Investigating the Role of Inositol Polyphosphate 4 ... · Fontanezi-Maciel, Shayne Greenberg,...
Transcript of Investigating the Role of Inositol Polyphosphate 4 ... · Fontanezi-Maciel, Shayne Greenberg,...
Investigating the Role of Inositol Polyphosphate 4-Phosphatase Type II (INPP4B)
Overexpression on Autophagy in Acute Myeloid Leukemia (AML)
By
Mark Hani Sharobim
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Pharmacology and Toxicology
University of Toronto
© Copyright by Mark Sharobim 2016
ii
Investigating the Role of Inositol Polyphosphate 4-Phosphatase Type II (INPP4B)
Overexpression on Autophagy in Acute Myeloid Leukemia (AML)
Mark H. Sharobim
Master of Science
Department of Pharmacology and Toxicology
University of Toronto
2016
ABSTRACT
BACKGROUND: Inositol polyphosphate-4-phosphatase type-II (INPP4B) is a lipid phosphatase
that dephosphorylates PI(3,4)P2 into PI(3)P. The depletion of PI(3,4)P2 prevents aberrant AKT
signalling. Therefore, INPP4B is classically known as a tumour suppressor. Recent studies
however demonstrate INPP4B overexpression may promote cancer generation and progression.
We investigated effects of INPP4B overexpression in acute myeloid leukemia (AML).
METHODS: AML cell lines that overexpress wild-type (INPP4Bwt) and mutant (INPP4Bmut)
INPP4B were used to determine what phenotypes are governed by its phosphatase activity.
RESULTS: Overexpression of wild-type INPP4B conferred advantages in growth,
chemoresistance and colony forming assays, suggesting a role for INPP4B opposite to that of a
tumour suppressor. These phenotypes were either absent or greatly diminished in INPP4Bmut
cells. INPP4Bwt cells also had increased accumulation of autophagosomes with or without
autophagy inhibitors when compared to control.
CONCLUSION: INPP4B-mediated phenotypes in AML are phosphatase-dependent and this is
subsequently associated with increased potential to undergo autophagy.
Word Count: 150/150
iii
ACKNOWLEDGEMENTS
It would be remiss of me to acknowledge anyone prior to my Lord Jesus Christ and His help
throughout my entire graduate degree. I couldn’t have done it without Him and His constant
love.
My family is a rock in my life that has kept me steady throughout the tough times and pushed me
through obstacles I felt I could not overcome. It is with their support, guidance and love that I am
where I am today.
My dad is an example of integrity and virtue and not only do I learn from his actions everyday,
the lessons I have learned from him I will keep close to my heart forever.
My mother is the definition of a role-model and an exemplar for how I wish to carry myself in
my personal and professional life throughout my years.
My sisters are the greatest gift I could ever ask for and the relationship I have with them is
something I will cherish forever. Their company keeps me cheerful throughout the tough times.
My supervisor Dr. Lenny Salmena, PhD is by far and large the greatest inspiration I have in
science and as a mentor. Though I was his first student and have technically graduated, I will
consider him my mentor and teacher forever. His passion as well as dedication to his work and
craft are attributes I aspire to attain one day. His love and enthusiasm for science is something I
wish to pass on to those intending to pursue any sort of scientific career. Without him, without a
doubt I would not be where I am today. His constant mentoring is something that cannot be
understated. He has literally shaped the way I think and tackle science as a whole. Thank you so
much Lenny.
My lab mates, Martino Gabra, Emily Mangialardi, Anthony To, Meong-Hi Son, Lydia To, Thais
Fontanezi-Maciel, Shayne Greenberg, Ayesha Rashid, Erik Dzneladze and John Woolley are a
great family that has positively shaped my future forever.
The mentoring I received from Dr. Michael Jain, Dr. Rob Laister, Dr. Vuk Stambolic and
Ayesha Rashid are little gifts I cherish and I hope someone could be as lucky as me to have been
able to pick their brains the past 3 years.
I want to thank all those in the lab that taught me that science is an exercise in thinking. It is an
open garden of creativity and is conducive to forming bright ideas, innovations and concepts. It
is this I am most thankful that I learned while pursuing my degree, and a skill that could not have
been cultivated elsewhere.
iv
CONTRIBUTIONS
Martino Gabra treated all the cells with daunorubicin and counted their viability (Figure 11).
Emily Mangialardi created the immortalized Inpp4b knockout and wild type MEF cell lines
(Figure 16).
Anthony To helped with and performed western blots (Figures 15-17).
Dr. Meong Hi Son did the colony forming cell experiment (Figure 10).
Dr. John Woolley did the low serum viability counts (Figure 9B).
v
Table of Contents Abstract ........................................................................................................................................... ii
Acknowledgements ........................................................................................................................ iii
Contributions.................................................................................................................................. iv
Table of Contents ............................................................................................................................ v
List of Abbreviations .................................................................................................................... vii
List of Figures ................................................................................................................................. x
List of Tables ................................................................................................................................. xi
List of Appendices ........................................................................................................................ xii
1. Introduction ............................................................................................................................. 1
1.1 Inositol Phospholipids ......................................................................................................... 1
1.2 Phosphoinositide Signalling Overview ............................................................................... 2
1.3 Phosphoinositide Signalling in Cancer ............................................................................... 5
1.3.1 The PI3K Pathway .................................................................................................... 5
1.3.2 Antagonizing PI3K signalling................................................................................... 7
1.4 Inositol Polyphosphate 4-Phosphatase, Type II (INPP4B) ................................................. 9
1.4.1 Discovery .................................................................................................................. 9
1.4.2 Structure .................................................................................................................. 10
1.4.3 Functions ................................................................................................................. 11
1.5 INPP4B and Cancer .......................................................................................................... 14
1.5.1 INPP4B is a Tumour Suppressor ............................................................................ 14
1.5.2 INPP4B Overexpression in Cancer ......................................................................... 16
1.6 Acute Myeloid Leukemia ................................................................................................. 24
1.6.1 Overview ................................................................................................................. 24
1.6.2 The PI3K pathway in AML .................................................................................... 25
1.7 Autophagy ......................................................................................................................... 28
1.7.1 Overview ................................................................................................................. 28
1.7.2 Macroautophagy ..................................................................................................... 29
1.7.3 The PI3K-mTOR Pathway and Autophagy ............................................................ 33
1.7.4 Autophagy and Cancer: a Double Edged Sword? ................................................... 34
2. Rationale, Aims and Hypothesis ........................................................................................... 39
2.1 Rationale and Aims ........................................................................................................... 39
vi
2.1.1 Investigating mechanisms of INPP4B-mediated phenotypes in AML cells ........... 39
2.1.2 INPP4B Overexpression and PI(3)P signalling: Implications for Autophagy........ 40
2.2 Hypothesis......................................................................................................................... 41
3. Materials and Methods .......................................................................................................... 42
3.1 Cell Culture ....................................................................................................................... 42
3.2 Lentivirus production ........................................................................................................ 42
3.3 DNA plasmids ................................................................................................................... 43
3.4 Methylcellulose Colony Formation Cell (CFC) Assay ..................................................... 43
3.5 Phosphatase Assay ............................................................................................................ 43
3.6 Immunoblotting................................................................................................................. 44
3.7 Cyto-ID® assay ................................................................................................................. 44
3.8 Generation of Immortalized MEFs ................................................................................... 45
3.9 Genotyping ........................................................................................................................ 45
3.10 Statistics ............................................................................................................................ 46
4. Results ................................................................................................................................... 47
4.1 Generation of a phosphatase-null INPP4B mutant (INPP4Bmut) protein .......................... 47
4.2 INPP4Bmut OCI-AML2 cells do not exhibit phenotypes observed in INPP4Bwt
overexpressing cells ...................................................................................................................... 51
4.3 INPP4Bwt Overexpressing Cells Have Increased Staining of Autophagosomes in an
Untreated Condition ...................................................................................................................... 56
4.4 INPP4Bwt cells demonstrate increased autophagosome accumulation in the presence of
inhibitors of autolysosomal acidification ...................................................................................... 58
4.5 INPP4Bwt NB4 cells demonstrate increased autophagosome accumulation when treated
with chloroquine ........................................................................................................................... 61
4.6 Inpp4b -/- MEFs have a reduced ability to undergo autophagy ......................................... 62
5. Discussion .............................................................................................................................. 64
5.1 Summary of Results .......................................................................................................... 64
5.2 INPP4B Phosphatase Activity .......................................................................................... 66
5.3 INPP4B and Autophagy .................................................................................................... 69
5.4 Conclusions ....................................................................................................................... 71
5.5 Future Directions .............................................................................................................. 71
6. References ............................................................................................................................. 74
Appendices .................................................................................................................................... 91
Publications and abstracts ............................................................................................................. 95
vii
LIST OF ABBREVIATIONS
AKT V-akt murine thymoma viral oncogene homolog 1 or Protein Kinase B
ALL Acute lymphoblastic leukemia or acute lymphocytic leukemia
AML Acute myeloid leukemia or acute myelogenous leukemia
AMPK AMP-activated protein kinase
APL Acute promyelocytic leukemia
Ara-C Cytarabine
As2O3 Arsenic trioxide
Atg7 Autophagy related protein 7
Atg8 Autophagy related protein 8 (yeast) or LC3A/B/C (human)
ATRA All-trans retinoic acid
BCR/ABL1 Philadelphia translocation fusion protein, Breakpoint cluster region
(BCR)/ Abelson murine leukemia viral oncogene homolog 1 (ABL1)
Beclin 1 or Atg6 Beclin 1 (human) or Autophagy related protein 6 (yeast)
BRCA1 Breast cancer 1, early onset gene
C. elegans Caenorhabditis elegans
CDP-DAG Cytidine-diphosphate diacylglycerol
CFC Colony forming cell
c-Kit Tyrosine-protein kinase Kit or CD117
Class III PI-3K VPS34
CMA Chaperone mediated autophagy
CML Chronic myeloid leukemia or chronic myelogenous leukemia
CR Complete remission
DAG Diacyleglycerol
DFCP1 Double FYVE-domain containing protein 1
EFS Event free survival
EGF Epidermal growth factor
ER Endoplasmic Reticulum
ERec Estrogen receptor
FLT3 Fms-like tyrosine kinase 3
FLT3-ITD Fms-like tyrosine kinase 3 internal tandem duplication
FOXO3A Forkhead box O3
FYVE Fab1p, YOTB, Vac1p and Early Endosome Antigen 1
GPCRs G protein couple receptors
HER2 Human epidermal growth factor receptor 2
HIF-1α and HIF-1β Hypoxia-inducible factor 1-alpha and beta
HMECs Human mammary epithelial cells
HSC Haematopoietic stem cell
HSPCs Haematopoietic stem and progenitor cells
INPP4A Inositol polyphosphate 4-phosphatase type I
INPP4B Inositol polyphosphate 4-phosphatase type II
INPP4Bmut Denotes overexpression of mutant full length INPP4B protein
INPP4Bwt Denotes overexpression of wild-type full length INPP4B protein
INPP5A-J Inositol polyphosphate 5-phosphatases
Ins(1,3)P2 Inositol 1,3-bisphosphate
viii
Ins(1,3,4)P3 Inositol 1,3,4-trisphosphate
Ins(1,4,5)P3 or IP3 Inositol-1,4,5-trisphosphate
Ins(3)P Inositol 3-phosphate
IRS1 Insulin receptor substrate 1
kBp Kilo base pairs
KFERQ Lys-Phe-Glu-Arg-Gln
KNMT2A or MLL Histone-lysine N-methyltransfeRASe 2A
KRAS Kirsten rat sarcoma virus oncogene
LAMP2A Lysosome-associated membrane protein 2
LFS Leukemia-free survival
LOH Loss of heterozygosity
LSC Leukemic stem cell
LSK cells Lin- Sca-1+ c-Kit+ progenitor cells
MAP1LC3A/B/C
or LC3A/B/C
Microtubule-associated protein light chain 3 A/B/C (human)
or Atg8 (yeast)
MAPK Mitogen activated protein kinase
MEFs Mouse embryonic fibroblasts
miRNA microRNA
mTOR Mammalian target of rapamycin or mechanistic target of rapamycin
mTORC1 mTOR complex 1
mTORC2 mTOR complex 2
NHR2 Nervy-homology 2
NPC Nasopharyngeal carcinoma
NPM1 Nucleophosmin
NRAS Neuroblastoma RAS Viral (V-RAS) Oncogene
NSG NOD scid gamma
OS Overrall Survival
p53 Tumor protein p53
PA Phosphatidic acid
p-AKT or phospho-AKT Phosphorylated-AKT, otherwise activated AKT
PDPK1 or PDK1 3-phosphoinositide dependent protein kinase-1
PE Phosphatidylethanolamine
PEST Proline, glutamate/aspartate, serine/threonine rich
PH Pleckstrin homology
phospho-SGK3 or p-SGK3 Phosphorylated-SGK3, otherwise activated SGK3
PHTS PTEN hamartoma tumor syndrome
PI(3)P Phosphatidylinositol-3-phosphate
PI(3,4)P2 Phosphatidylinositol (3,4)-bisphosphate
PI(3,4,5)P3 or PIP3 Phosphatidylinositol (3,4,5)-trisphosphate
PI(4)P Phosphatidylinositol-4-phosphate
PI(4,5)P2 Phosphatidylinositol-4,5-bisphosphate
PI(5)P Phosphatidylinositol-5-phosphate
PI3K Phosphatidylinositol 3-kinase
PI3K C2α Class II PI3K alpha
PIKK PI3K-related protein kinase
PIs Phosphatidylinositols
ix
PIS Phosphatidylinositol synthase
PKB Protein kinase B or AKT
PKC Protein kinase C
PLC Phospholipase C
PML-RARα promyelocytic leukemia gene (PML) - retinoic acid receptor α
(RARα) fusion protein
PEG Polyethylene glycol
PTEN Phosphatase and tensin homolog deleted on chromosome 10
PTP Protein tyrosine phosphatase
PX Phox homology
RAS Rat sarcoma virus oncogene
RHEB RAS homolog enriched in brain
RNase A Ribonuclease A
RNase-S peptide Ribonuclease S peptide
RTKs Receptor tyrosine kinases
SGK3 Serine/threonine-protein kinase 3
SH2 Src homology 2
SHIP1 or INPP5D SH2-containing inositol 5-phosphatase 1
SHIP2 or INPPL1 SH2-containing inositol 5-phosphatase 2
shRNA Small or short hairpin RNA
SNPs Single nucleotide polymorphisms
TAPP1 Tandem PH domain-containing protein 1
TAPP2 Tandem PH domain-containing protein 2
TSC 1/2 Tuberous sclerosis complex 1 and 2
ULK1 Unc-51 like autophagy activating kinase 1
ULK2 Unc-51 like autophagy activating kinase 2
VPS34 or hVPS34 (human) Class III PI3K
x
LIST OF FIGURES
Figure 1. Schematic of a Phosphatidylinositol. .............................................................................. 3
Figure 2. Seven phosphoinositides found in cells, derived from phosphatidylinositol (PIs). ........ 4
Figure 3. Schematic depicting main INPP4B function. ................................................................ 13
Figure 4. Both the Substrate (PI(3,4)P2) and Product (PI(3)P) of INPP4B Function Activate
Similar Kinases. ............................................................................................................................ 21
Figure 5. Overview of Autophagic Flux. ...................................................................................... 32
Figure 6. AKT activation results in indirect stimulation of mTOR and inhibition of autophagy. 38
Figure 7. Sequencing Data Encoding INPP4Bwt and INPP4Bmut phosphatase domains. ............. 49
Figure 8. Characterization of OCI-AML2 cells expressing vector control and INPP4Bwt and
INPP4Bmut proteins. ...................................................................................................................... 50
Figure 9. INPP4Bwt cells proliferate more rapidly than control or mutant cells in normal and low
serum conditions. .......................................................................................................................... 53
Figure 10. INPP4Bwt cells form colonies preferentially in vitro. ................................................. 54
Figure 11. INPP4Bwt cells are more resistant to daunorubicin in vitro. ....................................... 55
Figure 12 INPP4B expression in OCI-AML3 cells leads to a higher level of autophagosomes in
an unstimulated condition.. ........................................................................................................... 57
Figure 13. OCI-AML3 INPP4Bwt have a greater propensity for autophagosome biogenesis. ..... 59
Figure 14. Expression of INPP4B in OCI-AML2 increases amount of autophagosome
accumulation. ................................................................................................................................ 60
Figure 15. Dose dependent effect of chloroquine in INPP4Bwt NB4 cells. .................................. 61
Figure 16. Inpp4b -/- MEFs have a reduction in their ability to accumulate autophagosomes in a
basal state. ..................................................................................................................................... 63
xi
LIST OF TABLES
Table 1. Summary of INPP4B roles and functions in select cancers. ...................................... 22-23
xii
LIST OF APPENDICES
Appendix 1. INPP4Bhigh AML patients have lower CR rates and shorter survival. (Taken from
Dzneladze et al. 2015, Leukemia). ................................................................................................ 91
Appendix 2. INPP4Bhigh constitutes a significant hazard in total and CN-AML (Taken from
Dzneladze et al. 2015, Leukemia). ................................................................................................ 92
Appendix 3. Ectopic overexpression of INPP4B in AML cells leads to increased colony-forming
potential and proliferation. (Taken from Dzneladze et al. 2015, Leukemia). ............................... 93
Appendix 4. INPP4B overexpression is associated with resistance to chemotherapy and ionizing
radiation. (Taken from Dzneladze et al. 2015, Leukemia). ........................................................... 94
1
1. INTRODUCTION
1.1 Inositol Phospholipids
Phosphatidylinositols (PIs) are a family of membrane bound phospholipids found in all
eukaryotic cells1. Structurally, PIs consist of two fatty acids and a myo-inositol ring linked via
phosphate group to a glycerol backbone (Figure 1). PIs are synthesized from cytidine-
diphosphate diacylglycerol (CDP-DAG) and myo-inositol by the action of phosphatidylinositol
synthase (PIS)2 and generally comprise 10-20% of all cellular phospholipids3.
Phosphatidylinositol kinases and phosphatidylinositol phosphatases tightly control the relative
abundance of different PIs by the addition or removal of phosphate groups. PIs can be reversibly
phosphorylated at the hydroxyl groups on positions 3, 4 and 5 of the inositol ring, thus
generating seven distinct PI-derivatives in addition to PI itself (Figure 2). Such variable
phosphorylation explains how PIs serve a wide range of cellular functions. Despite seemingly
little difference between PI isoforms (i.e. only a slightly shifted phosphate between
monophosphorylated PIs) PI-binding domains can distinguish PIs with varying degrees of
specificity4. Thus, proteins can be specifically "recruited" to intracellular membranes where PIs
are located. For example, pleckstrin homology domains can bind the second messengers
phosphatidylinositol (3,4,5)-trisphosphate (PI(3,4,5)P3 or PIP3) and phosphatidylinositol (3,4)-
bisphosphate (PI(3,4)P2) with high specificity (discussed below)5. Proteins such as protein kinase
B (PKB or AKT) can be recruited to the plasma membrane where PIP3 and PI(3,4)P2 are located,
they then can be activated and perform downstream functions.
2
1.2 Phosphoinositide Signalling Overview
PIs are essential to cellular homeostasis, and it has been suggested that phosphoinositide
signalling modulates virtually all biological processes6. Their roles in signal transduction
pathways controlling vesicle trafficking(reviewed in 7), DNA replication and repair8–10,
oncogenesis11, apoptosis12 and proliferation13 are well documented. The most notable example is
the phenomenon discovered in the 1980s by which phospholipase C (PLC) hydrolyzes
membrane bound phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2) to form diacyleglycerol
(DAG) and the soluble inositol-1,4,5-trisphosphate (Ins(1,4,5)P3 or IP3)14. Untethered, IP3 can
then diffuse throughout the cytoplasm to bind and activate calcium channels on intracellular
organelles, thereby increasing intracellular Ca2+. DAG and IP3 can also lead to activation of
protein kinase C (PKC), and thus subsequent phosphorylation of other cellular molecules.
Therefore, although PIs do not constitute a majority of cellular lipids, their effectiveness as
second messengers is imperative, as they are often one of the first events in signalling
hierarchies. Overall, the importance of PI signalling is illustrated by the many human diseases
that manifest because of dysregulation in the normal function of proteins and pathways
controlling PI metabolism15.
3
Figure 1. Schematic of a Phosphatidylinositol. Phosphatidylinositols (PIs) contain two
fatty acids and a myo-inositol ring linked via phosphate group to a glycerol backbone.
They can be phosphorylated at positions D3-D5 of the myo-inositol ring, generating PI
derivatives with phosphate groups called phosphoinositides. PIs are generated through the
enzymatic action of Phosphatidylinositol synthase (PIS); they are generated from cytidine-
diphosphate diacylglycerol (CDP-DAG) and myo-inositol2. They are found on the
cytosolic side of all eukaryotic membranes16.
4
Figure 2. Seven phosphoinositides found in cells, derived from phosphatidylinositol
(PIs). The bioavailability of each phosphoinositide is tightly controlled through the
function of multiple phosphoinositide kinases and phosphatases that can add or remove
phosphate groups on each PI. The most abundant phosphoinositide is PI(4,5)P26. In total,
there are 7 derivatives excluding the non-phosphorylated PI. In terms of total cellular lipid
content, PIs are not among the most abundant cellular lipids, but control various signalling
pathways3. This is due to their ability to be recognized by different protein structures and
domains. Proteins such as AKT or PDK1 can recognize phosphoinositides with high
specificity and accuracy, despite being similar in shape and structure. Thus, although there
are for example 3 mono-phosphorylated PIs (PI(3)P, PI(4)P and PI(5)P), the proteins that
can distinguish them are involved in very different pathways4.
Figure adapted from Le Roy and Wrana, Nature Reviews Molecular Cell Biology,
2005.(Image in Box 1) 17
5
1.3 Phosphoinositide Signalling in Cancer
1.3.1 The PI3K Pathway
The phosphatidylinositol 3-kinase (PI3K) pathway is a cellular signalling network
centered around the activity of the PI3K, AKT and the mammalian target of rapamycin (mTOR)
proteins. PI3Ks are a group of evolutionarily conserved lipid kinases that phosphorylate the
hydroxyl group at the D3 position of PIs18. The preferred substrate for PI3K is PI(4,5)P2, but it is
also able to phosphorylate phosphatidylinositol-5-phosphate (PI(5)P), phosphatidylinositol-4-
phosphate (PI(4)P) and PI to some capacity19.
