Investigating the Role(s) of LHCSRs in Chlamydomonas reinhardtii

By

Thuy Binh Truong

A dissertation submitted in partial satisfaction of the

requirements for the degree of

Doctor of Philosophy

in

Plant Biology

in the

Graduate Division

of the

University of California, Berkeley

Committee in charge:

Professor Krishna Niyogi, Chair

Professor Anastasios Melis

Professor Bob Buchanan

Professor Todd Dawson

Spring 2011

Investigating the Role(s) of LHCSRs in Chlamydomonas reinhardtii

By

Thuy Binh Truong

© 2011

by

Thuy Binh Truong

!

! "!

Abstract

Investigating the Role(s) of LHCSRs in Chlamydomonas reinhardtii

By

Thuy Binh Truong

Photosynthetic organisms must balance light absorption and light utilization. Excess

absorbed light leads to the production of reactive oxygen species that can cause photo-

oxidative damage to the cell and even cell death. To counteract the excess absorbed light,

plants and algae turn on the rapid component of non-photochemical quenching (NPQ)

known as qE to dissipate the extra energy as heat. From studies of higher plants, it is

known that three factors are needed for the activation of qE: 1) de-epoxidized

xanthophylls synthesized by a xanthophyll cycle, 2) a high proton gradient across the

thylakoid membrane, and 3) the PsbS protein, a member of the light-harvesting complex

(LHC) protein superfamily. Although the first two components are also involved in qE in

the green alga Chlamydomonas reinhardtii, PsbS does not appear to play a role in

quenching. The role of a different protein, called light-harvesting complex stress-related

(LHCSR), was demonstrated by molecular genetic analysis of the npq4 mutant of

Chlamydomonas. This mutant is deficient in qE and lacks two closely linked LHCSR

genes (LHCSR3.1 and LHCSR3.2) that encode identical LHCSR3 proteins. A third gene,

LHCSR1, encodes a second LHCSR isoform that is also involved in qE. The LHCSR1

protein is overexpressed in a suppressor of npq4 that partially restores the qE capacity of

the mutant. A loss-of-function lhcsr1 mutation was isolated using reverse genetics, and

an lhcsr1 npq4 double mutant exhibited no qE. Thus, all qE in Chlamydomonas is

dependent on LHCSR proteins. Based on biochemical and biophysical analysis of a

reconstituted LHCSR3 pigment-protein complex and site-directed mutagenesis of

LHCSR3, LHCSRs have a dual function in Chlamydomonas, acting as sensors of lumen

pH and as the sites of quenching, unlike in higher plants where the role of high light

sensing is attributed to PsbS and the sites of quenching are in the minor and/or major

antenna complexes. These findings have interesting implications for the evolution of qE

in the green lineage.

! "!

Acknowledgements

I would like to thank Kris Niyogi, my thesis advisor, for allowing me to be in his lab and

for having me work on such a wonderful project. I learned a great deal from my research

experience. I also have to thank all of the past and present members of the lab who have

helped me in some way. I especially would like to thank Marilyn Kobayashi, our lab

manager, who has always managed to get me everything I needed, and Robbie Calderon,

who let me use him as a punching bag.

Thank you to all my friends: Jenne Stonaker, Marc Strawn, Melissa Ma, Lina Guadagno,

Crystal Chuang, Haiyen Ho, Priscilla Moralez, Thao Tran, Andy Lee, Zung Chan and

Francesco Marmo for being such good friends and willing to listen to me complain about

everything under the sun. I am especially grateful for Crystal Simmons and Aennes

Abbas. They have been my best supporters in this whole endeavor and I am fortunate to

have such great friends in my life.

Lastly, I would like to thank my family for their support and for not forcing me to go to

medical school.

! ""!

Thesis Outline

!

Chapter I: Introduction

I. Photosynthesis and its potential damage…………………………………1-3

II. The current knowledge on qE in plants………………………………......3-8

III. The current knowledge on qE in algae………………………………….8-13

IV. Research focus………………………………………………………....13-14

V. References……………………………………………………………..15-23

Chapter 2: Analysis of the Chlamydomonas npq4 mutant

I. Introduction…………………………………………………………....23-26

II. Results………………………………………………………………....26-32

III. Discussion……………………………………………………………..32-34

IV. Material and Methods…………………………………………………34-36

V. References……………………………………………………………..37-39

Chapter 3: LHCSR1 and the npq4 lhcsr1 double mutant

I. Introduction…………………………………………………………....41-42

II. Results………………………………………………………………....42-49

III. Discussion……………………………………………………………..49-50

IV. Materials and Methods………………………………………………...50-52

V. References……………………………………………………………..53-55

Chapter 4: Characterization of the LHCSR3 protein

I. Introduction……………………………………………………………….57

II. Results………………………………………………………………....57-69

III. Discussion……………………………………………………………..69-71

IV. Materials and Methods………………………………………………...71-72

V. References……………………………………………………………..73-74

Chapter 5: Conclusions

I. Conclusions and future directions……………………………………..75-77

II. References………………………………………………………………...78

! "!

Chapter 1

Introduction

Light energy is needed to carry out photosynthesis, but in the case of excessive light--

when light absorption exceeds the capacity for CO2 fixation (Figure 1)--photochemistry

can be saturated, resulting in photoinhibition (Aro et al., 1993; Melis et al., 1999;

Takahashi et al., 2008). Excited state triplet chlorophyll molecules can transfer their

energy to molecular oxygen, forming singlet oxygen, a type of reactive oxygen species

(ROS). This reaction happens mostly around the PSII reaction center due to its hyperoxic

environment (Macpherson et al., 1993; Telfer et al., 1994) and lack of triplet chlorophyll

quenching by beta-carotenes (Krieger-Liszkay et al., 2008). Other ROS such as

superoxide, hydrogen peroxide, and hydroxyl radical are generated around PSI due to the

transfer of electrons from ferredoxin and NADPH to oxygen species (Tjus et al., 2001;

Asada et al., 2006). Together these ROS can cause damage to pigments, proteins, and

lipids in the thylakoid membranes, eventually leading to photodamage (Ledford et al.,

2005).

Figure 1: Graph showing rates of photosynthesis and light absorption versus incident

light intensity. The point of saturation is dependent on whether the plant is shade- or sun-

acclimated.

Fortunately, photosynthetic organisms have a variety of ways to cope with the problem of

excess light and generation of ROS. Plants can move their chloroplasts away to minimize

light absorption (Walters et al., 2005) or adjust the size of their light-harvesting

! #!

Figure 2: Scheme of oxygenic photosynthesis showing generation of particular types of

reactive oxygen species from the two photosystems.

antennae to decrease the amount of light that is absorbed (Teramoto et al., 2002; Ballotari

et al., 2007). They can also produce carotenoids and other antioxidants to scavenge ROS

(Sieffermann-Harms et al. 1987; Havaux et al., 1999). Another photoprotective response

is non-photochemical quenching (NPQ) of chlorophyll fluorescence, the topic of this

dissertation. NPQ is a fast-acting mechanism used during periods of excess light to

eliminate photons that are already absorbed, before the deleterious production of ROS

can occur (Demmig-Adams et al., 1992; Szabo et al., 2005; Eberhard et al., 2008).

NPQ has three different kinetic components, specifically the fast energy-dependent

quenching (qE), the intermediate zeaxanthin-dependent (qZ) or state transition quenching

(qT), and the slow photoinhibitory quenching (qI) (Eberhard et al., 2008). qE works by

dissipating the excess absorbed light energy as heat and is quickly inducible and

reversible. It is a mechanism that can be activated within seconds to deal with short-term

fluctuations in light intensity. This mechanism has been seen in a range of organisms,

from higher plants to algae. There are aspects of this mechanism that are conserved

across species, including the need for a pH gradient, the presence of specific xanthophylls

and certain components of the light harvesting antenna. Originally linked to state

transition quenching, qT is the process by which LHCII proteins move from PSII to PSI

in order to lessen the excitation pressure on PSII. State transition is signaled by the redox

state of the plastoquinone pool and is independent of pH or xanthophyll concentration.

However, it was shown that qT might not be active under high light stress in plants, but

rather during exposure to low or moderate light or selective excitation pressure on PSII

(Walters et al., 1991). Another type of intermediate quenching component is believed to

be associated with the conversion of violaxanthin into zeaxanthin and is now designated

as qZ (Nilkens et al., 2010). The induction and relaxation time of qZ coincide with the

! $!

formation and re-epoxidation of zeaxanthin--within the 10-15 minute time range that is

also attributed to qT. The slowest quenching mechanism is known as qI and it is more

ambiguous than the other two. qI is commonly associated with the damage of the D1

protein that leads to photoinhibition and lower photosynthetic capacity. It is thought that

the impaired PSII reaction centers are capable of quenching fluorescence directly (Horton

et al., 1996), but the mechanism by which this occurs is still unknown. On the whole, qI

may be a composite of many mechanisms and more studies are needed to uncover the

processes involved.

In this introductory chapter, I will focus mainly on the mechanism of qE, dealing first

with the phenomenon in higher plants followed by an examination of the process in

eukaryotic algae.

2. Overview of qE in higher plants

Most of the work done on photoprotection has focused on higher plants, especially the

model organism Arabidopsis thaliana. Screens for mutants deficient in qE have been

fruitful in dissecting the components responsible for this mechanism. Established are

three essential factors for the activation of qE: de-epoxidized xanthophylls synthesized by

the xanthophyll cycle, a high pH gradient across the thylakoid membrane, and members

of the light-harvesting complex (LHC) protein superfamily. How some components are

involved in the mechanism is still up for debate and will be discussed below.

2.1 The xanthophyll cycle

Xanthophylls are oxygenated derivatives of carotenes and are known to play roles in light

harvesting, photoprotection by way of triplet chlorophyll quenching and ROS

scavenging, and the structure and organization of the photosynthetic antennas (Young et

al., 1996; Pogson et al., 1998). The xanthophyll cycle in plants refers to the conversion of

the xanthophyll violaxanthin into its de-epoxidized forms: antheraxanthin and zeaxanthin.

Xanthophylls are critical to qE, and the role of xanthophylls in qE is strongly established

with Arabidopsis mutants. The npq1 mutant, which cannot convert violaxanthin into

zeaxanthin due to the absence of the violaxanthin de-epoxidase (VDE) gene, has reduced

NPQ capacity compared to wild type (Niyogi et al., 1998). The npq2 mutant that

constitutively accumulates zeaxanthin, in turn, has a faster NPQ induction, but not higher

NPQ than wild type (Niyogi et al., 1998). It is believed that the extent and kinetics of

NPQ are not solely dependent on the total amount of zeaxanthin, but also the rate of de-

epoxidation and the de-epoxidation state ([zeaxanthin plus antheraxanthin]/([total

xanthophyll cycle pool]). The xanthophyll lutein, isomeric with zeaxanthin except for the

placement of one double bond, has also been shown to be important in qE. The lut1 and

lut2 mutants lacking lutein exhibit a slower NPQ induction and a corresponding decrease

in qE (Pogson et al., 1998). Lutein can partly replace zeaxanthin function; when lutein

over-accumulates in the szl1 npq1 mutant, qE is partially rescued (Li et al., 2009).

! %!

The mechanism by which the xanthophylls act in qE is not clear; it is believed that they

can have a direct and/or indirect role. One school of thought proposes that zeaxanthin

quenches chlorophyll a fluorescence directly, due to its lower S1 energy state compared

to that of chlorophyll a (Frank et al., 1994) or due to charge transfer between zeaxanthin

and chlorophyll, generating a zeaxanthin radical cation (Holt et al., 2005). The second

school of thought proposes that xanthophylls have an indirect or allosteric role in the

quenching mechanism. Here, zeaxanthin would facilitate a conformational change in the

light-harvesting antenna leading to quenching, but would not itself be a quencher of

excited chlorophylls. This idea comes from experiments with LHCII aggregates and

thylakoids that exhibit quenching in the absence of zeaxanthin (Ruban et al., 1994; Pascal

et al., 2005).

2.2 The proton gradient

When plants are exposed to excess light and photochemistry is saturated, it leads to the

over-accumulation of protons in the thylakoid lumen and a decrease in lumen pH, which

act as a signal for excessive light. We know that the proton gradient is necessary for qE

generation, because qE cannot build up when the gradient is caused to collapse with the

uncoupler nigericin (Quick et al., 1989; Jans et al., 1999). Mutants that are defective in

building the proton gradient further confirm its necessity. Arabidopsis mutants unable to

produce a high proton gradient, such as pgr1 or pgr5, showed lower qE than the wild type

(Munekage et al., 2001; Okegawa et al., 2007). pgr1 has a mutation in the Rieske subunit

of the cytochrome b6/f complex and is defective in linear electron transport, thereby

preventing generation of the required threshold pH for qE activation under high light

exposure. Cyclic electron flow (CEF) also adds to the buildup of the proton gradient.

When CEF is impaired, as in the case of the pgr5 mutant, qE is also impaired. PGR5 is

involved in one of the cyclic electron transport pathways around PSI, moving electrons

from ferredoxin to the plastoquinone pool. When PGR5 was overexpressed in

Arabidopsis plants, qE was enhanced relative to wild type at very low light conditions

and in light fluctuation experiments (Okegawa et al., 2007). This enhanced qE phenotype

is due to increased cyclic electron flow around PSI and the resulting higher pH

difference.

The roles of the proton gradient in qE are two fold. Firstly, it activates the xanthophyll

cycle. The VDE enzyme is located in the thylakoid lumen and is only functional at low

pH. During normal light conditions, the enzyme is free in the lumen; however, when the

pH decreases below a threshold level in high light, the enzyme binds to the thylakoid

membrane and is triggered to convert violaxanthin into zeaxanthin (Rockholm et al.,

1996). The second role of the gradient is the protonation of LHC proteins. The antenna

proteins contain acidic residues in their lumenal loops and these can be protonated at low

pH. The significance of protonation of each of these proteins is not known, but we do

know that protonation of PsbS is essential for qE induction, as discussed in the next

section.

! &!

2.3 The Lhc superfamily

It is generally agreed that qE occurs in the antenna of PSII, but the question is: exactly

where? PSII exists as a supercomplex surrounded by antenna proteins, which are divided

into two categories: major and minor. The major antenna complexes are LHCII trimers

composed of Lhcb1, 2 and 3 that are connected to the PSII reaction centers through the

minor antennas, made up of Lhcb4, 5, and 6. Both types bind to an assortment of

chlorophylls and xanthophylls. Each major antenna protein binds two luteins at sites

termed L1 and L2, one violaxanthin/zeaxanthin at V1, and one neoxanthin at N1. The

minor antenna proteins hold only one lutein at site L1, one violaxanthin/zeaxanthin at site

L2 and one neoxanthin at N1.

The aforementioned aggregation model places the sites of quenching within the LHCII

major antenna. However, anti-sense mutants in Lhcb1 and Lhcb2 still retain qE, albeit

with reduced capacity compared to wild type (Andersson et al., 2003) and a T-DNA

knockout of Lhcb3 had wild-type NPQ level (Damkjaer et al., 2009). In both cases,

though, other components of the antenna were upregulated. With the Lhcb1 and Lhcb2

antisense mutants, Lhcb5 (CP26) amount increased, whereas both Lhcb1 and Lhcb2 were

amplified in the Lhcb3 knockout. So it seems that if the major antenna are sites of

quenching, they are redundant in their function—when one Lhc is lacking, other Lhcs are

upregulated. In this model, lutein at site L1 quenches the nearby excited chlorophyll

dimer (Pascal et al., 2005). It was found that the site consisting of the chlorophylls and

lutein involved in this quenching is conserved in all major and minor antennas, with the

exception of CP24 (Mozzo et al., 2008). Therefore, the aggregation model might involve

both major and minor antenna proteins.

The location of the minor antenna proteins, positioned between LHCIIs and the reaction

center, makes them good candidates as sites of quenching. Earlier literature showed that

they contain a higher xanthophyll to chlorophyll ratio compared to the major antennas,

suggestive of their quenching capabilities (Bassi et al., 1993; Young et al., 1997).

Arabidopsis mutants affecting each of the minor antenna complexes are qE defective, but

not completely absent, implying again functional redundancy in the LHC superfamily

(Andersson et al., 2001; Kovacs et al., 2006). For quenching in the minor antenna

proteins, the zeaxanthin bound to site L2 is critical and it is thought to undergo charge

transfer with excited chlorophylls in order to quench them (Avenson et al., 2008; Ahn et

al., 2008).

The only LHC related mutant that shows a complete loss of qE capacity is the npq4

mutant (Li et al., 2000). It lacks PsbS, a member of the LHC family that contains four

transmembrane domains instead of the usual three. PsbS was initially hypothesized to be

the site of qE, but it now appears that the protein does not actually bind pigments

(Bonente et al., 2008). Structure-function analysis of PsbS in vivo revealed two lumenal

glutamate residues that are required for its function and that are responsible for sensing

the lumen pH (Li et al., 2002). It is hypothesized that protonation of these acidic residues

! '!

leads to a conformational change in PsbS that cascades to other LHC proteins and results

in quenching (Li et al., 2004; Ahn et al., 2008). This is supported by the work of Betterle

et al. (2009), who found that quenching is accompanied by the PsbS-dependent

dissociation of a subcomplex of proteins comprising CP29, CP24 and an LHCII trimer.

This dissociation does not occur in the npq4 mutant. By comparing electron microscopic

images of grana protein complexes between wild type and npq4, Kereiche et al. (2010)

observed an increase in the frequency of crystalline arrays of PSII supercomplexes in the

grana membrane of the npq4 mutant, whereas a PsbS overexpressor with more qE lacked

any crystalline array.

2.4 Molecular mechanisms of qE

There are currently three models for how qE is induced in plants. All three models agree

that upon high light exposure, a decrease in lumen pH results in the protonation of

proteins in the antenna--one of which is PsbS--and in the accumulation of zeaxanthin via

the xanthophyll cycle. Protonation of PsbS induces a conformational change in the PSII

antenna, resulting in qE. The models differ concerning the exact role of each component,

the location of quenching, and the biophysical mechanism by which chlorophyll is de-

excited.

