CDV infection

5 Chapter 5: Dendritic cells in canine distemper virus

infection

Canine distemper virus infection leads to reduced antigen

presenting function of monocyte-derived dendritic cells

V. Qeska1,2, Y. Barthel1, C. Urhausen3, V.M. Stein4, K. Rohn5, A. Tipold4,2, W.

Baumgärtner1,2, A. Beineke1


D-30559 Hannover, Germany

2Center for Systems Neuroscience, Hannover, Germany

3Unit for Reproductive Medicine, Small Animal Clinic, University of Veterinary Medicine

Hannover, Bünteweg 15, D-30559 Hannover, Germany

4Department of Small Animal Medicine and Surgery, University of Veterinary Medicine

Hannover, Bünteweg 9, D-30559 Hannover, Germany.

5Department of Biometry, Epidemiology and Information Processing, University of

Veterinary Medicine Hannover, Bünteweg 2, D-30559 Hannover, German

70


Abstract

Canine distemper virus (CDV) shows a profound lymphotropism that causes

immunosuppression and increased susceptibility of affected dogs to opportunistic

infections. Similar to human measles virus, CDV is supposed to inhibit terminal

differentiation of dendritic cells (DCs), responsible for disturbed repopulation of

lymphoid tissues and diminished antigen presenting function in dogs. In order to testify

the hypothesis that CDV-infection leads to an impairment of co-stimulatory functions of

professional antigen presenting cells, canine DCs have been generated from peripheral

blood monocytes in vitro and infected with CDV. Virus infection was confirmed and

quantified by transmission electron microscopy, CDV-specific immunofluorescence and

virus titration. Phenotypical changes of cultured cells were determined by flow

cytometry. In addition, apoptotic changes and cellular damage were quantified by the

terminal desoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-method

and lactate dehydrogenase assay, while cell proliferation was determined by 5-bromo-

2’-deoxyuridine-incorporation. Results demonstrated a significant time dependant

increase of the infectivity rate of DCs at 24, 72 and 120 hours post infection (hpi). As

observed by flow cytometry at 120 hpi, CDV-infection of canine DCs led to a down-

regulation of co-stimulatory molecules CD80 and CD86 as well as of the major

histocompatibility complex class II, indicative of disturbed antigen presenting properties.

As a potential mechanism to evade host immune responses, infected DCs showed no

evidence of apoptosis or cell lysis at 24, 72 and 120 hpi. Similarly, cell proliferation rate

of infected cells was unaffected at any investigated time points. These data suggest that

CDV-infection of DCs plays a role for pathogenesis of long lasting immune alterations

and virus persistence in canine distemper.

71


1. Introduction

Canine distemper virus (CDV), a morbillivirus, causes persistent infection of peripheral

lymphoid organs and the central nervous system of carnivores (Krakowka 1982;

Beineke et al. 2009). Similar to measles virus (MV) infection of human beings clinical

findings in CDV-infected dogs include fever, rash, respiratory signs, and lymphopenia.

Affected dogs show an increased susceptibility to opportunistic infections as a

consequence of generalized lymphoid depletion and profound immunosuppression,

respectively (von Messling et al. 2006; Beineke et al. 2009; Sellin et al. 2009). Several

pathogens, including human herpesvirus type 1 as well as human and feline

immunodeficiency viruses, target DCs and have evolved strategies to modulate their

cytokine expression and antigen presenting capacity, thereby promoting virus immune

evasion and persistence (Steinman and Banchereau, 2007; Tompkins and Tompkins

2008). Additionally, the interaction between different viruses and DCs causes an

alteration of endocytosis, vesicle trafficking and immunological synapse formation, and

apoptosis induction of DCs (Klagge and Schneider-Schaulies 1999; Rinaldo and Piazza

2004; Harman et al. 2006; Schneider-Schaulies and Dittmer 2006; Cunningham et al.

2010). Immunosuppressive effects of MV is supposed to be a consequence of disturbed

function of antigen presenting cells, including DCs (Oldstone et al. 1999; Hahm et al.

2005; Trifilo et al. 2006; Zilliox et al. 2006). Moreover, following infection of the

respiratory tract, DCs might mediate viral transport to secondary lymphoid organs in

measles patients (Steinman 2007; Abt et al. 2009). MV-infection of DCs has been

demonstrated in vitro and in animal experiments using cotton rats, transgenic mice and

macaques. However, until now, DC infection by MV has not been confirmed in human

beings in vivo (Hahm et al. 2005; de Swart et al. 2007; Griffin 2010).

During the chronic disease stage of canine distemper, DCs seem to serve as the

primary host cells for the virus, which might promote viral persistence in lymphoid

organs (Wünschmann et al. 2000). This process is assumed to inhibit terminal

differentiation of DCs, responsible for disturbed repopulation of lymphoid tissues and

72


diminished antigen presenting function in dogs, as suggested for MV-infection (Kerdiles

et al. 2006; Schneider-Schaulies and Dittmer 2006). In addition, CDV-infection of thymic

epithelial DCs may result in compromised maturation of T cells, promoting the release

of immature, potentially autoreactive lymphocytes, demonstrating a potential central role

of DCs in CDV-induced immunosuppression and immunopathology (Wünschmann et al.

2000). However, until now, the effect of CDV upon the function of canine DCs has not

been investigated. Thus, the aim of the present study was to investigate the

susceptibility of canine DCs for CDV and to testify the hypothesis that CDV-infection

leads to an impairment of co-stimulatory functions of canine DCs in vitro.

2. Materials and Methods

2.1 Generation of monocyte derived dendritic cells

Monocyte dendritic cells (moDCs) were generated as previously described, with minor

modifications (Yoshida et al. 2003; Ibisch et al. 2005; Bonnefont-Rebeix et al. 2006).

Briefly, 20ml of fresh heparinized blood was taken from clinically healthy dogs (n=16).

Peripheral blood mononuclear cells (PBMC) were obtained by density gradient

centrifugation (500xg) using Histopaque®-1077 (Sigma-Aldrich, Germany) at room

temperature for 30 minutes. PBMC were carefully collected from the interface, washed

twice with phosphate buffered saline (PBS) + 0.02% EDTA, counted and adjusted to a

concentration of 2x106 cells/ml, seeded in RPMI 1640 medium (PAA, Austria)

supplemented with 100UI/ml penicillin, 100µg/ml streptomycin and 10% fetal calf serum

(FCS) and incubated for 24h at 37°C and 5%CO2. Subsequently, non-adherent cells

were removed by gentle washing with PBS and adherent cells were incubated under

standard conditions for 6 more days, supplemented with 10.6µg/ml recombinant human

(rh) GM-CSF (RND Systems, MN, USA) and 20µg/ml recombinant canine (rc) IL-4

(RND Systems, MN, USA). Fresh medium was added every third day. During medium

73


change, non-adherent cells were collected, centrifuged, and supernatant (SNT) was

discarded. Diluted cell pellet was transferred back to the culture flask.

2.2 Immuophenotyping of dendritic cells

Antibodies used for phenotypic analyses were either cell surface markers specific for

dog or cross-reacting with canine antigens. Monoclonal antibodies CD1a, CD11c,

CD14, CD80, CD86, and major histocompatibility complex (MHC) II were used for

labeling monocytes and DCs, respectively, while CD3- and CD21-specific antibodies

were used for labeling T cells and B cells, respectively. IgG1 and IgG2a were used as

isotype controls. All antibodies used for phenotypic analysis are listed in table 1.

Monocytes and DCs were stained as already described (Stein et al. 2004). Briefly, after

the cultivation period cells were collected, centrifuged (250xg, 4°C, 10 minutes) and

washed. Non-specific antibody binding was blocked by pretreatment of cells with 10

mg/ml human normal IgG (Globuman Berna, Switzerland). Primary antibodies and

isotype controls were incubated for 30 minutes at 4°C and afterwards centrifuged

(250xg, 20°C, 10 minutes) and washed twice with cell wash solution (BD Dickinson,

Germany). Cells labeled with conjugated markers (CD14, CD21 and IgG2a) were

resuspended in FACS flow solution (BD Dickinson, Germany) and stored at 4°C until

use. Non-conjugated primary antibodies were incubated with the secondary antibody

(goat anti-mouse pycoerythrin; Jackson ImmunoResearch, Dianova, Germany) for 30

minutes at 4°C, followed by centrifugation (250xg, 20°C, 10 minutes) and two washing

steps. Subsequently, cells were resuspended in FACS flow solution and analyzed

immediately. Cells were gated using forward scatter height (FSC-H) and side scatter

height (SSC-H) not exceeding 2% positive staining with serotypes. Phenotyping of cells

was performed using the FACSCalibur flow cytometer (Becton Dickinson, CA, USA) and

data were analyzed with FlowJo software (Tree star, OR, USA). Monocytes were

analyzed at day one in culture after the cell adherence and DCs were analyzed at day

seven in culture

74


Tabel 1. List of primary and secondary antibodies and isotype controls used for

immunophenotyping of dendritic cells.

Antibodies Target cells

Producer/clone no. Dilution Secondary

antibodies

Isotype

control

MHC II APC P.F. Moore, (University of Davis,

CA, USA) / (CA2.1C12) 1:6 GaM PE IgG1

CD11c APC Abd Serotec (Oxford, UK) /

(CA11.6A1) 1:6 GaM PE IgG1

B7-1

(CD80) APC

P.F. Moore, (University of Davis,

CA, USA) / (CA24.5D4) 1:6 GaM PE IgG1

B7-2

(CD86) APC

P.F. Moore, (University of Davis,

CA, USA) / (CA24.3E4) 1:6 GaM PE IgG1

CD21 PE B cells Abd Serotec (UK) / (CA2.1D6) 1:6 - IgG1

CD3 T cells Abd Serotec (UK) / (MCA17.74) 1:50 GaM PE IgG1

CD1a

APC Abcam (UK) / (NA1/34-HLK) 1:50 GaM PE IgG2a

CD14 PE Monocytes,

dendritic cells Abcam (UK) / (TÜK4) 1:6 - IgG2a

IgG1 - Abd Serotec (UK) / (MCA928) 1:6 GaM PE -

IgG2a PE -

Souther Biotech (AL, USA)

(1080-09)

1:6 - -

GaM PE Jackson ImmunoResearch,

Dianova (Germany) 1:100 -

APC = antigen presenting cells; GaM-PE = goat anti-mouse pycoerythrin

2.3 Canine distemper virus infection of monocyte derived dendritic cells

moDCs were harvested after an incubation period of seven days for the infection

experiment. Cells were centrifuged and washed in RPMI 1640 medium (FCS free),

seeded at the density of 0.25x104 cells/ml in 6-well plates (Nunc™, Sigma-Aldrich,

Germany) and infected with the CDV strain R252 at multiplicity of infection (MOI) 0.1.

75


After an incubation period of 2 hours under standard conditions (37°C, 5%CO2), cells

were centrifuged and washed twice with PBS to remove unbound virus. Subsequently

fresh conditioned medium containing cytokines (rhGM-CSF, rcIL-4) and 10% FCS was

added to the culture. Medium was changed every third day as described above.

Infectivity rate of the cells was investigated at 24, 72 and 120 hours post infection (hpi).

2.4 Immunofluorescence

For the detection of infected cells and quantification of the infectivity rate, respectively,

cells were labeled using a monoclonal mouse anti-CDV-specific antibody (D110; dilution

1:200; A. Zurbriggen, Switzerland). Briefly, cells were transferred to a glass slide by

cytospin centrifugation (250xg, 5 minutes). After fixation with paraformaldehyde 4% for

30 minutes at room temperature, cells were washed with phosphate buffered saline

Triton X (PBST). Non-specific blocking was performed with goat and horse serum (5%

each) for 20 minutes. Subsequently, cells were incubated with the primary antibody

(dilution 1:100) for 4 hours at room temperature, followed by incubation with the

secondary antibody (goat anti-mouse Cy3; 1:100; Jackson, ImmunoResearch, Dianova,

Germany) for 1 hour at room temperature in a dark chamber. For counterstaining cells

were incubated with bisbenzimidine (1:100; Sigma-Aldrich, Germany) for 15 minutes at

room temperature. The percentages of CDV-infected cells were determined at 24, 72

and 120 hpi in duplicates (n=4 for each time point) by immunofluorescence microscopy

(Olympus IX-70, Olympus Life Science Europe GmbH, Germany).

2.5 Virus titration

At 24, 72 and 120 hpi, the SNT was harvested to calculate the 50% log10 tissue culture

infectious dose/ml (TCID50/ml) of cell free SNT of CDV-infected cells. Briefly, SNT was

centrifuged at 300xg at 4°C, aliquoted and stored at -80°C until used. SNT was diluted

logarithmically from 100 to 10-8 in RPMI 1640 medium containing 10% FCS and titrated

76


in 96-well microtiter plates (Nunc™, Sigma-Aldrich, Germany) containing

Vero.dogSLAM cells (1.5x104 cells/well). After an incubation period of five days under

standard conditions cells were examined and evaluated for presence of cytopathogenic

effects. The TCID50 was calculated as described (Frisk et al. 1999; Techangamsuwan et

al. 2009). All samples were evaluated in triplicates (n=5; for each time point).

2.6 Proliferation assay

The proliferation rate was determined in control samples (non-infected DCs) and CDV-

infected DCs at 24, 72 and 120hpi in duplicates by the 5-bromo-2’-deoxyuridine (BrdU)-

assay (In Situ Proliferation Kit, FLUOS, Roche, Switzerland) following the

manufacturer’s instruction. Briefly, infected and non-infected cells were incubated

with10μM BrdU for 12 hours (37°C, 5%CO2). After centrifugation (200xg, 5 minutes)

cells were washed and fixated for 30 minutes (4°C) with ethanol fixative (3 volumes of

glycine solution [50mM, pH 2.0] with 7 volumes of ethanol). Subsequently, cells were

denaturated with 4M HCl for 20 minutes at room temperature. Denaturation was

stopped by adding 2ml PBS and centrifugation (300xg, 10 minutes). Non-specific

antibody binding was blocked with goat and horse serum (5% each) for 20 minutes and

incubation with 50μl anti-BrdU-FLUOS-antibody for 45 minutes at room temperature.

Cells were counterstained by bisbenzimidine (1:100, Sigma-Aldrich, Germany) for 15

minutes at room temperature. For the detection and quantification of proliferating cells,

ten randomly chosen areas (40x magnification; n=4 for each time point) were evaluated

by immunofluorescence microscopy (Olympus IX-70; Olympus Life Science Europe

GmbH, Germany).

2.7 Detection and quantification of apoptosis

Apoptotic cells were identified by the terminal desoxynucleotidyl transferase-mediated

dUTP-biotin nick end labeling (TUNEL)-method (ApopTag® Plus Peroxidase In Situ

77


Apoptosis Detection Kit, Chemicon, MA, USA) according to the manufacturer’s

instructions (Urhausen et al. 2011). Briefly, infected and non-infected DCs were

transferred to glass slides by cytospin centrifugation (250xg, 5 minutes). Cells were

fixated with 1% paraformaldehyde for 10 minutes at room temperature and post-fixated

with ice cold (-20°C) ethanol : acetic acid (2:1) for 5 minutes. Subsequently, endogenous

peroxidase was quenched with 3% H2O2 for 5 minutes followed by 2 washing steps in

PBS. After short incubation (10 seconds) in washing equilibration buffer, the terminal

desoxynucleotidyl transferase (TdT) enzyme (working strength TdT enzyme) was added

and samples were incubated in a humidified chamber for 1 hour. Reaction was stopped

by transferring the slides into working strength stop/wash buffer and three subsequent

washing steps. Afterwards, anti-dioxigenin conjugate was applied and slides were

incubated at room temperature for 30 minutes. Following cytospin slides were washed

four times in PBS and incubated at room temperature in diaminobenzidin-

tetrahydrochloride peroxidase substrate for 5 minutes. Mayer’s hematoxylin was used

for nuclear counterstaining following dehydration in a series of graded alcohols. Slides

were mounted under coverslip and ten randomly chosen areas (40x magnification; n=4

for each time point) were investigated by light microscopy. Mouse spleen tissue served

as a positive control, while DC cytospin slides that lacked TdT enzyme was used as

negative controls.

2.8 Lactate dehydrogenase assay

For detecting cell lysis, a lactate dehydrogenase assay (LDH; CytoTox 96® Non-

radioactive Cytotoxicity Assay assay Promega, WI, USA) was performed according to

manufacturer`s instructions. Briefly, after centrifugation of cells, SNT from non-infected

and CDV-infected cells at 24, 72, and 120 hpi were carefully collected and stored at -

80°C until further use. 50μl of SNT and 50μl of substrate mix were added to a 96-well

microtiter plate, and incubated for 30 minutes. Reaction was stopped with 1M acetic

acid (stop solution) and absorbance was measured at 490nm using an ELISA reader

78


(Fluorostat Optima, BMG LABTECH, Germany). Data (n=4 for each time point) were

analyzed using the Optima data analysis software (BMG LABTECH, Germany).

2.9 Transmission electron microscopy

Isolated monocytes at day one and generated DCs at day seven in culture were

centrifuged (250xg, 4°C, 10 minutes) and collected in 1.5ml tubes, while non-infected

and CDV-infected DCs at 24, 72, and 120hpi in 6-well plates (Nunc™, Sigma-Aldrich,

Germany) were centrifuged (250xg, 4°C, 10 minutes). Subsequently cells were fixated

with 2.5% glutaraldehyde and incubated overnight at 4°C. Post-fixation was performed

in 1% aqueous osmium tetroxide and after 5 washes in cacodylate buffer (5 minutes

each) samples were dehydrated through series of graded alcohols and embedded in

Epon 812 medium. Semi-thin sections were cut at microtome (Ultracut Reichert-Jung,

Leica Microsystems, Germany) and stained with uranyl citrate for 15 minutes. After

eight washing steps samples were incubated with lead citrate for 7 minutes. Ultra-thin

sections were cut with a diamond knife (Diatome, PA, USA) and transferred to copper

grids. Samples were examined by a transmission electron microscope (EM 10C, Zeiss,

Germany).

2.10 Statistical analyses

To determine the distribution of data a Shapiro-Wilk test and visualization assessment

were performed. For not normally distributed values (phenotypic analyses, LDH assay)

a non-parametric test (Mann-Whitney U-test) was used. For normally distributed data

(evaluation of semi-thin sections, infectivity rate, BrdU-assay, TUNEL-assay) a student’s

T-test was performed. For statistical analyses and visualization of data the SPSS

software (IBM, NY, USA) was used.

79


1 Results

3.1 Generation and characterization of monocyte derived dendritic cells in

culture

3.1.1. Morphological characterization

After seven days in culture in the presence of rcIL-4 and rhGM-CSF, isolated PBMC

showed a typical DC-like morphology with long cytoplasmic processes as demonstrated

by phase contrast microscopy (Fig.1A). In agreement with this, counting of different cell

types on semi-thin sections at day one in culture revealed that the majority of cells

represented monocytes (p=0.001) and only few lymphocytes and neutrophils were

detected (Fig.2A). In contrast, at day seven in culture the majority of generated cells

showed a DC-like morphology (Fig.1B) with long cytoplasmic processes, while the

amount of monocyte-like cells was comparatively low (p=0.001; Fig.2B). Comparing day

one and day seven a significant decrease of monocytes (p=0.001) and lymphocytes

(p=0.031) was observed over time (data not shown). At day one in culture individual

cells were identified as neutrophils, while no neutrophils were observed at day seven.

DC differentiation in vitro was confirmed by transmission electron microscopy which

revealed a typical DC-like morphology, including long cytoplasmic processes, abundant

golgi apparatus formation, only few lysosomes and the presence of periodical

microstructures as a distinct ultrastructural feature of canine monocyte derived DCs

(Fig.3).

3.1.2. Flow cytometry

Phenotypical analyses of PBMC (day one) and moDCs (day seven) were performed by

flow cytometry (Fig.4). The percentage of gated cells was determined to characterize

culture purity and the geometrical mean fluorescent intensity (GMFI) for the

quantification of surface marker expression of monocytes and DCs, respectively. The

majority of cultured cells at day one and day seven expressed CD14 and CD11c,

indicative of monocytic origin. Moreover, CD3+ T cells showed a significant decrease at

day seven compared to day one in culture (p=0.01). An increased percentage of cells

80


expressing CD86 at day seven compared to day one in culture was noticed (p=0.03),

while no statistical differences were found for CD1a, CD11c, CD14, CD21, CD80 and

MHC II (Fig.5). Analysis of GMFI revealed a significant up-regulation of the co-

stimulatory molecules CD80 (p=0.012) and CD86 (p=0.018) as well as an increased

surface expression of CD1a (p=0.001) and CD14 (p=0.001) of cells at day seven in

culture compared to cells at day one in culture, indicative of DC differentiation (Fig.6,7).

Figure 1. Generated canine dendritic cells. A) Phase contrast microscopy B) Light microscopy. Bar

sizes = 20μm.

Figure 2. Morphological characterization of cells in culture at day one and seven. A) At day one the

majority of cells showed monocyte morphology, while only few cells represented lymphocytes and

neutrophils. No dendritic cells were observed at this day B) The majority of cells showed a characteristic

DC morphology, while only a small pe

(p0.05) compared to all other cell types; ▲= significant increase (p0.05) compared to lymphocytes and

neutrophils. Box and whisker plots display median and quartiles with maximum and minimum values.

81


Figure 3. Periodic microstructructure in a monocyte derived dendritic cell. Wasp nest-like structure

representing a periodical microstructure (arrowhead) in the cytoplasm as a distinct ultrastructural marker

for canine monocyte derived dendritic cells. Magnification 25.000x.

Figure 4. Flow cytometric analyses of canine monocytes and dendritic cells in culture. A) Flow

cytometric analysis of cultured cells: dot plots showing gated monocytes at day one and B) dendritic cells

at day seven in culture. FSH-H = forward scatter height; SSC-H = side scatter height

3.2 Canine distemper virus infection of monocyte derived dendritic cells

3.2.1. Virus detection by immunofluorescence and transmission electron microscopy

In order to determine the ability of CDV to infect canine DCs and to quantify the

infectivity rate, respectively, moDCs were infected at seven days in culture. Infections

82


were stopped at 24, 72 and 120hpi and cell cultures were investigated by

immunofluorescence (Fig.8A). CDV-infected cells were detected as early as 24 hours

post infection. A significantly higher infectivity rate was found at 72 (p=0.03) and 120hpi

(0.023) compared to 24hpi, indicative of a time dependant increase (Fig.9). CDV

infection was confirmed by electron microscopy, which revealed the presence of virus

nucleocapsid in DCs (Fig.8B).

Figure 5. Phenotypical analyses by flow cytometry of cells at day one and day seven in culture.

Percentage of cells expressing A) CD1a, B) CD3, C) CD11c, D) CD14, E) CD21, F) CD80, G) CD86, and

H) MHC II at day one and seven. Significant differences (p0.05) between time points are labeled with

asterisks. Box and whisker plots display median and quartiles with maximum and minimum values.

83


Figure 6. Expression of different markers measured by flow cytometry in monocytes and

generated dendritic cells. During the period of culture, monocytes at day one showed a significantly

lower levels of co-stimulatory molecules, CD80 and CD86, and CD1a. MHC II- and CD11c-expression

exhibited no changes. CD14 was higher expressed in dendritic cells at day seven compared to

monocytes at day one. Significant differences (p0.05) between time points are labeled with asterisks.

Figure 7. Histograms of monocytes and dendritic cells in culture. A) Increased expression of CD80

in dendritic cells at seven days. B) Increased expression of CD86 in dendritic cells at day seven. C)

Increased expression of CD1a in dendritic cells at seven days in culture. Filled tinted curve = isotpype

control; thin line = monocytes at day one; thick black line = dendritic cells at seven days in culture.

84


Figure 8. Detection of canine distemper virus (CDV) in dendritic cells by immunofluorescence and

transmission electron microscopy. A) Infected dendritic cell (DC) at 72 hour post infection labeled with

a CDV-specific antibody (red color). Nuclear staining with bisbenzimidine (blue color); Bar size = 20μm.

B) Transmission electron microscopy showing CDV-infected dendritic cell at 120 hours post infection.

Note accumulation of viral nucleocapsid in the cytoplasma (arrow) and DC-specific periodical

microstructure (arrowhead). Magnification 50.000x.

Figure 9. Phenotypical analyses by flow cytometry of non-infected and canine distemper virus

(CDV)-infected dendritic cells at 120 hours post infection. Significantly decreased expression of A)

CD80, B) CD86, and C) MHC II in CDV-infected dendritic cells compared to controls. Box and whisker

plots display median and quartiles with maximum and minimum values. = significant differences

(p≤0.05).

85


3.2.2 Virus titration

The amount of cell free virus in the SNT was determined by virus titration. All samples

at 24, 72 and 120hpi were titrated in quadruplicates using the Vero.dogSLAM cells and

the TCID50/ml was calculated. Replicating virus was detected throughout the

observation period, although no statistical difference of virus titer among the

investigated time points was found probably attributed to a limited virus release of

infected cells.

3.2.3. Flow cytometry

The impact of CDV upon phenotypical properties of canine DCs was evaluated at

120hpi by flow cytometry (Fig.9). Flow cytometric analysis revealed a significant down-

regulation of the co-stimulatory molecules CD80 (p=0.018) and CD86 (p=0.036) as well

as of MHC II (p=0.029) of CDV-infected DCs compared to non-infected DCs (Fig.10).

Figure 10. Histograms of non-infected and canine distemper virus-infected dendritic cells at 120

hours post infection. Decreased expression of A) CD80, B) CD86 and C) MHC II in CDV-infected

dendritic cells compared to non-infected cells. Filled tinted curve = isotpype control; thin line = non-

infected dendritic cells; thick black line = CDV-infected dendritic cells.

86


3.2.4 Quantification of cell proliferation, apoptosis and lysis

To determine the possible effect of CDV upon cell division the proliferation rate of

infected and non-infected DCs was measured by BrdU-incorporation. Although

proliferating cells (BrdU+ cells) were present at 24, 72 and 120hpi, no statistical

differences of proliferation rates were found between non-infected and CDV-infected

DCs at any time point.

TUNEL-assay was performed to detect apoptotic changes at 24, 72 and 120hpi.