There are three main classes of PI3K: Class I, II and III, each largely differing based on
primary structure and substrate specificity. Class I PI3Ks are further subdivided into types IA
and IB, depending on whether they are activated by receptor tyrosine kinases (RTKs) or G
protein couple receptors (GPCRs), respectively. Class I PI3Ks are heterodimers of two subunits,
a functional p110 subunit and a p85 regulatory subunit, each of which have three isoforms20. The
main product of class I PI3K activity is PIP3 through the phosphorylation of PI(4,5)P2. PIP3 is the
only triphosphorylated phosphoinositide and is found predominantly on the plasma membrane21.
PI3Ks are activated through stimulation of RTKs or GPCRs. To describe this briefly, when a
ligand binds its matching receptor, the receptor dimerizes and an autophosphorylation event
occurs on tyrosine residues on the cytosolic side of the receptor. Phosphorylated tyrosine
residues create binding sites for adaptor proteins with Src homology 2 (SH2) protein domains
such as insulin receptor substrate 1 (IRS1) or PI3K itself, allowing for increased PI3K activity22.
While basal levels of PIP3 and PI(3,4)P2 (generated from phosphatidylinositol-4-phosphate,
PI(4)P) are low, receptor-ligand binding (e.g. epidermal growth factor (EGF) binding RTK)
6
results in elevated class I PI3K activation, thus causing both PIs to accumulate at the plasma
membrane. Although all classes of PI3K are known to phosphorylate the D3 position of
phosphoinositides, Class II PI3Ks have affinity for PI and PI(4)P, thus generating PI(3)P and
PI(3,4)P2 respectively, while Class III PI3Ks (VPS34 or hVPS34 in humans) generate PI(3)P
from PI. It is possible that the products generated by each PI3K may differ based on class-
specific localization in the cell (that is, some intracellular membranes may be enriched with a
specific 3-phosphoinositide, such as endosomes and PI(3)P, which are accounted for by VPS34
on these structures)23.
PH domain containing proteins such as 3-phosphoinositide dependent protein kinase-1
(PDPK1 or PDK1)24,25 and AKT26 can bind to PIP3 and PI(3,4)P2, facilitating their recruitment to
lipid membranes. Recruitment of AKT to the cell membrane is required for full activation, which
is achieved by phosphorylation of two residues, Thr308 and Ser473 on its kinase and regulatory
protein domains, respectively27,28. PDK1 mediates T308 phosphorylation and membrane binding
is also required for PDK1 activation of AKT24. There have been many kinases proposed to
mediate the phosphorylation of the S473 residue on AKT, but a recent consensus confirms that it
is mediated by the mTOR complex 2 (mTORC2) proteins29. Once activated, the serine/threonine
kinase, AKT controls many critical processes such as apoptosis, cell cycle and proliferation
through phosphorylation of its numerous substrates30,31. Recent estimates suggest that AKT has
more than 100 substrates of which it can phosphorylate and modulate function32,33. Hyperactive
AKT is a common occurrence in many human cancers, and mouse models have demonstrated
that on its own, constitutively active AKT is sufficient for carcinogenesis34.
One of the principal AKT effector proteins is the mTOR kinase. mTOR is a 289 kDa protein
that belongs to the PI3K-related protein kinase (PIKK) family35. mTOR is the catalytically active
7
member of two functionally unique protein kinase complexes called mTOR complex 1 and 2
(mTORC1 and 2). The mTORC complexes differ in the effectiveness by which the macrolide
fungicide rapamycin inhibits their activity, with mTORC2 being practically insensitive while
mTORC1 exhibits sensitivity. Stimulation of AKT leads to the inhibition of tuberous sclerosis
complex 1 and 2 (TSC 1/2) proteins which themselves normally prevent activation of mTORC1
by further inhibition of the GTPase RAS homolog enriched in brain (RHEB), a known activator
of mTOR (Figure 6). mTORC1 itself receives input from cellular energy sensors (Figure 6), and
stimulation causes gene transcription, mRNA translation as well as ribosome biogenesis which
all together increase cell growth, proliferation and survival. Accordingly, it is desirable to control
or prevent dysregulation of AKT in cancer.
1.3.2 Antagonizing PI3K signalling
1.3.2.1 Phosphatase and tensin homolog deleted on chromosome 10 (PTEN)
The primary biological mechanism by which PI3K signalling is negatively regulated is
through the activity of phosphatase and tensin homolog deleted on chromosome 10 (PTEN).
PTEN exhibits lipid phosphatase activity by dephosphorylating PIP3 at the D3 position of the
inositol ring, generating PI(4,5)P2. By decreasing levels of PIP3, AKT activity is curtailed
because it can no longer localize to the plasma membrane. PTEN also has a C2 lipid binding
domain which localizes it to the plasma membrane, an association that is necessary for its lipid
phosphatase activity36. Germline losses or mutation of PTEN are associated with a myriad of
syndromes and disorders including PTEN hamartoma tumor syndrome (PHTS, including but not
limited to Cowden syndrome)37,38 and autism spectrum disorder39. PTEN is also a bona-fide
8
tumour suppressor; almost 50% of all human cancers contain inactive alleles of PTEN. Indeed, it
is among the most frequently mutated or lost genes in cancer, and in some malignancies up to
80% of cases harbour some sort of PTEN inactivity40.
1.3.2.2 SH2-containing inositol 5-phosphatase (SHIP)
A large group of proteins that can also hydrolyze PIP3 are the inositol polyphosphate 5-
phosphatases, of which there are 10 isoforms. Although a majority of isoforms exhibit D5
phosphatase activity on multiple PIs, the product generated when these phosphatases hydrolyze
PIP3 is PI(3,4)P2. One such phosphatase, SH2-containing inositol 5-phosphatase 1 (SHIP1), is a
5-phosphatase encoded by the INPP5D gene. Its expression is mainly restricted to hematopoietic
tissues while a closely related SHIP2 isoform is more widely expressed41,42.
It has been proposed that increased 5-phosphatase activity may lead to elevated or
sustained AKT signalling, since like PIP3, PI(3,4)P2 can also bind the PH domain on AKT. Other
studies demonstrate the opposite; that SHIP phosphatases suppress AKT activity 43–45. This may
be explained by the stability or differential binding of AKT to PIP3 or PI(3,4)P2. There are some
studies showing SHIP proteins to be inactivated in cancer; for example, mice with B cell specific
downregulation of SHIP1 develop acute lymphoblastic leukemia (ALL)46 and ALL cell lines as
well as primary tumour samples exhibit SHIP1 inactivation or loss47. While its role in cancer
may be attributed to the notion that many 5-phosphatases certainly terminate PI3K/AKT
signalling, only one study has implicated a 5-phosphatase as a real tumour suppressor at the in
vitro and in vivo level in cancer48. In summary, through increased 5-phosphatase activity, there
is accumulation of the preferred substrate for 4-phosphatases, the biphosphorylated PI(3,4)P2.
9
1.4 Inositol Polyphosphate 4-Phosphatase, Type II (INPP4B)
1.4.1 Discovery
The first evidence that there was enzymatic degradation of the D4 phosphate found on the
inositol ring on radiolabelled inositol phospholipids was reported in 1987 by Inhorn et al. using
crude tissue extracts of calf brain. In their study, they noticed that inositol 3,4-bisphosphate
(Ins(3,4)P2) is converted to the soluble inositol 3-phosphate (Ins(3)P)49. In the same year, it was
discovered that inositol 1,3,4-trisphosphate (Ins(1,3,4)P3) can be dephosphorylated to inositol
1,3-bisphosphate (Ins(1,3)P2) using a similar method50. The term inositol polyphosphate 4-
phosphatase was the term used to describe the enzyme that performed this function, and it was
isolated and characterized in 1990. Later purified from calf brain tissue extract, it was identified
as a Mg2+ independent 105 kDa protein with affinity for both Ins(1,3,4)P3 and Ins(3,4)P251
.
Notably, both Ins(1,3,4)P3 and Ins(3,4)P2 are soluble inositol lipids, and that only in 1994 was it
discovered that there was an enzyme capable of dephosphorylating the membrane bound
PI(3,4)P2. In agreement with current knowledge, the purified inositol polyphosphate 4-
phoshphatase had a greater affinity for PI(3,4)P2 than Ins(1,3,4)P3 or Ins(3,4)P252.
cDNA encoding the inositol polyphosphate 4-phosphatase enzymes revealed two
isoforms, a type I and type II (also INPP4A and B, respectively) which share 37% amino acid
sequence identity. With both having varying tissue specific expression levels, it is now
understood the type I and type II isoforms are located at different genetic loci. INPP4A is highly
expressed in brain tissue, and while INPP4B has a wider tissue distribution, expression is highest
in skeletal muscle and heart53–56, but is also present in epithelial tissues like the breast57. There
was also evidence that the type II isoenzyme was subject to alternative splicing, thus further
10
subdividing both types into α and β splice variants. The murine Inpp4bα isoform also has high
expression in haematopoietic lineages, specifically in natural killer (NK) as well as mast cells
and to a lesser degree in B-lymphocytes58.
1.4.2 Structure
The INPP4B gene is located on the long arm of chromosome 4, at 4q31.2159. The coding
exons span approximately 825 kilo base pairs (kBp) and the mRNA sequence 4 kBp. The
primary mRNA transcript codes for a protein of 105 kDa consisting of 924 amino acids with 3
conserved protein domains55,60. INPP4B contains a N-terminal C2 lipid binding domain that is
conserved among similar lipid binding proteins61. The INPP4B C2-domain is said to have
highest affinity for phosphatidic acid (PA, a major constituent of lipid membranes) and PIP358.
INPP4B also has a central hydrophobic protein motif called the Nervy Homology 2 (NHR2) and
that allows protein to protein interaction and oligomerization, such as is the case for fusion
proteins such as AML1/ETO62. The catalytic phosphatase domain of INPP4B is located in the
extreme C-terminus.
The INPP4 phosphatases have a conserved catalytically active phosphatase domain and
in INPP4B, this is characterized by the amino acid motif CKSAKDR (starting at amino acid
842). This domain is conserved amongst similar acid, protein tyrosine and dual specificity (i.e.
lipid and protein) phosphatases, identified by 5 amino acids flanked by cysteine and arginine
residues (CX5R in similar proteins). This signature motif brings the oxygen atom on the
phosphate into the catalytic pocket. The nucleophilic sulfhydryl group on the cysteine residue
attacks the oxygen on the phosphorous atom resulting in an intermediate cysteine-PO3 complex
and eventually, an inorganic phosphate63. Substitution of the Cys-842 residue to serine or
11
alanine will render the phosphatase activity null63,64. Replacement of the cysteine residue to
serine allows the phosphatase to access the substrate but stabilizes the intermediate complex
formed with the phosphate group, preventing release of inorganic phosphate and this overall
prevents dephosphorylation from occuring65.
1.4.3 Functions
The most well studied biological function of INPP4B is of its ability to mediate the
hydrolysis of the D4 phosphate group (i.e. dephosphorylation) found on the inositol head ring of
PI(3,4)P2, generating phosphatidylinositol-3-phosphate (PI(3)P), (shown in Figure 3). While PIP3
is most certainly a potent activator of AKT, PI(3,4)P2 has also been shown to regulate AKT
activation in vitro66. Both PI(3,4,5)P3 and PI(3,4)P2 can act as membrane anchors for proteins,
however some studies suggests PI(3,4)P2 remains at the plasma membrane longer after receptor-
mediated stimulation of PI3K, and is not subject to rapid degradation similar to PI(3,4,5)P367.
Therefore prolonged inactivation of INPP4 phosphatases may result in continuous AKT
activation. Accordingly, INPP4B has been shown to be lost or inactivated in cancers of the
breast57,68, ovarian69, thyroid70 and lung71.
While a role for INPP4B has been implicated in the progression and maintenance of
cancer, the same has cannot be said for its paralog, INPP4A. This may be due to their tissue
specific expression, as INPP4A expression is mainly restricted to neuronal tissues. Studies
suggest it has a role in preventing excitotoxic cell death of neurons72,73. INPP4A has also been
shown to localize to endosomes and can modulate PI3K signalling there as well74. Although this
discussion is mainly focused on the proposed roles of INPP4B in cancer, it may have other
biological functions. Inpp4b was identified as a novel regulator of osteoclastogenesis, where it
12
represses differentiation of osteoclasts and shows an ability to affect the transcription of
osteoclast-specific target genes75. Single nucleotide polymorphisms (SNPs) in the Inpp4b gene in
mice changed nerve conduction velocity, and was associated with multiple sclerosis (MS) in
patents76. Inpp4b was also shown to positively control callosal axon formation in mice77.
13
Figure 3. Schematic depicting main INPP4B function. INPP4B normally
dephosphorylates the D4 phosphate on the inositol ring found on the lipid
membrane bound PI(3,4)P2 to generate the mono-phosphorylated PI(3)P. The
phosphatase domain is catalyzed by a protein motif CKSAKDR. Substitution of
the cysteine to a serine renders the phosphatase catalytically inactive64.
14
1.5 INPP4B and Cancer
1.5.1 INPP4B is a Tumour Suppressor
The first indication that INPP4B was implicated in cancer was published by Westbrook et
al. in 2006. The authors used a shRNA library to screen for suppressors of transformation in
human mammary epithelial cells (HMECs). INPP4B was one of 8 genes that were lost in 90% of
colonies formed as a result of small hairpin (shRNA) knockdown78. In other studies, INPP4B
was lost during the transformation of malignant proerythroblast cell line models, and when
overexpressed, it regulated phosphorylated-AKT (p-AKT) levels79.
A tumour suppressive role for INPP4B was later demonstrated by Gewinner et al. and
Fedele et al. in breast cancer 57,68. The two groups showed that INPP4B knockdown increases
anchorage independent growth, migratory as well as invasive potential and p-AKT in multiple
breast cancer cell lines. Xenograft models suggested INPP4B overexpression reduces tumour
formation, whereas its knockdown mediated the opposite effect in mice. Also, loss of
heterozygosity (LOH) at the INPP4B locus is a common feature in breast cancer patients from
both studies57,68. The genetic locus harbouring INPP4B was one of the 2 most frequently deleted
regions in tumours of breast cancer patients80. Along with PTEN, INPP4B is the most commonly
lost or mutated gene associated within the PI3K pathway in the basal and human epidermal
growth factor receptor 2 (HER2) subtypes of breast cancer81.
Consistent with these studies, INPP4B has also been shown to behave as a tumour
suppressor in additional epithelial cancers. Loss of INPP4B is associated with poor survival and
lymph node metastasis of ovarian cancer patients. Immunohistochemistry also revealed it is more
frequently lost than PTEN or Tumor protein 53 (p53) in ovarian cancer tissue microarrays68,69.
15
In prostate cancer, INPP4B expression is driven by androgen receptor and its loss
increased activation of AKT. It is absent in primary prostate tumour samples and predicts disease
recurrence in patients with rapidly proliferating tumour cells82,83. Ectopic INPP4B expression in
prostate cancer cell lines suppresses their invasive potential in vitro and in vivo. It is also lost in
prostate carcinoma epithelium when compared to benign prostate epithelium83,84.
In melanoma, INPP4B is present in primary samples but is lost in tumour tissue, and
INPP4B overexpression curtails receptor mediated AKT activation. As in previous studies,
ectopic INPP4B expression suppressed tumour size and burden occurring in xenograft mouse
models85.
In thyroid cancer, complete or partial Inpp4b knockout causes progression of benign
thyroid adenomas found in Pten heterozygous mice into metastatic thyroid tumours. It is lost in
thyroid cancer lines and its expression was able to specifically abrogate AKT signalling on
endosomes, suggesting location-specific function for this phosphatase70.
In bladder cancer, INPP4B expression is strongly induced by estrogen receptor (ERec)
expression and this is associated with inhibition of AKT activation. Knocking down INPP4B
reverts this phenotype86.
Evidence of epigenetic inactivation of the INPP4B locus in nasopharyngeal carcinoma
(NPC) tumours and cell lines87 demonstrates there are multiple routes by which a tumour
inactivates INPP4B.
Taken together, there is a substantial body of work that demonstrates INPP4B is a bona-
fide tumour suppressor, and that when present, its main enzymatic function is to counteract
PI3K/AKT signalling.
16
1.5.2 INPP4B Overexpression in Cancer
The tumour suppressive characteristics of INPP4B have been well established in multiple
cancer types. A number of studies now demonstrate that INPP4B is upregulated in cancer with
pathological significance. For example, by analyzing gene expression from radioresistant
laryngeal cancer cell lines, INPP4B mRNA levels was proposed to be a marker of tumour
resistance to radiotherapy. Radiation treatment of laryngeal cancer cell lines also induced
expression of INPP4B. De novo INPP4B expression increased resistance to both radiation and
chemotherapy drug by evasion of apoptosis88. In a follow up study, the authors similarly noticed
that INPP4B expression is induced by hypoxia, with predicted binding sites for the transcription
factors hypoxia-inducible factor 1-alpha and beta (HIF-1α and HIF-1β) found on the INPP4B
promoter sequence. Furthermore, the resistance phenotype in cells with high expression of
INPP4B is associated with an increased production of glucose, a commonly observed
characteristic of drug resistant tumor cells. Finally, up to 70% of their laryngeal cancer tissue
samples stained positively for INPP4B89.
Prior to our work, there was little data regarding INPP4B function in leukemias or other
blood cancers. One study showed that INPP4B is overexpressed in childhood acute
lymphoblastic leukemia (ALL) that is Philadelphia translocation (BCR/ABL1) positive90. Since
INPP4B has never been investigated in acute myeloid leukemia (AML), we first interrogated
gene expression data from AML patients to determine what role it may have. Unexpectedly, the
transcript was upregulated in approximately 25% of patients across multiple patient gene
expression databases. INPP4Bhigh (in the top 25%) was associated with a variety of clinical
factors that depict an overall worse disease for those with AML. This signature was accompanied
by decreased overall survival (OS) and event free survival (EFS) in patients from all six
17
independent data sets. It was also identified that patients with INPP4Bhigh are poor responders to
standard chemotherapy used to treat AML (Appendices 1 and 2). In AML, prognostication of the
survival risk associated with different subtypes is confirmed by the presence of biomarkers such
as cytogenetic abnormalities and adverse molecular events. INPP4B was demonstrated to be an
independent prognostic measure of poor disease; with predictability comparable or better than
known risk factors such as the presence of Fms-like tyrosine kinase 3 internal tandem duplication
(FLT3-ITD) or Nucleophosmin (NPM1) mutations (Appendix 2) 91. Taken together, AML
patients with INPP4B transcript overexpression demonstrated a poorer outcome compared to
those with low INPP4B transcript levels.
We performed a series of in vitro experiments to validate these observations; cDNA
encoding the full-length wild-type INPP4B transcript was overexpressed in various AML cell
lines. We observed that INPP4B overexpressing cell lines (INPP4Bwt) grew faster in full or low
serum media, were more resistant to treatment with drug or ionizing radiation and formed
colonies preferentially in colony forming cell (CFC) assays (Appendices 3 and 4). These in vitro
results recapitulated our clinical findings for INPP4B and AML91. In an independent study, data
published by Rijal et al. reflected these findings where they show that INPP4B protein is
upregulated in bone marrow from AML patients when compared to normal based on mass
spectrometry. Moreover, INPP4B overexpressing leukemia cells injected into NOD scid gamma
(NSG) mice showed greater infiltration into bone marrow compared to controls. Mice treated
with the chemotherapeutic agent cytarabine showed chemoresistance under the same
conditions92. Altogether, these two independent studies demonstrate that INPP4B overexpression
is associated with more aggressive AML, indicating that there may be a tumour-promoting role
for INPP4B in some cancer types.
18
Indeed, context specific functions may partially explain differential INPP4B phenotypes
(Figure 4). Gasser et al. showed in a study that upregulation of serine/threonine-protein kinase 3
(SGK3) in estrogen receptor (ERec) positive breast cancers may be in part due to INPP4B
upregulation. The authors note that INPP4B expression is also induced by ERec57, and that both
have a functional connection. This is because the product of INPP4B catalysis is PI(3)P, and
SGK3 (unlike its closely related isoforms, SGK1 and SGK2) contains a phox homology (PX)
protein domain that binds PI(3)P which allows it to localize to membranes where it can be
activated. Interestingly, SGK isoforms are 55% homologous to the AKT1-3 catalytic domains as
well as phosphorylate the same target motif as AKT in effector proteins, and in some cases
compensate for oncogenic AKT signalling even when AKT activation is absent93,94. Gasser and
colleagues performed starvation-stimulation experiments in vitro and showed that INPP4B is
necessary for SGK3 activation (phospho-SGK3 or p-SGK3) after growth factor stimulation.
INPP4B expression was also necessary for SGK3-dependent anchorage independent growth and
xenograft tumour formation in nude mice95.
In colon cancer cell lines, Guo and colleagues demonstrated that INPP4B knockdown led
to a decrease in SGK3 activation, presumably through a similar mechanism suggested by Gasser
et al. in breast cancer96. However, they also showed that INPP4B overexpression was
accompanied by an increase in AKT activation in colon cancer cell lines. This finding appears
paradoxical because the tumour suppressor function of INPP4B was reportedly dependent on its
ability to decrease AKT activation. This was also the first reported instance that INPP4B
upregulation leads to greater activation of AKT. Phenotypically, INPP4B overexpression in
colon cancer cell lines led to increased cell proliferation as well as promoted colony forming
19
potential. Accordingly, knockdown of INPP4B decreased growth in colon cancer xenografts in
nude mice.
Although most reports to date describe INPP4B exclusively as a lipid phosphatase, Guo
et al. suggest that INPP4B may also possess protein tyrosine phosphatase (PTP) activity64,97.
They report that this “oncogenic regulator” phenotype can be explained by PTP function of
INPP4B on the tumour suppressor PTEN. This is demonstrated through experiments where
overexpression of INPP4B downregulates PTEN expression levels, and simultaneously increases
PI(3,4,5)P3 levels. This finding was corroborated in vitro where INPP4B was able to
dephosphorylate total and immunoprecipitated PTEN97.
Therefore, the proposed mechanism for this phenomenon is that INPP4B
dephosphorylates PTEN, thereby destabilizing it and making it unable to control AKT activation.