In the first model, zeaxanthin has a direct role in the quenching of excited chlorophylls. It

is believed that de-excitation happens via charge separation and subsequent

recombination in a chlorophyll-zeaxanthin complex (Figure 3). Using transient

absorption (TA) spectroscopy to probe for a carotenoid radical cation in the near-infrared

region, these researchers found a species at a 1000 nm that they ascribed to be a

zeaxanthin radical cation (Holt et al., 2005). This species was found only in the quenched

state and was missing in the npq4 mutant. TA spectroscopy of isolated minor antenna

complexes showed the presence of the zeaxanthin radical cation, whereas the trimeric

LHCII showed no such species (Avenson et al., 2008). Reconstituting these proteins with

pigments and applying the same ultrafast spectroscopic technique also revealed the

presence of a zeaxanthin radical cation. Based on these results, the likely sites of

quenching are the minor antenna proteins Lhcb4 (CP29), Lhcb5 (CP26), and Lhcb6

(CP24). In the case of CP29, mutagenesis of chlorophyll ligands pinpointed a pair of

chlorophylls coupled to the xanthophyll bound at the L2 site as the site of the charge

transfer quenching (Ahn et al., 2008). In high light, violaxanthin is exchanged for

zeaxanthin that then can undergo charge transfer with the nearby chlorophyll dimer. In

the case of the szl1 npq1 mutant, lutein is able to replace zeaxanthin (Li et al., 2009). TA

spectroscopy of this suppressor mutant indicated a rise at 920 nm, where a lutein radical

cation would absorb. Reconstituted CP24 and CP29 in the presence of lutein only also

showed the same radical cation species (Li et al., 2009).

! (!

Figure 3: Scheme showing the charge-separation model for qE mechanism, from Holt et

al. (2005). The numbers refer to (1) transfer of energy from the bulk chlorophylls to a

chlorophyll-zeaxanthin dimer, (2) relaxation of the excited dimer into a chlorophyll anion

and a zeaxanthin cation radical, (3) charge recombination and dissipation of energy as

heat, and (4) all other phenomena that occur within the bulk chlorophylls

The other prominent model for qE focuses on the aggregation of LHCII proteins. It was

observed that oligomerization of LHCII trimers leads to quenching of chlorophyll

fluorescence and this quenching is also found in LHCII crystals (Ruban et al., 1994;

Pascal et al., 2005). The crystals have shorter fluorescence lifetime compared to the

isolated trimers. This quenching is accompanied by a twist in the neoxanthin bound at the

N1 site as shown by Raman spectroscopy both in vitro and in vivo (Pascal et al., 2005;

Ruban et al., 2007). The conformational change purportedly brings one or two

chlorophylls together that can then transfer the excess energy to the S1 state of a nearby

lutein at site L1 in LHCII (Ruban et al., 2007). This mechanism still requires the proton

gradient as well as the PsbS protein and zeaxanthin, with zeaxanthin having an allosteric

role (i.e., affecting the aggregation state). Recently, however, the view that LHCII

crystals are in a quenched state was challenged by Barros et al. (2009). Quenching was

not affected by mutation of the chlorophyll and carotenoid sites of LHCII proteins

proposed by Pascal et al. (2005) to be essential for quenching. The LHCII mutant lacking

neoxanthin also showed no defect. Instead, they proposed a model in which LHCII

aggregates form randomly, creating quenching sites through the interaction between

chlorophylls from the LHCII outer surface and transient PsbS-bound zeaxanthin. This

hetero-dimer would undergo quenching by charge separation and recombination as

proposed by Holt et al. (2005) and Ahn et al. (2008). One problem with this model is that

PsbS may not be a pigment-binding protein (Funk et al., 1995; Dominici et al., 2002).

A third mechanism invokes the involvement of Chl-Chl charge transfer (Muller et al.,

2010). Using time-resolved fluorescence spectroscopy, they showed the presence of a

400 ps lifetime component that is associated with LHCII aggregates and is found in intact

! )!

Arabidopsis leaves undergoing qE (Miloslavina et al., 2008). This component was

actually found 15 years earlier by Gilmore et al. (1995) in spinach thylakoid membranes.

They saw that the presence of both zeaxanthin and the proton gradient increases the

formation of this 400 ps component while decreasing a 2 ns fluorescence lifetime. Based

on global target analysis, Miloslavina et al. concluded that the quenching mechanism

arises from a Chl dimer that undergoes charge transfer and subsequent emission to the

ground state, with no energy transfer to xanthophylls. With the model proposed by

Holzwarth et al. (2009), LHCII antenna proteins are detached from the PSII cores in high

light and most probably quenched by this Chl-Chl charge transfer mechanism. This site

of quenching is called Q1 and is independent of zeaxanthin, because it is still present in

the npq1 mutant. The presence of zeaxanthin, however, modulates the fluorescence

lifetime, which is found to be 543 ps in npq1 compared to 430 ps in wild type. PsbS is

required and believed to allow for the detachment of the LHCII from the supercomplex.

A second proposed site of quenching is called Q2 and it is a slower zeaxanthin-dependent

mechanism (qZ) located within the minor antenna. However, the specific role of

zeaxanthin in Q2 is unknown. It could either be involved in chlorophyll-carotenoid

energy transfer or play a role in a charge transfer mechanism.

3. qE in algae

Algae are a diverse, polyphyletic group of oxygenic phototrophs, including green algae,

red algae, and chromalveolate algae such as diatoms. The green algae are a sister group to

higher plants. Many algae are aquatic and depending on the nature of the habitat, whether

it be the euphotic zone or estuaries, light conditions can vary on an hours to seconds

timescale and can range in orders of magnitude due to the water movements (Lavaud et

al., 2003). It is believed that photoprotection in the form of qE is crucial for the survival

of these organisms and that it may dictate their niche. As mentioned above, the

components required for qE in algae are similar to those in plants: a xanthophyll cycle,

the proton gradient, and specific antenna proteins. In the following sections, I will discuss

these various components and their roles in quenching in algae. The model organism of

choice in the study of algal qE has been Chlamydomonas reinhardtii, in part due to the

possibility to generate and analyze mutants in this species. qE has also been studied in a

number of other algae, particularly diatoms because of their major ecological role in the

ocean. The discussion presented below will show that there exist many parallels in the

mechanism for qE between plants and algae, but also some important differences.

3.1 The xanthophyll cycle in algae

The xanthophyll cycle consisting of reversible interconversion of violaxanthin,

antheraxanthin, and zeaxanthin is found in higher plants, ferns, mosses, and some groups

of algae (Latowski et al., 2004). Chlamydomonas is an alga in which the xanthophyll

cycle has been studied extensively with regards to qE. The npq1 mutant in this alga,

which lacks zeaxanthin, has less qE but does not show the same qE defect as the

corresponding Arabidopsis mutant (Niyogi et al., 1997). Its initial induction phase is

! *!

similar to wild type, and total qE is only slightly lower than wild type. Although the

Chlamydomonas npq1 mutant is defective in the conversion of violaxanthin into

zeaxanthin, the molecular basis of the mutation remains unknown. Moreover, there is no

ortholog of the plant VDE in the Chlamydomonas genome, suggesting that either the

enzyme responsible for the conversion is highly divergent from its plant counterpart or

that it is an entirely new enzyme (Anwaruzzaman et al., 2004). The double mutant npq1

lor1, which lacks both zeaxanthin and lutein, shows a severe lack of qE; this suggests that

lutein might play an important role in quenching. The possible role of lutein in quenching

has also been observed in Ostreococcus tauri, another green alga (Six et al., 2009).

In diatoms, a different xanthophyll cycle involving diadinoxanthin and diatoxanthin is

present (Figure 4) (Young et al., 1996). This cycle entails a one-step de-epoxidation that

turns diadinoxanthin (with 10 conjugated bonds), into diatoxanthin, (with 11 conjugated

bonds). The cycle in higher plants requires two de-epoxidation steps to make zeaxanthin

(with 11 double bonds) from violaxanthin (with 9 double bonds).

It is believed that the roles of diadinoxanthin and diatoxanthin in diatoms are equivalent

to those of violaxanthin and zeaxanthin in higher plants and green algae (Olaizola et al.,

1994). These researchers found that an increase in non-photochemical quenching is

linearly correlated with the amount of diatoxanthin in the diatom Chaetoceros muelleri.

This phenomenon has been documented in a number of other species of diatoms,

including Phaeodactylum tricornutum (Arsalane et al., 1994; Lavaud et al., 2002) and

Nitzschia palea (Willemoes et al., 1991), as well as the haptophyte Emiliania huxleyi

(Harris et al., 2005; Ragni et al., 2008). Cultures grown at higher light intensity had a

greater xanthophyll cycle pool size and also a higher de-epoxidation state. Cultures that

were grown in light/dark cycles or intermittent light cycles exhibited more total

xanthophylls as well as higher amount of diatoxanthin, compared to those grown in

continuous light (Willemoes et al., 1991; Lavaud et al., 2002). A higher de-epoxidation

state allows for immediate activation of high NPQ at the onset of high light and results in

the monophasic increase of NPQ (Ruban et al., 2004). This was found to be different in

plants. Johnson et al. (2008) showed that an Arabidopsis mutant with an increase in the

xanthophyll cycle pool size exhibited slower NPQ induction than wild type, likely due to

a slower increase in de-epoxidation state.

3.2 The proton gradient and qE in algae

In diatoms as in green algae and higher plants, the proton gradient is required to initiate

qE. The enzyme diadinoxanthin de-epoxidase, responsible for converting diadinoxanthin

into diatoxanthin, is also activated by a low pH (Jakob et al., 2001). However, the

activation of the diatom de-epoxidase occurs at a higher pH (5.5) than for the VDE (5.2)

found in plants (Goss et al., 2010). Because of this higher pH requirement, the diatoms

Phaeodactylum and Cyclotella are capable of accumulating diatoxanthin in the dark due

to the process of chlororespiration. Many algae are known to be capable of qE in the

dark.

! "+!

The need for the proton gradient in qE has been examined by inhibitor studies. In

Phaeodactylum, the addition of nigericin or CCCP, which uncouples the proton gradient,

abolishes the quenching (Ting et al., 1993). In spite of these data, the proton gradient in

diatoms may work differently compared to that in higher plants. Although the low lumen

pH is needed to activate the de-epoxidase, the continual presence of the proton gradient

Figure 4: The xanthophyll cycle in plants and algae.

! ""!

itself is not needed for quenching, according to Goss et al. (1995). In algae that contain

the diadino- and diatoxanthin cycle, diatoxanthin concentration is linearly correlated with

the level of qE, independent of the proton gradient once this de-epoxidation state is

established (Goss et al., 2006). However, the view that diatoxanthin alone is needed for

qE was challenged by Lavaud et al. (2002). They showed that increasing diatoxanthin

content alone does not increase NPQ. Analogously, the addition of DCCD to build up the

proton gradient resulted in increased qE, despite constant diatoxanthin amount.

Uncoupling the proton gradient led to the reductions of NPQ and diatoxanthin, but the

decrease of the quenching was not linearly correlated with the decrease of diatoxanthin

(Lavaud et al. 2006). Consequently, the role of the proton gradient goes beyond the

activation of the xanthophyll cycle. The authors believe that the proton gradient is

required in diatoms as it is in higher plants by ‘activating’ LHC antenna components to

be in the quenched state (i.e., through protonation). This would lead to a very similar

scenario for the mechanism of quenching in both higher plants and algae.

3.3 The Lhc superfamily in algae

In green algae, the major LHCII proteins have diversified independently from higher

plants (Neilson et al., 2010). The organization of the PSII supercomplex differs in terms

of the number of trimers bound, due to the absence of the minor antenna protein CP24 in

some green algae like Chlamydomonas (Nield et al., 2004). Instead, there exist a number

of novel antenna proteins found in green algae, including LHCSRs which are ancient

light harvesting antenna proteins belonging to the Lhc superfamily (Savard et al., 1996).

The presence of LHCSRs is not limited to Chlamydomonas, as it has been documented in

a number of other species such as Ostreococcus (Six et al., 2005). LHCSR homologs

were also discovered in the diatom Cyclotella cryptica (Zhu et al., 2010; Eppard et al.,

1998) and found to be upregulated in high light compared to other light harvesting

proteins. Other diatoms including T. pseudonana, P. tricornutum, and C. neogracile have

also shown an increase in expression of this class of proteins, termed Lhcx, during high

light exposure (Zhu et al., 2010; Nymark et al., 2009; and Park et al., 2010). Six et al.

(2005) found that LHCSRs group closely with fucoxanthin-chlorophyll binding proteins

(FCPs), which are the main light harvesting antenna proteins found in diatoms. FCPs are

encoded by a conserved family of five to six gene members (Miloslavina et al., 2009) and

have been implicated as the sites of quenching in diatoms (Lavaud et al., 2003).

The role of PsbS in green algae is not established as it has been for higher plants.

Screening for npq mutants of Chlamydomonas has yielded no mutants affecting PsbS.

Biochemical studies showed that despite the fact that this alga contains two copies of the

gene, neither isoform is expressed in the chloroplast (Bonente et al., 2008). In the case of

diatoms, no sequence for PSBS has been found in either Thalassiosira pseudonana or

Phaeodactylum tricornutum (Miloslavina et al., 2009). This suggests that some algae

must use other light harvesting proteins in place of PsbS for qE.

! "#!

Insertional mutagenesis in Chlamydomonas has given some clues as to the nature of the

sites of quenching in algae. The npq5 mutant lacking Lhcbm1, a gene that encodes for

one of the LHCII trimer proteins, exhibits low qE (Elrad et al., 2002). In turn, it contains

fewer LHCII trimers compared to wild type. This correlation between LHCII trimers and

qE deficiency implies that the quenching sites might just be in the trimers themselves, as

suggested by Ruban et al. (1999, 2005, 2007).

3.4 Molecular mechanism of qE

The molecular mechanism of qE in algae is not as well studied as in higher plants and

new studies are just emerging. In high light, free FCPs (those not associated with PSI or

PSII) from Phaeodactylum have a larger xanthophyll content compared to those

associated with the reaction centers and also a higher de-epoxidation state. From

fluorescence experiments, these xanthophylls do not transfer their energy to chlorophylls.

With these results, it is possible that diatoxanthins quench excited chlorophylls and FCPs

are the quenching sites in diatoms (Lavaud et al., 2003). Global target analysis of the

fluorescence decays for both Phaeodactylum and Cyclotella showed the presence of an

additional fluorescent antenna component in high light that is functionally detached from

PSI and PSII (Miloslavina et al., 2009). The detached antenna is attributed to oligomers

of FCPs and the appearance of this component is accompanied by a fluorescence decay

with a shorter lifetime. This is reminiscent of the LHCII aggregation quenching model

proposed by Ruban and Horton in higher plants and the Q1 site quenching by Holzwarth

et al. The detached antenna quenching is also thought to be independent of xanthophylls

and relies on the inter-complex chlorophyll-chlorophyll contacts. Also, like in higher

plants, there is also an FCP-related Q2 quenching site that is still attached to the PSII core

and requires the xanthophylls. Further support for the hypothesis of Q1 and Q2

quenching sites comes from isolated FCP complexes containing diatoxanthin in C.

meneghiniana. Gundermann et al. (2008) showed that two complexes isolated from high

light have lower fluorescence emission, namely trimeric FCPa and oligomeric FCPb. In

FCPa, the amount of quenching is correlated with the amount of diatoxanthin. FCPb

complexes, although binding to diatoxanthin, are only able to increase quenching upon

more aggregation. FCPa is comparable to the Q2 site because of its dependence on

xanthophylls, and FCPb is similar to site Q1 in its independence of xanthophylls.

However, whereas the Q1 site is still attached to the reaction center, FCPb is not. The

mechanism by which the quenching happens at both sites remains to be identified.

! "$!

A.

B.

Figure 5: A. Model for qE in higher plants and B. Model for qE in diatoms.

4. Research focus

My thesis examines the qE mechanism in Chlamydomonas reinhardtii, an algal model

organism. My research has focused on the Chlamydomonas npq4 mutant and the role of

LHCSR proteins in the mechanism of qE. Without LHCSR3, the npq4 mutant exhibits

lower NPQ capacity and consequently suffers a fitness defect compared to the wild type.

Isolation and characterization of an lhcsr1 mutant led to the conclusion that all the qE in

Chlamydomonas depends on LHCSRs. I attempted to elucidate the role(s) that these

proteins play in the qE mechanism and performed experiments to test the hypotheses that

they are (1) sites of quenching and/or (2) sensors of high light. In collaboration with

Roberto Bassi’s lab, I found that these proteins bind both chlorophylls and xanthophylls

as shown by reconstitution of the proteins in vitro. Ultrafast spectroscopy in collaboration

with Graham Fleming’s group showed the presence of a lutein radical cation species,

suggesting that LHCSRs are the quenching sites. We had also speculated that LHCSRs

are protonated under high light stress and so behave as sensor/inducer of quenching in

Chlamydomonas, similar to PsbS. The protein sequence of LHCSRs contains many

lumen-facing acidic residues, and mutagenesis of these residues resulted in a reduction in

! "%!

NPQ capacity relative to the amount of protein present. Thus, it appears that algae have

incorporated the two functions in quenching into one protein. These findings reveal a

difference between algae and higher plants, where the two functions have been divided

into two sets of proteins: PsbS as the sensor and the minor/major antennas as the sites of

quenching. LHCSRs appear to be ancient players in qE and the discovery that they are

important in algal qE has many implications for the evolution of this mechanism in

photosynthetic eukaryotes.

! "&!

References

1. Ahn TK, Avenson TJ, Ballottari M, Cheng Y-C, Niyogi KK, Bassi R, Fleming GR.

2008. Architecture of a charge-transfer state regulating light harvesting in a plant

antenna protein. Science (Washington DC) 320 (5877): 794-797.

2. Andersson J, Walters RG, Horton P, Jansson S. 2001. Antisense inhibition of the

photosynthetic antenna proteins CP29 and CP26: Implications for the mechanism of

protective energy dissipation. Plant Cell 13 (5): 1193-1204.

3. Andersson J, Wentworth M, Walters RG, Howard CA, Ruban AV, Horton P, Jansson

S. 2003. Absence of the Lhcb1 and Lhcb2 proteins of the light-harvesting complex of

photosystem II: Effects on photosynthesis, grana stacking and fitnes. Plant Journal 35

(3): 350-361.

