InteractionbetweenOxidativeStressSensorNrf2and Xenobiotic ... · ing the process of xenobiotic...

Interaction between Oxidative Stress Sensor Nrf2 andXenobiotic-activated Aryl Hydrocarbon Receptor in theRegulation of the Human Phase II DetoxifyingUDP-glucuronosyltransferase 1A10*□S

Received for publication, October 14, 2009, and in revised form, January 5, 2010 Published, JBC Papers in Press, January 6, 2010, DOI 10.1074/jbc.M109.075770

Sandra Kalthoff, Ursula Ehmer, Nicole Freiberg, Michael P. Manns, and Christian P. Strassburg1

From the Department of Gastroenterology, Hepatology and Endocrinology, Hannover Medical School, 30625 Hannover, Germany

The defense against oxidative stress is a critical feature thatprevents cellular and DNA damage. UDP-glucuronosyltrans-ferases (UGTs) catalyze the glucuronidation of xenobiotics,mutagens, and reactivemetabolites and thus act as indirect anti-oxidants. Aim of this study was to elucidate the regulation ofUGTs expressed in the mucosa of the gastrointestinal tract byxenobiotics and themainmediator of antioxidant defense, Nrf2(nuclear factor erythroid 2-related factor 2). Xenobiotic (XRE)and antioxidant (ARE) response elements were detected in thepromoters ofUGT1A8,UGT1A9, andUGT1A10. Reporter geneexperiments demonstrated XRE-mediated induction by dioxinin addition to tert-butylhydroquinone (ARE)-mediated induc-tion of UGT1A8 and UGT1A10, which are expressed in extra-hepatic tissue in humans in vivo. The responsible XRE and AREmotifs were identified by mutagenesis. Small interfering RNAknockdown, electrophoretic mobility shifts, and supershiftsidentified a functional interactionofNrf2 and the aryl hydrocar-bon receptor (AhR). Induction of UGT1A8 and UGT1A10requires Nrf2 and AhR. It proceeds by utilizing XRE- as well asARE-binding motifs. In summary, we demonstrate the coordi-nated AhR- and Nrf2-dependent transcriptional regulation ofhuman UGT1As. Cellular protection by glucuronidation is thusinducible by xenobiotics via AhR and by oxidative metabolitesvia Nrf2 linking glucuronidation to cellular protection anddefense against oxidative stress.

Molecular oxygen is essential for the survival of almost alleukaryotes. Under normal physiological conditions, reactiveoxygen species (ROS),2 including hydrogen peroxide, superox-ide, peroxynitrite, and hydroxyl radicals, are generated as met-abolic by-products. However, increased levels of ROS can leadto oxidative stress and cell injury. During evolution, mamma-

lian cells have developed a variety of inducible genetic pro-grams to adapt to the presence of ROS. As a first cellular reac-tion in response to oxidative/electrophilic stress, an array ofdefense genes is activated (1, 2), which, in most instances, leadsto the neutralization of oxidative stress, its effects, and finally tosurvival. In the absence of appropriate defensemechanisms, theaccumulation of ROS and electrophiles can lead to membraneand DNA damage, mutagenicity, degeneration of tissues, pre-mature aging, apoptotic cell death, cellular transformation, andcancer (3–5).Cellular antioxidant defense employs a number of proteins

(e.g. enzymes) and small molecules (e.g. vitamins C and E), torestrict ROS at levels, which are not critical for the organism.Enzymes with antioxidant capabilities capable of inactivatingROS and preventing ROS-initiated reactions include superox-ide dismutases, catalase, and glutathione peroxidase and belongto the group of “direct” antioxidants (6–8). In contrast, phase 2detoxifying (conjugating) enzymes are classified as “indirect”antioxidants based upon their role in maintaining redox bal-ance and thiol homeostasis. They contribute to biosynthesisand the recycling of thiols or facilitate the excretion of oxidized,reactive secondary metabolites (quinines, epoxides, aldehydes,and peroxides) through reduction/conjugation reactions dur-ing the process of xenobiotic detoxification (9). Phase 2enzymes with antioxidant capability include glutathioneS-transferase isozymes and NADP(H):quinine oxidoreductase(NQO1), �-glutamyl cysteine synthethase, and UDP-glucu-ronosyltransferases (UGTs).UGTs facilitate the elimination of a broad array of endoge-

nous and exogenous substances by glucuronidation. Cyto-chromes P450 generate ROS as a result of oxidative metabo-lism. The resulting reactive metabolites are among the majorsubstrates for conjugation with glucuronic acid, which is cata-lyzed by UGTs. Glucuronidation leads to biologically inactiveglucuronides in most instances. The human UGT1A enzymefamily encoded on chromosome 2 comprises nine members(UGT1A1, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7,UGT1A8, UGT1A9, and UGT1A10) (10). The proximal 1 kb ofthe UGT1A8–10 promoters are highly similar, displaying�75% of sequence identity (11). The UGT1A10 gene productdetoxifiesmany xenobiotic substrates and drugs aswell as 7-hy-droxy-benzo[a]pyrene, known as a precursor of ROS.UGT1A10 is expressed exclusively in the extrahepatic gastro-intestinal tract (12–15).UGT1A9 is the only isoformwithin the

* This work was supported by Deutsche Forschungsgemeinschaft GrantSFB621 C3.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Tables 3–5.

1 To whom correspondence should be addressed: Department of Gastro-enterology, Hepatology and Endocrinology, Hannover Medical School,Carl-Neuberg Str. 1, 30625 Hannover, Germany. Tel.: 49-511-532-2219; Fax:49-511-532-4896; E-mail: [email protected].

2 The abbreviations used are: ROS, reactive oxygen species; AhR, aryl hydro-carbon receptor; tBHQ, tert-butylhydroquinone; TCDD, 2,3,7,8-tetra-chlordibenzo-p-dioxin; UGT, UDP-glucuronosyltransferase; ARE, antioxi-dant response element; XRE, xenobiotic response element; EMSA,electrophoretic mobility shift assay.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 9, pp. 5993–6002, February 26, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