It is generally understood however that phosphorylation of PTEN inhibits enzymatic activity98
and dephosphorylation would activate it, notwithstanding in a majority of cases phosphorylation
of PTEN has been shown to increase its half-life, albeit without preserving enzymatic acitivty99.
It is important to note that the PTEN protein sequence contains over 10 residues that are known
to be phosphorylated100, and in some cases phosphorylation could activate enzyme activity. The
phosphorylation sites on PTEN proposed to be controlled by INPP4B in the study by Guo and
colleagues were those of Serine 380 and 385, as well as Threonine 382 and 383 (Ser380-Ser385
cluster), all of which are found in the tail region of PTEN. Nonetheless, phosphorylation of this
cluster is known to result in increased protein stability but not enzymatic activity100. Taken
altogether, this raises the possibility of another paradox, and the potential that INPP4B mediated
regulation of PTEN is different than that by other proteins and post translational modifications.
20
It was previously mentioned that INPP4B functions as a tumour suppressor in melanoma.
Recently, a study emerged that shows in a subset of melanomas it may function oppositely. The
authors found that it was upregulated in primary and metastatic melanoma. In contrast to other
findings, they observed that INPP4B expression did not correlate with any change in AKT
activation. Instead, they showed that INPP4B upregulation is associated with SGK3 activation,
and that this drove enhanced proliferation and clonogenic growth101.
In summary, there is growing evidence that demonstrates INPP4B overexpression
promotes cellular phenotypes associated with more aggressive or worse cancer. This is in direct
contrast to its previously cemented role as a tumour suppressor. It is especially interesting that in
two cases, INPP4B was published to have both roles in the same cancer, though different subsets
within the same cancer may explain this duality. A summary of proposed INPP4B roles in
various cancers is found in Table 1. This warrants further investigation into what sways the role
of INPP4B one way or another. More importantly, it demonstrates the importance of accounting
for context in the analysis of signalling pathways implicated in different cancers.
21
Figure 4. Both the Substrate (PI(3,4)P2) and Product (PI(3)P) of INPP4B Function Activate
Similar Kinases. (A) Like the triphosphorylated PI(3,4,5)P3, the biphosphorylated PI(3,4)P2 can
be bound by AKT, thus anchoring it to lipid membranes. This brings AKT into the proximity of
the kinases that can phosphorylate it. Phosphorylation of AKT is essential to its kinase activity.
When active, it can activate or deactivate effector proteins, thus accounting for several AKT-
mediated phenotypes. Aberrant activation of AKT is conducive to many of the characteristics
cells acquire in becoming carcinogenic34. INPP4B acts to prevent this by depleting the AKT
activator, PI(3,4)P2.
The figure in 5A is adapted from Bunney and Katan. Nature Reviews Cancer, 2010.6
(B) Like AKT, PDK1 can bind membrane bound phosphoinositides such as PI(3,4,5)P3 and
PI(3,4)P2. PDK1 phosphorylates AKT at T308 and the mTORC2 complex phosphorylates AKT
at S473. Also shown are some of the proteins whose activity is modulated by active AKT.
The figure is 5B is adapted from Manning and Cantley, Cell. 2007.33
(C) SGK3 is a kinase with ~55% sequence identity to AKT94. It also is activated by PDK1.
SGK3 is unique when compared to AKT and even its closely related SGK1 and SGK2 isoforms
in that it has a Phox homology (PX) domain that can selectively bind PI(3)P at lipid membranes
(shown here at the endosome). This binding is similar to AKT binding of PI(3,4,5)P3 and
PI(3,4)P2. AKT and SGK3 share common target proteins and SGK3 can often compensate for
the absence of AKT signalling93. Therefore, in one instance, INPP4B may act to halt AKT
activation (5A+B), in another, it may act to indirectly activate AKT-like phenotypes through the
stimulation of the closely related SGK3.
The figure in 4C is adapted from the record accessed from mutagenetix.utsouthwestern.edu102.
A B
C
22
Table 1. Summary of INPP4B roles and functions in select cancers.
Cancer Potential Role for
INPP4B
Description of INPP4B role, phenotypes and
mechanism
Breast cancer,
general57,68
Tumour suppressor - INPP4B loss increases AKT activation,
INPP4B overexpression decreases AKT
activation
- INPP4B promotes anchorage independent
growth
- Overexpression of INPP4B decreases tumour
formation in xenograft mouse models
- LOH at INPP4B genetic locus found in breast
cancer patients
Breast cancer,
ERec-positive96
Cancer promoting,
Driver of PI3K/AKT
signalling
- ERec drives INPP4B expression
- Accumulation of PI(3)P as a result of INPP4B
upregulation leads to SGK3 activation
Ovarian
Cancer68,69
Tumour suppressor - Loss of INPP4B is associated with poor
survival and lymph node metastasis in patients.
- It is more frequently lost than PTEN or Tumor
protein 53 (p53) in ovarian cancer tissue
microarray.
Colon Cancer97 Oncogenic Regulator,
Tumour promoting
- INPP4B knockdown led to a decrease in SGK3
activation.
- INPP4B overexpression resulted in AKT
- knockdown of INPP4B decreased growth in
colon cancer xenografts in mice
- INPP4B downregulates PTEN expression
levels through dephosphorylation of PTEN
Prostate
Cancer82,103,104
Tumour suppressor - INPP4B loss increased activation of AKT
- It is lost in primary prostate tumour samples
- INPP4B expression suppressor invasive
potential of prostate cancer cells
Laryngeal
Cancer88,105
Promotes tumour
resistance
- Radiation induced expression of INPP4B in
laryngeal cancer cell lines
- De novo INPP4B expression increased
resistance to both radiation and chemotherapy
Melanoma85 Tumour suppressor - INPP4B is present in primary samples but is
lost in tumour tissue,
- INPP4B overexpression prevents AKT
activation.
- INPP4B expression suppressed tumour size
and burden occurring in xenograft mouse
models
23
Melanoma,
primary and
metastatic106
Oncogenic Driver,
Upregulated
- INPP4B expression does not affect AKT
activation status
- INPP4B is associated with activation of SGK3
and this causes enhanced cell growth in vitro
Thyroid70 Tumour suppressor - Inpp4b knockout causes progression of benign
thyroid adenomas found in Pten+/- mice.
- Specifically abrogate AKT signalling on
endosomes
Leukemia,
acute
myeloid92,107
Biomarker of
aggressive AML,
overexpression
phenotypes indicative
of worse disease
- Subset of patients with high levels of INPP4B
survive less, respond less favorably to
chemotherapy
- Overexpression of INPP4B increases
proliferation and chemoresistance
Nasopharyngeal
carcinoma87
Tumour suppressor - Epigenetic inactivation of INPP4B in tumours
and cell lines
Bladder86 Tumour suppressor - ERec expression is associated with high levels
of INPP4B mRNA
- INPP4B knockdown increases AKT activation
24
1.6 Acute Myeloid Leukemia
1.6.1 Overview
Acute myeloid leukemia (AML) is an aggressive blood cell cancer identified as invasion
primarily of the bone marrow and blood by irregularly differentiated cells of the haematopoietic
hierarchy. Clonal expansion of these malignant and functionally immature myeloblasts or
“blasts” hinders normal hematopoietic function leading to recurrent infections, bleeding or organ
failure and rapid fatality if left untreated108.
AML is diagnosed by morphological assessment of primary tumour blasts in addition to
expression of cell surface or cytoplasmic markers and the presence of cytogenetic abnormalities
from the tumour109. AML is the most common leukemia in adults with the median age of
diagnosis being 67 years. The prognosis for AML worsens with age and chromosomal
abnormalities commonly found in the elderly complicate treatment109,110. In younger populations,
AML does not account for a majority of cancer diagnoses (i.e. only less than 3% incidence in
young persons), however in some estimates it is the leading cause of death in children as well as
those under the age of 39111.
Standard treatment for AML is composed of induction chemotherapy, most typically the
“7+3” regimen in which 3 days of anthracycline (e.g. daunorubicin, idarubicin or mitoxantrone)
simultaneous with 7 days of cytarabine (Ara-C) are given intravenously. These achieve complete
remission (CR) in up to 60 to 80% of younger adults. There has been no other intervention that
has consistently been shown to perform better112–114. Anthracycline antibiotics like daunorubicin
cause cell death in various ways. Some of these include intercalation into DNA with subsequent
induction of DNA damage along with interruption of synthesis and replication, as well as
25
interfering in the ability of DNA to unwind and the inhibition of topoisomerase II115.
Topisomerase II is an enzyme that actively relaxes supercoiled DNA and affects its topology. It
introduces transient double stranded breaks as it is bound to DNA in an intermediate that allows
other DNA duplexes to pass through116. Topoisomerase poisons such as daunorubicin stabilize
this intermediate complex and introduce permanent double stranded breaks117, a process that
turns on DNA damage response signalling and apoptosis118. Despite the efficacy of these drugs,
an overwhelming majority of patients relapse, as 40-70% do not achieve long term survival after
treatment; indeed, 5 year survival is less than 50% in adults and even worse for the elderly119,120.
It is therefore necessary to know the changes in molecular signalling pathways that may account
for the resistance to standard therapy often seen in AML.
1.6.2 The PI3K pathway in AML
Signalling pathways that control proliferation and survival are often altered in AML,
especially in the blood where cells undergo constant growth, renewal and differentiation. It is
widely recognized that the haematopoietic system is organized as a hierarchy of cells all
differentiating from a common progenitor, the haematopoietic stem cell (HSC). HSCs are a rare
group of cells that are capable of self-renewal, and have the ability to give rise to all the mature
cells found in the blood. It has been suggested that a similar paradigm exists in AML, where the
leukemic stem cell (LSC) performs a similar function, and by constantly evading therapy perhaps
due to inherent resistance mechanisms, they continuously contribute to a pool of leukemic blasts
in a tumour that is often clonally derived121. It follows then that aberrant signalling through
multiple cellular pathways allows the maintenance and propagation of these cell types.
26
Both primary and cell line AML samples commonly display constitutive PI3K/AKT
signal activation122,123. These over amplified signals also predict a poor prognosis clinically124.
Like in many other cancers, characterizing and targeting the PI3K pathway in leukemias is of
great importance. In some instances, leukemic cells are preferentially targeted by
pharmacological inhibition of the PI3K pathway125. Inhibitors that target multiple proteins in
this pathway are more effective then single agents126. This presents an appealing therapeutic
opportunity for those with AML. As even constitutive activation of the further downstream
mTORC1 can sometimes be found in all cases of AML, modulating this may be beneficial across
multiple cohorts of patients. Despite this however, there are little to no reports of large groups of
patients harbouring activating mutations in the catalytic isoforms of PI3K or AKT proteins127.
Through mutations in other proteins upstream of the PI3K and related proteins, there are
multiple ways for this network continuously active in AML. For example, receptor tyrosine
kinases that are frequently over activated in AML due to mutation (especially in cytogenetically
normal AML), such as FLT3 and c-KIT (tyrosine-protein kinase Kit or CD117; the former of
which is mutated in up to 30% of AML and as well in other leukemias), lead to PI3K activation.
This is exacerbated by the fact that not only do patients with FLT3 mutation have shorter time to
relapse, their overall survival is among the worst for those with AML128. FLT3 mutations may
directly activate PI3K, but also indirectly through activation of the RAS signalling network, thus
contributing further to constant oncogenic PI3K signalling. As a proof of principle, this is seen in
vitro where mutant PI3K drives factor independent growth of haematopoietic cells, and in vivo,
mutant PI3K can drive leukemic transformation in sublethally irradiated mice. Interestingly,
mutant c-KIT receptor had stronger transformative potential in vivo, suggesting additional
signalling effects beyond PI3K.
27
Although to a lesser degree, mutations of the small GTPase family called RAS tell a
similar story in some subtypes of AML. In cases with chromosomal rearrangements of Histone-
lysine N-methyltransferase 2A (KNMT2A, also known as mixed lineage leukemia or MLL),
NRAS and KRAS mutations are both seen in up to a quarter of patients, and up to 50% had
mutations in some type of protein that is part of this pathway129. In other studies, similar
mutations in components of this pathway were as high as 45%. Multiple RAS mutations were
detected in the same leukemia, also at relapse130. This potentially speaks to the importance of
RAS-MAPK, as well PI3K signalling in the clonogenic potential of AML blasts. In MLL
rearranged cells, mitogen activated protein kinase (MAPK) inhibition reduced cell survival,
without exhibiting the same effect in normal control, suggesting this pathway may be selectively
activated in MLL positive leukemia. Interestingly, a small subpopulation of therapy-resistant
cells had sustained PI3K pathway activation, experimentally demonstrating an "escape route" for
cells and delineating the complexity of the signalling pathophysiology involved131. Since the
manner in which the PI3K pathway is dysregulated in the pathogenesis of blood cancers is
clearly distinct than in solid tumours, there is a great need to understand resistance mechanisms
to conventional PI3K inhibition.
28
1.7 Autophagy
1.7.1 Overview
Autophagy (literally, "self-eating") is the term used to describe the various ways cellular
cytoplasmic contents are delivered to lysosomes for their degradation. To date, three types of
autophagy have been identified; they are microautophagy, macroautophagy and chaperone-
mediated autophagy132 (Figure 5). Both macro- and microautophagy can be selective or
nonselective, they differ however based on how autophagic contents reach the lysosome133.
Microautophagy is the direct engulfment of contents in the cytoplasm by the lysosome (or
homologous proteins in other organsims, (e.g. vacuoles)134. In this type of autophagy, the
lysosome itself invaginates cytoplasmic cargo for degradation. Although this has not been
studied extensively, it has been reported to occur in mammalian cells such as mouse/rat liver
hepatocytes. Some hypothesize this lesser known type of autophagy might be required for basal
turnover of long lived proteins135. In both yeast and mammalian cells, microautophagy has been
observed to be both constitutively active and stress induced via nutrient deprivation136.
Chaperone mediated autophagy (CMA) is only a selective form of autophagy wherein
soluble cytosolic proteins labelled for degradation by specific peptide motifs are shuttled to the
lysosome. This direct shuttling does not required the formation of additional vesicles, and
proteins directly traverse the lysosomal membrane from the surrounding cytosol137. These
proteins are delivered by the heat shock protein hsc70 and then to the lysosome by binding to
Lysosome-associated membrane protein 2 (LAMP2A)137. Proteins degraded by CMA frequently
have an amino acid sequence that is biochemically related to the Lys-Phe-Glu-Arg-Gln
(KFERQ) sequence initially found in ribonuclease S peptide (RNase-S peptide). RNase-S
29
peptide was identified as a cleavage product of ribonuclease A (RNase A) protein that is
selectively degraded by serum withdrawal in human fibroblasts138. Thus, chaperone mediated
autophagy is carried out by recognition of a motif similar to KFERQ in cytosolic proteins. It is
estimated that 25-30% of cytosolic proteins have a similar sequence 139,140. The third and most
well studied type of autophagy is referred to as macroautophagy.
1.7.2 Macroautophagy
Macroautophagy (herein referred to as autophagy) is a cellular process by which bulk
degradation of cytoplasmic contents occurs through their engulfment in double membraned
vesicles termed autophagosomes. The subsequent fusion of autophagosomes with lysosomes
(termed autolysosomes) ensures the degradation of cargo (Figure 5). Autophagy can degrade
long-lived proteins, cytoplasmic aggregates, mitochondria, peroxisomes, ribosomes,
macromolecules and even invasive pathogens141. Starvation conditions can induce autophagy
beyond a basal level142, as autophagy is thought of as a cellular and energy recycling program, or
in other words a way to conserve energy during times of cellular stress by degrading present
cellular components into natural "building blocks".
Current studies suggest that there are multiple sites at which autophagosomes may form,
among which are the endoplasmic reticulum (ER), mitochondria and the plasma membrane. At
these locations, pre-autophagosomal structures called phagophores or isolation membranes are
where the budding of double membrane vesicles begin143. Biogenesis of autophagosomes are
tightly associated with the presence of PI(3)P at these pre-autophagosomal structures. Many
proteins involved in autophagy initiation and maintenance contain protein domains that can bind
PI(3)P with high affinity and thus selectively localize them to areas in the cell where
30
autophagosomes can form. One of these is the FYVE domain, the name arises from the first four
proteins found to have this motif (Fab1p, YOTB, Vac1p and Early Endosome Antigen 1)144.
Cellular PI(3)P is mainly produced by Class III PI-3K (VPS34) and proteins that bind to PI(3)P
are involved in membrane trafficking, for example, from endosomes to Golgi bodies to
lysosomes. In one documented instance, double FYVE-domain containing protein 1 (DFCP1)
binds PI(3)P in a VPS34 dependent manner and forms double membraned structures called
omegasomes (i.e. they are physically shaped like the Greek letter omega, Ω145) associated with
the ER membrane and Golgi144. Moreover, this is also where microtubule-associated protein light
chain 3 A/B/C (MAP1LC3A/B/C or LC3 in humans, in yeast it is referred to as autophagy
related protein 8, Atg8) positive structures can be seen emanating from these intracellular
localizations146.
LC3 is the yeast homologue of Atg8 and is one of, if not the only, highly selective marker
for mature autophagosomes (i.e. those that will soon be delivered to a lysosome) 147. After being
translated, an unprocessed proLC3 is cleaved by Atg4 at the carboxy terminal to produce a
cytosolic LC3-I. In a process mediated by the enzyme Atg7, LC3-I is conjugated or "lipidated"
to a phosphatidylethanolamine (PE) moiety found on autophagosomal membranes, thus
generating LC3-II148. Since LC3-II is tethered and lipidated, it is readily distinguished from
LC3-I on a SDS-PAGE gel due to differential mobility147.
Since there is a normally rapid turnover of autophagosomes by lysosomes149, a need
arises to inhibit this process to visualize autophagy. Autophagy inhibitors hydroxychloroquine or
its derivative chloroquine and bafilomycin A1 are frequently used to achieve this. Chloroquine is
a weak base that accumulates in lysosomes, thus preventing their acidification, and degradation
of autophagic vesicles150. Bafilomycin A1 achieves a similar result by inhibiting lysosomal H+-
31
ATPases necessary for acidification151. As mentioned previously, the protein LC3 is highly
selective for autophagy and is conjugated to the membranes of autophagosomes as they mature.
The conjugated form is referred to as LC3-II and the soluble LC3-I, with the former being highly
enriched on autophagosomes, and autophagy inhibitors cause accumulation of this marker147.
The most widely accepted technique to measure autophagosome generation is to measure the
amount of LC3-II under blocked or non-blocked conditions and normalize this to actin level, as
described by Klionsky and others147. This method is therefore seen as a surrogate for autophagic
flux, since these double membrane structures will eventually be delivered to the lysosome for
degradation.
Taken together, these findings are consistent with the notion that a) VPS34 and
importantly PI(3)P are necessary for autophagy initiation b) one of the locales of autophagy
initiation is the ER c) LC3 is an exclusive marker for mature autophagosomes that will
eventually form autolysosomes.
32
NOTE: LC3-PE = LC3-II
Figure 5. Overview of Autophagic Flux. Schematic of the 3 different types of
autophagy. In chaperone-mediated autophagy (CMA), cytoplasmic contents are
delivered straight to the lysosome. Proteins degraded by CMA have a peptide
motif consisting of the residues KFERQ that localizes it to the lysosomal
membrane associated LAMP2A, which mediates movement of cargo into the
lysosome137. In microautophagy, there is direct invagination of cytoplasmic
contents by the lysosome134. In macroautophagy, double membraned vesicles
invaginate and enclose portions of the cytoplasm. These vesicles are termed
autophagosomes, and they eventually fuse with the lysosome, forming an
autolysosome. Pre-autophagosomal structures (PAS) are locations where the
initiating events of macroautophagy occur143. The phagophore is the location
where the budding of double membrane vesicles occur, they are often referred
to as omegasomes since they are similar in shape to the greek Ω145. Shown
below each step in macroautophagy is the names of the human genes
responsible for mediating each specific step in the pathway. Eventually,
degraded contents are released back into the cytoplasm for recycling and reuse.
Figure adapted from Kaur and Debnath, Nature Reviews Molecular Cell
Biology. 2015152.
33
1.7.3 The PI3K-mTOR Pathway and Autophagy
A central node of control in the autophagic signalling pathway are the mTOR complexes.
Normally able to "sense" the availability of nutrients themselves, mTOR complexes are also
under direct regulation by AMP-activated protein kinase (AMPK). AMPK is sensitive to the
ratio of cellular AMP:ATP and is activated by metabolic stresses153. Under nutrient deficient
conditions, AMPK can either promote activation of the negative mTORC1 regulator TSC2 or
through direct inhibitory phosphorylation154. When energy is abundant, mTOR remains active
and has inhibitory phosphorylation on the unc-51 like autophagy activating kinase 1 (ULK1)
protein complex, which normally activates autophagy. This process is reversed and autophagy
(even under nutrient rich conditions) is activated, when under the influence of rapamycin, a
potent mTORC1 inhibitor155. Another way mTOR-mediated inhibition of autophagy may occur
is when there is a removal of stimuli that activate mTOR through the PI3K-AKT pathway. Since
AKT is activated downstream of growth factors binding RTKs, a lack of growth factor signalling
that subsequently decreases AKT activation would also decrease mTOR activity, since it is a
downstream target of AKT156. There is evidence that both mTORC1 and 2 inhibit autophagy, and
they both achieve this in different ways; whether AKT is activated as a result of mTORC2
upregulation or when mTORC1 is stimulated by AKT, the end result is autophagy inhibition157.
ULK1 and the closely related ULK2 proteins are normally activators of autophagy and
knockdown of each or both protein complexes results in an inability to undergo normal
autophagy158. ULK1 phosphorylates key proteins involved in autophagy initiation. Following
mTOR inhibition and starvation, ULK1 can phosphorylate Beclin 1 (Atg6 in yeast, BECN1 in
humans), enhancing the complex it forms with VPS34 and other proteins, as this complex is
extremely important at isolation membranes where it accounts for the PI(3)P necessary for
34
autophagosome biogenesis159. Conserved from yeast to humans, class III PI3K proteins (hVPS34
in humans) use PI as a substrate to generate PI(3)P; VPS34 is also thought to be the main source
of PI(3)P in cells160. As mentioned previously, both PI(3)P and VPS34 are necessary for
autophagy, and they are implicated in the earliest stages of this process161. Pan PI3K inhibitors
that target VPS34 such as 3-methyladenine, wortmannin and LY294002 inhibit autophagy162.
