Insulin Modulates Intracellular Apolipoprotein B mRNA ... · ii . Insulin Modulates Intracellular...

Insulin Modulates Intracellular Apolipoprotein B mRNA Traffic

into RNA Granules/Cytoplasmic P Bodies: Implications in

Translational Control

by

Navaz Karimian Pour

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Biochemistry

Faculty of Medicine

University of Toronto

©Copyright by Navaz Karimian Pour 2012

ii

Insulin Modulates Intracellular Apolipoprotein B mRNA Traffic into RNA Granules/ Cytoplasmic P Bodies: Implications in Translational Control

Navaz Karimian Pour

Master of Biochemistry

Department of Biochemistry University of Toronto

2012

Abstract

Apolipoprotein B (ApoB) synthesis is partially regulated at the translational level;

however, the molecular mechanisms that govern translational control of apoB mRNA

remains largely unknown. We imaged intracellular apoB mRNA traffic and determined

whether insulin silences apoB mRNA translation by trafficking into translationally-silenced

cytoplasmic RNA granules called Processing Bodies (PBS). ApoB mRNA was visualized by

using a strong interaction between the bacteriophage MS2 protein and a specific phage RNA

sequence that binds MS2 protein. We observed a statistically significant increase in the

localization of apoB mRNA into PBs, 4h, 8h, and 16h after insulin treatment. Conversely,

acute insulin treatment (1h) did not show any significant effect. Insulin was also found to

reduce polysomal association of apoB mRNA 4h and 16h post treatment in HepG2 cells.

Overall, our data suggest that chronic insulin treatment silences apoB translation in HepG2

cells by localizing apoB mRNA into PBs and reducing translationally-competent mRNA

pools.

iii

Table of Contents

Abstract .................................................................................................................................................. ii

Table of Contents .................................................................................................................................. iii

List of Figures ....................................................................................................................................... vi

List of Tables....................................................................................................................................... viii

List of abbreviations .............................................................................................................................. ix

I. Introduction ......................................................................................................................................... 1

1.1 Introduction to Lipoproteins......................................................................................................... 1

1.2 Apolipoprotein B .......................................................................................................................... 1

1.2.1 The Importance of Studying ApoB ....................................................................................... 2

1.2.2 Structural Features of Human ApoB Gene, mRNA, and Protein .......................................... 3

1.2.3 ApoB Protein Function and Importance ................................................................................ 6

1.2.4 Hepatic Regulation of ApoB Gene Expression ..................................................................... 6

1.3 Role of Insulin in Metabolic Regulation of ApoB ..................................................................... 12

1.3.1 Insulin Signaling Pathways Involved in ApoB Biosynthesis and Regulation ..................... 13

1.3.2 ApoB Overproduction in Insulin Resistance States (Type 2 Diabetes and Obesity) .......... 14

1.4 The Process of mRNA Translation ............................................................................................ 15

1.4.1 Translation Initiation ........................................................................................................... 15

1.4.2 Translation Elongation ........................................................................................................ 16

1.4.3 Translation Termination ...................................................................................................... 16

1.5 Translational Control ................................................................................................................. 16

1.6 The RNA Journey in the Cytosol ............................................................................................... 18

1.7 Localization of RNA in the Cytoplasm ...................................................................................... 19

1.7.1 Cytoplasmic RNA Granules ................................................................................................ 19

1.7.2 Stress Granules (SGs).......................................................................................................... 20

1.7.3 Processing Bodies (PBs) ..................................................................................................... 20

1.8 Rationale for the Current Studies ............................................................................................... 21

1.8.1 Objective ............................................................................................................................. 24

1.8.2 Hypothesis ........................................................................................................................... 24

1.8.3 Specific Aims ...................................................................................................................... 25

II. Materials and Methods .................................................................................................................... 26

iv

2.1 Polysomal Profiling .................................................................................................................... 26

2.1.1 Cell Culture ......................................................................................................................... 26

2.1.2 Insulin Treatment and Cell lysis .......................................................................................... 26

2.1.3 Sucrose Gradient and Ultracentrifugation ........................................................................... 27

2.1.4 Sucrose Gradient Fractionation ........................................................................................... 27

2.1.5 Total RNA Extraction, cDNA Synthesis, and Real-Time PCR .......................................... 28

2.1.6 Statistic Analysis ................................................................................................................. 29

2.2 Cytoplasmic RNA Granules ....................................................................................................... 31

2.2.1 Preparation of LB Media and LB Plates ............................................................................. 31

2.2.2 Plasmids .............................................................................................................................. 31

2.2.3 Transformation and Plasmid DNA Amplification .............................................................. 33

2.2.4 Restriction Enzyme Digestion ............................................................................................. 34

2.2.5 Gel extraction ...................................................................................................................... 34

2.2.6 Ligation Reaction ................................................................................................................ 35

2.2.7 Construction of pCMV-MS2bs-24X-cyto Plasmid ............................................................. 35

2.2.8 Construction of pCMV-5’URT-apoB15%-3’UTR-MS2-24X-cyto Chimeric Plasmid ...... 35

2.2.9 Direct DNA Sequencing...................................................................................................... 36

2.2.10 Transient Transfection Experiments ................................................................................. 36

2.2.11 Preparation of Collagen Coated plates .............................................................................. 37

2.2.12 GFP Expression and Insulin Treatment............................................................................. 38

2.2.13 Immunostaining Experiments ........................................................................................... 38

2.2.14 Confocal Microscopy Imaging .......................................................................................... 39

2.2.15 Using hDCP1a, a Second Primary Antibody, to Detect P bodies ..................................... 39

2.2.16 Puromycin Treatment ........................................................................................................ 39

2.2.17 Statistical Analysis of Imaging Data ................................................................................. 40

III. Results ............................................................................................................................................ 41

3.1 Polysome Profiling ..................................................................................................................... 41

3.1.1 Results of Constructing a Linear Sucrose Gradient ............................................................ 41

3.1.2 Effect of Insulin on apoB mRNA Translation ..................................................................... 42

3.1.3 Under conditions that inhibit apoB mRNA polysomal association, insulin acutely stimulates global translation ......................................................................................................... 46

3.1.4 Effect of Insulin on Beta-2-microglobulin mRNA Distribution (as a control) ................... 47

v

3.1.5 Determination of ApoB mRNA Abundance and Optimization of Real Time PCR Experiments using Internal Controls ............................................................................................ 49

3.1.6 Effect of Acute Insulin Treatments on ApoB mRNA Translation (Data Normalized to Internal Control Gene) ................................................................................................................. 52

3.1.7 Effect of Chronic Insulin Treatments on ApoB mRNA Translation (Data Normalized to Internal Control Genes) ................................................................................................................ 54

3.1.8 Effect of Insulin on Polysomal Distribution of Beta-2-microglobulin mRNA ................... 56

3.2 Translational Control of ApoB mRNA: Role of Cytoplasmic Ribonucleoproteins ................... 57

3.2.1 Construction of pCMV-MS2bs-24X-cyto Plasmid ............................................................. 57

3.2.2 Construction of pCMV-5’UTR-ApoB15%-3’UTR-MS2bs-24X-cyto Chimeric Plasmid .. 60

3.2.3 Detection of P Bodies (PBs) in HepG2 Cells and the Influence of Puromycin on PB formation ...................................................................................................................................... 62

3.2.4 Employing the MS2 Tagging System to Visualize ApoB mRNA in HepG2 Cells ............ 65

3.2.5 Transfection of HepG2 Cells with pMS2-GFP-SV40 NLS Plasmid .................................. 66

3.2.6 Insulin Induces Co-localization of ApoB mRNA with P Bodies ........................................ 69

3.2.7 Insulin does not affect the Co-localization of Beta-Globin mRNA with P Bodies ............. 71

3.2.8 Statistical Analysis .............................................................................................................. 75

IV. Discussion ...................................................................................................................................... 77

4.1 Polysome Profiling ..................................................................................................................... 78

4.2 Storage of ApoB mRNA in Cytoplasmic RNA Granules .......................................................... 80

4.3 Postulated Mechanism of Insulin Modulation of ApoB mRNA Traffic into P bodies .............. 85

V. Conclusions ..................................................................................................................................... 88

VI. Future Directions ........................................................................................................................... 90

Reference List ...................................................................................................................................... 91

Appendix ............................................................................................................................................ 104

vi

List of Figures

Figure 1 Schematic diagram of the pentapartite structural model of apoB and a three-dimensional consensus

model for LDL ............................................................................................................................................... 5

Figure 2 Synthesis of a linear sucrose gradient. ................................................................................................... 42

Figure 3 Effect of short-term insulin treatment on apoB mRNA association with polysomes............................. 44

Figure 4 Effect of long-term insulin treatment on apoB mRNA association with polysomes ............................ 45

Figure 5 Insulin acutely stimulates global mRNA translation in HepG2 cells. .................................................... 47

Figure 6 Effect of long-term insulin treatment on Beta-2-microglobulin mRNA (positive control) association

with polysomes ............................................................................................................................................ 48

Figure 7 Validation of potential internal control genes ........................................................................................ 51

Figure 8 Effect of short-term insulin treatment on apoB mRNA association with polysomes (data normalized to

internal control genes) .................................................................................................................................. 53

Figure 9 Effect of long-term insulin treatment on apoB mRNA association with polysomes (data normalized to

internal control genes) .................................................................................................................................. 55

Figure 10 Effect of long-term insulin treatment on B2M mRNA (positive control) association with polysomes

(Data normalized to internal control genes) ................................................................................................. 56

Figure 11 Construction of pCMV-MS2bs-24X-cyto plasmid. ............................................................................. 59

Figure 12 Construction of pCMV-5’UTR-ApoB15%-3’UTR-MS2bs-24X-cyto plasmid. .................................. 61

Figure 13 Detection of P bodies in the cytoplasm of HepG2 cells. ...................................................................... 63

Figure 14 Effect of puromycin on P body formation ........................................................................................... 64

Figure 15 Construction map of MS2-GFP and apoB mRNA reporter plasmids .................................................. 66

Figure 16 Expression of pMS2-GFP-SV40 NLS vector and the effect of NLS. .................................................. 68

Figure 17 Visualizing apoB mRNA traffic in HepG2 Cells: Long-term exposure to insulin induced co-

localization of apoB mRNA with P bodies .................................................................................................. 70

vii

Figure 18 Visualizing apoB mRNA traffic in HepG2 Cells: Short term exposure to insulin did not induce co-

localization of apoB mRNA with P bodies .................................................................................................. 71

Figure 19 Effect of insulin on the co-localization of beta-globin mRNA with P bodies ...................................... 74

Figure 20 Quantification of apoB mRNA co-localization with P bodies ............................................................. 76

Figure 21 Quantification of beta-globin mRNA co-localization with P bodies ................................................... 76

Figure 22. A proposed model for insulin modulation of apoB mRNA traffic into P bodies ................................ 87

Figure 23 Visualizing apoB mRNA traffic in HepG2 Cells: 4 hour exposure to insulin induced co-localization

of apoB mRNA with P bodies. ................................................................................................................... 104





Figure 26 Visualizing apoB mRNA traffic in HepG2 Cells: 1 hour exposure to insulin din not induce co-

localization of apoB mRNA with P bodies ................................................................................................ 107

Figure 27 Effect of serum starvation on the co-localization of apoB mRNA with P bodies. ............................. 108

Figure 28 Effect of serum starvation on the co-localization of beta-globin mRNA with P bodies .................... 109

Figure 29 Effect of 1hour insulin exposure on the co-localization of beta-globin mRNA with P bodies. ......... 110

Figure 30 Effect of 4 hour insulin exposure on the co-localization of beta-globin mRNA with P bodies. ........ 111

Figure 31 Effect of 8 hour insulin exposure on the co-localization of beta-globin mRNA with P bodies. ........ 112

Figure 32 Effect of 16 hour insulin exposure on the co-localization of beta-globin mRNA with P bodies ....... 113

viii

List of Tables

Table 1 Characteristics of Plasma Lipoproteins. .................................................................................................... 3

Table 2 Primers used in Real Time PCR reactions .............................................................................................. 30

Table 3 List of primers used in PCR reaction to generate proper restriction sites at both ends of the 5’UTR-

apoB15%-3’UTR fragment. ......................................................................................................................... 36

Table 4 Primers used for direct sequencing ......................................................................................................... 37

ix

List of abbreviations

Acronym Definition ACF apobec-1 complementation factor AMEM alpha modification of eagles medium APO Apolipiprotein ApoB apolipoprotein B APOBEC-1 ApoB mRNA editing catalytic subunit 1 ASH1 achaete-Scute Homologue-1 ATCC american Type Culture Collection B2M beta-2-microglobulin BiP binding immunoglobulin protein C/EBP CCAAT/enhancer binding protein Caco-2 human colonic adenocarcinoma cells CBP20 cap-binding protein 20 CCR4-NOT cDNA

carbon catabolite repression 4- Negative on TATA complementary DNA

CE cholesteryl ester CHX cyclohexamide CM chylomicrons COS CV-1 (simian) in Origin, and carrying the SV40 genetic material CPEB cytoplasmic polyadenylation element binding protein Cy3 Cyanine CYFIP1 cytoplasmic FMR1 interacting protein 1 DAPI 4',6-Diamidino-2-Phenylindole Dcp1a mRNA-decapping enzyme 1A DIC differential interference contrast DNA deoxyribonucleic acid DTT dithiothreitol Edc3 enhancer of mRNA-decapping protein 3 eEFs eukaryotic elongation factors eFG elongation factor G EGP contain eIF4E, eIF4G and Pab1 eIFs eukaryotic initiation factors ER endoplasmic reticulum ERAD endoplasmic reticulum associated protein degradation eRFs eukaryotic release factors FBS fetal bovine serum FMRP fragile X mental retardation 1 protein Foxa2 forkhead box protein A2 G3BP Ras-GAP SH3 domain binding protein GAPDH Glyceraldehyde 3-phosphate dehydrogenase

x

Acronym Definition GFP green fluorescent protein gp78 glycoprotein 78 GTP guanosine triphosphate hDcp1 human decapping protein 1 HDL high density lipoproteins HepG2 human hepatoma cell line HIV-1 human immunodeficiency virus type 1 HMBS hydroxymethyl-bilane synthase HNF hepatocyte nuclear factor HPRT1 Hypoxanthine phosphoribosyltransferase 1 hsps heat shock proteins IDL intermediate density lipoproteins IL-6 interleukin 6 IR insulin receptor IRES internal ribosomal entry site IRS insulin receptor substrate LB lysogeny broth LDL low density lipoprotein LDLR low density lipoprotein receptor Lsm1-7 like sm LUC Luciferase MAPK/ERK mitogen-activated protein kinase/extracellular signal regulated kinase mRNA messenger ribonucleic acid mRNP messenger ribonucleoprotein MTP microsomal triglyceride transfer protein Pab1 poly A binding protein PABP poly A binding protein P-body processing body PBs Processing Bodies PBS phosphate buffered saline PCR polymerase chain reaction PERPP post-ER pre-secretory proteolysis PI3-K phosphatidylinositol 3-kinase PKC protein kinase C PUFAs polyunsaturated fatty acids P-value probability value RNA Ribonucleic acid RRF ribosome recycling factor SGs Stress Granules SH3 Hepatocyte nuclear factor SMAD small ‘mothers against’ decapentaplegic SV40 Simian vacuolating virus 40 TG Triglyceride TGF-β Transforming growth factor beta

xi

Acronym Definition TNF tumor necrosis factor tRNA transfer RNA UBC ubiquitin C UTR untranslated regions UTRs untranslated regions VLDL very low density lipoprotein YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein

zeta polypeptide β2M Beta-2-microglobulin

1

I. Introduction

1.1 Introduction to Lipoproteins

Lipoproteins are macromolecular complexes composed of proteins and lipids. They

transport insoluble lipids, such as cholesterol, steroid hormones, bile, and triglycerides

between tissues. These sphere-shaped particles contain a core of insoluble cholesteryl ester

and triglyceride encircled by apoproteins (protein component), amphipathic phospholipids,

and cholesterol (1). The interactions of lipoproteins with cell surface receptors are mediated

by the apolipoproteins. Lipoproteins are synthesized by the liver and intestine and based on

their sizes and densities are classified into five major groups: chylomicrons (CM), very low

density lipoproteins (VLDL), intermediate density lipoproteins (IDL), low density

lipoproteins (LDL), and high density lipoproteins (HDL) (Table 1) (2). The focus of this

thesis project was on apolipoprotein B (apoB) which is the major protein component of the

atherogenic LDL particle (2).

1.2 Apolipoprotein B

Apolipoprotein B is a large amphipathic protein that is synthesized by the liver and

the intestine. In humans full-length apolipoprotein B (apoB100) is expressed by the liver and

is the main scaffold protein constituent of cholesterol rich VLDL, and LDL. A truncated

form of apoB containing 48% of the full length (apoB48) is expressed by the small intestine

and is crucial for absorption of dietary fat and chylomicron formation (3). ApoB plays an

essential role in synthesis, secretion and trafficking of lipoproteins (4). Moreover, ApoB100

http://www.answers.com/topic/cholesterol�

http://www.answers.com/topic/hormone�

http://www.answers.com/topic/triglycerides-1�

http://www.answers.com/topic/ester�

http://www.answers.com/topic/mediate�

2

mediates the binding of LDL to LDL receptor (LDLR) and facilitates the plasma clearance of

LDL (5-7).

1.2.1 The Importance of Studying ApoB

Atherosclerosis is the major cause of cardiovascular disease world-wide, and there is

a positive correlation between the augmented levels of LDL and VLDL in the circulation and

the development of coronary heart disease. Accumulation of cholesterol-rich LDL particles

in the intima of arterial vessels is a critical underlying mechanism that occurs during early

stage of plaque formation in atherosclerosis (8). Since apoB is the essential structural protein

component of the atherogenic LDL and VLDL, overproduction of apoB containing

lipoproteins causes dyslipidemia followed by the development of atherosclerosis and

coronary artery heart disease (9). Therefore, studying the regulation of synthesis and

secretion of apoB has been of significant interest for many years.

3

Table 1 Characteristics of Plasma Lipoproteins [Adapted from reference (2)]. TG: Triglyceride; CE: Cholesteryl Ester.

Lipoprotein

Calss

Density (g/mL) Size (nm)

Major lipids Major

Apoproteins

CM <0.93 100-500 Dietary TGs B48, C-II, E

VLDL 0.93-1.006 30-80 Endogenous

TGs

B100, CII, E

IDL 1.006-1.019 25-50 CEs and TGs B100, E

LDL 1.019-1.063 18-28 CEs B100

HDL 1.063-1.210 5-15 CEs A, C-II, E

1.2.2 Structural Features of Human ApoB Gene, mRNA, and

Protein

The human apoB gene is located on chromosome 2 and spans over 43 kb (10;11). It

consists of 29 exons and 28 introns (12), and is transcribed to a 14.121 kb mRNA. The

5’untraslated region (UTR) and the 3’UTR of the mRNA are composed of 128 nucleotides

and 304 nucleotides, respectively (13;14). The 5’UTR region has 76% GC content and is

predicted to be able to make stable secondary structure (15). ApoB is mostly expressed in the

liver and intestine although a low level expression has been detected in the heart (16-18).

Translation of apoB mRNA is very tissue specific: human liver generates a full length form

of apoB called apoB100 that contains 4536 amino acids including a 27 residue signal peptide

(19), whereas human enterocytes produce apoB48. ApoB48 consists of 48% of the full

4

length apoB from the N-terminus (20). This truncated form of apoB is generated due to a

posttranscriptional editing process that converts a glutamine codon at amino acid 2153

(CAA) to a stop codon (UAA) as a result of a deamination reaction at nucleotide 6666

(21;22). The expected molecular mass of full length apoB is 514 kDa while its real molecular

weight is around 550 kD caused by posttranslational modifications such as glycosylation,

phosphorylation, and acylation (19;23-26).

ApoB is capable of recruiting lipids and functions as a lipid transporter vehicle in the

plasma; this is mainly due to its amphipathic polypeptide structure. Despite several attempts,

scientists have not been able to obtain a high resolution apoB structure. This is mostly

because of its hydrophobic makeup and large size (27-30). On the other hand, computational

studies, circular dichroism and infrared spectroscopy propose a pentapartite domain structure

(31). This model predicts a globular βα1 domain at the very N-terminus that extends the first

15-20% of the polypeptide. This domain plays a very important role in lipid acquisition

during the lipid assembly process and is followed by amphipathic β1 domain. This domain

spans over 20%-40% of the length of the protein. α2 domain is next which is an amphipathic

helix, continued by a β2 domain that has the LDLR binding affinity. α3 domain is located at

the very C-terminus end of the polypeptide (Figure1) (3;31;32).

5

A

B

Figure 1 Schematic diagram of the pentapartite structural model of apoB and a three-dimensional consensus model for LDL. A: Illustrates the pentapartite structural model of apoB100: NH2-βα1-β1-α2-β2-α3-COOH composed of alternating α helices and β sheets. B: Left figure demonstrates the anticipated distribution of lipids in an LDL particle. Surface phospholipids are shown in yellow, whereas, core lipid is in red. Green represents phospholipids, and amphipathic β sheets are in blue. Right figure represents the proposed organization of apoB100 on an LDL particle surface. β sheets and α helices are in blue and red, respectively [Adapted from reference (31)].