Strikingly, similar apoptotic rates of infected DCs and non-infected cells were observed

(data not shown). The absence of an overt apoptosis induction and cell damage

following infection was confirmed by LDH-assay, which revealed no statistical

differences between infected and non-infected cells at any time point (data not shown).

4 Discussion

Results of the present study demonstrate the ability of CDV to infect canine DCs and to

modulate their antigen presenting properties, which has the potential to influence host

innate and adaptive immune responses. Many viruses have developed strategies to

alter antigen presentation or allostimulatory properties of DCs in order to evade immune

responses, as described for influenza virus, HIV, and herpes simplex virus (Mikloska et

al. 2001; Rinaldo and Piazza, 2004; Granucci, 2005). Furthermore, infection of DCs is

supposed to account for long lasting and profound immunosuppression in measles

patients (Fugier-Vivier et al. 1997; Murabayashi et al. 2002; Ohgimoto et al. 2007).

Similarly, CDV-mediated modulation of DC function might represent a mechanism to

suppress protective immunity, which favors persistent infection in infected dogs. In

agreement with this, Wünschmann et al. (2000) reported the occurrence of CDV-

infected DC-like cells within lymphoid organs in advanced stages of canine distemper.

Based on these observations in vivo and the present results in vitro it is hypothesized

that infection of DCs represents a mechanism of viral persistence in peripheral organs

87


similar to observations in neurons and glial cells in canine distemper (Nesseler et al.

1997; Zurbriggen et al. 1998; Nesseler et al. 1999; Wünschmann et al. 2000; Beineke

et al. 2009; Céspedes et al. 2010).

CDV-infection of canine moDCs leads to a down-regulation of co-stimulatory molecules

(CD80 and CD86) as well as of MHC II, which might impair T cell activation in affected

dogs (Björck et al. 1997). According to this, in addition to lymphopenia, remaining

peripheral blood lymphocytes of dogs suffering from CDV infection show an extensively

reduced mitogen-induced lymphocyte proliferation (Krakowka et al. 1975; Krakowka and

Wallace, 1979). Besides reducing T cell responses, CDV inhibits IL-1 production and

increases prostaglandin E2 release, which impairs antigen presentation and subsequent

B cell differentiation, plasma cell formation and immunoglobulin production in CDV-

infected dogs (Krakowka et al. 1987). In addition, diminished T helper cell function as a

consequence of impaired antigen presentation in persistently infected dogs might

contribute also to disturbed germinal center formation and a reduced class switch from

IgM to IgG (Winters et al. 1983).

Dysregulation of antigen presenting properties is supposed to account for

immunosuppression in human measles (Servet-Delprat et al. 2000). Mechanisms

include the down-regulation of IL-12, which leads to a failure to activate T cells by DCs

(Fugier-Vivier et al. 1997; Servet-Delprat et al. 2000; Schneider-Schaulies et al. 2002).

Possibly, CDV nucleoprotein acts indirectly on T cell function by modulating antigen

presentation of DCs via interaction with the Fc receptor (CD32) and subsequent

diminished IL-12 production (Schneider-Schaulies and Dittmer, 2006). Similar to the

findings of the present study, MV-infection of mice causes a down-regulation of co-

stimulatory molecules as well as of MHC class I and II molecules in splenic DCs

(Oldstone et al. 1999; Hahm et al. 2005; Trifilo et al. 2006). However, in contrast to the

present results, MV-infection of human DCs in vitro leads to an up-regulation of co-

stimulatory molecules. These differences demonstrate that despite numerous

similarities between the pathogeneses of human measles and canine distemper virus-

88


specific but also species-specific properties have to be considered for critical

interpretation of data in translational research.

Human cytomegalovirus, murine cytomegalovirus and Epstein-Barr virus infect and

manipulate DCs to circumvent cell death, which causes persistent infection (Rinaldo

and Piazza, 2004). According to this, the observed lack of apoptosis and lysis of CDV-

infected DCs represents a potential prerequisite for virus persistence in lymphoid

organs in chronically infected dogs. Furthermore, DCs have a limited lifespan and

defects in DC apoptosis might trigger autoimmune disease as demonstrated in

transgenic FasL- and Fas-deficient mice (Cohen and Eisenberg, 1992; Kushwah and

Hu, 2010). Referring to this, disturbed DC function in canine distemper is supposed to

compromise maturation and selection of T cells, promoting the release of immature CD5

negative T cells, including potentially autoreactive cells (Wünschmann et al. 2000).

In conclusion, for the first time CDV infection of canine DCs has been demonstrated in

vitro. Modulation of co-stimulatory molecules and reduced antigen presenting function of

CDV-infected DCs might account for inhibitory effects upon the immune system of dogs.

Getting insights into the interaction between viruses and DCs is fundamental to

understand the pathogeneses of infectious disorders, which has implication for

prevention (e.g. vaccination) and treatment strategies (Hou et al. 2007). Thus, further

studies are needed to investigate the role of DCs in the pathogenesis of

immunopathology and virus persistence in canine distemper.

Acknowledgment

The authors would like to thank Kerstin Schöne, Regina Carlson, Kerstin Rohn, Danuta

Waschke, Bettina Buck, and Petra Grünig for their excellent technical support during the

laboratory work. This study was supported by the German Research Foundation (FOR

1103, BA 815/10-2 and BE 4200/1-2).





89


References:

Abt M, Gassert E, Schneider-Schaulies S, 2009. Measles virus modulates chemokine release and

chemotactic responses of dendritic cells. J Gen Virol 90, 909–914.

Beineke A, Puff C, Seehusen F, Baumgärtner W, 2009. Pathogenesis and immunopathology of systemic

and nervous canine distemper. Vet Immuno Immunopathol 127, 1–18.

Björck P, Banchereau J, Flores-Romo L, 1997. CD40 ligation counteracts Fas-induced apoptosis of

human dendritic cells. Int Immunol 9, 365–372.

Bonnefont-Rebeix C, Miranda de Carvalho C, Bernaud J, Chabanne L, Marchal T, Rigal D, 2006. CD86

molecule is a specific marker for canine monocyte-derived dendritic cells. Vet Immuno

Immunopathol 109, 167–176.

Cohen PL, Eisenberg RA, 1992. The Lpr and Gld genes in systemic autoimmunity: life and death in the

Fas lane. Immunol Today 13, 427–428.

Cunningham AL, Donaghy H, Harman AN, Kim M, Turville SG, 2010. Manipulation of dendritic cell

function by viruses. Curr Opin Microbiol 13, 524–529.

Céspedes PF, Cruz P, Navarro CO, 2010. Modulación de la respuesta inmune durante la infección por

virus distemper canino : implicancias terapéuticas y en el desarrollo de vacunas - Modulation of

immune response during canine distemper virus infection: therapeutic and vaccine development

implication. Arch Med Vet 28, 15–28.

De Swart RL, Ludlow M, de Witte L, Yanagi Y, van Amerongen G, McQuaid S, Yüksel S, Geijtenbeek

TBH, Paul Duprex W, Osterhaus ADME, 2007. Predominant infection of CD150+ lymphocytes

and dendritic cells during measles virus infection of macaques. PLoS Pathog 3, e178.

Frisk AL, Baumgärtner W, Gröne A, 1999. Dominating interleukin-10 mRNA expression induction in

cerebrospinal fluid cells of dogs with natural canine distemper virus induced demyelinating and

non-demyelinating CNS lesions. J Neuroimmunol 97, 102–109.

Fugier-Vivier I, Servet-Delprat C, Rivailler P, Rissoan MC, Liu YJ, Rabourdin-Combe C, 1997. Measles

virus suppresses cell-mediated immunity by interfering with the survival and functions of dendritic

and T cells. J Exp Med 186, 813–23.

Granucci F, Foti M, Ricciardi-Castagnoli P, 2005. Dendritic cell biology. Adv Immunol 88, 193–233.

Griffin DE, 2010. Measles virus-induced suppression of immune responses. Immunol Rev 236, 176–189.

Hahm B, Trifilo MJ, Zuniga EI, Oldstone MBA, 2005. Viruses evade the immune system through type I

Interferon-mediated STAT2-dependent, but STAT1-independent, signaling. Immunity 22, 247–

257.

90


Harman AN, Wilkinson J, Bye CR, Bosnjak L, Stern JL, Nicholle M, Lai J, Cunningham AL, 2006. HIV

induces maturation of monocyte-derived dendritic cells and langerhans cells. J Immunol 177,

7103–7113.

Hou W, So E, Kim BS, 2007. Role of dendritic cells in differential susceptibility to viral demyelinating

disease. PLoS Pathog 3, e124.

Ibisch C, Pradal G, Bach JM, Lieubeau B, 2005. Functional canine dendritic cells can be generated in

vitro from peripheral blood mononuclear cells and contain a cytoplasmic ultrastructural marker. J

Immunol Methods 298, 175–182.

Kerdiles YM, Sellin CI, Druelle J, Horvat B, 2006. Immunosuppression caused by measles virus: role of

viral proteins. Rev Med Virol 16, 49–63.

Klagge IM, Schneider-Schaulies S, 1999. Virus interactions with dendritic cells. J Gen Virol 80, 823–833.

Krakowka S, Cockerell G, Koestner A, 1975. Effects of canine distemper virus infection on lymphoid

function in vitro and in vivo. Infec Immun 11, 1069–1078.

Krakowka S, Wallace AL, 1979. Lymphocyte-associated immune responses to canine distemper and

measles viruses in distemper-infected gnotobiotic dogs. Am J Vet Res 40, 669–672.

Krakowka S, 1982. Mechanisms of in vitro immunosuppression in canine distemper virus infection. J Clin

Lab Immunol 8, 187–196.

Krakowka S, Ringler SS, Lewis M, Olsen RG, Axthelm MK 1987. Immunosuppression by canine

distemper virus: modulation of in vitro immunoglobulin synthesis, interleukin release and

prostaglandin E2 production. Vet Immuno Immunopathol 15, 181–201.

Kushwah R, Hu J, 2010. Dendritic cell apoptosis: regulation of tolerance versus immunity. J Immunol,

185, 795–802.

von Messling V, Svitek N, Cattaneo R, 2006. Receptor (SLAM [CD150]) recognition and the V protein

sustain swift lymphocyte-based invasion of mucosal tissue and lymphatic organs by a

morbillivirus. J Virol 80, 6084–6092.

Mikloska Z, Bosnjak L, Cunningham AL, 2001. Immature monocyte-derived dendritic cells are

productively infected with herpes simplex virus Type 1. J Virol 75, 5958–5964.

Murabayashi N, Kurita-Taniguchi M, Ayata M, Matsumoto M, Ogura H, Seya T, 2002. Susceptibility of

human dendritic cells (DCs) to measles virus (MV) depends on their activation stages in

conjunction with the level of CDw150: role of toll stimulators in DC maturation and MV

amplification. Microb Infect 4, 785–794.

Nesseler A, Baumgärtner W, Gaedke K, Zurbriggen A, 1997. Abundant expression of viral nucleoprotein

mRNA and restricted translation of the corresponding viral protein in inclusion body

polioencephalitis of canine distemper. J Comp Pathol 116, 291–301.

91


Nesseler A, Baumgärtner W, Zurbriggen A, Orvell C. 1999. Restricted virus protein translation in canine

distemper virus inclusion body polioencephalitis. Vet Microbiol 69, 23–28.

Ohgimoto K, Ohgimoto S, Ihara T, Mizuta H, Ishido S, Ayata M, Ogura H, Hotta H, 2007. Difference in

production of infectious wild-type measles and vaccine viruses in monocyte-derived dendritic

cells. Virus Res 123, 1–8.

Oldstone MBA, Lewicki H, Thomas D, Tishon A, Dales S, Patterson J, Manchester M, Homann D,

Naniche D, Holz A, 1999. Measles virus infection in a transgenic model: and central nervous

system disease. Cell 98, 629–640.

Rinaldo CR, Piazza P, 2004. Virus infection of dendritic cells: portal for host invasion and host defense.

Trends Microbiol 12, 337–345.

Schneider-Schaulies S, Bieback K, Avota E, Klagge I, ter Meulen V, 2002. Regulation of gene expression

in lymphocytes and antigen-presenting cells by measles virus: consequences for

immunomodulation. J Mol Med 80, 73–85.

Schneider-Schaulies S, Dittmer U, 2006. Silencing T cells or T-cell silencing: concepts in virus-induced

Iimunosuppression. J Gen Virol 87, 1423–1438.

Sellin CI, Jégou J-F, Renneson J, Druelle J, Wild TF, Marie JC, Horvat B, 2009. Interplay between virus-

specific effector response and Foxp3 regulatory T cells in measles virus immunopathogenesis.

PloS One 4, e4948.

Servet-Delprat C, Vidalain PO, Bausinger H, Manié S, Le Deist F, Azocar O, Hanau D, Fischer A,

Rabourdin-Combe C, 2000. Measles virus induces abnormal differentiation of CD40 ligand-

activated human dendritic cells. J Immunol 164, 1753–1760.

Stein VM, Czub M, Schreiner N, Moore PF, Vandevelde M, Zurbriggen A, Tipold A, 2004. Microglial cell

activation in demyelinating canine distemper lesions. J Neuroimmunol 153, 122–131.

Steinman RM, 2007. Dendritic cells: versatile controllers of the immune system. Nat Med 13, 1155–1159.

Steinman RM, Banchereau J, 2007. Taking dendritic cells into medicine. Nat 449, 419–426.

Techangamsuwan S, Haas L, Rohn K, Baumgärtner W, Wewetzer K, 2009. Distinct cell tropism of canine

distemper virus strains to adult olfactory ensheathing cells and schwann cells in vitro. Virus Res

144, 195–201.

Tompkins MB, Tompkins WA, 2008. Lentivirus-induced immune dysregulation. Vet Immuno


Trifilo MJ, Hahm B, Zuniga EI, Edelmann KH, Oldstone MBA, 2006. Dendritic cell inhibition: memoirs from

immunosuppressive viruses. J Infect Dis 194 Suppl 1, S3–10.

Urhausen C, Beineke A, Piechotta X, Karre I, Beyerbach M, Günzel-Apel AR, 2011. Apoptosis in the

uterotubal junction and oviductal isthmus during the estrous cycle of the bitch. Anat Rec 294,

342–348.

92


Winters KA, Mathes LE, Krakowka S, Olsen RG, 1983. Immunoglobulin class response to canine

distemper virus in gnotobiotic dogs. Vet Immuno Immunopathol 5, 209–215.

Wünschmann A, Kremmer E, Baumgärtner W, 2000. Phenotypical characterization of T and B cell areas

in lymphoid tissues of dogs with spontaneous distemper. Vet Immuno Immunopathol 73, 83–98.

Yoshida H, Momoi Y, Taga N, Ide K, Yamazoe K, Iwasaki T, Kudo T, 2003. Generation of canine

dendritic cells from peripheral blood mononuclear cells. J Vet Med Sci 65, 663–669.

Zilliox MJ, Parmigiani G, Griffin DE, 2006. Gene expression patterns in dendritic cells infected with

measles virus compared with other pathogens. Proc Natl Acad Sci USA 103, 3363–3368.

Zurbriggen A, Schmid I, Graber HU, Vandevelde M, 1998. Oligodendroglial pathology in canine

distemper. Acta Neuropathol 95, 71–77.

93

Chapter 6: General discussion

6 Chapter 6: General Discussion

Based upon the observation that immune alterations in canine distemper are a

consequence of direct and indirect viral effects and thus a disturbed immunomodulation

accounts for lesion development, the aims of the present study were (i) to investigate

phase-dependant changes of Treg and their association with peripheral immune

responses in canine distemper to testify the hypothesis that insufficient Treg numbers

contribute to uncontrolled neuroinflammation and early lesion initiation in the CNS of

infected dogs. Since DCs have been demonstrated to influence immune homeostasis in

several infectious diseases and immunopathologies (ii) current concepts of canine DCs

and their impact upon canine diseases have been reviewed. In addition, (iii) the impact

of CDV upon antigen presenting function of canine DCs and the proposed role of DCs in

virus persistence have been investigated in vitro.

6.1 The role of innate immunity in demyelinating disorders

Results of the present study demonstrate a lack of Treg infiltration in predemyelinating

and early demyelinating lesions in CDV-infected dogs, which represents a potential

cause for excessive neuroinflammation, including glial and innate immune responses,

respectively. Microglia and astrocytes contribute to innate immune responses within the

CNS. Together with infiltrating Natual Killer cells, granulocytes, macrophages and DCs,

resident glial cells initiate responses to various stimuli and thus represent an important

prerequisite for antigen-specific adaptive immune responses in neurological disorders

(Gandhi et al. 2010). Similar to observations in the present survey, microglial activation

can be observed in early demyelinating lesions in MS patients. However, it remains

undetermined whether microglia induces primary tissue damage or have to be activated

first by encephalitogenic T cells (Marik et al. 2007; Gandhi et al. 2010).

In canine distemper, microglial activation leads to bystander demyelination during the

progressive disease phase (Griot et al. 1990; Botteron et al. 1992). Early signs of

94


activation of resident CNS cells represent the prominent up-regulation of MHC II prior to

T and B cell infiltration in canine and phocine distemper (Beineke et al. 2008; Stimmer

et al. 2010). Referring to this, a dominance of pro-inflammatory cytokine environment in

the brain during the acute distemper phase is indicative of M1-polarization of microglia

(Beineke et al. 2008; Markus et al. 2002). This hypothesis is supported by the

observation of an increased expression of adhesion molecules, phagocytic activity and

release of reactive oxygen species by microglia in experimentally CDV-infected dogs

(Stein et al. 2004; Stein et al. 2008). In EAE and Theiler’s murine encephalomyelitis

(TME), M1-type microglial cells contribute to lesion development, while M2-type cells

exhibit immunomodulatory properties and attenuation of clinical signs (Mikita et al.

2011; Gerhauser et al. 2012). Thus activation of potentially neurotoxic microglial

populations might represent an initiating event for subsequent immune mediated tissue

damage of the cerebellar white matter in canine distemper. Similarly, a dominating role

of innate immunity in acute and subacute traumatic spinal cord injury has been

observed in dogs (Spitzbarth et al. 2011).

Similar to findings in canine distemper, the cerebral cortex is not primarily affected by

myelin loss in TME and phocine distemper (Stimmer et al. 2010; Kummerfeld et al.

2012). The reason for region-specific differences in demyelinating disorders remains

undetermined. Possible explanations for this phenomenon include topographical

differences of the CNS microenvironment or functionality of glial cells, such as a

reduced myelin degrading proteolytic activity of microglia as observed in C57BL/6 mice

(Liuzzi et al. 1995). Functional differences of microglial cells have also been observed in

different CNS regions of the dog (Stein et al. 2004; Stein et al. 2006; Stein et al. 2007;

Ensinger et al. 2010). Moreover, regional differences of the vulnerability of axons might

account for topographical differences of glial responses in virus-induced demyelinating

disorders, such as canine distemper and TME (Tsunoda and Fujinami 2002; Seehusen

and Baumgärtner 2010; Kummerfeld et al. 2012). Regional differences of myelin loss

can also be observed in toxic demyelination models, such as the cuprizone model

(Herder et al. 2011). While microglia and macrophages contribute to demyelination in

95


the corpus callosum (Biancotti et al. 2008), a delayed infiltration of CD107b+ microglial

cells and CD11b-mRNA-expression can be found in the spinal cord of cuprizone treated

mice (Herder et al. 2011). In contrast to the potential neurotoxic function of glial cells in

canine distemper, this process might represent a reaction to toxin-induced

oligodendroglial damage in the spinal cord, which potentially promotes tissue repair and

remyelination (M2-type microglia; Kotter et al. 2001; Mantovani et al. 2005; Kigerl et al.

2009). In analogy to the concept of region-specific lesion development in canine

distemper and human MS, recent studies have demonstrated topographical differences

of de- and remyelination within the brain of cuprizone fed mice, which might be

attributed to unequal densities or functions of microglia, astrocytes and oligodendocyte

progenitor cells in the respective CNS areas (Skripuletz et al. 2008; Gudi et al.

2009;Skripuletz et al. 2010).

The role of microglia in neurological disorders is discussed controversially, since both

detrimental and beneficial effects have been described. For instance, phagocytosis of

myelin debris by microglia and macrophages represent an important prerequisite for

regeneration following traumatic CNS injury (Yang and Schnaar, 2008), while excessive

cytokine expression and release of reactive oxygen species by these cells enhances

tissue damage (Banati and Kreutzberg, 1993; Stein et al. 2006; Ensinger et al. 2010;

Stein et al. 2011). As demonstrated in canine organotypic spinal cord slice cultures and

early MS lesions, an activation of microglia by phagocytosis of myelin debris leads to a

pro-inflammatory and potentially neurotoxic M1-phenotype of microglia (Pinteaux-Jones

et al. 2008; Spitzbarth et al. 2011). This process is supposed to be initiated by the

interaction between TLR on glial cells and the released cellular compounds (damage

associated molecular patterns) as a consequence of tissue damage (Kigerl et al. 2007;

Kigerl and Popovich, 2009).

Besides their function in innate immunity, microglia, macrophages, and DCs play a

pivotal role in the induction of specific immune responses in peripheral lymphoid organs.

In TME an early migration of CD68+-antigen presenting cells from the CNS to the

96


cervical lymph node can be observed (Navarrete-Talloni et al. 2010). Subsequently,

activated peripheral lymphocytes infiltrate the CNS and get reactivated by APCs in the

CNS (McMahon et al. 2005). In agreement with this, prominent MHC II expression in

early virus-induced lesions might account for antigen presenting capacity of glial cells in

canine and phocine distemper (Beineke et al. 2008; Stimmer et al. 2010). However, in

contrast to non-lymphotropic viruses (e.g. Theiler’s murine encephalomyelitis virus

(TMEV)), pathogen-specific immune responses in peripheral lymphoid organs are not

induced in MS and TME, probably as a consequence of massive lymphoid depletion as

observed in the present study.

6.2 Role of regulatory T cells in neurological diseases

Treg play a key role in controlling immune responses under physiological conditions and

in various systemic and CNS inflammatory diseases (Sakaguchi et al. 2006; Liesz et al.

2009). This has been demonstrated by depletion of natural Treg which leads to an

activation of self-reactive T cell clones, inducing severe and widespread autoimmune

inflammatory diseases (Sakaguchi et al. 2006). Moreover, functional impairment or an

insufficient amount of Treg is suspected to contribute to demyelination in acute MS

lesions (Fritzsching et al. 2011). Impaired Treg function could lead to disturbed

tolerance against autoantigens, resulting in autoimmunity (Viglietta et al. 2004; Baecher-

Allan and Hafler, 2006; Zozulya and Wiendl, 2008). These studies demonstrate that

manipulation of Treg in the periphery influences the outcome of CNS infection.

Well orchestrated immune responses against invading pathogens is essential within the

CNS since also minor damage can have significant consequences for neurological

functions (Lowther and Hafler, 2012). For instance, Treg reduce antiviral immunity in

experimental Theiler’s murine encephalomyelitis (TME; Herder et al. 2012; Richards et

al. 2012). Treg protect the CNS against an overshooting immune response, as

demonstrated in EAE as well as in animal models of stroke and HIV-associated

neurodegeneration. Besides dampening leukocyte responses, Treg are also able to

97


reduce astrogliosis and microglia-mediated inflammation (Beyersdorf et al. 2005; Liesz

et al. 2009; Liu et al. 2009). For example, the absence of Treg in mouse models of

stroke leads to an increased severity of tissue damage due to an excessive activation of

microglia and expression of TNF and IFN-γ (Liesz et al. 2009). In mouse models of

coronavirus-induced acute encephalitis, Treg help to limit immune mediated tissue

damage during the acute stage, demonstrating a protective role of Treg (Anghelina et

al. 2009). Moreover, during acute herpes simplex virus (HSV) infection of mice, Treg

facilitate early immune responses to local viral infection by allowing a timely entry of

immune cells into infected tissues, including the brain (Lund et al. 2008). In contrast, a

lack of Treg in HSV-infected mice is associated with delayed infiltration of DCs and T

cells, that accelerates fatal infection and increases the viral load in the CNS (Lund et al.

2008). However, although the generation of Treg in CNS inflammatory diseases is

regarded as physiological process to prevent immunopathology (MacDonald et al. 2002;

Sakaguchi 2003; Dittmer et al. 2004), Treg can also have detrimental effects for the

host by their suppressive effects upon protective immune responses which leads to an

incomplete elimination of pathogens and persistent infections, respectively (Dittmer et

al. 2004; Belkaid and Rouse, 2005). For instance, in experimental MV-infection of mice,

an elevated number of Treg increases viral replication in the brain, whereas transient

depletion of Treg significantly reduces the number of infected neurons (Reuter et al.

2012).

In the present study, permanent depletion of Treg in the spleen of all disease stages of

canine distemper has been observed, which causes a delayed infiltration of Treg

infiltration in the brain in advanced stages of canine distemper. The origin of CNS-

infiltrating Treg in the chronic stage of canine distemper remains unclear. It remains to

determine whether Treg accumulation in the brain of investigated dogs represents a

cumulative effect due to migration of residual peripheral Treg or a de novo generation of

Treg within the inflamed CNS. In HIV encephalitis mouse models, Treg migrate across

the blood brain barrier and are retained within neuroinflammatory sites (Gong et al.

2011). The lack of Treg observed in early stages of CDV-induced leukoencephalitis

98


potentially contributes to uncontrolled inflammatory responses by resident cells.

Similarly, an insufficient expansion of peripheral Treg might lead to strong

immunopathology in acute severe dengue fever and West Nile virus infection (Lühn et

al. 2007; Lanteri et al. 2009). Interestingly, the increase of Foxp3+ Treg in the CNS

during advanced inflammatory stages coincides with persistent infection, similar to

findings in experimental MV infection of mice (Sellin et al. 2009; Reuter et al. 2012).

Probably a compartmentalization of immune responses in the CNS as described in MS

(Massacesi 2002; Meinl et al. 2008) might induce the proliferation and expansion of

Foxp3+ cells locally within the brain of CDV-infected animals. In EAE, large numbers of

Treg are present in the inflamed brain, but their function is impaired by the elevated

expression of pro-inflammatory molecules, such as IL-6 and TNF, which counters Treg

immunosuppressive effects (Pasare and Medzhitov, 2003; Korn et al. 2007). Results of

the present study are indicative of inadequate immunoregulation which represents a

potential prerequisite for early lesion development. However, further studies are needed

to determine disease phase-specific and probably ambiguous functions of Treg in the

pathogenesis of canine distemper, which might also have relevance for the

understanding of human demyelinating diseases.