Also, VPS34 knockout or mutation in vitro inhibits autophagy in multiple cell types 161,163,164.
1.7.4 Autophagy and Cancer: a Double Edged Sword?
Autophagy has frequently been implicated in the pathogenesis of neoplasms, and is
thought to have context-specific roles in cancer maintenance and progression. Initially,
autophagy was envisaged to have a tumour suppressive function in cancer. This is because
proteins important for this process such as Beclin 1 (BECN1) are lost in cancer, sometimes up to
75% at the genetic level, in tumours of the breast, prostate and ovary. Interestingly, the genetic
locus for BECN1 is adjacent to the known tumour suppressor breast cancer 1, early onset
(BRCA1)165. Becn1 null mice die prenatally and heterozygous mice frequently form tumours at
random, indicating it is haploinsufficient166, though this may be tissue dependent in some
cases167. Beclin 1 expression is also a predictor of clinical outcome in other cancers168. In
general, autophagy is important in some tissues or organ systems that may accumulate damaged
mitochondria and protein aggregates.
Impaired autophagy results in oxidative stresses, activation of DNA damage response or
genomic instability and dysregulation of metabolism, all of which are implicated in cancer
development and are of particular importance in degenerative diseases169,170. In some cases,
35
blocking autophagy may inhibit differentiation, for example, as mature erythrocytes require the
clearance of mitochondria and other organelles during development; a process thought to be
achieved through autophagy. Ulk1 deletion in mice impairs their ability to remove mitochondria
and ribosomes during development of red blood cells, albeit these knockout cells still have the
ability to activate autophagy171. This supports the idea that certain types of autophagy may be
selective for some organelles or cargo (in this case, mitophagy or ribophagy), these however are
nonetheless important in promoting critical events such as differentiation.
Therefore, autophagy can be thought of as a process that "cleans up" products of
malfunctioning processes in the cell, and when eliminated in a normal context, can have
profound cell physiological consequences. This is consistent with the notion that cancer arises
due to imbalances in normal maintenance of cellular functions. Indeed, genomic instability is
thought to be the most prominent enabling characteristic of malignant cells that have acquired
the "hallmarks of cancer"172.
On the other hand, a robust autophagy programme has been proposed to promote tumour
formation. Cancer cells in some cases may undergo autophagy more than normal cells, possibly
due to the increased demands in metabolism or biosynthesis, also they may encounter a lack of
nutrients in hypoxic microenvironments and tumour niches173. Expression of oncogenic mutant
RAS upregulates basal autophagy174 and certain tumours require autophagy for efficient growth
under various conditions175. Interestingly, almost all anticancer drugs in addition to radiation
activate autophagy in some manner150, thus suggesting resistant cancer cells are more effectively
poised to activate autophagy, and thereby able to withstand more cytotoxic stresses. Since the
manner by which autophagy affects cancer may be contextually or even temporally specific,
36
some have described an "autophagic switch" in cancer development. That is, some tumours may
become dependent on autophagy after they have been formed, as a means of pro-survival176.
Chemotherapy resistance is also a significant hurdle needed to be overcome for optimal
outcome of those treated with anticancer drugs. In addition to autophagy inhibitors being used in
a myriad of clinical trials in cancer150, autophagy inhibition has been frequently demonstrated to
sensitize cells to various cancer therapies. For instance, combination of the autophagy inhibitor
chloroquine with epirubicin decreased tumour survival and growth in breast cancer, and similarly
with other chemotherapy drugs in melanoma, ovarian and colon cancer177–180.
1.7.4.1 Autophagy and Leukemia
Haematopoietic stem cells are in a state of constant quiescence when residing in the bone
marrow181. It is thought that autophagy is a crucial mechanism by which stem cells can maintain
this phenotype, especially due to their long lifespan in some organisms182. Ablation of the
essential autophagy gene Atg7 (involved in post-translational processing of LC3 protein) in mice,
results in a variety of blood-related complications. Indeed, haematopoietic stem and progenitor
cells (HSPCs) lacking Atg7 were unable to form secondary colonies in colony-forming cell
(CFC) assays, were unable to reconstitute the bone marrow of lethally irradiated mice and bone
marrows from Atg7 -/- mice had an overall reduction of HSCs183. Strikingly, the overall number
of the more differentiated Lin- Sca-1+ c-Kit+ (LSK) progenitor cells are increased, albeit with
defective autophagy and accumulation of dysfunctional mitochondria. The authors suggest this
may account for the fact these mice have symptoms of a myeloproliferative disease, underlying
the importance for autophagy in this model183. The AKT-controlled transcription factor Forkhead
box O3 (FOXO3A) transcribes genes that drive a pro-autophagy programme needed to survive
37
pro-apoptotic stimuli in HSCs184. The same can be said for the master regulator of erythropoiesis,
GATA-1, which transcribes a similar set of autophagy-related genes185.
Catalytic mTORC1 inhibitors can induce a protective autophagy program in AML, but
autophagy blockers in combination with these inhibitors increase cytotoxicity. Thus, there is a
promising avenue for synergistic roles for inhibiting autophagy and aberrant signalling pathways
in leukemias with elevated PI3K/AKT signalling186. Similarly, L-asparaginase (often used to
treat acute lymphocytic leukemia) induces a cytoprotective autophagy in AML cells, thought to
be as a result of mTORC1 inhibition187. Owing to the theme of context-specificity, autophagy
may play different roles in certain acute leukemias.
In acute promyelocytic leukemia (APL) a bulk of tumours express the fusion protein
promyelocytic leukemia gene (PML) - retinoic acid receptor α (RARα) caused by translocation
t(15;17) (q22;q12). This fusion protein blocks the differentiation of myeloid cells by inhibiting
transcription of genes necessary to facilitate their normal maturation. An overwhelming number
of cases (up to 90%) can be cured with treatment by arsenic trioxide (As2O3) with all-trans
retinoic acid (ATRA) 188,189. An interesting result of this therapy is that it has been shown to
activate autophagy, and the PML-RARα fusion protein is degraded in an autophagy-dependent
manner190. This was also found to be exacerbated by mTORC1 inhibitor191. Notably, this is not
only limited to fusion protein found in APL; in chronic myeloid leukemia (CML), As2O3 induces
the autophagic degradation of the BCR-ABL oncoprotein192. It is now evident that autophagy
plays multiple roles that are very likely context-dependent in cancer. Unfortunately, this
contributes to the incredible amount of complexity and the difficulty involved in delineating the
features of this pathway, it however provides great opportunity to discover targeted therapies that
are effective for those with aggressive leukemias.
38
Figure 6. AKT activation results in indirect stimulation of mTOR and inhibition of
autophagy. An increase in mTOR activity results in inhibition of the ULK complex of
proteins necessary for autophagy stimulation. Shown here is two methods by which this
may occur. A) AKT can directly block the inhibitor of Rheb proteins, TSC1/2, as normally
activated Rheb can stimulate mTOR. B) AMPK can feed into this pathway by direct
inhibiton of TSC1/2, thus having opposite effects of AKT, and thereby initiating more
autophagy. Bars indicate inhibitory inputs, arrows indicate stimulatory inputs.
Figure adapted from Burman and Ktistakis, FEBS Letters. 2010. 144
39
2. RATIONALE, AIMS AND HYPOTHESIS
2.1 Rationale and Aims
2.1.1 Investigating mechanisms of INPP4B-mediated phenotypes in AML cells
Given the unexpected association between INPP4B overexpression and poor disease
outcome in AML, it was important to investigate the mechanisms mediating this phenotype. Our
group discovered that INPP4B overexpression was associated with decreased overall survival,
event free survival and poor response to induction therapy. We also demonstrated in vitro that
INPP4B overexpressing cells recapitulate phenotypes representative of a more aggressive disease
including increased proliferation, enhance colony forming potential and chemoresistance91.
These results presented a paradox because INPP4B had been clearly established as a tumour
suppressor in other cancers, owing to its ability to regulate and prevent aberrant AKT activation.
An important mechanistic question that arises from these data was whether these phenotypes can
be explained by the lipid phosphatase activity of INPP4B or whether this is mediated by other
phosphoinositide phosphatase-independent functions.
Other groups have shed light on a potential mechanism for INPP4B overexpression in
cancer. Gasser et al. demonstrated that INPP4B overexpression in breast cancer results in
oncogenic PI3K signalling through SGK3 activation in vitro, but do not describe any patient
outcomes associated with this upregulation95. Despite this, the accumulation of PI(3)P is
proposed to be a result of INPP4B upregulation, attributing functional consequence to lipid
phosphatase activity of INPP4B. Similarily, two other studies in melanoma and colon cancer
describe INPP4B overexpression mediating similar activation of SGK3. Guo and colleagues
however also suggest this overexpression results in the dephosphorylation of PTEN, and hence,
40
sustained AKT activation because of PTEN inhibition. One common finding in all three studies
is that INPP4B phosphatase activity is essential for these phenotypes95,97. As a result, a central
aim of this study was to explore phosphatase dependent phenotypes associated with
INPP4B expression in our AML cell models.
2.1.2 INPP4B Overexpression and PI(3)P signalling: Implications for Autophagy
The reports suggesting that INPP4B may activate SGK3 through PI(3)P accumulation96,97
sheds light on unexplored considerations for INPP4B biology. In addition to the activation of
SGK3, PI(3)P regulates a diverse array of biological processes such as cytokinesis193, endosomal
trafficking194, phagocytosis195 and autophagy160, each of which can impact cancer. In particular,
autophagy has long been considered to have multi-faceted roles in the generation and
progression of cancers and it is a significant mechanism used by cancer cells to achieve
resistance to chemotherapy150.This has been demonstrated to be especially important in cancers
such as AML where a majority of patients relapse after successful primary treatment
regimens113,176.
There are currently no studies exploring the role of INPP4B in autophagy, however
unpublished data from the Technical University of Munich hints at the involvement of ULK1196.
ULK1 is a lipid kinase essential for autophagy that phosphorylates VPS34 containing structures
necessary for autophagy induction159. The authors suggest there are predicted phosphorylation
sites on INPP4B residues for ULK1. Interestingly, these sites are not found in its paralog,
INPP4A. Moreover, they show that INPP4B and ULK1 interact in vitro, but do not show
phosphorylation occurring under normal non-starvation conditions196. It is possible that ULK1
41
phosphorylates proteins such as the Beclin 1-VPS34 complex necessary for autophagy, and even
INPP4B, as a means to generate PI(3)P required for autophagic induction. Therefore,
investigating the link between INPP4B and autophagy may explain the mechanisms behind some
of the INPP4B overexpression-associated phenotypes demonstrated by our group and others.
2.2 Hypothesis
We propose that INPP4B overexpression in AML promotes the activation of autophagy
in a phosphatase dependent manner.
42
3. MATERIALS AND METHODS
3.1 Cell Culture
OCI-AML2 and OCI-AML3 were cultured in αMEM media, and NB-4 cells in RPMI 1640
media, both supplemented with 10% FBS and 100 units/mL penicillin as well as 100 units/mL
streptomycin at 37oC and 5% CO2. For the growth curve assay, cells were seeded on a 10 cm
dish at a confluency of 1x103 or 1x104 cells/mL with counting once daily for a period of 6 days.
Low serum conditions were defined as similar to normal media conditions as mentioned above
except for the substitution of 10% FBS with 1% FBS for starvation purposes.
3.2 Lentivirus production
pSMAL-puro, pSMAL-puro-FLAG-INPP4Bwt (wild-type) and pSMAL-puro-FLAG-
INPP4Bmut-C824S (mutant) lentiviruses were produced by calcium phosphate transfection of
HEK-293T cells with 2nd generation lentiviral packaging and envelope plasmids (psPAX2 and
pCI-VSVG) as described by the manufacturer (Life Technologies, Burlington, ON, Canada).
Briefly, 6.4 μg of psPAX2 and 3.6 μg of pCI-VSVG along with 10 μg of target plasmid were
transfected into HEK-293T cells at a confluency of 3.0x106 cells on a 10 cm plate. Media was
changed 24 hours post-transfection.
Viral particles in supernatants collected at 48 and 72 hours post-transfection were enriched
with Lenti-X Concentrator according to manufacturer protocols (Clontech, Mountain View, CA,
USA) or by centrifugation at 1500xg for 45 min at 4°C after overnight incubation with
concentrator solution at 4°C. The concentrator solution consists of: 50% polyethylene glycol
(PEG) 6000 and 0.3M NaCl. OCI-AML2, OCI-AML3 and NB4 cells were infected with 10X
43
concentrated lentivirus for 24 or 48 hours once or twice in the presence of 8 μg/mL protamine
sulfate and selected with 2 μg/mL puromycin for 48 hours.
3.3 DNA plasmids
Human cDNA encoding wild-type INPP4B and C842S mutant INPP4B were cloned into
pSMAL-puro (a kind gift from Dr. John Dick) using the PacI/XbaI restriction sites. The INPP4B
C842S mutant cDNA was generated by site directed mutagenesis using a Q5 Site Directed
Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) according to manufacturer
protocols. Site-directed mutagenesis primers were as follows: 5′-TTTCACCTGTAGTAAAAGT
GC-3′ (forward) and 5′-CGAATACCATTCAGTTTGC-3′ (reverse). Plasmid DNA was purified
using a Qiagen Maxiprep kit according to manufacturer's protocol (QIAGEN Inc., Hilden,
Germany).
3.4 Methylcellulose Colony Formation Cell (CFC) Assay
900 μL of OCI-AML2 cells (control, INPP4Bwt and INPP4Bmut) at a concentration of
1x103 cells/mL were mixed with 1.2 mL of 2.1% (w/v) methylcellulose and 900 μL of fetal
bovine serum (FBS). 3 mL of this mixture was plated in triplicate in 3.5 cm plates with grids for
counting. Pictures were taken of colonies and counted 9 days after plating and subsequent
incubation at 37oC and 5% CO2 with the EVOS® XL Core Imaging System.
3.5 Phosphatase Assay
INPP4B immunoprecipitated from 500 μg of lysates generated from the overexpression of
INPP4B in the OCI-AML2 cell line (control or endogenous, INPP4Bwt and INPP4Bmut). Isolated
protein was combined with purified 100 μM diC8-PtdIns(3,4)P2 (Echelon Biosciences, Salt Lake
City, Utah) in 25 mM Tris-HCl (pH 7.5), 140 mM NaCl, 1 mM DTT at 37°C for 1 hour (see
44
manufacturer protocols for details). INPP4A protein provided by the manufacturer (Echelon
Biosciences, Salt Lake City, Utah, USA) was used as a positive control, the same reaction with
no enzyme was used as a negative control. Free inorganic phosphate release was measured with
Pi-Glo: A Universal Bioluminescent Phosphatase Assay (gifted via Promega Corp.).
3.6 Immunoblotting
Cell lysates were generated by spinning down cells in normal media and washing with
PBS and subsequent spin at 4oC. Cells were then resuspended in the appropriate volume RIPA
buffer with protease inhibitors (Roche) and the following phosphatase inhibitors: 50 mM beta-
glycerol-phosphate (BGP), 1 mM Sodium Orthovanadate (activated chemical, Na3VO4), 4 mM
Sodium Fluoride (NaF). Cells in RIPA buffer were then flash frozen using liquid N2. Cells were
then lysed at 4oC for 30 min and then centrifuged at 12,000xg for 20 min. Protein containing
lysate was then mixed with 6X Laemmli buffer and ran on SDS-PAGE gel. The recipe for RIPA
buffer is as follows: 10 mM Tris-Cl (pH 8.0), 1 mM EDTA, 1% Trition X-100, 0.1% sodium
deoxycholate, 0.1% SDS and 140 mM NaCl.
Western blotting was performed using the following commercial antibodies: LC3B
(#3868), INPP4B (#8450 OR #14543), beta-Actin (#4967S), GAPDH (#2118) and Anti-rabbit
IgG, HRP-linked (#7074) from Cell Signaling Technology (CST, Danvers, Massachusetts,
USA). All antibodies were incubated at a concentration of 1:1000 in 5% BSA in TBS-T buffer
overnight at 4oC unless otherwise stated.
3.7 Cyto-ID® assay
OCI-AML3 cells were collected and washed with PBS containing calcium or 1X assay
buffer provided by the manufacturer (VWR, Radnor, Pennsylvania, USA). Cells were stained in
45
a solution containing 100 μL of PBS with 5% FBS and 100 μL of 1X Cyto-ID assay buffer. 1
mL of 1X Cyto-ID buffer is composed of: 1 μL Cyto-ID reagent, 50 μL FBS, and 949 μL PBS or
1X assay buffer. After 1 hour incubation at 37oC in the dark, cells were pelleted and washed with
1X assay buffer or PBS and then ran through the flow cytometer. Live cells were determined by
forward scatter and side scatter gating and green fluorescence was measured on the FITC
channel (FL1).
3.8 Generation of Immortalized MEFs
Low passage (P3-P5) wild-type and Inpp4b-/- C57BL/6J58 primary MEFs were generated
by infection with SV40 Large-T antigen retrovirus generated by retroviral transfection in
HEK293T cells. After 48 hours infection in retroviral media and protamine sulfate (described
similarly in lentiviral preparations), cells were selected in 75 μg/mL hygromycin for 48 hours197.
3.9 Genotyping
Genomic DNA was extracted from MEF cells using protocol outlined as previously
described198, without the use of phenol/chloroform/isoamyl alcohol. Primers used for genotyping
were as follows: Wild-type forward: 5’ GCTTCTGATAAAACATGGG 3’ Wild type reverse:
5’ TGGGCACATTTATAAGCCTTC 3’ Mutant forward: 5’ GCTTCTGATAAAACATGGG 3’
Mutant reverse: 5’ TGTTTTAAAAGCCTTGCTAAGTGTC 3’
46
3.10 Statistics
All P-values were determined to be significant if they were <0.05. Unless otherwise stated,
all P-values were derived using a two-tailed, unpaired Student’s t-test. *P<0.05, ** P <0.01, ***
P <0.001. A one-way parametric analysis of variance (ANOVA) was used to determine the
significance value for the daunorubicin dose-response curves.
47
4. RESULTS
4.1 Generation of a phosphatase-null INPP4B mutant (INPP4Bmut) protein
INPP4B catalyzes the dephosphorylation of PI(3,4)P2 into PI(3)P through the action of a
dual specificity-phosphatase (CX5R) consensus domain located near its carboxy terminal (Figure
3). In INPP4B, this is characterized by a CKSAKDR amino acid sequence starting at amino acid
842. In order to generate a catalytically inactive mutant, the cysteine (C) residue 842 was
replaced by serine (S) to generate the C842S mutant through site directed mutagenesis of
thymine (T)-2524 to adenine (A), as described previously (Figure 7)64.
To investigate whether the phosphatase function of INPP4B was necessary for the cellular
phenotypes we observed previously in INPP4Bwt overexpressing AML cell lines, lentiviral
plasmids encoding catalytically active (pSMAL-puro-FLAG-INPP4Bwt) and inactive (pSMAL-
puro-FLAG-INPP4Bmut) proteins or vector control (pSMAL-empty) were transduced in the OCI-
AML2 line (Figure 8A). The presence of wild-type or mutant INPP4B did not change the basal
AKT phosphorylation level in any of these cell lines. This was seen previously in wild-type cells
by flow cytometric staining for p-AKT (Ser473, both OCI-AML2 and OCI-AML3) in
INPP4BWT cells. For phosphatase assays, INPP4B protein (isolated via immunoprecipitation
with an anti-INPP4B antibody, see methods) was incubated with purified PI(3,4)P2 and
phosphatase activity was measured via luminescence generated by a chemical reaction with
liberated phosphate groups. Compared to vector control (i.e. endogenous INPP4B) and mutant,
immunoprecipitates from INPP4Bwt overexpressing OCI-AML2 cells had 1.6 and 2.0 fold greater
4-phosphatase activity, respectively (Figure 8B). Thus, these results indicate that our engineered
48
INPP4Bmut protein is functionally inactive and suitable to perform further experiments to address
the phosphatase dependency of INPP4B-overexpression phenotypes.
49
Figure 7. Sequencing Data Encoding INPP4Bwt and INPP4Bmut phosphatase
domains. Raw cDNA sequencing data from plasmids encoding wild-type and null
INPP4B proteins. The catalytic domain in INPP4B is characterized by a residue sequence
of 7 amino acids: CKSAKDR. In other similar phosphatases, it is characterized by 5
amino acids surrounded by a cysteine and arginine (CX5R)199. In the top-half of the panel
is the sequencing data from the plasmid pSMAL-puro-FLAG-INPP4BC824S (mutant) and
the bottom-half pSMAL-puro-FLAG-INPP4Bwt (wild-type). The mutant is characterized
by a cysteine to serine mutation, C842S, as described previously for INPP4B64.
Mutant:
Wild-type:
50
Figure 8. Characterization of OCI-AML2 cells expressing vector control and
INPP4Bwt and INPP4Bmut proteins. (A) Western blot characterizing expression of
exogenous INPP4B protein and basal levels of AKT and p-AKT protein in OCI-AML2
cells. C842S mutant was generated by site directed mutagenesis. (B) Phosphatase assay
measuring catalytic activity of INPP4B in the OCI-AML2 cell line. Briefly, purified
INPP4B protein was incubated with PI(3,4)P2 and the release of free phosphate was
measured. A greater luminescence means more liberation of phosphate groups from
PI(3,4)P2 by INPP4B. P-values were derived using the Student’s t-test. *P<0.05, ** P
<0.01, *** P <0.001. This figure was adapted from Dzneladze et al., 2015, Leukemia91.
51
4.2 INPP4Bmut OCI-AML2 cells do not exhibit phenotypes observed in INPP4Bwt
overexpressing cells
To determine whether the phenotypes caused by INPP4Bwt overexpression are phosphatase
dependent, we repeated previous experiments with the INPP4Bmut overexpressing OCI-AML2
cell line. AML cells overexpressing INPP4Bwt have faster growth rates compared to control
cells; INPP4Bmut cells on the other hand showed an intermediate growth response (Figure 9A).
Similarly, INPP4Bmut cells displayed only a partial decease viability after growth in low serum
conditions when compared to INPP4Bwt and vector control cells after 96 hours (Figure 9B). In all
the aforementioned experiments, viability was determined by Trypan Blue exclusion staining.