6

1.2.3 ApoB Protein Function and Importance

The most important function of apoB is to transport lipids and lipid soluble vitamins

from dietary fat and lipid storage tissues to tissues in demand. ApoB100 is also capable of

binding to LDL receptor (LDLR) and mediates endocytosis and plasma clearance of LDL.

Regulation of apoB synthesis is very crucial and both increased and reduced circulating

levels of apoB are known as risk factors for life threatening complications. For example, a

high plasma level of apoB is highly associated with dyslipidemia and increased risk of

cardiovascular disease. On the other hand, having too little apoB, observed in

hypobetalipoproteinemic patients, is linked to hepatic steatosis (33). In addition, apoB

knockdown is embryonic lethal (34;35).

1.2.4 Hepatic Regulation of ApoB Gene Expression

ApoB is constitutively expressed in the liver and shows relatively constant levels of

transcript under most metabolic stimuli (36-41). There is often more apoB protein

synthesized than secreted, signifying the importance of posttranslational degradative

mechanisms in regulating the secretion of this protein (42). Nonetheless, there is evidence

showing that apoB synthesis is regulated at the levels of transcription, translation, co-

translational proteasomal degradation and post-translational proteolysis.

7

1.2.4.1 Transcriptional Regulation of ApoB

Cell culture experiments using promoter reporter constructs revealed many cis-acting

sequences that play an important role in the regulation of apoB gene expression. For

example, the sequence spanning -150 and +124 of apoB promoter moderates gene expression

of the reporter in hepatic and intestinal cell lines (43-45). Some transcription factors that are

abundantly found in the liver such as, hepatic nuclear factor-3, -4 (HNF-3 and HNF-4) have

been found to bind to this region. In a study in HepG2 cells, Human hepatoma cell line, it

was shown that the region between +43 and +53 particularly up-regulated apoB gene

transcription (46;47) with a G nucleotide at +51 playing a crucial role (47). On the other

hand, the sequence extending between +20 and +40 appears to be important for down-

regulation of gene expression (46). In addition, it has been shown that some intronic regions,

such as a 443 bp segment within intron 2 and a 155 bp segment within intron 3 improve

apoB promoter activity in HepG2 and CaCo2, heterogeneous human epithelial colorectal

adenocarcinoma cells, cell lines (43-45).

Comparison of apoB gene expression data obtained from in vivo models to that

obtained from cell culture has shown some differences. For example, studies in transgenic

mice showed that the apoB promoter alone is inadequate to control apoB gene transcription

and that a 443 bp enhancer sequence within the second intron and also a fragment upstream

of the apoB promoter (-899 to -5262) are both essential for a high level of apoB expression

in the liver (48). Interestingly, the cis regulatory elements that modulate transcription of

apoB in the intestine are entirely different from their counterparts in the liver. For instant, the

second intron enhancer and the -899 to -5262 region are not important for human apoB gene

transcription in the liver (49). However, the 54-62 kb region upstream of the apoB gene plays

http://en.wikipedia.org/wiki/Heterogeneous�

http://en.wikipedia.org/wiki/Epithelium�

http://en.wikipedia.org/wiki/Colon_%28anatomy%29�

http://en.wikipedia.org/wiki/Adenocarcinoma�

8

an important role (50). There is a 315 bp sequence located 56 kb upstream of the apoB gene

that enhances apoB gene transcription in the intestine. Some intestinal transcription factors,

such as HNF-4, HNF-3β, and CCAAT/enhancer binding protein (C/EBPβ) interact with this

region (51). Moreover, in a study that involved transient transfection experiments and

transgenic mice models a 485 bp fragment was identified upstream of the 315 bp region that

improves intestinal apoB promoter activity. This region contains an HNF-4/ARP-1 binding

site (52). In addition, another transcription factor, SMAD, that mediates TGF-β signaling

likely binds to this region in CaCo2 cells, heterogeneous human epithelial colorectal

adenocarcinoma cells (53). Finally, a 1031 bp sequence located 1.2 kb downstream of the

315 bp fragment enhanced apoB gene expression in transgenic intestine models but not in

cell culture experiments (49).

As pointed out above, under different metabolic stimuli apoB transcript level remains

realitively constant in cell culture experiments (40). Nevertheless, new data suggests that

under certain circumstances apoB gene transcription and apoB mRNA levels may change.

For example, when HepG2, Human hepatoma cell line, and Huh cells, hepatocyte derived

cellular carcinoma cell line, were incubated with palmitate (a free fatty acid) for 48 hours

apoB mRNA levels were up-regulated (54). Conversely in another study treatment with a

combination of interlukin (IL)-1, IL-6, and tumor necrosis factor alpha (TNFα) reduced apoB

mRNA levels (55). Moreover, TNF β has been shown to modulate apoB transcript level in

HepG2 and CaCo-2 cells (56). These factors activate intracellular signaling cascades that

modify gene expression and affect transcription of many genes including apoB.

http://en.wikipedia.org/wiki/Heterogeneous�

http://en.wikipedia.org/wiki/Epithelium�

http://en.wikipedia.org/wiki/Colon_%28anatomy%29�

http://en.wikipedia.org/wiki/Adenocarcinoma�

9

1.2.4.2 Post Transcriptional Regulation of ApoB

ApoB mRNA undergoes an editing process in the small intestine of all mammals and

in the liver of rats, mice, dogs, and horses (57). Editing is performed by a 27 kDa enzyme

called apoB mRNA editing complex-1 (apobec-1). Apobec-1 binds to a 11 nucleotide long

AU-rich mooring sequence 5 base pair downstream of cytidine 6666 in apoB mRNA.

Apobec-1 then deaminase this cytidine and converts it to uridine. As a result, a Glutamine

codon (CAA) is converted to a stop codon (UAA) and a truncated form of apoB protein

containing 48% of the full length is produced (20;58-62).

1.2.4.3 Translational Regulation of ApoB

There is ample evidence demonstrating that apoB synthesis could be regulated at the

translational level; for example, under some metabolic stimuli such as carbohydrate overload

or a fasting state apoB secretion changed with no change at the mRNA level (63). In another

study, primary hepatocytes of streptozotocin-induced diabetic rats showed a dramatic

reduction of apoB synthesis while mRNA levels remained constant (41). In addition, in vitro

translation of the 14 kb apoB mRNA showed a reduction in translational efficiency by 52.6%

in response to insulin while the mRNA level remained stable (64).

It is well known that apoB synthesis is regulated by insulin (64;65). Although insulin

is believed to promote global mRNA translation in the cell, it has a unique inhibitory effect

on apoB mRNA translation. This unusual response of apoB mRNA to insulin has recently

been linked to its 5’UTR sequence (15;66). Computational analysis predicted the formation

of highly structured secondary hairpin structures at the 5’UTR of apoB mRNA that are

essential for optimal translation of this protein (66). An insulin sensitive protein factor with a

10

molecular weight of 110 kD (p110) has been detected that interacts with the 5’UTR of apoB

mRNA (15). It has also been shown that insulin inhibits the interaction of p110 with the

5’UTR region. This suppression was later shown to be mediated by the phosphotidylinositol

3-kinase (PI3-K)-mTOR pathway (67;68). In constrast, binding of p110 to the 5’UTR is

promoted by the protein kinase C (PKC) activation (68). PKC activation is also associated

with the development of insulin resistant state. Increased apoB mRNA translation could thus

be one contributing factor in apoB overproduction that associates with insulin resistance.

1.2.4.4 Co-Translational Proteasomal Degradation of ApoB

ApoB is synthesized on rough endoplasmic reticulum (ER) membrane bound

ribosomes. Due to the existence of a signal peptide at the N-terminus of apoB, the nascent

polypeptide chain is directly translocated into the ER. With the help of microsomal

triglyceride transfer protein (MTP) newly synthesized apoB associates with lipids co-

translationally and primordial dense lipoprotein particles are formed (69). The availability of

lipids regulates apoB assembly and secretion while it is being translocated into the ER

(9;70). When there are adequate amounts of phospholipids, cholesterol, cholesteryl ester and

triglyceride, apoB is properly assembled into VLDL particles. However, if there is

insufficient supply of lipids, the translation is paused and a large amount of newly

synthesized apoB proteins are targeted for degradation before secretion (32;71). As opposed

to many secretory proteins apoB levels are mainly regulated by means of degradation

(72;73). Insufficient lipid availability targets apoB for ER-associated degradation (ERAD)

mediated by the cytosolic ubiquitin-proteasome apparatus. In this system, misfolded proteins

are tagged by a poly-ubiquitin chain that is recognizable by the ERAD machinery (74).

11

Tagged proteins interact with proteasomes and are targeted for degradation (75). Available

evidence suggests that the C-terminus of apoB is exposed to the cytosol during translocation

into the ER. If needed, this region is ubiquitinated by gp78, an E3 ubiquitin ligase (76). Other

factors that play important roles in recognition, tagging and degradation of the misfolded

apoB protein include cytosolic heat shock proteins 70 and 90 (Hsp70 and Hsp90) (77-79),

and binding immunoglobulin protein (Bip), an ER luminal chaperone (80).

1.2.4.5 Post-Translational non-Proteasomal Degradation of ApoB

In addition to ER- associated proteosomal degradation of apoB which takes place

when lipids are limiting, intracellular degradation of misfolded apoB is also carried out by

post-ER pre-secretory proteolysis (PERPP). Abundant evidence shows that apoB undergoes

non-proteasomal proteolysis once it is safely translocated into the ER (81-85). Degradation

of apoB through PERPP takes place when TG availability is normal. PERPP targets large

aggregates of apoB that are formed as a result of extensive damage by oxidative stress after

translation, perhaps upon its exit from the ER. PERPP prevents secretion of misfolded apoB

that forms late in the secretory pathway, whereas proteosomal degradation would be a

response to co-translational misfolding of apoB.

It has recently been shown that dietary polyunsaturated fatty acids (PUFAs) reduced

VLDL secretion when the lipid supply was abundant (thus the process was not through

ERAD that typically occurs when lipid supply is inadequate). In fact ω-3 polyunsatuarated

fatty acids which are susceptible to oxidative stress owing to their double bounds induce

PERPP (84;85). PUFAs are not the only factors that trigger PERPP of apoB, an acute rise in

insulin both in vivo and in cell culture diminished apoB secretion and VLDL production

12

through a post-ER but non-proteasomal pathway (65;86). This process is probably mediated

by PERPP since insulin sensitivity could be improved by PUFA rich diets (87;88).

Autophagy has been shown to be involved in PERPP. Autophagy typically involves

formation of an autophagosome around damaged material such as, cytosolic proteins,

organelles, organell fragments, and aggregated proteins and happens under normal condition.

Autophagosomes later fuse with lysosomes to form autophagolysosomes in which apoB or

other material would be degraded. Therefore, autophagy prevents oxidized apoB and lipid

peroxides exiting from the cell where they could have toxic consequences. Although

autophagy is a normal process within cells, it can be stimulated under pathological conditions

such as starvation or oxidative stress.

Both proteasome-mediated ERAD and autophagy pathways are capable of degrading

misfolded proteins; however, the proteasome appears to prefer monomeric substrates while

autophagosomes are generally involved in the degradation of protein aggregates. ER stress

could provoke both pathways (89-91).

1.3 Role of Insulin in Metabolic Regulation of ApoB

Insulin is a metabolic hormone produced by pancreatic β-cells. Its main target tissues

are: liver, adipose tissue, and muscle. Insulin is known to inhibit gluconeogenesis, reduce

glycogen hydrolysis in the liver and increase glucose uptake in the adipose tissue and

muscle. It also suppresses TG breakdown in adipose tissue, and increases lipid synthesis in

liver and adipose tissue (3). Hepatic apoB and TG secretions have been shown to be inhibited

by insulin in rat hepatocytes, human hepatocytes and HepG2 cells, Human hepatoma cell

13

line, (65;92-96). Insulin stimulates TG synthesis (96) and does not limit lipid availability,

therefore, the inhibitory effect of insulin on TG secretion could be due to a reduction in

VLDL assembly and decreased intracellular association of apoB with lipids (93;97). Insulin

has also been shown to directly regulate apoB synthesis by reducing its translation and

increasing the degradation of newly synthesized apoB (65). Recent studies also show that

insulin could inhibit the fusion of microsomal lipid droplets with apoB and promote apoB

proteolysis which leads to a reduction in VLDL-apoB secretion (93;97).

1.3.1 Insulin Signaling Pathways Involved in ApoB Biosynthesis

and Regulation

Insulin controls apoB secretion via the insulin receptor (IR), which is a tyrosine

kinase (94;98;99). Upon insulin binding the receptor is activated through

autophosphorylation. Activated IR then phosphorylates insulin receptor substrate (IRS)

protein, and consequently phosphatidylinositol 3-kinase (PI3K) is activated (100). Cell

culture studies showed that acute insulin treatment directly suppressed apoB secretion and

this effect was not reliant on exogenous fatty acid supply (93;101). PI3K activation has been

shown to be involved in this process (86;97;99;102) but this is not via activation of Akt1

pathway (103). In fact, the mitogen-activated protein kinase/extracellular signal regulated

kinase (MAPK/ERK) pathway has been implicated in this process (104).

Insulin also regulates apoB degradation indirectly through mitogen activated protein

(MTP). Insulin inhibits MTP transcription (partly through the MAPK/ERK signaling

pathway) (105) and also through inhibition of forkhead box protein A2 (Foxa2) (106). If

14

apoB is not properly lipidated due to the lack of MTP it undergoes co-translational

degradation.

Chronic hyperinsulinemia, on the other hand, decreases apoB protein degradation

resulting in increased levels of apoB protein and increased VLDL production (107;108).

Reduction in apoB degradation could be due to an increased MTP level that is observed in

insulin resistance states (107;109).

1.3.2 ApoB Overproduction in Insulin Resistance States (Type 2

Diabetes and Obesity)

Insulin resistance occurs when cells become hyposensitive to insulin, predominantly

in liver, muscle, and adipose tissues (100). Insulin stimulated glucose uptake is the most

important pathway that is defective in this state. Insulin receptor activity, PI3-K activity and

insulin stimulated glucose uptake are decreased in the muscle and adipose tissues of obese

humans (110). Once insulin is not able to clear postprandial glucose efficiently, the pancreas

produces more insulin to compensate for the ineffective insulin. This consequently results in

hyperinsulinemia which is a hallmark of insulin resistance state where hepatic

gluconeogenesis and glucose production are also promoted. Besides glucose metabolism,

insulin contributes to lipid metabolism. Chronic hyperinsulinemia increases free fatty acid

flux (reducing the inhibition of lipolysis in adipose tissue) resulting in an increase in VLDL

production and consequent hypertriglyceridemia (111-114). Hyperinsulinemia, thus, leads to

overproduction of apoB containing lipoproteins, metabolic dyslipidemia

(hypertriglyceridemia, high plasma VLDL, low amount of HDL cholesterol (115), small

dense LDL (116), and ultimately the development of cardiovascular disease (117).

15

1.4 The Process of mRNA Translation

Since the focus of this thesis project was to study the translational control of apoB

mRNA, here, we describe the mechanisms of translation and translational regulation in

eukaryotic cells.

The process of decoding messenger RNA (mRNA) into protein is called translation.

Translation involves three key steps: initiation, elongation, and termination. Regulation at

three different levels of translation results in production of various amounts of different

proteins under diverse physiological states (118).

1.4.1 Translation Initiation

The very early event in eukaryotic translation initiation is the formation of a ternary

complex composed of methionine transfer RNA (Met-tRNAiMet), guanosine 5'-triphosphate

(GTP), and eukaryotic initiation factor 2 (eIF2) (118). This primary complex then recruits

other initiation factors, eIF1, eIF1A, eIF3, eIF5, and 40S ribosomal subunit, and together

they form the 43S pre initiation complex (119). In mammalian cells 48S pre-initiation

complex is then formed through the interaction of eIF3 with eIF4G which is in association

with the 5’ end of the mRNA (120). Presence of m7G-cap-binding complex, composed of

eIF4A, eIF4G, eIF4E, is essential for proper loading of the 48S on the 5’ end of the mRNA

(121). After recruitment to the 5’ end of the mRNA, the 48S complex scans the mRNA

towards the 3’ end in order to find the AUG start codon with the help of helicase. Once the

AUG is recognized, the 60S ribosomal subunit joins with the 40S subunit forming the 80S

ribosome, after which elongation starts.

http://www.google.ca/search?hl=en&lr=&ei=NjHXSquhNonOM7v50ccI&sa=X&oi=spell&resnum=0&ct=result&cd=1&ved=0CAgQBSgA&q=methionine+transfer+RNA&spell=1�

16

1.4.2 Translation Elongation

Polypeptide elongation involves retaining the reading frame, recruiting the correct

aminoacyl tRNAs to the 80S ribosome with the assistance of eEF1A (eukaryotic elongation

factor 1A), forming peptide bounds, and translocating the ribosome which is facilitated by

eEF2 (118).

1.4.3 Translation Termination

Termination is triggered with the recognition of one of the stop codons: UAA, UAG,

or UGA with the help of a protein known as class I release factor (RF) (122;123). In

eukaryotes a unique releasing factor (eRF1) identifies all the three stop codons. eRF1

catalyzes the hydrolysis of the ester bound between the newly synthesized polypeptide and

the tRNA in the P site, and releases the peptide. Class II releasing factor (eRF3 in

eukaryotes) then remove the class 1 RF from the ribosome with the help of GTP hydrolysis

(124). The two ribosomal subunits become dissociated and recycled afterwards with the help

of ribosome recycling factor (RRF) and elongation factor G (eFG) (125).

1.5 Translational Control

Translation can be regulated at all three described levels although most of the

translational control mechanisms known so far function at the level of initiation. A general

regulatory mechanism that shuts down most cap-dependent translations is the binding of the

4E binding protein (4E-BP) family members to eIF4E. Once 4E-BP binds to 4E, 4E-4G

interaction is blocked and translation cannot be initiated (126-128). This way of translation

17

inhibition is independent of the RNA sequence; however, some specific mechanisms can

repress the translation of mRNAs in a manner that is dependent upon the sequence of the

mRNA. In some of these cases, 4E binding proteins are involved; however, these proteins are

recruited to specific mRNAs through their interations with sequence-specific RNA binding

proteins (129-132). In addition, a protein called eIF4E-homologous protein (4E-HP) was

discovered recently that interacts directly with the 5’ cap of the mRNA and does not allow

the binding of the eIF4F complex (133). 4E-HP does not interact with eIF4G and as such

these proteins repress translation by blocking recruitment of the 40S ribosome to the mRNA

(134).

There is another form of translation control that is independent of cap structure and

cap-binding factors. This prevents the binding of 60S subunit to the 40S at AUG codon

(135;136). The exact mechanism of this process is not clear; nonetheless, eIF6 might be

involved (137;138). In addition to translational regulation at the initiation level, there are a few examples

of translational control at the elongation step. It has been shown that elongation factor 2

(eEF2) which is responsible for ribosomal translocation plays an important role in the

suppression of translation (139;140). Once phosphorylated, eEF2 is unable to catalyze

translocation and elongation is repressed (118). When cells start dividing, protein synthesis is

decreased through reduction in elongation rates. Once cells enter G1 they continue rapid

protein synthesis (141), phosphorylation of eEF2 by eEF2 kinase might be involved in this

process (141). In neurons translational control at the elongation level forms the cellular basis

of learning and memory (142).

18

Translation can also be regulated at the termination stage; mRNAs that do not have

an in frame stop codon (nonstop mRNAs) are identified and degraded. In eubacteria, a signal

is sent to a specific tRNA when a ribosome reaches the 3’end of an mRNA lacking proper

stop codon. This tRNA acts as both tRNA and mRNA, and binds to the ribosome. A protein

is synthesized using tmRNA’s open reading frame, and this short newly synthesized peptide

then signals the degradation of this truncated protein (143);(144). In a study involved using

reporter constructs, Akimitsu et al. were able to show that when nonstop mRNAs are present

in mammalian cells, protein production was reduced; however, a decrease in the amount of

the aberrant mRNA or an increase in the degradation of the protein was not observed (145).

Using [14C]-leucine incorporation, different sized short polypeptides were found suggesting

premature ribosome termination (145).

1.6 The RNA Journey in the Cytosol

Cap binding protein 20 (CBP20)-CBP80 complex binds to the mRNA cap while the

mRNA is in the nucleus. Once it enters the cytoplasm this complex is replaced by eukaryotic

translation initiation factor 4E (eIF4E) which is a cytoplasmic cap binding protein. In

somatic cells, newly synthesized mRNAs are assembled into transport RNA granules in the

cytoplasm (146). The RNA binding proteins that present in RNA granules can determine the

fate of mRNAs. For example, recruitment of translation initiation complex followed by

polysomal assembly results in protein synthesis (147), and association of carbon catabolite

repression 4- Negative on TATA (CCR4-NOT1) complex and the consequential

deadenylation leads to mRNA degradation (148). Some mRNAs are destined to be stored for

19

a certain time in the cytoplasm and association of a specific set of RNA binding proteins with

these mRNAs bring about the formation of RNA granules for example, Processing Bodies

(PBs) or Stress Granules (SGs). Depending on future cellular requirements, these stored

mRNAs are targeted for translation or degradation (149). Microtubule motor proteins like

kinesin, dynein, and myosin provide a vehicle to transport RNA granules on actin filaments

within the cytoplasm (150).