4. Anwaruzzaman M, Chin BL, Li X-P, Lohr M, Martinez DA, Niyogi KK. 2004.

Genomic analysis of mutants affecting xanthophyll biosynthesis and regulation of

photosynthetic light harvesting in Chlamydomonas reinhardtii. Photosynthesis

Research 82 (3): 265-276.

5. Aro E-MVV, Andersson B. 1993. Photoinhibition of photosystem II: Inactivation,

protein damage and turnover. Biochimica et Biophysica Acta 1143 (2): 113-134.

6. Arsalane W, Rousseau B, Duval J-C. 1994. Influence of the pool size of the

xanthophyll cycle on the effects of light stress in a diatom: Competition between

photoprotection and photoinhibition. Photochemistry and Photobiology 60 (3): 237-

243.

7. Asada K. 2006. Production and scavenging of reactive oxygen species in chloroplasts

and their functions. Plant Physiology (Rockville) 141(2): 391-396.

8. Avenson TJ, Ahn TK, Zigmantas D, Niyogi KK, Li Z, Ballottari M, Bassi R, Fleming

GR. 2008. Zeaxanthin radical cation formation in minor light-harvesting complexes of

higher plant antenna. Journal of Biological Chemistry 283 (6): 3550-3558.

9. Ballottari M, Dall'Osto L, Morosinotto T, Bassi R. 2007. Contrasting behavior of

higher plant photosystem I and II antenna systems during acclimation. Journal of

Biological Chemistry 282 (12): 8947-8958.

! "'!

10. Barros T, Royant A, Standfuss J, Dreuw A, Kuhlbrandt W. 2009. Crystal structure of

plant light-harvesting complex shows the active, energy-transmitting state. EMBO

(European Molecular Biology Organization) Journal 28 (3): 298-306.

11. Bassi R, Pineau B, Dainese P, Marquardt J. 1993. Carotenoid-binding proteins of

photosystem II. European Journal of Biochemistry 212 (2): 297-303.

12. Betterle N, Ballottari M, Zorzan S, de Bianchi S, Cazzaniga S, Dall'Osto L,

Morosinotto T, Bassi R. 2009. Light-induced Dissociation of an Antenna Hetero-

oligomer Is Needed for Non-photochemical Quenching Induction. Journal of

Biological Chemistry 284 (22): 15255-15266.

13. Bonente G, Passarini F, Cazzaniga S, Mancone C, Buia MC, Tripodi M, Bassi R,

Caffarri S. 2008. The Occurrence of the psbS Gene Product in Chlamydomonas

reinhardtii and in Other Photosynthetic Organisms and Its Correlation with Energy

Quenching. Photochemistry and Photobiology 84 (6): 1359-1370.

14. Damkjaer JT, Kereiche S, Johnson MP, Kovacs L, Kiss AZ, Boekema EJ, Ruban AV,

Horton P, Jansson S. 2009. The Photosystem II Light-Harvesting Protein Lhcb3

Affects the Macrostructure of Photosystem II and the Rate of State Transitions in

Arabidopsis. Plant Cell 21 (10): 3245-3256.

15. Demmig-Adams B, Adams WW, III. 1992. PHOTOPROTECTION AND OTHER

RESPONSES OF PLANTS TO HIGH LIGHT STRESS. Briggs, W. R. p. 599-626.

16. Dominici P, Caffarri S, Armenante F, Ceoldo S, Crimi M, Bassi R. 2002. Biochemical

properties of the PsbS subunit of Photosystem II either purified from chloroplast or

recombinant. Journal of Biological Chemistry 277 (25): 22750-22758.

17. Eberhard S, Finazzi G, Wollman F-A. 2008. The Dynamics of Photosynthesis. Annual

Review of Genetics 42: 463-515.

18. Elrad D, Niyogi KK, Grossman AR. 2002. A major light-harvesting polypeptide of

photosystem II functions in thermal dissipation. Plant Cell 14 (8): 1801-1816.

19. Eppard M, Rhiel E. 1998. The genes encoding light-harvesting subunits of Cyclotella

cryptica (Bacillariophyceae) constitute a complex and heterogeneous family.

Molecular and General Genetics 260 (4): 335-345.

20. Frank HA, Cua A, Chynwat V, Young A, Gosztola D, Wasielewski MR. 1994.

Photophysics of the carotenoids associated with the xanthophyll cycle in

photosynthesis. Photosynthesis Research 41 (3): 389-395.

! "(!

21. Funk C, Adamska I, Green BR, Andersson B, Renger G. 1995. The nuclear-encoded

chlorophyll-binding photosystem II-S protein is stable in the absence of pigments.

Journal of Biological Chemistry 270 (50): 30141-30147.

22. Gilmore AM, Hazlett TL, Govindjee. 1995. Xanthophyll cycle-dependent quenching

of photosystem II chlorophyll a fluorescence: Formation of a quenching complex with

a short fluorescence lifetime. Proceedings of the National Academy of Sciences of the

United States of America 92 (6): 2273-2277.

23. Goss R, Jakob T. 2010. Regulation and function of xanthophyll cycle-dependent

photoprotection in algae. Photosynthesis Research 106 (1-2, Sp. Iss. SI): 103-122.

24. Goss R, Pinto EA, Wilhelm C, Richter M. 2006. The importance of a highly active

and Delta pH-regulated diatoxanthin epoxidase for the regulation of the PSII antenna

function in diadinoxanthin cycle containing algae. Journal of Plant Physiology 163

(10): 1008-1021.

25. Goss R, Richter M, Wild A. 1995. Role of DELTA-pH in the mechanism of

zeaxanthin-dependent amplification of q-E. Journal of Photochemistry and

Photobiology B Biology 27 (2): 147-152.

26. Gundermann K, Buechel C. 2008. The fluorescence yield of the trimeric fucoxanthin-

chlorophyll-protein FCPa in the diatom Cyclotella meneghiniana is dependent on the

amount of bound diatoxanthin. Photosynthesis Research 95 (2-3): 229-235.

27. Harris GN, Scanlan DJ, Geider RJ. 2005. Acclimation of Emiliania huxleyi

(Prymnesiophyceae) to photon flux density. Journal of Phycology 41 (4): 851-862.

28. Havaux M, Niyogi KK. 1999. The violaxanthin cycle protects plants from

photooxidative damage by more than one mechanism. Proceedings of the National

Academy of Sciences of the United States of America 96 (15): 8762-8767.

29. Holt NE, Zigmantas D, Valkunas L, Li X-P, Niyogi KK, Fleming GR. 2005.

Carotenoid cation formation and the regulation of photosynthetic light harvesting.

Science (Washington DC) 307 (5708): 433-436.

30. Holzwarth AR, Miloslavina Y, Nilkens M, Jahns P. 2009. Identification of two

quenching sites active in the regulation of photosynthetic light-harvesting studied by

time-resolved fluorescence. Chemical Physics Letters: 262-267.

31. Horton P, Ruban AV, Walters RG. 1996. Regulation of light harvesting in green

plants. In: Jones RL, editor. Annual Review of Plant Physiology and Plant Molecular

Biology. p. 655-684.

! ")!

32. Jakob T, Goss R, Wilhelm C. 2001. Unusual pH-dependence of diadinoxanthin de-

epoxidase activation causes chlororespiratory induced accumulation of diatoxanthin in

the diatom Phaeodactylum tricornutum. Journal of Plant Physiology 158 (3): 383-390.

33. Jans P, Heyde S. 1999. Dicyclohexylcarbodiimide alters the pH dependence of

violaxanthin de-epoxidation. Planta (Berlin) 207 (3): 393-400.

34. Johnson MP, Davison PA, Ruban AV, Horton P. 2008. The xanthophyll cycle pool

size controls the kinetics of non-photochemical quenching in Arabidopsis thaliana.

FEBS Letters 582 (2): 259-263.

35. Kereiche S, Kiss AZ, Kouril R, Boekema EJ, Horton P. 2010. The PsbS protein

controls the macro-organisation of photosystem II complexes in the grana membranes

of higher plant chloroplasts. FEBS Letters 584 (4): 759-764.

36. Kovacs L, Damkjaer J, Kereiche S, Ilioaia C, Ruban AV, Boekema EJ, Jansson S,

Horton P. 2006. Lack of the light-harvesting complex CP24 affects the structure and

function of the grana membranes of higher plant chloroplasts. Plant Cell 18 (11):

3106-3120.

37. Krieger-Liszkay A, Fufezan C, Trebst A. 2008. Singlet oxygen production in

photosystem II and related protection mechanism. Photosynthesis Research 98 (1-3):

551-564.

38. Latowski D, Grzyb J, Strzalka K. 2004. The xanthophyll cycle - molecular

mechanism and physiological significance. Acta Physiologiae Plantarum 26 (2): 197-

212.

39. Lavaud J, Kroth PG. 2006. In diatoms, the transthylakoid proton gradient regulates

the photoprotective non-photochemical fluorescence quenching beyond its control on

the xanthophyll cycle. Plant and Cell Physiology 47 (7): 1010-1016.

40. Lavaud J, Rousseau B, Etienne A-L. 2003. Enrichment of the light-harvesting

complex in diadinoxanthin and implications for the nonphotochemical fluorescence

quenching in diatoms. Biochemistry 42 (19): 5802-5808.

41. Lavaud J, Rousseau B, Etienne AL. 2002a. In diatoms, a transthylakoid proton

gradient alone is not sufficient to induce a non-photochemical fluorescence

quenching. FEBS Letters 523 (1-3): 163-166.

! "*!

42. Lavaud J, Rousseau B, van Gorkom HJ, Etienne A-L. 2002b. Influence of the

diadinoxanthin pool size on photoprotection in the marine planktonic diatom

Phaeodactylum tricornutum. Plant Physiology (Rockville) 129 (3): 1398-1406.

43. Ledford HK, Niyogi KK. 2005. Singlet oxygen and photo-oxidative stress

management in plants and algae. Plant Cell and Environment 28 (8): 1037-1045.

44. Li X-P, Bjorkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK.

2000. A pigment-binding protein essential for regulation of photosynthetic light

harvesting. Nature (London) 403 (6768): 391-395.

45. Li X-P, Gilmore AM, Caffarri S, Bassi R, Golan T, Kramer D, Niyogi KK. 2004.

Regulation of photosynthetic light harvesting involves intrathylakoid lumen pH

sensing by the PsbS protein. Journal of Biological Chemistry 279 (22): 22866-22874.

46. Li XP, Phippard A, Pasari J, Niyogi KK. 2002. Structure-function analysis of

photosystem II subunit S (PsbS) in vivo. Functional Plant Biology 29 (10): 1131-

1139.

47. Li Z, Ahn TK, Avenson TJ, Ballottari M, Cruz JA, Kramer DM, Bassi R, Fleming

GR, Keasling JD, Niyogi KK. 2009. Lutein Accumulation in the Absence of

Zeaxanthin Restores Nonphotochemical Quenching in the Arabidopsis thaliana npq1

Mutant. Plant Cell 21 (6): 1798-1812.

48. MacPherson AN, Telfer A, Barber J, Truscott TG. 1993. Direct detection of singlet

oxygen from isolated Photosystem II reaction centres. Biochimica et Biophysica Acta

1143 (3): 301-309.

49. Melis A. 1999. Photosystem II damage and repair cycle in chloroplasts: what

modulates the rate of photodamage in vivo? : Trends in Plant Science. p. 130-135.

50. Miloslavina Y, Grouneva I, Lambrev PH, Lepetit B, Goss R, Wilhelm C, Holzwarth

AR. 2009. Ultrafast fluorescence study on the location and mechanism of non-

photochemical quenching in diatoms. Biochimica et Biophysica Acta 1787 (10):

1189-1197.

51. Miloslavina Y, Wehner A, Lambrev PH, Wientjes E, Reus M, Garab G, Croce R,

Holzwarth AR. 2008. Far-red fluorescence: A direct spectroscopic marker for LHCII

oligomer formation in non-photochemical quenching. FEBS Letters 582 (25-26):

3625-3631.

! #+!

52. Mozzo M, Passarini F, Bassi R, van Amerongen H, Croce R. 2008. Photoprotection in

higher plants: The putative quenching site is conserved in all outer light-harvesting

complexes of Photosystem II. Biochimica et Biophysica Acta 1777 (10): 1263-1267.

53. Muller M, Petar L, R. RMECRHA. 2010. Singlet Energy Dissipation in the

Photosystem II Light-Harvesting Complex Does Not Involve Energy Transfer to

Carotenoids. In: Petar L, editor.: ChemPhysChem. p. 1289–1296.

54. Munekage Y, Takeda S, Endo T, Jahns P, Hashimoto T, Shikanai T. 2001.

Cytochrome b6f mutation specifically affects thermal dissipation of absorbed light

energy in Arabidopsis. Plant Journal 28 (3): 351-359.

55. Neilson JAD, Durnford DG. 2010. Structural and functional diversification of the

light-harvesting complexes in photosynthetic eukaryotes. Photosynthesis Research

106 (1-2, Sp. Iss. SI): 57-71.

56. Nield J, Redding K, Hippler M. 2004. Remodeling of light-harvesting protein

complexes in Chlamydomonas in response to environmental changes. Eukaryotic Cell

3 (6): 1370-1380.

57. Nilkens M, Kress E, Lambrev P, Miloslavina Y, Mueller M, Holzwarth AR, Jahns P.

2010. Identification of a slowly inducible zeaxanthin-dependent component of non-

photochemical quenching of chlorophyll fluorescence generated under steady-state

conditions in Arabidopsis. Biochimica et Biophysica Acta 1797 (4): 466-475.

58. Niyogi KK, Bjorkman O, Grossman AR. 1997. Chlamydomonas xanthophyll cycle

mutants identified by video imaging of chlorophyll fluorescence quenching. Plant

Cell 9 (8): 1369-1380.

59. Niyogi KK, Grossman AR, Bjorkman O. 1998. Arabidopsis mutants define a central

role for the xanthophyll cycle in the regulation of photosynthetic energy conversion.

Plant Cell 10 (7): 1121-1134.

60. Nymark M, Valle KC, Brembu T, Hancke K, Winge P, Andresen K, Johnsen G,

Bones AM. 2009. An Integrated Analysis of Molecular Acclimation to High Light in

the Marine Diatom Phaeodactylum tricornutum. PLoS One 4 (11): Article No.:

e7743.

61. Okegawa Y, Long TA, Iwano M, Takayama S, Kobayashi Y, Covert SF, Shikanai T.

2007. A balanced PGR5 level is required for chloroplast development and optimum

operation of cyclic electron transport around photosystem I. Plant and Cell Physiology

48 (10): 1462-1471.

! #"!

62. Olaizola M, Yamamoto HY. 1994. Short-term response of the diadinoxanthin cycle

and fluorescence yield to high irradiance in Chaetoceros muelleri (Bacillariophyceae).

Journal of Phycology 30 (4): 606-612.

63. Park S, Jung G, Hwang Y-s, Jin E. 2010. Dynamic response of the transcriptome of a

psychrophilic diatom, Chaetoceros neogracile, to high irradiance. Planta (Berlin) 231

(2): 349-360.

64. Pascal AA, Liu Z, Broess K, van Oort B, van Amerongen H, Wang C, Horton P,

Robert B, Chang W, Ruban A. 2005. Molecular basis of photoprotection and control

of photosynthetic light-harvesting. Nature (London) 436 (7047): 134-137.

65. Pogson BJ, Niyogi KK, Bjorkman O, Dellapenna D. 1998. Altered xanthophyll

compositions adversely affect chlorophyll accumulation and nonphotochemical

quenching in Arabidopsis mutants. Proceedings of the National Academy of Sciences

of the United States of America 95 (22): 13324-13329.

66. Quick P, Scheibe R, Stitt M. 1989. USE OF TENTOXIN AND NIGERICIN TO

INVESTIGATE THE POSSIBLE CONTRIBUTION OF DELTA-PH TO ENERGY

DISSIPATION AND THE CONTROL OF ELECTRON TRANSPORT IN

SPINACH LEAVES. Biochimica et Biophysica Acta 974 (3): 282-288.

67. Ragni M, Airs RL, Leonardos N, Geider RJ. 2008. Photoinhibition of PSII in

Emiliania huxleyi (Haptophyta) under high light stress: The roles of photoacclimation,

photoprotection, and photorepair. Journal of Phycology 44 (3): 670-683.

68. Rockholm DC, Yamamoto HY. 1996. Violaxanthin de-epoxidase: Purification of a

43-kilodalton lumenal protein from lettuce by lipid-affinity precipitation with

monogalactosyldiacylglyceride. Plant Physiology (Rockville) 110 (2): 697-703.

69. Ruban AV, Berera R, Ilioaia C, van Stokkum IHM, Kennis JTM, Pascal AA, van

Amerongen H, Robert B, Horton P, van Grondelle R. 2007. Identification of a

mechanism of photoprotective energy dissipation in higher plants. Nature (London)

450 (7169): 575.

70. Ruban AV, Horton P. 1999. The xanthophyll cycle modulates the kinetics of

nonphotochemical energy dissipation in isolated light-harvesting complexes, intact

chloroplasts, and leaves of spinach. Plant Physiology (Rockville) 119 (2): 531-542.

71. Ruban AV, Lavaud J, Rousseau B, Guglielmi G, Horton P, Etienne A-L. 2004. The

super-excess energy dissipation in diatom algae: comparative analysis with higher

plants. Photosynthesis Research 82 (2): 165-175.

! ##!

72. Ruban AV, Young A, Horton P. 1994. Modulation of chlorophyll fluorescence

quenching in isolated light harvesting complex of photosystem II. Biochimica et

Biophysica Acta 1186 (1-2): 123-127.

73. Savard F, Richard C, Guertin M. 1996. The Chlamydomonas reinhardtii LI818 gene

represents a distant relative of the cabI/II genes that is regulated during the cell cycle

and in response to illumination. Plant Molecular Biology 32 (3): 461-473.

74. Siefermann-Harms D. 1987. THE LIGHT-HARVESTING AND PROTECTIVE

FUNCTION OF CAROTENOIDS IN PHOTOSYNTHETIC MEMBRANES.