We previously determined that OCI-AML2 and OCI-AML3 show increased survival through
diminished Annexin V staining when compared to control under normal growth conditions and
negligible cell cycle differences91. This suggests they do not proliferate quicker but rather
expression of wild-type INPP4B confers a survival advantage. These data demonstrate that
mutant INPP4B may confer partial growth phenotypes in liquid culture conditions. In contrast,
colony formation potential of AML cell lines colony forming cell (CFC) assays in
methylcellulose was enhanced by overexpression of INPP4Bwt, however cells overexpressing
INPP4Bmut were no different than that of vector control cells (Figure 10).
Similar to CFC assays, the resistance conferred by INPP4Bwt overexpression appears to be
completely dependent upon the phosphatase function of INPP4B. Dose response experiments
demonstrated that the EC50 for daunorubicin (DNR) of INPP4Bwt overexpressing cells was 63.5
nM whereas it was 20.2 and 23.7 nM for control and INPP4Bmut, respectively (Figure 11A).
Similarly, no differences were observed in the viability of control and INPP4Bmut cells compared
52
to INPP4Bwt expressing cells over 4 days in the presence of 10 nM or 50 nM DNR (Figure 11B).
Viability was measured using the trypan blue exclusion assay.
Overall, the cellular phenotypes observed upon overexpression of INPP4Bwt in AML cell
lines were generally phosphatase-dependent. However, partially enhanced viability and
proliferative potential was observed upon expression of INPP4Bmut in AML cell lines, suggesting
the potential of context-linked phosphatase dependency.
53
Figure 9. INPP4Bwt cells proliferate more rapidly than control or mutant cells in
normal and low serum conditions. (A) Cells expressing exogenous wild-type INPP4B
protein were able to grow in normal media faster than control or mutant expressing cells
for a period of 5 days. (B) INPP4Bwt cells show greater viability after being cultured in
low serum (1% FBS) conditions at 96 hours. Error bars are +/- S.E.M. This figure was
adapted from Dzneladze et al., 2015, Leukemia91.
A B
54
Figure 10. INPP4Bwt cells form colonies preferentially in vitro.
In methylcellulose media, wild-type overexpressing INPP4B OCI-AML2 cells form
more colonies than control or mutant cells. Shown are representative images of colonies
formed from each cell line in 3 independent experiments. Error bars are +/- S.E.M. All
P-values were derived using the Student’s t-test. *P<0.05, ** P <0.01, *** P <0.001.
This figure was adapted from Dzneladze et al., 2015, Leukemia91
55
Figure 11. INPP4Bwt cells are more resistant to daunorubicin in vitro. (A) INPP4B
overexpression conferred chemoresistance to OCI-AML2 cells in cuture that was not seen
in mutant or control cell lines. Shown is a dose response curve in which increase doses of
daunorubicin were used to assay for drug sensitivity. Overall, wild type cells had
approximately 3-fold greater EC50 than either control or mutant cell lines. (B) Using 2
specific doses of daunorubicin, 10 and 50 nM, INPP4Bwt cells were more resistant to a
time course of drug treatment over a period of 4 days. Mutant and control cells showed
little to no difference in response over this time period. This figure was adapted from
Dzneladze et al., 2015, Leukemia91
A
B
56
4.3 INPP4Bwt Overexpressing Cells Have Increased Staining of Autophagosomes in an
Untreated Condition
Since INPP4B overexpression generally demonstrated phosphatase dependent phenotypes,
we reasoned that signalling as a result of PI(3)P overproduction may be activated in INPP4Bwt
overexpressing AML cell lines. Since PI(3)P is a potent activator of autophagy and sites of
autophagosome biogenesis are enriched with PI(3)P144, we sought to measure autophagy
activation in INPP4B overexpressing cells. For this we first utilized a green-fluorescent dye that
selectively stains autophagic vesicles ranging from autophagosomes to autophagolysosomes,
called Cyto-ID®. Cyto-ID® stains live cells and can be used to monitor autophagy without the
need of cell permeabilization200. Using flow cytometry, we observed that INPP4Bwt OCI-AML3
cells displayed greater staining as measured by the increase in green fluorescence compared to
vector control cells (Figure 12A and B) In total, INPP4Bwt cells displayed 20% greater staining
versus control, indicating an increase in the amount of autophagic vesicles at a basal, untreated
or unstimulated setting. These data provide the first evidence that overexpression of INPP4B
may promote the activation of autophagy. Nevertheless, Cyto-ID® alone is not a reliable
measure of autophagy induction thus more reliable assays are required.
57
Figure 12. INPP4B expression in OCI-AML3 cells leads to a higher level of
autophagosomes in an unstimulated condition. (A) In an untreated condition, OCI-
AML3 cells expressing exogenous wild-type INPP4B protein had a higher level of
autophagosome staining measured by flow cytometry using the green fluorescent dye
Cyto-ID, which is specific for membranes of autophagosomes. Data shown is of 4
independent experiments. Each line connecting a different shape represents one
experiment in which both control and INPP4Bwt cells were stained with Cyto-ID. In
each case, there is a fold change in the difference in staining intensity, depicted by the
line connecting any two shapes. Overall, wild-type overexpressing cells had
approximately 20% more staining than control.
(B) A representative figure of 4 experiments showing the shift in fluorescence for entire
population of stained wild-type or control cells. Cells were gated for the live population
only.
A
B
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Fold
Change M
ean F
luore
sence
Control INPP4B
58
4.4 INPP4Bwt cells demonstrate increased autophagosome accumulation in the presence
of inhibitors of autolysosomal acidification
As mentioned previously, there is a need to inhibit autophagy to visualize it and measure it
effectively. This is because autophagy normally has rapid turnover, and is thus difficult to
measure a steady state condition. To determine whether INPP4Bwt overexpressing cells had
increased levels of autophagy, we inhibited autolysosomal acidification and observed alterations
in autophagosome accumulation through Western blot detection of LC3B-II protein.
Overexpression of INPP4B in the OCI-AML3 cell-line resulted in a 2-fold increase in
LC3B-II protein under inhibition via chloroquine (Figure 13A and B). Notably, even in the
absence of chloroquine we were able to visualize LCB3-I and II proteins in this cell line (Figure
13A). This finding corroborates our observations with INPP4Bwt OCI-AML3 cells stained with
Cyto-ID®, where there is an increase in the basal level of autophagosomes. When measured by
LC3B-II protein by western blot, we observed 1.6 fold LC3B-II in INPP4Bwt vs control (without
chloroquine; Figure 13B).
In the OCI-AML2 cell line, overexpression of INPP4Bwt results in an increased
accumulation of autophagosomes, as measured by levels of LC3B-II protein by Western blot
(Figure 14A). There was a 4-fold increase in the amount of LC3B-II in the presence of
chloroquine in INPP4Bwt OCI-AML2 cells compared to control (Figure 14B). Without
chloroquine, there is little to no detection of LC3B-II, consistent with previous reports that basal
level of this protein is cell-line dependent (Figure 14A)147 .
59
Figure 13. OCI-AML3 INPP4Bwt have a greater propensity for autophagosome
biogenesis. (A) Immunoblot characterizing the amount of LC3 accumulated in OCI-
AML3 cells. In the presence of the autophagy inhibitor chloroquine, INPP4Bwt OCI-
AML3 cells have more accumulation of the mature autophagosome marker, LC3-II at
24 hours in normal media, as judged by immunoblotting. Shown is a representative
image of 3 experiments. 5 μM chloroquine was used over a period of 24 hours. (B)
Densitometric analysis showing relative levels of LC3-II protein in AML3 cells with
respect to β-Actin. Error bars are +/- S.E.M. Shown are the average of 3 independent
experiments. All P-values were derived using the Student’s t-test. *P<0.05, ** P
<0.01, *** P <0.001.
A
B
60
Figure 14. Expression of INPP4B in OCI-AML2 increases amount of
autophagosome accumulation. (A) Immunoblot characterizing the amount of LC3
accumulated in OCI-AML2 cells. In the presence of the autophagy inhibitor
chloroquine, INPP4Bwt OCI-AML2 cells have more accumulation of the mature
autophagosome marker, LC3-II at 24 hours in normal media, as judged by
immunoblotting. Shown is a representative image of 3 experiments. 25 μM
chloroquine was used over a period of 24 hours. (B) Densitometric analysis
showing relative levels of LC3-II protein in AML cells with respect to β-Actin.
Error bars are +/- S.E.M. Shown are the average of 3 independent experiments.
A
B
61
4.5 INPP4Bwt NB4 cells demonstrate increased autophagosome accumulation when
treated with chloroquine
Treatment of cells with increasing levels of chloroquine has been previously
demonstrated to simultaneously increase LC3 accumulation201. To determine whether cell lines
overexpressing INPP4B showed dose dependent differences in LC3 quantity, NB4 cells
overexpressing INPP4Bwt and control constructs were cultured in the presence of 5 and 10 μM
chloroquine for 24 hours. Interestingly, there was an expected increase in LC3B-II accumulation
(6.5 fold) in INPP4Bwt NB4 cells treated with 5 μM chloroquine (Figure 15). In contrast, there
were no changes in LC3IIB in control vs. INPP4Bwt NB4 cells treated with 10 μM of
chloroquine (Figure 15). This suggests there may be threshold effect with 10 μM chloroquine at
24 hours in NB4 cells.
Figure 15. Dose dependent effect of chloroquine in INPP4Bwt NB4
cells. Immunoblot characterizing more LC3B-II protein in the presence of
chloroquine, this shows that wild-type expressing INPP4B NB4 cells had
a greater accumulation of autophagosomes after 24 hours in culture,
however only at a 5 μM dose, 6.5 fold higher. At a 10 μM dose, the effect
was diminished and not seen.
62
4.6 Inpp4b -/- MEFs have a reduced ability to undergo autophagy
Using Inpp4b knockout mouse embryonic fibroblasts (MEFs) obtained from the Vacher
lab75, we sought to determine whether Inpp4b is necessary for autophagy. In a basal, untreated
condition, Inpp4b null MEFs have lower levels of LC3B-II protein compared to wild type MEF
(Figure 16A). To determine whether these Inpp4b knockout cells had less accumulation of
autophagic vesicles over time, we treated them with the autophagy inhibitor bafilomycin A1 at a
concentration of 25 nM for up to 3 hours (Figure 16B). We noticed that surprisingly, over time
wild-type MEFs had a much greater ability to accumulate autophagosomes in the presence of
bafilomycin A1, as measured by the amount of LC3B-II at all timepoints. It is of note that time
course experiments are better indicator of autophagic flux according to guidelines147, since this
indicates a constant delivery of autophagosomes to the lysosome. These data therefore suggest
that knockout of Inpp4b causes a severe deficiency in the ability of MEFs to undergo autophagy.
63
Figure 16. Inpp4b -/- MEFs have a reduction in their ability to accumulate
autophagosomes in a basal state. (A) Wild-type and Inpp4b null mouse
embryonic fibroblasts were lysed and total LC3 protein was detected. In
normal untreated conditions, Inpp4b-/- cells had decreased level of basal
autophagosomes. Shown is a representative immunoblot of 3 independent
experiments. (B) In the presence of the autophagy inhibitor bafilomycin A1 (25
nM), Inpp4b-/- cells had a considerable reduction in the accumulation of
autophagosome at 1.5 or 3 hours in culture. Over time, accumulation of
autophagosomes in the presence of bafilomycin A1 occurred in both cell lines,
but to a much lesser extent in Inpp4b null MEFs. Consistent with previous
results, they also had less basal amount of autophagosomes in an untreated
setting (0 hours).
A
B
64
5. DISCUSSION
5.1 Summary of Results
The primary objective of this study was to investigate the molecular consequences of
INPP4B overexpression in AML. My project was designed to provide insight into novel cell
signalling coordinated by INPP4B. In brief, we observed that INPP4B overexpression-mediated
phenotypes in AML cells are greatly diminished or absent with the introduction of a
phosphatase-null, mutant INPP4B protein suggesting that INPP4B is functioning in a
phosphatase dependent manner. It was also observed that overexpression of INPP4B leads to
increased autophagosome accumulation, an indicator that INPP4B promotes autophagic flux,
presumably as a result of increased cellular PI(3)P production.
Initially, I thought it was important to show that the phenotypes we observed upon
exogenous INPP4B overexpression were mediated by INPP4B phosphatase function. For this
reason I generated a phosphatase dead mutant version of INPP4B protein, by changing the DNA
sequence coding for the cysteine at residue number 842 to serine (C842S; INPP4Bmut) (Figures 7
and 8). For these experiments I overexpressed INPP4Bwt and INPP4Bmut in the OCI-AML2 cell
line, a well-established human AML-derived cell line commonly used to study biological
properties of AML202. Using a phosphatase assay, I demonstrated that the INPP4Bmut protein was
catalytically inactive, as compared to INPP4Bwt protein in OCI-AML2 (Figure 8). Next, we
performed a battery of experiments on INPP4Bwt and INPP4Bmut OCI-AML2 cells to investigate
the role of INPP4B phosphatase function in observed AML phenotypes (Figures 8-11).
In all tests performed, INPP4Bmut presented phenotypes that were either similar to control
or only partially recapitulated the INPP4Bwt phenotype. In summary, colony formation in
65
methylcellulose (Figure 10) and DNR resistance (Figure 11) conferred by INPP4Bwt
overexpression were completely phosphatase dependent, whereas INPP4B may have some cell
growth and viability effects (Figure 9) which are phosphatase-independent.
Since autophagy is normally a rapid process with high turnover, visualizing it remains
difficult. We therefore used agents that inhibit the lysosomal acidification of autophagosomes to
permit the investigation of autophagosomal proteins and measure if their accumulation is altered
in cells with INPP4B overexpression. Using AML cell lines (OCI-AML2, OCI-AML4, NB4)
overexpressing INPP4Bwt, we observed that INPP4B promotes autophagy. When blocking
autophagy using inhibitors such as chloroquine in any cell line, there is usually an increase of the
autophagosome-specific marker LC3B-II. We noticed that despite this, there was even greater
increase of LC3B-II in OCI-AML2, OCI-AML3 and NB4 INPP4Bwt cells with the addition of
chloroquine (Figures 13-15); although the dose used to achieve this effect is different across cell
lines. This is similar to previous findings that suggest different levels of chloroquine result in
varying amounts of LC3 accumulation201. Notably, INPP4B expression alone increases the
amount of autophagosomes without stimulation or treatment in OCI-AML3 cells (Figure 12 and
13) and MEFs (Figure 16A), since in these cells it is possible to visualize this to a limited extent
without pharmacological inhibition. In Inpp4b knockout MEFs, we observed a marked increase
in the basal level of autophagosomes without stimulation or blocking. With the addition of
bafilomycin, there was a greater accumulation over time of autophagosomes in the presence of
25 nM bafilomycin (Figure 16B), an indicator of increased autophagic flux.
66
5.2 INPP4B Phosphatase Activity
Despite its importance in many solid cancers and some leukemias203,204, the phosphoinositide
3-phosphatase PTEN does not play important roles in acute leukemias such as AML. This suggests
that hyperactivation of the PI3K/AKT pathway may be achieved by other means specifically in
cancers such as AML. INPP4B is a lipid phosphatase that dephosphorylates the phosphoinositide
PI(3,4)P2 to generate the mono-phosphorylated PI(3)P. Until recently, it has been thought that
INPP4B acts to “halt” AKT activation by depleting one of its membrane anchors, hence
diminishing its membrane recruitment and subsequent activation. While this paradigm is true for
many cancers and biological contexts, it was not described in blood cancers such as AML.
Like our study published in Leukemia, Rijal and colleagues observed that INPP4B was
upregulated in AML patients and this was associated with poor disease outcome. Based on
expression from bone marrow patients measured via mass spectrometry, high levels of INPP4B
mRNA were correlated with decreased overall survival (OS). Overexpression of INPP4B
protein in patient AML blasts was also associated with poor leukemia free survival (LFS) and
OS. Finally, they also found that higher levels of INPP4B correlated with inferior response to
induction therapy. This demonstrated there is likely a functional consequence for this surprising
overexpression of INPP4B gene and protein92.
We sought to determine whether this phenomenon is true at the cellular level. The study by
Rijal et al. also mainly confirmed our findings from in vitro experiments, as INPP4B mediated
chemoresistance to multiple drugs and knockdown of INPP4B sensitized these cells to treatment.
Interestingly, in both studies, overexpression of INPP4B in AML cell lines did not alter p-AKT
status, as would be expected based on the canonical tumour suppressor INPP4B function, further
67
suggesting an alternative mechanism for INPP4B function in this tissue or cell type205. In
xenograft experiments, INPP4B overexpressing AML cells were transplanted into sublethally
irradiated NSG mice. Mice overexpressing INPP4Bwt were more resistant to Ara-C treatment
and died quicker from leukemia than did control or INPP4Bmut expressing cells. These and our
findings suggest that INPP4B upregulation in AML is functionally relevant both in a cellular
context, where can it promote the cellular phenotypes and chemotherapy responses associated
with more aggressive AML, and in a physiological context, where it causes chemoresistance in
leukemia xenografts and finally, as a clinical tool, since it is an effective biomarker of poor
prognosis AML.
What differs in the findings by Rijal and colleagues with respect to our study is their
discovery that almost of all these phenotypes are phosphatase-independent. That is, a
catalytically inactive mutant protein (engineered as a similar cysteine to alanine mutation,
C842A) recapitulated all of the phenotypes observed in cell lines or mice overexpressing wild-
type INPP4B. Notably, they showed that INPP4B protein is also catalytically active in AML
patient samples. Of concern, this directly contrasts the findings of our study that show that
INPP4B phenotypes are completely (or partially) phosphatase-dependent. It is possible that there
are phosphoinositide phosphatase-independent functions of INPP4B but these are to date,
mechanistically unfounded.
Notably, it has been recently reported that INPP4B may exhibit protein tyrosine
phosphatase activity64, suggesting it may modulate protein targets through dephosphorylation.
Guo et al. have suggested this INPP4B-mediated protein phosphatase activity could promote
cancer progression and activation 97, however the protein substrate targets INPP4B may act upon
are not clearly identified, especially in the context of AML.
68
The lack of evidence of INPP4B controlling AKT phosphorylation in AML corroborates
the possibility that other INPP4B functions may be at play. We hypothesized that INPP4B is
indeed catalytically active as a PI(3,4)P2 4-phosphatase, thus more INPP4B activity will generate
more of its product, PI(3)P. PI(3)P in turn drives specific signalling and cellular processes. This
is not without precedent, as it has been demonstrated that INPP4B upregulation only in certain
subtypes of breast cancer and melanoma drives SGK3 signalling, presumably through the local
accumulation of PI(3)P. Regardless of the likely consequence of INPP4B overexpression, it is
important to consider that it hasn’t been well characterized whether the cellular pool of PI(3)P
that comes from INPP4B has biological relevance, since Class III PI3K has been previously
thought to be the main source of this phosphoinositide160. This further validates a context-
specific theme for INPP4B biology, because this would be a novel situation in which INPP4B is
preferentially upregulated in blood cancers, as opposed to mainly being lost or inactivated in
solid tumours.
69
5.3 INPP4B and Autophagy
Autophagy is a cellular degradation pathway wherein cytoplasmic contents are delivered to
a lysosome for destruction and eventually, recycling back into the cell. Although autophagy has
been proposed to have numerous roles in cancer, there is evidence that it is a resistance
mechanism employed by many tumours to evade therapies and cytotoxic insults150. Herein we
showed that the phenotypes we observed upon ectopic INPP4B overexpression were mediated by
the phosphatase activity of INPP4B. This led us to the hypothesis that INPP4B overexpression
could lead to the accumulation of cellular PI(3)P.
Since PI(3)P is required for autophagy, we assumed that INPP4B may contribute to the
signalling that promotes this process. By showing that INPP4B overexpression leads to
accumulation of autophagosomes (Figures 12-15), this would provide evidence to suggest that
PI(3)P generated downstream of INPP4B may facilitate autophagy. As mentioned previously,
autophagy normally has rapid turnover and the presence of the autophagosome-associated
protein LC3 I or II is variable across cell lines, especially without the use of autophagy inhibitor.
I demonstrated that INPP4BWT showed little to no difference in LC3 levels without the use of
chloroquine but in the presence of autophagy inhibition there was a noticeable difference in the
amount of LC3-II accumulation. This corroborates the idea that autophagy needs to be visualized
over time (in this case, 24 hours in the presence of chloroquine) to “appreciate” the extent of
autophagosome generation or accumulation147. Further work still needs to be done to determine
if autophagosomes generated in this scenario in fact mean there is more autophagic flux; that is,
do these vesicles actually invaginate more cytoplasmic content, whether selectively or not, and is
this subsequently cleared by the lysosome.
70
Furthermore, our study of Inpp4b-/- MEFs indicate that lack of INPP4B protein may have
profound effects on LC3-II accumulation. In basal conditions, INPP4B-null MEF cells had
compromised ability to accumulate autophagosomes, as measured by western blot of LC3B-II
levels (Figure 16A). We also saw that autophagic flux was markedly reduced in knock out cells,
by using bafilomycin to inhibit autophagosomal degradation and observed the accumulation of
autophagosomes over time (Figure 16B). Previously, it was reported that MEF cells deficient in
VPS34 can still undergo appreciable levels of autophagy206, a puzzling finding given the
documented indispensability of VPS34 for autophagy in other studies. Therefore, further studies
of Inpp4b-/- MEF are necessary and warranted.
In addition to this, it is interesting to note that autophagy is involved in some manner in
each of the aberrant phenotypes observed in INPP4Bwt overexpressing AML cells. Links to
autophagy and cell proliferation, nutrient deprivation, chemoresistance and colony formation are
documented207. Whether increased autophagy is commonly observed across all AML cell lines
upon the introduction or expression of INPP4B remains to be seen. Though this link is not
particularly evident at this time, there is a convincing rationale to explore this avenue because
autophagy is a process that can be targeted quite effectively with pharmacological intervention in
a wide range of cancers150.