1.7 Localization of RNA in the Cytoplasm

Localization of an mRNA in the cytoplasm is one form of controlling gene

expression. This kind of regulation enhances cell’s ability to direct protein synthesis under

certain stimuli without participation of the nucleus (150). Localization of some mRNAs to a

specific cytoplasmic site involves the presence of cis-acting elements within the transcript,

known as zipcodes. Zipcodes are usually located at the 3’UTR although they have been

found at 5’UTR or coding regions in some mRNAs. They vary in length from five

nucleotides to some hundreds. These sequences are often redundant and capable of forming

stem loop secondary structures. Trans-acting RNA binding proteins identify zipcodes and are

involved in localization and translational control of zipcode mRNAs (150).

1.7.1 Cytoplasmic RNA Granules

Cytoplasmic RNA granules have been proposed as the main controllers of post-

transcriptional gene regulation process and epigenetic changes (151). They are classically

divided into 4 groups: germinal granules, stress granules (SGs), processing bodies (PBs), and

neural granules, although other forms of RNA granules have recently been identified. The

20

first is found in germ cells and the latter three exist in somatic cells. They are composed of

various RNAs and proteins. The role of RNA granules is to determine the localization,

stability, and translation of the associated mRNAs (149).

1.7.2 Stress Granules (SGs)

Stress granules are dynamic cytoplasmic foci that form when translation initiation is

impaired under certain conditions such as, decreased translation initiation rates upon stress,

addition of inhibitors of translation initiaton, knockdown of some initiation factors, and

overexpression of translation repressors. Puromycin causes ribosome-mRNA dissociation

and stimulates SG formation, whereas cyclohexamide that stalls ribosome elongation inhibits

SG formation. SGs have mostly been observed in the cytoplasm of plant and mammalian

cells (150), and are mainly composed of mRNAs stalled in the process of translation

initiation. SGs typically contain poly (A)+ ,mRNAs (150), 40S ribosomal subunits, eIF4E,

eIF4G, eIF4A, eIF4B, poly (A) binding protein (PABP), eIF3, and eIF2 (148;156;157;158).

SG composition can vary depending on the cell type and conditions under which they are

formed though. These granules have been predicted to act as a “triage” spot for mRNA

storage, degradation, and translation re-initiation (157).

Similar structures have also been found in yeast cells and are called EGP bodies

(eIF4E, eIF4G, PABP concentration sites). EGP bodies lack eIF3 and small ribosomal

subunits that are present in SGs (148;151-153).

1.7.3 Processing Bodies (PBs)

P bodies are dynamic cytoplasmic RNA-protein structures visible by light

microscopy. They have been observed in vertebrate, invertebrate, yeast, plants and

21

trypanosomes (159). P bodies have at least two functions: first, they host translationally

silenced mRNAs that are capable of re-entering the translation (150;160-162). Second,

mRNAs that are destined for deadenylation and degradation are recruited by P bodies (159).

PBs hold the components of mRNA decay machinery pathway, and are mainly composed of

Dcp1/Dcp2 (decapping enzymes), Dhh1/ RCK/p54, Pat1, Scd6/RAP55, Edc3, the Lsm1-7

complex (activators of decapping), Xrn1 (5’-3’ exonuclease) (149;154), nonsense mediated

decay machinery, miRNA repression system (148;155), staufen, and FMRP (RNA binding

proteins mediating mRNA transport) (150).

1.8 Rationale for the Current Studies

ApoB synthesis is known to be metabolically regulated at multiple levels through

post-transcriptional, co-translational, and post-translational mechanisms (32). Kinetic

analysis of the decay of [3H] uridine-labeled apoB mRNA demonstrated that the half-life of

apoB mRNA was 16 h (Pullinger et al., 1989) in HepG2, Human hepatoma cell line, (40).

ApoB mRNA levels remain stable over a wide variety of conditions that considerably alter

apoB protein levels, suggesting control at the level of translation and posttranslational

mechanisms (Dashti et al., 1989 (163); Pullinger et al., 1989 (40); Adeli et al., 1990 (92);

Theriault et al., 1992 (164); Adeli et al., 1992 (64); Mohammadi et al., 1996 (165); Levy et

al., 1996 (166); Pan et al., 2000 (167)). Early studies demonstrated that insulin-mediated

inhibition of apoB synthesis is at least partially mediated by translational control (Sparks and

Sparks, 1990 (65); Adeli and Theriault, 1992 (64)).

22

A number of other studies have since confirmed translational regulation of apoB

synthesis by insulin and other metabolic regulators (Levy et al., 1996; Pan et al., 2000).

However, the molecular mechanism(s) governing this inhibitory effect at the translational

level have remained largely unknown. Recent studies in our laboratory have revealed

important translational mechanisms of apoB mRNA involving the 5’ untranslated region

(5’UTR). ApoB mRNA has a 5’UTR of 128 nucleotides and a 3’UTR of 304 nucleotides.

Several structural features of apoB mRNA UTR sequences suggest the presence of potential

cis-elements that may interact with putative trans-acting protein factors. A graduate student

in our laboratory recently analyzed the apoB UTR sequences using Mfold, to predict RNA

secondary structure, which revealed elements within the 5' and 3'UTR’s of apoB mRNA with

potential to form secondary structure (66). We assessed the biological activity of the putative

RNA motifs within the UTR sequences and found that 5'UTR motifs are important for

optimal translation of the apoB message. Deletion constructs of the UTR regions of apoB

revealed that the 5'UTR was necessary and sufficient for insulin to inhibit apoB synthesis

(66). Interestingly, although insulin normally activates global translation of cellular protein

synthesis, it has a specific inhibitory effect on apoB mRNA translation. This suggests that

insulin induces a unique signaling cascade that leads to specific inhibition of apoB mRNA

translation despite global translational stimulation. He also demonstrated that insulin may

modulate apoB mRNA translation via changes in the binding of a trans-acting 110-kDa

protein factor to the 5’UTR (15). This putative RNA-binding protein (referred to as p110)

was found to specifically bind the 5’UTR of apoB mRNA, with its binding reduced in the

presence of insulin (15). Interestingly, translational control of apoB mRNA via the 5’UTR

and the binding of the 110 kDa protein factor was found to be regulated by protein kinase C

23

(PKC) signaling cascade (68). Using dual (bicistronic) luciferase constructs, he also

examined the role of internal ribosomal entry (IRES) with respect to the 5'UTR of the apoB

mRNA and found that the apoB 5’UTR possesses IRES activity and basal translational

activity of the apoB mRNA may be partly cap independent (67).

The focus of the current study was to investigate the potential role of cytoplasmic

RNA granules (P bodies) in insulin mediated translational regulation of apoB. P bodies

control the translation of many mRNAs in eukaryotic cells and we postulated that apoB

mRNA is subcellularly compartmentalized in the form of ribonucleoprotein complexes in

RNA granules, which act as a reservoir for translatable mRNA, a process potentially

inhibitable by insulin.

Mature mRNAs in the cytoplasm of eukaryotic cells are associated with a complex

network of ribonucleoprotein particles (mRNPs) (168;169). Early studies of mRNPs showed

the presence of two major proteins (170), a 70-kDa poly(A) binding protein (PABP) (171)

and a 50-kDa protein (p50) responsible for the repressed, nonactive state of mRNAs, such as

globin mRNA within free mRNP particles (172). Recent studies have identified a large

number of other protein components of mRNPs including RNA binding proteins, RNA

helicases, and translational factors (173). Importantly, RNA granules have been identified in

both germ cells and somatic cells that appear to play important roles in mRNA storage,

stability, and translational control. Processing Bodies (PB) are cytoplasmic RNA granules

containing mRNA decay machinery and the RNA-induced silencing complex (149). All

RNA granules contain translationally silenced mRNAs. New evidence suggests a dynamic

interaction between these RNA granules and translationally-active polysomal mRNAs (174),

suggesting that the availability of some mRNAs could be regulated by the rate of release

24

from translationally-silenced mRNAs within RNA granules. It is currently unknown whether

apoB mRNA translation can be controlled by the release of translatable apoB mRNA

transcripts from cytoplasmic stores of mRNPs that are translationally repressed. However,

the long half life of apoB mRNA (16 h) clearly suggests that a significant proportion of the

message may be stored in the cell prior to translation. Interestingly, apoB mRNA polysome

complexes have been reported to show unusual physical properties and exhibit unique

sedimentation behaviors more characteristic of nonpolysomal mRNPs (175) further

suggesting the existence of apoB mRNA in RNA granules.

1.8.1 Objective

The major objective of the present study was to visualize apoB mRNA traffic in

HepG2 cells, human cultured hepatocytes, to test for its localization in cytoplasmic P bodies,

and the potential role of these RNA granules in translational control of the apoB message by

insulin. We further examined the effect of insulin on the distribution of apoB mRNA

between translationally-competent polysomal and non-polysomal pools.

1.8.2 Hypothesis

We postulated that long-term insulin treatment down-regulates apoB mRNA

association with translationally active polysomes and shifts this mRNA pool towards

translationally inactive monosomes. We also hypothesized that apoB mRNA is subcellularly

compartmentalized in the form of ribonucleoprotein complexes in RNA granules/ P bodies,

which act as a reservoir for translatable mRNA, certain stimuli such as insulin may inhibit

25

apoB mRNA translation by reducing the release of translatable mRNA transcripts from

stored mRNPs.

1.8.3 Specific Aims

1. To determine the effect of insulin on the polysomal distribution of apoB mRNA. This

involved investigating whether insulin results in the dissociation of apoB from

translationally active polysomes by performing polysomal profiling and real time

PCR analysis in HepG2.

2. To determine if apoB mRNA is localized within cytoplasmic RNA granules and to

examine if insulin silences apoB mRNA translation by localizing the message into

these granules.

26

II. Materials and Methods

2.1 Polysomal Profiling

2.1.1 Cell Culture

HepG2, Human hepatoma cell line, was obtained from American Type Culture

Collection (ATCC, Manassas, VA), and maintained in complete alpha modification of eagles

medium (AMEM) (Wisent, Inc. Montreal, QC) supplemented with 10% fetal bovine serum

(FBS) (Wisent, Inc. Montreal, QC). Cells were seeded into T-75 flasks, and kept in a Nuaire

incubator at 37°C under 95% air/ 5% CO2. Media was replenished every 3 days, and cells

were sub-cultured on a weekly basis usually after reaching 90% confluency.

2.1.2 Insulin Treatment and Cell lysis

To investigate the effect of insulin on the translational control of apoB mRNA,

HepG2 cells were subjected to short-term and long-term insulin treatments. Cells were sub-

cultured into T75 flasks (3.5×106 cells/ flask) two days prior to treatment. Cells were then

serum starved briefly and treated with 100 nM insulin (Eli Lilly, Canada Inc. Toronto, ON)

for 15 minutes, 1 hour, 4 hours, or 16 hours. Cyclohexamide (CHX) (Sigma Aldrich, St.

Louis, MO) was added to the media at a final concentration of 100 μg/ mL half an hour

before harvesting to stabilize the polysome structures. Media containing CHX was discarded,

and cells were transferred on ice. After three washes (7 mL ice cold 1× PBS +100 μg/ mL

CHX), 750 μL lysis buffer was added to each flask. Lysis buffer contained: 0.015M Tris-HCl

pH 8.0; 0.3 M NaCl ; 0.005 M MgCl2; 1% Triton-X100; 0.0005 M Dithiothreitol (DTT); 1

27

mg/ mL Heparin sodium salt; 0.1 mg/ mL CHX. All lysis buffer components were obtained

from Sigma Aldrich (St. Louis, MO). Cells were scraped off the flask surface with a rubber

scrapper, transferred into a pre-chilled 1.5 ml tube, and kept on ice for 10 minutes to be

lysed. Cell lysates were subjected to 10 minute centrifugation at 12,000 rpm at 4°C.

Supernatant containing the cytoplasmic extract was transferred to a pre-chilled 1.5 mL tube

and kept on ice for subsequent ultracentrifugation on a sucrose gradient.

2.1.3 Sucrose Gradient and Ultracentrifugation

Two mL of the cytoplasmic extracts from insulin treated and non-treated cells were carefully

layered over 12 to 55% linear sucrose (Sigma Aldrich, St. Louis, MO) gradients separately.

Sucrose gradients were made freshly in polysome buffer containing: 0.02 M Tris-HCl pH

8.0; 0.14 M KCl; 0.005 M MgCl2; 0.0005 M DTT; 0.5 mg/ mL heparin sodium salt; 0.1 mg/

mL CHX. Gradients were subjected to ultracentrifugation for 2.5 h at 40,000 rpm at 4°C in a

Beckman SW41 Ti rotor.

The linear sucrose gradient was prepared using a sucrose gradient maker (BioComp

Gradient Mate Model 117, BioComp Instruments, Inc., Canada) (angle: 82.5°, speed: 25,

time: 4 minutes). To verify the linearity of the gradients, 70 μl trypan blue 0.4% from

GIBCO (Invitrogen, Carlsbad, CA) was added to the more concentrated sucrose, and the

gradient was constructed. Twelve 1 ml fractions were then collected from the top;

absorbance at 584 nm was determined for each fraction, and graphed versus sample numbers.

2.1.4 Sucrose Gradient Fractionation

Several fractions from each sucrose gradient were obtained either by a fractionation

device or manually. In the automated process, gradients were fractionated using an ISCO

28

gradient fractionation system equipped with a UA-6 detector following an upward

displacement method. For each fraction, absorbance at 254 nm was continuously monitored

and recorded. Twelve 1 mL tubes were collected from the top. Fractions collected in the first

four tubes assumed to represented light RNPs and free ribosomes based on the shape of the

graphs (http://www.nature.com/protocolexchange/protocols/67 ). This portion corresponds to

the translationally inactive pool of mRNAs whereas lower fractions (numbered 5 to 12)

contained polysomes, representing a source of translationally active mRNAs. When

fractionation was performed manually, four 3 mL fractions were carefully attained from each

gradient using a pipette. The top fraction was rich in light RNPs and free ribosomes.

Acquired fractions were kept at -80°C.

2.1.5 Total RNA Extraction, cDNA Synthesis, and Real-Time

PCR

Total RNA was isolated from each fraction using Trizol (Invitrogen, Carsbad, CA)

and RNeasy minikit (Qiagen, Hilden, Germany) reagents following the manufacturer's

suggested procedure. RNA was then quantified by a NanoDrop Spectrophotometer ND-1000

(Nanodrop Technologies, Wilmington, USA). Two μg of total RNA from each fraction was

reverse transcribed using a High capacity cDNA Reverse transcription kit with RNase

Inhibitor (Applied Biosystems, CA, USA) and random hexamer primers according to the

manufacturer’s protocol.

Real-time PCR analysis was performed on an ABI Prism 7700 (Applied Biosystems,

Carlsbad, CA) machine using Power SYBR Green reagent (Applied Biosystems, Carlsbad,

CA) and apoB primers. In addition to apoB, several other genes including glyceraldehyde 3-

http://www.nature.com/protocolexchange/protocols/67�

29

phosphate dehydrogenase (GAPDH), β-Actin, β2 microglobulin (β2M), hydroxymethyl-

bilane synthase (HMBS), Hypoxanthine phosphoribosyltransferase 1 (HPRT1), ubiquitin C

(UBC), and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta

polypeptide (YWHAZ) were quantified and tested as putative internal and/or positive

controls. An internal control gene is a genetic material that its expression does not change

significantly in the presence of experimental variable(s), presence of insulin in our case.

Primers’ names and sequences are listed in Table 2. All primers were synthesized by the

DNA Synthesis Facility, The Centre for Applied Genomics, at the Hospital for Sick

Children. Threshold cycle (Ct) values were obtained in duplicates for each sample. Means of

four experiments in duplicate were assessed for statistical analysis. For each primer set in the

real-time PCR, melting curves were analyzed to ensure that fluorescence signals solely

reflected specific amplicons.

2.1.6 Statistic Analysis

We first looked at the distribution of apoB mRNA in different fractions without

normalization to the internal control genes. For each primer set (either apoB or positive/

internal controls) the Ct value (threshold cycle) of each fraction was subtracted from the

maximum Ct value of four fractions. This was called ΔCt. Since DNA amplification is an

exponential process, and theoretically after each cycle the amount of DNA is doubled to

measure the relative mRNA changes 2ΔCt was calculated. The distribution of mRNA in each

fraction across the entire fractions was then graphed as the percentage of mRNA in each

fraction divided by the total mRNA (the sum of all 4 fractions) (176). Mean and standard

deviations (SD) of data were calculated and shown in graphs.

http://www.google.ca/search?hl=en&ei=u5gGS4-zLNPTnAeL2NS_Cw&sa=X&oi=spell&resnum=0&ct=result&cd=1&ved=0CAYQBSgA&q=%CE%B22+microglobulin+%28%CE%B22M%29&spell=1�

http://wiki.medpedia.com/Hypoxanthine_phosphoribosyltransferase_1_%28HPRT1%29�

30

Table 2 Primers used in Real Time PCR reactions

Primer Name Primer Sequence

ApoB-Forw AGACAGCATCTTCGTGTTTCAA

ApoB-Rev ATCATTTAGTTTCAGCCCAGGA

β2 Microglobulin-Forw TGCTGTCTCCATGTTTGATGTATCT

β2 Microglobulin-Rev TCTCTGCTCCCCACCTCTAAGT

β-Actin-Forw ATCTGGCACCACACCTTC

β-Actin-Rev AGCCAGGTCCAGACGCA

YWHAZ-Forw ACTTTTGGTACATTGTGGCTTCAA

YWHAZ-Rev CCGCCAGGACAAACCAGTAT

UBC-Forw ATTTGGGTCGCGGTTCTTG

UBC-Rev TGCCTTGACATTCTCGATGGT

HRTP1-Forw TGACACTGGCAAAACAATGCA

HRTP1-Rev GGTCCTTTTCACCAGCAAGCT

Second, we normalized the apoB mRNA amount to the quantities of internal control

genes (a different internal control gene was selected for each time point). In order to

normalize, the Ct value of the internal control gene in each fraction was subtracted from the

Ct value of the experimental gene (either apoB or the positive control). This was called ΔCt.

Then ΔΔCt values were calculated by subtracting each fraction’s ΔCt from the highest ΔCt

of all fractions. 2ΔΔCt value was determined for each fraction and the percentage of mRNA in



31

each fraction was estimated by dividing the 2ΔΔCt amount from each fraction by the sum of

all four 2ΔΔCt values.

2.2 Cytoplasmic RNA Granules

2.2.1 Preparation of LB Media and LB Plates

25 g of LB Broth Miller powder (EMD Chemicals Inc., North America) was dissolved in 1 L

Millipore-purified water and autoclaved. 37 g of LB Agar Miller (EMD, North America) was

dissolved in 1 L Millipore-purified water, mixed, and autoclaved. When agar cooled down to

about 50°C, ampicilin sodium salt (Sigma Aldrich, St. Louis, MO) was added (0.1 mg/mL

final concentration), and the solution was distributed into Petri dishes (Fisher Scientific

Nepean, ON). After polymerization, plates were kept at 4°C for up to one month.

2.2.2 Plasmids

To study the co-localization of apoB mRNA with P body markers, a well established

method was applied to image exogenous apoB mRNA. In this system, we made use of a

strong interaction between bacteriophage capsid protein MS2 and a sequence specific RNA

stem-loops structure. This method was first developed by Dr. Robert Singer (Department of

Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, NY) to image

mRNA molecules in living cells (177). Six different plasmids were used in this project.

First, a modified version of pGL3-Control Vector (Promega corporation, Madison,

WI) was constructed by a previous graduate student in our laboratory (66); the 5.2 kb pGL3-

Control Vector contains the firefly luciferase reporter gene (LUC) under the control of an

32

SV40 promoter. This construct was created by removing the LUC gene and inserting the a

sequence encoding 15% of the full length apoB from N-terminus enclosed by 5’UTR and

3’UTR using Hind III and XbaI restriction sites.

Second, pSL-MS2bs-24X vector received as a gift from Dr. Singer’s laboratory

(www.singerlab.or) (Albert Einstein College of Medicine, Yeshiva University, Bronx NY).

This vector contains a gene sequence that transcribes to 24 tandemly repeated MS2 binding

sites (177). MS2 binding site is an RNA sequence part of a stem-loop structure that is

naturally found in bacteriophage MS2. This RNA structure is recognizable by the

bacteriophage capsid protein called MS2. MS2 protein is capable of binding to MS2 binding

site on the RNA (177).

Third, pMS2-GFP-NLS plasmid which is a mammalian expression vector expressing

MS2 protein fused to GFP under DNA polymerase II promoter. This plasmid was designed

so that the encoded MS2-GFP protein contains a nuclear localization signal (NLS) at its C

terminus. This ensures the localization of free MS2-GFP proteins in the nucleus of

eukaryotic cells (177). pMS2-GFP-NLS plasmid was also generously provided by Dr.

Singer.

The forth plasmid was pCMV-myc-cyto (Invitrogen, Carlsbad, CA). This mammalian

expression vector was used as a mother plasmid to construct our desired plasmid which

contained the 5’URT-apoB15%-3’UTR sequence from the first plasmid followed by the

MS2-24X sequence from the second vector.