6.3 Role of dendritic cells in demyelinating disorders

DCs play a central role for the initiation and maintenance of both innate and adaptive

immune responses to infectious agents, including bacteria and viruses (Granucci et al.

2005; Hou et al. 2007). They are distributed in the skin, mucosa, and in lymphoid

organs, where they efficiently take up and process diverse microbial antigens and

present them as MHC–peptide complexes to T cells (Hou et al. 2007). Despite their

importance for immune homeostasis in peripheral organs, DCs have been assumed not

to be important for neuroinflammation because of their absence in the CNS parenchyma

(Hart and Fabre, 1981; Deshpande et al. 2007). However this view hase been

challenged by other studies which have shown the presence of DCs in meninges and

99


choroid plexus of healthy rodents, and their ability to activate naïve T cells that enter the

inflamed CNS (McMenamin 1999; McMahon et al. 2005). DCs are the primary APCs

directing T cell functions and therefore are extremely important in directing the immune

pathology characteristic of MS (Gandhi et al. 2010). Several studies have described an

accumulation of DCs in CNS during inflammation in MS and EAE pathogenesis (Bailey

et al. 2007; Cudrici et al. 2007; Wu and Laufer, 2007). In EAE, DCs primed with myelin

antigens in the periphery activate autoaggressive T cells and can lead to an overt

autoimmune disease (Dittel et al. 1999). DCs have been shown to be functionally

abnormal in MS (Wu and Laufer, 2007). For instance, DCs of MS patients exhibit an

activated phenotype with increased expression of activation markers, such as CD40

and CD80, and promote a pro-inflammatory environment (Huang et al. 1999; Karni et al.

2006). Moreover, DCs seem to affect the disease course of MS, since secondary

progressive MS patients show higher DC expression levels of CD80, IL-12 and TNF

compared to patients with relapsing-remitting MS (Karni et al. 2006). In MS, expression

of CD40 by DCs was found to be related to the increased production of IL-12 and IL-18

(Balashov et al. 1997; Karni et al. 2002). Furthermore, co-stimulatory molecules, CD80

and CD86, do not promote identical signals where expression of CD80 in DCs promotes

Th1 response and is involved in the exacerbation of EAE, and is reported to correlate

with disease duration, while CD86 elicits Th2 humural response (Freeman et al. 1995;

Kuchroo et al. 1995; Kouwenhoven et al. 2001). With progression of EAE, DCs tend to

show a down-regulation of antigen presentation properties, characterized by reduced

expression of MHC II and co-stimulatory molecules (Deshpande et al. 2007). Although,

DCs in MS patients and healthy controls show no differences in expression of IL-12, an

important inducer of IFN-γ and Th1 responses, respectively (Huang et al. 2001), several

studies reported a down-regulation of co-stimulatory molecules of plasmacytoid DCs

and moDCs of MS patients (Huang et al. 2001; Stasiolek et al. 2006).

In TME, infection rate of DCs varies between resistant and susceptible mice strains.

Altered DC function is supposed to influence antiviral immunity which causes persistent

infection and chronic demyelinating disease (Hou et al. 2007). In susceptible mice,

100


TMEV preferentially infects immature DCs, blocking their differentiation and activation,

while failing to induce apoptosis. TMEV-infected DCs may also contribute to disease

pathogenesis by altering the cytokine profile by T cells (Hou et al. 2007).

In the present study for the first time CDV-infection of DCs has been demonstrated.

Phenotyical analyses by flow cytometry revealed an impairment of antigen presentation

properties with down-regulation of co-stimulatory molecules of infected moDCs. These

changes might influence peripheral immune responses which potentially reduce antiviral

immunity in CDV-induced leukoencephalitis. Furthermore, the absence of apoptosis

induction of CDV-infected DCs might represent a mechanism of immune evasion and

viral persistence, respectively.

6.4 Interaction of dendritic cells and regulatory T cells in

demyelinating and chronic viral diseases

Function of DCs strongly depends on the signal, which can induce pro-inflammatory or

tolerogenic properties (Finkelman et al. 1996). The ability of DCs to induce immune

tolerance depends on their origin, activation state, maturation signals and the cytokine

environment at the time they encounter T lymphocytes (Janikashvili et al. 2011). The

tolerogenic function of DCs is mediated by T cell deletion, induction of anergy, or the

expansion of antigen-specific Treg (Steinman and Nussenzweig, 2002; Luo et al. 2007;

Yamazaki et al. 2007; Darrasse-Jèze et al. 2009; Janikashvili et al. 2011). The ability of

Treg to survive in the periphery requires the presence of co-stimulation through the

CD28 and B7 pathway (Perrin et al. 1995; Chang et al. 1999; Tada et al. 1999; Salomon

et al. 2000). In EAE, DCs support Treg-mediated immunosuppression which ameliorate

autoimmune responses (Deshpande et al. 2007). Furthermore, the number of Treg in

vivo is directly proportional to the number of DCs (Darrasse-Jèze et al. 2009). On the

other side, a decrease of Treg has been demonstrated to induce DC proliferation

(Darrasse-Jèze et al. 2009). DCs are the only APC population that can mediate

peripheral activation and expansion of Treg in vivo (Walker et al. 2003; Tarbell et al.

101


2004). The interaction of DCs and Treg is regulated by a feedback loop which depends

on MHC expression by DCs (Fig.8) (Darrasse-Jèze et al. 2009). DC stimulation in the

presence of TGF-β induces the generation of Treg from naïve CD4+ T cells (Shevach,

2002). In general, DC-T cell contact stimulates the secretion of small amounts of IL-2 by

T cells, which in conjunction with MHC II independently from DC co-stimulatory signals,

is sufficient for the induction and proliferation of Treg (Walker et al. 2003; Lange et al.

2007; Zou et al. 2010). Interestingly, matured DCs, although representing potent

inducer of cellular immune responses, have an higher ability to trigger expansion and

activation of Treg than immature DCs, as demonstrated in in vitro studies (Walker et al.

2003; Lange et al. 2007). These tolerogenic DCs are found in vivo in Peyer’s patches,

lungs, and the anterior chamber of the eye. They exhibit a mature DC phenotype but

secrete IL-10 and thus trigger Treg function (Lutz and Schuler, 2002).

Figure 8. Proposed homeostatic feedback loops between dendritic cells (DCs) and regulatory T

cells (Treg). A) Increased numbers of DCs increase the number of Treg via MHC II expression; B) Treg

are able to decrease the number of DCs due to expression of interleukin (IL)-10 and transforming growth

factor (TGF)-β; C) Reduction of DCs declines the amount of Treg due to decreased MHC II expression;

D) Loss of Treg induces DCs by an increased availability of Fms-related tyrosine kinase 3 ligand (Flt3L).

Modified from Darrasse-Jèze et al. (2009).

Co-stimulatory molecules of DCs, such as CD40, CD80 and CD86, play an important

role for the interaction with Treg. Here, CTLA-4 expressed on Treg impairs antigen

102


presentation properties of DCs (Salomon et al. 2000; Godfrey et al. 2004; Fallarino et al.

2006; Janikashvili et al. 2011). For instance, Treg can suppress the up-regulation co-

stimulatory molecules CD40, CD80 and CD86 and inhibit the production of pro-

inflammatory cytokines of murine DCs, which leads to a reduced ability to induce T cell

activation (Chaux et al. 1997). In humans it has been reported that a Treg-mediated

inhibition of DC maturation is associated with a down-regulation of CD80 and CD86

without affecting CD40 expression (Serra et al. 2003). Treg-mediated suppression of

DC maturation and down-regulation of co-stimulatory molecules depends on several

mechanisms, such as CTLA-4 ligation as well as the induction of indoleamine 2,3-

dioxygenase (IDO), lymphocyte activation gene 3 (LAG3) and neuropilin-1 (Fallarino et

al. 2006; Huang et al. 2004; Paust et al. 2004; Miyara and Sakaguchi, 2007; Sarris et al.

2008; Janikashvili et al. 2011). The precise role of LAG3, which interacts with MHC II,

remains unknown, since LAG3-deficient mice fail to develop enhanced autoimmune

responses unlike CTLA-4-deficient mice (Huang et al. 2004; Miyara and Sakaguchi,

2007). Furthermore, Treg can modulate DC function by the production of inhibitory

cytokines such as IL-10, IL-35 and TGF-β (Miyara and Sakaguchi, 2007; Vignali et al.

2009).

As demonstrated in vitro studies, CDV modulates the expression of co-stimulatory

molecules and MHC II in canine moDCs. Based on previous observations

(Wünschmann et al. 2000), cells with DC-like morphology in splenic germinal centers

were the only cell population to be infected with CDV during chronic stage. Moreover,

after lymphoid repopulation of the spleen during chronic disease stage, Foxp3+ cells

remained depleted. These results led to the hypothesis that impaired antigen presenting

properties of DCs might contribute to an insufficient function or expansion of Treg in

canine distemper.

103


6.5 Conclusion

In conclusion, results of the present study support the hypothesis that an inadequate

immunoregulation as a consequence of Treg depletion promotes early lesion CNS

development in canine distemper. These findings are in agreement with previous

reports that the initiation of inflammation in myelin disorders is influenced by an

immunological imbalance of the peripheral immune system (Tsunoda et al., 2005;

Navarrete-Talloni et al., 2010). As suggested for human MS, the development of novel

therapies targeting Treg represents a promising strategy in canine neurological

disorders. However, the ambiguous functions of Treg, exhibiting both beneficial and

detrimental effects upon the host immune response, have to be considered in canine

CNS diseases with a confirmed (e.g. canine distemper) or suspected infectious etiology

(e.g. granulomatous meningoencephalitis). Since dogs are appreciated as translational

animal models for several human diseases (Kling, 2007; Spitzbarth et al., 2012),

observations in canine distemper might have relevance also for human demyelinating

disorders.

Getting insight into the interaction between viruses and DCs is fundamental to

understand the pathogenesis of infectious disorders, which has implication for

prevention (e.g. vaccination) and treatment strategies (Hou, So, and Kim 2007). For the

first time, CDV infection of cultured canine DCs has been demonstrated in the present

survey. Modulation of co-stimulatory molecules and reduced antigen presenting function

of CDV-infected DCs might account for profound and long lasting inhibitory effects upon

the immune system in canine distemper. However, further studies are needed to

expand the existing knowledge about the impact of infected DCs upon leukocyte

activation and polarization of immune responses in canine distemper and other canine

neurological disorders, as a prerequisite for the development of future therapies.

105

Chapter 7: Summary

Visar Qeska - “Investigation of immunomodulatory properties of neurovirulent viruses –

in vitro and in vivo effects of canine distemper virus”

7 Chapter 7: Summary

Distemper in dogs is caused by the canine distemper virus (CDV). The disease course

and pathogenesis of canine distemper are similar to human measles, including fever,

rash, respiratory signs, lymphopenia, and profound immunosuppression with

generalized depletion of lymphoid organs during the acute disease phase. Central

nervous system (CNS) infection and neurological complications can be observed

frequently in infected dogs. Depending on CDV strain, host immune status and age,

naturally infected dogs develop demyelinating leukoencephalomyelitis, which shares

similarities with human myelin disorders. Therefore canine distemper is appreciated as

a translational animal model for multiple sclerosis (MS). In virus-induced neurological

diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects

by reducing immunopathology and detrimental effects by inhibiting antiviral immunity,

has been described. However, the role of Treg in the pathogenesis of canine distemper

has not been investigated yet. Moreover, despite the demonstration of infected dendritic

cell (DC)-like cells in canine distemper, the effect of CDV upon canine DCs remains

undetermined.

The aim of the first part of the present study was to testify the hypothesis that peripheral

lymphoid depletion influences immunomodulatory mechanisms in the brain of CDV-

infected dogs. Immunohistochemistry revealed a lack of Foxp3+ Treg in

predemyelinating and early demyelinating lesions which was associated with the

accumulation of CD3+ T cells, L1+ macrophages/microglia and GFAP+ astrocytes.

Together with CD79α+ B cells, a delayed infiltration of Foxp3+ Treg was observed in

chronic demyelinating lesions. Splenic depletion of Foxp3+ Treg was associated with an

increased mRNA-expression of tumor necrosis factor in the acute disease phase,

indicative of a pro-inflammatory microenvironment and lack of immunological counter

106

Chapter 7: Summary

regulation in peripheral lymphoid organs. In conclusion, disturbed immune regulatory

mechanisms represent a potential cause for excessive neuroinflammation and early

lesion development in canine distemper leukoencephalitis, as discussed for immune

mediated myelin disorders such as MS.

In the second part of the thesis species-specific properties and translational aspects of

canine DCs have been reviewed, including the current knowledge about in vitro

generation and characterization of canine DCs. In addition, the role of DCs in the

pathogenesis of selected canine neoplastic, infectious (including canine distemper),

allergic and autoimmune diseases, which share similarities with human disorders and

thus have significance for translational medicine, have been discussed.

The impact of CDV upon professional antigen presenting cells was investigated in the

third part of the thesis. Similar to human measles virus, CDV is supposed to inhibit

terminal differentiation of DCs, responsible for disturbed repopulation of lymphoid

tissues and diminished antigen presenting function in dogs. In order to testify the

hypothesis that CDV-infection leads to an impairment of co-stimulatory functions of

professional antigen presenting cells, canine DCs have been generated from peripheral

blood monocytes in vitro and infected with CDV. Virus infection was confirmed and

quantified by transmission electron microscopy, CDV-specific immunofluorescence and

virus titration. Phenotypical changes of cultured cells were determined by flow

cytometry. In addition, apoptotic changes and cellular damage were quantified by the

terminal desoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-method

and lactate dehydrogenase-assay, while cell proliferation was determined by 5-bromo-

2’-deoxyuridine-incorporation. Results demonstrated a significant time dependant

increase of the infectivity rate of DCs at 24, 72 and 120 hours post infection (hpi). As

observed by flow cytometry at 120 hpi, CDV-infection of canine DCs led to a down-

regulation of co-stimulatory molecules CD80 and CD86 as well as of MHC II, indicating

disturbed antigen presenting properties. As a potential mechanism to evade host

immune responses, infected DCs showed no evidence of apoptosis or cell lysis at 24,

72 and 120 hpi. Similarly, cell proliferation rate of infected cells was unaffected at any

107

Chapter 7: Summary

investigated time points. These data suggest that CDV-infection of DCs plays a role for

pathogenesis of long lasting immune alterations and virus persistence in canine

distemper.

In conclusion, results of the present study support the hypothesis that an inadequate

immunoregulation as a consequence of Treg depletion promotes the development of

early CNS lesion in canine distemper. These findings are in agreement with previous

reports, that initiation of inflammation in myelin disorders is influenced by an

immunological imbalance of the peripheral immune system. As suggested for human

MS, the development of novel therapies targeting Treg represents a promising strategy

in canine neurological disorders. Moreover, getting insights into the interaction between

viruses and DCs is fundamental to understand the pathogenesis of infectious disorders,

which has implication for prevention (e.g. vaccination) and treatment strategies. Since

dogs are appreciated as translational animal models for several human diseases

observations in canine distemper might have relevance also for human CNS disorders

109

Chapter 8: Zusammenfassung

Visar Qeska – “Untersuchung der immunomodulatorischen Eigenschaften von

neurovirulent viren – in vitro und in vivo Effekte des Staupevirus”

8 Chapter 8: Zusammenfassung

Die Infektion mit dem Hundestaupevirus (canine distemper virus, CDV) führt bei

Hunden zu einer fieberhaften Erkrankung mit respiratorischen, enteralen und

zentralnervösen Symptomen. Vergleichbar mit der Masernvirusinfektion des Menschen

entwickelt sich in der akuten Phase der Hundestaupe außerdem eine Depletion

sämtlicher lymphatischer Organe mit daraus resultierender Leukopenie und

Immunsuppression. In Abhängigkeit vom Immunstatus und Alter des Hundes sowie vom

Virusstamm entwickelt sich eine demyelinisierende Leukoenzephalomyelitis, welche

Ähnlichkeiten mit den Läsionen bei der Multiplen Sklerose (MS) aufweist. Die

Hundestaupe stellt daher ein translationales Tiermodell für humane

Entmarkungskrankheiten dar. Regulatorische T-Zellen (regulatory T cells, Treg) führen

einerseits zu einer Reduktion immunpathologischer Prozesse, andererseits konnte

insbesondere bei viralen Infektionen des Zentralen Nervensystems (ZNS) eine

Hemmung der protektiven Immunität und damit eine Exazerbation der Krankheit

beobachtet werden. Die Bedeutung von Treg im Verlauf der CDV-Infektion ist bislang

unklar. Außerdem ist die Rolle der Dendritischen Zellen (DZ) für die Pathogenese der

Hundestaupe bisher nur unzureichend untersucht worden.

Das Ziel des ersten Teils der Arbeit war die Überprüfung der Hypothese, dass eine

Treg-Depletion in peripheren lymphatischen Organen zu einer gestörten

Immunmodulation im Gehirn von CDV-infizierten Hunden führt. Mittels Immunhistologie

konnte ein Verlust von Foxp3+ Treg in Verbindung mit einer Ansammlung von CD3+ T-

Zellen, L1+ Makrophagen/Mikroglia und GFAP+ Astrozyten in prädemyelinisierenden

und frühen demyelinisierenden Herden im ZNS von infizierten Hunden nachgewiesen

werden. Gemeinsam mit CD79α+ B-Zellen konnte eine verzögerte Infiltration von

Foxp3+ Treg in der chronischen Entmarkungsphase festgestellt werden. Die Depletion

110


von Foxp3+ Treg in der Milz war mit einer vermehrten mRNS-Expression des Tumor-

Nekrose-Faktors vergesellschaftet. Die Ergebnisse sprechen für das Vorliegen einer

gestörten Immunregulation in peripheren lymphatischen Organen und dem ZNS, welche

zu einer exzessiven Neuroinflammation und möglicherweise Initiation der

Gehirnläsionen führt. Vergleichbare Vorgänge werden gegenwärtig für die Pathogenese

der MS diskutiert.

Im zweiten Teil der Arbeit wurden in einem Übersichtsartikel tierartspezifische und

translationale Aspekte von kaninen DZ zusammengefasst und die Rolle der Zellen in

neoplastischen, infektiösen (inklusive Hundestaupe), allergischen und autoimmunen

Krankheiten des Hundes diskutiert. Ein Schwerpunkt war hierbei, Unterschiede und

Gemeinsamkeiten zwischen kaninen und humanen Krankheiten aufzuzeigen.

Im dritten Teil der Arbeit wurde der Einfluss des CDV auf professionell

antigenpräsentierende Zellen näher untersucht. Hintergrund hierbei war die

Beobachtung, dass, vergleichbar mit den Prozessen bei der Masernvirusinfektion, CDV

eine Differenzierungsstörung von DZ hervorruft und dadurch eine verminderte

Antigenpräsentation und Lymphozytenaktivierung bei Hunden ausgelöst wird. Zur

Überprüfung wurden Monozyten aus dem Blut von klinisch gesunden Hunden isoliert, in

Kultur zu DZ differenziert und anschließend mit CDV infiziert. Die Infektion der DZ

wurde mittels Transmissionselektronenmikroskopie verifiziert und der Virusgehalt

mittels Immunfluoreszenz und Virustitration quantifiziert. Außerdem wurden

durchflusszytometrische Analysen durchgeführt. Zelluläre Schäden wurden mittels der

terminal desoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling

(TUNEL)-Methode und dem Laktatdehydrogenase (LDH)-Test ermittelt. Der

Bromdesoxyuridin (BrdU)-Test wurde zur Quantifizierung der Zellproliferation in vitro

eingesetzt. Die Ergebnisse zeigten eine signifikante Zunahme der Infektionsrate 24, 72

und 120 Stunden nach der Infektion (hours post infection, hpi). Mittels

Durchflusszytometrie konnte eine verminderte Expression der ko-stimulatorischen

Moleküle CD80 und CD86 sowie des MHC II in infizierten DZ nachgewiesen werden.

111


Als möglicher Persistenzmechanismus zeigten die Zellen 24, 72 und 120 hpi keine

gesteigerte Apoptose (TUNEL-Methode) bzw. Lyse (LDH-Test). Außerdem blieb die

Proliferation infizierter Zellen im Vergleich zu nicht infizierten Zellen mittels BrdU-Test

an allen Untersuchungszeitpunkten unverändert. Die Daten sprechen für das Vorliegen

einer virusinduzierten Störung der Ko-stimulation bzw. Antigenpräsentation von DZ.

Außerdem besitzt das CDV die Eigenschaft potentiell in kaninen DZ zu persistieren.

Die Ergebnisse der Studien unterstützen die Hypothese einer gestörten

Immunregulation im Zusammenhang mit dem Verlust von Treg, wodurch eine

unkontrollierte Entzündungsreaktion im ZNS von CDV-infizierten Tieren ausgelöst wird.

Außerdem ist möglicherweise die Infektion von DZ für die lang andauernden

Alterationen des Immunsystems bei der Hundestaupe mitverantwortlich. In diesem

Zusammenhang haben neuere Untersuchungen gezeigt, dass die Neuroinflammation

bei Entmarkungskrankheiten maßgeblich durch eine gestörte Immunhomöostase in

peripheren lymphatischen Organen beeinflusst wird. Techniken zur Modulation von

Treg und DZ stellen daher innovative Therapieansätze für neurologische Krankheiten in

der Human- und Tiermedizin dar.

113

Chapter 9: References

9 Chapter 9: References

Alldinger S, Baumgärtner W, Orvell C, 1993. Restricted expression of viral surface proteins in canine

distemper encephalitis. Acta Neuropathol 85, 635–645.

Alldinger S, Wünschmann A, Baumgärtner W, Voss C, Kremmer E, 1996. Up-regulation of major

histocompatibility complex class II antigen expression in the central nervous system of dogs with

spontaneous canine distemper virus encephalitis. Acta Neuropathol 92, 273–280.

Alldinger S, Fonfara S, Kremmer E, Baumgärtner W, 2000. Up-regulation of the hyaluronate receptor

CD44 in canine distemper demyelinated plaques. Acta Neuropathol 99, 138-46.

Alldinger S, Gröters S, Miao Q, Fonfara S, Kremmer E, Baumgärtner W, 2006. Roles of an extracellular

matrix (ECM) receptor and ECM processing enzymes in demyelinating canine distemper

encephalitis. Dtsch Tierarztl Wochenschr 113, 151-156.

Andrea BAD, Ma X, Aste-Amezaga M, Paganin C, Trinchieri G, 1995. Stimulatory and inhibitory effects of

interleukin ( IL ) -4 and ID13 on the production of cytokines by human peripheral blood

mononuclear cells : priming for ID12 and tumor necrosis factor alpha production. J Exp Med 181,

537–546.

Anghelina D, Zhao J, Trandem K, Perlman S, 2009. Role of regulatory T cells in coronavirus-induced

acute encephalitis. Virology 385, 358–367.

Appel MJ, 1969. Pathogenesis of canine distemper. Am J Vet Res30(7):1167-82.

Appel MJ, 1970. Distemper pathogenesis in dogs. J Am Vet Med Assoc 156, 1681-4.

Aseffa A, Gumy A, Launois P, MacDonald RH, Louis JA, Tacchini-Cottier F, 2002. The early IL-4

response to Leishmania major and the resulting Th2 cell maturation steering progressive disease

in BALB/c mice are subject to the control of regulatory CD4+CD25+ T cells. J Immunol 169,

3232–3241.

Azuma T, Takahashi T, Kunisato A, 2003. Human CD4 + CD25 + Regulatory T cells suppress NKT cell

functions. Cancer Res 63, 4516–4520.

Baecher-Allan C, Hafler DA, 2006. Human regulatory T cells and their role in autoimmune disease.

Immunol Rev 212, 203–216.

Bailey SL, Bettina S, Eileen JM, Miller SD, 2007. CNS myeloid DCs presenting endogenous myelin

peptides ‘preferentially’ polarize CD4+ T(H)-17 cells in relapsing EAE. Nat Immunol 8, 172-180.

Baines SJ, Mcinnes EF, Mcconnell I, 2008. E-cadherin expression in canine cutaneous histiocytomas.

Vet Rec 162, 509-513

Balashov KE, Smith DR, Khoury SJ, Hafler DA, Weiner HL, 1997. Increased interleukin 12 production in

progressive multiple sclerosis: induction by activated CD4+ T cells via CD40 ligand. Proc Natl

Acad Sci USA 94, 599–603.

http://www.ncbi.nlm.nih.gov/pubmed?term=Alldinger%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10672320

http://www.ncbi.nlm.nih.gov/pubmed?term=Fonfara%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10672320

http://www.ncbi.nlm.nih.gov/pubmed?term=Kremmer%20E%5BAuthor%5D&cauthor=true&cauthor_uid=10672320

http://www.ncbi.nlm.nih.gov/pubmed?term=Baumg%C3%A4rtner%20W%5BAuthor%5D&cauthor=true&cauthor_uid=10672320

http://www.ncbi.nlm.nih.gov/pubmed/10672320


http://www.ncbi.nlm.nih.gov/pubmed?term=Gr%C3%B6ters%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16716051

http://www.ncbi.nlm.nih.gov/pubmed?term=Miao%20Q%5BAuthor%5D&cauthor=true&cauthor_uid=16716051

http://www.ncbi.nlm.nih.gov/pubmed?term=Fonfara%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16716051



http://www.ncbi.nlm.nih.gov/pubmed?term=roles%20of%20an%20extracellular%20matrix%20(ECM)%20receptor%20and%20ECM%20processing%20enzymes%20in%20demyelinating%20canine%20distemper%20encephalitis

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Appel%20MJ%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=Apple%20MJ.%2C%201969.%20Pathogenesis%20of%20canine%20distemper

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Appel%20MJ%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=Appel%2C%20M.J.G.%2C%201970.%20Distemper%20pathogenesis%20in%20dogs

114


Banati RB, Kreutzberg GW, 1993. Flow Cytometry: Measurement of proteolytic and cytotoxic activity of

microglia. Clin Neuropathol 12, 285–288.

Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K, 2000.

Imunobiology of dendritic cells. Annu Rev Immunol 18, 767–811.