71
5.4 Conclusions
To date, INPP4B has been proposed to have different roles in multiple cancers. It remains
to be seen what mechanism best describes which function is preferred in a given context. Two
independent studies have presented findings that point to INPP4B overexpression being
representative of a more aggressive disease in AML. We propose that INPP4B promotes
signalling in a manner consistent with its primary role as a lipid phosphatase in AML cell line
models. Indeed, the catalytic function of INPP4B is critical for the cellular phenotypes including
colony formation and chemoresistance. We hypothesized that INPP4B was capable of activating
autophagy in AML cells; as measured by different tools, we have found this hypothesis to be
true. In summary, this study sheds light on the cellular and molecular consequences of INPP4B
and serves as a platform for future studies that intend to uncover the complexities of
phosphoinositide signalling and INPP4B biology.
5.5 Future Directions
It remains to be seen whether INPP4B function can be sufficient for leukemia formation,
or just as a facilitator for worse disease. Mouse models in which INPP4B is deleted would
provide a platform to study its direct effects on cancer generation and progression. A leukemia is
not likely to be caused by a single genetic event, as this suggests INPP4B may act in concert
with other known oncogenes. Furthermore, it is paramount to understand the contribution of
INPP4B to the levels of cellular phosphoinositides in AML. Importantly, what is the effect on
cellular PI(3,4)P2 and PI(3)P when it is lost or gained? Are the conventional sources of both
lipids, Class II and III PI3Ks respectively, altered in similar disease states?
72
If there is in fact increases in phosphoinositides such as PI(3)P, is downstream signalling
as a result controlled spatially in the cell? Since PI(3)P is formed upstream of autophagosome
formation, there is rationale to investigate whether INPP4B co-localizes with pre-
autophagosomal structures. INPP4B has been shown to be specifically enriched on endosomes70,
and in some cases endosomes can feed into the same pathway by which lysosomes degrade
contents of autophagosomes208. There are a number of proteins involved in autophagosome
biogenesis that could be used as markers for potential co-localization experiments with INPP4B.
There is limited data to show that our C842S mutant has defective autophagy (data not shown)
but this requires further investigation under the same conditions for which there was a difference
in INPP4Bwt cells compared to control.
Beyond an AML context, there is a larger question as to what is the "switch" between a
tumour suppressive versus oncogenic activator or initiator roles for INPP4B. It remains unclear if
AKT activation is changed with overexpression of INPP4B in AML cell lines with respect to a
starvation or stimulation scenario. It is possible that some cellular contexts are more "primed" to
lean one way or the other. In a cancer cell that has tight regulation of AKT, that is when PTEN is
not deleted or mutated in a tumour, INPP4B regulation of AKT may not be significant in the
pathogenesis and maintenance of disease. The reverse is potentially true as well, cells that
otherwise do not upregulate or change levels of PI(3)P producing proteins (for example, Class II
or III PI3Ks) may induce INPP4B to compensate this.
Another aspect of these findings is whether or not they contribute to resistance
mechanisms. To answer these questions, it may be required to block autophagy in the presence
or absence of chemotherapeutic agents. Modulation of autophagy has clear benefit as inhibitors
73
are frequent agents used in clinical trials. Being selective, or "personalizing" contexts in which
these drugs may be more efficacious is of great therapeutic value.
74
6. REFERENCES
1. Di Paolo, G. & De Camilli, P. Phosphoinositides in cell regulation and membrane
dynamics. Nature 443, 651–7 (2006).
2. Agranoff, B. W., Roy, M. & Brady, R. O. The Enzymatic Synthesis of Inositol
Phosphatide. J. Biol. Chem. 233, 1077–1083 (1958).
3. Balla, T. Phosphoinositides: tiny lipids with giant impact on cell regulation. Physiol. Rev.
93, 1019–137 (2013).
4. Lemmon, M. A. Membrane recognition by phospholipid-binding domains. Nat. Rev. Mol.
Cell Biol. 9, 99–111 (2008).
5. Lemmon, M. A. & Ferguson, K. M. Signal-dependent membrane targeting by pleckstrin
homology (PH) domains. Biochem. J. 350 Pt 1, 1–18 (2000).
6. Bunney, T. D. & Katan, M. Phosphoinositide signalling in cancer: beyond PI3K and
PTEN. Nat. Rev. Cancer 10, 342–52 (2010).
7. Mayinger, P. Phosphoinositides and vesicular membrane traffic. Biochim. Biophys. Acta
1821, 1104–13 (2012).
8. Redondo-Muñoz, J., Josefa Rodríguez, M., Silió, V., Pérez-García, V., María Valpuesta, J.
& Carrera, A. C. Phosphoinositide 3-kinase beta controls replication factor C assembly
and function. Nucleic Acids Res. 41, 855–868 (2013).
9. Kumar, A., Fernandez-Capetillo, O., Fernadez-Capetillo, O. & Carrera, A. C. Nuclear
phosphoinositide 3-kinase beta controls double-strand break DNA repair. Proc. Natl.
Acad. Sci. U. S. A. 107, 7491–6 (2010).
10. Marqués, M., Kumar, A., Poveda, A. M., Zuluaga, S., Hernández, C., Jackson, S., Pasero,
P. & Carrera, A. C. Specific function of phosphoinositide 3-kinase beta in the control of
DNA replication. Proc. Natl. Acad. Sci. U. S. A. 106, 7525–30 (2009).
11. Yin, Y. & Shen, W. H. PTEN: a new guardian of the genome. Oncogene 27, 5443–53
(2008).
12. Mejillano, M., Yamamoto, M., Rozelle, A. L., Sun, H. Q., Wang, X. & Yin, H. L.
Regulation of apoptosis by phosphatidylinositol 4,5-bisphosphate inhibition of caspases,
and caspase inactivation of phosphatidylinositol phosphate 5-kinases. J. Biol. Chem. 276,
1865–72 (2001).
13. Yusuf, I., Zhu, X., Kharas, M. G., Chen, J. & Fruman, D. A. Optimal B-cell proliferation
requires phosphoinositide 3-kinase-dependent inactivation of FOXO transcription factors.
Blood 104, 784–7 (2004).
14. Falkenburger, B. H., Jensen, J. B., Dickson, E. J., Suh, B.-C. & Hille, B.
Phosphoinositides: lipid regulators of membrane proteins. J. Physiol. 588, 3179–85
(2010).
75
15. Pendaries, C., Tronchère, H., Plantavid, M. & Payrastre, B. Phosphoinositide signaling
disorders in human diseases. FEBS Lett. 546, 25–31 (2003).
16. Mak, L. H. in Encyclopedia of Biophysics 1286–1289 (Springer Berlin Heidelberg, 2013).
doi:10.1007/978-3-642-16712-6_537
17. Le Roy, C. & Wrana, J. L. Clathrin- and non-clathrin-mediated endocytic regulation of
cell signalling. Nat. Rev. Mol. Cell Biol. 6, 112–26 (2005).
18. Vivanco, I. & Sawyers, C. L. The phosphatidylinositol 3-Kinase AKT pathway in human
cancer. Nat. Rev. Cancer 2, 489–501 (2002).
19. VANHAESEBROECK, B. & ALESSI, D. R. The PI3K–PDK1 connection: more than just
a road to PKB. Biochem. J. 346, 561–576 (2000).
20. Engelman, J. a, Luo, J. & Cantley, L. C. The evolution of phosphatidylinositol 3-kinases
as regulators of growth and metabolism. Nat. Rev. Genet. 7, 606–619 (2006).
21. Gassama-Diagne, A., Yu, W., ter Beest, M., Martin-Belmonte, F., Kierbel, A., Engel, J. &
Mostov, K. Phosphatidylinositol-3,4,5-trisphosphate regulates the formation of the
basolateral plasma membrane in epithelial cells. Nat. Cell Biol. 8, 963–970 (2006).
22. Gual, P., Le Marchand-Brustel, Y. & Tanti, J.-F. Positive and negative regulation of
insulin signaling through IRS-1 phosphorylation. Biochimie 87, 99–109 (2005).
23. Jean, S. & Kiger, A. A. Classes of phosphoinositide 3-kinases at a glance. J. Cell Sci. 127,
923–8 (2014).
24. Scheid, M. P., Marignani, P. A. & Woodgett, J. R. Multiple phosphoinositide 3-kinase-
dependent steps in activation of protein kinase B. Mol. Cell. Biol. 22, 6247–6260 (2002).
25. Waugh, C., Sinclair, L., Finlay, D., Bayascas, J. R. & Cantrell, D. Phosphoinositide
(3,4,5)-triphosphate binding to phosphoinositide-dependent kinase 1 regulates a protein
kinase B/Akt signaling threshold that dictates T-cell migration, not proliferation. Mol.
Cell. Biol. 29, 5952–62 (2009).
26. Ma, K., Cheung, S. M., Marshall, A. J. & Duronio, V. PI(3,4,5)P3 and PI(3,4)P2 levels
correlate with PKB/akt phosphorylation at Thr308 and Ser473, respectively; PI(3,4)P2
levels determine PKB activity. Cell. Signal. 20, 684–94 (2008).
27. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B. &
Cohen, P. Characterization of a 3-phosphoinositide-dependent protein kinase which
phosphorylates and activates protein kinase Balpha. Curr. Biol. 7, 261–9 (1997).
28. Sarbassov, D. D., Guertin, D. A., Ali, S. M. & Sabatini, D. M. Phosphorylation and
regulation of Akt/PKB by the rictor-mTOR complex. Science 307, 1098–101 (2005).
29. Vadlakonda, L., Dash, A., Pasupuleti, M., Anil Kumar, K. & Reddanna, P. The Paradox of
Akt-mTOR Interactions. Front. Oncol. 3, 165 (2013).
30. Zhang, X., Tang, N., Hadden, T. J. & Rishi, A. K. Akt, FoxO and regulation of apoptosis.
Biochim. Biophys. Acta 1813, 1978–86 (2011).
76
31. Kandel, E. S., Skeen, J., Majewski, N., Di Cristofano, A., Pandolfi, P. P., Feliciano, C. S.,
Gartel, A. & Hay, N. Activation of Akt/protein kinase B overcomes a G(2)/m cell cycle
checkpoint induced by DNA damage. Mol. Cell. Biol. 22, 7831–41 (2002).
32. Carracedo, A. & Pandolfi, P. P. The PTEN-PI3K pathway: of feedbacks and cross-talks.
Oncogene 27, 5527–41 (2008).
33. Manning, B. D. & Cantley, L. C. AKT/PKB signaling: navigating downstream. Cell 129,
1261–74 (2007).
34. Altomare, D. A. & Testa, J. R. Perturbations of the AKT signaling pathway in human
cancer. 7455–7464 (2005). doi:10.1038/sj.onc.1209085
35. Pópulo, H., JMl, L. & Soares, P. The mTOR signalling pathway in human cancer. Int. J.
Mol. Sci. 13, 1886–1918 (2012).
36. Yasui, M., Matsuoka, S. & Ueda, M. PTEN hopping on the cell membrane is regulated via
a positively-charged C2 domain. PLoS Comput. Biol. 10, e1003817 (2014).
37. Liaw, D., Marsh, D. J., Li, J., Dahia, P. L., Wang, S. I., Zheng, Z., Bose, S., Call, K. M.,
Tsou, H. C., Peacocke, M., Eng, C. & Parsons, R. Germline mutations of the PTEN gene
in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat. Genet. 16, 64–7
(1997).
38. Hobert, J. A. & Eng, C. PTEN hamartoma tumor syndrome: an overview. Genet. Med. 11,
687–94 (2009).
39. Butler, M. G., Dasouki, M. J., Zhou, X.-P., Talebizadeh, Z., Brown, M., Takahashi, T. N.,
Miles, J. H., Wang, C. H., Stratton, R., Pilarski, R. & Eng, C. Subset of individuals with
autism spectrum disorders and extreme macrocephaly associated with germline PTEN
tumour suppressor gene mutations. J. Med. Genet. 42, 318–21 (2005).
40. Salmena, L., Carracedo, A. & Pandolfi, P. P. Tenets of PTEN tumor suppression. Cell
133, 403–14 (2008).
41. Sly, L. M., Rauh, M. J., Kalesnikoff, J., Büchse, T. & Krystal, G. SHIP, SHIP2, and
PTEN activities are regulated in vivo by modulation of their protein levels: SHIP is up-
regulated in macrophages and mast cells by lipopolysaccharide. Exp. Hematol. 31, 1170–
81 (2003).
42. Schurmans, S., Carrió, R., Behrends, J., Pouillon, V., Merino, J. & Clément, S. The mouse
SHIP2 (Inppl1) gene: complementary DNA, genomic structure, promoter analysis, and
gene expression in the embryo and adult mouse. Genomics 62, 260–71 (1999).
43. Scheid, M. P., Huber, M., Damen, J. E., Hughes, M., Kang, V., Neilsen, P., Prestwich, G.
D., Krystal, G. & Duronio, V. Phosphatidylinositol (3,4,5)P3 is essential but not sufficient
for protein kinase B (PKB) activation; phosphatidylinositol (3,4)P2 is required for PKB
phosphorylation at Ser-473: studies using cells from SH2-containing inositol-5-
phosphatase knockout mice. J. Biol. Chem. 277, 9027–35 (2002).
44. Sharrard, R. M. & Maitland, N. J. Regulation of Protein Kinase B activity by PTEN and
SHIP2 in human prostate-derived cell lines. Cell. Signal. 19, 129–138 (2007).
77
45. Carver, D. J., Aman, M. J. & Ravichandran, K. S. SHIP inhibits Akt activation in B cells
through regulation of Akt membrane localization. Blood 96, 1449–56 (2000).
46. Costinean, S., Sandhu, S. K., Pedersen, I. M., Tili, E., Trotta, R., Perrotti, D., Ciarlariello,
D., Neviani, P., Harb, J., Kauffman, L. R., Shidham, A. & Croce, C. M. Src homology 2
domain-containing inositol-5-phosphatase and CCAAT enhancer-binding protein beta are
targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice. Blood 114, 1374–82
(2009).
47. Lo, T. C. T., Barnhill, L. M., Kim, Y., Nakae, E. A., Yu, A. L. & Diccianni, M. B.
Inactivation of SHIP1 in T-cell acute lymphoblastic leukemia due to mutation and
extensive alternative splicing. Leuk. Res. 33, 1562–6 (2009).
48. Ooms, L. M., Binge, L. C., Davies, E. M., Rahman, P., Conway, J. R. W., Gurung, R.,
Ferguson, D. T., Papa, A., Fedele, C. G., Vieusseux, J. L., Chai, R. C., Koentgen, F.,
Price, J. T., Tiganis, T., Timpson, P., McLean, C. A. & Mitchell, C. A. The Inositol
Polyphosphate 5-Phosphatase PIPP Regulates AKT1-Dependent Breast Cancer Growth
and Metastasis. Cancer Cell 28, 155–69 (2015).
49. Inhorn, R. C., Bansal, V. S. & Majerus, P. W. Pathway for inositol 1,3,4-trisphosphate and
1,4-bisphosphate metabolism. Proc. Natl. Acad. Sci. U. S. A. 84, 2170–4 (1987).
50. Bansal, V. S., Inhorn, R. C. & Majerus, P. W. The metabolism of inositol 1,3,4-
trisphosphate to inositol 1,3-bisphosphate. J. Biol. Chem. 262, 9444–9447 (1987).
51. Bansal, V. S., Caldwell, K. K. & Majerus, P. W. The Isolation and Characterization of
Inositol Polyphosphate 4-Phosphatase. J. Biol. Chem. 265, 1806–1811 (1990).
52. Norris, F. A. & Majerus, P. W. Hydrolysis of phosphatidylinositol 3,4-bisphosphate by
inositol polyphosphate 4-phosphatase isolated by affinity elution chromatography. J. Biol.
Chem. 269, 8716–20 (1994).
53. Norris, F. A., Atkins, R. & Majerus, P. The cDNA Cloning and Characterization of
Inositol Polyphosphate 4-Phosphatase Type II. EVIDENCE FOR CONSERVED
ALTERNATIVE SPLICING IN THE 4-PHOSPHATASE FAMILY. J. Biol. Chem. 272,
23859–23864 (1997).
54. Norris, F. A., Auethavekiat, V. & Majerus, P. The isolation and characterization of cDNA
encoding human and rat brain inositol polyphosphate 4-phosphatase. J. Biol. Chem. 272,
16128–16133 (1995).
55. Pruitt, K., Brown, G., Tatusova, T. & Maglott, D. The Reference Sequence (RefSeq)
Database. (2012).
56. Joseph, R. E., Walker, J. & Norris, F. A. Assignment of the inositol polyphosphate 4-
phosphatase type I gene (INPP4A) to human chromosome band 2q11.2 by in situ
hybridization. Cytogenet. Cell Genet. 87, 276–7 (1999).
57. Fedele, C. G., Ooms, L. M., Ho, M., Vieusseux, J., O’Toole, S. a, Millar, E. K., Lopez-
Knowles, E., Sriratana, A., Gurung, R., Baglietto, L., Giles, G. G., Bailey, C. G., Rasko, J.
E. J., Shields, B. J., Price, J. T., Majerus, P. W., Sutherland, R. L., Tiganis, T., McLean, C.
a, et al. Inositol polyphosphate 4-phosphatase II regulates PI3K/Akt signaling and is lost
78
in human basal-like breast cancers. Proc. Natl. Acad. Sci. U. S. A. 107, 22231–6 (2010).
58. Ferron, M. & Vacher, J. Characterization of the murine Inpp4b gene and identification of
a novel isoform. Gene 376, 152–161 (2006).
59. Hakim, S., Bertucci, M. C., Conduit, S. E., Vuong, D. L. & Mitchell, C. A. Inositol
polyphosphate phosphatases in human disease. Curr. Top. Microbiol. Immunol. 362, 247–
314 (2012).
60. Yates, A., Akanni, W., Amode, M. R., Barrell, D., Billis, K., Carvalho-Silva, D.,
Cummins, C., Clapham, P., Fitzgerald, S., Gil, L., Girón, C. G., Gordon, L., Hourlier, T.,
Hunt, S. E., Janacek, S. H., Johnson, N., Juettemann, T., Keenan, S., Lavidas, I., et al.
Ensembl 2016. Nucleic Acids Res. 44, D710–6 (2016).
61. Cho, W. & Stahelin, R. V. Membrane binding and subcellular targeting of C2 domains.
Biochim. Biophys. Acta - Mol. Cell Biol. Lipids 1761, 838–849 (2006).
62. Liu, Y., Cheney, M. D., Gaudet, J. J., Chruszcz, M., Lukasik, S. M., Sugiyama, D., Lary,
J., Cole, J., Dauter, Z., Minor, W., Speck, N. A. & Bushweller, J. H. The tetramer
structure of the Nervy homology two domain, NHR2, is critical for AML1/ETO’s activity.
Cancer Cell 9, 249–260 (2006).
63. Mukhopadhyay, R. & Rosen, B. P. The phosphatase C(X)5R motif is required for catalytic
activity of the Saccharomyces cerevisiae Acr2p arsenate reductase. J. Biol. Chem. 276,
34738–42 (2001).
64. Lopez, S. M., Hodgson, M. C., Packianathan, C., Bingol-ozakpinar, O., Uras, F., Rosen,
B. P. & Agoulnik, I. U. Determinants of the tumor suppressor INPP4B protein and lipid
phosphatase activities. Biochem. Biophys. Res. Commun. 440, 277–282 (2013).
65. Blanchetot, C. Substrate-trapping techniques in the identification of cellular PTP targets.
Methods 35,
66. Franke, T. F., Kaplan, D. R., Cantley, L. C. & Tokert, A. Direct Regulation of the Akt
Proto-Oncogene Product by Phosphatidylinositol-3 , 4- bisphosphate Author ( s ): Thomas
F . Franke , David R . Kaplan , Lewis C . Cantley and Alex Toker Published by :
American Association for the Advancement of Science Stable. 275, 665–668 (2016).
67. Marshall, A. J., Krahn, A. K., Ma, K., Duronio, V. & Hou, S. TAPP1 and TAPP2 Are
Targets of Phosphatidylinositol 3-Kinase Signaling in B Cells: Sustained Plasma
Membrane Recruitment Triggered by the B-Cell Antigen Receptor. Mol. Cell. Biol. 22,
5479–5491 (2002).
68. Gewinner, C., Wang, Z. C., Richardson, A., Teruya-Feldstein, J., Etemadmoghadam, D.,
Bowtell, D., Barretina, J., Lin, W. M., Rameh, L., Salmena, L., Pandolfi, P. P. & Cantley,
L. C. Evidence that inositol polyphosphate 4-phosphatase type II is a tumor suppressor
that inhibits PI3K signaling. Cancer Cell 16, 115–25 (2009).
69. Salmena, L., Shaw, P., Fans, I., McLaughlin, Rosen, B., Risch, H., Mitchell, C., Sun, P.,
Narod, S. A. & Kotsopoulos, J. Prognostic value of INPP4B protein
immunohistochemistry in ovarian cancer. Eur. J. Gynaecol. Oncol. 36, 260–7 (2015).
79
70. Chew, C. L., Lunardi, A., Gulluni, F., Ruan, D. T., Chen, M., Salmena, L., Nishino, M.,
Papa, A., Ng, C., Fung, J., Clohessy, J. G., Sasaki, J., Sasaki, T., Bronson, R. T., Hirsch,
E. & Pandolfi, P. P. In vivo role of INPP4B in tumor and metastasis suppression through
regulation of PI3K/AKT signaling at endosomes. Cancer Discov. 740–752 (2015).
doi:10.1158/2159-8290.CD-14-1347
71. Stjernström, A., Karlsson, C., Fernandez, O. J., Söderkvist, P., Karlsson, M. G. & Thunell,
L. K. Alterations of INPP4B, PIK3CA and pAkt of the PI3K pathway are associated with
squamous cell carcinoma of the lung. Cancer Med. 3, 337–48 (2014).
72. Sasaki, J., Kofuji, S., Itoh, R., Momiyama, T., Takayama, K., Murakami, H., Chida, S.,
Tsuya, Y., Takasuga, S., Eguchi, S., Asanuma, K., Horie, Y., Miura, K., Davies, E. M.,
Mitchell, C., Yamazaki, M., Hirai, H., Takenawa, T., Suzuki, A., et al. The
PtdIns(3,4)P(2) phosphatase INPP4A is a suppressor of excitotoxic neuronal death. Nature
465, 497–501 (2010).
73. Sachs, A. J., David, S. a, Haider, N. B. & Nystuen, A. M. Patterned neuroprotection in the
Inpp4a(wbl) mutant mouse cerebellum correlates with the expression of Eaat4. PLoS One
4, e8270 (2009).