The fifth plasmid was EF1a-β-globin mRNA-MS2-bs. We used this plasmid as a

positive control. It has been previously shown that β-globin mRNA localizes into

http://www.singerlab.or/�

33

cytoplasmic P bodies (178). This plasmid was purchased from Dr. Nancy Kedersha’s

laboratory (Harvard Medical School, Brigham and Women’s Hospital, Boston, MA).

Finally, pEGFP-N1 plasmid (Clontech, Mountain View, CA). As opposed to pMS2-

GFP-NLS plasmid (third plasmid), this plasmid expresses GFP protein lacking nuclear

localization signal and was used as a control.

2.2.3 Transformation and Plasmid DNA Amplification

Subcloning efficiency DH5α competent cells (Invitrogen, Carlsbad, CA) were used to

amplify all plasmids. 50-100 μL of DH5α aliquots were thawed on wet ice. One μg of

plasmid DNA in water was then taken for transformation and added to the cells. PUC 19

plasmid (Invitrogen, Carlsbad, CA) was used as a positive control for transformation

reaction. Cells were mixed briefly with gentle tabbing on the tube and incubated on ice for

30 minutes. The heat shock reaction was performed by transferring cells to a 42°C water bath

for 30 seconds. Cells were then returned on ice. After 2 minutes, 900 μL of room

temperature LB Broth media without antibiotic was added, mixed, and incubated in a 37°C

incubator shaker (New Brunswick Scientific, Edison, NJ.), shaking at 250 rpm for 1 hour

(enough time for three growth cycles). After incubation, tubes were centrifuged for 5 minutes

at 5000 rpm at room temperature. All but 100 μL of the supernatant was discarded; pellet

was resuspended in the remaining of the supernatant and poured onto an LB-ampicillin agar

plate. A “hockey puck” spreader was used to spread the cells evenly over the plate. Plates

were placed in a 37°C incubator with the agar side up and the lid side down overnight.

Several colonies were picked off the plates using sterile pipettes and were individually

transferred to a 14 ml polypropylene falcon tubes (Becton Dickinson labware, NJ) containing

34

3 mL LB Broth media and ampicilin (0.1 mg/ mL). Bacteria grew at 37°C for 8 hours in a

bacterial incubator shaker. After 8 hours, they were transferred to a new 250 mL LB broth

media containing the antibiotic, and grew overnight at 37°C in the bacterial shaker incubator.

To prepare a stock of bacteria, 850 µL of the growing bacteria was placed in a 1.5 mL

freezing tube (Sarstedt, Montreal, Quebec), and 150 µL of autoclaved glycerol (Sigma

Aldrich, St. Louis, MO) was added, vortexed, and kept on ice for 1 hour. Cells were then

stored at -80°C.

Midiprep plasmid isolation was conducted using the Endotoxin Free Plasmid

Isolation Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

Plasmids were eluted using purified autoclaved water, and their concentrations were

determined by Nanodrop. The purity of the plasmid DNA was assessed by calculating the

ratio of optical density units at A260/A280, which was mostly around 1.8.

2.2.4 Restriction Enzyme Digestion

All restriction enzymes were purchased from New England Biolabs, Inc. (Ipswich,

MA). One unit of each enzyme was used to digest 1 μg of DNA for 3 hours at 37°C

according to the manufacturer’s protocols.

2.2.5 Gel extraction

Digested products were run on a 0.8% agarose gel (Invitrogen Life Technologies,

Grand Island, NY) at 50 V. Desired DNA bands were then cut and gel purified using

QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer’s

protocol.

35

2.2.6 Ligation Reaction

Purified digested plasmids and insert fragments were mixed and incubated at 56°C

for 10 minutes to anneal. T4 DNA ligase reaction mixture (Invitrogen, Carlsbad, CA) was

then prepared according to the manufacturer’s protocol and added. Ligation reaction was

performed for 4 hours at 25οC and for some plasmids continued for another 48 hours at 16ο

C. T4 DNA Ligase enzyme was heat inactivated for 10 minutes at 65ο C. Half of the total

reaction (5 μL) was used to transform DH5α competent cells.

2.2.7 Construction of pCMV-MS2bs-24X-cyto Plasmid

The gene transcribing 24 tandem repeats of MS2bs from pSL-MS2bs-24X vector was

inserted into pCMV-myc-cyto plasmid using NcoI and NotI restriction enzymes and T4

DNA ligase (New England Biolabs).

2.2.8 Construction of pCMV-5’URT-apoB15%-3’UTR-MS2-24X-

cyto Chimeric Plasmid

To construct this plasmid, the 5’UTR-apoB15%-3’UTR sequence was obtained from

the modified pGL3 vector. In order to create proper restriction sites, 18 mer PCR primers

were designed (Table 3) to create an ApaI restriction site before the 5’UTR end and a BamHI

site after the 3’UTR end. A clamp of 3 random bases was added at both extreme ends of the

oligonucleotide primers to provide a sufficient grip for the restriction enzyme. PfuUltra II

fusion HS DNA polymerase enzyme (Stratagene, La Jolla, CA) was used to amplify the

sequence according to the manufacturer’s protocol (95°C, 2 minutes; 40 cycles (95°C 25

36

seconds; 62°C 25 seconds; 72°C 3 minutes); 72°C 15 minutes. This fragment was then

inserted in place on pCMV-MS2bs-24X-cyto plasmid.

Table 3 List of primers used in PCR reaction to generate proper restriction sites at both ends of the 5’UTR-apoB15%-3’UTR fragment. Primer Name Primer Sequence

5’ApaI-Forw AGAGGGCCCTTATTCCCACCGGGACCT

BamH13’-Rev AGAGGATCCCCGCCCCGACTCTAGATA

2.2.9 Direct DNA Sequencing

Direct DNA sequencing method was used to validate the sequence of constructed

plasmids (DNA sequencing facility, The Hospital for Sick Children, Toronto, ON)

(http://www.tcag.ca/dnaSequencingSynthesis.html). Table 4 represent a list of primers that

have been designed and used to sequence different constructs.

2.2.10 Transient Transfection Experiments

HepG2 cells were transiently co-transfected with 5.5 µg of pMS2-GFP-SV40 NLS

plasmid and 14.5 µg of either pCMV-5’URT-apoB15%-3’UTR-MS2-24X-cyto (reporter

plasmid) or EF1a-β-globin mRNA-MS2bs plasmid (control) using Lipofectamine 2000

reagent (Invitrogen, Carlsbad, CA) and reverse transfection method according to the

manufacturer’s recommendations; at about 50%- 60% confluency in a T75 flask HepG2 cells

were trypsinized, and mixed with the transfection complexes. Transfected HepG2 cells were

seeded on collagen-coated cover slips into six-well plates (8×105 cells/ well). Cells were

http://www.tcag.ca/dnaSequencingSynthesis.html�

37

incubated at 37°C for 5 hours. Lipofectamin reagent was then replaced with fresh AMEM

containing 10% FBS. Cells were kept at 37°C incubator for about 16 hours prior to insulin

treatment.

Table 4 Primers used for direct sequencing

Construct Primer

Name

Primer Sequence

pGL-5’UTR-apoB15%-3’UTR pGL3-5’end CTCGGCCTCTGAGCTATTCC

pGL-5’UTR-apoB15%-3’UTR pGL3-3’end TCCCCCTGAACCTGAAACAT

pCMV-MS2-24X-cyto CMV-fwd CGCAAATGGGCGGTAGGCGTG

pCMV-MS2-24X-cyto BGH-rev TAGAAGGCACAGTCGAGG

pCMV-5’URT-apoB15%-

3’UTR-MS2-24X-cyto

R-final CAACACTTGCTTGGCTTCTTC

pCMV-5’URT-apoB15%-

3’UTR-MS2-24X-cyto

L-final AGCCTCAGCCAAAATAGAAGG

2.2.11 Preparation of Collagen Coated plates

To make 100 collagen coated cover slips in a 6 well plate (100 μg/ well), 10 mg type

I collagen (MP Biomedicals, Solon, OH) was weighed and dissolved in 100 mL 0.05 M HCl

(0.1 mg/ mL collagen solution). The solution was then filtered using 0.45 μm filters (Sarstedt

Inc., Montreal, Quebec). One autoclaved cover slip (VWR, Mississauga, ON) was inserted

38

into each well and 1 mL of the solution was layerd on top. Collagen surface was air dried in a

cell culture hood overnight. Wells were washed twice with autoclaved H2O. Plates were air

dried in the hood, repacked, and stored at 4°C for up to 3 months.

2.2.12 GFP Expression and Insulin Treatment

Sixteen hours post transfection, GFP signal was detected under an Epifluorescence

Microscope (Zeis). At this time, cells were serum starved for half an hour and treated with

100 nM insulin (Eli Lilly, Canada Inc. Toronto, ON) for 1 h, 4 h, 8 h, or 16 h.

2.2.13 Immunostaining Experiments

To detect P bodies in HepG2 cells, human hepatoma cell line, that express exogenous

GFP, and to investigate the co-localization of P bodies with apoB mRNA, after proper

insulin treatments cells were fixed and stained for human enhancer of decapping large

subunit (hedls), a protein marker of P bodies. Cells were rinsed twice with PBS and fixed

immediately using 4% paraformaldehyde in 1XPBS solution for 15 minutes.

Paraformaldehyde was then aspirated and -20° C methanol was added for 10 minutes. Cells

were washed with 1XPBS, and blocked in 1X PBS containing 5% fetal bovine serum (FBS)

and 0.02% sodium azide (Sigma Aldrich, St. Louis, MO) for 1 hour. Mouse-anti-human GE-

1/hedls antibody (P70 S60 kinase α) (Santacruz Biotechnology, Inc., Santa Cruz, CA) was

diluted 1:1000 in the blocking solution and added to the fixed cells for 1 hour. After two

washes with 1XPBS (10 minutes each) Donkey-anti-mouse Rhodamine Red secondary

antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) was diluted 1000

times in the blocking solution and added for one hour. Three washes with 1X PBS were

performed (10 minutes each), and cells were incubated with DAPI (4′6 -diamidino-2-

39

phenylindole·2HCl) (1 mg/ mL stock, 1:1000 dilution) (Santa Cruz Biotechnology, Inc.) for

15 minutes to stain the nucleus. After 3 washes with 1XPBS (10 minutes each) cells were

mounted in Dako flurescent mounting media (Dako North America, Inc., Carpinteria, CA),

slides were protected from light and kept at 4°C (179). All staining steps were performed on

a gentle shaker at room temperature.

2.2.14 Confocal Microscopy Imaging

Images were acquired from fixed cells using spinning disk confocal microscopy

(Zeiss) and velocity software. DAPI confocal, GFP confocal and Cy3 confocal laser channels

were used to detect the nucleus, GFP signal, and P bodies, respectively, with sensitivities

around 200 and exposures not longer that 1 second. Images were then deconvolved to

remove the out of focus light (90% similarity between the deconvolved image and the

original; 20 rounds of deconvolution).

2.2.15 Using hDCP1a, a Second Primary Antibody, to Detect P

bodies

To confirm the detection of P bodies another primary antibody, hDCP1a (human

decapping protein 1) (Santacruz Biotechnology, Inc., Santa Cruz, CA), was utilized in the

imaging experiments. This antibody targets, Dcp1a, another protein component of P bodies

(179).

2.2.16 Puromycin Treatment

Puromycin is known to disrupt the translational machinery and increase the size and

number of P bodies (180). To further validate the detection of P bodies, HepG2 cells were

40

treated with 1 mM puromycin dihydrochloride (Sigma Aldrich, St. Louis, MO) for 30

minutes to disrupt the translational machinery and promote P body formation. Cells were

then fixed and stained for P bodies.

2.2.17 Statistical Analysis of Imaging Data

Pearson correlation coefficient is a measure of the correlation (linear dependence)

between two variables X and Y, giving a value between 0 and 1. It is widely used as a

measure of the strength of linear dependence between two variables. We used this measure to

evaluate the strength of the co-localization of P bodies and apoB mRNA at different time

points. Velocity software version 5 was used to quantify the co-localization data and the

significance of the findings was validated by the Pearson’s correlation coefficient. Mean and

standard deviations (SD) of data were calculated and shown in graphs.

41

III. Results

3.1 Polysome Profiling

3.1.1 Results of Constructing a Linear Sucrose Gradient

In order to assess the insulin effect on the association of apoB mRNA with polysomes

cytoplasmic extracts of HepG2 cells were first subjected to sucrose gradient sedimentation.

To verify the linearity of the sucrose gradient Trypan Blue was premixed with the heavier

sucrose (55%) and the gradient was generated. The gradient was then fractionated and the

distribution of Trypan Blue was assessed by spectrophotometry. Absorbances of Trypan Blue

at 584 nm indicated a constant decrease in the concentration of Trypan Blur towards the top

of the gradient (Figure 2).

42

Figure 2 Synthesis of a linear sucrose gradient.A continuous sucrose gradient was generated using a 55% sucrose solution containing Trypan Blue and 12% sucrose solution lacking Trypan Blue. Eleven 1mL fractions were collected and spectrophotometry analysis was performed to verify the linearity of the sucrose gradient.

3.1.2 Effect of Insulin on apoB mRNA Translation

In order to investigate the effect of insulin on the translation of apoB mRNA,

polysomal and non polysomal pools were obtained using the sucrose fractionation method.

Real Time PCR was conducted to analyse the relative percentage of apoB mRNA in each

pool. HepG2 cells subjected to short-term and long-term insulin treatments were lysed and

fractionated on continuous sucrose gradients (12%-55%). Four 3 mL fractions were obtained

from each gradient. While the fraction on top contained monosomes and ribosomal subunits,

polysomes were found in the bottom layers. The forth fraction contained the heaviest

polysomes. Total RNA was then extracted from each fraction and subjected to Real Time

PCR analysis. The relative percentage of apoB mRNA in each fraction was calculated and

graphed. Data from four independent experiments suggested that very short term insulin

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1 2 3 4 5 6 7 8 9 10 11

Abs

orba

nce

at 5

84 n

m

Top Bottom

43

treatments (15 minutes and 1 hour) increased apoB mRNA association with polysomes

(Figure 3), while long term insulin exposure (4 hours and 16 hours) showed an inhibitory

effect on the translation of apoB and shifted the mRNA towards the lighter polysomes and

monosome rich fractions (Figure 4).

44

Figure 3 Effect of short-term insulin treatment on apoB mRNA association with polysomes. HepG2 cells were treated with insulin for 15 minutes (on top) and 1 hour (on bottom). Cytoplasmic extracts were then subjected to density fractionation at 40000 rpm for 2.5 hours, and Real Time PCR was performed to measure the relative percentage of apoB mRNA in each fraction. (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient. Data shown is mean +/- SD. *= p< 0.05

0

20

40

60

80

100

120

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

15 m

inut

es p

ost i

nsul

in

trea

tmen

t

Top Bottom

Control

Insulin

0

10

20

30

40

50

60

70

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

1 h

post

insu

lin tr

eatm

ent

Top Bottom

Control

Insulin

45

Figure 4 Effect of long-term insulin treatment on apoB mRNA association with polysomes. HepG2 cells were treated with insulin for 4 hours (on top) and 16 hours (on bottom). Cytoplasmic extracts were then subjected to density fractionation at 40000 rpm for 2.5 hours, and Real Time PCR was performed to measure the relative percentage of apoB mRNA in each fraction. (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient. Data shown is mean +/- SD. *= p< 0.05

0

10

20

30

40

50

60

70

80

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

4 h

post

insu

lin tr

eatm

ent

Top Bottom

Control

Insulin

0

10

20

30

40

50

60

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

16 h

pos

t ins

ulin

trea

tmen

t

Top Bottom

Control

Insulin

46

3.1.3 Under conditions that inhibit apoB mRNA polysomal

association, insulin acutely stimulates global translation

As a control, we also examined the insulin effect on global translation in HepG2 cells

by assaying the absorbance of fractions at 254 nm. As shown in Figure 5, short term insulin

treatment (15 minutes) promoted global translation, as depicted by the rightward shift of the

polysomal profile (indicating the formation of heavy polysomes), similar to its effect on

apoB mRNA. However, following 4 hours of insulin treatment, although apoB mRNA

association with polysomes was inhibited, global translation was noticeably increased as

indicated by the presence of heavy polysomes. After 16 hours, the effect of insulin on global

translation was lost, while its inhibition of apoB mRNA translation persisted (Figure 5).

47

Figure 5 Insulin acutely stimulates global mRNA translation in HepG2 cells. In order to assess the general effect of insulin on the cellular protein translation, HepG2 cells were serum starved briefly and insulin treated for 15 minutes, 1 h, 4 h, and 16 hours. Cytoplasmic extracts were then analyzed using polysome gradients. Gradients were then fractionated using the upward displacement method and the absorbance at 254 nm was continuously monitoried.

3.1.4 Effect of Insulin on Beta-2-microglobulin mRNA

Distribution (as a control)

We were able to show that long-term insulin treatments (4 hour and 16 hour)

decreased the association of apoB mRNA with polysomes and therefore has a negative effect

Control


48

on the translation of this mRNA. In order to confirm that this is not a universal response to

insulin, we examined the effect of long term insulin exposure on beta-2-microglobulin

mRNA translation, and observed an increased association of this mRNA with the heaviest

polysomal fractions 16 hours post insulin treatment (Figure 6).

Figure 6 Effect of long-term insulin treatment on Beta-2-microglobulin mRNA (positive control) association with polysomes. HepG2 cells were insulin treated for 16 hours and the cytoplasmic extracts were analyzed using polysome gradients. Relative percentage of Beta-2-microglobulin mRNA in each fraction was then measured by Real Time PCR. (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient. Data shown is mean +/- SD. *= p< 0.05

0

10

20

30

40

50

60

1 2 3 4

Rela

tive

% o

f B2M

mRN

A in

eac

h fr

actio

n 16

h p

ost i

nsul

in tr

eatm

ent

Top Bottom

Control

Insulin




49

3.1.5 Determination of ApoB mRNA Abundance and

Optimization of Real Time PCR Experiments using Internal

Controls

Usually all Real Time PCR data are normalized to one or more internal control

gene(s). The mRNA level(s) of internal control gene(s) stay(s) constant under the

experimental procedure. In order to normalize apoB mRNA to an internal control gene under

the insulin stimuli, several genes that are commonly used as endogenous controls in Real

Time PCR analysis were used. For example, GAPDH (glyceraldehyde 3-phosphate

dehydrogenase), 18SrRNA gene, YWHAZ (tyrosine 3-monooxygenase/tryptophan 5-

monooxygenase activation protein zeta polypeptide), B2M (Beta-2-microglobulin), HMBS

(Hydroxymethyl-bilane synthase), HPRT1 (Hypoxanthine phosphoribosyl-transferase1),

UBC (Ubiquitin C). This was a challenging step because insulin augments the translation of

most mRNAs in HepG2 cells. Therefore, different internal control genes were found for

different time points; for example, HMBS mRNA remained constant at 15 minutes and 1

hour post insulin treatment; however, at longer insulin exposure times, HMBS mRNA level

altered significantly compare to the control. Although B2M mRNA level stayed steady 4

hours after insulin treatment, it changed significantly at other times. Finally, UBC mRNA

level remained stable only at 16 hours after insulin treatment (Figure 7).


50

A

B

0

10

20

30

40

50

60

70

80

1 2 3 4

Rela

tive

% o

f HM

BS m

RNA

in e

ach

frac

tion

15 m

inut

es p

ost i

nsul

in

trea

tmen

t

Top Bottom

Control

Insulin

0

10

20

30

40

50

60

70

1 2 3 4

Rela

tive

% o

f HM

BS m

RNA

in e

ach

frac

tion

1 h

post

insu

lin tr

eatm

ent

Top Bottom

Control

Insulin

51

C

D

Figure 7 Validation of potential internal control genes. HepG2 cells were insulin treated for 15 minutes (A), 1 hour (B), 4hours (C), and 16 hours (D). Cytoplasmic extracts were then analyzed using polysome gradients. Relative percentage of HMBS mRNA (A and B), B2M (C), and UBC (D) in each fraction was then measured by Real Time PCR. (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient. Data shown is mean +/- SD.

0

10

20

30

40

50

60

1 2 3 4

Rela

tive

% o

f B2M

mRN

A in

eac

h fr

actio

n 4

h po

st in

sulin

trea

tmen

t

Top Bottom

Control

Insulin

0

10

20

30

40

50

60

1 2 3 4

Rela

tive

% o

f UBC

mRN

A in

eac

h fr

actio

n 16

h p

ost i

nsul

in tr

eatm

ent

Top Bottom

Control

Insulin

52

3.1.6 Effect of Acute Insulin Treatments on ApoB mRNA

Translation (Data Normalized to Internal Control Gene)

The threshold cycle numbers obtained from Real Time PCR experiments in section

3.1.2 correspond to relative percentage of apoB mRNA in each fraction was then normalized

to the relative amounts of HMBS mRNAs. Results from four independent experiments were

analyzed and presented in Figure 8. Fifteen minutes after insulin treatment, similar to

unnormalized data, a significant amount of apoB mRNA bound to the heaviest polysome

fraction was observed which indicates an increase in apoB mRNA translation. Conversely, 1

hour insulin treatment shifted this mRNA towards the lighter fractions.