FEBRUARY 26, 2010 • VOLUME 285 • NUMBER 9 JOURNAL OF BIOLOGICAL CHEMISTRY 5993

by guest on March 22, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/content/full/M109.075770/DC1

http://www.jbc.org/

UGT1A7–10 gene cluster, which is expressed in the liver. It isalso highly expressed in kidneys and catalyzes the glucuronida-tion of estragole, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine and compounds such as phenylbutazone (16–18).The signal transduction pathways responsible for sensing

oxidative stress and activating the appropriate defense genesare still not completely understood in eukaryotes. The tran-scription factor Nrf2 appears to represent a key regulator inoxidative stress that is activated by ROS (1, 2). Nrf2 is amemberof the Cap’n’Collar family of bZIP proteins and recognizes theantioxidant response element (ARE) in the promoter of its tar-get genes (19). Under normal basal conditions, Nrf2 is bound toits inhibitor, the cytoskeleton-associated protein Keap1, whichrepresses Nrf2 by facilitating its proteasomal degradation (20).Upon stimulation by antioxidants such as tert-butylhydroqui-none (tBHQ),Nrf2 is released fromKeap1 and translocates intothe nucleus, followed by heterodimerization with other tran-scription factors, such as Jun and small Maf (21–23).Recent data provide evidence for a cross-talk between the

Nrf2 pathway and the pathway leading to the induction of XRE-driven genes and the aryl hydrocarbon receptor (AhR). AhR is abasic helix-loop-helix transcription factor that, prior to ligandbinding, is stabilized in the cytoplasm by direct interactionwithHSP90 (heat shock protein 90), XAP2 (X-associated protein 2),and HSP90 co-chaperone p23 (24). Upon ligand binding (e.g.2,3,7,8-tetrachlordibenzo-p-dioxin (TCDD), phytochemicals,and sterols) the AhR ligand complex translocates into thenucleus and dimerizes with the Arnt (aryl hydrocarbon recep-tor nuclear translocator) (25). The AhR/Arnt dimer binds toXRE DNA-binding motifs located in the promoter of manydrug-metabolizing enzymes. A number of studies have investi-gated the cross-talk between Nrf2 and AhR. Mutagenesis ofARE-binding elements in the promoter of humanUGT1A6wasshown to lead to a reduced response to tBHQ, and, surprisingly,to the simultaneous loss of TCDD inducibility (26). Convincingdata were presented in a study that examined the dependenceof TCDD inducibility of different drug-processing genes on theNrf2 presence in livers of wild type and Nrf2-null mice. Yeageret al. (27) showed in mice that TCDD induction of Ugt1a5,Ugt1a6, and Ugt1a9 was dependent on Nrf2, whereas TCDDinduction of Ugt1a1 was not. There are several possibilities toexplain this dependence. Miao et al. (28) demonstrated thatnrf2 gene transcription is directly modulated by AhR throughXRE-elements in the nrf2 gene promoter. A second possiblemechanism is a direct interaction between AhR and Nrf2 pro-teins, but evidence that the two transcription factors can phys-ically interact has not been presented to date. A third possibilityis an interaction betweenNrf2- andAhR-associated proteins oran interaction between AhR- and Nrf2-associated proteins.As the major site of first entry for xenobiotics, the gastroin-

testinal tract, and subsequently the liver are continuouslyexposed to a broad array of compounds with ROS capability.Mucosal metabolism can lead to metabolites with increasedtoxicity and increases the susceptibility of the gastrointestinaltract and the liver for oxidative metabolites, chemical toxicity,and potentially carcinogenesis. Both organ systems harbormolecular defense mechanisms to detoxify reactive intermedi-ates and minimize oxidative stress. Because UGTs are

expressed directly in the intestinalmucosa aswell as in the liver,we hypothesized that they are regulated by antioxidant signal-ing pathways. In this study, the human UGT1A8/UGT1A10(extrahepatic expression in humans in vivo) and UGT1A9(hepatic expression in humans in vivo) were studied, and theirregulation by Nrf2 and/or AhR was identified andcharacterized.

EXPERIMENTAL PROCEDURES

Cells and Culture Conditions—In all experiments, humanesophageal squamous cell carcinoma (KYSE70) cells were used.Theywere previously established from the poorly differentiatedinvasive esophageal squamous cell carcinoma resected frommiddle intrathoracic esophagus of a 77-year-old Japanese manprior to treatment. KYSE70 cells were cultured in RPMI 1640(Invitrogen) supplemented with 10% fetal bovine serum.Esophageal epitheliumderivedKYSE70 cells were used becausethe esophageal mucosa exclusively expresses UGT1A7,UGT1A8, UGT1A9, and UGT1A10 (10), the regulation ofwhich was the aim of the experimental characterization of thisstudy. The cells were maintained at 37 °C under an atmosphereof 5% CO2 and 95% air.RNA Isolation and Reverse Transcription-PCR—KYSE70

cells were treated with test compounds (5 nM TCDD, 100 �M

tBHQ, or vehicle dimethyl sulfoxide) for 24 h, and total RNAwas prepared with TRIzol (Invitrogen). 5 �g of RNA were usedfor the generation of cDNA in an oligo(dT)-primed SuperscriptIII reverse transcriptase reaction according to the manufactur-er’s instructions (Invitrogen).PCR of UGT1A10, Nrf2, and AhR—The influence of TCDD

and tBHQ on UGT1A10-, AhR-, and Nrf2-mRNA-levels wasshown by co-amplification of the gene of interest and �-actin.Amplification ofUGT1A10 from cDNAwas performedwith aninitial denaturation for 5 min at 94 °C followed by 35 cycles ofdenaturation for 30 s at 94 °C, primer annealing for 30 s at 59 °C,and an extension reaction for 1 min at 72 °C, followed by a finalextension reaction of 7 min at 72 °C. Amplification of Nrf2 andAhR was carried out using the same protocol except for theannealing temperature (58 °C) and the number of cycles (AhR,31 cycles; Nrf2, 25 cycles). �-Actin primers were added after 10(UGT1A10 andAhR) or 5 (Nrf2) cycles. All primers are listed insupplemental Table 3.Generation of UGT1A8, UGT1A9, and UGT1A10 Luciferase

Reporter Gene Constructs—A 500-bp (UGT1A8 andUGT1A10) and a 530-bp (UGT1A9) DNA fragment of eachUGT1A 5�-upstream sequence were amplified by PCR from ahealthy blood donor (all primers are shown in supplementalTable 4). The PCR fragments were cut by XhoI and NheI andligated into pGL3 vector (Promega, Mannheim, Germany).Mutagenesis of putative AhR- and Nrf2-binding sites was per-formed by primer extension using primers specified in supple-mental Table 5. All inserts were sequenced in full using the DyeTerminator Cycle Sequencing kit 1.1 (Applied Biosystems,Darmstadt, Germany) and the ABI 310 automated sequencer(Applied Biosystems, Darmstadt, Germany).Luciferase Assays—KYSE70 cells were seeded in 12-well

plates and transfected with UGT1A8-, UGT1A9-, andUGT1A10 constructs (800 ng/well) in addition to the pRL-TK