Baumgärtner W, Orvell C, Reinacher M, 1989. Naturally occurring canine distemper virus encephalitis:

distribution and expression of viral polypeptides in nervous tissues. Acta Neuropathol 78, 504-

512.

Baumgärtner W, Alldinger S, 2005. The pathogenesis of canine distemper virus induced demyelination —

a biphasic process. In: Lavi, E, Constantinescu, CS (Eds), Experimental Models of Multiple

Sclerosis Springer, New York, pp 871–887

Beck K, Meyer-König U, Weidmann M, Nern C, Hufert FT, 2003. Human cytomegalovirus impairs

dendritic cell function: a novel mechanism of human cytomegalovirus immune escape. Eur J

Immunol 33, 1528–1538.

Beineke A, Markus S, Borlak J, Thum T, Baumgärtner W, 2008. Increase of pro-inflammatory cytokine

expression in non-demyelinating early cerebral lesions in nervous canine distemper. Viral

Immunol 21, 401–410.

Beineke A, Puff C, Seehusen F, Baumgärtner W, 2009. Pathogenesis and immunopathology of systemic

and nervous canine distemper. Vet Immunol Immunopathol 127, 1–18.

Beineke A, Siebert U, Wohlsein P, Baumgärtner W, 2010. Immunology of whales and dolphins. Vet

Immunol Immunopathol 133, 81–94.

Belkaid Y, Rouse BT, 2005. Natural regulatory T cells in infectious disease. Nat Immunol 6, 353–60.

Bestetti G, Fatzer R, Frankhauser R, 1978. Encephalitis following vaccination against distemper and

infectious hepatitis in the dog An optical and ultrastructural study. Acta Neuropathol 43, 69-75.

Beyersdorf N, Gaupp S, Balbach K, Schmidt J, Toyka KV, Lin CH, Hanke T, Hünig T, Kerkau T, Gold R,

2005. Selective targeting of regulatory T cells with CD28 superagonists allows effective therapy of

experimental autoimmune encephalomyelitis. J Exp Med 202, 445–455.

Bhardwaj N, 2003. The modulation of immunity by dendritic cells. Clin Appl Immunol 3, 173-182.

Biancotti JC, Kumar S, de Vellis J, 2008. Activation of inflammatory response by a combination of growth

factors in cuprizone-induced demyelinated brain leads to myelin repair. Neurochem Res 33,

2615–2628.

Biller BJ, Elmslie RE, Burnett RC, Avery AC, Dow SW, 2007. Use of FoxP3 expression to identify

regulatory T cells in healthy dogs and dogs with cancer. Vet Immunol Immunopathol 116, 69–78.

Bodey B, Bodey BJr, Kaiser HE, 1997. Dendritic type, accessory cells within the mammalian thymic

microenvironment Antigen presentation in the dendritic neuro-endocrine-immune cellular network.

In Vivo 11, 351-370.

http://www.ncbi.nlm.nih.gov/pubmed?term=Bestetti%20G%5BAuthor%5D&cauthor=true&cauthor_uid=676689

http://www.ncbi.nlm.nih.gov/pubmed?term=Fatzer%20R%5BAuthor%5D&cauthor=true&cauthor_uid=676689

http://www.ncbi.nlm.nih.gov/pubmed?term=Frankhauser%20R%5BAuthor%5D&cauthor=true&cauthor_uid=676689


http://www.ncbi.nlm.nih.gov/pubmed?term=Gaupp%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Balbach%20K%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmidt%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Toyka%20KV%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Lin%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Hanke%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=H%C3%BCnig%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Kerkau%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16061730

http://www.ncbi.nlm.nih.gov/pubmed?term=Gold%20R%5BAuthor%5D&cauthor=true&cauthor_uid=16061730



115


Björck P, Banchereau J, Flores-Romo L, 1997. CD40 ligation counteracts Fas-induced apoptosis of

human dendritic cells. Int Immunol 9, 365–372

Boliar S, Chambers TM, 2010. A new strategy of immune evasion by influenza A virus: inhibition of

monocyte differentiation into dendritic cells. Vet Immunol Immunopathol 136, 201–210.

Bonnefont-Rebeix C, de Carvalho CM, Bernaud J, Chabanne L, Marchal T,Rigal D, 2006. CD86 molecule

is a specific marker for canine monocyte-derived dendritic cells. Vet Immunol Immunopathol 109,

167–176.

Botteron C, Zurbriggen A, Griot C, Vandevelde M, 1992. Canine distemper virus-immune complexes

induce bystander degeneration of oligodendrocytes. Acta Neuropathol 83, 402–407.

Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Yasayko SA, Wilkinson JE, Galas D, Ziegler

SF, Ramsdell F, 2001. Disruption of a new forkhead/winged-helix protein, scurfin, results in the

fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27, 68–73.

Bund D, Buhmann R, Gökmen F, Kremser A, Dreyssig J, Kolb HJ, Schmetzer HM, 2010. Canine-DCs

using different serum-free methods as an approach to provide an animal-model for

immunotherapeutic strategies. Cell Immunol 263, 88–98.

Carvalho OV, Botelho CV, Ferreira CG, Scherer PO, Soares-Martins JA, Almeida MR, Silva Júnior A,

2012. Immunopathogenic and neurological mechanisms of canine distemper virus. Adv Virol

2012, 1–10.

Cecere TE, Todd SM, Leroith T, 2012. Regulatory T cells in arterivirus and coronavirus infections: do they

protect against disease or enhance it? Viruses 4, 833–846.

Cerquetella, M, Spaterna, A, Laus, F, Tesei, B, Rossi, G, Antonelli, E, Villanacci V, Bassotti G, 2010.

Inflammatory bowel disease in the dog: differences and similarities with humans. World J

Gastroenterol 16, 1050-1056.

Chang TT, Jabs C, Sobel RA, Kuchroo VK, Sharpe AH, 1999. Studies in B7-deficient mice reveal a

critical role for B7 costimulation in both induction and effector phases of experimental

autoimmune encephalomyelitis. J Exp Med 190, 733–740.

Chaux P, Favre N, Martin M, Martin F, 1997. Tumor-infiltrating dendritic cells are defective in their

antigen-presenting function and inducible B7 expression in rats. Int J Cancer 72, 619–624

Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM, 2003. Conversion of

peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of

transcription factor Foxp3. J Exp Med 198, 1875–1886.

Cocks BG, Chang CCJ, Carballido JM, Yssel H, de Vries JE, Aversa G, 1995. A novel receptor involved

in T-cell activation. Nature 376, 260–263.

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Carvalho%20CM%5BAuthor%5D&cauthor=true&cauthor_uid=16202456

http://www.ncbi.nlm.nih.gov/pubmed?term=Bernaud%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16202456

http://www.ncbi.nlm.nih.gov/pubmed?term=Chabanne%20L%5BAuthor%5D&cauthor=true&cauthor_uid=16202456

http://www.ncbi.nlm.nih.gov/pubmed?term=Marchal%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16202456

http://www.ncbi.nlm.nih.gov/pubmed?term=Rigal%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16202456

http://www.ncbi.nlm.nih.gov/pubmed?term=Jeffery%20EW%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Hjerrild%20KA%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Paeper%20B%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Clark%20LB%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Yasayko%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilkinson%20JE%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Galas%20D%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Ziegler%20SF%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Ziegler%20SF%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Ramsdell%20F%5BAuthor%5D&cauthor=true&cauthor_uid=11138001

http://www.ncbi.nlm.nih.gov/pubmed?term=Buhmann%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=G%C3%B6kmen%20F%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=Kremser%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=Dreyssig%20J%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=Kolb%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmetzer%20HM%5BAuthor%5D&cauthor=true&cauthor_uid=20347071

http://www.ncbi.nlm.nih.gov/pubmed?term=Botelho%20CV%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

http://www.ncbi.nlm.nih.gov/pubmed?term=Ferreira%20CG%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

http://www.ncbi.nlm.nih.gov/pubmed?term=Scherer%20PO%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

http://www.ncbi.nlm.nih.gov/pubmed?term=Soares-Martins%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

http://www.ncbi.nlm.nih.gov/pubmed?term=Almeida%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

http://www.ncbi.nlm.nih.gov/pubmed?term=Silva%20J%C3%BAnior%20A%5BAuthor%5D&cauthor=true&cauthor_uid=23193403

116


Cudrici C, Ito T, Zafranskaia E, Niculescu F, Mullen KM, Vlaicu S, Judge SIV, Calabresi PA, Rus H, 2007.

Dendritic cells are abundant in non-lesional gray matter in multiple sclerosis. Exp Mol Pathol 83,

198–206.

Cunningham AL, Donaghy H, Harman AN, Kim M, Turville SG, 2010. Manipulation of dendritic cell

function by viruses. Curr Opin Microbiol 13, 524–529.

Céspedes PF, Cruz P, Navarro CO, 2010. Modulación de la respuesta inmune durante la infección por

virus distemper canino : implicancias terapéuticas y en el desarrollo de vacunas - Modulation of

immune response during canine distemper virus infection: therapeutic and vaccine development

implication. Arch Med Vet 28, 15–28.

Darrasse-Jèze G, Deroubaix S, Mouquet H, Victora GD, Eisenreich T, Yao KH, Masilamani RF, Dustin

ML, Rudensky A, Liu K, Nussenzweig MC, 2009. Feedback control of regulatory T cell

homeostasis by dendritic cells in vivo. J Exp Med 206, 1853–1862.

Decaro N, Camero M, Greco G, Zizzo N, Tinelli A, Campolo M, Pratelli A, Buonavoglia C, 2004. Canine

distemper and related diseases: report of a severe outbreak in a kennel. New Microbiol 2, 177-

181.

Del Puerto HL, Martins AS, Moro L, Milsted A, Alves F, Braz GF, Vasconcelos AC, 2010. Caspase-3/-8/-

9, Bax and Bcl-2 expression inthe cerebellum, lymph nodes and leukocytes of dogs naturally

infected with canine distemper virus. Genet Mol Res 9, 151–161.

Deem SL, Spelman LH, Yates RA, Montali RJ, 2000. Canine distemper in terrestrial carnivores: a review

J Zoo Wildl Med 31, 441–451.

Deshpande P, King IL, Segal BM, 2007. CNS CD11c+ Cells from mice with encephalomyelitis polarize

Th17 cells and support CD25+CD4+ T cell-mediated immunosuppression, suggesting dual roles

in the disease process. J Immunol 178, 6695–6699.

de Swart RL, Ludlow M, de Witte L, Yanagi Y, van Amerongen G, McQuaid S, Yüksel S, Geijtenbeek TB,

Duprex WP, Osterhaus AD, 2007. Predominant infection of CD150+ lymphocytes and dendritic

cells during measles virus infection of macaques. PLoS Pathog 3, e178.

de Witte L, de Vries RD, van der Vlist M, Yüksel S, Litjens M, de Swart RL, Geijtenbeek TB, 2008. DC-

SIGN and CD150 have distinct roles in transmission of measles virus from dendritic cells to T-

lymphocytes. PLoS Pathog 4, e1000049.

Dhiman N, Jacobson RM, Poland GA, 2004. Measles virus receptors: SLAM and CD46. Rev Med Virol

14, 217–229.

Dittel B, Visintin I, Merchantm RM, Janeway CA Jr, 1999. Presentation of the self antigen myelin basic

protein by dendritic cells leads to experimental autoimmune encephalomyelitis. J Immunol 163,

32–39.

http://www.ncbi.nlm.nih.gov/pubmed?term=Donaghy%20H%5BAuthor%5D&cauthor=true&cauthor_uid=20598938

http://www.ncbi.nlm.nih.gov/pubmed?term=Harman%20AN%5BAuthor%5D&cauthor=true&cauthor_uid=20598938

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20598938

http://www.ncbi.nlm.nih.gov/pubmed?term=Turville%20SG%5BAuthor%5D&cauthor=true&cauthor_uid=20598938

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Decaro%20N%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Camero%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Greco%20G%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Zizzo%20N%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tinelli%20A%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Campolo%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Pratelli%20A%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Buonavoglia%20C%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=Canine%20distemper%20and%20related%20diseases%3Areport%20of%20severe%20outbreak%20in%20a%20kennel

http://www.ncbi.nlm.nih.gov/pubmed?term=Del%20Puerto%20HL%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Martins%20AS%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Moro%20L%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Milsted%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Alves%20F%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Braz%20GF%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Vasconcelos%20AC%5BAuthor%5D&cauthor=true&cauthor_uid=20198571

http://www.ncbi.nlm.nih.gov/pubmed?term=Ludlow%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Witte%20L%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=Yanagi%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=van%20Amerongen%20G%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=McQuaid%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=Y%C3%BCksel%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=Geijtenbeek%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=Duprex%20WP%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=Osterhaus%20AD%5BAuthor%5D&cauthor=true&cauthor_uid=18020706

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Vries%20RD%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=van%20der%20Vlist%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=Y%C3%BCksel%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=Litjens%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Swart%20RL%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=Geijtenbeek%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=18421379

http://www.ncbi.nlm.nih.gov/pubmed?term=Visintin%20I%5BAuthor%5D&cauthor=true&cauthor_uid=10384096

http://www.ncbi.nlm.nih.gov/pubmed?term=Merchant%20RM%5BAuthor%5D&cauthor=true&cauthor_uid=10384096

http://www.ncbi.nlm.nih.gov/pubmed?term=Janeway%20CA%20Jr%5BAuthor%5D&cauthor=true&cauthor_uid=10384096

117


Dittmer U, He H, Messer RJ, Schimmer S, Olbrich AR, Ohlen C, Greenberg PD, Stromnes, IM, Iwashiro

M, Sakaguchi S, Evans LH, Peterson KE, Yang G, Hasenkrug KJ, 2004. Functional impairment of

CD8(+) T cells by regulatory T cells during persistent retroviral infection. Immunity 20, 293–303.

Donaghy H, Gazzard B, Gotch F, Patterson S, 2003. Dysfunction and infection of freshly isolated blood

myeloid and plasmacytoid dendritic cells in patients infected with HIV-1. Blood 101, 4505–4511.

Dörig RE, Marcil A, Chopra A, Richardson CD, 1993. The human CD46 molecule is a receptor for

measles virus (Edmonston strain). Cell 75, 295–305.

Ensinger EM, Boekhoff TMA, Carlson R, Beineke A, Rohn K, Tipold A, Stein VM, 2010. Regional

topographical differences of canine microglial immunophenotype and function in the healthy

spinal cord. J Neuroimmunol 227, 144–152.

Erlenhöfer C, Duprex WP, Rima BK, ter Meulen V, Schneider-Schaulies J, 2002. Analysis of receptor

(CD46, CD150) usage by measles virus. J Gen Virol 83, 1431–1436.

Esolen LM, Ward BJ, Moench TR, Griffin DE, 1993. Infection of monocytes during measles. J Infect Dis

168, 47–52.

Fallarino F, Grohmann U, You S, Mcgrath BC, Cavener DR, Vacca C, Orabona, C, Bianchi R, Belladona

ML, Volpi C, Santamaria P, Fioretti MC, Puccetti O, 2006. The combined effects of tryptophan

starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and induce a

regulatory phenotype in naive T cells. J Immunol 176, 6752–6761.

Fantini MC, Becker C, Monteleone G, Pallone F, Galle PR, Neurath MF, 2004. Cutting edge: TGF-beta

induces a regulatory phenotype in CD4+CD25- T cells through Foxp3 induction and down-

regulation of Smad7. J Immunol 172, 5149–5153.

Feger U, Tolosa E, Huang YH, Waschbisch A, Biedermann T, Melms A, Wiendl H, 2007. HLA-G

expression defines a novel regulatory T-cell subset present in human peripheral blood and sites

of inflammation. Blood, 110, 568–577.

Feuerer M, Hill JA, Mathis D, Benoist C, 2009. Foxp3+ regulatory T cells: differentiation, specification,

subphenotypes. Nat Immunol 10, 689–695.

Feuerer M, Hill JA, Kretschmer K, von Boehmer H, Mathis D, Benoist C, 2010. Genomic definition of

multiple ex vivo regulatory T cell subphenotypes. Proc Nat Acad Sci U S A 107, 5919–5924.

Finkelman F, Lees A, Birnbaum R, Gause WC, Morris SC, 1996. Dendritic cells can present antigen in

vivo in a tolerogenic or immunogenic fashion. J Immunol 157, 1406–1414.

Fitting J, Killian D, Junghanss C, Willenbrock S, Murua Escobar H, Lange S, Nolte I, Barth S, Tur MK,

2011. Generation of recombinant antibody fragments that target canine dendritic cells by phage

display technology. Vet Comp Oncol 9, 183–195.

http://www.ncbi.nlm.nih.gov/pubmed?term=He%20H%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Messer%20RJ%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Schimmer%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Olbrich%20AR%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Ohlen%20C%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Greenberg%20PD%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Stromnes%20IM%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Iwashiro%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Iwashiro%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Sakaguchi%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Evans%20LH%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Peterson%20KE%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Hasenkrug%20KJ%5BAuthor%5D&cauthor=true&cauthor_uid=15030773

http://www.ncbi.nlm.nih.gov/pubmed?term=Gazzard%20B%5BAuthor%5D&cauthor=true&cauthor_uid=12576311

http://www.ncbi.nlm.nih.gov/pubmed?term=Gotch%20F%5BAuthor%5D&cauthor=true&cauthor_uid=12576311

http://www.ncbi.nlm.nih.gov/pubmed?term=Patterson%20S%5BAuthor%5D&cauthor=true&cauthor_uid=12576311

http://www.ncbi.nlm.nih.gov/pubmed?term=Marcil%20A%5BAuthor%5D&cauthor=true&cauthor_uid=8402913

http://www.ncbi.nlm.nih.gov/pubmed?term=Chopra%20A%5BAuthor%5D&cauthor=true&cauthor_uid=8402913

http://www.ncbi.nlm.nih.gov/pubmed?term=Richardson%20CD%5BAuthor%5D&cauthor=true&cauthor_uid=8402913

http://www.ncbi.nlm.nih.gov/pubmed?term=Duprex%20WP%5BAuthor%5D&cauthor=true&cauthor_uid=12029158

http://www.ncbi.nlm.nih.gov/pubmed?term=Rima%20BK%5BAuthor%5D&cauthor=true&cauthor_uid=12029158

http://www.ncbi.nlm.nih.gov/pubmed?term=ter%20Meulen%20V%5BAuthor%5D&cauthor=true&cauthor_uid=12029158

http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider-Schaulies%20J%5BAuthor%5D&cauthor=true&cauthor_uid=12029158

http://www.ncbi.nlm.nih.gov/pubmed?term=Becker%20C%5BAuthor%5D&cauthor=true&cauthor_uid=15100250

http://www.ncbi.nlm.nih.gov/pubmed?term=Monteleone%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15100250

http://www.ncbi.nlm.nih.gov/pubmed?term=Pallone%20F%5BAuthor%5D&cauthor=true&cauthor_uid=15100250

http://www.ncbi.nlm.nih.gov/pubmed?term=Galle%20PR%5BAuthor%5D&cauthor=true&cauthor_uid=15100250

http://www.ncbi.nlm.nih.gov/pubmed?term=Neurath%20MF%5BAuthor%5D&cauthor=true&cauthor_uid=15100250

http://www.ncbi.nlm.nih.gov/pubmed?term=Tolosa%20E%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20YH%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Waschbisch%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Biedermann%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Melms%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Wiendl%20H%5BAuthor%5D&cauthor=true&cauthor_uid=17371944

http://www.ncbi.nlm.nih.gov/pubmed?term=Hill%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=19536194

http://www.ncbi.nlm.nih.gov/pubmed?term=Mathis%20D%5BAuthor%5D&cauthor=true&cauthor_uid=19536194

http://www.ncbi.nlm.nih.gov/pubmed?term=Benoist%20C%5BAuthor%5D&cauthor=true&cauthor_uid=19536194

http://www.ncbi.nlm.nih.gov/pubmed?term=Hill%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=20231436

http://www.ncbi.nlm.nih.gov/pubmed?term=Kretschmer%20K%5BAuthor%5D&cauthor=true&cauthor_uid=20231436

http://www.ncbi.nlm.nih.gov/pubmed?term=von%20Boehmer%20H%5BAuthor%5D&cauthor=true&cauthor_uid=20231436

http://www.ncbi.nlm.nih.gov/pubmed?term=Mathis%20D%5BAuthor%5D&cauthor=true&cauthor_uid=20231436

http://www.ncbi.nlm.nih.gov/pubmed?term=Benoist%20C%5BAuthor%5D&cauthor=true&cauthor_uid=20231436

http://www.ncbi.nlm.nih.gov/pubmed?term=Lees%20A%5BAuthor%5D&cauthor=true&cauthor_uid=8759720

http://www.ncbi.nlm.nih.gov/pubmed?term=Birnbaum%20R%5BAuthor%5D&cauthor=true&cauthor_uid=8759720

http://www.ncbi.nlm.nih.gov/pubmed?term=Gause%20WC%5BAuthor%5D&cauthor=true&cauthor_uid=8759720

http://www.ncbi.nlm.nih.gov/pubmed?term=Morris%20SC%5BAuthor%5D&cauthor=true&cauthor_uid=8759720

http://www.ncbi.nlm.nih.gov/pubmed?term=Killian%20D%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Junghanss%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Willenbrock%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Murua%20Escobar%20H%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Lange%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Nolte%20I%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Barth%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

http://www.ncbi.nlm.nih.gov/pubmed?term=Tur%20MK%5BAuthor%5D&cauthor=true&cauthor_uid=21848621

118


Floess S, Freyer J, Siewert C, Baron U, Olek S, Polansky J, Schlawe K, Chang HD, Bopp T, Schmitt E,

Klein-Hessling S, Serfling E, Hamann A, Huehn J, 2007. Epigenetic control of the foxp3 locus in

regulatory T cells. PLoS Biol 5, pe38.

Fox RJ, Rostami AM, 2000. Anti-Interleukin-12 antibody: potential role in preventing relapses of multiple

sclerosis. Biodrugs 13, 233-241.

Freeman GJ, Boussiotis VA, Anumanthan A, Bernstein GM, Ke XY, Rennert PD, Gray GS, Gribben JG,

Nadler LM, 1995. B7-1 and B7-2 do not deliver identical costimulatory signals, since B7-2 but not

B7-1 preferentially costimulates the initial production of IL-4. Immunity 2, 523–532.

Frenzke M, Sawatsky B, Wong XX, Delpeut S, Mateo M, Cattaneo R, von Messling V, 2012. Nectin-4

dependent measles virus spread to the cynomolgus monkey tracheal epithelium: role of infected

immune cells infiltrating the lamina propria. J Virol JVI, 03037-12.

Frisk AL, Baumgärtner W, Gröne A, 1999. Dominating interleukin-10 mRNA expression induction in

cerebrospinal fluid cells of dogs with natural canine distemper virus induced demyelinating and

non-demyelinating CNS lesions. J Neuroimmunol 97, 102–109.

Fritzsching B, Haas J, König F, Kunz P, Fritzsching E, Pöschl J, Krammer PH, Brück W, Suri-Payer E,

Wildemann B, 2011. Intracerebral human regulatory T cells: analysis of CD4+ CD25+ FOXP3+ T

cells in brain lesions and cerebrospinal fluid of multiple sclerosis patients. PloS One, 6, pe17988.

Fugier-Vivier I, Servet-Delprat C, Rivailler P, Rissoan MC, Liu YJ, Rabourdin-Combe C, 1997. Measles

virus suppresses cell-mediated immunity by interfering with the survival and functions of dendritic

and T cells. J Exp Med 186, 813–823.

Gandhi R, Laroni A, Weiner HL, 2010. Role of the innate immune system in the pathogenesis of multiple

sclerosis. J Neuroimmunol 221, 7–14.

Gerhauser I, Hansmann F, Puff C, Kumnok J, Schaudien D, Wewetzer K, Baumgärtner W, 2012. Theiler's

murine encephalomyelitis virus induced phenotype switch of microglia in vitro. J Neuroimmunol

15, 49-55.

Godfrey WR, Ge YG, Spoden DJ, Levine BL, June CH, Blazar BR, Porter SB, 2004. In vitro-expanded

human CD4(+)CD25(+) T-regulatory cells can markedly inhibit allogeneic dendritic cell-stimulated

MLR cultures. Blood 104, 453–461.

Goodell EM, Blumenstock DA, Bowers WE, 1985. Canine dendritic cells from peripheral blood and lymph

nodes. Vet Immunol Immunopathol 8, 301-310.

Gong N, Liu J, Reynolds AD, Gorantla S, Mosley RL, Gendelman HE, 2011. Brain ingress of regulatory T

Cells in a murine model of HIV-1 encephalitis. J Neuroimmunol 230, 33–41.

Granucci F, Foti M, Ricciardi-Castagnoli P, 2005. Dendritic cell biology. Adv Immunol 88, 193–233.