Physiologia Plantarum 69 (3): 561-568.

75. Six C, Sherrard R, Lionard M, Roy S, Campbell DA. 2009. Photosystem II and

Pigment Dynamics among Ecotypes of the Green Alga Ostreococcus. Plant

Physiology (Rockville) 151 (1): 379-390.

76. Six C, Worden AZ, Rodriguez F, Moreau H, Partensky F. 2005. New insights into the

nature and phylogeny of prasinophyte antenna proteins: Ostreococcus tauri, a case

study. Molecular Biology and Evolution 22 (11): 2217-2230.

77. Szabo I, Bergantino E, Giacometti GM. 2005. Light and oxygenic photosynthesis:

energy dissipation as a protection mechanism against photo-oxidation. EMBO

Reports 6 (7): 629-634.

78. Takahashi S, Murata N. 2008. How do environmental stresses accelerate

photoinhibition? Trends in Plant Science 13 (4): 178-182.

79. Telfer A, Bishop SM, Phillips D, Barber J. 1994. Isolated photosynthetic reaction

center of photosystem II as a sensitizer for the formation of singlet oxygen: Detection

and quantum yield determination using a chemical trapping technique. Journal of

Biological Chemistry 269 (18): 13244-13253.

80. Teramoto H, Nakamori A, Minagawa J, Ono T. 2001. Light-intensity dependent

expression of genes for light-harvesting chlorophyll-a/b proteins of photosystem II

Chlamydomonas reinhardtii. Photosynthesis Research 69 (1-3): 45.

81. Ting CS, Owens TG. 1993. Photochemical and nonphotochemical fluorescence

quenching processes in the diatom Phaeodactylum tricornutum. Plant Physiology

(Rockville) 101 (4): 1323-1330.

82. Tjus SE, Scheller HV, Andersson B, Moller BL. 2001. Active oxygen produced

during selective excitation of photosystem I is damaging not only to photosystem I,

but also to photosystem II. Plant Physiology (Rockville) 125 (4): 2007-2015.

! #$!

83. Walters RG. 2005. Towards an understanding of photosynthetic acclimation. Journal

of Experimental Botany 56 (411): 435-447.

84. Walters RG, Horton P. 1991. RESOLUTION OF COMPONENTS OF NON-

PHOTOCHEMICAL CHLOROPHYLL FLUORESCENCE QUENCHING IN

BARLEY LEAVES. Photosynthesis Research 27 (2): 121-134.

85. Willemoes M, Monas E. 1991. RELATIONSHIP BETWEEN GROWTH

IRRADIANCE AND THE XANTHOPHYLL CYCLE POOL IN THE DIATOM

NITZSCHIA-PALEA. Physiologia Plantarum 83 (3): 449-456.

86. Young AJ, Frank HA. 1996. Energy transfer reactions involving carotenoids:

Quenching of chlorophyll fluorescence. Journal of Photochemistry and Photobiology

B Biology 36 (1): 3-15.

87. Zhu S-H, Green BR. 2010. Photoprotection in the diatom Thalassiosira pseudonana:

Role of LI818-like proteins in response to high light stress. Biochimica et Biophysica

Acta 1797 (8): 1449-1457.

! #%!

The work in Chapter 2 is published in: Peers G., Truong T.B., Ostendorf E., Busch A.,

Elrad D., Grossman A.R., Hippler M., and Niyogi K.K. (2009) An ancient light-

harvesting protein is critical for the regulation of algal photosynthesis. Nature 462: 518-

521.

I was responsible for most of the molecular biology experiments while Graham Peers did

the physiological work presented in this chapter.

! #&!

Chapter 2: Analysis of the Chlamydomonas npq4 mutant

Introduction

Non-photochemical quenching (NPQ) is a safety valve by which photosynthetic

organisms remove excess absorbed light energy as heat. This photoprotective mechanism

is essential for plants and algae during periods of high light exposure, when

photochemistry is saturated and the risk for reactive oxygen species (ROS) formation is

great. There are three layers of quenching and they are characterized by their induction

and relaxation times: qE, qT/qZ, and qI (Horton et al., 1996; Müller et al., 2001). qE (or

energy-dependent quenching) is the fastest component of NPQ and can be turned on and

off on a time scale of seconds to minutes. Consequently, qE performance is vital at times

of fluctuating high light intensities. It was shown that the Arabidopsis thaliana npq4

mutant lacking qE function suffered a fitness defect when grown in a natural light

environment or in a fluctuating environment in the laboratory, presumably due to its

inability to cope with rapid changes in light intensity (Kulheim et al., 2002).

qE and its mechanism have been extensively studied in the plant model organism

Arabidopsis thaliana (Holt et al., 2004). There are three essential components for qE

development in higher plants: 1) the lumenal proton gradient, 2) the xanthophyll cycle

and 3) the PsbS protein. PsbS is a crucial factor for qE, and the Arabidopsis npq4 mutant

lacking this protein exhibits no qE (Li et al., 2000). PsbS belongs to the LHC

superfamily, but it is an aberrant member with four trans-membrane domains, instead of

the usual three. It is found in higher plants and mosses and is believed to be responsible

for qE in these organisms. There have been numerous studies on PsbS in relation to NPQ.

Pines exhibit greater quenching capacity in the winter, and the expression of PsbS is

concomitantly higher during this period compared to the summer (Ottander et al., 1995).

Although we know that PsbS is necessary for qE, we do not yet know by what means this

protein works. Currently, it is believed that PsbS is a sensor of lumen pH and transducer

of this signal for the activation of qE. It is thought to be protonated during exposure to

excess light, and the quenching capacity of a plant is compromised when two specific

glutamate residues are mutated to non-protonatable residues (Li et al., 2004). This

protonation of PsbS is hypothesized to cause a conformational change in the PSII

supercomplex that triggers the minor antenna complexes to switch into a quenching

mode. Recent investigations have shown that these minor antenna complexes may be the

sites of quenching (Avenson et al., 2008; Ahn et al., 2009).

Although phytoplankton are responsible for approximately half of the global carbon

fixation (Falkowski et al., 2004), photosynthesis in these organisms is not as extensively

studied as in plants. It has been demonstrated that the proton gradient and xanthophylls

are necessary for qE in the green alga Chlamydomonas reinhardtii (Niyogi et al., 1997;

Finazzi et al., 2006). However, although green algae, including Chlamydomonas, contain

PSBS genes in their genomes, (Koziol et al., 2007) the role of PsbS is not known.

! #'!

Chlamydomonas has two copies of PSBS in its genome (Anwaruzzaman et al., 2004) and

one PSBS-like gene that is more closely related to the Volvox carteri copy. Screens for

NPQ-deficient mutants have not uncovered any that are affected in PSBS, suggesting that

PsbS has no role in algal qE. It could be that the mutagenesis was sub-saturating or that

genetic redundancy prevented the recovery of NPQ-deficient mutants affecting PSBS.

However, Bonente et al. (2008) showed that PsbS protein is not expressed in

Chlamydomonas and when these researchers tried to overexpress PsbS, they found that

the protein was not even directed to the thylakoid membrane. Interestingly, other algal

species such as the diatoms also perform qE, but they do not contain any copy of the

PSBS gene. Altogether, these observations suggest that algae may use other proteins for

quenching.

In this chapter, I will show that Chlamydomonas utilizes a different protein known as

LHCSR (light-harvesting complex stress-related protein) in the mechanism of qE. The

Chlamydomonas npq4 mutant lacks LHCSR3 and has less qE than the wild type. When

the mutation was complemented with a wild-type copy of the LHCSR3 gene, the qE -

deficient phenotype was rescued. These LHCSR proteins appear to be ancient members

of the light-harvesting complex (LHC) protein superfamily. They are not present in

higher plants where PsbS plays a role, but are found in mosses and algae and are

responsible for the quenching seen in these groups of photosynthetic organisms (Alboresi

et al., 2010; Bailleul et al., 2010; Zhu and Green, 2010). These findings shed some light

on the evolution of qE from green algae to higher plants.

Results

Chlamydomonas reinhardtii mutants were generated using insertional mutagenesis and

screened for NPQ defects using a fluorescence video imaging system that translates

fluorescence measurements into false-color images (Figure 1A and 1B). The

Chlamydomonas npq4 mutant, along with other qE-deficient mutants affecting the

xanthophyll cycle or another LHC protein, was found from these screens (Niyogi et al.,

1997). Using pulse-amplitude modulated (PAM) fluorescence measurements, it was

shown that npq4 is deficient in qE in high light (Figure 2). Low-light-grown npq4 cells

have similar NPQ capacity compared to wild-type cells. Plasmid rescue showed that the

insertion in npq4 is next to two genes, which are now annotated as LHCSR3.1 and

LHCSR3.2. These genes are ~10 kb apart on chromosome 8 (data not shown). The two

isoforms are 94% identical at the DNA level—most of the differences lie in the 5’ and 3’

UTRs—and 100% identical at the protein level when aligned with ClustalW2 (data not

shown). There also exists a third isoform called LHCSR1 that has high identity with

LHCSR3 at the amino acid level. The role of LHCSR1 will be the topic of the next

chapter.

PCR amplifications revealed that the genes LHCSR3.1 and LHCSR3.2 are missing from

the npq4 mutant (Figure 3A), and their respective mRNA transcripts are also missing

(Figure 3B). Insertional mutagenesis in Chlamydomonas is often accompanied by large

! #(!

deletions in the genome, sometimes up to 20 kb (Dent et al., 2001), as is the case with the

npq4 mutant. The plasmid rescue showed that the insertion is 8 kb upstream from

LHCSR3.2, and primer walking in this region further showed that the insertion had

deleted the region from the insertion to 5 kb downstream of LHCSR3.1, totaling 23 kb.

The additional genes abolished have homologs elsewhere in the genome, and they do not

appear to function in NPQ or photochemistry, thereby eliminating them from being the

cause of the NPQ deficient phenotype.

To make sure that the lack of LHCSR3 is indeed responsible for the deficient qE seen in

npq4, I complemented it by expression of an LHCSR3.1 cDNA under control of the

PSAD promoter (Figure 4).

Figure 1A and 1B: Scheme of the video imaging assay, copied from Niyogi et al. (1997).

! #)!

LHCSR3.1 was used instead of LHCSR3.2, because qPCR data showed that LHCSR3.1 is

more highly expressed in high light compared to LHCSR3.2. Complementation of the

npq4 mutant with LHCSR3.1 rescued the NPQ phenotype (Figure 4), however, the cDNA

complementation was not a complete rescue because the expression of the protein was

lower compared to wild type. This could be due to the PSAD promoter not being as

strong as the endogenous promoter of LHCSR3.1, or perhaps the insertion site of the

plasmid is in a heterochromatic region, where gene expression is low.

Figure 2: NPQ of wild type and

npq4 in low light and high light.

The npq4 mutant in filled circles

shows a much-reduced NPQ level

compared to wild type in high

light.

Figure 3A: Genomic PCR showing

the presence or absence of LHCSR

genes in wild type and npq4.

Figure 3B: RT-PCR showing the

presence or absence of LHCSR

mRNA in wild type and npq4.

! #*!

Wild type npq4 npq4+LHCSR3

Figure 4: Complementation of npq4 with LHCSR3.1. The schematic at the top shows the

plasmid used for complementation. LHCSR3.1 cDNA is flanked by the promoter and

terminator sequences of PSAD. The middle image is from the video imaging assay

showing NPQ in false color. The immunoblot at the bottom shows the complemented line

expressing LHCSR3.

Because qE capacity is induced by growth in high light as shown in Figure 2, I expected

the expression of LHCSRs to also increase in high-light-grown cells. Wild-type and npq4

cells were grown in low light or high light and harvested during log phase for

comparison. LHCSR transcripts were found to be higher in Chlamydomonas cultures

grown in high light compared to those grown in low light (Figure 5A). In the wild type, it

seems that LHCSR3.1 was the most highly expressed with a 10-fold increase, whereas

LHCSR1 showed a five-fold increase. In the npq4 mutant, LHCSR1 RNA increased eight-

fold increase in high light, suggesting that there might be some sort of compensation for

the lack of the other two genes. Correspondingly, LHCSR1 and LHCSR3 protein levels

! $+!

also increased in high light. (Figure 5B) The npq4 mutant had a higher amount of

LHCSR1 protein compared to wild type, as seen by the darker lower band.

To examine whether npq4 is negatively affected by high light and whether the lack of qE

affects its fitness, low-light-grown wild-type and npq4 cultures were exposed to excess

light of 1100 µmol photon m-2 sec-1 for 4 hours and then allowed to grow in high light

(400 µmol photon m-2 sec-1) on minimal medium for a week. As Figure 6 shows, npq4

cells were unable to grow as well as wild-type cells after exposure to high light. Thus, the

lack of qE affects the fitness of the alga, as has been shown with higher plants (Külheim

et al., 2002).

Figure 5B: Immunoblot showing levels of LHCSR proteins.

Figure 5A: Graph showing

levels of LHCSR mRNAs in

wild type versus npq4 under

low light and high light

conditions.

! $"!

Figure 6: Growth of wild type and npq4 on plates in high light after exposure to excess

high light for 4 hours and their NPQ phenotypes as shown by video imaging of

chlorophyll fluorescence.

In steady-state high light, both wild type and npq4 had similar growth rates and apparent

quantum efficiencies of oxygen evolution, indicating that npq4 is not deficient in

photosynthetic capacity. However, npq4 has a lower photosystem II efficiency compared

to wild type and also a higher chlorophyll a:b ratio, suggesting an alteration of its antenna

system. The xanthophyll cycle, which is involved in qE, is not affected in the npq4

mutant, signifying that the qE deficiency in this mutant is not related to the xanthophyll

cycle.

Table 1: Physiological parameters and chlorophyll contents of wild type and npq4 cells

grown in high light. ammol O2 (mol Chl a)-1 s-1 (!mol photons m-2 s-1)-1; *significantly

different (p<0.05, t-test)

! $#!

Table 2: The de-epoxidation state of xanthophylls in wild type and npq4, exposed to high

light for the indicated time points. DES = (Antheraxanthin +

Zeaxanthin)/(Violaxanthin+Antheraxanthin+Zeaxanthin).

Discussion

The Chlamydomonas npq4 mutant has a similar NPQ phenotype compared to the

Arabidopsis npq4 mutant. However, the absence of the LHCSR3 genes is responsible for

the qE-deficient phenotype in this green alga and not the PSBS gene as in Arabidopsis.

We showed that the npq4 mutant lacks the genomic region containing both LHCSR3.1

and LHCSR3.2. Although the insertion caused a large deletion, the npq4 mutation was

complemented by expression of an LHCSR3.1 cDNA (Figure 4). Two-dimensional gel

analysis showed that other components of the photosynthetic complexes, including

LHCBM1 (Elrad et al., 2002), are intact and similar to wild type (Peers et al., 2009).

Therefore, it appears that the lack of LHCSR3 is solely responsible for the qE-deficient

phenotype in the npq4 mutant.

LHCSR expression increases at both the mRNA and protein levels when cells are grown

in high light (Figure 5). This correlates with the induction of qE capacity in high light

(Figure 2). Having a higher expression level of LHCSRs in high light must confer some

advantage to the algae as protein expression incurs costs in terms of resources and

energy. This is indeed the case; qE and LHCSRs are important for survival of the algae in

high light, as has been demonstrated in higher plants. The npq4 mutant, when exposed to

an interval of over-saturating light, experienced a decrease in growth and fitness

compared to wild-type cells (Figure 6).

The xanthophyll cycle is involved in qE in both plants and algae; mutants unable to

accumulate zeaxanthin in both Arabidopsis and Chlamydomonas have a low NPQ

phenotype. However, npq4 shows a similar de-epoxidation state compared to wild type

when the cells are exposed to high light (Table 2). Thus, the xanthophyll cycle is not

affected in the mutant and is not accountable for the low NPQ seen in npq4. When npq4

was grown in constant high light, it grew just as well as wild type and had a comparable

apparent quantum efficiency of oxygen evolution (Table 1), suggesting that its

photosynthetic capacity is not compromised. However, npq4 seems to undergo some

! $$!

modification in its antenna system. The mutant has a slightly higher chlorophyll a content

compared to wild type and also a higher chlorophyll a:b ratio. Whether this is an effect of

having lower LHCSR3 or a compensatory consequence of having lower qE remains to be

determined.

PsbS is an important protein in the formation of qE in Arabidopsis. Although PSBS is

present in the Chlamydomonas genome in two copies, these genes do not seem to play a

role in quenching. It is possible that the protein is not even directed to the thylakoid

membrane, which is crucial for any direct role in qE (Bonente et al., 2008).

Overexpression of PSBS resulted in no differences in qE (Bonente et al., 2008). This

behavior of PsbS in Chlamydomonas is unlike that seen in higher plants, where

increasing the amount of PsbS led to an increase in NPQ capacity. These findings are not

consistent with the idea that algal PsbS has a role in NPQ or photochemistry. The current

conclusion is that the two copies of PSBS are pseudogenes in Chlamydomonas. However,

a recent publication by Miller et al. (2010) showed that PSBS mRNA is expressed at a

higher level during nitrogen deprivation. Perhaps PsbS only plays a role in qE under

certain situations and/or we have yet to find the conditions in which it is functional.

The discovery of the role of LHCSRs in Chlamydomonas qE reveals something about the

evolution of the mechanism of qE in the green clade. LHCSRs are present in algae and

are grouped under the so-called stress-induced chlorophyll-binding proteins (Dittami et

al, 2010). It was also shown that Ostreococcus tauri, a unicellular prasinophyte green

alga, contains LHCSR, and this protein is likely to be responsible for the qE seen in this

species. The level of LHCSR increases in high light just as qE is induced (Peers et al.,

2009). Recent papers on diatoms have illustrated the involvement of LHCSR homologs

in NPQ in these organisms (Bailleul et al., 2010; Zhu et al., 2010). In contrast, nearly all

higher plants such as Arabidopsis, tobacco, and poplars do not contain LHCSRs, but

employ PsbS instead.