Coordinate Regulation of UGT1A10 by Nrf2 and AhR

5994 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 9 • FEBRUARY 26, 2010


http://ww

w.jbc.org/

Dow

nloaded from






http://www.jbc.org/

plasmid using Lipofectin Transfection reagent (Invitrogen) toperform a Dual-Luciferase assay (Dual-Reporter Assay; Pro-mega, Mannheim, Germany). For transfection of siRNA (100nM) Lipofectamine 2000 (Invitrogen) was used. Transfectionof the reporter gene constructs using Lipofectin followed 6 hlater. On the next day, cells were treated with 5 nM TCDD or100 �M tBHQ for 48h if not stated otherwise. All experi-ments were performed in triplicate in at least 3–10 indepen-dent experiments. Results were analyzed using MicrosoftExcel software and are shown as luciferase activity relative toempty pGL3 vector or as fold induction where indicated.Error bars represent S.D. Statistical analysis was performedusing Student’s t test for comparisons between groups. Sig-

nificance was determined across all performed experiments.Differences were considered significant when p values were�0.05.Transfection of siRNA—200 pmol of siRNA (MWG Biotech,

Ebersberg, Germany) against Nrf2 (AAGAGUAUGAGCUG-GAAAAACTT), AhR (AAGCGGCAUAGAGACCGACU-UTT), or nonsilencing control (UAAUGUAUUGGAACG-CAUATT) were transfected within 2 ml of OPTI-MEM(Invitrogen) into KYSE70 cells seeded into 6-well plates usingLipofectamine 2000 according to the manufacturer’s instruc-tions. Consequently, final concentration of siRNA was 100 nM.Knockdown efficiency was determined by semiquantitativeWestern blot analysis (see below).

FIGURE 1. A, time-dependent regulation of UGT1A10 mRNA by TCDD (5 nM) and tBHQ (100 �M) in comparison to solvent (dimethyl sulfoxide, DMSO) in KYSE70cells. The highest induction of UGT1A10 mRNA by TCDD was detectable after 48 h. Maximal tBHQ inducibility was observed after 24 h. B, time-dependentregulation of the UGT1A10 500-bp 5�-upstream region by TCDD and tBHQ in luciferase assay in KYSE70 cells. A maximal up-regulation of luciferase activity wasobserved after 48 h both by TCDD and tBHQ. WT, wild type.

TABLE 1Sequence of used oligonucleotides in EMSAs

Primer Position Sequence

ARE consensus AGA ATG CTG AGT CAC GGT G (forward), CAC CGT GAC TCA GCA TTC T (reverse)XRE consensus GGG GAT CGC GTG ACA ACC C (forward), GGG TTG TCA CGC GAT CCC C (reverse)PPAR�a consensus CAAAACTAGGTCAAAGGTCA (forward), TGACCTTTGACCTAGTTTTG (reverse)1A10 XRE-101 bp�114 to �85 GAA AGG ATA AAT ACA CGC CCT CTA TTG GGG (forward),

CCC CAA TAG AGG GCG TGT ATT TAT CCT TTC (reverse)1A10 ARE-149 bp�159 to �130 TAT GAG TAA ATC ATT GGC AGT GAG TGT GAT (forward),

ATC ACA CTC ACT GCC AAT GAT TTA CTC ATA (reverse)1A10 XRE-136 bp�144 to �120 GGC AGT GAG TGT GAT TTT TTT TTT T (forward),

AAA AAA AAA AAT CAC ACT CAC TGC C (reverse)a PPAR�, peroxisome proliferator-activated receptor �.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Western Blot—20 �g of total cell lysates from KYSE70 cellstreatedwith either 5 nMTCDDor 100�M tBHQwere boiled for10 min in Laemmli sample buffer (2% sodium dodecyl sulfate,

62.5 mM Tris-HCl, pH 6.8, 10% glycerol, and 0.001% bromphe-nol blue) and separated by 8% SDS-PAGE prior to electrotrans-fer onto a nitrocellulosemembrane. Blocking was performed in

FIGURE 2. A, luciferase reporter gene assay with a UGT1A10 wild type promoter construct and mutagenesis of different potential XRE- and ARE-binding sites. Asignificant reduction of both TCDD- and tBHQ-induced luciferase activity was observed for the constructs with mutagenized XRE-101, XRE-136, and theARE-149 binding elements compared with wild type. B, comparison of UGT1A8, UGT1A9, and UGT1A10 induction by TCDD and tBHQ. There was a comparableTCDD and tBHQ inducibility for UGT1A8 and UGT1A10, whereas UGT1A9 showed a lower TCDD and no tBHQ inducibility. Significance is determined in relationto control vector. C, mutagenesis of the XRE-101 and ARE-149 binding sites of UGT1A8. Similar to UGT1A10, mutation of these binding sites led to a significantand simultaneous reduction of both TCDD- and tBHQ-induced luciferase activity in comparison to wild type construct. D, mutagenesis of the XRE-101 andARE-143 binding sites of UGT1A9. In contrast to UGT1A8 and UGT1A10, mutagenesis of the ARE binding site of UGT1A9 did not affect TCDD inducibility.Significance is determined in relation to wild type construct. The XRE sequences of all mutant constructs are replaced with the sequence ‘AAATT,‘ and the AREsequences are mutagenized to ‘AAATTTAAA‘. KYSE70 cells were treated with TCDD (5 nM) and tBHQ (100 �M) for 48 h (A–D). DMSO, dimethyl sulfoxide; WT, wildtype.

TABLE 2UGT1A8, UGT1A9 and UGT1A10 5�-upstream regions with the different XRE- and ARE-binding sitesDifferences in the sequences of UGT1A8 and UGT1A9 in comparison with that of UGT1A10 are shown in boldface letters. The XRE-101 site is the reverse complementsequence of the consensus sequence. Sequences of the constructs UGT1A10 ARE-149 mut-like 1A9 and UGT1A9 ARE-143 mut-like 1A10 are shown below. Differencesfrom the respective wild type constructs are displayed in boldface letters.