Greene CE, Appel MJ, 1998. Canine distemper In: Greeene CE (Ed), Infectious diseases of dog and cat,

WB Saunders Company, Philadephia, London, Toronto, Montreal, Sydney, Tokyo, pp 9-22

http://www.ncbi.nlm.nih.gov/pubmed?term=Freyer%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Siewert%20C%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Baron%20U%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Olek%20S%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Polansky%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Schlawe%20K%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Chang%20HD%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Bopp%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmitt%20E%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Klein-Hessling%20S%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Serfling%20E%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Hamann%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Huehn%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17298177

http://www.ncbi.nlm.nih.gov/pubmed?term=Frenzke%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Sawatsky%20B%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Wong%20XX%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Delpeut%20S%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Mateo%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Cattaneo%20R%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=von%20Messling%20V%5BAuthor%5D&cauthor=true&cauthor_uid=23255790

http://www.ncbi.nlm.nih.gov/pubmed?term=Haas%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=K%C3%B6nig%20F%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Kunz%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Fritzsching%20E%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=P%C3%B6schl%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Krammer%20PH%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Br%C3%BCck%20W%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Suri-Payer%20E%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Wildemann%20B%5BAuthor%5D&cauthor=true&cauthor_uid=21437244

http://www.ncbi.nlm.nih.gov/pubmed?term=Servet-Delprat%20C%5BAuthor%5D&cauthor=true&cauthor_uid=9294136

http://www.ncbi.nlm.nih.gov/pubmed?term=Rivailler%20P%5BAuthor%5D&cauthor=true&cauthor_uid=9294136

http://www.ncbi.nlm.nih.gov/pubmed?term=Rissoan%20MC%5BAuthor%5D&cauthor=true&cauthor_uid=9294136

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20YJ%5BAuthor%5D&cauthor=true&cauthor_uid=9294136

http://www.ncbi.nlm.nih.gov/pubmed?term=Rabourdin-Combe%20C%5BAuthor%5D&cauthor=true&cauthor_uid=9294136

http://www.ncbi.nlm.nih.gov/pubmed?term=Gerhauser%20I%5BAuthor%5D&cauthor=true&cauthor_uid=22967352

http://www.ncbi.nlm.nih.gov/pubmed?term=Hansmann%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22967352

http://www.ncbi.nlm.nih.gov/pubmed?term=Puff%20C%5BAuthor%5D&cauthor=true&cauthor_uid=22967352

http://www.ncbi.nlm.nih.gov/pubmed?term=Kumnok%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22967352

http://www.ncbi.nlm.nih.gov/pubmed?term=Schaudien%20D%5BAuthor%5D&cauthor=true&cauthor_uid=22967352

http://www.ncbi.nlm.nih.gov/pubmed?term=Wewetzer%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22967352



http://www.ncbi.nlm.nih.gov/pubmed?term=Godfrey%20WR%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=Ge%20YG%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=Spoden%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=Levine%20BL%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=June%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=Blazar%20BR%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=Porter%20SB%5BAuthor%5D&cauthor=true&cauthor_uid=15031211

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Goodell%20EM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Blumenstock%20DA%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Bowers%20WE%22%5BAuthor%5D


http://www.ncbi.nlm.nih.gov/pubmed?term=Gong%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

http://www.ncbi.nlm.nih.gov/pubmed?term=Reynolds%20AD%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

http://www.ncbi.nlm.nih.gov/pubmed?term=Gorantla%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

http://www.ncbi.nlm.nih.gov/pubmed?term=Mosley%20RL%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

http://www.ncbi.nlm.nih.gov/pubmed?term=Gendelman%20HE%5BAuthor%5D&cauthor=true&cauthor_uid=20846730

119


Griffin, DE, 2010. Measles virus-induced suppression of immune responses. Immunol Rev 236, 176–189.

Griot C, Vandevelde M, Richard A, Peterhans E, Stocker R, 1990. Selective degeneration of

oligodendrocytes mediated by reactive oxygen species. Free Radic Res Commun 11, 181–193.

Grosjean I, Caux C, Bella C, Berger I, Wild F, Banchereau J, Kaiserlian D, 1997. Measles virus infects

human dendritic cells and blocks their allostimulatory properties for CD4+ T cells. J Exp Med 186,

801–812.

Gröne A, Frisk AL, Baumgärtner W, 1998. Cytokine mRNA expression in whole blood samples from dogs

with natural canine distemper virus infection. Vet Immunol Immunopathol 65, 11–27.

Gröne A, Alldinger S, Baumgärtner W, 2000. Interleukin-1b, -6, -12 and tumor necrosis factor-a

expression in brains of dogs with canine distemper virus infection. J Neuroimmunol 110, 20–30.

Gröne A, Fonfara S, Baumgärtner W, 2002. Cell type-dependent cytokine expression after canine

distemper virus infection. Viral Immunol 15, 493–505.

Gröne A, Doherr MG, Zurbriggen A, 2004. Canine distemper virus infection of canine footpad epidermis.

Vet Dermatol 15, 159-167.

Gudi V, Moharregh-Khiabani D, Skripuletz T, Koutsoudaki PN, Kotsiari A, Skuljec J, Trebst C, Stangel M,

2009. Regional differences between grey and white matter in cuprizone induced demyelination.

Brain Res 1283, 127–138.

Göbel K, Bittner S, Melzer N, Pankratz S, Dreykluft A, Schuhmann MK, Meuth SG, Wiendl H, 2012.

CD4(+) CD25(+) FoxP3(+) regulatory T cells suppress cytotoxicity of CD8(+) effector T cells:

implications for their capacity to limit inflammatory central nervous system damage at the

parenchymal level. J Neuroinflammation 9, 41.

Haas L, Liermann H, Harder TC, Barrett T, Löchelt M, von Messling V, Baumgärtner W, Greiser-Wilke I,

1999. Analysis of the H gene, the central untranslated region and the proximal coding part of the

F gene of wild-type and vaccine canine distemper viruses. Vet Microbiol 69, 15-18.

Hart DN, Fabre JW, 1981. Demonstration and characterization of Ia-positive dendritic cells in the

interstitial connective tissues of rat heart and other tissues, but not brain. J Exp Med 154, 347–

361.

Hahm B, Arbour N, Oldstone MBA, 2004. Measles virus interacts with human SLAM receptor on dendritic

cells to cause immunosuppression. Virology 323, 292–302.

Hahm B, Trifilo MJ, Zuniga EI, Oldstone MB, 2005. Viruses evade the immune system through type I

interferon-mediated STAT2-dependent, but STAT1-independent, signaling. Immunity 22, 247–

257

Hamilton-Easton A, Eichelberger M, 1995. Virus-specic antigen presentation by different subsets of cells

from lung and mediastinal lymph node tissues of inluenza-infected mice. J Virol 69, 6359-6366.

http://www.ncbi.nlm.nih.gov/pubmed?term=Caux%20C%5BAuthor%5D&cauthor=true&cauthor_uid=9294135

http://www.ncbi.nlm.nih.gov/pubmed?term=Bella%20C%5BAuthor%5D&cauthor=true&cauthor_uid=9294135

http://www.ncbi.nlm.nih.gov/pubmed?term=Berger%20I%5BAuthor%5D&cauthor=true&cauthor_uid=9294135

http://www.ncbi.nlm.nih.gov/pubmed?term=Wild%20F%5BAuthor%5D&cauthor=true&cauthor_uid=9294135

http://www.ncbi.nlm.nih.gov/pubmed?term=Banchereau%20J%5BAuthor%5D&cauthor=true&cauthor_uid=9294135

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaiserlian%20D%5BAuthor%5D&cauthor=true&cauthor_uid=9294135


http://www.ncbi.nlm.nih.gov/pubmed?term=Bittner%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Melzer%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Pankratz%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Dreykluft%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Schuhmann%20MK%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Meuth%20SG%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Wiendl%20H%5BAuthor%5D&cauthor=true&cauthor_uid=22373353

http://www.ncbi.nlm.nih.gov/pubmed?term=Haas%20L%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=Liermann%20H%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=Harder%20TC%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=Barrett%20T%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=L%C3%B6chelt%20M%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=von%20Messling%20V%5BAuthor%5D&cauthor=true&cauthor_uid=10515263


http://www.ncbi.nlm.nih.gov/pubmed?term=Greiser-Wilke%20I%5BAuthor%5D&cauthor=true&cauthor_uid=10515263

http://www.ncbi.nlm.nih.gov/pubmed?term=Analyses%20of%20the%20H%20gene%2C%20he%20central%20untranslated%20region%20

http://www.ncbi.nlm.nih.gov/pubmed?term=Trifilo%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=15723812

http://www.ncbi.nlm.nih.gov/pubmed?term=Zuniga%20EI%5BAuthor%5D&cauthor=true&cauthor_uid=15723812

http://www.ncbi.nlm.nih.gov/pubmed?term=Oldstone%20MB%5BAuthor%5D&cauthor=true&cauthor_uid=15723812

120


Harman AN, Wilkinson J, Bye CR, Bosnjak L, Stern JL, Nicholle M, Lai J, Cunningham AL, 2006. HIV

induces maturation of monocyte-derived dendritic cells and Langerhans cells. J Immunol 177,

7103–7113.

Hengel H, Lindner M, Wagner H, Heeg K, 1987. Frequency of herpes simplex virus specific murine

cytotoxic T lymphocyte precursors in mitogen- and antigen-driven primary T cell responses. J

Immunol 139, 4196-4202.

Herder V, Hansmann F, Stangel M, Skripuletz T, Baumgärtner W, Beineke A, 2011. Lack of cuprizone-

induced demyelination in the murine spinal cord despite oligodendroglial alterations substantiates

the concept of site-specific susceptibilities of the central nervous system. Neuropathol App

Neurobiol 37, 676–684.

Herder V, Hansmann F, Stangel M, Schaudien D, Rohn K, Baumgärtner W, Beineke A, 2012. Cuprizone

inhibits demyelinating leukomyelitis by reducing immune responses without virus exacerbation in

an infectious model of multiple sclerosis. J Neuroimmunol 244, 84–93.

Hori S, Nomura T, Sakaguchi S, 2003. Control of regulatory T cell development by the transcription factor

Foxp3. Science 299, 1057–1061.

Hou W, So EY, Kim BS, 2007. Role of dendritic cells in differential susceptibility to viral demyelinating

disease. PLoS Pathog 3, pe124.

Huang YM, Xiao BG, Ozenci V, Kouwenhoven M, Teleshova N, Fredrikson S, Link H, 1999. Multiple

sclerosis is associated with high levels of circulating dendritic cells secreting pro-inflammatory

cytokines. J Neuroimmunol 99, 82–90.

Huang YM, Stoyanova N, Jin YP, Teleshova N, Hussien Y, Xiao BG, Fredrikson S, Link H, 2001. Altered

phenotype and function of blood dendritic cells in multiple sclerosis are modulated by IFN-beta

and IL-10. Clin Exp Immunol 124, 106-114.

Huang CT, Workman CJ, Flies D, Pan X, Marson AL, Zhou G, Hipkiss EL, Ravi S, Kowalski J, Levitsky

HI, Powell JD, Pardoll DM, Drake CG, Vignali DA, 2004. Role of LAG-3 in regulatory T cells.

Immunity 21, 503–513.

Hägglund HG, McSweeney PA, Mathioudakis G, Bruno B, Georges GE, Gass MJ, Moore P, Sale GE,

Storb R, Nash RA, 2000. Ex vivo expansion of canine dendritic cells from CD34+ bone marrow

progenitor cells. Transplantation 70, 1437–1442.

Ibisch C, Pradal G, Bach JM, Lieubeau B, 2005. Functional canine dendritic cells can be generated in

vitro from peripheral blood mononuclear cells and contain a cytoplasmic ultrastructural marker. J

Immunol Methods 298, 175–182.

Isotani M, Katsuma K, Tamura K, Yamada M, Yagihara H, Azakami D, Ono K, Washizu T, Bonkobara M,

2006. Efficient generation of canine bone marrow-derived dendritic cells. J Vet Med Sci 68, 809–

814.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilkinson%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Bye%20CR%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Bosnjak%20L%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Stern%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Nicholle%20M%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Lai%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Cunningham%20AL%5BAuthor%5D&cauthor=true&cauthor_uid=17082627

http://www.ncbi.nlm.nih.gov/pubmed?term=Hansmann%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22329906

http://www.ncbi.nlm.nih.gov/pubmed?term=Stangel%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22329906

http://www.ncbi.nlm.nih.gov/pubmed?term=Schaudien%20D%5BAuthor%5D&cauthor=true&cauthor_uid=22329906

http://www.ncbi.nlm.nih.gov/pubmed?term=Rohn%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22329906


http://www.ncbi.nlm.nih.gov/pubmed?term=Beineke%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22329906

http://www.ncbi.nlm.nih.gov/pubmed?term=Xiao%20BG%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Ozenci%20V%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Kouwenhoven%20M%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Teleshova%20N%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Fredrikson%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Link%20H%5BAuthor%5D&cauthor=true&cauthor_uid=10496180

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20YM%5BAuthor%5D&cauthor=true&cauthor_uid=11422209

http://www.ncbi.nlm.nih.gov/pubmed?term=Stoyanova%20N%5BAuthor%5D&cauthor=true&cauthor_uid=11422209

http://www.ncbi.nlm.nih.gov/pubmed?term=Jin%20YP%5BAuthor%5D&cauthor=true&cauthor_uid=11422209


http://www.ncbi.nlm.nih.gov/pubmed?term=Hussien%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=11422209

http://www.ncbi.nlm.nih.gov/pubmed?term=Xiao%20BG%5BAuthor%5D&cauthor=true&cauthor_uid=11422209

http://www.ncbi.nlm.nih.gov/pubmed?term=Fredrikson%20S%5BAuthor%5D&cauthor=true&cauthor_uid=11422209


http://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20CT%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Workman%20CJ%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Flies%20D%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Pan%20X%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Marson%20AL%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhou%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Hipkiss%20EL%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Ravi%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Kowalski%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Levitsky%20HI%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Levitsky%20HI%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Powell%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Pardoll%20DM%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Drake%20CG%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=Vignali%20DA%5BAuthor%5D&cauthor=true&cauthor_uid=15485628

http://www.ncbi.nlm.nih.gov/pubmed?term=McSweeney%20PA%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Mathioudakis%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Bruno%20B%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Georges%20GE%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Gass%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Moore%20P%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Sale%20GE%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Storb%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Nash%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=11118086

http://www.ncbi.nlm.nih.gov/pubmed?term=Pradal%20G%5BAuthor%5D&cauthor=true&cauthor_uid=15847807

http://www.ncbi.nlm.nih.gov/pubmed?term=Bach%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=15847807

http://www.ncbi.nlm.nih.gov/pubmed?term=Lieubeau%20B%5BAuthor%5D&cauthor=true&cauthor_uid=15847807

http://www.ncbi.nlm.nih.gov/pubmed?term=Katsuma%20K%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Tamura%20K%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Yamada%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Yagihara%20H%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Azakami%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Ono%20K%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Washizu%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

http://www.ncbi.nlm.nih.gov/pubmed?term=Bonkobara%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16953080

121


Iwatsuki K, Okita M, Ochikubo F, Gemma T, Shin YS, Miyashita N, Mikami T, Kai C, 1995.

Immunohistochemical analysis of the lymphoid organs of dogs naturally infected with canine

distemper virus. J Comp Pathol 113, 185-190.

Janikashvili N, Bonnotte B, Katsanis E, Larmonier N, 2011. The dendritic cell-regulatory T lymphocyte

crosstalk contributes to tumor-induced tolerance. Clin Dev Immunol 2011, 430394.

Johnson R, Glickman LT, Emerick TJ, Patronek GJ, 1995. Canine distemper infection in pet dogs: I

Surveillance in Indiana during a suspected outbreak. J Am Anim Hosp Assoc 31, 223–229.

Karni A, Abraham M, Monsonego A, Cai G, Freeman GJ, Hafler D, Khoury SJ, Weiner HL, 2006. Innate

immunity in multiple sclerosis: Myeloid dendritic cells drive a proinflammatory immune response

1. J Immunol 177, 4196–4202.

Karni A, Koldzic DN, Bharanidharan P, Khoury SJ, Weiner HL, 2002. IL-18 Is linked to raised IFN-gamma

in multiple sclerosis and is induced by activated CD4(+) T Cells via CD40-CD40 ligand

interactions. J Neuroimmunol 125, 134–140.

Kast WM, Boog CJP, Roep BO, Voordouw AC, Melief CJM, 1988. Failure or success in the restoration of

virus-specific cytotoxic T lymphocyte response defects by dendritic cells. J Immunol 140, 3186-

3193.

Kerdiles YM, Sellin CI, Druelle J, Horvat B, 2006. Immunosuppression caused by measles virus: role of

viral proteins. Rev Med Virol 16, 49–63.

Kigerl KA, Lai W, Rivest S, Hart RP, Satoskar AR, Popovich PG, 2007. Toll-like receptor (TLR)-2 and

TLR-4 regulate inflammation, gliosis, and myelin sparing after spinal cord injury. J Neurochem

102, 37–50.

Kigerl KA, Popovich PG, 2009. Toll-like receptors in spinal cord injury. Curr Top Microbiol Immunol 336,

121–136.

Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, Popovich PG, 2009. Identification of two

distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in

the injured mouse spinal cord. J Neurosci 29, 13435–13444.

Kipnis J, Avidan H, Caspi RR, Schwartz M, 2004. Dual effect of CD4+CD25+ regulatory T cells in

neurodegeneration: a dialogue with microglia. Proc Natl Acad Sci U S A 101, 14663–14669.

Klagge IM, Schneider-Schaulies S, 1999. Virus interactions with dendritic cells. J Gen Virol 80, 823–833.

Klagge IM, Abt M, Fries B, Schneider-Schaulies S, 2004. Impact of measles virus dendritic-cell infection

on Th-cell polarization in vitro. J Gen Virol 85, 3239–3247.

Knight SC, Askonas BA, Macatonia SE, 1997. Dendritic cells as targets for cytotoxic T lymphocytes. Adv

Exp Med Biol 417, 389-394.

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Iwatsuki%20K%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Okita%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Ochikubo%20F%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Gemma%20T%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Shin%20YS%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Miyashita%20N%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Mikami%20T%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Kai%20C%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=immunohistochemical%20analyses%20of%20the%20lymphoid%20organs%20of%20dogs%20naturally%20infected%20with%20canine%20distemper

http://www.ncbi.nlm.nih.gov/pubmed?term=Janikashvili%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22110524

http://www.ncbi.nlm.nih.gov/pubmed?term=Bonnotte%20B%5BAuthor%5D&cauthor=true&cauthor_uid=22110524

http://www.ncbi.nlm.nih.gov/pubmed?term=Katsanis%20E%5BAuthor%5D&cauthor=true&cauthor_uid=22110524

http://www.ncbi.nlm.nih.gov/pubmed?term=Larmonier%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22110524

http://www.ncbi.nlm.nih.gov/pubmed?term=Glickman%20LT%5BAuthor%5D&cauthor=true&cauthor_uid=7634056

http://www.ncbi.nlm.nih.gov/pubmed?term=Emerick%20TJ%5BAuthor%5D&cauthor=true&cauthor_uid=7634056

http://www.ncbi.nlm.nih.gov/pubmed?term=Patronek%20GJ%5BAuthor%5D&cauthor=true&cauthor_uid=7634056

http://www.ncbi.nlm.nih.gov/pubmed?term=Karni%20A%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Abraham%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Monsonego%20A%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Cai%20G%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Freeman%20GJ%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Hafler%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Khoury%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Weiner%20HL%5BAuthor%5D&cauthor=true&cauthor_uid=16951385

http://www.ncbi.nlm.nih.gov/pubmed?term=Karni%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11960649

http://www.ncbi.nlm.nih.gov/pubmed?term=Koldzic%20DN%5BAuthor%5D&cauthor=true&cauthor_uid=11960649

http://www.ncbi.nlm.nih.gov/pubmed?term=Bharanidharan%20P%5BAuthor%5D&cauthor=true&cauthor_uid=11960649

http://www.ncbi.nlm.nih.gov/pubmed?term=Khoury%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=11960649


http://www.ncbi.nlm.nih.gov/pubmed?term=Sellin%20CI%5BAuthor%5D&cauthor=true&cauthor_uid=16237742

http://www.ncbi.nlm.nih.gov/pubmed?term=Druelle%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16237742

http://www.ncbi.nlm.nih.gov/pubmed?term=Horvat%20B%5BAuthor%5D&cauthor=true&cauthor_uid=16237742

http://www.ncbi.nlm.nih.gov/pubmed?term=Kigerl%20KA%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Lai%20W%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Rivest%20S%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Hart%20RP%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Satoskar%20AR%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Popovich%20PG%5BAuthor%5D&cauthor=true&cauthor_uid=17403033

http://www.ncbi.nlm.nih.gov/pubmed?term=Kigerl%20KA%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Gensel%20JC%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Ankeny%20DP%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Alexander%20JK%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Donnelly%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Popovich%20PG%5BAuthor%5D&cauthor=true&cauthor_uid=19864556

http://www.ncbi.nlm.nih.gov/pubmed?term=Avidan%20H%5BAuthor%5D&cauthor=true&cauthor_uid=15331781

http://www.ncbi.nlm.nih.gov/pubmed?term=Caspi%20RR%5BAuthor%5D&cauthor=true&cauthor_uid=15331781

http://www.ncbi.nlm.nih.gov/pubmed?term=Schwartz%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15331781

http://www.ncbi.nlm.nih.gov/pubmed?term=Abt%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15483237

http://www.ncbi.nlm.nih.gov/pubmed?term=Fries%20B%5BAuthor%5D&cauthor=true&cauthor_uid=15483237

http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider-Schaulies%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15483237

122


Korn T, Reddy J, Gao W, Bettelli E, Awasthi A, Petersen TR, Bäckström BT, Sobel RA, Wucherpfennig

KW, Strom TB, Oukka M, Kuchroo VK, 2007. Myelin-specific regulatory T cells accumulate in the

CNS but fail to control autoimmune inflammation. Nat Med 13, 423–431.

Kotter MR, Setzu A, Sim FJ, Van Rooijen N, Franklin RJ, 2001. Macrophage depletion impairs

oligodendrocyte remyelination following lysolecithin-induced demyelination. Glia 35, 204–212.

Kouwenhoven M, Teleshova N, Ozenci V, Press R, Link H, 2001. Monocytes in multiple sclerosis:

phenotype and cytokine profile. J Neuroimmunol 112 197–205.

Kuchroo VK, Das MP, Brown JA, Ranger AM, Zamvil SS, Sobel RA, Weiner HL, Nabavi N, Glimcher LH,

1995. B7-1 and B7-2 costimulatory molecules activate differentially the Th1/Th2 developmental

pathways: application to autoimmune disease therapy. Cell 80, 707–718.

Kummerfeld M, Seehusen F, Klein S, Ulrich R, Kreutzer R, Gerhauser I, Herder V, Baumgärtner W,

Beineke A, 2012. Periventricular demyelination and axonal pathology is associated with

subependymal virus spread in a murine model for multiple sclerosis. Intervirology 55, 401–416.

Krakowka S, Higgins RJ, Koestner A, 1980. Canine distemper virus: review of structural and functional

modulations in lymphoid tissues. Am J Vet Res 41, 284-292.

Krakowka S, 1982. Mechanisms of in vitro immunosuppression in canine distemper virus infection. J Clin

Lab Immunol 8, 187-196.

Krakowka S, Ringler SS, Lewis M, Olsen RG, Axthelm MK, 1987. Immunosuppression by canine

distemper virus: modulation of in vitro immunoglobulin synthesis, interleukin release and

prostaglandin E2 production. Vet Immunol Immunopathol 15, 181-201.

Lamb RA, 1993. Paramyxovirus fusion: a hypothesis for changes. Virology, 197, 1–11.

Lambotin M, Raghuraman S, Stoll-Keller F, Baumert TF, Barth H, 2010. A look behind closed doors:

interaction of persistent viruses with dendritic cells. Nat Rev Microbiol 8, 350-360.

Lange C, Dürr M, Doster H, Melms A, Bischof F, 2007. Dendritic Cell-regulatory T-cell Interactions Control

Self-directed Immunity. Immunol Cell Biol 85, 575–581.

Langedijk JPM, Janda J, Origgi FC, Örvell C, Vandevelde M, Zurbriggen A, Plattet P, 2011. Canine

distemper virus infects canine keratinocytes and immune cells by using overlapping and distinct

regions located on one side of the attachment protein. J Virol 85, 11242–11254.

Lanteri M, O'Brien KM, Purtha WE, Cameron MJ, Lund JM, Owen RE, Heitman JW, Custer B, Hirschkorn

DF, Tobler LH, Kiely N, Prince HE, Ndhlovu LC, Nixon DF, Kamel HT, Kelvin DJ, Busch MP,

Rudensky AY, Diamond MS, Norris PJ, 2009. Tregs control the development of symptomatic

West Nile virus infection in humans and mice. J Clin Invest 119, 3266-3277.

Li L, Liu D, Hutt-Fletcher L, Morgan A, Masucci MG, Levitsky V, 2002. Epstein-Barr virus inhibits the

development of dendritic cells by promoting apoptosis of their monocyte precursors in the

http://www.ncbi.nlm.nih.gov/pubmed?term=Reddy%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Gao%20W%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Bettelli%20E%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Awasthi%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Petersen%20TR%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=B%C3%A4ckstr%C3%B6m%20BT%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Sobel%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Wucherpfennig%20KW%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Wucherpfennig%20KW%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Strom%20TB%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Oukka%20M%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Kuchroo%20VK%5BAuthor%5D&cauthor=true&cauthor_uid=17384649

http://www.ncbi.nlm.nih.gov/pubmed?term=Kotter%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=11494411

http://www.ncbi.nlm.nih.gov/pubmed?term=Setzu%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11494411

http://www.ncbi.nlm.nih.gov/pubmed?term=Sim%20FJ%5BAuthor%5D&cauthor=true&cauthor_uid=11494411

http://www.ncbi.nlm.nih.gov/pubmed?term=Van%20Rooijen%20N%5BAuthor%5D&cauthor=true&cauthor_uid=11494411

http://www.ncbi.nlm.nih.gov/pubmed?term=Franklin%20RJ%5BAuthor%5D&cauthor=true&cauthor_uid=11494411

http://www.ncbi.nlm.nih.gov/pubmed?term=Kouwenhoven%20M%5BAuthor%5D&cauthor=true&cauthor_uid=11108949


http://www.ncbi.nlm.nih.gov/pubmed?term=Ozenci%20V%5BAuthor%5D&cauthor=true&cauthor_uid=11108949

http://www.ncbi.nlm.nih.gov/pubmed?term=Press%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11108949


http://www.ncbi.nlm.nih.gov/pubmed?term=Kuchroo%20VK%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Das%20MP%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Brown%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Ranger%20AM%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Zamvil%20SS%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Sobel%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=7534215


http://www.ncbi.nlm.nih.gov/pubmed?term=Nabavi%20N%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=Glimcher%20LH%5BAuthor%5D&cauthor=true&cauthor_uid=7534215

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Krakowka%20S%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Higgins%20RJ%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Koestner%20A%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=canine%20distemper%20virus%3A%20review%20of%20structural%20and%20functional%20modulations%20in%20lymphoid%20tissues





http://www.ncbi.nlm.nih.gov/pubmed?term=%22Ringler%20SS%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lewis%20M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Olsen%20RG%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Axthelm%20MK%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=immunosupression%20by%20canine%20distemper%20virus%3A%20modulation%20of%20in%20vitro

http://www.ncbi.nlm.nih.gov/pubmed?term=Lambotin%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20372157

http://www.ncbi.nlm.nih.gov/pubmed?term=Raghuraman%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20372157

http://www.ncbi.nlm.nih.gov/pubmed?term=Stoll-Keller%20F%5BAuthor%5D&cauthor=true&cauthor_uid=20372157

http://www.ncbi.nlm.nih.gov/pubmed?term=Baumert%20TF%5BAuthor%5D&cauthor=true&cauthor_uid=20372157

http://www.ncbi.nlm.nih.gov/pubmed?term=Barth%20H%5BAuthor%5D&cauthor=true&cauthor_uid=20372157

http://www.ncbi.nlm.nih.gov/pubmed?term=A%20look%20behind%20closed%20doors%3A%20interaction%20of%20persistent%20viruses%20with%20dendritic%20cells.

http://www.ncbi.nlm.nih.gov/pubmed?term=Lange%20C%5BAuthor%5D&cauthor=true&cauthor_uid=17592494

http://www.ncbi.nlm.nih.gov/pubmed?term=D%C3%BCrr%20M%5BAuthor%5D&cauthor=true&cauthor_uid=17592494

http://www.ncbi.nlm.nih.gov/pubmed?term=Doster%20H%5BAuthor%5D&cauthor=true&cauthor_uid=17592494

http://www.ncbi.nlm.nih.gov/pubmed?term=Melms%20A%5BAuthor%5D&cauthor=true&cauthor_uid=17592494

http://www.ncbi.nlm.nih.gov/pubmed?term=Bischof%20F%5BAuthor%5D&cauthor=true&cauthor_uid=17592494

http://www.ncbi.nlm.nih.gov/pubmed?term=Janda%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=Origgi%20FC%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=%C3%96rvell%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=Vandevelde%20M%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=Zurbriggen%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=Plattet%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21849439

http://www.ncbi.nlm.nih.gov/pubmed?term=O'Brien%20KM%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Purtha%20WE%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Cameron%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Lund%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Owen%20RE%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Heitman%20JW%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Custer%20B%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Hirschkorn%20DF%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Hirschkorn%20DF%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Tobler%20LH%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Kiely%20N%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Prince%20HE%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Ndhlovu%20LC%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Nixon%20DF%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Kamel%20HT%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Kelvin%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Busch%20MP%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Rudensky%20AY%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Diamond%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Norris%20PJ%5BAuthor%5D&cauthor=true&cauthor_uid=19855131

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20L%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20D%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

http://www.ncbi.nlm.nih.gov/pubmed?term=Hutt-Fletcher%20L%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

http://www.ncbi.nlm.nih.gov/pubmed?term=Morgan%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

http://www.ncbi.nlm.nih.gov/pubmed?term=Masucci%20MG%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

http://www.ncbi.nlm.nih.gov/pubmed?term=Levitsky%20V%5BAuthor%5D&cauthor=true&cauthor_uid=11986229

123


presence of granulocyte macrophage-colony-stimulating factor and interleukin-4. Blood 99, 3725–

3734.