The moss Physcomitrella patens presents an interesting case. This organism has been

shown to utilize both PsbS and LHCSRs for qE (Alboresi et al., 2010). When LHCSR or

PSBS genes were knocked out, qE was reduced; when both genes were knocked out, all

qE was eliminated. The moss represents an intermediate in the evolution of green algae to

land plants. As plants evolved from a moss-like ancestor, they eventually lost LHCSRs

and retained PSBS instead. This is interesting when we look at the data from the Alboresi

et al. paper. Knocking out PSBS reduces qE capacity to a lesser extent than when LHCSR

is knocked out. It would make more sense to keep LHCSR to benefit from the higher

quenching capacity, but that did not happen. It seems then that PsbS must confer some

advantage that permitted its replacement of LHCSRs in higher plants. One possibility is

that PsbS is a better regulator of quenching than LHCSRs. In low light, we can still see a

low level of LHCSRs in Chlamydomonas, suggesting that there may be some quenching

happening. However, there is no need for quenching in low light and this is rather a waste

of the absorbed light energy. Unlike LHCSRs, PsbS is not turned on in low light and so

! $%!

does not lead to the dissipation of the light energy that could otherwise go into

photochemistry.

LHCSRs appear in both the green and red clades of photosynthetic eukaryotes, but red

algae themselves lack LHCSRs. There exist a number of possible hypotheses for this

occurrence. The wide distribution of LHCSRs suggests they emerged before the

separation of red and green algae, and red algae may have lost LHCSRs as did higher

plants. Another possibility, suggested by phylogenomic analysis of diatom genomes, is

that LHCSRs evolved in the green clade and because of a cryptic endosymbiotic event

involving a prasinophyte green alga, spread to chromalveolate algae such as diatoms

(Moustafa et al., 2009). Other qE-related proteins, i.e., violaxanthin de-epoxidase and

zeaxanthin epoxidase, were also found in diatoms, and these two enzymes are closely

related to homologs in Ostreococcus (Frommolt et al., 2008). Their homology to those

found in this prasinophyte is supported by the synteny of the two enzymes and the

analogous insertions/deletions shared in both groups. However, a recent paper by Dittami

et al. (2010) proposed a different scenario. Based on a structural study between LHCSR

and a chlorophyll a/c-binding protein from Ectocarpus siliculosis, a brown alga, they

proposed that LHCSRs are unable to bind chlorophyll b and lutein; rather, LHCSRs are

more likely to bind chlorophyll c and fucoxanthin. They suggested that LHCSR evolved

from an early evolving haptophyte and a green alga obtained the gene through lateral

transfer. However, as we will see in Chapter 4, LHCSRs do bind chlorophyll b and lutein,

negating the hypothesis of Dittami et al. It seems that the cryptic endosymbiosis of a

green alga was more likely the event that led to the proliferation of LHCSRs in other

species.

Materials and Methods

Strains and growth conditions

The Chlamydomonas reinhardtii wild-type strain used in this work was 4A+ (137c

genetic background) (Dent et al., 2005). The npq4 mutant was originally generated from

the arginine-requiring CC-425 background as described previously (Niyogi et al., 1997),

and it was backcrossed four times to the 4A+ strain before physiological characterization.

All physiological measurements were performed on fully acclimated cells cultured

photoautotrophically in a constant light environment and at 25 °C as described previously

(Niyogi et al., 1997). Cells were grown in low light (40 µmol photons m-2 s-1) or high

light (400 µmol photons m-2 s-1).

Measurement of chlorophyll fluorescence, oxygen evolution, and photosynthetic

pigments

Chlorophyll fluorescence measurements of Chlamydomonas cells were performed with a

Hansatech FMS2 system or with a custom fluorescence imager as previously described

(Niyogi et al., 1997) but with some modifications. Cells were dark-acclimated for 30 to

! $&!

60 min before measurement, then gently filtered onto a glass-fiber filter and placed on the

instrument’s leaf clip. The maximum efficiency of photosystem II ([Fm-Fo]/Fm = Fv/Fm)

was measured after 5 min of far-red light to ensure transition into State I. Fo is the

fluorescence resulting from the measuring light alone. Fm is the maximum fluorescence

measured during a brief, saturating flash of light. Cells were exposed to actinic light of

600 µmol photons m-2 s-1 to induce NPQ. Total NPQ was calculated as (Fm-Fm!)/Fm!,

where Fm! is the maximum fluorescence measured in the light-adapted state (during or

after actinic light illumination). Oxygen evolution, chlorophyll content per cell, and

xanthophyll cycle pigments were measured on exponentially growing cultures (< 1 X 106

cells ml-1) as described.

Genomic DNA analyses

Genomic DNA was isolated using a phenol/chloroform extraction method (Baroli et al.,

2003). For plasmid rescue, 10!!g of genomic DNA from the npq4 mutant was digested

overnight with SacI, the enzyme was heat-inactivated for 20!min at 65!°C, and the DNA

fragments ligated overnight at 4!°C. After a phenol/chloroform purification, the DNA was

ethanol precipitated, and resuspended in 20!!l TE (10!mM Tris-HCl, 1!mM EDTA,

pH!7.4). Escherichia coli strain DH5" was then transformed with half of the ligation

mixture.

To test for the presence of LHCSR genes, standard PCR was performed with primer pairs

that span each entire gene. The primers used were LHCSR1 (protein ID 184724 in

Chlamydomonas genome sequence v3) (5!-TTCTCAGCTTGCACCTCCTT-3! and 5!-

GGCACTTAGATGGCCTTGAG-3!), LHCSR3.1 (protein ID 184731) (5!-

GCTCCTCGACAATCGCTTAC-3! and 5!-TCATGCTCTCTCTGCTGTGC-3!), and

LHCSR3.2 (protein ID 184730) (5!-ATTAACATGGGCGACTACCG-3! and 5!-

TGTACGCAGTTCAAGGGATG-3!).

RNA analysis

Cells were grown for more than 2 days to reach log phase and collected by centrifugation

at 4!°C. RNA was extracted with TRIZOL and treated with DNase from Invitrogen

according to the manufacturer’s instructions. First-strand complementary DNA was made

with Invitrogen Superscript III reagents and protocols. Standard RT–PCR using Taq

polymerase was performed to test for the presence of transcripts in the wild type and

npq4. The primers used were LHCSR1 (5!-ATCTGCTTCACGGTTTGGTC-3! and 5!-

CACACAATTCTGCCAACAGC-3!), LHCSR3.1 (5!-CGCACAGTCCTATGGTGTTG-

3! and 5!-TGTTCGCACTCGTCTTCATC-3!), and LHCSR3.2 (5!-

CCAATACACACGATCCCTCTC-3! and 5!-GGTGGAAGAGTATCGCAAGC-3!). To

measure the expression level of these genes by quantitative RT–PCR, I employed the

SYBR Green Master Mix and an Applied BioSystems 7000 qPCR machine. The

efficiencies of the primers were between 95% and 100%. All samples were calibrated

! $'!

against the wild type in low light. A gamma-tubulin gene (TUG, protein ID 188933) was

used as the endogenous control, and the ##Ct method was used to calculate mRNA

levels. The TUG primers used were 5!-CGCCAAGTACATCTCCATCC-3! and 5!-

TAGGGGCTCTTCTTGGACAG-3!.

Complementation of npq4

The cDNA of LHCSR3.1 was placed under the control of the PSAD promoter using the

pSL18 vector (Depège et al., 2003) using standard molecular biology protocols. Vectors

were transformed into npq4 cells grown in TAP and selected for paromomycin resistance.

Colonies were then screened for NPQ capacity as described previously (Niyogi et al.,

1997).

Immunoblot analysis

Cells were harvested in exponential growth phase (<1!$!106!cells!ml-1) by centrifugation

(1,800 g for 4 !min). Cells were resuspended in standard SDS denaturing buffer and lysed

with vigorous shaking at room temperature (25!°C) for 5!min. An aliquot was removed for

chlorophyll determination, and insoluble material was removed by centrifugation at

10,000g for 10!min. Samples were diluted to a final concentration of 0.1!nmol

chlorophyll!!l-1. Protein homogenates were loaded on pre-cast Novex 10–20% Tricine

gels (Invitrogen). 35!mA was applied until the 15!kDa molecular weight standard ran off

the gel. Proteins were blotted onto nitrocellulose membranes using standard methods.

Membranes were blocked overnight with 2% milk in TBS and then incubated with anti-

LHCSR polyclonal antibody diluted 1:10,000 (in 0.5% milk in TBS), anti-LHCSR3

antibody diluted 1:20,000, or anti-D2 antibody (Agrisera), diluted 1:5,000. Membranes

were incubated for 1 hour and then rinsed four times for 5!min before incubation with

1:100,000 WestFemto (Pierce) secondary antibodies, and reactive bands were detected

according to the manufacturer’s protocol. PSAD was resolved and detected as described

previously.

! $(!

References

1. Ahn TK, Avenson TJ, Ballottari M, Cheng Y-C, Niyogi KK, Bassi R, Fleming GR.

2008. Architecture of a charge-transfer state regulating light harvesting in a plant

antenna protein. Science (Washington DC) 320 (5877): 794-797.

2. Alboresi A, Gerotto C, Giacometti GM, Bassi R, Morosinotto T. 2010.

Physcomitrella patens mutants affected on heat dissipation clarify the evolution of

photoprotection mechanisms upon land colonization. Proceedings of the National

Academy of Sciences of the United States of America 107 (24): 11128-11133.

3. Anwaruzzaman M, Chin BL, Li X-P, Lohr M, Martinez DA, Niyogi KK. 2004.

Genomic analysis of mutants affecting xanthophyll biosynthesis and regulation of

photosynthetic light harvesting in Chlamydomonas reinhardtii. Photosynthesis

Research 82 (3): 265-276.

4. Avenson TJ, Ahn TK, Zigmantas D, Niyogi KK, Li Z, Ballottari M, Bassi R, Fleming

GR. 2008. Zeaxanthin radical cation formation in minor light-harvesting complexes of

higher plant antenna. Journal of Biological Chemistry 283 (6): 3550-3558.

5. Bailleul B, Rogato A, de Martino A, Coesel S, Cardol P, Bowler C, Falciatore A,

Finazzi G. 2010. An atypical member of the light-harvesting complex stress-related

protein family modulates diatom responses to light. Proceedings of the National

Academy of Sciences of the United States of America 107 (42): 18214-18219.

6. Ballottari M, Dall'Osto L, Morosinotto T, Bassi R. 2007. Contrasting behavior of

higher plant photosystem I and II antenna systems during acclimation. Journal of

Biological Chemistry 282 (12): 8947-8958.

7. Baroli I, Do AD, Yamane T, Niyogi KK. 2003. Zeaxanthin accumulation in the

absence of a functional xanthophyll cycle protects Chlamydomonas reinhardtii from

photooxidative stress. Plant Cell 15 (4): 992-1008.

8. Bonente G, Dall'Osto L, Bassi R. 2008. In Between Photosynthesis and

Photoinhibition: The Fundamental Role of Carotenoids and Carotenoid-Binding

Proteins in Photoprotection. In: Pavesi L, Fauchet PM, editors. Biological and

Medical Physics, Biomedical Engineering. p. 29-46.

9. Dent RM, Haglund CM, Chin BL, Kobayashi MC, Niyogi KK. 2005. Functional

genomics of eukaryotic photosynthesis using insertional mutagenesis of

Chlamydomonas reinhardtii. Plant Physiology (Rockville) 137 (2): 545-556.

! $)!

10. Dent RM, Han M, Niyogi KK. 2001. Functional genomics of plant photosynthesis in

the fast lane using Chlamydomonas reinhardtii. Trends in Plant Science 6 (8): 364-

371.

11. Depege N, Bellafiore S, Rochaix J-D. 2003. Role of chloroplast protein kinase Stt7 in

LHCII phosphorylation and state transition in Chlamydomonas. Science (Washington

DC) 299 (5612): 1572-1575.

12. Dittami SM, Michel G, Collen J, Boyen C, Tonon T. 2010. Chlorophyll-binding

proteins revisited - a multigenic family of light-harvesting and stress proteins from a

brown algal perspective. BMC Evolutionary Biology 10:Article No.: 365.

13. Elrad D, Niyogi KK, Grossman AR. 2002. A major light-harvesting polypeptide of

photosystem II functions in thermal dissipation. Plant Cell 14(8): 1801-1816.

14. Falkowski PG, Katz ME, Knoll AH, Quigg A, Raven JA, Schofield O, Taylor FJR.

2004. The evolution of modern eukaryotic phytoplankton. Science (Washington D C)

305 (5682): 354-360.

15. Finazzi G, Johnson GN, Dall'Osto L, Zito F, Bonente G, Bassi R, Wollman F-A.

2006. Nonphotochemical quenching of chlorophyll fluorescence in Chlamydomonas

reinhardtii. Biochemistry 45 (5): 1490-1498.

16. Frommolt R, Werner S, Paulsen H, Goss R, Wilhelm C, Zauner S, Maier UG,

Grossman AR, Bhattacharya D, Lohr M. 2008. Ancient Recruitment by Chromists of

Green Algal Genes Encoding Enzymes for Carotenoid Biosynthesis. Molecular

Biology and Evolution 25 (12): 2653-2667.

17. Holt NE, Fleming GR, Niyogi KK. 2004. Toward an understanding of the mechanism

of nonphotochemical quenching in green plants. Biochemistry 43 (26): 8281-8289.

18. Horton P, Ruban AV, Walters RG. 1996. Regulation of light harvesting in green

plants. In: Jones RL, editor. Annual Review of Plant Physiology and Plant Molecular

Biology. p. 655-684.

19. Koziol AG, Borza T, Ishida K-I, Keeling P, Lee RW, Durnford DG. 2007. Tracing the

evolution of the light-harvesting antennae in chlorophyll a/b- containing organisms.

Plant Physiology (Rockville) 143 (4): 1802-1816.

20. Kulheim C, Agren J, Jansson S. 2002. Rapid regulation of light harvesting and plant

fitness in the field. Science (Washington DC) 297 (5578): 91-93.

! $*!

21. Li X-P, Bjorkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK.

2000. A pigment-binding protein essential for regulation of photosynthetic light

harvesting. Nature (London) 403 (6768): 391-395.

22. Li X-P, Gilmore AM, Caffarri S, Bassi R, Golan T, Kramer D, Niyogi KK. 2004.

Regulation of photosynthetic light harvesting involves intrathylakoid lumen pH

sensing by the PsbS protein. Journal of Biological Chemistry 279 (22): 22866-22874.

23. Miller R, Wu G, Deshpande RR, Vieler A, Gaertner K, Li X, Moellering ER, Zaeuner

S, Cornish AJ, Liu B et al. 2010. Changes in Transcript Abundance in

Chlamydomonas reinhardtii following Nitrogen Deprivation Predict Diversion of

Metabolism. Plant Physiology (Rockville) 154 (4) : 1737-1752.

24. Moustafa A, Reyes-Prieto A, Bhattacharya D. 2008. Chlamydiae Has Contributed at

Least 55 Genes to Plantae with Predominantly Plastid Functions. PLoS One 3( 5):

Article No.: e2205.

25. Muller P, Li X-P, Niyogi KK. 2001. Non-photochemical quenching. A response to

excess light energy. Plant Physiology (Rockville) 125 (4): 1558-1566.

26. Niyogi KK, Bjorkman O, Grossman AR. 1997. Chlamydomonas xanthophyll cycle

mutants identified by video imaging of chlorophyll fluorescence quenching. Plant

Cell 9(8): 1369-1380.

27. Ottander C, Campbell D, Oquist G. 1995. Seasonal changes in photosystem II

organisation and pigment composition in Pinus sylvestris. Planta (Heidelberg) 197

(1): 176-183.

28. Peers G, Truong TB, Ostendorf E, Busch A, Elrad D, Grossman AR, Hippler M,

Niyogi KK. 2009. An ancient light-harvesting protein is critical for the regulation of

algal photosynthesis. Nature (London) 462 (7272): 518.

29. Zhu S-H, Green BR. 2010. Photoprotection in the diatom Thalassiosira pseudonana:

Role of LI818-like proteins in response to high light stress. Biochimica et Biophysica

Acta 1797 (8): 1449-1457.

! %+!

Marilyn Kobayashi, William Inwood, Graham Peers and the Seattle TILLING Project

were responsible for isolating the lhcsr1 mutant. I did the physiological and biochemical

analysis for the lhcsr1 and the npq4 lhcsr1 mutants. I was also responsible for the

genomic complementation of the npq4 line. Carmela Guadagno isolated the npq4 supp1

line and carried out the physiological and biochemical analysis for it.

! %"!

Chapter 3: LHCSR1 and the npq4 lhcsr1 double mutant

Introduction

The LHCSR3 protein is necessary for normal qE in the green alga Chlamydomonas

reinhardtii (Chapter 2; Peers et al., 2009). The qE capacity of the npq4 mutant, which

lacks LHCSR3, is diminished, and it suffers from a lower survival rate than wild type

when shifted to excess light. Several studies have been performed subsequently detailing

the importance of LHCSRs in qE in the moss Physcomitrella patens and various diatom

species (Alboresi et al., 2010; Bailleul et al., 2010; Zhu and Green, 2010). It appears that

LHCSRs are ancient members of the LHC family and are responsible for qE in many

algae, whereas a role for PsbS appeared during the evolution of higher plants.

The npq4 mutant lacks the LHCSR3.1 and LHCSR3.2 genes, which are 10 kb apart.

However, a third LHCSR gene, known as LHCSR1, is about 200 kb from the other two

(Figure 1A). LHCSR1 is 36% identical to both LHCSR3s at the DNA level, but is greater

than 80% identical in amino acid sequence (Figure 1B). Chlamydomonas contains many

instances of gene duplication events, where the duplicated genes exist as inverted repeats

that are very close to each other (Merchant et al., 2007); a recent gene duplication event

is most likely the reason that LHCSR3.1 and LHCSR3.2 share such a high degree of

identity. However, based on the protein sequence alignment (Figure 1B), it appears that

most of the differences in the sequence between LHCSR1 and LHCSR3 are in the amino-

terminal chloroplast transit peptide. Given the very high identity between the mature

portions of the LHCSR1 and LHCSR3 isoforms, I hypothesized that LHCSR1 is also

involved in qE. As shown in Peers et al. (2009), levels of both LHCSR1 mRNA and its

protein increased in high light in a manner similar to the expression profiles of LHCSR3.