Accession no. XRE-256 XRE-176 ARE-143/149 XRE-136 XRE-101

Consensus sequence GCGTG GCGTG GCNNNGTCA GCGTG GCGTGCACGC

(reverse complement)UGT1A8 AF462268.1 GCACT TCATG A...A...TCATTGGCA...G GTGTG CACGCUGT1A9 NM_021027.2 GCATG TCATA T...G...TCATTGTCA...C CTGAT CACGCUGT1A10 NM_019075.2 GCGTG TCGTG A...A...TCATTGGCA...G GTGTG CACGCUGT1A10 ARE-149 mut-like 1A9 Gly3 Thr GCGTG TCGTG A...A...TCATTGTCA...G GTGTG CACGCUGT1A10 ARE-149 mut-like 1A9 “all” GCGTG TCGTG T...G...TCATTGTCA...C GTGTG CACGCUGT1A9 ARE-143 mut-like 1A10 Thr3 Gly GCATG TCATA T...G...TCATTGGCA...C CTGAT CACGCUGT1A9 ARE-143 mut-like 1A10 “all” GCATG TCATA A...A...TCATTGGCA...G CTGAT CACGC




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10% drymilk (90% phosphate-buffered saline-Tris). Incubationwith primary antibodies (anti-AhR and anti Nrf2, Santa CruzBiotechnology, Santa Cruz, CA) was carried out in 10% drymilk. After incubation with appropriate secondary antibodies(Millipore, Schwalbach, Germany), protein was visualized bychemiluminescence (Pierce) on x-ray film. Staining with �-actin antibody (sc-69879) was used as loading control.Electrophoretic Mobility Shift Assay (EMSA)—Nonradioac-

tiveEMSAwasperformedusing theLightShiftChemiluminescentEMSA kit (Pierce). Nuclear extracts were prepared from 5 nMTCDD-treated (for all experiments with XRE-probes) or 100 �M

tBHQ-treated (for all experiments with ARE-probes) (48 h)KYSE70 cells as described elsewhere (14). 1�g of nuclear extractswas incubated for 30 min at room temperature with biotinylatedoligonucleotides containing the binding sites listed in Table 1. Forthe determination of binding specificity, 200-fold excess of unla-beled double-stranded oligonucleotide were incubated withnuclear extracts for 15 min prior to the addition of biotinylatedoligonucleotides. The samples were electrophoretically separated(120 V, 1–2.5 h) in a 6% polyacrylamide gel and blotted (300 mil-liamperes, 45 min) on a Biodyne B (0.45 �m) nylon membrane(Pall Corp., Pensacola, FL). Chemiluminescence was visualizedusing x-ray film (Amersham Biosciences) exposed for 1–10 min.EMSA supershift assays were performed by a 30-min incubationon ice with 2�g of anti-AhR antibody (sc-8088X, Santa Cruz Bio-technology) or 2 �g of anti-Nrf2 antibody (sc-722X, Santa CruzBiotechnology) prior to addition of labeled oligonucleotides.

RESULTS

Time-dependent Inducibility of Human UGT1A10 mRNA byTCDD(AhR) and tBHQ (Nrf2)—Asemiquantitative PCRwasper-formed forUGT1A10mRNA in relation to actinmRNA.KYSE70cells treated with TCDD or tBHQ for different lengths of timeshowed an UGT1A10mRNA induction by TCDD after 3 h and amaximum after 48 h (Fig. 1A). tBHQ induced UGT1A10 mRNAafter 24 h of incubation, which is also the point of strongest induc-

tion. Luciferase reporter gene assays similarly showed a time-de-pendent inductionof aUGT1A10500-bp construct byTCDDandtBHQ (Fig. 1B). The strongest TCDD and tBHQ inducibility wasdetectable after 48 h. Induction was 6.4-fold with TCDD and 2.5-foldwithtBHQ.Thesedataindicateapreviouslyundescribedtime-dependent induction of human UGT1A10 mRNA and of theUGT1A10 5�-upstream region, most likely by the transcriptionfactors AhR andNrf2, which was further clarified.Identification of XRE- and ARE-binding Elements in

UGT1A10 5�-upstream Region—To identify the responsibleDNAbindingmotifs 5�-upstreamDNA sequencewas analyzed.Four potential XRE-binding sites and one ARE-binding sitewere identified in the human UGT1A10 5�-upstream regionwithin the first 500 bp of the UGT1A10 promoter that werehighly similar to XRE and ARE consensus sequences (Table 2).All potential binding sites were mutagenized individually toexamine their specific effects on TCDD and tBHQ inducibility.If the transcription factors AhR or Nrf2 bind specifically to theexamined binding elements, mutagenesis would be expected tolead to the prevention of transcription factor binding and there-fore result in abolishedTCDDor tBHQ induction.Mutagenesisof the XRE-176 and XRE-256 site did not affect UGT1A10induction by AhR or Nrf2 (Fig. 2A). By mutagenesis of XRE-binding elements, a reduction of TCDD induction wasexpected. Interestingly, themutagenesis of only theXRE-101 ortheXRE-136motif led to a significant reduction of bothTCDD-and tBHQ-mediated induction. Similarly, the mutagenesis ofthe ARE-149 motif resulted in a simultaneous decrease ofTCDD- and tBHQ-mediated UGT1A10 induction. In sum-mary, these data indicate interdependency between the AhR-and Nrf2-mediated induction of UGT1A10.TCDD and tBHQ Inducibility of Highly Homologous

UGT1A8 and UGT1A9 and Identification of Respective XRE-and ARE-binding Elements—The experiments were expandedto include the highly homologous UGT1A8 and UGT1A9

FIGURE 3. A, effect of mutagenesis of the ARE of UGT1A10 corresponding to that of UGT1A9 on the inducibility by TCDD and tBHQ. (The sequences of theconstructs are shown in Table 2.) In luciferase assays, UGT1A10 promoter inducibility by TCDD and tBHQ was significantly reduced with an ARE-containing Thrinstead of Gly, in comparison to wild type construct. B, chimeric mutagenesis of the UGT1A9 ARE to correspond to the sequence of the UGT1A10 ARE led to tBHQinducibility previously not observed with the wild type UGT1A9 sequence. (The sequences of the constructs are shown in Table 2.) Significance is determinedin comparison to wild type construct. KYSE70 cells were treated with TCDD (5 nM) and tBHQ (100 �M) for 48 h (A and B). DMSO, dimethyl sulfoxide; WT, wild type.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

genes. Despite a promoter sequence homology of �75%,UGT1A9 is mainly expressed in liver and kidneys, whereasUGT1A8 and UGT1A10 are exclusively expressed in the extra-hepatic gastrointestinal tract in humans in vivo (14, 15). Lucif-erase activity assays showed a similar TCDD (6.4-fold) andtBHQ (2.7-fold) inducibility for UGT1A8 in comparison toUGT1A10 (Fig. 2B). In contrast, liver expressed UGT1A9 wasonly induced 4.3-fold byTCDD, and no tBHQ-mediated induc-tion was detectable. The corresponding XRE-101 and ARE-149binding elements were mutagenized in both the UGT1A8 andUGT1A9 5�-upstream regions. Mutagenesis of the XRE-101and ARE-149 sites in theUGT1A8 promoter led to a significantreduction of TCDD and tBHQ inducibility similar to that seenforUGT1A10 (Fig. 2C).When the corresponding XRE-101 ele-ment in theUGT1A9 promoter was mutated, TCDD inducibil-ity decreased significantly (Fig. 2D). However, mutagenesis ofthe correspondingARE-143 site did not affect TCDD inducibil-

ity, as shown for UGT1A8 and UGT1A10. We conclude thatthere is coordination betweenTCDD (AhR)- and tBHQ (Nrf2)-mediated induction of the UGT1A8 and UGT1A10 genes,which is absent for the TCDD inducibility of UGT1A9.Conversion of the UT1A10 ARE-149 Binding Element to the