Li MZ, Xu FD, Huang XH, Chen XC, Deng QW, Liu ST, Liu Y, Xu LM, Wang HS, Cui JJ, 2008.

[Immunosuppression induced by measles virus in adult patients is not related to CD4+ CD25+

regulatory T cell induction]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 22, 211–213.

Liesz A, Suri-Payer E, Veltkamp C, Doerr H, Sommer, C Rivest S, Giese T, Veltkamp R, 2009.

Regulatory T cells are key cerebroprotective immunomodulators in acute experimental stroke.

Nat Med 15, 192–199.

Lim HW, Hillsamer P, Banham AH, Kim CH, 2005. Cutting edge: Direct suppression of B Cells by

CD4+CD25+ regullatory T cells. J Immunol 175, 4180-4183.

Lipscomb TP, Schulman FY, Moffett D, Kennedy S, 1994. Morbilliviral disease in Atlantic bottlenose

dolphins (Tursiops truncatus) from the 1987-1988 epizootic. J Wildl Dis 30, 567–571

Liu H, Hu B, Xu D, Liew FY, 2003. CD4+CD25+ regulatory T cells cure murine colitis: the role of IL-10,

TGF-beta, and CTLA4. J Immunol 171, 5012–5017.

Liu J, Gong N, Huang X, Reynolds AD, Mosley RL, Gendelman HE, 2009. Neuromodulatory activities of

CD4+CD25+ regulatory T cells in a murine model of HIV-1 associated neurodegeneration. J

Immunol 182, 3855–3865.

Liuzzi GM, Riccio P, Dal Canto MC, 1995. Release of myelin basic protein-degrading proteolytic activity

from microglia and macrophages after infection with Theiler’s murine encephalomyelitis virus:

comparison between susceptible and resistant mice. J Neuroimmunol 62, 91–102.

Lowther DE, Hafler DA, 2012. Regulatory T cells in the central nervous system Immunol Rev 248, 156–

169.

Ludewig B, Odermatt B, Landmann S, Hengartner H, Zinkernagel RM, 1998. Dendritic cells induce

autoimmune diabetes and maintain disease via de novo formation of local lymphoid tissue. J Exp

Med 188, 1493–1501.

Lund MJ, Hsing L, Pham TT, Rudensky Y, 2008. Coordination of early protective immunity to viral

infection by regulatory T cells. Science, 320, 1220–1224.

Luo X, Tarbell KV, Yang H, Pothoven K, Bailey SL, Ding R, Steinman RM, Suthanthiran M, 2007.

Dendritic cells with TGF-beta1 differentiate naive CD4+CD25- T cells into islet-protective Foxp3+

regulatory T cells. Proc Natl Acad Sci USA 104, 2821–2826.

Lutz MB, Schuler G, 2002. Immature, semi-mature and fully mature dendritic cells: which signals induce

tolerance or immunity? Trends in Immunol 23, 445–449.

Löffler S, Lottspeich F, Lanza F, Azorsa DO, ter Meulen V, Schneider-Schaulies J, 1997. CD9, a

tetraspan transmembrane protein, renders cells susceptible to canine distemper virus. J Virol 71,

42–49.

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20MZ%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu%20FD%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20XH%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen%20XC%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Deng%20QW%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20ST%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu%20LM%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang%20HS%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Cui%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=19031706

http://www.ncbi.nlm.nih.gov/pubmed?term=Liesz%20A%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Suri-Payer%20E%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Veltkamp%20C%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Doerr%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Sommer%20C%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Rivest%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Giese%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Veltkamp%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19169263

http://www.ncbi.nlm.nih.gov/pubmed?term=Lim%20HW%5BAuthor%5D&cauthor=true&cauthor_uid=16177055

http://www.ncbi.nlm.nih.gov/pubmed?term=Hillsamer%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16177055

http://www.ncbi.nlm.nih.gov/pubmed?term=Banham%20AH%5BAuthor%5D&cauthor=true&cauthor_uid=16177055

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=16177055

http://www.ncbi.nlm.nih.gov/pubmed?term=Cutting%20Edge%E2%80%AF%3A%20Direct%20Suppression%20of%20B%20Cells

http://www.ncbi.nlm.nih.gov/pubmed?term=Lipscomb%20TP%5BAuthor%5D&cauthor=true&cauthor_uid=7760492

http://www.ncbi.nlm.nih.gov/pubmed?term=Schulman%20FY%5BAuthor%5D&cauthor=true&cauthor_uid=7760492

http://www.ncbi.nlm.nih.gov/pubmed?term=Moffett%20D%5BAuthor%5D&cauthor=true&cauthor_uid=7760492

http://www.ncbi.nlm.nih.gov/pubmed?term=Kennedy%20S%5BAuthor%5D&cauthor=true&cauthor_uid=7760492

http://www.ncbi.nlm.nih.gov/pubmed?term=Hu%20B%5BAuthor%5D&cauthor=true&cauthor_uid=14607897

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu%20D%5BAuthor%5D&cauthor=true&cauthor_uid=14607897

http://www.ncbi.nlm.nih.gov/pubmed?term=Liew%20FY%5BAuthor%5D&cauthor=true&cauthor_uid=14607897

http://www.ncbi.nlm.nih.gov/pubmed?term=Gong%20N%5BAuthor%5D&cauthor=true&cauthor_uid=19265165

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20X%5BAuthor%5D&cauthor=true&cauthor_uid=19265165

http://www.ncbi.nlm.nih.gov/pubmed?term=Reynolds%20AD%5BAuthor%5D&cauthor=true&cauthor_uid=19265165

http://www.ncbi.nlm.nih.gov/pubmed?term=Mosley%20RL%5BAuthor%5D&cauthor=true&cauthor_uid=19265165

http://www.ncbi.nlm.nih.gov/pubmed?term=Gendelman%20HE%5BAuthor%5D&cauthor=true&cauthor_uid=19265165

http://www.ncbi.nlm.nih.gov/pubmed?term=Liuzzi%20GM%5BAuthor%5D&cauthor=true&cauthor_uid=7499498

http://www.ncbi.nlm.nih.gov/pubmed?term=Riccio%20P%5BAuthor%5D&cauthor=true&cauthor_uid=7499498

http://www.ncbi.nlm.nih.gov/pubmed?term=Dal%20Canto%20MC%5BAuthor%5D&cauthor=true&cauthor_uid=7499498

http://www.ncbi.nlm.nih.gov/pubmed?term=Odermatt%20B%5BAuthor%5D&cauthor=true&cauthor_uid=9782126

http://www.ncbi.nlm.nih.gov/pubmed?term=Landmann%20S%5BAuthor%5D&cauthor=true&cauthor_uid=9782126

http://www.ncbi.nlm.nih.gov/pubmed?term=Hengartner%20H%5BAuthor%5D&cauthor=true&cauthor_uid=9782126

http://www.ncbi.nlm.nih.gov/pubmed?term=Zinkernagel%20RM%5BAuthor%5D&cauthor=true&cauthor_uid=9782126

http://www.ncbi.nlm.nih.gov/pubmed?term=Tarbell%20KV%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20H%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Pothoven%20K%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Bailey%20SL%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Ding%20R%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Steinman%20RM%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Suthanthiran%20M%5BAuthor%5D&cauthor=true&cauthor_uid=17307871

http://www.ncbi.nlm.nih.gov/pubmed?term=Lottspeich%20F%5BAuthor%5D&cauthor=true&cauthor_uid=8985321

http://www.ncbi.nlm.nih.gov/pubmed?term=Lanza%20F%5BAuthor%5D&cauthor=true&cauthor_uid=8985321

http://www.ncbi.nlm.nih.gov/pubmed?term=Azorsa%20DO%5BAuthor%5D&cauthor=true&cauthor_uid=8985321



124


Lühn K, Simmons CP, Moran E, Dung NT, Chau TN, Quyen NT, Thao le TT, Van Ngoc T, Dung NM, Wills

B, Farrar J, McMichael AJ, Dong T, Rowland-Jones S, 2007. Increased frequencies of CD4+

CD25(high) regulatory T cells in acute dengue infection. J Exp Med 204, 979–985.

Macatonia SE, Hosken NA, Litton M, Vieira P, Hsieh CS, Culpepper JA, Wysocka M, Trinchieri G, Murphy

KM, O’Garra A, 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from

naïve CD4 T cells. J Immunol 154, 5071–5079.

MacDonald AJ, Duffy M, Brady MT, McKiernan S, Hall W, Hegarty J, Curry M, Mills KH, 2002. CD4 T

helper Type 1 and regulatory T cells induced against the same epitopes on the core protein in

hepatitis C virus-infected persons. J Infect Dis 185, 720–727.

Mantovani A, Sica A, Locati M, 2005. Macrophage polarization comes of age. Immunity. 23, 344–346.

Marik C, Felts PA, Bauer J, Lassmann H, Smith KJ, 2007. Lesion genesis in a subset of patients with

multiple sclerosis : a role for innate immunity? Brain 130, 2800–2815.

Markus S, Failing K, Baumgärtner W, 2002. Increased expression of pro-inflammatory cytokines and lack

of up-regulation of anti-inflammatory cytokines in early distemper CNS lesions. J Neuroimmunol

125, 30–41.

Massacesi L, 2002. Compartmentalization of the immune response in the central nervous system and

natural history of multiple sclerosis Implications for therapy. Clin Neurol Neurosurg 104, 177–181.

McMahon EJ, Bailey SL, Castenada CV, Waldner H, Miller SD, 2005. Epitope spreading initiates in the

CNS in two mouse models of multiple sclerosis. Nat Med 11, 335–339.

McMenamin PG, 1999. Distribution and phenotype of dendritic cells and resident tissue macrophages in

the dura mater, leptomeninges, and choroid plexus of the rat brain as demonstrated in

wholemount preparations. J Comp Neurol 405, 553–562.

Meinl E, Krumbholz M, Derfuss T, Junker A, Hohlfeld R, 2008. Compartmentalization of inflammation in

the CNS: a major mechanism driving progressive multiple sclerosis. J Neurol Sci 274, 42–44.

Mielcarek M, Torok-Storb B, Storb R, 2011. Pharmacological immunosuppression reduces but does not

eliminate the need for total-body irradiation in nonmyeloablative conditioning regimens for

hematopoietic cell transplantation. Biol Blood Marrow Transplant 17, 1255–1260.

Miele JA, Krakowka S, 1983. Antibody responses to virion polypeptides in gnotobiotic dogs infected with

canine distemper virus. Infect Immunity 41, 869–871.

Mikita J, Dubourdieu-Cassagno N, Deloire MS, Vekris A, Biran M, Raffard G, Brochet B, Canron MH,

Franconi JM, Boiziau C, Petry KG, 2011. Altered M1/M2 activation patterns of monocytes in

severe relapsing experimental rat model of multiple sclerosis Amelioration of clinical status by M2

activated monocyte administration. Multi Scler 17, 2–15

Mikloska Z, Bosnjak L, Cunningham AL, 2001. Immature monocyte-derived dendritic cells are

productively infected with herpes simplex virus type 1. J Virol 75, 5958–5964.

http://www.ncbi.nlm.nih.gov/pubmed?term=Simmons%20CP%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Moran%20E%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Dung%20NT%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Chau%20TN%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Quyen%20NT%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Thao%20le%20TT%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Van%20Ngoc%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Dung%20NM%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Wills%20B%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Wills%20B%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=Farrar%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=McMichael%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=McMichael%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=17452519

http://www.ncbi.nlm.nih.gov/pubmed?term=MacDonald%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Duffy%20M%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Brady%20MT%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=McKiernan%20S%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Hall%20W%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Hegarty%20J%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Curry%20M%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Mills%20KH%5BAuthor%5D&cauthor=true&cauthor_uid=11920289

http://www.ncbi.nlm.nih.gov/pubmed?term=Mantovani%20A%5BAuthor%5D&cauthor=true&cauthor_uid=16226499

http://www.ncbi.nlm.nih.gov/pubmed?term=Sica%20A%5BAuthor%5D&cauthor=true&cauthor_uid=16226499

http://www.ncbi.nlm.nih.gov/pubmed?term=Locati%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16226499

http://www.ncbi.nlm.nih.gov/pubmed?term=Marik%20C%5BAuthor%5D&cauthor=true&cauthor_uid=17956913

http://www.ncbi.nlm.nih.gov/pubmed?term=Felts%20PA%5BAuthor%5D&cauthor=true&cauthor_uid=17956913

http://www.ncbi.nlm.nih.gov/pubmed?term=Bauer%20J%5BAuthor%5D&cauthor=true&cauthor_uid=17956913

http://www.ncbi.nlm.nih.gov/pubmed?term=Lassmann%20H%5BAuthor%5D&cauthor=true&cauthor_uid=17956913

http://www.ncbi.nlm.nih.gov/pubmed?term=Smith%20KJ%5BAuthor%5D&cauthor=true&cauthor_uid=17956913

http://www.ncbi.nlm.nih.gov/pubmed?term=McMahon%20EJ%5BAuthor%5D&cauthor=true&cauthor_uid=15735651

http://www.ncbi.nlm.nih.gov/pubmed?term=Bailey%20SL%5BAuthor%5D&cauthor=true&cauthor_uid=15735651

http://www.ncbi.nlm.nih.gov/pubmed?term=Castenada%20CV%5BAuthor%5D&cauthor=true&cauthor_uid=15735651

http://www.ncbi.nlm.nih.gov/pubmed?term=Waldner%20H%5BAuthor%5D&cauthor=true&cauthor_uid=15735651

http://www.ncbi.nlm.nih.gov/pubmed?term=Miller%20SD%5BAuthor%5D&cauthor=true&cauthor_uid=15735651

http://www.ncbi.nlm.nih.gov/pubmed?term=Krumbholz%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18715571

http://www.ncbi.nlm.nih.gov/pubmed?term=Derfuss%20T%5BAuthor%5D&cauthor=true&cauthor_uid=18715571

http://www.ncbi.nlm.nih.gov/pubmed?term=Junker%20A%5BAuthor%5D&cauthor=true&cauthor_uid=18715571

http://www.ncbi.nlm.nih.gov/pubmed?term=Hohlfeld%20R%5BAuthor%5D&cauthor=true&cauthor_uid=18715571

http://www.ncbi.nlm.nih.gov/pubmed?term=Mikita%20J%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Dubourdieu-Cassagno%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Deloire%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Vekris%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Biran%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Raffard%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Brochet%20B%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Canron%20MH%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Franconi%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Boiziau%20C%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

http://www.ncbi.nlm.nih.gov/pubmed?term=Petry%20KG%5BAuthor%5D&cauthor=true&cauthor_uid=20813772

125


Mills KHG, 2004. Regulatory T cells: friend or foe in immunity to infection? Nat Rev Immunol 4, 841–855.

Minagawa H, Tanaka K, Ono N, Tatsuo H, Yanagi Y, 2001. Induction of the measles virus receptor SLAM

(CD150) on monocytes. J Gen Virol 82, 2913–2917.

Misra N, Bayry J, Lacroix-Desmazes S, Kazatchkine MD, Kaveri SV, 2004. Cutting edge: human

CD4+CD25+ T cells restrain the maturation and antigen-presenting function of dendritic cells. J

Immunol 172, 4676–4680.

Miyara M, Sakaguchi S, 2007. Natural regulatory T cells: mechanisms of suppression. Trends Mol Med

13, 108–116.

Moore PF, Schrenzel MD, Affolter VK, Olivry T, Naydan D, 1996. Canine cutaneous histiocytoma is an

epidermotropic Langerhans cell histiocytosis that expresses CD1 and specific beta 2-integrin

molecules. Am J Pathol 148, 1699–1708.

Moore PF, 2008. Immunological concepts applied to pathologic diagnosis of proliferative diseases of the

immune system. Cancer Ther 6, 263–270.

Mori T, Shin YS, Okita M, Hirayama N, Miyashita N, Gemma T, Kai C, Mikami T, 1994. The biological

characterization of field isolates of canine distemper virus from Japan. J Gen Virol 75, 2403–

2408.

Moro L, de Sousa Martins A, de Moraes Alves C, de Araújo Santos FG, dos Santos Nunes JE, Carneiro

RA, Carvalho R, Vasconcelos AC, 2003. Apoptosis in canine distemper. Arch Virol 148, 153–164.

Murabayashi N, Kurita-Taniguchi M, Ayata M, Matsumoto M, Ogura H, Seya T, 2002. Susceptibility of

human dendritic cells (DCs) to measles virus (MV) depends on their activation stages in

conjunction with the level of CDw150: role of Toll stimulators in DC maturation and MV

amplification. Microbes Infect 4, 785–794.

Mühlebach MD, Mateo M, Sinn PL, Prüfer S, Uhlig KM, Leonard VH, Navaratnarajah CK, Frenzke M,

Wong XX, Sawatsky B, Ramachandran S, McCray PB Jr, Cichutek K, von Messling V, Lopez M,

Cattaneo R, 2012. Adherens junction protein nectin-4 is the epithelial receptor for measles virus.

Nature 480, 530-533.

Naniche D, Varior-Krishnan G, Cervoni F, Wild TF, Rossi B, Rabourdin-Combe C, Gerlier D, 1993.

Human membrane cofactor protein ( CD46 ) acts as a cellular receptor for measles virus.

Microbiology 67, 6025–6032.

Navarrete-Talloni MJ, Kalkuhl A, Deschl U, Ulrich R, Kummerfeld M, Rohn K, Baumgärtner W, Beineke A,

2010. Transient peripheral immune response and central nervous system leaky

compartmentalization in a viral model for multiple sclerosis. Brain Pathol 20, 890–901.

Nesseler A, Baumgärtner W, Gaedke K, Zurbriggen A, 1997. Abundant expression of viral nucleoprotein

mRNA and restricted translation of the corresponding viral protein in inclusion body

polioencephalitis of canine distemper. J Comp Pathol 116, 291–301.

http://www.ncbi.nlm.nih.gov/pubmed?term=Tanaka%20K%5BAuthor%5D&cauthor=true&cauthor_uid=11714966

http://www.ncbi.nlm.nih.gov/pubmed?term=Ono%20N%5BAuthor%5D&cauthor=true&cauthor_uid=11714966

http://www.ncbi.nlm.nih.gov/pubmed?term=Tatsuo%20H%5BAuthor%5D&cauthor=true&cauthor_uid=11714966

http://www.ncbi.nlm.nih.gov/pubmed?term=Yanagi%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=11714966

http://www.ncbi.nlm.nih.gov/pubmed?term=Bayry%20J%5BAuthor%5D&cauthor=true&cauthor_uid=15067041

http://www.ncbi.nlm.nih.gov/pubmed?term=Lacroix-Desmazes%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15067041

http://www.ncbi.nlm.nih.gov/pubmed?term=Kazatchkine%20MD%5BAuthor%5D&cauthor=true&cauthor_uid=15067041

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaveri%20SV%5BAuthor%5D&cauthor=true&cauthor_uid=15067041

http://www.ncbi.nlm.nih.gov/pubmed?term=Schrenzel%20MD%5BAuthor%5D&cauthor=true&cauthor_uid=8623937

http://www.ncbi.nlm.nih.gov/pubmed?term=Affolter%20VK%5BAuthor%5D&cauthor=true&cauthor_uid=8623937

http://www.ncbi.nlm.nih.gov/pubmed?term=Olivry%20T%5BAuthor%5D&cauthor=true&cauthor_uid=8623937

http://www.ncbi.nlm.nih.gov/pubmed?term=Naydan%20D%5BAuthor%5D&cauthor=true&cauthor_uid=8623937

http://www.ncbi.nlm.nih.gov/pubmed?term=Shin%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Okita%20M%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Hirayama%20N%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Miyashita%20N%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Gemma%20T%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Kai%20C%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=Mikami%20T%5BAuthor%5D&cauthor=true&cauthor_uid=8077940

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Sousa%20Martins%20A%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Moraes%20Alves%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Ara%C3%BAjo%20Santos%20FG%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=dos%20Santos%20Nunes%20JE%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=Carneiro%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=Carneiro%20RA%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=Carvalho%20R%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=Vasconcelos%20AC%5BAuthor%5D&cauthor=true&cauthor_uid=12536301

http://www.ncbi.nlm.nih.gov/pubmed?term=Kurita-Taniguchi%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12270725

http://www.ncbi.nlm.nih.gov/pubmed?term=Ayata%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12270725

http://www.ncbi.nlm.nih.gov/pubmed?term=Matsumoto%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12270725

http://www.ncbi.nlm.nih.gov/pubmed?term=Ogura%20H%5BAuthor%5D&cauthor=true&cauthor_uid=12270725

http://www.ncbi.nlm.nih.gov/pubmed?term=Seya%20T%5BAuthor%5D&cauthor=true&cauthor_uid=12270725


http://www.ncbi.nlm.nih.gov/pubmed?term=Varior-Krishnan%20G%5BAuthor%5D&cauthor=true&cauthor_uid=8371352

http://www.ncbi.nlm.nih.gov/pubmed?term=Cervoni%20F%5BAuthor%5D&cauthor=true&cauthor_uid=8371352

http://www.ncbi.nlm.nih.gov/pubmed?term=Wild%20TF%5BAuthor%5D&cauthor=true&cauthor_uid=8371352

http://www.ncbi.nlm.nih.gov/pubmed?term=Rossi%20B%5BAuthor%5D&cauthor=true&cauthor_uid=8371352


http://www.ncbi.nlm.nih.gov/pubmed?term=Gerlier%20D%5BAuthor%5D&cauthor=true&cauthor_uid=8371352

126


Nesseler A, Baumgärtner W, Zurbriggen A, Orvell C, 1999. Restricted virus protein translation in canine

distemper virus inclusion body polioencephalitis. Vet Microbiol 69, 23–28.

Nonacs R, Humborg C, Tam JP, Steinman RM, 1992. Mechanisms of mouse spleen dendritic cell

function in the generation of influenza-specific cytolytic T lymphocytes. J Exp Med 176, 519-529.

Noyce RS, Richardson CD, 2012. Nectin 4 is the epithelial cell receptor for measles virus. Trends

Microbiol 20, 429-439.

Ohgimoto K, Ohgimoto S, Ihara T, Mizuta H, Ishido S, Ayata M, Ogura H, Hotta H, 2007. Difference in

production of infectious wild-type measles and vaccine viruses in monocyte-derived dendritic

cells. Virus Res 123, 1–8.

Okada H, Kobune F, Sato TA, Kohama T, Takeuchi Y, Abe T, Takayama N, Tsuchiya T, Tashiro M, 2000.

Extensive lymphopenia due to apoptosis of uninfected lymphocytes in acute measles patients.

Arch Virol 145, 905–920.

Oldstone MBA, Lewicki H, Thomas D, Tishon A, Dales S, Patterson J, Manchester M, Homann D,

Naniche D, Holz A, 1999. Measles virus infection in a transgenic model: and central nervous

system disease. Cell 98, 629–640.

Orlando EA, Imbschweiler I, Gerhauser I, Baumgärtner W, Wewetzer K, 2008. In vitro characterization

and preferential infection by canine distemper virus of glial precursors with Schwann cell

characteristics from adult canine brain. Neuropathol App Neurobiol 34, 621–637.

Osterhaus A, Groen J, Spijkers HE, Broeders HW, UytdeHaag FG, de Vries P, Teppema JS, Visser IK,

van de Bildt MW, Vedder EJ, 1990. Mass mortality in seals caused by a newly discovered virus-

like morbillivirus. Vet Microbiol 23, 343–350.

Pasare C, Medzhitov R, 2003. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated

suppression by dendritic cells. Science 299, 1033–1036.