In this chapter, I describe the LHCSR1 isoform and its role in qE in Chlamydomonas. I

characterize the first TILLING (Targeting Induced Local Lesions in Genomes) mutant in

Chlamydomonas – dubbed lhcsr1 for its lack of the LHCSR1 isoform – as well as the

double mutant npq4 lhcsr1. TILLING is a method that allows for direct identification of

mutations in specific genes (McCallum et al., 2000). This method combines UV/EMS-

induced mutagenesis with a high-throughput screening system to identify mutations in a

gene of interest. While the lhcsr1 mutant shows no significant deficiency in qE, the

double mutant lacks all LHCSRs and exhibits essentially no qE capacity. These data,

along with those described in Chapter 2, indicate that LHCSR1 is involved in qE but

LHCSR3 contributes more to qE capacity. Furthermore, based on the result from the

double mutant, we conclude that all qE in Chlamydomonas is attributable to LHCSRs;

this is unlike the situation in the moss P. patens, in which both PsbS and LHCSRs are

important. Based on the work presented here, I propose that LHCSRs are the major

quenching sites in algae, whereas in plants the LHCII and/or the minor antenna

complexes play that role.

! %#!

A.

B.

Figure 1: A. Schematic of the location of the three LHCSR genes in the Chlamydomonas

genome. B. Protein alignment of LHCSRs using ClustalW. LHCSR3.1 and LHCSR3.2

are identical proteins.

Results

As shown in Chapter 2, Chlamydomonas cells have a low level of qE when grown in low

light, and this was correlated with low expression of LHCSR proteins, compared to cells

grown in high light. Complementation of npq4 by expression of an LHCSR3.1 cDNA

resulted in partial rescue of the mutant’s qE defect, consistent with the intermediate level

! %$!

of LHCSR3 protein expression obtained (Chapter 2, Figure 4). To generate

complemented lines with higher levels of LHCSR3 expression, the npq4 mutant was

transformed with an LHCSR3.1 genomic clone including its native promoter. One

transformant line (#4) expressed LHCSR3 protein at approximately the same level as

wild type, and its qE capacity was very similar to that of wild type. Two transformant

lines contained more LHCSR3 protein than wild type (Figure 2B) and, similar to PsbS in

Arabidopsis (Li et al., 2002), overexpression of LHCSR3 led to enhanced qE in

Chlamydomonas (Figure 2A). These results are consistent with the hypothesis that qE

capacity is determined, at least in part, by the level of LHCSR3 protein expression.

A.

B.

! %%!

Figure 2. Complementation of npq4 with an LHCSR3.1 genomic clone. (A) NPQ of

transformant lines compared to npq4 and wild type. (B) Immunoblot analysis of LHCSR

protein levels.

To determine if another gene might be able to bypass the qE defect of the npq4 mutant, a

screen for suppressors of npq4 was performed. The npq4 mutant was UV-mutagenized

and the resulting colonies were monitored for a higher NPQ phenotype using video

imaging of chlorophyll fluorescence (Niyogi et al., 1997; data not shown). One line,

named npq4 supp1, consistently showed higher NPQ capacity when measured with PAM

fluorescence. The NPQ analysis showed that this suppressor strain has an intermediate qE

level, between npq4 and wild type cells (Figure 3A). Immunoblot analysis confirmed the

lack of LHCSR3 protein in npq4 supp1 and showed that the suppressor accumulated

more of the LHCSR1 isoform compared to the npq4 mutant (Figure 3B). This result

strongly suggests that LHCSR1 has a role in qE, and as shown above for LHCSR3, it

appears that qE capacity is limited by LHCSR1 expression.

A.

! %&!

B.

Figure 3. Overexpression of LHCSR1 in a partial suppressor of npq4. (A) NPQ

measurements of the npq4 supp1 strain compared to npq4 and wild type. (B) Immunoblot

analysis of LHCSR protein levels.

To assess the contribution of LHCSR1 in qE, a loss-of-function mutation affecting the

LHCSR1 gene was identified by TILLING. Screening of 4,024 UV-mutagenized lines of

wild type yielded four lhcsr1 point mutants: two missense mutations, one silent mutation

in the coding region, and one intron mutation. Immunoblot analysis of the mutants

showed that one of the missense mutants, lhcsr1-1, lacked accumulation of the LHCSR1

protein but had normal levels of LHCSR3 (Figure 4). This lhcsr1 mutant has a

substitution of the “GA” for “CT” in the third exon of the gene, resulting in the

conversion of a tyrosine at position 164 to an asparagine residue (Y164N). The lhcsr1

mutant had both LHCSR3 its proposed phosphorylated form (Figure 4B). This

immunoblot analysis indicates that LHCSR1 is not phosphorylated, because there is no

third upper band seen in the npq4 mutant (Bonente et al., 2011). However, a low,

undetectable level of phosphorylated LHCSR1 cannot be ruled out.

The qE capacity of the lhcsr1 mutant is not significantly different from wild type (Figure

4A). Thus, the LHCSR3 isoform is sufficient for normal qE in the lhcsr1 mutant. When

lhcsr1 was crossed to npq4, the double mutant completely lacked qE, showing that all qE

in Chlamydomonas is LHCSR-dependent. LHCSR1 does contribute to qE as shown by

the npq4 supp1 line above, however the LHCSR3 isoform plays a more dominant role.

! %'!

A.

B.

Figure 4. LHCSR-dependent qE in Chlamydomonas. (A) NPQ of the four strains: wild

type, lhcsr1, npq4 and npq4 lhcsr1. (B) Immunoblot analysis of LHCSR protein levels.

The single and double mutant strains seemed to grow just as well as wild type in high

light (Figure 5). To determine if the mutants sustain more oxidative stress because of

their lack of qE, the level of lipid peroxidation was measured using the thiobarbituric acid

reactive substances (TBARS) test (Baroli et al., 2003). Figure 6 shows that none of the

mutants exhibited any more lipid peroxidation than the wild type. Moreover, lipid

peroxidation was not a major consequence of high light stress, as there was no difference

between low-light-grown cells and high-light-grown cells. The maximum efficiency of

photosystem II was also not significantly different from wild type (Table 1).

! %(!

Because the mutant and wild-type cells were grown in steady-state high light, it is likely

that the mutants could acclimate to the higher light condition by activating other

mechanisms of quenching or other ways to deal with the excessive light energy, i.e.

decreasing their light harvesting ability or increasing their antioxidant levels. Table 1B

shows that both measures are taking place. The levels of neoxanthin and chlorophyll a

decreased in all strains when the cultures were grown in high light (Table 1B) compared

to low light (Table 1A), indicating that they all down-regulated their antenna to avoid

absorption of the excessive light. All mutant and wild-type cells exhibited increased

antioxidant levels in high light, but the qE-deficient mutants had a higher increase

compared to wild type. The npq4 and npq4 lhcsr1 mutants had higher amounts of lutein,

a larger xanthophyll cycle pool, and a higher de-epoxidation state in comparison to wild

type, allowing for the removal of triplet excited chlorophyll and singlet oxygen. These

two mutants also produced more "-tocopherol, which can quench or scavenge singlet

oxygen, superoxide, and hydrogen peroxide.

Figure 5: Growth curves of npq4 lhcsr1, npq4, lhcsr1 and wild type Chlamydomonas

cells in high light (400 !mol photon m-2 s-1).

! %)!

Figure 6: Lipid peroxidation levels of npq4 lhcsr1, npq4, lhcsr1 and wild type

Chlamydomonas cells in low light (40 !mol photon m-2 s-1) and high light (400 !mol

photon m-2 s-1).

A. low light

! %*!

B. high light

Table 1: Photosystem II efficiency and pigment composition of the mutants and wild type

grown in A. low light (40 !mol photons m-2 s-1) and B. high light (400 !mol photons m-2

s-1). The units for pigments are mmol/mol and are normalized by Chl a. V= violaxanthin,

A= antheraxanthin, and Z= zeaxanthin. DES= (A+Z)/(V+A+Z).

Discussion

Here, I have characterized the first Chlamydomonas mutant, lhcsr1, obtained using

TILLING as a reverse genetics approach for algae. TILLING has been used in a variety

of other organisms, from the model plant Arabidopsis thaliana to model animals such as

Caenorhabditis elegans and Drosophila melanogaster. The lhcsr1-1 allele is a null

mutant that is unable to accumulate the LHCSR1 protein (Figure 4). In principle, by

screening more mutants, an allelic series of mutations in LHCSR1 could be obtained that

would allow dissection of the protein domains important for qE function.

By generating an npq4 lhcsr1 double mutant, I showed that LHCSRs are necessary for all

the qE in Chlamydomonas. Although the lhcsr1 mutant on its own does not show much

of a qE-deficient phenotype, the npq4 lhcsr1 mutant lacks qE completely. When either

the LHCSR1 or LHCSR3 isoform is overexpressed in the npq4 mutant background, the

qE capacity increases. Therefore, qE capacity is directly correlated with the amount of

LHCSR protein. This is similar to the scenario with PsbS in plants, where overexpression

of PsbS also leads to higher NPQ capacity (Li et al., 2002; Niyogi et al., 2005). However,

unlike PsbS, LHCSRs might be the sites of quenching.

Chlamydomonas npq4 and npq4 lhcsr1 cells can acclimate to constant high light and

even grow well despite the lack of qE. Acclimation of these cells to high light involves

other photoprotective mechanisms such as 1) down-regulating the antenna complexes to

absorb less light and 2) up-regulating anti-oxidant capacity by increasing the amount of

! &+!

lutein, alpha-tocopherol and xanthophyll cycle pigments to combat the reactive oxygen

species generated in high light. Under fluctuating high light conditions, however, qE-

deficient mutants do not survive as well as demonstrated by Kulheim et al. (2002) with

the Arabidopsis PsbS mutant and by Peers et al. (2009) with the npq4 mutant of

Chlamydomonas.

In the past few years, many papers have been published on rapidly induced NPQ in

various species, such as cyanobacteria, mosses, and algae. These different organisms use

different specialized proteins for this component of NPQ. Cyanobacteria employ the

orange carotenoid protein (OCP) and have another protein called the FRP to turn the

quenching off (Wilson et al., 2008; Boulay et al., 2010). Eukaryotic photosynthetic

organisms that do not have phycobilisomes instead use proteins from the LHC

superfamily to dissipate excess absorbed light energy. In higher plants such as

Arabidopsis, PsbS in conjunction with the minor and/or major antenna proteins are

necessary for quenching (Li et al., 2000; Ruban et al, 2007; Ahn et al., 2008; Avenson et

al., 2008). In the mosses, both PsbS and LHCSRs are responsible for qE. The two

proteins play additive roles in quenching in these “lower plants”, each responsible for

approximately half of the qE capacity. In green algae such as Chlamydomonas, LHCSRs

are solely responsible for the quenching, as found in this chapter. I hypothesize that

LHCSRs are also capable of being protonated and can behave in a similar way to PsbS,

i.e. to induce quenching. From protein alignments, it is evident that LHCSRs contain

many acidic residues in their lumenal domains, more so than PsbS. These proteins bind to

DCCD, a reagent that binds to acidic residues in hydrophobic regions, indicating that

LHCSRs are capable of being protonated (Bonente et al., 2011). Thus, LHCSRs might

have two functions in qE in algae. They might be both the sites of quenching and the

sensors of the low lumen pH that is the signal for turning on qE. The regulatory capacity

of LHCSRs and their homologs is illustrated in a recent publication by Bailleul et al.

(2010) in the case of the Lhcx1 protein from P. tricornutum. Lhcx1, a member of the

LHCSR family, is expressed in all light conditions and is believed to modulate quenching

under the different light intensities. Additionally, different ecotypes of this diatom

express different levels of Lhcx1 depending on the light environment of that strain.

Materials and Methods

Genomic complementations

Genomic LHCSR3.2 were amplified from wild type with its endogenous promoters,

which are assumed to be about 1000bp upstream of the 5’UTR, and cloned into the entry

vector pENTR’D according to the manufacturer’s protocol (Invitrogen). The genes were

then sequenced and cloned into our own GATEWAY vector containing paromomycin for

selection in Chlamydomonas, using the Invitrogen GATEWAY LR Clonase II enzyme

mix. The GATEWAY vector (called GwypBC1) was created by cloning the GATEWAY

! &"!

fragment from the pEARLEYGATE 205 plasmid (Earley et al., 2006) into the XhoI sites

of pBC1—a homemade vector from pBluescript containing the paromomycin resistance

gene. This GATEWAY fragment comprises the cddB gene flanked by attR sites. npq4

cells were then transformed with the gene with the glass bead method (McCarthy et al.,

2004) and grown on TAP plus paromomycin plates. After 10 days, we picked colonies,

grew them on minimal media and screened for NPQ capacity with the video imaging of

chlorophyll fluorescence (Niyogi et al., 1997). Positive colonies were then tested for

protein presence and retested for NPQ with PAM fluorescence. The primers used for the

PCR were (5’ TTCAAGGGATGAGCAAGTT 3’) and (5’

CACCGCTGACTCCCCTGTCTTCAG 3’).

Measure of chlorophyll fluorescence and pigments

Chlamydomonas cells were grown photoautotrophically in minimal (HS) media in high

light (400 !mol photons m-2 s-1) and harvested while in their log phase. Chlorophyll

fluorescence measurements of the cells were performed with a Hansatech FMS2 system.

Before FMS measurements, cells were dark incubated for 15 to 30 min and filtered onto a

glass-fiber filter and placed on the instrument’s leaf clip. The same script was used as in

Peers et al. (2009). Pigment composition measurements were done according to Baroli et

al. (2003).

Immunoblot analysis

Cells were harvested in log phase and collected via centrifugation at 4000 rpm for 3 min.

They were resuspended in SDS denaturing buffer for 15 min at room temperature and

centrifuged again at 14,000 rpm to remove insoluble material. Samples were measured

for chlorophyll a concentration and diluted to a concentration of 0.01 to 0.02 ng per !l.

Proteins were separated according to Peers et al. (2009) except membranes were blocked

with 10% milk in TBS overnight while the concentration of the LHCSR antibody used

was 1:2000 and 1:50,000 for secondary.

Generation of the lhcsr1 TILLING mutant

A detailed description of TILLING in Chlamydomonas will be published elsewhere. In

brief, Chlamydomonas cells were UV-mutagenized and DNA extracted using a kit from

Stratagene. The DNAs from individuals were then pooled 16-fold into master plates. PCR

and Cel1 digestion were done on the plate and products were run on a Li-Cor. For an

introduction to the TILLING process, please refer to McCallum et al. (2000). The

following primers were used for PCR amplification of the LHCSR1 gene: LHCSR1F (5’-

CATTCAGAGTCATTCCCCAACCCACTT-3’) and

LHCSR1R (5’-ACTCACACAACGCTACACCATCCATCC-3’).

Generation of the npq4 lhcsr1 mutant

To obtain the npq4 lhcsr1 mutant, npq4 was crossed to the lhcsr1 mutant and tetrad

progeny were restreaked onto HS plates and grown in high light. These plates were then

! &#!

assayed by video imaging of chlorophyll fluorescence (Niyogi et al., 1997) using an

Imaging PAM instrument (Walz). One progeny that exhibited lower NPQ compared to

npq4 was genotyped by PCR using primers LHCSR1F and LHCS1R, and the product

was sequenced to confirm the presence of the mutation in LHCSR1. The primers

LHCSR3.1 (5’-CGCACAGTCCTATGGTGTTG-3’ and 5’-

TGTTCGCACTCGTCTTCATC-3’), and LHCSR3.2 (5’-

CCAATACACACGATCCCTCTC-3’ and 5’-GGTGGAAGAGTATCGCAAGC-3’)

were also used to test the presence of the LHCSR3 isoforms. Subsequent immunoblot

analysis was done using an anti-LHCSR antibody (Richard et al., 2000) to test for

presence of the protein.

Isolation of the npq4 supp1 mutant

UV mutagenesis of npq4 cells was performed as described previously in McCarthy et al.

(2004). Liquid cultures were grown in LL conditions (40 !mol photons m-2 s-1) up to a

cell concentration of 4 x 106 cells/ml. Mutagenesis was performed using the Stratalinker

UV crosslinker with an energy level of 70,000 !J cm-2. Mutagenized cells were grown on

HS plates for 10 days. Colonies with higher NPQ values compared to the control (npq4)

were re-patched onto new plates and further analyzed. Chlorophyll fluorescence

measurements were performed as previously described.

! &$!

References

1. Ahn TK, Avenson TJ, Ballottari M, Cheng Y-C, Niyogi KK, Bassi R, Fleming GR.

2008. Architecture of a charge-transfer state regulating light harvesting in a plant

antenna protein. Science (Washington DC) 320 (5877): 794-797.

2. Alboresi A, Gerotto C, Giacometti GM, Bassi R, Morosinotto T. 2010.

Physcomitrella patens mutants affected on heat dissipation clarify the evolution of

photoprotection mechanisms upon land colonization. Proceedings of the National

Academy of Sciences of the United States of America 107 (24): 11128-11133.

3. Avenson TJ, Ahn TK, Zigmantas D, Niyogi KK, Li Z, Ballottari M, Bassi R, Fleming

GR. 2008. Zeaxanthin radical cation formation in minor light-harvesting complexes of

higher plant antenna. Journal of Biological Chemistry 283 (6): 3550-3558.

4. Bailleul B, Rogato A, de Martino A, Coesel S, Cardol P, Bowler C, Falciatore A,

Finazzi G. 2010. An atypical member of the light-harvesting complex stress-related

protein family modulates diatom responses to light. Proceedings of the National

Academy of Sciences of the United States of America 107 (42): 18214-18219.

5. Baroli I, Do AD, Yamane T, Niyogi KK. 2003. Zeaxanthin accumulation in the

absence of a functional xanthophyll cycle protects Chlamydomonas reinhardtii from

photooxidative stress. Plant Cell 15 (4): 992-1008.

6. Bonente G, Ballottari M, Truong TB, Morosinotto T, Ahn TK, Fleming GR, Niyogi

KK, Bassi R. 2011. Analysis of LhcSR3, a Protein Essential for Feedback De-

Excitation in the Green Alga Chlamydomonas reinhardtii. PLoS Biology 9 (1):

Article No.: e1000577.