74. Ivetac, I., Munday, A. D., Kisseleva, M. V., Zhang, X.-M., Luff, S., Tiganis, T.,
Whisstock, J. C., Rowe, T., Majerus, P. W. & Mitchell, C. A. The Type I Inositol
Polyphosphate 4-Phosphatase Generates and Terminates Phosphoinositide 3-Kinase
Signals on Endosomes and the Plasma Membrane. Mol. Biol. Cell 16, 2218–2233 (2005).
75. Ferron, M., Boudiffa, M., Arsenault, M., Rached, M., Pata, M., Giroux, S., Elfassihi, L.,
Kisseleva, M., Majerus, P. W., Rousseau, F., Vacher, J., Asagiri, M., Sato, K., Usami, T.,
Ochi, S., Nishina, H., Yoshida, H., Morita, I., Wagner, E. F., et al. Inositol polyphosphate
4-phosphatase B as a regulator of bone mass in mice and humans. Cell Metab. 14, 466–77
(2011).
76. Lemcke, S., Müller, S., Möller, S., Schillert, A., Ziegler, A., Cepok-Kauffeld, S.,
Comabella, M., Montalban, X., Rülicke, T., Nandakumar, K. S., Hemmer, B., Holmdahl,
R., Pahnke, J., Ibrahim, S. M., Fernandez, V., Valls-Sole, J., Relova, J. L., Raguer, N.,
Miralles, F., et al. Nerve conduction velocity is regulated by the inositol polyphosphate-4-
phosphatase II gene. Am. J. Pathol. 184, 2420–9 (2014).
77. Ji, L., Kim, N.-H., Huh, S.-O. & Rhee, and H. J. Depletion of Inositol Polyphosphate 4-
Phosphatase II Suppresses Callosal Axon Formation in the Developing Mice. Mol. Cells
39, 501–507 (2016).
78. Westbrook, T. F., Martin, E. S., Schlabach, M. R., Leng, Y., Liang, A. C., Feng, B., Zhao,
J. J., Roberts, T. M., Mandel, G., Hannon, G. J., Depinho, R. a, Chin, L. & Elledge, S. J. A
genetic screen for candidate tumor suppressors identifies REST. Cell 121, 837–48 (2005).
79. Barnache, S., Le Scolan, E., Kosmider, O., Denis, N. & Moreau-Gachelin, F.
Phosphatidylinositol 4-phosphatase type II is an erythropoietin-responsive gene.
Oncogene 25, 1420–3 (2006).
80. Naylor, T. L., Greshock, J., Wang, Y., Colligon, T., Yu, Q. C., Clemmer, V., Zaks, T. Z.
& Weber, B. L. High resolution genomic analysis of sporadic breast cancer using array-
80
based comparative genomic hybridization. Breast Cancer Res. 7, R1186–98 (2005).
81. TCGA. Comprehensive molecular portraits of human breast tumours. Nature 490, 61–70
(2012).
82. Hodgson, M. C., Shao, L., Frolov, A., Li, R., Peterson, L. E., Ayala, G., Ittmann, M. M.,
Weigel, N. L. & Agoulnik, I. U. Decreased expression and androgen regulation of the
tumor suppressor gene INPP4B in prostate cancer. Cancer Res. 71, 572–82 (2011).
83. Rynkiewicz, N. K., Fedele, C. G., Chiam, K., Gupta, R., Kench, J. G., Ooms, L. M.,
McLean, C. a, Giles, G. G., Horvath, L. G. & Mitchell, C. a. INPP4B is highly expressed
in prostate intermediate cells and its loss of expression in prostate carcinoma predicts for
recurrence and poor long term survival. Prostate (2014). doi:10.1002/pros.22895
84. Hodgson, M. C., Deryugina, E. I., Suarez, E., Lopez, S. M., Lin, D., Xue, H., Gorlov, I. P.,
Wang, Y., Agoulnik, I. U., Thurairaja, R., McFarlane, J., Traill, Z., Persad, R., Morgan,
T., Lange, P., Porter, M., Lin, D., Ellis, W., Gallaher, I., et al. INPP4B suppresses prostate
cancer cell invasion. Cell Commun. Signal. 12, 61 (2014).
85. Perez-Lorenzo, R., Gill, K. Z., Shen, C.-H., Zhao, F. X., Zheng, B., Schulze, H.-J.,
Silvers, D. N., Brunner, G., Horst, B. A., Balch, C. M., Gershenwald, J. E., Soong, S. J.,
al., et, Cantley, L. C., Chin, L., Garraway, L. A., Fisher, D. E., Clement, S., Krause, U., et
al. A Tumor Suppressor Function for the Lipid Phosphatase INPP4B in Melanocytic
Neoplasms. J. Invest. Dermatol. 134, 1359–1368 (2014).
86. Hsu, I., Yeh, C.-R., Slavin, S., Miyamoto, H., Netto, G., Tsai, Y.-C., Muyan, M., Wu, X.-
R., Yeh, S., Hsu, I., Yeh, C.-R., Slavin, S., Miyamoto, H., Netto, G., Tsai, Y.-C., Muyan,
M., Wu, X.-R. & Yeh, S. Estrogen receptor alpha prevents bladder cancer via INPP4B
inhibited akt pathway in vitro and in vivo. Oncotarget 5, 7917–7935 (2014).
87. Yuen, J. W.-F., Chung, G. T.-Y., Lun, S. W.-M., Cheung, C. C.-M., To, K.-F., Lo, K.-W.,
Manning, B., Cantley, B., Engelman, J., Liu, P., Cheng, H., Roberts, T., Zhao, J., Bertucci,
M., Mitchell, C., Gewinner, C., Wang, Z., Richardson, A., Teruya-Feldstein, J., et al.
Epigenetic Inactivation of Inositol polyphosphate 4-phosphatase B (INPP4B), a Regulator
of PI3K/AKT Signaling Pathway in EBV-Associated Nasopharyngeal Carcinoma. PLoS
One 9, e105163 (2014).
88. Kim, J.-S., Yun, H. S., Um, H.-D., Park, J. K., Lee, K.-H., Kang, C.-M., Lee, S.-J. &
Hwang, S.-G. Identification of inositol polyphosphate 4-phosphatase type II as a novel
tumor resistance biomarker in human laryngeal cancer HEp-2 cells. Cancer Biol. Ther. 13,
1307–18 (2012).
89. Min, J. W., Kim, K. Il, Kim, H.-A., Kim, E.-K., Noh, W. C., Jeon, H. B., Cho, D.-H., Oh,
J. S., Park, I.-C., Hwang, S.-G. & Kim, J.-S. INPP4B-mediated tumor resistance is
associated with modulation of glucose metabolism via hexokinase 2 regulation in
laryngeal cancer cells. Biochem. Biophys. Res. Commun. 2–7 (2013).
doi:10.1016/j.bbrc.2013.09.041
90. Ross, M. E., Zhou, X., Song, G., Shurtleff, S. A., Girtman, K., Williams, W. K., Liu, H.-
C., Mahfouz, R., Raimondi, S. C., Lenny, N., Patel, A. & Downing, J. R. Classification of
pediatric acute lymphoblastic leukemia by gene expression profiling. Blood 102, 2951–9
81
(2003).
91. Dzneladze, I., He, R., Woolley, J. F., Son, M. H., Sharobim, M. H., Greenberg, S. A.,
Gabra, M., Langlois, C., Rashid, A., Hakem, A., Ibrahimova, N., Arruda, A., Löwenberg,
B., Valk, P. J. M., Minden, M. D. & Salmena, L. INPP4B overexpression is associated
with poor clinical outcome and therapy resistance in acute myeloid leukemia. Leukemia
29, 1485–95 (2015).
92. Rijal, S., Fleming, S., Cummings, N., Rynkiewicz, N. K., Ooms, L. M., Nguyen, N.-Y. N.,
Teh, T.-C., Avery, S., McManus, J. F., Papenfuss, A. T., McLean, C., Guthridge, M. A.,
Mitchell, C. A. & Wei, A. H. Inositol polyphosphate 4-phosphatase II (INPP4B) is
associated with chemoresistance and poor outcome in AML. Blood 125, 2815–24 (2015).
93. Vasudevan, K. M., Barbie, D. A., Davies, M. A., Rabinovsky, R., McNear, C. J., Kim, J.
J., Hennessy, B. T., Tseng, H., Pochanard, P., Kim, S. Y., Dunn, I. F., Schinzel, A. C.,
Sandy, P., Hoersch, S., Sheng, Q., Gupta, P. B., Boehm, J. S., Reiling, J. H., Silver, S., et
al. AKT-independent signaling downstream of oncogenic PIK3CA mutations in human
cancer. Cancer Cell 16, 21–32 (2009).
94. Tessier, M. & Woodgett, J. R. Serum and glucocorticoid-regulated protein kinases:
Variations on a theme. J. Cell. Biochem. 98, 1391–1407 (2006).
95. Gasser, J. A., Inuzuka, H., Lau, A. W., Wei, W., Beroukhim, R. & Toker, A. SGK3
Mediates INPP4B-Dependent PI3K Signaling in Breast Cancer. Mol. Cell 1–13 (2014).
doi:10.1016/j.molcel.2014.09.023
96. Gasser, J. A., Inuzuka, H., Lau, A. W., Wei, W., Beroukhim, R. & Toker, A. SGK3
Mediates INPP4B-Dependent PI3K Signaling in Breast Cancer. Mol. Cell 56, 595–607
(2014).
97. Guo, S. T., Chi, M. N., Yang, R. H., Guo, X. Y., Zan, L. K., Wang, C. Y., Xi, Y. F., Jin,
L., Croft, A., Tseng, H.-Y., Yan, X. G., Farrelly, M., Wang, F. H., Lai, F., Wang, J. F., Li,
Y. P., Ackland, S., Scott, R., Agoulnik, I. U., et al. INPP4B is an oncogenic regulator in
human colon cancer. Oncogene 1–13 (2015). doi:10.1038/onc.2015.361
98. Ross, A. & Gericke, A. Phosphorylation keeps PTEN phosphatase closed for business.
Proc. Natl. Acad. Sci. U. S. A. 106, 1297–8 (2009).
99. Vazquez, F., Ramaswamy, S., Nakamura, N. & Sellers, W. R. Phosphorylation of the
PTEN Tail Regulates Protein Stability and Function. Mol. Cell. Biol. 20, 5010–5018
(2000).
100. Fragoso, R. & Barata, J. T. Kinases, tails and more: Regulation of PTEN function by
phosphorylation. Methods 77, 75–81 (2015).
101. Chi, M. N., Guo, S. T., Wilmott, J. S., Guo, X. Y., Yan, X. G., Wang, C. Y., Liu, X. Y.,
Jin, L., Tseng, H.-Y., Liu, T., Croft, A., Hondermarck, H., Scolyer, R. A., Jiang, C. C.,
Zhang, X. D., Chi, M. N., Tang Guo, S., Wilmott, J. S., Yun Guo, X., et al. INPP4B is
upregulated and functions as an oncogenic driver through SGK3 in a subset of
melanomas. Oncotarget 6, 39891–39907 (2015).
102. Siggs, O. M., Smart, N. G. & Beutler, B. Record for woolly, updated May 13, 2016. at
82
<mutagenetix.utsouthwestern.edu>
103. Hodgson, M. C., Deryugina, E. I., Suarez, E., Lopez, S. M., Lin, D., Xue, H., Gorlov, I. P.,
Wang, Y. & Agoulnik, I. U. INPP4B suppresses prostate cancer cell invasion. Cell
Commun. Signal. 12, 61 (2014).
104. Rynkiewicz, N. K. INPP4B is highly expressed in prostate intermediate cells and its loss
of expression in prostate carcinoma predicts for recurrence and poor long term survival.
75,
105. Min, J. W., Kim, K. Il, Kim, H.-A., Kim, E.-K., Noh, W. C., Jeon, H. B., Cho, D.-H., Oh,
J. S., Park, I.-C., Hwang, S.-G. & Kim, J.-S. INPP4B-mediated tumor resistance is
associated with modulation of glucose metabolism via hexokinase 2 regulation in
laryngeal cancer cells. Biochem. Biophys. Res. Commun. 440, 137–42 (2013).
106. Chi, M. N., Guo, S. T., Wilmott, J. S., Guo, X. Y., Yan, X. G., Wang, C. Y., Ying Liu, X.,
Jin, L., Tseng, H.-Y., Liu, T., Croft, A., Hondermarck, H., Scolyer, R. A., Jiang, C. C. &
Zhang, X. D. INPP4B is upregulated and functions as an oncogenic driver through SGK3
in a subset of melanomas. Oncotarget 6, 39891–39907 (2015).
107. Dzneladze, I., He, R., Woolley, J. F., Son, M. H., Sharobim, M. H., Greenberg, S. A.,
Gabra, M., Langlois, C., Rashid, A., Hakem, A., Ibrahimova, N., Arruda, A., Löwenberg,
B., Valk, P. J. M., Minden, M. D. & Salmena, L. INPP4B overexpression is associated
with poor clinical outcome and therapy resistance in acute myeloid leukemia. Leukemia
29, 1485–1495 (2015).
108. Shipley, J. L. & Butera, J. N. Acute myelogenous leukemia. Exp. Hematol. 37, 649–658
(2009).
109. Estey, E. & Döhner, H. Acute myeloid leukaemia. Lancet 368, 1894–907 (2006).
110. Jemal, A., Siegel, R., Ward, E., Murray, T., Xu, J. & Thun, M. J. Cancer statistics, 2007.
CA. Cancer J. Clin. 57, 43–66
111. Deschler, B. & Lübbert, M. Acute myeloid leukemia: Epidemiology and etiology. Cancer
107, 2099–2107 (2006).
112. Döhner, H., Estey, E. H. E., Amadori, S., Appelbaum, F. R. F. R., Büchner, T., Burnett, A.
K. a. K., Dombret, H., Fenaux, P., Grimwade, D., Larson, R. a. R. A., Lo-Coco, F., Naoe,
T., Niederwieser, D., Ossenkoppele, G. J., Sanz, M. A., Sierra, J., Tallman, M. S.,
Löwenberg, B., Bloomfield, C. D., et al. Diagnosis and management of acute myeloid
leukemia in adults: recommendations from an international expert panel, on behalf of the
European LeukemiaNet. Blood 115, 453–474 (2010).
113. Estey, E. & Döhner, H. Acute myeloid leukaemia. Lancet 368, 1894–907 (2006).
114. Löwenberg, B., Griffin, J. D. & Tallman, M. S. Acute myeloid leukemia and acute
promyelocytic leukemia. Hematology Am. Soc. Hematol. Educ. Program 82–101 (2003).
at <http://www.ncbi.nlm.nih.gov/pubmed/14633778>
115. Gewirtz, D. A. A critical evaluation of the mechanisms of action proposed for the
antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochem.
83
Pharmacol. 57, 727–741 (1999).
116. Burden, D. A. & Osheroff, N. Mechanism of action of eukaryotic topoisomerase II and
drugs targeted to the enzyme. Biochim. Biophys. Acta - Gene Struct. Expr. 1400, 139–154
(1998).
117. Willmore, E., de Caux, S., Sunter, N. J., Tilby, M. J., Jackson, G. H., Austin, C. A. &
Durkacz, B. W. A novel DNA-dependent protein kinase inhibitor, NU7026, potentiates
the cytotoxicity of topoisomerase II poisons used in the treatment of leukemia. Blood 103,
4659–65 (2004).
118. Kaina, B. DNA damage-triggered apoptosis: critical role of DNA repair, double-strand
breaks, cell proliferation and signaling. Biochem. Pharmacol. 66, 1547–1554 (2003).
119. Savani, B. N., Mielke, S., Reddy, N., Goodman, S., Jagasia, M. & Rezvani, K.
Management of relapse after allo-SCT for AML and the role of second transplantation.
Bone Marrow Transplant. 44, 769–777 (2009).
120. Kell, J. Emerging treatments in acute myeloid leukaemia. Expert Opin. Emerg. Drugs 9,
55–71 (2004).
121. Lapidot, T., Sirard, C., Vormoor, J., Murdoch, B., Hoang, T., Caceres-Cortes, J., Minden,
M., Paterson, B., Caligiuri, M. A. & Dick, J. E. A cell initiating human acute myeloid
leukaemia after transplantation into SCID mice. Nature 367, 645–8 (1994).
122. Grandage, V. L., Gale, R. E., Linch, D. C. & Khwaja, A. PI3-kinase/Akt is constitutively
active in primary acute myeloid leukaemia cells and regulates survival and
chemoresistance via NF-kappaB, Mapkinase and p53 pathways. Leukemia 19, 586–94
(2005).
123. Xu, Q., Simpson, S.-E., Scialla, T. J., Bagg, A. & Carroll, M. Survival of acute myeloid
leukemia cells requires PI3 kinase activation. Blood 102, 972–80 (2003).
124. Kornblau, S. M., Womble, M., Qiu, Y. H., Jackson, C. E., Chen, W., Konopleva, M.,
Estey, E. H. & Andreeff, M. Simultaneous activation of multiple signal transduction
pathways confers poor prognosis in acute myelogenous leukemia. Blood 108, 2358–65
(2006).
125. Zhao, S., Konopleva, M., Cabreira-Hansen, M., Xie, Z., Hu, W., Milella, M., Estrov, Z.,
Mills, G. B. & Andreeff, M. Inhibition of phosphatidylinositol 3-kinase dephosphorylates
BAD and promotes apoptosis in myeloid leukemias. Leukemia 18, 267–75 (2004).
126. Sandhöfer, N., Metzeler, K. H., Rothenberg, M., Herold, T., Tiedt, S., Groiß, V., Carlet,
M., Walter, G., Hinrichsen, T., Wachter, O., Grunert, M., Schneider, S., Subklewe, M.,
Dufour, a, Fröhling, S., Klein, H.-G., Hiddemann, W., Jeremias, I. & Spiekermann, K.
Dual PI3K/mTOR inhibition shows antileukemic activity in MLL-rearranged acute
myeloid leukemia. Leukemia 1–11 (2014). doi:10.1038/leu.2014.305
127. Park, S., Chapuis, N., Tamburini, J., Bardet, V., Cornillet-Lefebvre, P., Willems, L.,
Green, A., Mayeux, P., Lacombe, C. & Bouscary, D. Role of the PI3K/AKT and mTOR
signaling pathways in acute myeloid leukemia. Haematologica 95, 819–28 (2010).
84
128. Levis, M. FLT3 mutations in acute myeloid leukemia: what is the best approach in 2013?
Hematology Am. Soc. Hematol. Educ. Program 2013, 220–226 (2013).
129. Grossmann, V., Schnittger, S., Poetzinger, F., Kohlmann, A., Stiel, A., Eder, C., Fasan,
A., Kern, W., Haferlach, T. & Haferlach, C. High incidence of RAS signalling pathway
mutations in MLL-rearranged acute myeloid leukemia. Leukemia 27, 1933–6 (2013).
130. Lavallée, V.-P., Baccelli, I., Krosl, J., Wilhelm, B., Barabé, F., Gendron, P., Boucher, G.,
Lemieux, S., Marinier, A., Meloche, S., Hébert, J. & Sauvageau, G. The transcriptomic
landscape and directed chemical interrogation of MLL-rearranged acute myeloid
leukemias. Nat. Genet. 47, 1030–7 (2015).
131. Kampen, K., Ter Elst, A., Mahmud, H., Scherpen, F., Diks, S., Peppelenbosch, M., De
Haas, V., Guryev, V. & De Bont, E. Insights in dynamic kinome reprogramming as a
consequence of MEK inhibition in MLL-rearranged AML. Leukemia 28, 589–599 (2013).
132. Levine, B. & Kroemer, G. Autophagy in the Pathogenesis of Disease. Cell 132, 27–42
(2008).
133. Mizushima, N., Levine, B., Cuervo, A. M. & Klionsky, D. J. Autophagy fights disease
through cellular self-digestion. Nature 451, 1069–1075 (2008).
134. Li, W. W., Li, J. & Bao, J. K. Microautophagy: Lesser-known self-eating. Cell. Mol. Life
Sci. 69, 1125–1136 (2012).
135. Mortimore, G. E., Lardeux, B. R. & Adams, C. E. Regulation of microautophagy and
basal protein turnover in rat liver. Effects of short-term starvation. J. Biol. Chem. 263,
2506–12 (1988).
136. Mijaljica, D., Prescott, M. & Devenish, R. J. Microautophagy in mammalian cells:
Revisiting a 40-year-old conundrum. Autophagy 7, 673–682 (2011).
137. Knecht, E. & Salvador, N. Chaperone-Mediated Autophagy. (Landes Bioscience). at
<http://www.ncbi.nlm.nih.gov/books/NBK6036/>
138. Dice, J. F., Chiang, H. L., Spencer, E. P. & Backer, J. M. Regulation of catabolism of
microinjected ribonuclease A. Identification of residues 7-11 as the essential pentapeptide.
J. Biol. Chem. 261, 6853–9 (1986).
139. Bejarano, E. & Cuervo, A. M. Chaperone-Mediated Autophagy. 34, (Landes Bioscience,
2010).
140. Fred Dice, J. Peptide sequences that target cytosolic proteins for lysosomal proteolysis.
Trends Biochem. Sci. 15, 305–309 (1990).
141. Boya, P., Reggiori, F. & Codogno, P. Emerging regulation and functions of autophagy.
Nat. Cell Biol. 15, 713–720 (2013).
142. Li, L., Chen, Y. & Gibson, S. B. Starvation-induced autophagy is regulated by
mitochondrial reactive oxygen species leading to AMPK activation. Cell. Signal. 25, 50–
65 (2013).
143. Tooze, S. A. & Yoshimori, T. The origin of the autophagosomal membrane. Nat. Cell
85
Biol. 12, 831–835 (2010).
144. Burman, C. & Ktistakis, N. T. Regulation of autophagy by phosphatidylinositol 3-
phosphate. FEBS Lett. 584, 1302–12 (2010).
145. Roberts, R. & Ktistakis, N. T. Omegasomes: PI3P platforms that manufacture
autophagosomes. Essays Biochem. 55, 17–27 (2013).
146. Axe, E. L., Walker, S. A., Manifava, M., Chandra, P., Roderick, H. L., Habermann, A.,
Griffiths, G. & Ktistakis, N. T. Autophagosome formation from membrane compartments
enriched in phosphatidylinositol 3-phosphate and dynamically connected to the
endoplasmic reticulum. J. Cell Biol. 182, 685–701 (2008).