Paust S, Lu L, McCarty N, Cantor H, 2004. Engagement of B7 on effector T cells by regulatory T cells

prevents autoimmune disease. Proc Natl Acad Sci USA 101, 10398–10403.

Patel JR, Heldens JG, Bakonyi T, Rusvai M, 2012. Important mammalian veterinary viral

immunodiseases and their control. Vaccine 30, 1767–1781.

Pearce-Kelling S, Mitchell WJ, Summers BA, Appel MJ, 1990. Growth of canine distemper virus in

cultured astrocytes: relationship to in vivo persistence and disease. Microb Pathogen 8, 71–82.

Perrin PJ, Scott D, Quigley L, Albert PS, Feder O, Gray GS, Abe R, June CH, Racke MK, 1995. Role of

B7:CD28/CTLA-4 in the induction of chronic relapsing experimental allergic encephalomyelitis. J

Immunol 154, 1481–1490.

Piccirillo CA, Shevach EM, 2001. Cutting edge: control of CD8+ T cell activation by CD4+CD25+

immunoregulatory cells. J Immunol 167, 1137–1140.



http://www.ncbi.nlm.nih.gov/pubmed?term=Orvell%20C%5BAuthor%5D&cauthor=true&cauthor_uid=10515265

http://www.ncbi.nlm.nih.gov/pubmed?term=Ohgimoto%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Ihara%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Mizuta%20H%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Ishido%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Ayata%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Ogura%20H%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Hotta%20H%5BAuthor%5D&cauthor=true&cauthor_uid=16959355

http://www.ncbi.nlm.nih.gov/pubmed?term=Kobune%20F%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Sato%20TA%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Kohama%20T%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Takeuchi%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Abe%20T%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Takayama%20N%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Tsuchiya%20T%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Tashiro%20M%5BAuthor%5D&cauthor=true&cauthor_uid=10881678

http://www.ncbi.nlm.nih.gov/pubmed?term=Lewicki%20H%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Thomas%20D%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Tishon%20A%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Dales%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Patterson%20J%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Manchester%20M%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Homann%20D%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Naniche%20D%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Holz%20A%5BAuthor%5D&cauthor=true&cauthor_uid=10490102

http://www.ncbi.nlm.nih.gov/pubmed?term=Imbschweiler%20I%5BAuthor%5D&cauthor=true&cauthor_uid=19076697

http://www.ncbi.nlm.nih.gov/pubmed?term=Gerhauser%20I%5BAuthor%5D&cauthor=true&cauthor_uid=19076697



http://www.ncbi.nlm.nih.gov/pubmed?term=Groen%20J%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Spijkers%20HE%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Broeders%20HW%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=UytdeHaag%20FG%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Vries%20P%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Teppema%20JS%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Visser%20IK%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=van%20de%20Bildt%20MW%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Vedder%20EJ%5BAuthor%5D&cauthor=true&cauthor_uid=2205971

http://www.ncbi.nlm.nih.gov/pubmed?term=Paust%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15235129

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu%20L%5BAuthor%5D&cauthor=true&cauthor_uid=15235129

http://www.ncbi.nlm.nih.gov/pubmed?term=McCarty%20N%5BAuthor%5D&cauthor=true&cauthor_uid=15235129

http://www.ncbi.nlm.nih.gov/pubmed?term=Cantor%20H%5BAuthor%5D&cauthor=true&cauthor_uid=15235129

http://www.ncbi.nlm.nih.gov/pubmed?term=Patel%20JR%5BAuthor%5D&cauthor=true&cauthor_uid=22261411

http://www.ncbi.nlm.nih.gov/pubmed?term=Heldens%20JG%5BAuthor%5D&cauthor=true&cauthor_uid=22261411

http://www.ncbi.nlm.nih.gov/pubmed?term=Bakonyi%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22261411

http://www.ncbi.nlm.nih.gov/pubmed?term=Rusvai%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22261411

http://www.ncbi.nlm.nih.gov/pubmed?term=Mitchell%20WJ%5BAuthor%5D&cauthor=true&cauthor_uid=2333034

http://www.ncbi.nlm.nih.gov/pubmed?term=Summers%20BA%5BAuthor%5D&cauthor=true&cauthor_uid=2333034

http://www.ncbi.nlm.nih.gov/pubmed?term=Appel%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=2333034

http://www.ncbi.nlm.nih.gov/pubmed?term=Scott%20D%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Quigley%20L%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Albert%20PS%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Feder%20O%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Gray%20GS%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Abe%20R%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=June%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

http://www.ncbi.nlm.nih.gov/pubmed?term=Racke%20MK%5BAuthor%5D&cauthor=true&cauthor_uid=7529805

127


Pinteaux-Jones F, Sevastou IG, Fry VA, Heales S, Baker D, Pocock JM, 2008. Myelin-induced microglial

neurotoxicity can be controlled by microglial metabotropic glutamate receptors. J Neurochem

106, 442–454.

Plattet P, Rivals JP, Zuber B, Brunner JM, Zurbriggen A, Wittek R, 2005. The fusion protein of wild-type

canine distemper virus is a major determinant of persistent infection. Virology 337, 312–326.

Plattet P, Cherpillod P, Wiener D, Zipperle L, Vandevelde M, Wittek R, Zurbriggen A, 2007. Signal

peptide and helical bundle domains of virulent canine distemper virus fusion protein restrict

fusogenicity. J Virol 81, 11413–11425.

Pringle CR, 1999. Virus taxonomy at the XIth international congress of virology, Sydney, Australia, Arch

Virol 144, 2065–2070.

Syme R, Bajwa R, Robertson L Stewart D, Glück S, 2005. Comparison of CD34 and monocyte-derived

dendritic cells from mobilized peripheral blood from cancer patients. Stem Cells 23, 74–81.

Rai AK, Thakur CP, Singh A, Seth T, Srivastava SK, Singh P, Mitra DK, 2012. Regulatory T cells

suppress T cell activation at the pathologic site of human visceral leishmaniasis. PloS One 7,

pe31551.

Relland LM, Williams JB, Relland GN, Haribhai D, Ziegelbauer J, Yassai M, Gorski J, Williams CB, 2012.

The TCR repertoires of regulatory and conventional T cells specific for the same foreign antigen

are distinct. J Immunol 189, 3566–3574.

Reuter D, Sparwasser T,Hünig T, Schneider-Schaulies J, 2012. Foxp3+ regulatory T cells control

persistence of viral CNS infection. PLoS One 7, pe33989.

Richards MH, Getts MT, Podojil JR, Jin YH, Kim BS, Miller SD, 2012. Virus expanded regulatory T cells

control disease severity in the Theiler’s virus mouse model of MS. J Autoimmun 36, 142–154.

Ricklin Gutzwiller ME, Moulin HR, Zurbriggen A, Roosje P, Summerfield A, 2010. Comparative analysis of

canine monocyte- and bone-marrow-derived dendritic cells. Vet Res 41, 40.

Ricklin ME, Roosje P, Summerfield A, 2010. Characterization of canine dendritic cells in healthy, atopic,

and non-allergic inflamed skin. J Clin Immunol 30, 845–854.

Rima KB, Duffy N, Mitchell JW, Summers AB, Appel GJM, 1991. Correlation between humoral immune

responses and presence of virus in the CNS in dogs experimentally infected with canine

distemper virus. Arch Virol 121, 1–8.

Rinaldo CR, Piazza P, 2004. Virus infection of dendritic cells: portal for host invasion and host defense.

Trends Microbiol 12, 337–345.

Rothwell NJ, 1997. Neuroimmune interactions : the role of cytokines. Brit J Pharmacol 121, 841–847.

Rudd PA, Bastien-Hamel LE, Von Messling V, 2010. Acute canine distemper encephalitis is associated

with rapid neuronal loss and local immune activation. J Gen Virol 91, 980–989.

http://www.ncbi.nlm.nih.gov/pubmed?term=Pinteaux-Jones%20F%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Sevastou%20IG%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Fry%20VA%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Heales%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Baker%20D%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Pocock%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=18419765

http://www.ncbi.nlm.nih.gov/pubmed?term=Rivals%20JP%5BAuthor%5D&cauthor=true&cauthor_uid=15893783

http://www.ncbi.nlm.nih.gov/pubmed?term=Zuber%20B%5BAuthor%5D&cauthor=true&cauthor_uid=15893783

http://www.ncbi.nlm.nih.gov/pubmed?term=Brunner%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=15893783


http://www.ncbi.nlm.nih.gov/pubmed?term=Wittek%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15893783

http://www.ncbi.nlm.nih.gov/pubmed?term=Cherpillod%20P%5BAuthor%5D&cauthor=true&cauthor_uid=17686846

http://www.ncbi.nlm.nih.gov/pubmed?term=Wiener%20D%5BAuthor%5D&cauthor=true&cauthor_uid=17686846

http://www.ncbi.nlm.nih.gov/pubmed?term=Zipperle%20L%5BAuthor%5D&cauthor=true&cauthor_uid=17686846




http://www.ncbi.nlm.nih.gov/pubmed?term=Thakur%20CP%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Seth%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Srivastava%20SK%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20P%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Mitra%20DK%5BAuthor%5D&cauthor=true&cauthor_uid=22347492

http://www.ncbi.nlm.nih.gov/pubmed?term=Williams%20JB%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Relland%20GN%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Haribhai%20D%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Ziegelbauer%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Yassai%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Gorski%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Williams%20CB%5BAuthor%5D&cauthor=true&cauthor_uid=22933635

http://www.ncbi.nlm.nih.gov/pubmed?term=Sparwasser%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22448284

http://www.ncbi.nlm.nih.gov/pubmed?term=H%C3%BCnig%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22448284


http://www.ncbi.nlm.nih.gov/pubmed?term=Getts%20MT%5BAuthor%5D&cauthor=true&cauthor_uid=21273044

http://www.ncbi.nlm.nih.gov/pubmed?term=Podojil%20JR%5BAuthor%5D&cauthor=true&cauthor_uid=21273044

http://www.ncbi.nlm.nih.gov/pubmed?term=Jin%20YH%5BAuthor%5D&cauthor=true&cauthor_uid=21273044

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20BS%5BAuthor%5D&cauthor=true&cauthor_uid=21273044

http://www.ncbi.nlm.nih.gov/pubmed?term=Miller%20SD%5BAuthor%5D&cauthor=true&cauthor_uid=21273044

http://www.ncbi.nlm.nih.gov/pubmed?term=Moulin%20HR%5BAuthor%5D&cauthor=true&cauthor_uid=20167201


http://www.ncbi.nlm.nih.gov/pubmed?term=Roosje%20P%5BAuthor%5D&cauthor=true&cauthor_uid=20167201

http://www.ncbi.nlm.nih.gov/pubmed?term=Summerfield%20A%5BAuthor%5D&cauthor=true&cauthor_uid=20167201

128


Rudd PA, Cattaneo R, Von Messling V, 2006. Canine distemper virus uses both the anterograde and the

hematogenous pathway for neuroinvasion. J Virol 80, 9361–9370.

Röthlisberger A, Wiener D, Schweizer M, Peterhans E, Zurbriggen A, Plattet P, 2010. Two domains of the

V protein of virulent canine distemper virus selectively inhibit STAT1 and STAT2 nuclear import. J

Virol 84, 6328–6343.

Saliki TJ, Cooper JE, Gustavson PJ, 2002. Emerging morbillivirus infections of marine mammals. Ann NY

Acad Sci 5, 51–59.

Sakaguchi S, 2003. Regulatory T cells: mediating compromises between host and parasite. Nat Immunol

4, 10–11.

Sakaguchi S, Ono M, Setoguchi R, Yagi H, Hori S, Fehervari Z, Shimizu J, Takahashi T, Nomura T, 2006.

Foxp3+ CD25+ CD4+ natural regulatory T cells in dominant self-tolerance and autoimmune

disease. Immunol Rev 212, 8–27.

Salomon B, Lenschow DJ, Rhee L, Ashourian N, Singh B, Sharpe A, Bluestone JA, 2000. B7/CD28

costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that

control autoimmune diabetes. Immunity 12, 431–440.

Sarris M, Andersen KG, Randow F, Mayr L, Betz AG, 2008. Neuropilin-1 expression on regulatory T cells

enhances their interactions with dendritic cells during antigen recognition Immunity 28, 402–413.

Sato H, Yoneda M, Honda T, Kai C, 2012. Morbillivirus receptors and tropism: multiple pathways for

infection. Front Microbiol 3, 75.

Schmid E, Zurbriggen A, Gassen U, Rima B, ter Meulen V, Schneider-Schaulies J, 2000. Antibodies to

CD9 , a tetraspan transmembrane protein, inhibit canine distemper virus-induced cell-cell fusion

but not virus-cell fusion. J Virol 74, 7554–7561.

Schneider-Schaulies S, Klagge IM, ter Meulen V, 2003. Dendritic cells and measles virus infection. Curr

Topics Microbiol Immunol 276, 77–101.

Schneider-schaulies S, ter Meulen V, 2002. Measles virus and immunomodulation : molecular bases and

perspectives Measles virus and immunomodulation. Exp Rev Mol Med 4, 1–18.

Schneider-Schaulies S, Bieback K, Avota E, Klagge I, ter Meulen V, 2002. Regulation of gene expression

in lymphocytes and antigen-presenting cells by measles virus: consequences for

immunomodulation. J Mol Med 80, 73–85.

Schneider-Schaulies S, Dittmer U, 2006. Silencing T cells or T-cell silencing: concepts in virus-induced

immunosuppression. J Gen Virol 87, 1423–38.

Schnorr JJ, Xanthakos S, Keikavoussi P, Kämpgen E, ter Meulen V, Schneider-Schaulies S, 1997.

Induction of maturation of human blood dendritic cell precursors by measles virus is associated

with immunosuppression. Proc Natl Acad Sci USA 94, 5326–5331.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wiener%20D%5BAuthor%5D&cauthor=true&cauthor_uid=20427537

http://www.ncbi.nlm.nih.gov/pubmed?term=Schweizer%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20427537

http://www.ncbi.nlm.nih.gov/pubmed?term=Peterhans%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20427537



http://www.ncbi.nlm.nih.gov/pubmed?term=Sakaguchi%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Ono%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Setoguchi%20R%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Yagi%20H%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Hori%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Fehervari%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Shimizu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Takahashi%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Nomura%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16903903

http://www.ncbi.nlm.nih.gov/pubmed?term=Lenschow%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Rhee%20L%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Ashourian%20N%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20B%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Sharpe%20A%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Bluestone%20JA%5BAuthor%5D&cauthor=true&cauthor_uid=10795741

http://www.ncbi.nlm.nih.gov/pubmed?term=Sarris%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18328743

http://www.ncbi.nlm.nih.gov/pubmed?term=Andersen%20KG%5BAuthor%5D&cauthor=true&cauthor_uid=18328743

http://www.ncbi.nlm.nih.gov/pubmed?term=Randow%20F%5BAuthor%5D&cauthor=true&cauthor_uid=18328743

http://www.ncbi.nlm.nih.gov/pubmed?term=Mayr%20L%5BAuthor%5D&cauthor=true&cauthor_uid=18328743

http://www.ncbi.nlm.nih.gov/pubmed?term=Betz%20AG%5BAuthor%5D&cauthor=true&cauthor_uid=18328743

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoneda%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22403577

http://www.ncbi.nlm.nih.gov/pubmed?term=Honda%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22403577

http://www.ncbi.nlm.nih.gov/pubmed?term=Kai%20C%5BAuthor%5D&cauthor=true&cauthor_uid=22403577


http://www.ncbi.nlm.nih.gov/pubmed?term=Gassen%20U%5BAuthor%5D&cauthor=true&cauthor_uid=10906209

http://www.ncbi.nlm.nih.gov/pubmed?term=Rima%20B%5BAuthor%5D&cauthor=true&cauthor_uid=10906209



http://www.ncbi.nlm.nih.gov/pubmed?term=Bieback%20K%5BAuthor%5D&cauthor=true&cauthor_uid=11907644

http://www.ncbi.nlm.nih.gov/pubmed?term=Avota%20E%5BAuthor%5D&cauthor=true&cauthor_uid=11907644

http://www.ncbi.nlm.nih.gov/pubmed?term=Klagge%20I%5BAuthor%5D&cauthor=true&cauthor_uid=11907644


http://www.ncbi.nlm.nih.gov/pubmed?term=Xanthakos%20S%5BAuthor%5D&cauthor=true&cauthor_uid=9144236

http://www.ncbi.nlm.nih.gov/pubmed?term=Keikavoussi%20P%5BAuthor%5D&cauthor=true&cauthor_uid=9144236

http://www.ncbi.nlm.nih.gov/pubmed?term=K%C3%A4mpgen%20E%5BAuthor%5D&cauthor=true&cauthor_uid=9144236


http://www.ncbi.nlm.nih.gov/pubmed?term=Schneider-Schaulies%20S%5BAuthor%5D&cauthor=true&cauthor_uid=9144236

129


Schobesberger M, Zurbriggen A, Doherr MG, Weissenböck H, Vandevelde M, Lassmann H, Griot C,

2002. Demyelination precedes oligodendrocyte loss in canine distemper virus-induced

encephalitis. Acta Neuropathol 103, 11-19.

Schobesberger M, Summerfield A, Doherr MG, Zurbriggen A, Griot C, 2005. Canine distemper virus-

induced depletion of uninfected lymphocytes is associated with apoptosis. Vet Immunol


Seehusen, F, Orlando, EA, Wewetzer, K, Baumgärtner, W, 2007. Vimentin-positive astrocytes in canine

distemper: a target for canine distemper virus especially in chronic demyelinating lesions? Acta

Neuropathol 114, 597–608.

Seehusen F, Baumgärtner W, 2010. Axonal pathology and loss precede demyelination and accompany

chronic lesions in a spontaneously occurring animal model of multiple sclerosis. Brain Pathol 20,

551–559.

Sellin CI, Jégou JF, Renneson J, Druelle J, Wild TF, Marie JC, Horvat B, 2009. Interplay between virus-

specific effector response and Foxp3 regulatory T cells in measles virus immunopathogenesis.

PloS One 4, e4948.

Serra P, Amrani A, Yamanouchi J, Han B, Thiessen S, Utsugi T, Verdaguer J, Santamaria P, 2003. CD40

ligation releases immature dendritic cells from the control of regulatory CD4+CD25+ T cells.

Immunity 19, 877–889.

Servet-Delprat C, Vidalain PO, Bausinger H, Manié S, Le Deist F, Azocar O, Hanau D, Fischer A,

Rabourdin-Combe C, 2000. Measles virus induces abnormal differentiation of CD40 ligand-

activated human dendritic cells. J Immunol 164, 1753–1760.

Shevach EM, 2002. CD4+ CD25+ suppressor T cells: more questions than answers. Nat Rev Immunol 2,

389–400.

Shishkova Y, Harms H, Krohne G, Avota E, Schneider-Schaulies S, 2007. Immune synapses formed with

measles virus-infected dendritic cells are unstable and fail to sustain T cell activation. Cell

Microbiol 9, 1974–1986.

Silva SJ, Andrade CA, Santana CC, Santos QL, de Oliveira IC, Vassallo J, dos-Santos CLW, 2012. Low

CXCL13 expression, splenic lymphoid tissue atrophy and germinal center disruption in severe

canine visceral leishmaniasis. PLoS ONE 7, e29103.

Simon-Martínez J, Ulloa-Arvizu R, Soriano VE, Fajardo R, 2008. Identification of a genetic variant of

canine distemper virus from clinical cases in two vaccinated dogs in Mexico. Vet J 175, 423–426.

Sips G, Chesik D, Glazenburg L, Wilschut J, De Keyser J, Wilczak N, 2007. Involvement of morbilliviruses

in the pathogenesis of demyelinating disease. Rev Med Virol 17, 223–244.

http://www.ncbi.nlm.nih.gov/pubmed?term=Schobesberger%20M%5BAuthor%5D&cauthor=true&cauthor_uid=11837742


http://www.ncbi.nlm.nih.gov/pubmed?term=Doherr%20MG%5BAuthor%5D&cauthor=true&cauthor_uid=11837742

http://www.ncbi.nlm.nih.gov/pubmed?term=Weissenb%C3%B6ck%20H%5BAuthor%5D&cauthor=true&cauthor_uid=11837742


http://www.ncbi.nlm.nih.gov/pubmed?term=Lassmann%20H%5BAuthor%5D&cauthor=true&cauthor_uid=11837742

http://www.ncbi.nlm.nih.gov/pubmed?term=Griot%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11837742


http://www.ncbi.nlm.nih.gov/pubmed?term=Summerfield%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15661329

http://www.ncbi.nlm.nih.gov/pubmed?term=Doherr%20MG%5BAuthor%5D&cauthor=true&cauthor_uid=15661329


http://www.ncbi.nlm.nih.gov/pubmed?term=Griot%20C%5BAuthor%5D&cauthor=true&cauthor_uid=15661329

http://www.ncbi.nlm.nih.gov/pubmed?term=Orlando%20EA%5BAuthor%5D&cauthor=true&cauthor_uid=17965866



http://www.ncbi.nlm.nih.gov/pubmed?term=J%C3%A9gou%20JF%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Renneson%20J%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Druelle%20J%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Wild%20TF%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Marie%20JC%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Horvat%20B%5BAuthor%5D&cauthor=true&cauthor_uid=19319188

http://www.ncbi.nlm.nih.gov/pubmed?term=Serra%20P%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Amrani%20A%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Yamanouchi%20J%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Han%20B%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Thiessen%20S%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Utsugi%20T%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Verdaguer%20J%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Santamaria%20P%5BAuthor%5D&cauthor=true&cauthor_uid=14670304

http://www.ncbi.nlm.nih.gov/pubmed?term=Vidalain%20PO%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Bausinger%20H%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Mani%C3%A9%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Le%20Deist%20F%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Azocar%20O%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Hanau%20D%5BAuthor%5D&cauthor=true&cauthor_uid=10657621

http://www.ncbi.nlm.nih.gov/pubmed?term=Fischer%20A%5BAuthor%5D&cauthor=true&cauthor_uid=10657621


http://www.ncbi.nlm.nih.gov/pubmed?term=Ulloa-Arvizu%20R%5BAuthor%5D&cauthor=true&cauthor_uid=17382567

http://www.ncbi.nlm.nih.gov/pubmed?term=Soriano%20VE%5BAuthor%5D&cauthor=true&cauthor_uid=17382567

http://www.ncbi.nlm.nih.gov/pubmed?term=Fajardo%20R%5BAuthor%5D&cauthor=true&cauthor_uid=17382567

130


Skripuletz T, Lindner M, Kotsiari A, Garde N, Fokuhl J, Linsmeier F, Trebst C, Stangel M, 2008. Cortical

demyelination is prominent in the murine cuprizone model and is strain-dependent. Am J Pathol

172, 1053–1061.

Skripuletz T, Bussmann JH, Gudi V, Koutsoudaki PN, Pul R, Moharregh-Khiabani D, Lindner M, Stangel

M, 2010. Cerebellar cortical demyelination in the murine cuprizone model. Brain Pathol 20, 301–

312.

Smed-Sörensen A, Chalouni C, Chatterjee B, Cohn L, Blattmann P, Nakamura N, Delamarre L,

Mellman I, 2012. Influenza A virus infection of human primary dendritic cells impairs their ability to

cross-present antigen to CD8 T cells. PLoS Pathog 8, e1002572.

Spitzbarth I, Bock P, Haist V, Stein VM, Tipold A, Wewetzer K, Baumgärtner W, Beineke A, 2011.

Prominent microglial activation in the early proinflammatory immune response in naturally

occurring canine spinal cord injury. J Neuropathol Exp Neurol 70, 703–714.

Spitzbarth I, Baumgärtner W, Beineke A, 2012. The role of pro- and anti-inflammatory cytokines in the

pathogenesis of spontaneous canine CNS diseases. Vet Immunol Immunopathol 147, 6–24.

Stasiolek M, Bayas A, Kruse N, Wieczarkowiecz A, Toyka KV, Gold R, Selmaj K, 2006. Impaired

maturation and altered regulatory function of plasmacytoid dendritic cells in multiple sclerosis.

Brain 129, 1293–1305.

Stein VM, Czub M, Schreiner N, Moore PF, Vandevelde M, Zurbriggen A, Tipold A, 2004. Microglial cell

activation in demyelinating canine distemper lesions. J Neuroimmunol 153, 122–131.

Stein VM, Baumgärtner W, Kreienbrock L, Zurbriggen A, Vandevelde M, Tipold A, 2006. Canine

microglial cells: stereotypy in immunophenotype and specificity in function? Vet Immunol


Stein VM, Baumgärtner W, Schröder S, Zurbriggen A, Vandevelde M, Tipold A, 2007. Differential

expression of CD45 on canine microglial cells. J Vet Med A Physiol Pathol Clin Med 54, 314–320.

Stein VM, Schreiner NM, Moore PF, Vandevelde M, Zurbriggen A, Tipold A, 2008. Immunophenotypical

characterization of monocytes in canine distemper virus infection. Vet Microbiol 131, 237–246.

Stein VM, Puff C, Genini S, Contioso VB, Baumgärtner W, Tipold A, 2011. Variations on brain microglial

gene expression of MMPs, RECK, and TIMPs in inflammatory and non-inflammatory diseases in

dogs. Vet Immunol Immunopathol 144, 17–26.

Steinman RM, Nussenzweig MC, 2002. Avoiding horror autotoxicus: the importance of dendritic cells in

peripheral T cell tolerance. Proc Natl Acad Sci USA 99, 351–358.

Steinman RM, 2007. Dendritic cells: versatile controllers of the immune system. Nat Med 13, 1155-1159.