7. Boulay C, Wilson A, D’Haene S, Kirilovsky D. 2010. Identification of a protein

required for recovery of full antenna capacity in OCP-related photoprotective

mechanism in cyanobacteria. Proceedings of the National Academy of Sciences of the

United States of America 107: 11620-11625.

8. Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS. 2006.

Gateway-compatible vectors for plant functional genomics and proteomics. Plant

Journal 45 (4): 616-629.

9. Kulheim C, Agren J, Jansson S. 2002. Rapid regulation of light harvesting and plant

fitness in the field. Science (Washington DC) 297 (5578): 91-93.

! &%!

10. Li X-P, Bjorkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK.

2000. A pigment-binding protein essential for regulation of photosynthetic light

harvesting. Nature (London) 403 (6768): 391-395.

11. Li X-P, Muller-Moule P, Gilmore AM, Niyogi KK. 2002. PsbS-dependent

enhancement of feedback de-excitation protects photosystem II from photoinhibition.

Proceedings of the National Academy of Sciences of the United States of America 99

(23): 15222-15227.

12. McCallum CM, Comai L, Greene EA, Henikoff S. 2000. Targeting Induced Local

Lesions IN Genomes (TILLING) for plant functional genomics. Plant Physiology

(Rockville) 123 (2): 439-442.

13. McCarthy SS, Kobayashi MC, Niyogi KK. 2004. White mutants of Chlamydomonas

reinhardtii are defective in phytoene synthase. Genetics 168 (3): 1249-1257.

14. Merchant SS, Prochnik SE, Vallon O, Harris EH, Karpowicz SJ, Witman GB, Terry

A, Salamov A, Fritz-Laylin LK, Maréchal-Drouard L et al. 2007. The

Chlamydomonas genome reveals the evolution of key animal and plant functions.

Science 318 (5848): 245-50.

15. Niyogi KK, Bjorkman O, Grossman AR. 1997. Chlamydomonas xanthophyll cycle

mutants identified by video imaging of chlorophyll fluorescence quenching. Plant

Cell 9 (8): 1369-1380.

16. Niyogi KK, Li X-P, Rosenberg V, Jung H-S. 2005. Is PsbS the site of non-

photochemical quenching in photosynthesis? Journal of Experimental Botany 56

(411): 375-382.

17. Peers G, Truong TB, Ostendorf E, Busch A, Elrad D, Grossman AR, Hippler M,

Niyogi KK. 2009. An ancient light-harvesting protein is critical for the regulation of

algal photosynthesis. Nature (London) 462 (7272): 518.

18. Richard C, Ouellet H, Guertin M. 2000. Characterization of the LI818 polypeptide

from the green unicellular alga Chlamydomonas reinhardtii. Plant Molecular Biology

42 (2): 303-316.

19. Ruban AV, Berera R, Ilioaia C, van Stokkum IHM, Kennis JTM, Pascal AA, van

Amerongen H, Robert B, Horton P, van Grondelle R. 2007. Identification of a

mechanism of photoprotective energy dissipation in higher plants. Nature (London)

450 (7169): 575.

! &&!

20. Wilson A, Punginelli C, Gall A, Bonetti C, Alexandre M, Routaboul J-M, Kerfeld

CA, van Grondelle R, Robert B, Kennis JTM et al. 2008. A photoactive carotenoid

protein acting as light intensity sensor. Proceedings of the National Academy of

Sciences of the United States of America 105 (33): 12075-12080.

21. Zhu S-H, Green BR. 2010. Photoprotection in the diatom Thalassiosira pseudonana:

Role of LI818-like proteins in response to high light stress. Biochimica et Biophysica

Acta 1797 (8): 1449-1457.

! &'!

The first half of Chapter 4 is published in: Bonente G., Ballotari M., Truong T.B.,

Morosinotto T., Ahn T.K., Fleming G.R., Niyogi K.K. and Bassi R. (2011) Analysis of

LhcSR3, a Protein Essential for Feedback De-Excitation in the Green Alga

Chlamydomonas reinhardtii. PLoS Biol: e1000577.

I did the cloning of LHCSR3 for expression in E. coli and helped with the in vitro

reconstitution of the protein.

! &(!

Chapter 4: Characterization of the LHCSR3 protein

Introduction

LHCSRs have very recently emerged as central players in qE in algae, but not much is

known about their biochemical properties. Two main questions surround the function of

LHCSRs in qE in Chlamydomonas reinhardtii, as well as other algae and the moss

Physcomitrella patens: (1) are LHCSRs the sites of quenching? and (2) are LHCSRs

involved in sensing thylakoid lumen pH via protonation, similar to the role of PsbS in

plants? Initial protein alignment showed that LHCSRs share two conserved

transmembrane regions with Lhc proteins and possess six potential chlorophyll ligands

(Savard et al., 1996). Sites of carotenoid binding are not well conserved and therefore

harder to predict. It is tempting to speculate that LHCSRs act as quenching sites for

chlorophyll de-excitation. If so, they should bind to both chlorophylls and at least one

carotenoid species. As for protonation, alignment of Chlamydomonas LHCSRs with

those of other species showed multiple conserved acidic residues in the lumenal regions

that are potential sites of protonation during high light. Moreover, it was found that

LHCSRs also bind to DCCD, more so than other antenna complexes (Bonente et al.,

2011). Therefore it is possible that LHCSRs are sensors of high light exposure and

responsible for the induction of qE.

This chapter presents evidence that LHCSRs function as both sensors of lumen pH and

sites of quenching in Chlamydomonas. LHCSRs might have been the first members of

the LHC protein family to be involved in quenching and therefore have assumed both of

these roles. In higher plants, however, these roles were separated as other LHC-related

proteins such as PsbS evolved to function in qE. This increase in complexity, of both

organisms and the qE process, provides additional opportunities for the regulation of

photosynthesis.

Results

Alignment of Chlamydomonas LHCSR1 and LHCSR3 compared to the Arabidopsis

Lhcb1 protein shows that they share conserved chlorophyll binding sites (Figure 1).

Sequences for carotenoid binding sites are not as well known and therefore cannot be

easily predicted (Bonente et al., 2011). To determine if LHCSRs are capable of pigment

binding, we attempted the reconstitution of pigment-protein complexes in vitro. In

contrast to previous experiments done with PsbS (Dominici et al., 2002; Bonente et al.,

2008), we were able to express recombinant LHCSR1 and LHCSR3 in E. coli and obtain

pigment-protein complexes after sucrose gradient centrifugation (Figure 2). LHCSR1 and

LHCSR3 were able to form putative pigment-binding complexes as seen in the lower

green band; the yellow upper band has been previously shown to contain free pigments.

The lower band containing LHCSR1 and LHCSR3-pigment-binding complexes was faint

compared to that of a typical LHC protein, Lhcbm1. Because the yield of LHCSR1

! &)!

pigment-protein complexes was very low, further experiments were done only on the

LHCSR3 isoform.

Because the protocol used for reconstitution has been optimized for typical LHC antenna

proteins and LHCSR3 might differ somewhat in its properties, the reconstitution was

most likely sub-optimal. One potential problem was the presence of the chloroplast

transit peptide. Mature chloroplast proteins fold correctly without their transit peptide,

and it was possible that its presence impeded the proper folding of LHCSR3 in vitro. To

enhance the reconstitution yield, the transit peptide of the protein was identified using

algorithms such as ChloroP, PSORT and TargetP to determine its predicted length, which

ranged from 14 to 35 amino acids. We were conservative and chose to omit the relatively

short amino-terminal fragments from the recombinant protein. LHCSR3-14 and

LHCSR3-19 have 14 and 19 amino acids deleted from their amino-terminal ends,

respectively. Both forms yielded similar spectra, so results below are shown for

LHCSR3-14 only.

Figure 1. Alignment of Chlamydomonas LHCSR1 and LHCSR3 with Arabidopsis Lhcb1

protein using ClustalW. Underlined are the conserved chlorophyll-binding sites. Figure

modified from Bonente et al. (2011).

To make sure that LHCSR3 does indeed bind pigments and that the lower band was not

an artifact arising from co-migration of proteins and pigments, these putative pigment-

protein fractions were subjected to a series of spectroscopic analyses. First, the absorption

spectrum of the LHCSR3 band was very similar to that of reconstituted Lhcbm1, with

! &*!

some minor differences. As shown in Figure 3, LHCSR3 lacks a prominent peak at 480

nm and a shoulder at 650 nm, two wavelengths where chlorophyll b absorbs. LHCSR3

additionally is missing a shoulder at 390 nm at which chlorophyll a can absorb. Based on

this spectrum alone, it seems that LHCSR3 binds to less chlorophyll b or that the

chlorophylls contained by LHCSR3 absorb different wavelengths compared to Lhcbm1,

perhaps due to modifications by their particular protein environments. Interestingly, the

Qy absorption of chlorophyll a is slightly red-shifted compared to Lhcbm1 as seen in the

peak at 680 nm, which has not been seen before in other antenna proteins. LHCSR3

appears to be different from other LHC proteins in terms of its absorption spectrum.

Figure 2: Recombinant LHCSRs and Lhcbm1 separated from free pigments on a sucrose

gradient associate with photosynthetic pigments.

! '+!

Figure 3: Absorption spectra of reconstituted LHCSR3-14 and LHCSR3-19 compared to

Lhcbm1. Black= Lhcbm1; green= LHCSR3-14; and red= LHCSR3-19.

Next, the excitonic coupling of pigments in LHCSR3 was tested using fluorescence

emission spectroscopy. The LHCSR3-pigment binding fraction was excited at three

wavelengths -- 440nm, 475 nm, and 500 nm -- at which chlorophyll a, chlorophyll b, and

carotenoids absorb, respectively. If the pigments are coupled, then they will be able to

transfer their excitation energy ultimately to chlorophyll a, which will fluoresce due to

the absence of the reaction center to accept the excited energy. Figure 4 shows a very

prominent peak at 680 nm, indicating that energy absorbed by chlorophyll b or

carotenoids can be transferred to chlorophyll a. Thus, the pigments bound by LHCSR3

are mostly coupled. However, there is a shoulder at 650 nm upon excitation of

chlorophyll b, indicating that not all of the excited chlorophyll b molecules were able to

transfer their energy efficiently to chlorophyll a.

To confirm the results of the fluorescence emission spectroscopy, circular dichroism

spectroscopy of LHCSR3 was performed. Circular dichroism is the difference in the

absorption of left-handed and right-handed circularly polarized light at distinct

wavelengths by chiral molecules. It is thought that these negative and positive

symmetrical aspects of the absorption band in circular dichroism are due to the negative

and positive Cotton effects of excitonically coupled pigments (Aspinall-O’Dea et al.,

2002). The Lhcbm1 protein is used here as a model and positive control for pigment

coupling as demonstrated by circular dichroism spectroscopy. Figure 5 shows that

Lhcbm1 has a positive maximum from 400 to 450 nm and negative maximum from 450

! '"!

nm to 500 nm, due to xanthophyll absorption; it then reaches a negative maximum at 650

nm, positive at 660 nm, and goes negative again around 680 nm due to chlorophyll

absorption. The free pigment band is flat and has an absorption of zero. LHCSR3 has

minimal and maximal peaks in the same region as Lhcbm1, but they are not quite as

prominent compared to those found in Lhcbm1. This suggests that the pigments in

LHCSR3 are not as tightly coupled as those in Lhcbm1 or other Lhc proteins.

Figure 4: Fluorescence emission spectrum of LHCSR3. Pigment fraction was excited at

440 nm (black), 475 nm (red), and 550 nm (green). Fluorescence emission of chlorophyll

was measured at 680 nm.

! '#!

Figure 5: Circular dichroism absorption spectra of LHCSR3 compared to Lhcbm1 and the

free pigment fraction. Black= Lhcbm1; green= free pigments; and red= LHCSR3-14.

We then went on to characterize the pigments bound to LHCSR3 using high performance

liquid chromatography (HPLC). From Table 1, it is evident that LHCSR3 has a different

pigment composition compared to Lhcbm1. LHCSR3 has a higher chlorophyll a/b ratio:

approximately 6 versus 1.5 for Lhcbm1, indicating a higher affinity for chlorophyll a

than b. LHCSR3 also has a lower chlorophyll/carotenoid ratio of 2 compared to 5 for

Lhcbm1. These numbers were confirmed upon examination of the stoichiometry of the

pigments in LHCSR3 and Lhcbm1. The stoichometry of pigments in LHCSR3 was 6 or 7

chlorophylls a: 1 chlorophyll b: 1 violaxanthin: 1 zeaxanthin: 1 lutein. Lhcbm1 on the

other hand had 8 chlorophylls a: 6 chlorophylls b: 2 luteins: 1 neoxanthin: 1

violaxanthin/zeaxanthin. Unlike Lhcbm1, LHCSR3 does not bind neoxanthin, whose

binding site is conserved in all other antenna proteins. Indeed, LHCSR3 is different from

other antenna proteins. It also contains the least chlorophyll of any antenna protein

known, suggesting that it has a unique position in the evolution of antenna proteins.

Given that LHCSR3 binds to both chlorophylls and xanthophylls, it is possible that

LHCSR3 acts as a site for qE.

To assess further whether LHCSR3 might be site of quenching, we collaborated with the

Fleming lab in the Chemistry Department at UC Berkeley. Based on the previous work

performed on spinach and Arabidopsis, the mechanism of qE in plants involves a charge

transfer between a pair of closely coupled chlorophylls and zeaxanthin to generate a

transient zeaxanthin radical cation species (Holt et al., 2005; Ahn et al., 2008).

Subsequent charge recombination could dissipate excess excitation energy as heat. Using

ultrafast transient absorption spectroscopy of LHCSR3 pigment-protein complexes,

! '$!

similar to what was done for the Arabidopsis minor antenna complexes (Avenson et al.,

2008; Ahn et al., 2008), formation of a lutein radical cation species was detected. Figure

6 shows that there is a strong transient absorption signal at 940 nm in LHCSR3 with or

without zeaxanthin binding. This rise and decay at 940 nm is indicative of the formation

and relaxation of a lutein radical cation species.

Table 1: Pigment composition of the reconstituted LHCSR3 protein compared to

Lhcbm1.

LHCSRs might also be involved in sensing thylakoid lumen pH via protonation. The

Chlamydomonas LHCSR3 protein has several protonatable acidic amino acid residues

(i.e. aspartate and glutamate) predicted to face the thylakoid lumen (Figures 7 and 8).

When LHCSR3 was compared to the LHCSRs of other organisms, including other green

algae and the moss P. patens (Figure 7), it is evident that many of these acidic residues

are conserved. There exist many more protonatable residues in the lumenal loop and C-

terminal end of LHCSR3 compared to PsbS (Figure 8). To test the importance of these

residues for LHCSR3 function, each individual aspartate or glutamate residue was

mutagenized in vitro to asparagine or glutamine, respectively. Each mutant LHCSR3

gene was then transformed into the npq4 mutant. After selection of transformants based

on paromomycin resistance, they were screened to determine the effect of the amino acid

change on the NPQ capacity.

!

! '%!

Figure 6: Transient absorption spectroscopy of LHCSR3 at 940 nm. (Figure taken from

Bonente et al., 2011)

Figure 7: Alignment of Chlamydomonas LHCSR3 with LHCSRs from other organisms.

Figure 9 shows that when each individual acidic residue was mutated, NPQ capacity was

not affected at all. All lines exhibited an NPQ level that correlated with the level of

expression of the mutated LHCSR3 protein. It is possible that there exists redundancy in

the proton sensing residues within the protein, i.e., more than one residue is capable of

being protonated and allows for LHCSR3 to act as a pH sensor. Therefore, combinations

of multiple mutations within the same protein were made and tested. Out of more than

300 colonies of the triple mutant D2E1E2 in the npq4 background, none had higher NPQ

than npq4, despite the presence of the mutant LHCSR3 protein (data not shown). To

improve the signal to background ratio in the NPQ assays, subsequent transformations

were done with the npq4 lhcsr1 double mutant. This system would allow for better

! '&!

resolution of the effect the mutated LHCSR3 protein has on NPQ, independent of the

LHCSR1 isoform that remains in the npq4 mutant.

! ''!

Figure 8: Schematic representation of the predicted topology of LHCSR3 (top) and

Arabidopsis PsbS (bottom) in the thylakoid membrane.

!!!!!!!!!!!!!!!!!!! !!

Figure 9: Results of NPQ measurements of individual mutants and immunoblot analysis

of LHCSR3 protein levels.

Combinations of the double mutations, D2E2 and E1E2, were made and transformed into

npq4 lhcsr1. These double mutations impaired but did not completely eliminate the qE

function of the LHCSR3 protein, because the expressed LHCSR3 protein still conferred

some NPQ in the npq4 lhcsr1 background. Lines containing 50-60% of E1E2 mutant

LHCSR3 compared to wild type had ~25% of wild-type qE (Figure 10). Two lines from

the D2E2 transformations, one containing 60% of wild-type LHCSR3 level and one with

! '(!

more than wild-type LHCSR3, had only ~30% and ~50% of the qE seen in wild type,

respectively (Figure 11). Thus, the double mutations are not sufficient to eliminate all qE

function from Chlamydomonas LHCSR3.

Figure 10: NPQ measurements and immunoblot analysis of the lines containing E1E2

mutated LHCSR3.

The D2E1E2 triple mutant version of LHCSR3 was then transformed into the npq4

lhcsr1 mutant. Two independent lines expressed ~60-70% of wild-type LHCSR3 protein

level, yet their qE capacity was ~25% of the wild-type level (Figure 12). It seems that

! ')!

even the triple D2E1E2 mutations are not enough to eradicate all the qE in

Chlamydomonas.

Figure 11: NPQ measurements and immunoblot analysis of the lines containing D2E2

mutated LHCSR3.

! '*!

Figure 12: NPQ measurements and immunoblot analysis of the lines containing D2E1E2

mutated LHCSR3.