147. Klionsky DJ, Abdelmohsen K, Abe A, Abedin MJ, Abeliovich H, Acevedo Arozena A,
Adachi H, Adams CM, Adams PD, Adeli K, Adhihetty PJ, Adler SG, Agam G, Agarwal
R, Aghi MK, Agnello M, Agostinis P, Aguilar PV, Aguirre-Ghiso J, Airoldi EM, Ait-Si-
Ali S, Akemat, Z. S. Guidelines for use and interpretation of assays for monitoring
autophagy (3rd edition). Autophagy 12, 1–222 (2016).
148. Barth, S., Glick, D. & Macleod, K. F. Autophagy: Assays and artifacts. J. Pathol. 221,
117–124 (2010).
149. Mizushima, N., Yoshimori, T. & Levine, B. Methods in mammalian autophagy research.
Cell 140, 313–26 (2010).
150. Thorburn, A., Thamm, D. H. & Gustafson, D. L. Autophagy and Cancer Therapy. Mol.
Pharmacol. 85, 830–838 (2014).
151. Juhasz, G. Interpretation of bafilomycin, pH neutralizing or protease inhibitor treatments
in autophagic flux experiments: Novel considerations. Autophagy 8, 1875–1876 (2012).
152. Kaur, J. & Debnath, J. Autophagy at the crossroads of catabolism and anabolism. Nat.
Rev. Mol. Cell Biol. 16, 461–472 (2015).
153. Hardie, D. G. AMP-activated/SNF1 protein kinases: conserved guardians of cellular
energy. Nat. Rev. Mol. Cell Biol. 8, 774–785 (2007).
154. Gwinn, D. M., Shackelford, D. B., Egan, D. F., Mihaylova, M. M., Mery, A., Vasquez, D.
S., Turk, B. E. & Shaw, R. J. AMPK Phosphorylation of Raptor Mediates a Metabolic
Checkpoint. Mol. Cell 30, 214–226 (2008).
155. Kim, J., Kundu, M., Viollet, B. & Guan, K.-L. AMPK and mTOR regulate autophagy
through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141 (2011).
156. Vander Haar, E., Lee, S.-I., Bandhakavi, S., Griffin, T. J. & Kim, D.-H. Insulin signalling
to mTOR mediated by the Akt/PKB substrate PRAS40. Nat. Cell Biol. 9, 316–23 (2007).
157. Jung, C. H., Ro, S.-H., Cao, J., Otto, N. M. & Kim, D.-H. mTOR regulation of autophagy.
FEBS Lett. 584, 1287–95 (2010).
158. Chan, E. Y. W., Kir, S. & Tooze, S. A. siRNA screening of the kinome identifies ULK1
as a multidomain modulator of autophagy. J. Biol. Chem. 282, 25464–74 (2007).
86
159. Russell, R. C., Tian, Y., Yuan, H., Park, H. W., Chang, Y.-Y., Kim, J., Kim, H., Neufeld,
T. P., Dillin, A. & Guan, K.-L. ULK1 induces autophagy by phosphorylating Beclin-1 and
activating VPS34 lipid kinase. Nat. Cell Biol. 15, 741–50 (2013).
160. Burman, C. & Ktistakis, N. T. Regulation of autophagy by phosphatidylinositol 3-
phosphate. FEBS Lett. 584, 1302–1312 (2010).
161. Simonsen, A. & Tooze, S. A. Coordination of membrane events during autophagy by
multiple class III PI3-kinase complexes. J. Cell Biol. 186, 773–782 (2009).
162. Blommaart, E. F., Krause, U., Schellens, J. P., Vreeling-Sindelárová, H. & Meijer, A. J.
The phosphatidylinositol 3-kinase inhibitors wortmannin and LY294002 inhibit autophagy
in isolated rat hepatocytes. Eur. J. Biochem. 243, 240–6 (1997).
163. Obara, K., Noda, T., Niimi, K. & Ohsumi, Y. Transport of phosphatidylinositol 3-
phosphate into the vacuole via autophagic membranes in Saccharomyces cerevisiae.
Genes Cells 13, 537–47 (2008).
164. Juhász, G., Hill, J. H., Yan, Y., Sass, M., Baehrecke, E. H., Backer, J. M. & Neufeld, T. P.
The class III PI(3)K Vps34 promotes autophagy and endocytosis but not TOR signaling in
Drosophila. J. Cell Biol. 181, 655–66 (2008).
165. Aita, V. M., Liang, X. H., Murty, V. V. V. S., Pincus, D. L., Yu, W., Cayanis, E.,
Kalachikov, S., Gilliam, T. C. & Levine, B. Cloning and Genomic Organization of Beclin
1, a Candidate Tumor Suppressor Gene on Chromosome 17q21. Genomics 59, 59–65
(1999).
166. Yue, Z., Jin, S., Yang, C., Levine, A. J. & Heintz, N. Beclin 1, an autophagy gene
essential for early embryonic development, is a haploinsufficient tumor suppressor. Proc.
Natl. Acad. Sci. U. S. A. 100, 15077–82 (2003).
167. Takamura, A., Komatsu, M., Hara, T., Sakamoto, A., Kishi, C., Waguri, S., Eishi, Y.,
Hino, O., Tanaka, K. & Mizushima, N. Autophagy-deficient mice develop multiple liver
tumors. Genes Dev. 25, 795–800 (2011).
168. Chen, Y., Lu, Y., Lu, C. & Zhang, L. Beclin-1 expression is a predictor of clinical
outcome in patients with esophageal squamous cell carcinoma and correlated to hypoxia-
inducible factor (HIF)-1alpha expression. Pathol. Oncol. Res. 15, 487–93 (2009).
169. Rabinowitz, J. D. & White, E. Autophagy and metabolism. Science 330, 1344–8 (2010).
170. Karantza-Wadsworth, V., Patel, S., Kravchuk, O., Chen, G., Mathew, R., Jin, S. & White,
E. Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis.
Genes Dev. 21, 1621–35 (2007).
171. Kundu, M., Lindsten, T., Yang, C.-Y., Wu, J., Zhao, F., Zhang, J., Selak, M. A., Ney, P.
A. & Thompson, C. B. Ulk1 plays a critical role in the autophagic clearance of
mitochondria and ribosomes during reticulocyte maturation. Blood 112, 1493–502 (2008).
172. Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: The next generation. Cell 144, 646–
674 (2011).
87
173. White, E. The Role for Autophagy in Cancer. 125, 42–46 (2015).
174. Guo, J. Y., Chen, H.-Y., Mathew, R., Fan, J., Strohecker, A. M., Karsli-Uzunbas, G.,
Kamphorst, J. J., Chen, G., Lemons, J. M. S., Karantza, V., Coller, H. A., Dipaola, R. S.,
Gelinas, C., Rabinowitz, J. D. & White, E. Activated Ras requires autophagy to maintain
oxidative metabolism and tumorigenesis. Genes Dev. 25, 460–70 (2011).
175. Yang, S., Wang, X., Contino, G., Liesa, M., Sahin, E., Ying, H., Bause, A., Li, Y.,
Stomme, J. M., Dell’Antonio, G., Mautner, J., Tonon, G., Haigis, M., Shirihai, O. S.,
Doglioni, C., Bardeesy, N. & Kimmelman, A. C. Pancreatic cancers require autophagy for
tumor growth. Genes Dev. 25, 717–729 (2011).
176. Sehgal, A. R., Konig, H., Johnson, D. E., Tang, D., Amaravadi, R. K., Boyiadzis, M. &
Lotze, M. T. You eat what you are: autophagy inhibition as a therapeutic strategy in
leukemia. Leukemia 29, 517–25 (2015).
177. Chittaranjan, S., Bortnik, S., Dragowska, W. H., Xu, J., Abeysundara, N., Leung, A., Go,
N. E., DeVorkin, L., Weppler, S. A., Gelmon, K., Yapp, D. T., Bally, M. B. & Gorski, S.
M. Autophagy inhibition augments the anticancer effects of epirubicin treatment in
anthracycline-sensitive and -resistant triple-negative breast cancer. Clin. Cancer Res. 20,
3159–73 (2014).
178. Selvakumaran, M., Amaravadi, R. K., Vasilevskaya, I. A. & O’Dwyer, P. J. Autophagy
inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin.
Cancer Res. 19, 2995–3007 (2013).
179. Ma, X.-H., Piao, S.-F., Dey, S., Mcafee, Q., Karakousis, G., Villanueva, J., Hart, L. S.,
Levi, S., Hu, J., Zhang, G., Lazova, R., Klump, V., Pawelek, J. M., Xu, X., Xu, W.,
Schuchter, L. M., Davies, M. A., Herlyn, M., Winkler, J., et al. Targeting ER stress–
induced autophagy overcomes BRAF inhibitor resistance in melanoma. J. Clin. Invest.
124, 1406–1417 (2014).
180. Wang, J. & Wu, G. S. Role of Autophagy in Cisplatin Resistance in Ovarian Cancer Cells.
J. Biol. Chem. 289, 17163–17173 (2014).
181. Wilson, A., Laurenti, E., Oser, G., van der Wath, R. C., Blanco-Bose, W., Jaworski, M.,
Offner, S., Dunant, C. F., Eshkind, L., Bockamp, E., Lió, P., Macdonald, H. R., Trumpp,
A., Adolfsson, J., Borge, O. J., Bryder, D., Theilgaard-Monch, K., Astrand-Grundstrom,
I., Sitnicka, E., et al. Hematopoietic stem cells reversibly switch from dormancy to self-
renewal during homeostasis and repair. Cell 135, 1118–29 (2008).
182. Guan, J., Simon, A. K., Prescott, M., Menendez, J. A., Wang, F., Wang, C., Wolvetang,
E., Vazquez-martin, A., Simon, A. K., Prescott, M., Menendez, J. A., Wang, F., Wang, C.,
Wolvetang, E., Vazquez-martin, A., Zhang, J., Guan, J., Simon, A. K., Prescott, M., et al.
Autophagy in stem cells. 8627, 830–849 (2015).
183. Mortensen, M., Soilleux, E. J., Djordjevic, G., Tripp, R., Lutteropp, M., Sadighi-Akha, E.,
Stranks, A. J., Glanville, J., Knight, S., W. Jacobsen, S.-E., Kranc, K. R. & Simon, A. K.
The autophagy protein Atg7 is essential for hematopoietic stem cell maintenance. J. Exp.
Med. 208, 455–467 (2011).
88
184. Warr, M. R., Binnewies, M., Flach, J., Reynaud, D., Garg, T., Malhotra, R., Debnath, J. &
Passegué, E. FOXO3A directs a protective autophagy program in haematopoietic stem
cells. Nature 494, 323–7 (2013).
185. Kang, Y.-A., Sanalkumar, R., O’Geen, H., Linnemann, A. K., Chang, C.-J., Bouhassira, E.
E., Farnham, P. J., Keles, S. & Bresnick, E. H. Autophagy driven by a master regulator of
hematopoiesis. Mol. Cell. Biol. 32, 226–39 (2012).
186. Willems, L., Chapuis, N., Puissant, A., Maciel, T. T., Green, A. S., Jacque, N., Vignon,
C., Park, S., Guichard, S., Herault, O., Fricot, A., Hermine, O., Moura, I. C., Auberger, P.,
Ifrah, N., Dreyfus, F., Bonnet, D., Lacombe, C., Mayeux, P., et al. The dual mTORC1 and
mTORC2 inhibitor AZD8055 has anti-tumor activity in acute myeloid leukemia.
Leukemia 26, 1195–202 (2012).
187. Willems, L., Jacque, N., Jacquel, A., Neveux, N., Maciel, T. T., Schmitt, A., Poulain, L.,
Green, A. S., Uzunov, M., Kosmider, O., Moura, I. C., Auberger, P., Ifrah, N., Bardet, V.,
Chapuis, N., Lacombe, C., Mayeux, P., Tamburini, J., Bouscary, D., et al. Inhibiting
glutamine uptake represents an attractive new strategy for treating acute myeloid leukemia
Inhibiting glutamine uptake represents an attractive new strategy for treating acute
myeloid leukemia. 122, 3521–3532 (2013).
188. de Thé, H. & Chen, Z. Acute promyelocytic leukaemia: novel insights into the
mechanisms of cure. Nat. Rev. Cancer 10, 775–83 (2010).
189. Shen, Z.-X., Shi, Z.-Z., Fang, J., Gu, B.-W., Li, J.-M., Zhu, Y.-M., Shi, J.-Y., Zheng, P.-
Z., Yan, H., Liu, Y.-F., Chen, Y., Shen, Y., Wu, W., Tang, W., Waxman, S., De Thé, H.,
Wang, Z.-Y., Chen, S.-J. & Chen, Z. All-trans retinoic acid/As2O3 combination yields a
high quality remission and survival in newly diagnosed acute promyelocytic leukemia.
Proc. Natl. Acad. Sci. U. S. A. 101, 5328–35 (2004).
190. Isakson, P., Bjørås, M., Bøe, S. O. & Simonsen, A. Autophagy contributes to therapy-
induced degradation of the PML/RARA oncoprotein. Blood 116, 2324–31 (2010).
191. Wang, Z., Cao, L., Kang, R., Yang, M., Liu, L., Zhao, Y., Yu, Y., Xie, M., Yin, X.,
Livesey, K. M. & Tang, D. Autophagy regulates myeloid cell differentiation by
p62/SQSTM1-mediated degradation of PML-RARα oncoprotein. Autophagy 7, 401–11
(2011).
192. Goussetis, D. J., Gounaris, E., Wu, E. J., Vakana, E., Sharma, B., Bogyo, M., Altman, J.
K. & Platanias, L. C. Autophagic degradation of the BCR-ABL oncoprotein and
generation of antileukemic responses by arsenic trioxide. Blood 120, 3555–62 (2012).
193. Sagona, A. P., Nezis, I. P., Pedersen, N. M., Liestøl, K., Poulton, J., Rusten, T. E.,
Skotheim, R. I., Raiborg, C. & Stenmark, H. PtdIns(3)P controls cytokinesis through
KIF13A-mediated recruitment of FYVE-CENT to the midbody. Nat. Cell Biol. 12, 362–
71 (2010).
194. Jean, S., Cox, S., Schmidt, E. J., Robinson, F. L. & Kiger, A. Sbf/MTMR13 coordinates
PI(3)P and Rab21 regulation in endocytic control of cellular remodeling. Mol. Biol. Cell
23, 2723–40 (2012).
89
195. Martinez, J., Malireddi, R. K. S., Lu, Q., Cunha, L. D., Pelletier, S., Gingras, S., Orchard,
R., Guan, J.-L., Tan, H., Peng, J., Kanneganti, T.-D., Virgin, H. W. & Green, D. R.
Molecular characterization of LC3-associated phagocytosis reveals distinct roles for
Rubicon, NOX2 and autophagy proteins. Nat. Cell Biol. 17, 893–906 (2015).
196. Mack, H. I. D. Dissertation: Regulation of Mammalian Autophagy by Unc-51-Like
Kinase 1. (TECHNISCHE UNIVERSITÄT MÜNCHEN, 2011, 2011).
197. Sun, H. & Taneja, R. Analysis of Transformation and Tumorigenicity Using Mouse
Embryonic Fibroblast Cells. Cancer Genomics Proteomics Methods Protoc. 383, 303–310
198. Strauss, W. M. & Strauss, W. M. in Current Protocols in Molecular Biology 2.2.1–2.2.3
(John Wiley & Sons, Inc., 2001). doi:10.1002/0471142727.mb0202s42
199. Agoulnik, I. U., Hodgson, M. C., Bowden, W. A., Ittmann, M. M., Agoulnik, I. U.,
Hodgson, M. C., Bowden, W. A. & Ittmann, M. M. INPP4B: the New Kid on the PI3K
Block. Oncotarget 2, 321–328 (2011).
200. Chan, L. L.-Y., Shen, D., Wilkinson, A. R., Patton, W., Lai, N., Chan, E., Kuksin, D., Lin,
B. & Qiu, J. A novel image-based cytometry method for autophagy detection in living
cells. Autophagy 8, 1371–82 (2012).
201. Amaravadi, R. K., Yu, D., Lum, J. J., Bui, T., Christophorou, M. A., Evan, G. I., Thomas-
Tikhonenko, A., Thompson, C. B., Kanzawa, T., Paglin, S., Bursch, W., Kondo, Y.,
Kanzawa, T., Sawaya, R., Kondo, S., Yu, L., Qu, X., Kiffin, R., Christian, C., et al.
Autophagy inhibition enhances therapy-induced apoptosis in a Myc-induced model of
lymphoma. J. Clin. Invest. 117, 326–336 (2007).
202. Tiacci, E., Spanhol-Rosseto, a, Martelli, M. P., Pasqualucci, L., Quentmeier, H.,
Grossmann, V., Drexler, H. G. & Falini, B. The NPM1 wild-type OCI-AML2 and the
NPM1-mutated OCI-AML3 cell lines carry DNMT3A mutations. Leukemia 26, 554–557
(2012).
203. Peng, C., Chen, Y., Yang, Z., Zhang, H., Osterby, L., Rosmarin, A. G., Dc, W., Peng, C.,
Chen, Y., Yang, Z., Zhang, H., Osterby, L., Rosmarin, A. G. & Li, S. leukemias in mice
PTEN is a tumor suppressor in CML stem cells and BCR-ABL – induced leukemias in
mice. 115, 626–635 (2013).
204. Gutierrez, A., Sanda, T., Grebliunaite, R., Carracedo, A., Salmena, L., Ahn, Y., Dahlberg,
S., Neuberg, D., Moreau, L. a, Winter, S. S., Larson, R., Zhang, J., Protopopov, A., Chin,
L., Pandolfi, P. P., Silverman, L. B., Hunger, S. P., Sallan, S. E. & Look, a T. Brief report
High frequency of PTEN , PI3K , and AKT abnormalities in T-cell acute lymphoblastic
leukemia. Science (80-. ). 114, 647–650 (2009).
205. Woolley, J. F., Dzneladze, I. & Salmena, L. Phosphoinositide signaling in cancer: INPP4B
Akt(s) out. Trends Mol. Med. 21, 530–532 (2015).
206. Devereaux, K., Dall’Armi, C., Alcazar-Roman, A., Ogasawara, Y., Zhou, X., Wang, F.,
Yamamoto, A., de Camilli, P. & Di Paolo, G. Regulation of Mammalian Autophagy by
Class II and III PI 3-Kinases through PI3P Synthesis. PLoS One 8, 10–12 (2013).
207. Mathew, R., Karantza-Wadsworth, V. & White, E. Role of autophagy in cancer. Nat. Rev.
90
Cancer 7, 961–7 (2007).
208. Klionsky, D. J., Eskelinen, E. L. & Deretic, V. Autophagosomes, phagosomes,
autolysosomes, phagolysosomes, autophagolysosomes... Wait, I’m confused. Autophagy
10, 549–551 (2014).
91
APPENDICES
Appendix 1. INPP4Bhigh AML patients have lower CR rates and shorter survival.
(Adapted from Dzneladze et al. 2015, Leukemia91). (A) INPP4B expression is aligned
with patient response to therapy. (B-D) Response to therapy and test of significance. CR
= complete response, NR = no response (E-H) Kaplan-Meier plots for INPP4Bhigh patient
OS.
92
Appendix 2. INPP4Bhigh constitutes a significant hazard in total and CN-AML
(Adapted from Dzneladze et al. 2015, Leukemia91). (A-B) OS and EFS of patients with
INPP4BHigh or FLT3-ITD versus all patients. (C) Forest plot of log hazard rates for OS in
AML patients within OCI-PMH data sets. (D) ROC analysis of EFS for potential
biomarkers in AML vs. INPP4B (E-H) Comparison of INPP4BHigh and INPP4BLow OS
and EFS in cytogenetically normal AML or FLT3-ITD AMLversus total patients in OCI-
PMH dataset.
93
Appendix 3. Ectopic overexpression of INPP4B in AML cells leads to increased
colony-forming potential and proliferation. (Adapted from Dzneladze et al. 2015,
Leukemia91). (A-B) Ectopic overexpression of INPP4B in OCI-AML2 and OCI-AML3
cell lines at the mRNA and protein level. (C-D) Colony formation for INPP4Bwt and
control OCI-AML2 and OCI-AML3 cells in methylcellulose. (E-F) Proliferation assay
and Annexin V staining of INPP4Bwt and control cells OCI-AML2 and OCI-AML3 cells.
(G-H) Low serum growth assay of INPP4Bwt and control cells OCI-AML2 and OCI-
AML3 cells. Viability is measured by trypan blue cell counts. All P-values were derived
using the Student’s t-test. *P<0.05, ** P <0.01, *** P <0.001.
94
Appendix 4. INPP4B overexpression is associated with resistance to chemotherapy
and ionizing radiation. (Adapted from Dzneladze et al. 2015, Leukemia91). Viability
is measured using trypan blue staining in all panels. (A-B) Viability and EC50 in
increasing concentrations of DNR in INPP4Bwt and control OCI-AML2 and OCI-AML3
cells at 24 hours. (C-D) INPP4Bwt and control OCI-AML2 and OCI-AML3 cells were
cultured in 10 or 50 nM DNR for up to 4 days. (E-F) Viability post treatment of
INPP4Bwt and control OCI-AML2 and OCI-AML3 cells with 10 Gy ionizing radation at
2.5 Gy/min at indicated times. Student’s t-test was used to test for significance in panels
(C-F). *P<0.05, ** P <0.01, *** P <0.001.
95
PUBLICATIONS AND ABSTRACTS
Publications
Dzneladze, I. He R, Woolley JF, Son MH, Sharobim MH, Greenberg SA, Gabra M, Langlois C,
Rashid A, Hakem A, Ibrahimova N, Salmena L. INPP4B overexpression is associated with poor
clinical outcome and therapy resistance in acute myeloid leukemia. Leukemia 29, 1485–95
(2015).
Abstracts
Sharobim M.H, Gabra M, Son Meong-Hi, To Anthony, Mangialardi E, Woolley J, Salmena L.
INPP4B Overexpression is Associated with an Autophagic Phenotype in AML Cells. Visions in
Pharmacology Conference 2016, Department of Pharmacology and Toxicology, Univ. of
Toronto.