Stern LB, Greenberg M, Gershoni JM, Rozenblatt S, 1995. The hemagglutinin envelope protein of canine

distemper virus (CDV) confers cell tropism as illustrated by CDV and measles virus

complementation analysis. J Virol 69, 1661–1668.

http://www.ncbi.nlm.nih.gov/pubmed?term=Skripuletz%20T%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Lindner%20M%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Kotsiari%20A%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Garde%20N%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Fokuhl%20J%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Linsmeier%20F%5BAuthor%5D&cauthor=true&cauthor_uid=18349131

http://www.ncbi.nlm.nih.gov/pubmed?term=Trebst%20C%5BAuthor%5D&cauthor=true&cauthor_uid=18349131


http://www.ncbi.nlm.nih.gov/pubmed?term=Skripuletz%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Bussmann%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Gudi%20V%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Koutsoudaki%20PN%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Pul%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Moharregh-Khiabani%20D%5BAuthor%5D&cauthor=true&cauthor_uid=19371354

http://www.ncbi.nlm.nih.gov/pubmed?term=Lindner%20M%5BAuthor%5D&cauthor=true&cauthor_uid=19371354



http://www.ncbi.nlm.nih.gov/pubmed?term=Bock%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21760535

http://www.ncbi.nlm.nih.gov/pubmed?term=Haist%20V%5BAuthor%5D&cauthor=true&cauthor_uid=21760535

http://www.ncbi.nlm.nih.gov/pubmed?term=Stein%20VM%5BAuthor%5D&cauthor=true&cauthor_uid=21760535

http://www.ncbi.nlm.nih.gov/pubmed?term=Tipold%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21760535






http://www.ncbi.nlm.nih.gov/pubmed?term=Kreienbrock%20L%5BAuthor%5D&cauthor=true&cauthor_uid=16834995






http://www.ncbi.nlm.nih.gov/pubmed?term=Schr%C3%B6der%20S%5BAuthor%5D&cauthor=true&cauthor_uid=17650152





http://www.ncbi.nlm.nih.gov/pubmed?term=Schreiner%20NM%5BAuthor%5D&cauthor=true&cauthor_uid=18472370

http://www.ncbi.nlm.nih.gov/pubmed?term=Moore%20PF%5BAuthor%5D&cauthor=true&cauthor_uid=18472370





http://www.ncbi.nlm.nih.gov/pubmed?term=Puff%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21802747

http://www.ncbi.nlm.nih.gov/pubmed?term=Genini%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21802747

http://www.ncbi.nlm.nih.gov/pubmed?term=Contioso%20VB%5BAuthor%5D&cauthor=true&cauthor_uid=21802747



http://www.ncbi.nlm.nih.gov/pubmed?term=%22Steinman%20RM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=Dendritic%20cells%3A%20versatile%20controllers%20of%20the%20immune%20system

http://www.ncbi.nlm.nih.gov/pubmed?term=Greenberg%20M%5BAuthor%5D&cauthor=true&cauthor_uid=7853502

http://www.ncbi.nlm.nih.gov/pubmed?term=Gershoni%20JM%5BAuthor%5D&cauthor=true&cauthor_uid=7853502

http://www.ncbi.nlm.nih.gov/pubmed?term=Rozenblatt%20S%5BAuthor%5D&cauthor=true&cauthor_uid=7853502

131


Stettler M, Beck K, Wagner A, Vandevelde M, Zurbriggen A, 1997. Determinants of persistence in canine

distemper viruses. Vet Microbiol 57, 83–93.

Stimmer L, Siebert U, Wohlsein P, Fontaine JJ, Baumgärtner W, Beineke A, 2010. Viral protein

expression and phenotyping of inflammatory responses in the central nervous system of phocine

distemper virus-infected harbor seals (Phoca vitulina). Vet Microbiol 145, 23–33.

Sugiura K, Wijewardana V, Fujimoto M, Akazawa T, Yahata M, Mito K, Hatoya S, Inoue N, Inaba T, 2010.

Effect of IL-12 on canine dendritic cell maturation following differentiation induced by granulocyte-

macrophage CSF and IL-4. Vet Immunol Immunopathol 137, 322–326.

Suter SE, Chein MB, von Messling V, Yip B, Cattaneo R, Vernau W, Madewell BR, London CA, 2005. In

vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for

lymphoma. Clin Cancer Res 11, 1579-1587.

Summers BA, Appel MJ, 1994. Aspects of canine distemper virus and measles virus encephalomyelitis.

Neuropathol Appl Neurobiol 20, 525-534.

Svitek N, von Messling V, 2007. Early cytokine mRNA expression profiles predict Morbillivirus disease

outcome in ferrets. Virology 362, 404–410.

Tada Y, Nagasawa K, Ho A, Morito F, Ushiyama O, Suzuki N, Ohta H, Mak TW, 1999. CD28-deficient

mice are highly resistant to collagen-induced arthritis. J Immunol 162, 203–208.

Tarbell KV, Yamazaki S, Olson K, Toy P, Steinman RM, 2004. CD25+ CD4+ T cells, expanded with

dendritic cells presenting a single autoantigenic peptide, suppress autoimmune diabetes. J Exp

Med 199, 1467–1477.

Tatsuo H, Ono N, Tanaka K, Yanagi Y, 2000. SLAM ( CDw150 ) is a cellular receptor. Nature 406, 893–

897.

Tipold A , Moore P, Zurbriggen A, Burgener I, Barben G, Vandevelde M, 1999. Early T cell response in

the central nervous system in canine distemper virus infection. Acta Neuropathol 97, 45–56.

Tizard IR, 2009 Veterinary immunology: An introduction Sunders Elsevier,´ISBN 978-1-4160-4989-0, p

89-95.

Trifilo MJ, Hahm B, Zuniga EI, Edelmann KH, Oldstone MB, 2006. Dendritic cell inhibition: memoirs from

immunosuppressive viruses. J Infect Dis 194, 3–10.

Tsunoda I, Fujinami RS, 2002. Inside-out versus outside-in models for virus induced demyelination:

axonal damage triggering demyelination. Springer Semin Immunopathol 24, 105–125.

Valencia X, Stephens G, Goldbach-Mansky R, Wilson M, Shevach EM, Lipsky PE, 2006. TNF

downmodulates the function of human CD4+CD25hi T-regulatory cells. Blood 108, 253–261.

Vandevelde M, Kristensen B, Braund KG, Greene CE, Swango LJ, Hoerlein BF, 1980. Chronic canine

distemper virus encephalitis in mature dogs. Vet Pathol 17, 17–29.

http://www.ncbi.nlm.nih.gov/pubmed?term=Beck%20K%5BAuthor%5D&cauthor=true&cauthor_uid=9231983

http://www.ncbi.nlm.nih.gov/pubmed?term=Wagner%20A%5BAuthor%5D&cauthor=true&cauthor_uid=9231983



http://www.ncbi.nlm.nih.gov/pubmed?term=Siebert%20U%5BAuthor%5D&cauthor=true&cauthor_uid=20303682

http://www.ncbi.nlm.nih.gov/pubmed?term=Wohlsein%20P%5BAuthor%5D&cauthor=true&cauthor_uid=20303682

http://www.ncbi.nlm.nih.gov/pubmed?term=Fontaine%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=20303682



http://www.ncbi.nlm.nih.gov/pubmed?term=Wijewardana%20V%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujimoto%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Akazawa%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Yahata%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Mito%20K%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Hatoya%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Inoue%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=Inaba%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20599278

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Suter%20SE%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Chein%20MB%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22von%20Messling%20V%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Yip%20B%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Cattaneo%20R%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Vernau%20W%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Madewell%20BR%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22London%20CA%22%5BAuthor%5D


http://www.ncbi.nlm.nih.gov/pubmed?term=Summers%20BA%5BAuthor%5D&cauthor=true&cauthor_uid=7898614

http://www.ncbi.nlm.nih.gov/pubmed?term=Appel%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=7898614


http://www.ncbi.nlm.nih.gov/pubmed?term=Tarbell%20KV%5BAuthor%5D&cauthor=true&cauthor_uid=15184500

http://www.ncbi.nlm.nih.gov/pubmed?term=Yamazaki%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15184500

http://www.ncbi.nlm.nih.gov/pubmed?term=Olson%20K%5BAuthor%5D&cauthor=true&cauthor_uid=15184500

http://www.ncbi.nlm.nih.gov/pubmed?term=Toy%20P%5BAuthor%5D&cauthor=true&cauthor_uid=15184500


http://www.ncbi.nlm.nih.gov/pubmed?term=Moore%20P%5BAuthor%5D&cauthor=true&cauthor_uid=9930894


http://www.ncbi.nlm.nih.gov/pubmed?term=Burgener%20I%5BAuthor%5D&cauthor=true&cauthor_uid=9930894

http://www.ncbi.nlm.nih.gov/pubmed?term=Barben%20G%5BAuthor%5D&cauthor=true&cauthor_uid=9930894


http://www.ncbi.nlm.nih.gov/pubmed?term=Hahm%20B%5BAuthor%5D&cauthor=true&cauthor_uid=16921469

http://www.ncbi.nlm.nih.gov/pubmed?term=Zuniga%20EI%5BAuthor%5D&cauthor=true&cauthor_uid=16921469

http://www.ncbi.nlm.nih.gov/pubmed?term=Edelmann%20KH%5BAuthor%5D&cauthor=true&cauthor_uid=16921469

http://www.ncbi.nlm.nih.gov/pubmed?term=Oldstone%20MB%5BAuthor%5D&cauthor=true&cauthor_uid=16921469

http://www.ncbi.nlm.nih.gov/pubmed?term=Stephens%20G%5BAuthor%5D&cauthor=true&cauthor_uid=16537805

http://www.ncbi.nlm.nih.gov/pubmed?term=Goldbach-Mansky%20R%5BAuthor%5D&cauthor=true&cauthor_uid=16537805

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilson%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16537805

http://www.ncbi.nlm.nih.gov/pubmed?term=Shevach%20EM%5BAuthor%5D&cauthor=true&cauthor_uid=16537805

http://www.ncbi.nlm.nih.gov/pubmed?term=Lipsky%20PE%5BAuthor%5D&cauthor=true&cauthor_uid=16537805

132


Vandevelde M, Kristensen F, Kristensen B, Steck AJ, Kihm U, 1982. Immunological and pathological

findings in demyelinating encephalitis associated with canine distemper virus infection. Acta


Vandevelde M, Zurbriggen A, 2005. Demyelination in canine distemper virus infection: a review. Acta


Vanloubbeeck Y, Hostetter J, Jones DE, 2003. The biology of dendritic cells and their potential use in

veterinary medicine. Health 4, 131–142.

Vidalain PO, Azocar O, Rabourdin-Combe C, Servet-Delprat C, 2001. Measle virus-infected dendritic

cells develop immuno-suppressive and cytotoxic activities. Immunobiol 204, 629–638.

Viglietta V, Baecher-Allan C, Weiner HL, Hafler DA, 2004. Loss of functional suppression by CD4+CD25+

regulatory T cells in patients with multiple sclerosis. J Exp Med 199, 971–979

Vignali DA, Collison WL, Workman JC, 2009. How regulatory T cells work. Nat Rev 8, 523–532.

von Messling V, Zimmer G, Herrler G, Haas L, Cattaneo R, 2001. The hemagglutinin of canine distemper

virus determines tropism and cytopathogenicity. J Virol 75, 6418-6427.

von Messling V, Svitek N, Cattaneo R, 2006. Receptor (SLAM [CD150]) recognition and the V protein

sustain swift lymphocyte-based invasion of mucosal tissue and lymphatic organs by a

morbillivirus. J Virol 80, 6084–6092.

von Rüden EL, Avemary J, Zellinger C, Algermissen D, Bock P, Beineke A, Baumgärtner W, Stein VM,

Tipold A, Potschka H, 2012. Distemper virus encephalitis exerts detrimental effects on

hippocampal neurogenesis. Neuropathol App Neurobiol 38, 426–442.

Vulcano M, Albanesi C, Stoppacciaro A, Bagnati R, D'Amico G, Struyf S, Transidico P, Bonecchi R, Del

Prete A, Allavena P, Ruco LP, Chiabrando C, Girolomoni G, Mantovani A, Sozzani S, 2001.

Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo.

Eur J Immunol 31, 812–822.

Walker LS, Chodos A, Eggena M, Dooms H, Abbas AK, 2003. Antigen-dependent Proliferation of CD4+

CD25+ Regulatory T Cells in Vivo. J Exp Med 198, 249–258.

Wang YS, Chi KH, Liao KW, Liu CC, Cheng CL, Lin YC, Cheng CH, Chu RM, 2007a. Characterization of

canine monocyte-derived dendritic cells with phenotypic and functional differentiation. Can J Vet

Res 71, 165–174.

Wang YS, Chi KH, Chu RM, 2007b. Cytokine profiles of canine monocyte-derived dendritic cells as a

function of lipopolysaccharide- or tumor necrosis factor-alpha-induced maturation. Vet Immunol


Weber M, Lange C, Günther W, Franz M, Kremmer E, Kolb HJ, 2003. Minor histocompatibility antigens

on canine hemopoietic progenitor cells. J Immunol 170, 5861–5868.

http://www.ncbi.nlm.nih.gov/pubmed?term=Baecher-Allan%20C%5BAuthor%5D&cauthor=true&cauthor_uid=15067033


http://www.ncbi.nlm.nih.gov/pubmed?term=Hafler%20DA%5BAuthor%5D&cauthor=true&cauthor_uid=15067033

http://www.ncbi.nlm.nih.gov/pubmed?term=Zimmer%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11413309

http://www.ncbi.nlm.nih.gov/pubmed?term=Herrler%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11413309

http://www.ncbi.nlm.nih.gov/pubmed?term=Haas%20L%5BAuthor%5D&cauthor=true&cauthor_uid=11413309

http://www.ncbi.nlm.nih.gov/pubmed?term=Cattaneo%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11413309

http://www.ncbi.nlm.nih.gov/pubmed?term=The%20Hemagglutinin%20of%20Canine%20Distemper%20Virus%20Determines%20Tropism%20and%20Cytopathogenicity%20The%20Hemagglutinin%20of%20Canine%20Distemper%20Virus%20Determines%20Tropism%20and%20Cytopathogenicity

http://www.ncbi.nlm.nih.gov/pubmed?term=Avemary%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21883377

http://www.ncbi.nlm.nih.gov/pubmed?term=Zellinger%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21883377

http://www.ncbi.nlm.nih.gov/pubmed?term=Algermissen%20D%5BAuthor%5D&cauthor=true&cauthor_uid=21883377

http://www.ncbi.nlm.nih.gov/pubmed?term=Bock%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21883377





http://www.ncbi.nlm.nih.gov/pubmed?term=Potschka%20H%5BAuthor%5D&cauthor=true&cauthor_uid=21883377

http://www.ncbi.nlm.nih.gov/pubmed?term=Albanesi%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Stoppacciaro%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Bagnati%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=D'Amico%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Struyf%20S%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Transidico%20P%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Bonecchi%20R%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Del%20Prete%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Del%20Prete%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Allavena%20P%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Ruco%20LP%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Chiabrando%20C%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Girolomoni%20G%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Mantovani%20A%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Sozzani%20S%5BAuthor%5D&cauthor=true&cauthor_uid=11241286

http://www.ncbi.nlm.nih.gov/pubmed?term=Walker%20LS%5BAuthor%5D&cauthor=true&cauthor_uid=12874258

http://www.ncbi.nlm.nih.gov/pubmed?term=Chodos%20A%5BAuthor%5D&cauthor=true&cauthor_uid=12874258

http://www.ncbi.nlm.nih.gov/pubmed?term=Eggena%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12874258

http://www.ncbi.nlm.nih.gov/pubmed?term=Dooms%20H%5BAuthor%5D&cauthor=true&cauthor_uid=12874258

http://www.ncbi.nlm.nih.gov/pubmed?term=Abbas%20AK%5BAuthor%5D&cauthor=true&cauthor_uid=12874258

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20CC%5BAuthor%5D&cauthor=true&cauthor_uid=17695590

http://www.ncbi.nlm.nih.gov/pubmed?term=Cheng%20CL%5BAuthor%5D&cauthor=true&cauthor_uid=17695590

http://www.ncbi.nlm.nih.gov/pubmed?term=Lin%20YC%5BAuthor%5D&cauthor=true&cauthor_uid=17695590

http://www.ncbi.nlm.nih.gov/pubmed?term=Cheng%20CH%5BAuthor%5D&cauthor=true&cauthor_uid=17695590

http://www.ncbi.nlm.nih.gov/pubmed?term=Chu%20RM%5BAuthor%5D&cauthor=true&cauthor_uid=17695590

http://www.ncbi.nlm.nih.gov/pubmed?term=Lange%20C%5BAuthor%5D&cauthor=true&cauthor_uid=12794111

http://www.ncbi.nlm.nih.gov/pubmed?term=G%C3%BCnther%20W%5BAuthor%5D&cauthor=true&cauthor_uid=12794111

http://www.ncbi.nlm.nih.gov/pubmed?term=Franz%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12794111


http://www.ncbi.nlm.nih.gov/pubmed?term=Kolb%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=12794111

133


Wenzlow N, Plattet P, Wittek R, Zurbriggen A, Gröne A, 2007. Immunohistochemical demonstration of the

putative canine distemper virus receptor CD150 in dogs with and without distemper. Vet Pathol

44, 943–948.

Weiss DJ, Wardrop KJ, 2010. Schalm's Veterinary Hematology Wiley-Blackwell, Iowa State, pp: 958-967;

1039-1041.

Wijewardana V, Sugiura K, Oichi T, Fujimoto M, Akazawa T, Hatoya S, Inaba M, Ikehara S, Jayaweera

TS, Inaba T, 2006. Generation of canine dendritic cells from peripheral blood monocytes without

using purified cytokines. Vet Immunol Immunopathol 114, 37–48.

Wright NG, Cornwell HJ, Thompson H, Lauder IM, 1974. Canine distemper: current concepts in

laboratory and clinical diagnosis. Vet Rec 94, 86-92.

Wu L, Liu Y J, 2007. Development of dendritic-cell lineages. Immunity, 26, 741–750.

Wu GF, Laufer TM, 2007. The role of dendritic cells in multiple sclerosis. Curr Neurol Neurosci Rep 7,

245-252.

Wyss-Fluehmann G, Zurbriggen A, Vandevelde M, Plattet P, 2010. Canine distemper virus persistence in

demyelinating encephalitis by swift intracellular cell-to-cell spread in astrocytes is controlled by

the viral attachment protein. Acta Neuropathol 119, 617–630.

Wünschmann A, Alldinger S, Kremmer E, Baumgärtner W, 1999. Identification of CD4+ and CD8+ T cell

subsets and B cells in the brain of dogs with spontanious acute, subacute and chronic-

demyelinating distemper encephalitis. Vet Immunol Immunopathol 67, 101–116.

Wünschmann A, Kremmer E, Baumgärtner W, 2000. Phenotypical characterization of T and B cell areas

in lymphoid tissues of dogs with spontaneous distemper. Vet Immunol Immunopathol 73, 83–98.

Yamazaki S, Bonito AJ, Spisek R, Dhodapkar M, Inaba K, Steinman RM, 2007. Dendritic cells are

specialized accessory cells along with TGF- for the differentiation of Foxp3+ CD4+ regulatory T

cells from peripheral Foxp3 precursors. Blood 110, 4293–4302.

Yanagi Y, Takeda M, Ohno S, 2006. Measles virus: cellular receptors, tropism and pathogenesis. J Gen

Virol 87, 2767–2779.

Yang LJS, Schnaar RL, 2008. Axon regeneration inhibitors. Neurol Res 30, 1047–1052.

Yu X, Cheng YM, Shi BS, Qian FX, Wang FB, Liu XN, Yang HY, Xu QN, Qi TK, Zha LJ, Yuan ZH,

Ghildyal R, 2008. Measles virus infection in adults induces production of IL-10 and is associated

with increased CD4 + CD25 + regulatory T cells. J Immunol 181, 7356–7366.

Zaba LC, Krueger JG, Lowes MA, 2009. Resident and “inflammatory” dendritic cells in human skin. J

Invest Dermatol 129, 302–308.

Zhang X, Lu G, Qi J, Li Y, He Y, Xu X, Shi J, Zhang CW, Yan J, Gao GF, 2013. Structure

of measles virus hemagglutinin bound to its epithelial receptor nectin-4. Nat Struct Mol Biol 20,

67-72. Zheng Y, Rudensky AY, 2007. Foxp3 in control of the regulatory T cell lineage. Nat Immunol 8, 457–462.




http://www.ncbi.nlm.nih.gov/pubmed?term=Gr%C3%B6ne%20A%5BAuthor%5D&cauthor=true&cauthor_uid=18039911

http://www.ncbi.nlm.nih.gov/pubmed?term=Sugiura%20K%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Oichi%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujimoto%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Akazawa%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Hatoya%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Inaba%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Ikehara%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Jayaweera%20TS%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Jayaweera%20TS%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=Inaba%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16904755

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Wright%20NG%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Cornwell%20HJ%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Thompson%20H%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lauder%20IM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=canine%20distemper%3A%20current%20concepts%20in%20laboratory

http://link.springer.com/search?facet-author=%22Gregory+F.+Wu+MD%2C+PhD%22

http://link.springer.com/search?facet-author=%22Terri+M.+Laufer+MD%22







http://www.ncbi.nlm.nih.gov/pubmed?term=Bonito%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=17699744

http://www.ncbi.nlm.nih.gov/pubmed?term=Spisek%20R%5BAuthor%5D&cauthor=true&cauthor_uid=17699744

http://www.ncbi.nlm.nih.gov/pubmed?term=Dhodapkar%20M%5BAuthor%5D&cauthor=true&cauthor_uid=17699744

http://www.ncbi.nlm.nih.gov/pubmed?term=Inaba%20K%5BAuthor%5D&cauthor=true&cauthor_uid=17699744


http://www.ncbi.nlm.nih.gov/pubmed?term=Cheng%20YM%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Shi%20BS%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Qian%20FX%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang%20FB%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu%20XN%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20HY%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu%20QN%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Qi%20TK%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Zha%20LJ%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuan%20ZH%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Ghildyal%20R%5BAuthor%5D&cauthor=true&cauthor_uid=18981159

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20X%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Lu%20G%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Qi%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=He%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu%20X%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Shi%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20CW%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Yan%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23202587

http://www.ncbi.nlm.nih.gov/pubmed?term=Gao%20GF%5BAuthor%5D&cauthor=true&cauthor_uid=23202587


134


Zilliox MJ, Parmigiani G, Griffin DE, 2006. Gene expression patterns in dendritic cells infected with

measles virus compared with other pathogens. Proc Natl Acad Sci USA 103, 3363–3368.

Zou T, Caton AJ, Koretzky GA, Kambayashi T, 2010. Dendritic cells induce regulatory T cell proliferation

through antigen-dependent and -independent Interactions. J Immunol 185, 2790–2799.

Zozulya AL, Wiendl H, 2008. The role of regulatory T cells in multiple sclerosis. Nat Clin Pract Neurol 4,

384–398.

Zurbriggen A, Schmid I, Graber HU, Vandevelde M, 1998. Oligodendroglial pathology in canine

distemper. Acta Neuropathol 95, 71–77.

Örvell C, 1980. Structural polypeptides of canine distemper virus. Arch Virol 206, 193–206.

http://www.ncbi.nlm.nih.gov/pubmed?term=Zou%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20686126

http://www.ncbi.nlm.nih.gov/pubmed?term=Caton%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=20686126

http://www.ncbi.nlm.nih.gov/pubmed?term=Koretzky%20GA%5BAuthor%5D&cauthor=true&cauthor_uid=20686126

http://www.ncbi.nlm.nih.gov/pubmed?term=Kambayashi%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20686126

135

Chapter 10: Acknowledgements

10 Chapter 10: Acknowledgements

I would like to thank:

First of all, my main supervisors,

Prof. Dr. Wolfgang Baumgärtner for excellent mentorship, motivation and

continues support. I appreciate his guidance toward critical thinking, organizing

and giving me confidence for the future. Also, I am very grateful for a friendly and

cosy working environment.

Prof. Dr. Andreas Beineke, for continues advice and supervision, lively

discussions, ideas, continues motivation, and correcting the manuscripts.

Especially for his availability and openness to discuss different ideas and

encouragement for my work.

Special thanks to my co-supervisors, Prof. Dr. Andrea Tipold and Prof. Dr. Martin

Stangel, for their support, constructive comments, and thoughtful suggestions.

Yvonne Barthel and Max Iseringhausen for their collaboration and interesting

discussions that contributed to the realization of joint publication.

Ingo Spitzbarth, Vanessa Herder, Johannes Junginger, Florian Hansmann for

apprehensive reading and thoughtful corrections of the final manuscript.

Rich Roy, for his cordial help in reading and correcting my manuscript and

publications.

Unit for Reproductive Medicine, Small Animal Clinic, Prof. Dr. Anne-Rose

Günzel-Apel and Dr. Carola Urhausen, for providing the blood samples and the

entire staff for their positive and friendly spirit, making me feel welcome each

time I needed the samples.

Small Animal Clinic for providing us the possibility to use their laboratories. PD

Dr. Veronika Stein, for her support and advices in analysing the flow cytometry

data. Regina Carlson and Arianna Maiolini, PhD, for providing me a quick and

efficient help for all the technical problems in the lab. Dr. Marina Hoffmann for

collecting the blood samples.

Special thanks to coordination office of ZSN for continues support.

136

Chapter 10: Acknowledgements

Danuta Waschke, Claudia Herrmann, Kerstin Schöne, Kerstin Rohn, Petra

Grünig, and Bettina Buck for their excellent technical support during the

execution of this project and making the work at lab way more fun.

Dr. Karl Rohn at the Department of Biometry, Epidemiology and Information

Processing at the University of Veterinary Medicine Hannover, for helpful

discussions and statistical advice.

Office mates, Ingo Spitzbarth, for unreserved help and for the hips of answered

questions, ranging from German grammar to molecular analysis, Kristel Kegler

for always relaxed attitude and putting it up with my music, and Oscar for being

such a well behaved and friendly dog.

All the colleagues in the institute, Armend, Kerstin, Barbara, Florian, Vannessa,

Stephi, Christina, Yanyong , Andre, Wenhui, Anika, Johannes, and many others

whom I see on corridors and the others who left in meantime, for their advices,

help and hints for an easier life in the lab, and with whom I shared many smokes,

drinks, laughs and music.

To my small family, Lejla, for her unconditional love, and making me happy all

these years.

To my big family, my mom and dad, Olta, Vali, Laura, Greta, and Liam, for all the

hugs and support they gave me.

Young cell scheme, European Counsel and Kosovo government, Department of

Pathology, Veterinary University, Hannover, Germany, for providing me with a

financial support, and German Research Foundation (FOR 1103) for financing

the project.

All the people that unintentionally I have forgot to mention.

Investigation of immunomodulatory properties of ...

Documents

Transcript of Investigation of immunomodulatory properties of ...