Discussion

This chapter looks more closely at the functions of LHCSRs. The previous chapter

concluded that all the qE in Chlamydomonas is dependent on LHCSRs and that they most

probably function as the sites of quenching. However, to determine if LHCSRs are

indeed quenching sites, I wanted to demonstrate pigment-binding by LHCSRs and obtain

evidence that quenching is happening in the proteins. The in vitro reconstitution of

LHCSR3 was successful, resulting in pigment-protein complexes that could be

investigated using spectroscopic and biochemical approaches. Reconstitution was

performed based on methods established for Lhcbm1, which has been studied

extensively. Absorption spectroscopy showed that LHCSR3 has a similar spectrum to

Lhcbm1 for the most part. However, LHCSR3 appears to bind fewer chlorophyll

molecules compared to the latter judging by the absence of peaks where chlorophylls

! (+!

absorb. The absorption data were confirmed by HPLC of the pigment-protein complexes.

Table 1 shows that LHCSR3 binds to a total of 6 or 7 chlorophylls, with a preference for

chlorophyll a, whereas Lhcbm1 binds 14 chlorophylls with almost the same number of

chlorophyll a as b. This number of chlorophylls bound to Lhcbm1 is typical of most outer

antenna proteins so it appears that LHCSR3 differs from most LHCII proteins. Further

spectroscopic analyses revealed that the pigments are coupled. When we excited the

chlorophylls a and b, and carotenoids within the LHCSR3-pigment complexes using

fluorescence emission spectroscopy, we observed fluorescence at 680 nm where

chlorophyll a emits. This indicates that the pigments within the complex are excitonically

coupled. Additional examination of the LHCSR3 pigment-protein complex with circular

dichroism spectroscopy also showed a similar spectrum to that seen in Lhcbm1.

However, the maximal and minimal peaks were not as intense as seen for Lhcbm1,

suggesting that the pigments are not as tightly coupled as those of Lhbm1. Perhaps the

reason they are not as closely coupled is due to the fact that they are involved in

quenching rather than light harvesting and exciton transfer. How the differently coupled

pigments in LHCSR3 are related to the proteins’ function in quenching is not yet known.

Transient absorption spectroscopy of the LHCSR3 complex revealed the presence of a

lutein radical cation. Unlike the zeaxanthin species found in Arabidopsis,

Chlamydomonas uses lutein instead. This result is consistent with a past report by Niyogi

et al. (1997) in which it was shown that the lor1 mutant lacking lutein is more defective

in qE than the npq1 mutant lacking zeaxanthin. Thus, lutein appears to be the dominant

quencher in Chlamydomonas. It is likely that both zeaxanthin and lutein contribute to qE,

because the double mutant npq1 lor1 has a greater reduction in qE compared to either of

the single mutants (Niyogi et al., 1997).

Site-directed mutagenesis was used to test the possibility that LHCSR3 is a sensor of

excessive light via the lumen pH. No individual mutation of an acidic amino acid residue

showed any effect on qE thus far, suggesting that there is a redundancy in function,

similar to that observed in PsbS (Li et al., 2004), due to many acidic residues being

present. In double mutants there was a decrease in qE relative to LHCSR3 protein level.

In particular, the E1E2 and D2E2 mutations gave a lower qE amount compared to the

quantity of LHCSR3 present, suggesting that a triple mutation D2E1E2 would give an

even worse phenotype. The D2E1E2 mutant expressed in npq4 lhcsr1 did show a slightly

more disproportionate correlation between protein level and qE capacity. Along with the

finding that LHCSR3 binds DCCD (Bonente et al., 2011), these results suggest that

protonation of LHCSR3 is important for its ability to function in qE.

The results described in this chapter indicate that LHCSRs have dual roles in the

mechanism of qE: they are both the sensors of high light and the sites of quenching.

These findings illuminate the functions of LHCSRs in qE in Chlamydomonas and could

be extended to other organisms that possess LHCSRs or their homologs. They also

illustrate the difference in the mechanism between higher plants and algae. In higher

plants and mosses, PsbS plays the role of pH sensor, and the minor and/or major antenna

! ("!

complexes are the quenching sites (Li et al., 2002; Ahn et al., 2008; Avenson et al., 2008;

Ruban et al., 2007). Thus, a division of labor occurred with the emergence of land plants.

In algae, both functions are incorporated in one set of protein—the LHCSRs.

Presumably, PsbS must confer some advantage to higher plants, because the PsbS-

dependent qE system was retained whereas LHCSRs were lost. It is possible that having

distinct sets of proteins responsible for the two functions involved in qE would allow for

a higher order of regulation. In the case of excessive light, PsbS would get protonated,

and the antenna complexes would be primed to act as quenching sites. This system would

also allow for amplification of the response, because protonation of PsbS could result in

the activation of many quenching sites. On the other hand, protonation of LHCSR would

immediately lead to quenching within the same protein. Additionally, according to

Bonente et al. (2011), it seems that LHCSRs might not be optimal quenchers that are

either turned on or off. In vitro, the LHCSR3 complex acts like a constitutive quencher

with a short fluorescence lifetime even at pH 7.5 (i.e., dark conditions). More quenching

is induced at low pH. This might explain why LHCSR expression is strongly regulated by

growth light intensity. In low light, there is a low level of LHCSR expression to minimize

quenching; in high light, LHCSR is induced to provide some flexible quenching at the

cost of wasting some absorbed light energy when light intensity decreases. Unlike

LHCSR, PsbS acts more like an on/off switch and is not turned on in low light, thereby

avoiding the dissipation of light energy that could otherwise go into photochemistry.

Ultimately, higher plants may have employed PsbS because it confers a fitness

advantage. P. patens offers a possible model to test this hypothesis because it contains

both PsbS and LHCSRs. It would be interesting to compare the fitness of moss strains

having the same qE capacity but containing only LHCSRs or only PsbS. This experiment

might provide an explanation for why PsbS was kept in higher plants and LHCSRs were

lost.

Methods

Reconstitution of LHCSR3 in vitro

LHCSR3.1 cDNA lacking the first 42 nucleotides (14 amino acids of the transit peptide)

was cloned into the pET28 vector (Novagen) and transformed into E. coli BL21de3 cells

for overexpression. The primers used were: LHCSR3-14F (5’-

AACCATGGGACAGACCCCCGCTCGTCGTG-3’) containing an NcoI restriction site

and LHCSR3-14R (5’-GCATAAGCTTCAGGCTCTTGAGGTTGTC-3’) containing a

HindIII site. The recombinant protein was purified as inclusion bodies from bacterial

lysate as described in Giuffra et al. (1996). Spectroscopic and pigment analyses were

performed as described in Bonente et al. (2011).

Site-directed mutagenesis of acidic residues

The LHCSR3.1 genomic clone plasmid LHCSR3/GwypBC1 from previous

! (#!

complementation experiments was used for site-directed mutagenesis of each acidic

residue; for plasmid information, refer to Chapter 3. The QuikChange® Site-Directed

Mutagenesis Kit was used according to the manufacturer’s instructions. The following

primers were used for amplification: D2F (5’-

CCCAACAGACTGGGACGGCCGCGTGTCT-3’) and D2R (5’-

AGACACGCGGCCGTCCCAGTCTGTTGGG-3’); E1F (5’-

TGGTGGAGCAGACCCAGATCTTCGAACACC-3’) and E1R (5’-

GGTGTTCGAAGATCTGGGTCTGCTCCACCA-3’); E2F (5’-

AGACCGAGATCTTCCAACACCTGGCTCTGC-3’) and E2R (5’-

GCAGAGCCAGGTGTTGGAAGATCTCGGTCT-3’); E3F (5’-

GCCCAGGAGCTGGTGCAGCAGACCGAGATCTTCG-3’) and

E3R (5’-CGAAGATCTCGGTCTGCTGCACCAGCTCCTGGGC-3’);

E4F (5’-CCTGGCTCTGCGCTTCCAAAAGGAGGCCATTCTG-3’) and E4R (5’-

CAGAATGGCCTCCTTTTGGAAGCGCAGAGCCAGG-3’); E5F (5’-

GCGCTTCGAGAAGCAAGCCATTCTGGAGCTGGAC-3’) and E5R

(5’-GTCCAGCTCCAGAATGGCTTGCTTCTCGAAGCGC-3’)

Transformation and isolation of site-directed mutants

The plasmid LHCSR3/GwypBC1 containing each or multiple mutations was transformed

into either npq4 or npq4 lhcsr1, and transformants were selected for pararomycin

resistance. At least 300 colonies were picked for each line and patched onto HS minimal

medium to grow in high light. NPQ was measured by chlorophyll fluorescence video

imaging (Imaging-PAM, Walz). Selected colonies, as judged by their NPQ value relative

to the parent strain, were further cultured in liquid HS to measure via the PAM

fluorometer (FMS2, Hansatech) and for immunoblots, as previously done (Peers et al.,

2009).

! ($!

References

1. Ahn TK, Avenson TJ, Ballottari M, Cheng Y-C, Niyogi KK, Bassi R, Fleming GR.

2008. Architecture of a charge-transfer state regulating light harvesting in a plant

antenna protein. Science (Washington DC) 320 (5877): 794-797.

2. Aspinall-O'Dea M, Wentworth M, Pascal A, Robert B, Ruban A, Horton P. 2002. In

vitro reconstitution of the activated zeaxanthin state associated with energy

dissipation in plants. Proceedings of the National Academy of Sciences of the United

States of America 99 (25): 16331-16335.

3. Avenson TJ, Ahn TK, Zigmantas D, Niyogi KK, Li Z, Ballottari M, Bassi R, Fleming

GR. 2008. Zeaxanthin radical cation formation in minor light-harvesting complexes of

higher plant antenna. Journal of Biological Chemistry 283 (6): 3550-3558.

4. Bonente G, Ballottari M, Truong TB, Morosinotto T, Ahn TK, Fleming GR, Niyogi

KK, Bassi R. 2011. Analysis of LhcSR3, a Protein Essential for Feedback De-

Excitation in the Green Alga Chlamydomonas reinhardtii. PLoS Biology 9 (1):

Article No.: e1000577.

5. Bonente G, Howes BD, Caffarri S, Smulevich G, Bassi R. 2008. Interactions between

the photosystem II subunit PsbS and xanthophylls studied in vivo and in vitro. Journal

of Biological Chemistry 283 (13): 8434-8445.

6. Dominici P, Caffarri S, Armenante F, Ceoldo S, Crimi M, Bassi R. 2002. Biochemical

properties of the PsbS subunit of Photosystem II either purified from chloroplast or

recombinant. Journal of Biological Chemistry 277 (25): 22750-22758.

7. Giuffra E, Cugini D, Croce R, Bassi R. 1996. Reconstitution and pigment-binding

properties of recombinant CP29. European Journal of Biochemistry 238 (1): 112-120.

8. Holt NE, Zigmantas D, Valkunas L, Li X-P, Niyogi KK, Fleming GR. 2005.

Carotenoid cation formation and the regulation of photosynthetic light harvesting.

Science (Washington DC) 307 (5708): 433-436.

9. Li X-P, Gilmore AM, Caffarri S, Bassi R, Golan T, Kramer D, Niyogi KK. 2004.

Regulation of photosynthetic light harvesting involves intrathylakoid lumen pH

sensing by the PsbS protein. Journal of Biological Chemistry 279 (22): 22866-22874.

! (%!

10. Li X-P, Phippard A, Pasari J, Niyogi KK. 2002. Structure-function analysis of

photosystem II subunit S (PsbS) in vivo. Functional Plant Biology 29 (10): 1131-

1139.

11. Niyogi KK, Bjorkman O, Grossman AR. 1997. The roles of specific xanthophylls in

photoprotection. Proceedings of the National Academy of Sciences of the United

States of America 94 (25): 14162-14167.

12. Peers G, Truong TB, Ostendorf E, Busch A, Elrad D, Grossman AR, Hippler M,

Niyogi KK. 2009. An ancient light-harvesting protein is critical for the regulation of

algal photosynthesis. Nature (London) 462 (7272): 518.

13. Ruban AV, Berera R, Ilioaia C, van Stokkum IHM, Kennis JTM, Pascal AA, van

Amerongen H, Robert B, Horton P, van Grondelle R. 2007. Identification of a

mechanism of photoprotective energy dissipation in higher plants. Nature (London)

450 (7169): 575.

"%, Savard F, Richard C, Guertin M. 1996. The Chlamydomonas reinhardtii LI818 gene

represents a distant relative of the cabI/II genes that is regulated during the cell cycle

and in response to illumination. Plant Molecular Biology 32 (3): 461-473.!

! (&!

Chapter 5: Conclusions and future directions

This thesis examines the Chlamydomonas npq4 mutant and the LHCSR proteins that are

responsible for essentially all of the qE seen in this green alga. LHCSRs have dual roles

in quenching: they function as both activators and quenchers in the mechanism of qE.

These proteins are ancient members of the light-harvesting complex protein superfamily

and have been found to be involved in qE in a number of other organisms, including

diatoms (Bailleul et al., 2010) and mosses (Alboresi et al., 2010). It is likely that LHCSRs

have the same roles in other species that contain them, but this hypothesis remains to be

examined.

Figure 1: Model for qE in Chlamydomonas reinhardtii.

Although the work described in this thesis has revealed a lot about the role of LHCSRs,

there is still much to be discovered about how they function in qE in Chlamydomonas

and other organisms. One key question concerns the organization of LHCSRs within the

photosynthetic complexes, particularly where they are located and what proteins they

bind to. In higher plants, the minor antenna proteins are considered to be quenching sites,

and their location between the major peripheral LHC antennas and the reaction center

makes them prime candidates. In subsaturating light, they can absorb and transfer energy

from the major antennas to the reaction center; during high light, they can quench the

excess energy instead. Because Chlamydomonas is missing one of the three minor

antenna proteins, CP24 (encoded by the LHCB6 gene in plants), is it possible that

LHCSRs are taking the place of this protein? Furthermore, are any other proteins

involved in this quenching complex or are LHCSRs by themselves sufficient? We still

have yet to figure out the exact role of Lhcbm1 in qE (Elrad et al., 2002). It is possible

that Lhcbm1 provides a docking site for connecting LHCSRs to the PSII antenna system.

In higher plants, an aggregate consisting of CP24 and CP29 with a trimeric LHCII

complex dissociates during quenching (Betterle et al., 2009). This dissociation requires

! ('!

PsbS and the absence of any of these components leads to a decrease in quenching. Does

the same phenomenon happen in Chlamydomonas? It seems that LHCSRs are adequate

on their own to form a quenching complex based on the data that we have. However,

there may be other proteins involved to aid the process. One of the approaches being

undertaken is using sucrose gradient centrifugation to isolate complexes formed during

high light. Presumably, the complex(es) formed under high light and containing LHCSRs

are the quenching units. To see if these complexes are actual quenching units, we can

examine their chlorophyll fluorescence lifetimes using time-correlated single photon

counting (TCSPC) spectroscopy. From experiments with live Chlamydomonas cells, we

know the lifetime attributed to qE (Amarnath et al., unpublished results) and can compare

this known lifetime to those obtained from the complexes. Nonetheless, complexes taken

out of their physiological states might not exhibit the same lifetimes, and we might need

to mimic the physiological conditions in vivo in order to achieve similar results.

Based on their hydropathy plots and alignment with other LHC proteins, LHCSRs should

share a similar overall structure with three transmembrane domains. Yet, LHCSRs are

quenchers of chlorophyll excitation, whereas LHC proteins are light harvesters. What

aspect of LHCSRs allows for them to be quenchers? One way to answer this question is

to obtain a crystal structure of an LHCSR complex. We know they bind to chlorophylls

and carotenoids, similarly to other LHCs, although not in the same number. Having a

structure of LHCSR will provide insights into how the pigments are organized within the

protein in comparison to that of Lhc and from this information, possibly how the

pigments can come together for quenching to occur.

Lastly, much research has been focused on finding out what factors are required for

quenching and the mechanism by which qE occurs. However, there is hardly any

knowledge on the regulation of quenching. We now know that LHCSRs are responsible

for sensing lumen pH and being the quenching sites, however, how do Chlamydomonas

cells know to upregulate LHCSR expression in high light to meet the demands for

quenching? What are the signals involved and what are the sensors? Is there one master

switch that activates every component involved in qE i.e. including the xanthophyll

cycle? Identification of the gene responsible for overexpression of LHCSR1 in the supp1

mutant (Chapter 3) might help to address these questions. Knowing the regulation of how

qE is turned on will enable us to fine-tune the process.

Given the rising cost of gasoline and the shortage of fossil fuels, much interest is focused

on alternative sources of energy, particularly on carbon neutral and renewable energy

resources such as algal biofuels. In order to get the highest possible yields, the process of

photosynthesis must be optimized and photodamage must be prevented. Algae use qE as

it is quick and reversible and it protects against photo-oxidative stress. In the near future,

it is possible that the pathway for qE will be engineered into specific organisms geared

for biofuel productions in order to offset the harmful side effects of excessive light

absorption. If we should want to incorporate LHCSR-related quenching into another

organism geared towards biofuel production, understanding how the quenching happens,

! ((!

what other components are necessary, and its regulation will be essential. The current

state of knowledge on qE in Chlamydomonas is still incomplete, and much more effort is

needed to elucidate completely the mechanisms of photoprotection in this alga.

! ()!

References

1. Alboresi A, Gerotto C, Giacometti GM, Bassi R, Morosinotto T. 2010. Physcomitrella

patens mutants affected on heat dissipation clarify the evolution of photoprotection

mechanisms upon land colonization. Proceedings of the National Academy of Sciences of

the United States of America 107 (24): 11128-11133.

2. Bailleul B, Rogato A, de Martino A, Coesel S, Cardol P, Bowler C, Falciatore A,

Finazzi G. 2010. An atypical member of the light-harvesting complex stress-related

protein family modulates diatom responses to light. Proceedings of the National

Academy of Sciences of the United States of America 107 (42): 18214-18219.

3. Betterle N, Ballottari M, Zorzan S, de Bianchi S, Cazzaniga S, Dall'Osto L,

Morosinotto T, Bassi R. 2009. Light-induced Dissociation of an Antenna Hetero-

oligomer Is Needed for Non-photochemical Quenching Induction. Journal of Biological

Chemistry 284 (22): 15255-15266.

4. Elrad D, Niyogi KK, Grossman AR. 2002. A major light-harvesting polypeptide of

photosystem II functions in thermal dissipation. Plant Cell 14 (8): 1801-1816.