53

Figure 8 Effect of short-term insulin treatment on apoB mRNA association with polysomes (data normalized to internal control genes). HepG2 cells were treated with insulin for 15 minutes (on top) and 1 hour (on bottom). Cytoplasmic extracts were then analyzed using polysome gradients and Real Time PCR was performed to measure the relative percentage of apoB mRNA in each fraction. Relative percentages of apoB mRNA were normalized to HMBS mRNA amount (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient). Data shown is mean +/- SD. *= p< 0.05

0

10

20

30

40

50

60

70

80

90

100

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

15 m

inut

es p

ost i

nsul

in

trea

tmen

t nor

mal

ized

to H

MBS

Top Bottom

Control

Insulin

0 10 20 30 40 50 60 70 80 90

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

mRN

A

in e

ach

frac

tion

1 h

post

insu

lin

trea

tmen

t nor

mal

ized

to H

MBs

Top Bottom

Control

Insulin

54

3.1.7 Effect of Chronic Insulin Treatments on ApoB mRNA

Translation (Data Normalized to Internal Control Genes)

As was explained in section 3.1.5 the amounts of B2M and UBC mRNAs remained

constant in the presence and absence of insulin 4h and 16h post treatment, respectively.

ApoB mRNA levels were normalized to these genes and the average results of four

independent experiments were analyzed (Figure 9). 4 hours post insulin treatment apoB

mRNA made a significant shift from translationally active mode to translationally inactive

form. Likewise more apoB mRNA was associated with lighter polysomes and monosome

rich fractions 16 hour post insulin treatment compared to the control.

55

Figure 9 Effect of long-term insulin treatment on apoB mRNA association with polysomes (data normalized to internal control genes). HepG2 cells were treated with insulin for 4 hours (on top) and 16 hour (on bottom). Cytoplasmic extracts were then analyzed using polysome gradients and Real Time PCR was performed to measure the relative percentage of apoB mRNA in each fraction. Relative percentages of apoB mRNA were normalized to B2M (top) and UBC (bottom) mRNA amounts (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient). Data shown is mean +/- SD. *= p< 0.05

0

10

20

30

40

50

60

70

80

90

1 2 3 4

Rela

tibe

% o

f apo

B m

RNA

in e

ach

frac

tion

4 h

post

insu

lin tr

eatm

ent

norm

aliz

ed to

B2M

Top Bottom

Control

Insulin

0

5

10

15

20

25

30

35

40

45

1 2 3 4

Rela

tive

% o

f apo

B m

RNA

in e

ach

frac

tion

16 h

pos

t ins

ulin

trea

tmen

t

norm

aliz

ed to

UBC

Top Bottom

Control

Insulin

56

3.1.8 Effect of Insulin on Polysomal Distribution of Beta-2-

microglobulin mRNA

We were able to show that long-term insulin treatments shifted apoB mRNA towards

lighter polysomes or monosomal fractions. In order to confirm that this is not a global effect

of insulin on translation, the association of B2M mRNA with polysomes was evaluated in the

presence of insulin. Relative percentage of B2M mRNA level in each fraction was

normalized to UBC mRNA. UBC mRNA level remained constant in each fraction in the

presence and absence of insulin (Figure 10). B2M mRNA showed a significantly higher

association with the heaviest polysomal fraction in the presence of insulin compared to the

serum starved sample.

Figure 10 Effect of long-term insulin treatment on B2M mRNA (positive control) association with polysomes (Data normalized to internal control genes). HepG2 cells were treated with insulin for 16 hours. Cytoplasmic extracts were then analyzed using polysome gradients and Real Time PCR was performed to measure the relative percentage of apoB mRNA in each fraction. Relative percentages of apoB mRNA were normalized to UBC mRNA amount (Fraction 1 was the lightest top fraction and fraction 4 contained the heaviest polysomes at the bottom of the gradient). Data shown is mean +/- SD. *= p< 0.05

0

10

20

30

40

50

60

1 2 3 4

Rela

tive

% o

f B2M

in e

ach

frac

tion

16

h p

ost i

nsul

in tr

eatm

ent

norm

aliz

ed to

UBC

Top Bottom

Control

Insulin


57

3.2 Translational Control of ApoB mRNA: Role of

Cytoplasmic Ribonucleoproteins

The role of P bodies was examined by applying a recently-established method that

has been successfully employed to visualize exogenously expressed mRNAs in mammalian

cells. We made use of a strong interaction between bacteriophage capsid MS2 protein and a

sequence specific RNA stem-loops structure. In this technique a fluorescent protein, for

example, GPF is fused to RNA phage MS2 coat protein with a nuclear localization signal at

the C terminus. The RNA of interest is constructed to contain tandem repeats of the specific

phage RNA sequence that binds MS2 coat protein. The strong interaction between the

bacteriophage capsid protein MS2 and the sequence specific RNA stem-loops structure helps

visualize the RNA

In order to visualize apoB mRNA with PBs, we constructed a chimeric plasmid

containing 15% of apoB gene with 5’ and 3’UTRs at both ends followed by 24 tandem

repeats of MS2 binding sites. HepG2 cells were then transiently co-transfected with this

chimeric plasmid and a plasmid expressing MS2 protein fused to GFP.

3.2.1 Construction of pCMV-MS2bs-24X-cyto Plasmid

In order to construct pCMV-MS2bs-24X-cyto plasmid, eukaryotic expression vector

pCMV-myc-cyto (Figure 11 A) and pSL-MS2bs-24X plasmid containing 24 tandem repeats

of MS2 binding sites (Figure 11 C) were double digested with NcoI and NotI enzymes. A

sequence containing 24 repeats of MS2 binding site (1482 bps) was then gel purified and

inserted into pCMV-myc-cyto plasmid (4855 bps) (Figure 11 B and 11 D). The sequence of

58

this newly synthesized plasmid named pCMV-MS2bs-24X-cyto was validated by direct

DNA sequencing.

59

C D

Figure 11 Construction of pCMV-MS2bs-24X-cyto plasmid. Both pCMV-myc-cyto (A) and pSL-MS2bs-24X vectors (C) were double digested with NcoI and NotI restriction enzymes (B and D). 24 repeats of MS2 binding site was then inserted into pCMV-myc-cyto vector with the help of T4 DNA ligase.

1Kb

mar

ker

A

3221 bps

1482 bps

B

4855 bps

1Kb

mar

ker

60

3.2.2 Construction of pCMV-5’UTR-ApoB15%-3’UTR-MS2bs-

24X-cyto Chimeric Plasmid

A graduate student in our laboratory had previously inserted a fragment of DNA

containing 5’untranslated region of apoB gene followed by a sequence encoding 15% of the

full length apoB from N-terminus and 3’untranslated region of apoB in a pGL3-Control

Vector (66) (Figure 12 A). In order to create pCMV-5’UTR-ApoB15%-3’UTR-MS2bs-24X-

cyto chimeric plasmid first PCR primers were designed to create new restriction sites at both

ends of the sequence (15% of the full length apoB enclosed by its UTRs). This fragment was

amplified (Figure 12 B) and ApaI and BamH1 restriction sites were added to the 5’ and 3’

end of the fragment, respectively. ApaI and BamH1 restriction enzymes were used to clone

this fragment into the previously synthesized pCMV-MS2bs-24X-cyto plasmid upstream of

the MS2 gene. The sequence of this plasmid was verified by direct DNA sequencing.

61

A

B

Figure 12 Construction of pCMV-5’UTR-ApoB15%-3’UTR-MS2bs-24X-cyto plasmid. A sequence containing 15% of the full length apoB enclosed by its UTRs was amplified (B) from a modified version of pGL3-Control Vector template (A) and positioned upstream of the MS2 gene using Apa1 and BamH1 restriction sites created by PCR (B).

5’UTR

3’UTR ApoB15%

2546 bps

62

3.2.3 Detection of P Bodies (PBs) in HepG2 Cells and the

Influence of Puromycin on PB formation

We used mouse-anti-human GE-1/hedls primary antibody to detect P bodies in

HepG2 cells. This antibody identifies a major protein component of P bodies called human

enhancer of decapping larger subunit. Donkey-anti-mouse Rhodamine Red conjugated

antibody was used to visualize the signal (Figure 13A). Immunostaining with GE-1/hedls

revealed ~60 foci per cell. A similar pattern was observed using an antibody against a second

P body protein, hDcp1a (human decapping protein 1) (Figure 13B). To further validate that

these are in fact P bodies, cells were subjected to 1 mM puromycin for 30 minutes (Figure

13C). Puromycin is known to promote the formation of P bodies by disrupting the

translational machinery. Results from 8 different slides indicated that puromycin

significantly increased P body count and size by 99% and 25%, respectively, (Figure 14) (P

< 0.005)

63

Figure 13 Detection of P bodies in the cytoplasm of HepG2 cells. HepG2 cells were fixed and immunostained for two protein components of P bodies, hedls (A), and hDcp1a (B), shown in red. DAPI was used to stain the nucleus, shown in blue. Puromycin was used to further verify the detection of P bodies (C), HepG2 cells were treated with 1 mM puromycin for half an hour, fixed and immunostained for hDCP1 (C). DIC (differential interference contrast) images of the same fields are represented on the right hand panel.

64

A

B

Figure 14 Effect of puromycin on P body formation. HepG2 cells were exposed to 1 mM puromycin for half an hour, then fixed and immunostained for hDCP1, one of the protein components of P bodies. The average size and number of P bodies were determined. Data shown is mean +/- SD. *= p < 0.005.

0

20

40

60

80

100

120

140

160

No puromycin 1 mM Puromycin

Aver

age

num

ber o

f P b

odie

s

0

0.1

0.2

0.3

0.4

0.5

0.6

No puromycin 1mM puromycin

Aver

age

size

of P

bodi

es (µ

M)

*

65

3.2.4 Employing the MS2 Tagging System to Visualize ApoB

mRNA in HepG2 Cells

To use the MS2 tagging system to visualize apoB mRNA HepG2 cells were

transiently co-transfected with two plasmids (Figure 15): First, a chimeric DNA construct

that would transcribed to a reporter mRNA containing 15% of the full length apoB linked to

its UTRs (5’UTR-apoB15%-3’UTR) which was fused to MS2 binding site. The MS2 binding

site included 24 tandem repeats of 19 nucleotide RNA stem loop structures. This RNA is

recognizable by phage capsid MS2 protein which was encoded by the second plasmid. The

second plasmid made a MS2 protein fused to GFP with a nuclear localization signal at the C-

terminus end. Upon expression the GFP-MS2 coat protein binds the stem loop structure as a

dimer (183), This allows the detection of a specific RNA that is bound to the stem loop. The

presence of nuclear localization signal at the 3’ end of the MS2 protein helped the

elimination of false positive signals in the cytoplasm by sequestering any unbound MS2-GFP

in the nucleus.

66

Pol II promoter MS2 eGFP SV40 NLS

MS2-GFP Protein

PCMV promoter 5 ’UTR-apoB15-3’UTR PolyA signal

Repeats of MS2 binding sites

Reporter mRNA

Figure 15 Construction map of MS2-GFP and apoB mRNA reporter plasmids. A system composed of two plasmids enabled us to detect apoB mRNA in HepG2 cells. In this system one plasmid encoded a MS2 binding protein fused to GFP (top) and the other one was transcribed to a reporter mRNA containing part of apoB mRNA sequence followed by MS2 binding sites (bottom).

3.2.5 Transfection of HepG2 Cells with pMS2-GFP-SV40 NLS

Plasmid

In order to ensure that the green florescent in the cytoplasm only reflects the MS2-

GFP spicies that are associated with the reporter mRNAs via MS2 recognition sites and not

67

the free MS2 proteins, a nuclear localization signal (NLS) was positioned at the 3’ terminus

of this plasmid. HepG2 cells were transiently transfected with pMS2-GFP-SV40 NLS

plasmid. This plasmid encoded a green fluorescent protein that upon expression concentrated

in the nucleus due to the presence of a nuclear localization signal (Figure 16A).

As a control experiment, HepG2 cells were transfected with pEGFP-N1 plasmid that

expressed green florescent protein lacking the nuclear localization signal. In this case all GFP

signal was detected in the cytoplasm (Figure 16B).

68

A

B

Figure 16 Expression of pMS2-GFP-SV40 NLS vector and the effect of NLS. HepG2 cells were transfected with either pMS2-GFP-SV40 NLS (A) or pEGFP-N1 plasmids (B). 16 hours post transfection cells were fixed and immunostained for Dapi and imaged. In the presence of nuclear localization signal the GFP signal was sequestered in the nucleus (A), whereas, in the absence of a nuclear localization signal the GFP signal was dispersed in the cytoplasm (B).

69

3.2.6 Insulin Induces Co-localization of ApoB mRNA with P

Bodies

We transiently co-transfected HepG2 cells with pCMV-5’URT-ApoB15%-3’UTR-

MS2bs-24X-cyto and MS2-GFP-NLS constructs. Transfected cells were then treated with

insulin at different time points, fixed and immunostained for P body marker, GE-1/hedls.

Upon expression, MS2 binding proteins recognized their binding sites on the reporter

mRNAs as illustrated in Figure 16. Due to the presence of a nuclear localization signal

downstream of the MS2 protein any unbound MS2-GFP protein was sequestered in the

nucleus. We used spinning disk confocal microscopy to image the co-localization of apoB

mRNA with P bodies. Long-term insulin treatments (4 h, 8 h, and 16 h) (Figure 17)

significantly increased the co-localization of apoB mRNA with P bodies. On the other hand,

acute insulin treatment (1 h) (Figure 18) did not have any significant effect on the

localization of apoB mRNA with P bodies.

70

Figure 17 Visualizing apoB mRNA traffic in HepG2 Cells: Long-term exposure to insulin induced co-localization of apoB mRNA with P bodies. HepG2 cells were transiently contransfected with pCMV-5’URT-ApoB15%-3’UTR-MS2bs-24X-cyto and MS2-GFP-NLS plasmids. 16 hours post transfection cells were serum sratved briefly and treated with insulin for 4 h (A), 8 h (B), and 16 h (C). Green represents apoB mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue). Please see Appendix, figures 23-25 for full size confocal images.

71

Figure 18 Visualizing apoB mRNA traffic in HepG2 Cells: Short term exposure to insulin did not induce co-localization of apoB mRNA with P bodies. HepG2 cells were transiently contransfected with pCMV-5’URT-ApoB15%-3’UTR-MS2bs-24X-cyto and MS2-GFP-NLS plasmids. 16 hours post transfection cells were serum sratved briefly (B) and treated with insulin for 1 h (A). Cells were then fixed and immunostained for hedls, one of the main protein components of P Bodies. Green represents apoB mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue). Please see Appendix, figures 26-27 for full size confocal images.

3.2.7 Insulin does not affect the Co-localization of Beta-Globin

mRNA with P Bodies

We were able to show that co-localization of apoB mRNA with P bodies increased at

4 hours, 8 hours and 16 hours post insulin treatment. To verify this is not the case for all

mRNAs we tested the influence of insulin on the co-localization of Beta-globin mRNA with

P bodies.

72

Beta-globin mRNA has already been shown to localize in P bodies (178). A plasmid

containing beta-globin mRNA fused to MS2 binding site and the MS2-GFP-NLS construct

were co-expressed in HepG2 cells. As shown in Figure 19, although there was marked co-

localization of beta-globin mRNA with the P body marker, no significant change was

observed following insulin treatment. Thus, in contrast to apoB mRNA, beta-globin mRNA

showed a high degree of co-localization with P bodies independent of insulin (Figure 19).

74

Figure 19 Effect of insulin on the co-localization of beta-globin mRNA with P bodies. HepG2 cells were co-transfected with EF1a-β-globin mRNA-MS2-bs and MS2-GFP-NLS plasmids, cells were then serum starved briefly (A) and treated with insulin for 1 hour (B), 4 hours (C), 8 hours (D), and 16 hours (E). Cells were then fixed and immunostained for hedls, one of the protein components of P bodies. Green represents beta-globin mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue). Please see Appendix, figures 28-32 for full size confocal images.

75

3.2.8 Statistical Analysis

Pearson correlation coefficient is a measure of the correlation (linear dependence)

between two variables and is widely used as a measure of the strength of linear dependence

between two variables. This measure was utilized in order to validate the strength of the co-

localization of P bodies and apoB mRNA under insulin stimuli.

In order to compare the co-localization of apoB mRNA with P bodies at different

time points of insulin treatment, Velocity software version 5 was used. Pearson’s correlation

coefficients were assessed based on the intensity of green and red pixels that overlapped as

an indication of the co-localization. A number between zero to one was assigned to each cell

with zero indicating no co-localization and one representing complete co-localization.

Numbers obtained from 8 different slides were averaged and graphed as represented in

Figure 20. These co-localization experiments allowed a qualitative assessment of the

association of intracellular apoB mRNA with P body granules. Our data suggestes that

insulin promotes apoB mRNA colocalization with P bodies after 4, 8, and 16 hours (Figure

20). Conversely, ß-globin mRNA shows a relatively high co-localization with P bodies at all

the experimental time points regardless of the presence and absence of insulin (Figure 21).

http://en.wikipedia.org/wiki/Correlation�

76

Figure 20 Quantification of apoB mRNA co-localization with P bodies. In order to evaluate the colocalization of apoB mRNA with P bodies Velocity software version 5 was used to measure the Pearson’s correlation coefficients. A number between zero and one was alloted to each cell with zero indicating no colocalization and one specifying perfect colocalization. Data shown is mean +/- SD. *= p< 0.05.

Figure 21 Quantification of beta-globin mRNA co-localization with P bodies.Velocity software version 5 was used to calculate Pearson’s correlation coefficients. A number between zero and one was given to each cell. Number one represents complete colocalization and zero shows no colocalization at all. Data shown is mean +/- SD.

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

Control 1 4 8 16

Pearson's correlation coefficient

hour(s)

* * *

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Control 1 4 8 16

Pearson's correlation coefficient

hour(s)

77

IV. Discussion

Hepatic apoB synthesis is known to be regulated at multiple levels including

translation (40;41;63-65;164;182). Under different stimuli apoB mRNA levels stay relatively

constant while apoB protein synthesis and secretion varies greatly, thereby indicating the

importance of translational and posttranslational control mechanisms. Several studies from

our laboratory and others have shown that insulin reduces hepatic apoB protein synthesis and

secretion while mRNA levels remain stable (40;64;92;163;165). However, the molecular

mechanism(s) governing this inhibitory effect at the translational level have remained largely

unknown. Recent studies in our laboratory have revealed important translational mechanisms

of apoB mRNA involving the 5’ untranslated region (5’UTR). ApoB mRNA has a 5’UTR of

128 nucleotides and a 3’UTR of 304 nucleotides. Several structural features of apoB mRNA

UTR sequences suggest the presence of potential cis-elements that may interact with putative

trans-acting protein factors. A previous graduate student in our laboratory recently analyzed

the apoB UTR sequences using Mfold program, to predict RNA secondary structure, which

revealed elements within the 5' and 3'UTR’s of apoB mRNA with potential to form

secondary structure (66). They also assessed the biological activity of the putative RNA

motifs within the UTR sequences and found that 5'UTR motifs are important for optimal

translation of the apoB message. Deletion constructs of the UTR regions of apoB showed

that the 5'UTR was necessary and sufficient for insulin to inhibit apoB synthesis (66).

Interestingly, although insulin normally activates global translation of cellular protein

synthesis, it has a specific inhibitory effect on apoB mRNA translation. This suggests that

insulin induces a unique signaling cascade that leads to specific inhibition of apoB mRNA

78

translation despite global translational stimulation. Our laboratory has now demonstrated that

insulin may modulate apoB mRNA translation via changes in the binding of a trans-acting

110-kDa protein factor to the 5’UTR (15). This putative RNA-binding protein (referred to as

p110) was found to specifically bind the 5’UTR of apoB mRNA, with its binding reduced in

the presence of insulin (15). Moreover, absence of insulin increased binding of this trans-

acting factor to the 5' UTR by 2-fold. Interestingly, translational control of apoB mRNA via

the 5’UTR and the binding of the 110 kDa protein factor was found to be regulated by

protein kinase C (PKC) signaling cascade (68). Using dual (bicistronic) luciferase constructs,

our laboratory also examined the role of internal ribosomal entry (IRES) with respect to the

5'UTR of the apoB mRNA and found that the apoB 5’UTR possesses IRES activity and basal

translational activity of the apoB mRNA may be partly cap independent (67). Presence of the

p110 protein highlights the importance of RNA-protein interactions that regulate the fate and

activity of apoB mRNA intracellularly.

There is now increasing evidence that eukaryotic mRNAs (particularly those with

longer half lives) exist in association with protein complexes in the form of RNA granules

which can govern both mRNA decay and translational activity. We thus investigated the

potential role of RNA granules in modulating apoB mRNA and its translational efficiency.

4.1 Polysome Profiling

In order to study the effect of insulin on apoB translation polysome gradient

sedimentation fractionation method was applied. This method is commonly used to study

translation under different physiological and experimental states. Our model system was

79

HepG2 cells because they are hepatocellular carcinoma derived cell lines that constitutively

express apoB. We measured apoB mRNA levels associated with translationally-active

polysomes using Real-Time PCR. Our results suggested that insulin initially increases apoB

mRNA translation at 15 minutes and 1 hour, very similar to its effect observed on global

translation. Interestingly however, following longer insulin exposure (4 h), apoB mRNA

shifted towards lighter polysomes and monosome fractions, suggesting inhibition of

translational activity. At the same time point, global mRNA translation was still stimulated

by insulin treatment. With even longer insulin treatment (16 h), both apoB mRNA

association with heavy polysomes and total global polysomal activity were reduced. These

data suggest that apoB mRNA translation is uniquely inhibited by insulin under conditions

that stimulate global mRNA translation.