Respective UGT1A9 ARE-143 Binding Element—The XRE-101and ARE-149 sites of UGT1A10 are identical to those ofUGT1A8 (Table 2). In contrast, the ARE-143 DNA motif ofUGT1A9 differs from those found in UGT1A8 and UGT1A10with respect to a single base pair, which is located directly in thebinding element, and within three base pairs, which are locatedwithin the adjoining sequence. When Gly at position �143 ofUGT1A10 was mutated into Thr corresponding to theUGT1A9 ARE motif (Table 2), both TCDD and tBHQ induc-ibility were abolished comparable with complete mutation ofARE-149 in luciferase assays (Fig. 3A). TheUGT1A10 construct“ARE-149 mut-like 1A9 “all”” contains all four base pair

FIGURE 4. A, Western blot confirmed the knockdown of AhR and Nrf2 by specific siRNA at different time points in KYSE70 cells. Cells were treated with siRNA andincubated 6 h later with either TCDD (5 nM) or tBHQ (100 �M) for an additional 24/48 h. B and C, siRNA-mediated knockdown of AhR and Nrf2 abolished bothTCDD and tBHQ inducibility of UGT1A10 and UGT1A8 in luciferase assays. Significance was determined in relation to the construct treated with control siRNA.D, use of AhR siRNA led to a significant reduction of TCDD inducibility of UGT1A9 compared with treatment with control siRNA. Nrf2 siRNA did not affect TCDDinducibility of UGT1A9, which contrasts the findings with UGT1A10 and UGT1A8. In B and C, KYSE70 cells were treated with TCDD (5 nM) and tBHQ (100 �M) for48 h. DMSO, dimethyl sulfoxide.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

changes corresponding to the UGT1A9 sequence includingthose of the surrounding sequence. In luciferase assay, this con-struct caused no further reduction in inducibility in compari-son to the single mutagenesis of Gly3 Thr at position �143.Interestingly, conversion ofThr at position�137 inARE-143 ofUGT1A9 led to a 1.8-fold inducibility andmutation of the addi-tional 3 bp to a 2.1-fold tBHQ (Nrf2) inducibility, whichwas notobserved for thewild typeUGT1A9 promoter (Fig. 3B). In sum-mary, these data suggest that the difference of one base pair inthe ARE DNA binding motifs of UGT1A10 and UGT1A9 areassociated with the ability of tBHQ (ARE/Nrf2) inducibility orits absence. This analysis identifies the molecular determinantof differential regulation of these two genes.siRNA-mediatedKnockdownofNrf2andAhRImpactsTCDDand

tBHQ Inducibility of UGT1A10, UGT1A8, and UGT1A9—The analysis was expanded to provide evidence for a directinvolvement of AhR and Nrf2 by siRNA knockdown. The effi-ciency of specific AhR and Nrf2 siRNA was tested by Westernblot at different time points. Using 100 nM AhR/Nrf2 siRNA,AhR and Nrf2 protein amounts were strongly reduced after 24and 48 h of incubation with either TCDD or tBHQ comparedwith control siRNA (Fig. 4A). In luciferase assays, the AhRknockdown resulted in a complete loss of both TCDD andtBHQ inducibility of UGT1A10 (Fig. 4B). Similarly, Nrf2knockdown caused a loss of tBHQ (Nrf2) and TCDD (AhR)-mediated induction. Similar to UGT1A10, the single use ofeither AhR or Nrf2 siRNA led to a simultaneous reduction ofTCDD and tBHQ inducibility of UGT1A8 (Fig. 4C). However,Nrf2 siRNA was not able to affect TCDD inducibility ofUGT1A9, although AhR siRNA reduced TCDD induction,which is in agreement with the previous induction studies (Fig.

4D). The UGT1A9 construct “ARE-143 mut like 1A10 ”all“ containingall four base pair changes corre-sponding to the ARE of UGT1A10(and a restoration of tBHQ induc-ibility, Fig. 3B) showed, as expected,a simultaneous decrease in AhR- aswell as Nrf2-mediated inductionusing only AhR siRNA. In contrast,Nrf2 knockdown resulted in an abol-ishment of tBHQ inducibility but didnot affect the induction by TCDD.Therefore, we conclude that bothtranscription factors, AhR and Nrf2,are required for either TCDD- andtBHQ-mediated induction. Thesedata suggest thatAhR andNrf2 inter-act to perform a coordinate regula-tion of UGT1A8 and UGT1A10.In contrast, TCDD inducibility ofUGT1A9 appears not to be depen-dent on the presence of Nrf2. Even ifthe ARE of UGT1A9 is mutated tocorrespond to the ARE ofUGT1A10,Nrf2 inducibility depends on AhR,andNrf2 does not appear to be essen-tial for AhR-mediated induction.

Specificity of TCDD- and tBHQ-mediated Induction of AhRand Nrf2 and Specificity of Used AhR and Nrf2 siRNA—TCDDis a ligand of AhR and is responsible for the separation of AhRfrom its inhibitor in the cytoplasm. tBHQ is a creator of oxida-tive stress and treatment results in separation of Nrf2 from itsinhibitor Keap1 and migration in the nucleus. It has beenreported that AhR-mediated induction of Nrf2 was associatedwith an XRE-binding element in the nrf2 promoter (28). In thiscase, TCDD treatment would not only lead to a specific activa-tion of AhR but also to mRNA induction of Nrf2. To test thespecificity ofTCDD- and tBHQ-mediatedAhRandNrf2 induc-tion, a Western blot was performed for both transcription fac-tors (Fig. 5A). Our data indicate that under the experimental con-ditions used in this study,TCDDonly activatedAhRandnotNrf2,and tBHQmediated only a specific induction of Nrf2. To confirmthesedata,mRNAlevels ofAhRandNrf2were examined (Fig. 5B).Neither TCDD nor tBHQ induced AhR or Nrf2 on the mRNAlevel, therefore, there is no evidence for the up-regulation of geneexpression of Nrf2 by TCDD in the employed KYSE70 cells. Fur-thermore, the specificity of siRNA used in this study was exam-ined.Nrf2 siRNAdidnotaffect theamountofAhRproteinanduseof AhR siRNA led not to a decrease of Nrf2 protein amount (Fig.5A). These data showconclusively that the coordinated regulationof theUGT1A8 andUGT1A10 genes byNrf2 andAhR are not theresult of cross-reactivity.Binding of AhRandNrf2 toUGT1A10XRE-101 andARE-149