One of the challenges we were facing in this part of the project was to obtain enough

mRNA from each fraction to perform both the spectroscopic quantitation and Real Time

PCR. We first acquired twelve 1 mL fractions from each sucrose gradient, and used phenol

chloroform extraction method followed by lithium chloride (LiCl) precipitation to remove

the heparin which is a PCR inhibitor reagent. In order to eliminate the genomic DNA we

then performed DNase treatment. Finally in order to measure total mRNA in each fraction

we used 200 µL spectroscopy cuvettes. These steps resulted in significant loss of mRNA. In

order to address this problem, we fractionated the sucrose gradients to four 3 mL fractions,

and used a commercially available kit to extract higher amounts of RNA. We also made use

of a nanodrop spectrophotometer to measure the total RNA. In this type of

spectrophotometery one micro liter of the sample is sufficient to quantify RNA

concentration.

80

4.2 Storage of ApoB mRNA in Cytoplasmic RNA

Granules

Mature mRNAs in the cytoplasm of eukaryotic cells are associated with a complex

network of ribonucleoprotein particles (mRNPs) (168;169). Early studies of mRNPs showed

the presence of two major proteins (170), a 70-kDa poly(A) binding protein (PABP) (171)

and a 50-kDa protein (p50) responsible for the repressed, nonactive state of mRNAs, such as

globin mRNA within free mRNP particles (172). Recent studies have identified a large

number of other protein components of mRNPs including RNA binding proteins, RNA

helicases, and translational factors (173). Importantly, RNA granules have been identified in

both germ cells and somatic cells that appear to play important roles in mRNA storage,

stability, and translational control. All RNA granules contain translationally silenced

mRNAs. New evidence suggests a dynamic interaction between these RNA granules and

translationally-active polysomal mRNAs (174), suggesting that the availability of some

mRNAs could be regulated by the rate of release from translationally-silenced mRNAs

within RNA granules. Stress granules (SG) contain mRNAs encoding most cellular proteins

and appear when translation initiation is impaired; for example, following exposure to

environmental stress (157). Another type of cytoplasmic RNA granule, called Processing

Bodies (PBs) are composed of RNA and proteins and translationally inactive mRNAs (149).

The protein components of P bodies are involved in RNA stability, storage, translation and

decay (183). P bodies are mainly composed of mRNAs, the 5’ to 3’ mRNA decay machinery,

the nonsense-mediated decay pathway proteins and the RNA- induced silencing complex

(183).

81

It was initially unknown whether apoB mRNA translation can be controlled by the

release of translatable apoB mRNA transcripts from cytoplasmic stores of mRNPs that are

translationally repressed. However, the long half-life of apoB mRNA (16 h) suggests that a

significant proportion of the message may be stored in the cell prior to translation.

Interestingly, apoB mRNA polysome complexes have been reported to show unusual

physical properties and exhibit unique sedimentation behaviors more characteristic of

nonpolysomal mRNPs (175) further suggesting the existence of apoB mRNA in RNA

granules. We thus hypothesized that certain stimuli such as insulin may inhibit apoB mRNA

translation by reducing the release of translatable mRNA transcripts from stored mRNPs. In

order to test this hypothesis we investigated the colocalization of apoB mRNA with P bodies

under insulin stimuli.

The role of P bodies was examined by applying a recently-established method that

has been successfully employed to visualize exogenously expressed mRNAs in mammalian

cells (177). We made use of a strong interaction between bacteriophage capsid MS2 protein

and a sequence specific RNA stem-loops structure. Several studies have utilized this system

in order to track mRNA traffic in living cells. Bertrand et al., monitored the asymmetrical

movement of ASH1 mRNA in dividing yeast cells (184). Rook et al. and Fusco et al.

examined the movements of cytoplasmic RNA particles in neurons and COS cells (177;185).

Forrest and Gavis investigated the dynamic co-localization of endogenous nanos RNA in

Drosophila oocytes (186), and Kedersha et al. monitored the presence of single species of

mRNA transcripts in both SGs and PBs. This method has also been applied to study the RNA

trafficking in retroviruses (187;188). In this technique a fluorescent protein, for example,

GPF is fused to RNA phage MS2 coat protein with a nuclear localization signal at the C

82

terminus (184). The RNA of interest is constructed to contain tandem repeats of the specific

phage RNA sequence that binds MS2 coat protein. The strong interaction between the

bacteriophage capsid protein MS2 and the sequence specific RNA stem-loops structure helps

visualize the RNA.

In order to visualize apoB mRNA with PBs, we constructed a chimeric plasmid

containing 15% of apoB gene with 5’ and 3’UTRs at both ends followed by 24 tandem

repeats of MS2 binding sites. HepG2 cells were then transiently co-transfected with this

chimeric plasmid and a plasmid expressing MS2 protein fused to GFP. The latter plasmid

contains a nuclear localization signal (NLS) at its C-terminus. Upon expression MS2 protein

finds its binding site on the reporter mRNA and any unbound MS2-GFP protein sequesters in

the nucleus due to the presence of the NLS.

Spinning disk confocal microscopy technique enabled us to visualize apoB mRNA in

fixed HepG2 cells. We then investigated the co-localization of exogenous apoB mRNA with

P bodies in the presence or absence of insulin at different time points. Confocal studies

revealed that long term insulin exposure promotes the co-localization of apoB mRNA with P

bodies with increases of 72% (after 4 h), 85% (after 8 h), and 89% (after 16 h) in PB co-

localization compared to respective non-insulin treated controls. However, a shorter (1 hour)

insulin treatment did not appear to induce observable changes in PB co-localization. As a

control, when HepG2 cells were transfected with pMS2-GFP-NLS plasmid alone, the entire

GFP signal was confined to the nucleus due to the presence of a nuclear localization signal at

the C-terminus of the protein.

It is important to note that although the above mentioned Singer’s method is a very

useful tool in imaging an exogenous mRNA in living cells it has some limitations. For

83

example to get a strong GFP signal presence of 24 repeats of MS2-binding sites is mandatory

(177) and it is not possible to get a good signal using fewer repeats of MS2 binding sites.

Since two molecules of GFP interact with each one of the stem-loop structures, a large

amount of GFP accumulates in a small area. This in fact increases the intensity of the signal

at the expense of lowering sensitivity.

Another alternative for us was to use in situ hybridization method in which the

presence of an mRNA could be assessed by designing probes that target specific sequences

on the mRNA of interest, apoB in our case. The in situ hybridization technique is more direct

and has a higher specificity compared to the method we used; however, it is not applicable to

live cells. Since we were planning to perform some live cell imaging analysis eventually and

look at the apoB mRNA movements under different experimental stimuli we chose to use the

former method.

Nancy Kedersha et al. had previously investigated the colocalization of β-globin

mRNA with P bodies and Stress Granules (178), and we thus used the same β-globin plasmid

as a control and examined the effect of insulin on the co-locolization of β-globin mRNA with

P bodies. HepG2 cells were transiently co-transfected with a plasmid containing β-globin

mRNA followed by the MS2-binding site and a plasmid expressing MS2 coat protein fused

to GFP followed by a nuclear localization signal. We observed clear co-localization of β-

globin mRNA with P bodies under normal cell culture condition. However, as opposed to

apoB mRNA, colocalization of β-globin mRNA with P bodies was insensitive to insulin in

HepG2 cells.

As can be observed from confocal images, apoB mRNA and PB marker did not co-

localize in all PBs. This is expected since each eukaryotic cell holds many P bodies

84

containing a variety of different kinds of mRNAs. A single PB does not contain all mRNAs,

and also a single species of mRNA does not exist in all P bodies. Also, in some of the images

we obtained, the GFP signal was observed in both the nucleus and the cytoplasm. This was

due to the large amount of MS2-GFP protein expression. Owing to the presence of the NLS,

the surplus GFP which was not bound to the mRNA sequestered in the nucleus. This in fact

was predictable from the onset and did not interfere with the interpretation of the imaging

data.

The monoclonal antibody used to recognize cytoplasmic P bodies showed some

nuclear staining in addition to the cytoplasm. This is due to the reactivity of this antibody

with p70 S6 kinase protein. The double specificity of this antibody was confirmed using

recombinant hedls, and this antibody was used to visualize PBs in p70 S6 kinases knockout

cells (179). The anti-hedls antibody readily detects cytoplasmic P bodies, and most of the

non-hedls signal is nuclear and did not impede the recognition of cytoplasmic P bodies (179).

We were able to show that puromycin, an aminonucleoside antibiotic derived from

the Streptomyces alboniger bacterium that causes premature chain termination during

translation, promoted the assembly of P bodies in HepG2 cells. Similar effect has been

reported by Nancy Kedersha et.al working on yeast, HeLa, and U2OS mammalian cell lines

(178).

In some of the images we acquired, GFP signal was detected in both the nucleus and

the cytoplasm. This was due to the presence of a large amount of MS2-GFP protein

expression. Owing to the existence of nuclear localization at the C termini of this protein the

surplus GFP which was not bound to the mRNA sequestered in the nucleus. This was in fact

predictable from the beginning and did not interfere with the accuracy of data interpretations.

http://en.wikipedia.org/w/index.php?title=Aminonucleoside&action=edit&redlink=1�

http://en.wikipedia.org/wiki/Antibiotic�

http://en.wikipedia.org/w/index.php?title=Streptomyces_alboniger&action=edit&redlink=1�

85

In conclusion, our data suggest that long-term insulin treatment may decrease apoB

mRNA translation by promoting the localization of the mRNA into P bodies. The time

course of insulin-mediated co-localization of apoB mRNA with P bodies coincides with

alterations in translational activity of the message. Cellular response to hormonal stimuli is

normally rapid, and like other hormonal responses, hepatocytes respond to insulin promptly

by decreasing apoB protein secretion via changes in protein stability/degradation. With

longer insulin exposure, hepatocytes reduce apoB synthesis by reprogramming apoB mRNA

and forcing the translationally-competent apoB mRNA towards P bodies for storage.

4.3 Postulated Mechanism of Insulin Modulation of ApoB

mRNA Traffic into P bodies

The present study shows that insulin silences apoB mRNA translation by localizing it

into P bodies and that this coincides with apoB mRNA run off from the translationally active

polysomes. However, the exact mechanism(s) that control apoB mRNA translational control

and the key molecule(s) that trigger apoB mRNA traffic into P bodies remain to be

elucidated. One possible mechanism may be through activation of an apoB mRNA binding

protein under insulin stimuli via protein modification(s), such as phosphorylation/

dephosphorylation. This activated RNA binding molecule will then interact with its proper

binding site on apoB mRNA, perhaps in the 5’UTR region that has been shown to play an

important role in regulating apoB mRNA translation in response to insulin. Such a cis-trans

interaction might result in the recruitment of P body factors to the mRNA through the

interaction of protein components of P bodies with the RNA binding protein(s) or directly

86

with apoB mRNA through new binding sites that appear after structural changes induced

following binding of the activated RNA binding factor. The newly formed small P Bodies

will then interact with each other through protein-protein interactions leading to the assembly

of larger P body aggregates. The translationally repressed apoB mRNA in P bodies could

have two faiths: it may either be degraded or reenter the translational machinery by

dissociating from P body granules, interacting with 40S ribosomal subunit and initiation

factors and assembeling into translationally active polysomes. Figure 22 depicts a proposed

model for insulin modulation of apoB mRNA localization in P bodies and the role of this

process in apoB mRNA translational control.

87

Figure 22. A proposed model for insulin modulation of apoB mRNA traffic into P bodies. Recent evidence suggest that insulin suppresses apoB mRNA translation through cis-transacting interactions with 5’UTR regions of apoB mRNA. Activation of RNA binding factor(s) by insulin facilitates their interaction with apoB mRNA and recruitment of P body components which nucleate the formation of larger P body aggregates. This results in translational suppression of apoB mRNA. Translationally repressed apoB mRNA could then either be degraded or disassembled from P bodies, re-associate with the translational machinery and be translated.

88

V. Conclusions

Although insulin normally activates global translation of cellular protein synthesis, it

has a specific inhibitory effect on apoB mRNA translation. This suggests that insulin induces

a unique signaling cascade that leads to specific inhibition of apoB mRNA translation despite

global translational stimulation. The mechanisms involved are post-transcriptional events

since apoB mRNA levels remained stable. In our investigation, we studied the potential role

of cytoplasmic RNA granules (P bodies) in insulin mediated translational regulation of apoB.

There is now increasing evidence that eukaryotic mRNAs (particularly those with longer half

lives) exist in association with protein complexes in the form of RNA granules which can

govern both mRNA decay and translational activity. P bodies control the translation of many

mRNAs in eukaryotic cells and we postulated that apoB mRNA is subcellularly

compartmentalized in the form of ribonucleoprotein complexes in RNA granules, which act

as a reservoir for translatable mRNA, a process potentially inhibitable by insulin.

In the current study we made use of a strong interaction between bacteriophage MS2

capsid protein and MS2 binding site to visualize apoB mRNA and to examine the influence

of insulin on the co-localization of apoB mRNA with P bodies. Spining disk confocal

imaging revealed that long-term insulin exposure promotes significant co-localization of

apoB mRNA with P bodies compared to non-insulin treated controls. Our data suggested that

insulin highly promotes apoB mRNA localization with P bodies after long-term insulin

treatment. Importantly, insulin-mediated co-localization of apoB mRNA with P bodies

coincided with alterations in translational activity of the message, based on polysomal

profiling experiments. Under these conditions, global mRNA translation was still stimulated

89

by insulin treatment. These data suggest that apoB mRNA translation is uniquely inhibited

by insulin under conditions that stimulate global mRNA translation. The time-course of

translational inhibition correlates with movement of apoB mRNA into cytoplasmic P bodies.

90

VI. Future Directions

ApoB mRNA translation is likely controlled by a complex network of RNA binding

proteins that interact with its 5’UTR and or 3’UTR regions. Insulin is a putative modulator of

some of these interactions. Therefore, it is important to investigate the effect of known RNA

binding proteins on apoB mRNA translation, and also to identify and characterize the novel

RNA binding proteins that regulate apoB mRNA translation. An important next step is to

study the regulatory effect of insulin on the cis-trans interactions on the apoB mRNA 5’UTR.

It will also be important to identify the RNA binding proteins involved in translational

repression of the apoB message and formation of RNA granules. Finally, considering the

exploration of interest in the role of miRNAs in regulating translation and mRNA decay, it

would be interesting to determine whether specific miRNAs are involved in translational

control of apoB mRNA. Recent bioinformatics analysis of the apoB mRNA sequence has

identified at least two miRNAs (miR-1202 and miR-544) that appear to interact with apoB

UTRs, supporting a possible role for miRNAs in regulation of apoB mRNA translation.

91

Reference List

1. Ginsberg,H.N. 1998. Lipoprotein physiology. Endocrinol.Metab Clin.North Am. 27:503-519.

2. Tulenko,T.N. and Sumner,A.E. 2002. The physiology of lipoproteins. J.Nucl.Cardiol. 9:638-649.

3. Blasiole,D.A., Davis,R.A., and Attie,A.D. 2007. The physiological and molecular regulation of lipoprotein assembly and secretion. Mol.Biosyst. 3:608-619.

4. Brodsky,J.L. and Fisher,E.A. 2008. The many intersecting pathways underlying apolipoprotein B secretion and degradation. Trends Endocrinol.Metab 19:254-259.

5. Ejarque,I., Real,J.T., Martinez-Hervas,S., Chaves,F.J., Blesa,S., Garcia-Garcia,A.B., Millan,E., Ascaso,J.F., and Carmena,R. 2008. Evaluation of clinical diagnosis criteria of familial ligand defective apoB 100 and lipoprotein phenotype comparison between LDL receptor gene mutations affecting ligand-binding domain and the R3500Q mutation of the apoB gene in patients from a South European population. Transl.Res. 151:162-167.

6. Johnson,L.A., Altenburg,M.K., Walzem,R.L., Scanga,L.T., and Maeda,N. 2008. Absence of hyperlipidemia in LDL receptor-deficient mice having apolipoprotein B100 without the putative receptor-binding sequences. Arterioscler.Thromb.Vasc.Biol. 28:1745-1752.

7. Real,J.T., Chaves,F.J., Ejarque,I., Garcia-Garcia,A.B., Valldecabres,C., Ascaso,J.F., Armengod,M.E., and Carmena,R. 2003. Influence of LDL receptor gene mutations and the R3500Q mutation of the apoB gene on lipoprotein phenotype of familial hypercholesterolemic patients from a South European population. Eur.J.Hum.Genet. 11:959-965.

8. Hansson,G.K. and Libby,P. 2006. The immune response in atherosclerosis: a double-edged sword. Nat.Rev.Immunol. 6:508-519.

9. Avramoglu,R.K. and Adeli,K. 2004. Hepatic regulation of apolipoprotein B. Rev.Endocr.Metab Disord. 5:293-301.

10. Knott,T.J., Rall,S.C., Jr., Innerarity,T.L., Jacobson,S.F., Urdea,M.S., Levy-Wilson,B., Powell,L.M., Pease,R.J., Eddy,R., Nakai,H. et al. 1985. Human apolipoprotein B: structure of carboxyl-terminal domains, sites of gene expression, and chromosomal localization. Science 230:37-43.

11. Law,S.W., Lackner,K.J., Hospattankar,A.V., Anchors,J.M., Sakaguchi,A.Y., Naylor,S.L., and Brewer,H.B., Jr. 1985. Human apolipoprotein B-100: cloning, analysis of liver mRNA, and assignment of the gene to chromosome 2. Proc.Natl.Acad.Sci.U.S.A 82:8340-8344.

12. Blackhart,B.D., Ludwig,E.M., Pierotti,V.R., Caiati,L., Onasch,M.A., Wallis,S.C., Powell,L., Pease,R., Knott,T.J., Chu,M.L. et al. 1986. Structure of the human apolipoprotein B gene. J.Biol.Chem. 261:15364-15367.

13. Knott,T.J., Wallis,S.C., Powell,L.M., Pease,R.J., Lusis,A.J., Blackhart,B., McCarthy,B.J., Mahley,R.W., Levy-Wilson,B., and Scott,J. 1986. Complete cDNA and derived protein sequence of human apolipoprotein B-100. Nucleic Acids Res. 14:7501-7503.

92

14. Taghibiglou,C., Carpentier,A., Van Iderstine,S.C., Chen,B., Rudy,D., Aiton,A., Lewis,G.F., and Adeli,K. 2000. Mechanisms of hepatic very low density lipoprotein overproduction in insulin resistance. Evidence for enhanced lipoprotein assembly, reduced intracellular ApoB degradation, and increased microsomal triglyceride transfer protein in a fructose-fed hamster model. J.Biol.Chem. 275:8416-8425.

15. Sidiropoulos,K.G., Pontrelli,L., and Adeli,K. 2005. Insulin-mediated suppression of apolipoprotein B mRNA translation requires the 5' UTR and is characterized by decreased binding of an insulin-sensitive 110-kDa 5' UTR RNA-binding protein. Biochemistry 44:12572-12581.

16. Nielsen,L.B., Veniant,M., Boren,J., Raabe,M., Wong,J.S., Tam,C., Flynn,L., Vanni-Reyes,T., Gunn,M.D., Goldberg,I.J. et al. 1998. Genes for apolipoprotein B and microsomal triglyceride transfer protein are expressed in the heart: evidence that the heart has the capacity to synthesize and secrete lipoproteins. Circulation 98:13-16.

17. Nielsen,L.B., Bartels,E.D., and Bollano,E. 2002. Overexpression of apolipoprotein B in the heart impedes cardiac triglyceride accumulation and development of cardiac dysfunction in diabetic mice. J.Biol.Chem. 277:27014-27020.

18. Yokoyama,M., Yagyu,H., Hu,Y., Seo,T., Hirata,K., Homma,S., and Goldberg,I.J. 2004. Apolipoprotein B production reduces lipotoxic cardiomyopathy: studies in heart-specific lipoprotein lipase transgenic mouse. J.Biol.Chem. 279:4204-4211.

19. Knott,T.J., Pease,R.J., Powell,L.M., Wallis,S.C., Rall,S.C., Jr., Innerarity,T.L., Blackhart,B., Taylor,W.H., Marcel,Y., Milne,R. et al. 1986. Complete protein sequence and identification of structural domains of human apolipoprotein B. Nature 323:734-738.

20. Wang,A.B., Liu,D.P., and Liang,C.C. 2003. Regulation of human apolipoprotein B gene expression at multiple levels. Exp.Cell Res. 290:1-12.

21. Chen,S.H., Habib,G., Yang,C.Y., Gu,Z.W., Lee,B.R., Weng,S.A., Silberman,S.R., Cai,S.J., Deslypere,J.P., Rosseneu,M. et al. 1987. Apolipoprotein B-48 is the product of a messenger RNA with an organ-specific in-frame stop codon. Science 238:363-366.

22. Powell,L.M., Wallis,S.C., Pease,R.J., Edwards,Y.H., Knott,T.J., and Scott,J. 1987. A novel form of tissue-specific RNA processing produces apolipoprotein-B48 in intestine. Cell 50:831-840.