Binding Sites Confirmed by Gel Shift Assay—To examine adirect interaction of the transcription factors AhR and Nrf2with the identified UGT1A10 XRE-101 and ARE-149 bindingelement, EMSA was performed (Fig. 6A). Gel shift bands wereobserved with bothUGT1A10XRE/AREmotifs and consensus

FIGURE 5. A, Western blot of Nrf2 and AhR in comparison to �-actin. KYSE70 cells were incubated with 5 nM

TCDD, 100 �M tBHQ, solvent (all incubations for 24 h), and 100 nM AhR/Nr2 siRNA. Analyses of protein quantityshowed that there was no induction of Nrf2 by TCDD and no induction of AhR by tBHQ. Furthermore, AhR siRNAdoes not affect the protein amount of Nrf2, and AhR protein amount was not diminished by Nrf2 siRNA.B, semiquantitative reverse transcription-PCR of Nrf2 and AhR mRNA was performed to show that both Nrf2-and AhR-mRNA amounts are not affected by TCDD or tBHQ in KYSE70 cells. DMSO, dimethyl sulfoxide.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

XRE/ARE elements. The UGT1A10XRE-101 band was competed byconsensus XRE and UGT1A10ARE-unlabeled oligonucleotidesbut not by unlabeled peroxisomeproliferator-activated receptor-�consensus sequence used as acontrol. Similarly, the band ofUGT1A10 ARE-149 was competi-tively reduced by unlabeled consen-sus ARE and the UGT1A10XRE-101 but not by the unlabeledperoxisome proliferator-activatedreceptor-� oligonucleotide. Thespecificity of transcription factorbinding to the XRE and ARE ele-ments of UGT1A10 was establishedby using AhR- and Nrf2-specificantibodies (Fig. 6B). Interestingly, asupershift for the XRE-101 site wasformed with both AhR and Nrf2antibody. In a similar way, bothantibodies were able to produce asupershift with the ARE-bindingelement. An unspecific IgG was notable to produce a supershifted band.A similar experiment was also per-formed for the XRE-136 bindingmotif, which also demonstrated asimultaneous binding of both Nrf2and AhR (Fig. 6C).In summary, these data show that

AhR andNrf2 simultaneously bind toUGT1A10 XRE-101 element as wellas to the ARE-149 element. This sug-gests an interaction between thesetwo transcription factors in the regu-lation of UGT1A10 and agrees withthe coordinate regulation observed inthis study.

DISCUSSION

Oxidative stress represents animbalance between oxidant produc-tion and antioxidant mechanismswithin a tissue. The effects of oxida-tive stress depend on the extent andduration of changes in redox bal-ance and the ability of the cell toregain a physiological balance.Severe oxidative stress contributesto aging and age-related diseasessuch as cardiovascular disease,chronic inflammation, neurodegen-erative diseases, and cancer. Levelsof oxidized proteins, phospholipids,and DNA increase in these pro-cesses. In addition, DNA-damaging




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

electrophiles are often carcinogens (4, 29–31). Induction of afamily of oxidative stress-related genes that protect againstdamage by electrophiles and ROS is a key element in the main-tenance of cellular redox homeostasis and in reducing oxidativedamage (32, 33). These genes encode various antioxidant anddetoxifying enzymes and are regulated through the cis actingARE in their 5�-flanking promoter regions. Nrf2 is the centraltranscription factor that regulates both constitutive and induc-ible ARE-related gene expression (32). Nrf2 knock-out micehave a deficiency in this protective genetic program and have ahigher susceptibility to oxidative damage (34, 35). Recent stud-ies have shown a connection between the Nrf2 and the AhRpathways but the nature of this potential cross-talk has not beendescribed specifically to date. In this study, we showed andcharacterized the interaction betweenNrf2 andAhR in the reg-ulation of human glucuronidation, which is a keymechanismofindirect antioxidant action and plays an important role for themaintenance of the redox balance in eukaryotic cells. Thesedata show that glucuronidation is not only regulated by itsxenobiotic substrates but also by subsequent oxidative metab-olism and ensuing oxidative stress, which indicates a closelyregulated mechanism of cellular defense.In humans, the UGT1A10 gene is expressed throughout the

extrahepatic gastrointestinal tract that establishes first contactto a host of compounds. In the presented in vitro studies, it isconclusively shown to be inducible by TCDD (AhR) and tBHQ(Nrf2). It was surprising that both TCDD and tBHQ inductionwere abolished when either XRE-101 or XRE-136 DNA-bind-ing elements in the promoter of UGT1A10 were eliminated,which was also observed when the ARE-149 binding motif wasabsent (Fig. 2A). Although a dependence of TCDD inductionon an intact ARE element has been reported for the humanUGT1A6 gene (26), the reduction of tBHQ inducibility as aresult of XRE mutagenesis described here was unexpected andadds new insight into the tightly coordinated regulation involv-ing both pathways.The expression pattern of UGT1A8 is very similar to that of

UGT1A10 (36). The first 500 bp of the promoter of UGT1A8are 89.6% similar to those of UGT1A10, and the ARE-149 andXRE-101 DNA-binding sites are identical in both promoters.Therefore, it is not surprising thatUGT1A8 is also up-regulatedbyTCDDand tBHQand thatmutagenesis of either XRE-101 orARE-149 in the UGT1A8 5�-upstream region leads to thesimultaneous loss ofTCDDand tBHQ inducibility as in the caseof UGT1A10 (Fig. 2C).However, in contrast to UGT1A8, the first 500 bp of the