23. Hoeg,J.M., Meng,M.S., Ronan,R., Demosky,S.J., Jr., Fairwell,T., and Brewer,H.B., Jr. 1988. Apolipoprotein B synthesized by Hep G2 cells undergoes fatty acid acylation. J.Lipid Res. 29:1215-1220.

24. Sparks,J.D., Sparks,C.E., Roncone,A.M., and Amatruda,J.M. 1988. Secretion of high and low molecular weight phosphorylated apolipoprotein B by hepatocytes from control and diabetic rats. Phosphorylation of APO BH and APO BL. J.Biol.Chem. 263:5001-5004.

25. Swift,L.L. 1996. Role of the Golgi apparatus in the phosphorylation of apolipoprotein B. J.Biol.Chem. 271:31491-31495.

26. Vukmirica,J., Nishimaki-Mogami,T., Tran,K., Shan,J., McLeod,R.S., Yuan,J., and Yao,Z. 2002. The N-linked oligosaccharides at the amino terminus of human apoB are important for the assembly and secretion of VLDL. J.Lipid Res. 43:1496-1507.

93

27. Chatterton,J.E., Phillips,M.L., Curtiss,L.K., Milne,R., Fruchart,J.C., and Schumaker,V.N. 1995. Immunoelectron microscopy of low density lipoproteins yields a ribbon and bow model for the conformation of apolipoprotein B on the lipoprotein surface. J.Lipid Res. 36:2027-2037.

28. Gantz,D.L., Walsh,M.T., and Small,D.M. 2000. Morphology of sodium deoxycholate-solubilized apolipoprotein B-100 using negative stain and vitreous ice electron microscopy. J.Lipid Res. 41:1464-1472.

29. Orlova,E.V., Sherman,M.B., Chiu,W., Mowri,H., Smith,L.C., and Gotto,A.M., Jr. 1999. Three-dimensional structure of low density lipoproteins by electron cryomicroscopy. Proc.Natl.Acad.Sci.U.S.A 96:8420-8425.

30. Spin,J.M. and Atkinson,D. 1995. Cryoelectron microscopy of low density lipoprotein in vitreous ice. Biophys.J. 68:2115-2123.

31. Segrest,J.P., Jones,M.K., De Loof,H., and Dashti,N. 2001. Structure of apolipoprotein B-100 in low density lipoproteins. J.Lipid Res. 42:1346-1367.

32. Fisher,E.A. and Ginsberg,H.N. 2002. Complexity in the secretory pathway: the assembly and secretion of apolipoprotein B-containing lipoproteins. J.Biol.Chem. 277:17377-17380.

33. Tarugi,P., Averna,M., Di Leo,E., Cefalu,A.B., Noto,D., Magnolo,L., Cattin,L., Bertolini,S., and Calandra,S. 2007. Molecular diagnosis of hypobetalipoproteinemia: an ENID review. Atherosclerosis 195:e19-e27.

34. Farese,R.V., Jr., Ruland,S.L., Flynn,L.M., Stokowski,R.P., and Young,S.G. 1995. Knockout of the mouse apolipoprotein B gene results in embryonic lethality in homozygotes and protection against diet-induced hypercholesterolemia in heterozygotes. Proc.Natl.Acad.Sci.U.S.A 92:1774-1778.

35. Huang,L.S., Voyiaziakis,E., Markenson,D.F., Sokol,K.A., Hayek,T., and Breslow,J.L. 1995. apo B gene knockout in mice results in embryonic lethality in homozygotes and neural tube defects, male infertility, and reduced HDL cholesterol ester and apo A-I transport rates in heterozygotes. J.Clin.Invest 96:2152-2161.

36. Dashti,N., Williams,D.L., and Alaupovic,P. 1989. Effects of oleate and insulin on the production rates and cellular mRNA concentrations of apolipoproteins in HepG2 cells. J.Lipid Res. 30:1365-1373.

37. Lin,M.C., Arbeeny,C., Bergquist,K., Kienzle,B., Gordon,D.A., and Wetterau,J.R. 1994. Cloning and regulation of hamster microsomal triglyceride transfer protein. The regulation is independent from that of other hepatic and intestinal proteins which participate in the transport of fatty acids and triglycerides. J.Biol.Chem. 269:29138-29145.

38. Moberly,J.B., Cole,T.G., Alpers,D.H., and Schonfeld,G. 1990. Oleic acid stimulation of apolipoprotein B secretion from HepG2 and Caco-2 cells occurs post-transcriptionally. Biochim.Biophys.Acta 1042:70-80.

39. Nassir,F., Mazur,A., Serougne,C., Gueux,E., and Rayssiguier,Y. 1993. Hepatic apolipoprotein B synthesis in copper-deficient rats. FEBS Lett. 322:33-36.

40. Pullinger,C.R., North,J.D., Teng,B.B., Rifici,V.A., Ronhild de Brito,A.E., and Scott,J. 1989. The apolipoprotein B gene is constitutively expressed in HepG2 cells: regulation of secretion by oleic acid, albumin, and insulin, and measurement of the mRNA half-life. J.Lipid Res. 30:1065-1077.

94

41. Sparks,J.D., Zolfaghari,R., Sparks,C.E., Smith,H.C., and Fisher,E.A. 1992. Impaired hepatic apolipoprotein B and E translation in streptozotocin diabetic rats. J.Clin.Invest 89:1418-1430.

42. Borchardt,R.A. and Davis,R.A. 1987. Intrahepatic assembly of very low density lipoproteins. Rate of transport out of the endoplasmic reticulum determines rate of secretion. J.Biol.Chem. 262:16394-16402.

43. Kardassis,D., Laccotripe,M., Talianidis,I., and Zannis,V. 1996. Transcriptional regulation of the genes involved in lipoprotein transport. The role of proximal promoters and long-range regulatory elements and factors in apolipoprotein gene regulation. Hypertension 27:980-1008.

44. Zannis,V.I., Kan,H.Y., Kritis,A., Zanni,E., and Kardassis,D. 2001. Transcriptional regulation of the human apolipoprotein genes. Front Biosci. 6:D456-D504.

45. Zannis,V.I., Kan,H.Y., Kritis,A., Zanni,E.E., and Kardassis,D. 2001. Transcriptional regulatory mechanisms of the human apolipoprotein genes in vitro and in vivo. Curr.Opin.Lipidol. 12:181-207.

46. Chuang,S.S., Zhuang,H., Reisher,S.R., Feinstein,S.I., and Das,H.K. 1995. Transcriptional regulation of the apolipoprotein B-100 gene: identification of cis-acting elements in the first nontranslated exon of the human apolipoprotein B-100 gene. Biochem.Biophys.Res.Commun. 215:394-404.

47. Chuang,S.S. and Das,H.K. 1999. A single in vitro point mutation in the first non-translated exon silences transcription of the human apolipoprotein B gene in HepG2 cells. Biochim.Biophys.Acta 1436:600-605.

48. Brooks,A.R., Nagy,B.P., Taylor,S., Simonet,W.S., Taylor,J.M., and Levy-Wilson,B. 1994. Sequences containing the second-intron enhancer are essential for transcription of the human apolipoprotein B gene in the livers of transgenic mice. Mol.Cell Biol. 14:2243-2256.

49. Antes,T.J., Goodart,S.A., Chen,W., and Levy-Wilson,B. 2001. Human apolipoprotein B gene intestinal control region. Biochemistry 40:6720-6730.

50. Nielsen,L.B., Kahn,D., Duell,T., Weier,H.U., Taylor,S., and Young,S.G. 1998. Apolipoprotein B gene expression in a series of human apolipoprotein B transgenic mice generated with recA-assisted restriction endonuclease cleavage-modified bacterial artificial chromosomes. An intestine-specific enhancer element is located between 54 and 62 kilobases 5' to the structural gene. J.Biol.Chem. 273:21800-21807.

51. Antes,T.J., Goodart,S.A., Huynh,C., Sullivan,M., Young,S.G., and Levy-Wilson,B. 2000. Identification and characterization of a 315-base pair enhancer, located more than 55 kilobases 5' of the apolipoprotein B gene, that confers expression in the intestine. J.Biol.Chem. 275:26637-26648.

52. Antes,T.J. and Levy-Wilson,B. 2001. HNF-3 beta, C/EBP beta, and HNF-4 act in synergy to enhance transcription of the human apolipoprotein B gene in intestinal cells. DNA Cell Biol. 20:67-74.

53. Singh,K., Batuman,O.A., Akman,H.O., Kedees,M.H., Vakil,V., and Hussain,M.M. 2002. Differential, tissue-specific, transcriptional regulation of apolipoprotein B secretion by transforming growth factor beta. J.Biol.Chem. 277:39515-39524.

54. Swagell,C.D., Henly,D.C., and Morris,C.P. 2007. Regulation of human hepatocyte gene expression by fatty acids. Biochem.Biophys.Res.Commun. 362:374-380.

95

55. Wang,Z. and Burke,P.A. 2007. Effects of hepatocyte nuclear factor-4alpha on the regulation of the hepatic acute phase response. J.Mol.Biol. 371:323-335.

56. Singh,K., Batuman,O.A., Akman,H.O., Kedees,M.H., Vakil,V., and Hussain,M.M. 2002. Differential, tissue-specific, transcriptional regulation of apolipoprotein B secretion by transforming growth factor beta. J.Biol.Chem. 277:39515-39524.

57. Greeve,J., Altkemper,I., Dieterich,J.H., Greten,H., and Windler,E. 1993. Apolipoprotein B mRNA editing in 12 different mammalian species: hepatic expression is reflected in low concentrations of apoB-containing plasma lipoproteins. J.Lipid Res. 34:1367-1383.

58. Hersberger,M., Patarroyo-White,S., Arnold,K.S., and Innerarity,T.L. 1999. Phylogenetic analysis of the apolipoprotein B mRNA-editing region. Evidence for a secondary structure between the mooring sequence and the 3' efficiency element. J.Biol.Chem. 274:34590-34597.

59. Shah,R.R., Knott,T.J., Legros,J.E., Navaratnam,N., Greeve,J.C., and Scott,J. 1991. Sequence requirements for the editing of apolipoprotein B mRNA. J.Biol.Chem. 266:16301-16304.

60. Navaratnam,N., Fujino,T., Bayliss,J., Jarmuz,A., How,A., Richardson,N., Somasekaram,A., Bhattacharya,S., Carter,C., and Scott,J. 1998. Escherichia coli cytidine deaminase provides a molecular model for ApoB RNA editing and a mechanism for RNA substrate recognition. J.Mol.Biol. 275:695-714.

61. Mehta,A., Kinter,M.T., Sherman,N.E., and Driscoll,D.M. 2000. Molecular cloning of apobec-1 complementation factor, a novel RNA-binding protein involved in the editing of apolipoprotein B mRNA. Mol.Cell Biol. 20:1846-1854.

62. Lellek,H., Kirsten,R., Diehl,I., Apostel,F., Buck,F., and Greeve,J. 2000. Purification and molecular cloning of a novel essential component of the apolipoprotein B mRNA editing enzyme-complex. J.Biol.Chem. 275:19848-19856.

63. Lusis,A.J., Taylor,B.A., Quon,D., Zollman,S., and LeBoeuf,R.C. 1987. Genetic factors controlling structure and expression of apolipoproteins B and E in mice. J.Biol.Chem. 262:7594-7604.

64. Adeli,K. and Theriault,A. 1992. Insulin modulation of human apolipoprotein B mRNA translation: studies in an in vitro cell-free system from HepG2 cells. Biochem.Cell Biol. 70:1301-1312.

65. Sparks,J.D. and Sparks,C.E. 1990. Insulin modulation of hepatic synthesis and secretion of apolipoprotein B by rat hepatocytes. J.Biol.Chem. 265:8854-8862.

66. Pontrelli,L., Sidiropoulos,K.G., and Adeli,K. 2004. Translational control of apolipoprotein B mRNA: regulation via cis elements in the 5' and 3' untranslated regions. Biochemistry 43:6734-6744.

67. Sidiropoulos,K.G., Meshkani,R., Avramoglu-Kohen,R., and Adeli,K. 2007. Insulin inhibition of apolipoprotein B mRNA translation is mediated via the PI-3 kinase/mTOR signaling cascade but does not involve internal ribosomal entry site (IRES) initiation. Arch.Biochem.Biophys. 465:380-388.

68. Sidiropoulos,K.G., Zastepa,A., and Adeli,K. 2007. Translational control of apolipoprotein B mRNA via insulin and the protein kinase C signaling cascades: evidence for modulation of RNA-protein interactions at the 5'UTR. Arch.Biochem.Biophys. 459:10-19.

96

69. Gordon,D.A., Jamil,H., Gregg,R.E., Olofsson,S.O., and Boren,J. 1996. Inhibition of the microsomal triglyceride transfer protein blocks the first step of apolipoprotein B lipoprotein assembly but not the addition of bulk core lipids in the second step. J.Biol.Chem. 271:33047-33053.

70. Sniderman,A.D. and Cianflone,K. 1993. Substrate delivery as a determinant of hepatic apoB secretion. Arterioscler.Thromb. 13:629-636.

71. Yao,Z., Tran,K., and McLeod,R.S. 1997. Intracellular degradation of newly synthesized apolipoprotein B. J.Lipid Res. 38:1937-1953.

72. Bostrom,K., Wettesten,M., Boren,J., Bondjers,G., Wiklund,O., and Olofsson,S.O. 1986. Pulse-chase studies of the synthesis and intracellular transport of apolipoprotein B-100 in Hep G2 cells. J.Biol.Chem. 261:13800-13806.

73. Borchardt,R.A. and Davis,R.A. 1987. Intrahepatic assembly of very low density lipoproteins. Rate of transport out of the endoplasmic reticulum determines rate of secretion. J.Biol.Chem. 262:16394-16402.

74. Brodsky,J.L. 2007. The protective and destructive roles played by molecular chaperones during ERAD (endoplasmic-reticulum-associated degradation). Biochem.J. 404:353-363.

75. Nakatsukasa,K., Huyer,G., Michaelis,S., and Brodsky,J.L. 2008. Dissecting the ER-associated degradation of a misfolded polytopic membrane protein. Cell 132:101-112.

76. Liang,J.S., Kim,T., Fang,S., Yamaguchi,J., Weissman,A.M., Fisher,E.A., and Ginsberg,H.N. 2003. Overexpression of the tumor autocrine motility factor receptor Gp78, a ubiquitin protein ligase, results in increased ubiquitinylation and decreased secretion of apolipoprotein B100 in HepG2 cells. J.Biol.Chem. 278:23984-23988.

77. Zhou,M., Fisher,E.A., and Ginsberg,H.N. 1998. Regulated Co-translational ubiquitination of apolipoprotein B100. A new paradigm for proteasomal degradation of a secretory protein. J.Biol.Chem. 273:24649-24653.

78. Fisher,E.A., Zhou,M., Mitchell,D.M., Wu,X., Omura,S., Wang,H., Goldberg,A.L., and Ginsberg,H.N. 1997. The degradation of apolipoprotein B100 is mediated by the ubiquitin-proteasome pathway and involves heat shock protein 70. J.Biol.Chem. 272:20427-20434.

79. Gusarova,V., Caplan,A.J., Brodsky,J.L., and Fisher,E.A. 2001. Apoprotein B degradation is promoted by the molecular chaperones hsp90 and hsp70. J.Biol.Chem. 276:24891-24900.

80. Qiu,W., Kohen-Avramoglu,R., Mhapsekar,S., Tsai,J., Austin,R.C., and Adeli,K. 2005. Glucosamine-induced endoplasmic reticulum stress promotes ApoB100 degradation: evidence for Grp78-mediated targeting to proteasomal degradation. Arterioscler.Thromb.Vasc.Biol. 25:571-577.

81. Wu,X., Sakata,N., Lele,K.M., Zhou,M., Jiang,H., and Ginsberg,H.N. 1997. A two-site model for ApoB degradation in HepG2 cells. J.Biol.Chem. 272:11575-11580.

82. Furukawa,S., Sakata,N., Ginsberg,H.N., and Dixon,J.L. 1992. Studies of the sites of intracellular degradation of apolipoprotein B in Hep G2 cells. J.Biol.Chem. 267:22630-22638.

83. Adeli,K. 1994. Regulated intracellular degradation of apolipoprotein B in semipermeable HepG2 cells. J.Biol.Chem. 269:9166-9175.

97

84. Fisher,E.A., Pan,M., Chen,X., Wu,X., Wang,H., Jamil,H., Sparks,J.D., and Williams,K.J. 2001. The triple threat to nascent apolipoprotein B. Evidence for multiple, distinct degradative pathways. J.Biol.Chem. 276:27855-27863.

85. Pan,M., Cederbaum,A.I., Zhang,Y.L., Ginsberg,H.N., Williams,K.J., and Fisher,E.A. 2004. Lipid peroxidation and oxidant stress regulate hepatic apolipoprotein B degradation and VLDL production. J.Clin.Invest 113:1277-1287.

86. Chirieac,D.V., Davidson,N.O., Sparks,C.E., and Sparks,J.D. 2006. PI3-kinase activity modulates apo B available for hepatic VLDL production in apobec-1-/- mice. Am.J.Physiol Gastrointest.Liver Physiol 291:G382-G388.

87. Galgani,J.E., Uauy,R.D., Aguirre,C.A., and Diaz,E.O. 2008. Effect of the dietary fat quality on insulin sensitivity. Br.J.Nutr. 100:471-479.

88. Riserus,U. 2008. Fatty acids and insulin sensitivity. Curr.Opin.Clin.Nutr.Metab Care 11:100-105.

89. Ding,W.X. and Yin,X.M. 2008. Sorting, recognition and activation of the misfolded protein degradation pathways through macroautophagy and the proteasome. Autophagy. 4:141-150.

90. Fujita,E., Kouroku,Y., Isoai,A., Kumagai,H., Misutani,A., Matsuda,C., Hayashi,Y.K., and Momoi,T. 2007. Two endoplasmic reticulum-associated degradation (ERAD) systems for the novel variant of the mutant dysferlin: ubiquitin/proteasome ERAD(I) and autophagy/lysosome ERAD(II). Hum.Mol.Genet. 16:618-629.

91. Kruse,K.B., Brodsky,J.L., and McCracken,A.A. 2006. Autophagy: an ER protein quality control process. Autophagy. 2:135-137.

92. Adeli,K. and Sinkevitch,C. 1990. Secretion of apolipoprotein B in serum-free cultures of human hepatoma cell line, HepG2. FEBS Lett. 263:345-348.

93. Patsch,W., Franz,S., and Schonfeld,G. 1983. Role of insulin in lipoprotein secretion by cultured rat hepatocytes. J.Clin.Invest 71:1161-1174.

94. Patsch,W., Gotto,A.M., Jr., and Patsch,J.R. 1986. Effects of insulin on lipoprotein secretion in rat hepatocyte cultures. The role of the insulin receptor. J.Biol.Chem. 261:9603-9606.

95. Salhanick,A.I., Schwartz,S.I., and Amatruda,J.M. 1991. Insulin inhibits apolipoprotein B secretion in isolated human hepatocytes. Metabolism 40:275-279.

96. Sparks,C.E., Sparks,J.D., Bolognino,M., Salhanick,A., Strumph,P.S., and Amatruda,J.M. 1986. Insulin effects on apolipoprotein B lipoprotein synthesis and secretion by primary cultures of rat hepatocytes. Metabolism 35:1128-1136.

97. Brown,A.M. and Gibbons,G.F. 2001. Insulin inhibits the maturation phase of VLDL assembly via a phosphoinositide 3-kinase-mediated event. Arterioscler.Thromb.Vasc.Biol. 21:1656-1661.

98. Phung,T.L., Roncone,A., Jensen,K.L., Sparks,C.E., and Sparks,J.D. 1997. Phosphoinositide 3-kinase activity is necessary for insulin-dependent inhibition of apolipoprotein B secretion by rat hepatocytes and localizes to the endoplasmic reticulum. J.Biol.Chem. 272:30693-30702.

99. Sparks,J.D., Phung,T.L., Bolognino,M., and Sparks,C.E. 1996. Insulin-mediated inhibition of apolipoprotein B secretion requires an intracellular trafficking event and phosphatidylinositol 3-kinase

98

activation: studies with brefeldin A and wortmannin in primary cultures of rat hepatocytes. Biochem.J. 313 ( Pt 2):567-574.

100. Taniguchi,C.M., Emanuelli,B., and Kahn,C.R. 2006. Critical nodes in signalling pathways: insights into insulin action. Nat.Rev.Mol.Cell Biol. 7:85-96.

101. Durrington,P.N., Newton,R.S., Weinstein,D.B., and Steinberg,D. 1982. Effects of insulin and glucose on very low density lipoprotein triglyceride secretion by cultured rat hepatocytes. J.Clin.Invest 70:63-73.

102. Borradaile,N.M., de Dreu,L.E., and Huff,M.W. 2003. Inhibition of net HepG2 cell apolipoprotein B secretion by the citrus flavonoid naringenin involves activation of phosphatidylinositol 3-kinase, independent of insulin receptor substrate-1 phosphorylation. Diabetes 52:2554-2561.

103. Au,C.S., Wagner,A., Chong,T., Qiu,W., Sparks,J.D., and Adeli,K. 2004. Insulin regulates hepatic apolipoprotein B production independent of the mass or activity of Akt1/PKBalpha. Metabolism 53:228-235.