UGT1A9 andUGT1A10 promoters share only 82.6% similarity,and the ARE-143 of UGT1A9 differs from the ARE ofUGT1A10 in one base pair (Table 2).UGT1A9 is the only UGTwithin the very homologous UGT1A7–10 cluster, which is

expressed in the liver. It differs in its absence of significanttBHQ inducibility, although amotif in its promoter is similar tothe ARE consensus sequence (GCNNNGTCA). Our promoteranalyses indicate that the difference of one base in the ARE ofUGT1A9 andUGT1A10 accounts for tBHQ inducibility, whichwas confirmed by chimeric mutagenesis experiments (Fig. 3).These data also provide evidence for a molecular mechanismdetermining differential inducibility of differentUGT1A genes.This may also contribute to the observation of tissue-specificUGT1A expressiondespite high degrees of sequence homology.The siRNA experiments in our study indicate that the pres-

ence of AhR is essential for Nrf2-mediated induction ofUGT1A10 and UGT1A8 and vice versa (Fig. 4, B and C). If onetranscription factor is eliminated, induction by bothTCDDandtBHQ are abolished simultaneously. In contrast, TCDD induc-ibility of UGT1A9 was not affected by the knockdown of Nrf2(Fig. 4D). However, Nrf2 inducibility of theUGT1A9 construct,with ARE mutated to correspond to the UGT1A10 ARE,appeared to be dependent on the presence of AhR (Fig. 4D),whereas AhR inducibility does not depend on the presence ofNrf2. To exclude that the interdependency of Nrf2 and AhR inthe regulation ofUGT1A10 andUGT1A8occurred as a result oftranscription factor up-regulation, their levels were examined(Fig. 5, A and B) and failed to show an unspecific effect. How-ever, Miao et al. (28) showed an up-regulation of Nrf2 mRNAby TCDD inmice. This discrepant result may be a consequenceof the fact thatMiao et al. (28) used amouse nrf2 promoter anddifferent mouse cell lines. Species specific and/or a tissue spe-cific regulation of Nrf2 may be an explanation. The results ofthis study suggest that a direct or indirect interaction betweenAhR and Nrf2 is the likely mechanism. This was further sub-stantiated by EMSA and supershift experiments withNrf2- andAhR-specific antibodies. In the promoter of UGT1A10, bothNrf2 and AhR are capable of binding to XRE as well as AREDNA-binding motifs.A previously reported study analyzing the murine glutathi-

one S-transferase A1 (Gsta1) promoter hypothesized that acoordinate regulation of AhR and Nrf2 by physical interactionor an adapter protein may exist (37). Our data demonstrate thepresence of both proteins in supershift assays with ARE as wellas XRE DNA-binding motifs. It can be hypothesized that theybind directly; however, the sequence specific binding of bothtranscription factors is extremely well conserved throughoutmammalian organisms, and it is questionable whether thisspecificity is lost regarding human UGT1A regulation. In thisstudy, the Nrf2/AhR interaction is conclusively demonstratedin the presence of theUGT1A10XRE-101, XRE-136, and ARE-149 DNAmotifs by electrophoretic mobility shifts and specificantibodies, and this is further suggested by induction and

FIGURE 6. Nuclear extracts for all EMSA experiments were prepared from KYSE70 cells treated with either 5 nM TCDD (for all experiments usingXRE-probes) or 100 �M tBHQ (for all experiments using ARE-probes) for 48 h. A, electrophoretic mobility shift assay for AhR (XRE-101) and Nrf2 (ARE-149)binding elements. Shifts are shown in comparison to published consensus sequences and can be competed by excess unlabeled consensus sequence but notby peroxisome proliferator-activated receptor-� (PPAR�; control) sequence. The ARE-binding site can be competed with excess of unlabeled XRE sequence andthe other way around. B, supershift of labeled UGT1A10 oligonucleotides with the addition of specific antibody for AhR and Nrf2. A supershift of UGT1A10 XRE-and ARE-binding site with AhR as well as Nrf2 antibody (Ab) suggests binding of both transcription factors to both sites. C, electrophoretic mobility shift assayfor UGT1A10 XRE-136 binding element. A supershifted band is observed with both AhR and Nrf2 antibody, and XRE-136 site can be competed with an excessof unlabeled ARE-149 sequence.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

knockdown studies. Whether additional proteins are involvedin this binding will require additional studies.The findings of this study are of importance for the under-

standing of the metabolic defense against xenobiotics and oxi-dative stress. Nrf2 is critical for cytoprotection by initiating theactivation of detoxification genes, which is relevant for thepathogenesis of toxicity reactions and inflammatory diseases.This activation is likely to determine the susceptibility to oxi-dative and chemical-induced injury. In addition, xenobioticsactivate the AhR pathway, which regulatesmetabolism by cyto-chrome P450 and, as shown previously as well as in this study,also of detoxification enzymes such as the UGT (38–40). Forcellular homeostasis, a critical balance between oxidativemetabolism and detoxification, i.e. by glucuronidation, is criti-cal. According to the data provided here, in cell culture exper-iments, the regulation of UGTs expressed in the mucosa of thedigestive tract, which is continuously exposed to xenobiotics,can proceed directly by xenobiotics using XRE-binding motifs,and indirectly, when ROS have been generated by oxidativemetabolism using ARE-binding motifs. This way, both AhR-and Nrf2-mediated signal transduction influences detoxifica-tion by glucuronidation. Their coordinated influence on thiscritical mechanism of cellular defense is therefore biologicallyplausible and conclusively demonstrated in this study. Coordi-nated regulationwas shown forUGT1A8 andUGT1A10, whichin humans are expressed in esophagus, small intestine, andcolon.In summary, this study identifies and characterizes the coor-

dinated regulation of UGT1A8 and UGT1A10 by the oxidativestress sensor Nrf2 and the xenobiotics-induced AhR, includingthe identification of the responsible DNA-binding elements. Incontrast to the regulation of human UGT1A9, UGT1A8 andUGT1A10 require the simultaneous presence of Nrf2 and AhR.These data provide an important link between xenobiotic anddrug metabolism, oxidative stress, cellular defense and, poten-tially, between toxicity and disease disposition. The elucidationof the biological mechanisms of cellular defense is of value forthe future development of specific therapeutic strategies ofmodulating oxidative stress and cellular injury for the preven-tion of inflammatory and neoplastic diseases.

REFERENCES1. Dhakshinamoorthy, S., Long, D. J., 2nd, and Jaiswal, A. K. (2000)Curr. Top

Cell Regul. 36, 201–2162. Jaiswal, A. K. (2000) Free Radic Biol. Med. 29, 254–2623. Ward, J. F. (1994) Int. J. Radiat Biol. 66, 427–4324. Goetz, M. E., and Luch, A. (2008) Cancer Lett 266, 73–835. Strassburg, C. P., Manns, M. P., and Tukey, R. H. (1997) Cancer Res. 57,

2979–29856. Auten, R. L., O’Reilly, M. A., Oury, T. D., Nozik-Grayck, E., andWhorton,

M. H. (2006) Am. J. Physiol. Lung Cell Mol. Physiol. 290, L32–407. Ho, Y. S., Xiong, Y.,Ma,W., Spector, A., andHo, D. S. (2004) J. Biol. Chem.