104. Allister,E.M., Borradaile,N.M., Edwards,J.Y., and Huff,M.W. 2005. Inhibition of microsomal triglyceride transfer protein expression and apolipoprotein B100 secretion by the citrus flavonoid naringenin and by insulin involves activation of the mitogen-activated protein kinase pathway in hepatocytes. Diabetes 54:1676-1683.

105. Au,W.S., Kung,H.F., and Lin,M.C. 2003. Regulation of microsomal triglyceride transfer protein gene by insulin in HepG2 cells: roles of MAPKerk and MAPKp38. Diabetes 52:1073-1080.

106. Wolfrum,C. and Stoffel,M. 2006. Coactivation of Foxa2 through Pgc-1beta promotes liver fatty acid oxidation and triglyceride/VLDL secretion. Cell Metab 3:99-110.

107. Taghibiglou,C., Carpentier,A., Van Iderstine,S.C., Chen,B., Rudy,D., Aiton,A., Lewis,G.F., and Adeli,K. 2000. Mechanisms of hepatic very low density lipoprotein overproduction in insulin resistance. Evidence for enhanced lipoprotein assembly, reduced intracellular ApoB degradation, and increased microsomal triglyceride transfer protein in a fructose-fed hamster model. J.Biol.Chem. 275:8416-8425.

108. Chirieac,D.V., Collins,H.L., Cianci,J., Sparks,J.D., and Sparks,C.E. 2004. Altered triglyceride-rich lipoprotein production in Zucker diabetic fatty rats. Am.J.Physiol Endocrinol.Metab 287:E42-E49.

109. Bartels,E.D., Lauritsen,M., and Nielsen,L.B. 2002. Hepatic expression of microsomal triglyceride transfer protein and in vivo secretion of triglyceride-rich lipoproteins are increased in obese diabetic mice. Diabetes 51:1233-1239.

110. Biddinger,S.B. and Kahn,C.R. 2006. From mice to men: insights into the insulin resistance syndromes. Annu.Rev.Physiol 68:123-158.

111. Reaven,G.M. 1992. The role of insulin resistance and hyperinsulinemia in coronary heart disease. Metabolism 41:16-19.

112. Lewis,G.F. and Steiner,G. 1996. Acute effects of insulin in the control of VLDL production in humans. Implications for the insulin-resistant state. Diabetes Care 19:390-393.

113. Kissebah,A.H. 1991. Insulin resistance in visceral obesity. Int.J.Obes. 15 Suppl 2:109-115.

99

114. Grundy,S.M., Mok,H.Y., Zech,L., Steinberg,D., and Berman,M. 1979. Transport of very low density lipoprotein triglycerides in varying degrees of obesity and hypertriglyceridemia. J.Clin.Invest 63:1274-1283.

115. Taskinen,M.R. 1995. Insulin resistance and lipoprotein metabolism. Curr.Opin.Lipidol. 6:153-160.

116. Reaven,G.M., Chen,Y.D., Jeppesen,J., Maheux,P., and Krauss,R.M. 1993. Insulin resistance and hyperinsulinemia in individuals with small, dense low density lipoprotein particles. J.Clin.Invest 92:141-146.

117. Lakka,H.M., Laaksonen,D.E., Lakka,T.A., Niskanen,L.K., Kumpusalo,E., Tuomilehto,J., and Salonen,J.T. 2002. The metabolic syndrome and total and cardiovascular disease mortality in middle-aged men. JAMA 288:2709-2716.

118. Groppo,R. and Richter,J.D. 2009. Translational control from head to tail. Curr.Opin.Cell Biol. 21:444-451.

119. Majumdar,R., Bandyopadhyay,A., and Maitra,U. 2003. Mammalian translation initiation factor eIF1 functions with eIF1A and eIF3 in the formation of a stable 40 S preinitiation complex. J.Biol.Chem. 278:6580-6587.

120. Lamphear,B.J., Kirchweger,R., Skern,T., and Rhoads,R.E. 1995. Mapping of functional domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral proteases. Implications for cap-dependent and cap-independent translational initiation. J.Biol.Chem. 270:21975-21983.

121. Gingras,A.C., Raught,B., and Sonenberg,N. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu.Rev.Biochem. 68:913-963.

122. Nakamura,Y. and Ito,K. 2003. Making sense of mimic in translation termination. Trends Biochem.Sci. 28:99-105.

123. Ramakrishnan,V. 2002. Ribosome structure and the mechanism of translation. Cell 108:557-572.

124. Fan-Minogue,H., Du,M., Pisarev,A.V., Kallmeyer,A.K., Salas-Marco,J., Keeling,K.M., Thompson,S.R., Pestova,T.V., and Bedwell,D.M. 2008. Distinct eRF3 requirements suggest alternate eRF1 conformations mediate peptide release during eukaryotic translation termination. Mol.Cell 30:599-609.

125. Petry,S., Weixlbaumer,A., and Ramakrishnan,V. 2008. The termination of translation. Curr.Opin.Struct.Biol. 18:70-77.

126. Sonenberg,N. and Hinnebusch,A.G. 2007. New modes of translational control in development, behavior, and disease. Mol.Cell 28:721-729.

127. Richter,J.D. and Sonenberg,N. 2005. Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433:477-480.

128. Pyronnet,S., Dostie,J., and Sonenberg,N. 2001. Suppression of cap-dependent translation in mitosis. Genes Dev. 15:2083-2093.

129. Stebbins-Boaz,B., Cao,Q., de Moor,C.H., Mendez,R., and Richter,J.D. 1999. Maskin is a CPEB-associated factor that transiently interacts with elF-4E. Mol.Cell 4:1017-1027.

100

130. Jung,M.Y., Lorenz,L., and Richter,J.D. 2006. Translational control by neuroguidin, a eukaryotic initiation factor 4E and CPEB binding protein. Mol.Cell Biol. 26:4277-4287.

131. Nakamura,A., Sato,K., and Hanyu-Nakamura,K. 2004. Drosophila cup is an eIF4E binding protein that associates with Bruno and regulates oskar mRNA translation in oogenesis. Dev.Cell 6:69-78.

132. Napoli,I., Mercaldo,V., Boyl,P.P., Eleuteri,B., Zalfa,F., De Rubeis,S., Di Marino,D., Mohr,E., Massimi,M., Falconi,M. et al. 2008. The fragile X syndrome protein represses activity-dependent translation through CYFIP1, a new 4E-BP. Cell 134:1042-1054.

133. Cho,P.F., Poulin,F., Cho-Park,Y.A., Cho-Park,I.B., Chicoine,J.D., Lasko,P., and Sonenberg,N. 2005. A new paradigm for translational control: inhibition via 5'-3' mRNA tethering by Bicoid and the eIF4E cognate 4EHP. Cell 121:411-423.

134. Rom,E., Kim,H.C., Gingras,A.C., Marcotrigiano,J., Favre,D., Olsen,H., Burley,S.K., and Sonenberg,N. 1998. Cloning and characterization of 4EHP, a novel mammalian eIF4E-related cap-binding protein. J.Biol.Chem. 273:13104-13109.

135. Ostareck,D.H., Ostareck-Lederer,A., Shatsky,I.N., and Hentze,M.W. 2001. Lipoxygenase mRNA silencing in erythroid differentiation: The 3'UTR regulatory complex controls 60S ribosomal subunit joining. Cell 104:281-290.

136. Huttelmaier,S., Zenklusen,D., Lederer,M., Dictenberg,J., Lorenz,M., Meng,X., Bassell,G.J., Condeelis,J., and Singer,R.H. 2005. Spatial regulation of beta-actin translation by Src-dependent phosphorylation of ZBP1. Nature 438:512-515.

137. Ceci,M., Gaviraghi,C., Gorrini,C., Sala,L.A., Offenhauser,N., Marchisio,P.C., and Biffo,S. 2003. Release of eIF6 (p27BBP) from the 60S subunit allows 80S ribosome assembly. Nature 426:579-584.

138. Gandin,V., Miluzio,A., Barbieri,A.M., Beugnet,A., Kiyokawa,H., Marchisio,P.C., and Biffo,S. 2008. Eukaryotic initiation factor 6 is rate-limiting in translation, growth and transformation. Nature 455:684-688.

139. Richter,J.D. and Klann,E. 2009. Making synaptic plasticity and memory last: mechanisms of translational regulation. Genes Dev. 23:1-11.

140. Sutton,M.A., Taylor,A.M., Ito,H.T., Pham,A., and Schuman,E.M. 2007. Postsynaptic decoding of neural activity: eEF2 as a biochemical sensor coupling miniature synaptic transmission to local protein synthesis. Neuron 55:648-661.

141. Sivan,G., Kedersha,N., and Elroy-Stein,O. 2007. Ribosomal slowdown mediates translational arrest during cellular division. Mol.Cell Biol. 27:6639-6646.

142. Collingridge,G.L., Isaac,J.T., and Wang,Y.T. 2004. Receptor trafficking and synaptic plasticity. Nat.Rev.Neurosci. 5:952-962.

143. Keiler,K.C., Waller,P.R., and Sauer,R.T. 1996. Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science 271:990-993.

144. Haebel,P.W., Gutmann,S., and Ban,N. 2004. Dial tm for rescue: tmRNA engages ribosomes stalled on defective mRNAs. Curr.Opin.Struct.Biol. 14:58-65.

101

145. Akimitsu,N., Tanaka,J., and Pelletier,J. 2007. Translation of nonSTOP mRNA is repressed post-initiation in mammalian cells. EMBO J. 26:2327-2338.

146. Rodriguez,A.J., Czaplinski,K., Condeelis,J.S., and Singer,R.H. 2008. Mechanisms and cellular roles of local protein synthesis in mammalian cells. Curr.Opin.Cell Biol. 20:144-149.

147. Sonenberg,N. 2008. eIF4E, the mRNA cap-binding protein: from basic discovery to translational research. Biochem.Cell Biol. 86:178-183.

148. Shyu,A.B., Wilkinson,M.F., and van Hoof,A. 2008. Messenger RNA regulation: to translate or to degrade. EMBO J. 27:471-481.

149. Anderson,P. and Kedersha,N. 2006. RNA granules. J.Cell Biol. 172:803-808.

150. Martin,K.C. and Ephrussi,A. 2009. mRNA localization: gene expression in the spatial dimension. Cell 136:719-730.

151. Anderson,P. and Kedersha,N. 2009. RNA granules: post-transcriptional and epigenetic modulators of gene expression. Nat.Rev.Mol.Cell Biol. 10:430-436.

152. Brengues,M. and Parker,R. 2007. Accumulation of polyadenylated mRNA, Pab1p, eIF4E, and eIF4G with P-bodies in Saccharomyces cerevisiae. Mol.Biol.Cell 18:2592-2602.

153. Buchan,J.R., Muhlrad,D., and Parker,R. 2008. P bodies promote stress granule assembly in Saccharomyces cerevisiae. J.Cell Biol. 183:441-455.

154. Eulalio,A., Behm-Ansmant,I., and Izaurralde,E. 2007. P bodies: at the crossroads of post-transcriptional pathways. Nat.Rev.Mol.Cell Biol. 8:9-22.

155. Franks,T.M. and Lykke-Andersen,J. 2008. The control of mRNA decapping and P-body formation. Mol.Cell 32:605-615.

156. Gilks,N., Kedersha,N., Ayodele,M., Shen,L., Stoecklin,G., Dember,L.M., and Anderson,P. 2004. Stress granule assembly is mediated by prion-like aggregation of TIA-1. Mol.Biol.Cell 15:5383-5398.

157. Anderson,P. and Kedersha,N. 2008. Stress granules: the Tao of RNA triage. Trends Biochem.Sci. 33:141-150.

158. Tourriere,H., Chebli,K., Zekri,L., Courselaud,B., Blanchard,J.M., Bertrand,E., and Tazi,J. 2003. The RasGAP-associated endoribonuclease G3BP assembles stress granules. J.Cell Biol. 160:823-831.

159. Kulkarni,M., Ozgur,S., and Stoecklin,G. 2010. On track with P-bodies. Biochem.Soc.Trans. 38:242-251.

160. Teixeira,D., Sheth,U., Valencia-Sanchez,M.A., Brengues,M., and Parker,R. 2005. Processing bodies require RNA for assembly and contain nontranslating mRNAs. RNA. 11:371-382.

161. Liu,J., Valencia-Sanchez,M.A., Hannon,G.J., and Parker,R. 2005. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat.Cell Biol. 7:719-723.

162. Pillai,R.S., Bhattacharyya,S.N., Artus,C.G., Zoller,T., Cougot,N., Basyuk,E., Bertrand,E., and Filipowicz,W. 2005. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science 309:1573-1576.

102

163. Dashti,N., Williams,D.L., and Alaupovic,P. 1989. Effects of oleate and insulin on the production rates and cellular mRNA concentrations of apolipoproteins in HepG2 cells. J.Lipid Res. 30:1365-1373.

164. Theriault,A., Ogbonna,G., and Adeli,K. 1992. Thyroid hormone modulates apolipoprotein B gene expression in HepG2 cells. Biochem.Biophys.Res.Commun. 186:617-623.

165. Mohammadi,A., Theriault,A., and Adeli,K. 1996. In vitro translation and translocation of apolipoprotein B in a cell-free system from HepG2 cells. Biochem.Biophys.Res.Commun. 228:852-858.

166. Levy,E., Sinnett,D., Thibault,L., Nguyen,T.D., Delvin,E., and Menard,D. 1996. Insulin modulation of newly synthesized apolipoproteins B-100 and B-48 in human fetal intestine: gene expression and mRNA editing are not involved. FEBS Lett. 393:253-258.

167. Pan,M., Liang,J., Fisher,E.A., and Ginsberg,H.N. 2000. Inhibition of translocation of nascent apolipoprotein B across the endoplasmic reticulum membrane is associated with selective inhibition of the synthesis of apolipoprotein B. J.Biol.Chem. 275:27399-27405.

168. Keene,J.D. 2001. Ribonucleoprotein infrastructure regulating the flow of genetic information between the genome and the proteome. Proc.Natl.Acad.Sci.U.S.A 98:7018-7024.

169. Spirin,A.S. 1966. "Masked" forms of mRNA. Curr.Top.Dev.Biol. 1:1-38.

170. Jain,S.K., Pluskal,M.G., and Sarkar,S. 1979. Thermal chromatography of eukaryotic messenger ribonucleoprotein particles on oligo (dT)-cellulose. Evidence for common mRNA-associated proteins in various cell types. FEBS Lett. 97:84-90.

171. Blobel,G. 1973. A protein of molecular weight 78,000 bound to the polyadenylate region of eukaryotic messenger RNAs. Proc.Natl.Acad.Sci.U.S.A 70:924-928.

172. Minich,W.B., Maidebura,I.P., and Ovchinnikov,L.P. 1993. Purification and characterization of the major 50-kDa repressor protein from cytoplasmic mRNP of rabbit reticulocytes. Eur.J.Biochem. 212:633-638.

173. Angenstein,F., Evans,A.M., Ling,S.C., Settlage,R.E., Ficarro,S., Carrero-Martinez,F.A., Shabanowitz,J., Hunt,D.F., and Greenough,W.T. 2005. Proteomic characterization of messenger ribonucleoprotein complexes bound to nontranslated or translated poly(A) mRNAs in the rat cerebral cortex. J.Biol.Chem. 280:6496-6503.

174. Balagopal,V. and Parker,R. 2009. Polysomes, P bodies and stress granules: states and fates of eukaryotic mRNAs. Curr.Opin.Cell Biol. 21:403-408.

175. Chen,X., Sparks,J.D., Yao,Z., and Fisher,E.A. 1993. Hepatic polysomes that contain apoprotein B mRNA have unusual physical properties. J.Biol.Chem. 268:21007-21013.

176. Bachand,F., Lackner,D.H., Bahler,J., and Silver,P.A. 2006. Autoregulation of ribosome biosynthesis by a translational response in fission yeast. Mol.Cell Biol. 26:1731-1742.

177. Fusco,D., Accornero,N., Lavoie,B., Shenoy,S.M., Blanchard,J.M., Singer,R.H., and Bertrand,E. 2003. Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr.Biol. 13:161-167.

103

178. Kedersha,N., Stoecklin,G., Ayodele,M., Yacono,P., Lykke-Andersen,J., Fritzler,M.J., Scheuner,D., Kaufman,R.J., Golan,D.E., and Anderson,P. 2005. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J.Cell Biol. 169:871-884.

179. Kedersha,N. and Anderson,P. 2007. Mammalian stress granules and processing bodies. Methods Enzymol. 431:61-81.

180. Eulalio,A., Behm-Ansmant,I., Schweizer,D., and Izaurralde,E. 2007. P-body formation is a consequence, not the cause, of RNA-mediated gene silencing. Mol.Cell Biol. 27:3970-3981.

181. Beckett,D. and Uhlenbeck,O.C. 1988. Ribonucleoprotein complexes of R17 coat protein and a translational operator analog. J.Mol.Biol. 204:927-938.

182. Yao,Z. and McLeod,R.S. 1994. Synthesis and secretion of hepatic apolipoprotein B-containing lipoproteins. Biochim.Biophys.Acta 1212:152-166.

183. Anderson,P. and Kedersha,N. 2006. RNA granules. J.Cell Biol. 172:803-808.

184. Bertrand,E., Chartrand,P., Schaefer,M., Shenoy,S.M., Singer,R.H., and Long,R.M. 1998. Localization of ASH1 mRNA particles in living yeast. Mol.Cell 2:437-445.

185. Rook,M.S., Lu,M., and Kosik,K.S. 2000. CaMKIIalpha 3' untranslated region-directed mRNA translocation in living neurons: visualization by GFP linkage. J.Neurosci. 20:6385-6393.

186. Forrest,K.M. and Gavis,E.R. 2003. Live imaging of endogenous RNA reveals a diffusion and entrapment mechanism for nanos mRNA localization in Drosophila. Curr.Biol. 13:1159-1168.

187. Basyuk,E., Boulon,S., Skou,P.F., Bertrand,E., and Vestergaard,R.S. 2005. The packaging signal of MLV is an integrated module that mediates intracellular transport of genomic RNAs. J.Mol.Biol. 354:330-339.

188. Moore,M.D., Nikolaitchik,O.A., Chen,J., Hammarskjold,M.L., Rekosh,D., and Hu,W.S. 2009. Probing the HIV-1 genomic RNA trafficking pathway and dimerization by genetic recombination and single virion analyses. PLoS.Pathog. 5:e1000627.

104

Appendix

ApoB, Nucleus, P bodies

Figure 23 Visualizing apoB mRNA traffic in HepG2 Cells: 4 hour exposure to insulin induced co-localization of apoB mRNA with P bodies. HepG2 cells were transiently contransfected with pCMV-5’URT-ApoB15%-3’UTR-MS2bs-24X-cyto and MS2-GFP-NLS plasmids. 16 hours post transfection cells were serum sratved briefly and treated with insulin for 4 h. Green represents apoB mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

105



106



107


Figure 26 Visualizing apoB mRNA traffic in HepG2 Cells: 1 hour exposure to insulin din not induce co-localization of apoB mRNA with P bodies. HepG2 cells were transiently contransfected with pCMV-5’URT-ApoB15%-3’UTR-MS2bs-24X-cyto and MS2-GFP-NLS plasmids. 16 hours post transfection cells were serum sratved briefly and treated with insulin for 1 h. Cells were then fixed and immunostained for hedls, one of the main protein components of P Bodies. Green represents apoB mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

108


Figure 27 Effect of serum starvation on the co-localization of apoB mRNA with P bodies. HepG2 cells were transiently contransfected with pCMV-5’URT-ApoB15%-3’UTR-MS2bs-24X-cyto and MS2-GFP-NLS plasmids. 16 hours post transfection cells were serum sratved briefly. Cells were then fixed and immunostained for hedls, one of the main protein components of P Bodies. Green represents apoB mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

109

Beta-globin, Nucleus, P bodies

Figure 28 Effect of serum starvation on the co-localization of beta-globin mRNA with P bodies. HepG2 cells were co-transfected with EF1a-β-globin mRNA-MS2-bs and MS2-GFP-NLS plasmids, cells were then serum starved briefly. Cells were then fixed and immunostained for hedls, one of the protein components of P bodies. Green represents beta-globin mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

110


Figure 29 Effect of 1hour insulin exposure on the co-localization of beta-globin mRNA with P bodies. HepG2 cells were co-transfected with EF1a-β-globin mRNA-MS2-bs and MS2-GFP-NLS plasmids, cells were then serum starved briefly and treated with insulin for 1 hour. Cells were then fixed and immunostained for hedls, one of the protein components of P bodies. Green represents beta-globin mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

111


Figure 30 Effect of 4 hour insulin exposure on the co-localization of beta-globin mRNA with P bodies. HepG2 cells were co-transfected with EF1a-β-globin mRNA-MS2-bs and MS2-GFP-NLS plasmids, cells were then serum starved briefly and treated with insulin for 4 hours. Cells were then fixed and immunostained for hedls, one of the protein components of P bodies. Green represents beta-globin mRNA, P bodies are in red and DAPI was used to stain the nucleus (blue).

112



113



Insulin Modulates Intracellular Apolipoprotein B mRNA ... · ii . Insulin Modulates Intracellular...

Documents

Transcript of Insulin Modulates Intracellular Apolipoprotein B mRNA ... · ii . Insulin Modulates Intracellular...