279, 32804–328128. Koo, H. C., Davis, J. M., Li, Y., Hatzis, D., Opsimos, H., Pollack, S., Strayer,

M. S., Ballard, P. L., and Kazzaz, J. A. (2005) Am. J. Physiol. Lung Cell MolPhysiol. 288, L718–726

9. Holtzclaw, W. D., Dinkova-Kostova, A. T., and Talalay, P. (2004) Adv.Enzyme Regul. 44, 335–367

10. Strassburg, C. P., Kalthoff, S., and Ehmer,U. (2008)Crit. Rev. Clin. Lab. Sci.45, 485–530

11. Gregory, P. A., Lewinsky, R. H., Gardner-Stephen, D. A., and Mackenzie,P. I. (2004)Mol. Pharmacol. 65, 953–963

12. Breimer, L. H. (1990)Mol. Carcinog. 3, 188–19713. Venkatraman, M., Konga, D., Peramaiyan, R., Ganapathy, E., and Dhana-

pal, S. (2008) Biol. Pharm. Bull. 31, 1639–164514. Strassburg, C. P.,Manns,M. P., and Tukey, R. H. (1998) J. Biol. Chem. 273,

8719–872615. Mojarrabi, B., and Mackenzie, P. I. (1998) Biochem. Biophys. Res. Com-

mun. 247, 704–70916. Iyer, L. V., Ho, M. N., Shinn, W. M., Bradford, W. W., Tanga, M. J., Nath,

S. S., and Green, C. E. (2003) Toxicol. Sci. 73, 36–4317. Dellinger, R.W., Chen,G., Blevins-Primeau, A. S., Krzeminski, J., Amin, S.,

and Lazarus, P. (2007) Carcinogenesis 28, 2412–241818. Nishiyama, T., Fujishima, M., Masuda, Y., Izawa, T., Ohnuma, T., Ogura,

K., and Hiratsuka, A. (2008) Arch. Biochem. Biophys. 478, 75–8019. Yu, X., and Kensler, T. (2005)Mutat Res. 591, 93–10220. Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J. D., and

Yamamoto, M. (1999) Genes Dev. 13, 76–8621. Venugopal, R., and Jaiswal, A. K. (1998) Oncogene 17, 3145–315622. Marini, M. G., Chan, K., Casula, L., Kan, Y.W., Cao, A., andMoi, P. (1997)

J. Biol. Chem. 272, 16490–1649723. Nguyen, T., Sherratt, P. J., and Pickett, C. B. (2003)Annu. Rev. Pharmacol.

Toxicol. 43, 233–26024. Petrulis, J. R., and Perdew, G. H. (2002) Chem. Biol. Interact 141, 25–4025. Whitlock, J. P., Jr. (1990) Annu. Rev. Pharmacol. Toxicol. 30, 251–27726. Munzel, P. A., Schmohl, S., Buckler, F., Jaehrling, J., Raschko, F. T., Kohle,

C., and Bock, K. W. (2003) Biochem. Pharmacol 66, 841–84727. Yeager, R. L., Reisman, S. A., Aleksunes, L. M., and Klaassen, C. D. (2009)

Toxicol. Sci. 111, 238–24628. Miao, W., Hu, L., Scrivens, P. J., and Batist, G. (2005) J. Biol. Chem. 280,

20340–2034829. Videan, E. N., Heward, C. B., Chowdhury, K., Plummer, J., Su, Y., and

Cutler, R. G. (2009) Comp. Med. 59, 287–29630. Segal, B. H., Davidson, B. A., Hutson, A. D., Russo, T. A., Holm, B. A.,

Mullan, B., Habitzruther, M., Holland, S. M., and Knight, P. R., 3rd. (2007)Am. J. Physiol. Lung Cell Mol. Physiol. 292, L760–768

31. Reddy, V. P., Zhu, X., Perry, G., and Smith, M. A. (2009) J. Alzheimers Dis.16, 763–774

32. Nguyen, T., Sherratt, P. J., Huang, H. C., Yang, C. S., and Pickett, C. B.(2003) J. Biol. Chem. 278, 4536–4541

33. Itoh, K., Tong, K. I., and Yamamoto, M. (2004) Free Radic Biol. Med. 36,1208–1213

34. Ramos-Gomez, M., Kwak, M. K., Dolan, P. M., Itoh, K., Yamamoto, M.,Talalay, P., and Kensler, T. W. (2001) Proc. Natl. Acad. Sci. U.S.A. 98,3410–3415

35. Chan, K., and Kan, Y. W. (1999) Proc. Natl. Acad. Sci. U.S.A. 96,12731–12736

36. Cheng, Z., Radominska-Pandya, A., and Tephly, T. R. (1998) Arch. Bio-chem. Biophys. 356, 301–305

37. Vasiliou, V., Puga, A., Chang, C. Y., Tabor, M. W., and Nebert, D. W.(1995) Biochem. Pharmacol 50, 2057–2068

38. Quattrochi, L. C., and Tukey, R. H. (1993)Mol. Pharmacol. 43, 504–50839. Lankisch, T. O., Gillman, T. C., Erichsen, T. J., Ehmer, U., Kalthoff, S.,

Freiberg, N., Munzel, P. A., Manns, M. P., and Strassburg, C. P. (2008)Arch. Toxicol. 82, 573–582

40. Erichsen, T. J., Ehmer, U., Kalthoff, S., Lankisch, T. O., Muller, T. M.,Munzel, P. A., Manns, M. P., and Strassburg, C. P. (2008) Toxicol Appl.Pharmacol. 230, 252–260




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

StrassburgSandra Kalthoff, Ursula Ehmer, Nicole Freiberg, Michael P. Manns and Christian P.

UDP-glucuronosyltransferase 1A10Hydrocarbon Receptor in the Regulation of the Human Phase II Detoxifying

Interaction between Oxidative Stress Sensor Nrf2 and Xenobiotic-activated Aryl

doi: 10.1074/jbc.M109.075770 originally published online January 6, 20102010, 285:5993-6002.J. Biol. Chem.

10.1074/jbc.M109.075770Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2010/01/05/M109.075770.DC1

http://www.jbc.org/content/285/9/5993.full.html#ref-list-1

This article cites 40 references, 11 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M109.075770

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;285/9/5993&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/9/5993

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=285/9/5993&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/285/9/5993

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2010/01/05/M109.075770.DC1

http://www.jbc.org/content/285/9/5993.full.html#ref-list-1

http://www.jbc.org/

InteractionbetweenOxidativeStressSensorNrf2and Xenobiotic ... · ing the process of xenobiotic...

Documents

Transcript of InteractionbetweenOxidativeStressSensorNrf2and Xenobiotic ... · ing the process of xenobiotic...