Inhibitory Role of Greatwall-Like Protein Kinase Rim15p in AlcoholicFermentation via Upregulating the UDP-Glucose Synthesis Pathway inSaccharomyces cerevisiae

Daisuke Watanabe,a,b Yan Zhou,b Aiko Hirata,c Yukiko Sugimoto,a Kenichi Takagi,a Takeshi Akao,b Yoshikazu Ohya,c Hiroshi Takagi,a

Hitoshi Shimoib,d

Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara, Japana; National Research Institute of Brewing, Higashihiroshima,Hiroshima, Japanb; Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Kashiwa, Chiba, Japanc; Faculty of Agriculture, IwateUniversity, Morioka, Iwate, Japand

The high fermentation rate of Saccharomyces cerevisiae sake yeast strains is attributable to a loss-of-function mutation in theRIM15 gene, which encodes a Greatwall-family protein kinase that is conserved among eukaryotes. In the present study, we per-formed intracellular metabolic profiling analysis and revealed that deletion of the RIM15 gene in a laboratory strain impairedglucose-anabolic pathways through the synthesis of UDP-glucose (UDPG). Although Rim15p is required for the synthesis oftrehalose and glycogen from UDPG upon entry of cells into the quiescent state, we found that Rim15p is also essential for theaccumulation of cell wall �-glucans, which are also anabolic products of UDPG. Furthermore, the impairment of UDPG or 1,3-�-glucan synthesis contributed to an increase in the fermentation rate. Transcriptional induction of PGM2 (phosphoglucomu-tase) and UGP1 (UDPG pyrophosphorylase) was impaired in Rim15p-deficient cells in the early stage of fermentation. Thesefindings demonstrate that the decreased anabolism of glucose into UDPG and 1,3-�-glucan triggered by a defect in the Rim15p-mediated upregulation of PGM2 and UGP1 redirects the glucose flux into glycolysis. Consistent with this, sake yeast strains withdefective Rim15p exhibited impaired expression of PGM2 and UGP1 and decreased levels of �-glucans, trehalose, and glycogenduring sake fermentation. We also identified a sake yeast-specific mutation in the glycogen synthesis-associated glycogenin geneGLG2, supporting the conclusion that the glucose-anabolic pathway is impaired in sake yeast. These findings demonstrate thatdownregulation of the UDPG synthesis pathway is a key mechanism accelerating alcoholic fermentation in industrially utilizedS. cerevisiae sake strains.

Sake yeast strains, which belong to the species Saccharomycescerevisiae, are capable of achieving ethanol yields as high as 22

vol% in fermenting sake mash (1–3). This characteristic pheno-type is attributed in part to their high and sustained maximumfermentation rates, as observed in batch cultures containing highconcentrations of glucose (4), and is due to the continuous supplyof fermentable sugars to yeast cells in sake mash via the degrada-tion of rice starch by enzymes produced by Aspergillus oryzae. Inrecent studies of the representative sake yeast strain Kyokai no. 7(K7) and its relatives, we revealed that several stress- and/or nu-trient-responsive transcription factors, particularly Msn2p andMsn4p (Msn2/4p), Hsf1p, Adr1p, and Cat8p, are significantly in-activated (5–7). Impairment of these transcriptional activators inlaboratory strains of S. cerevisiae leads to increased fermentationrates, indicating that defective stress responses are linked with thesuperior fermentation properties of sake yeast (2, 5–7). Moreover,a loss-of-function mutation by insertion of an A residue at posi-tion 5055 in the RIM15 gene (rim155055insA) was commonly foundamong K7-related strains (8). RIM15 encodes a conserved Great-wall-like protein kinase involved in the control of mitotic cell cycleprogression (9). The role of Rim15p in initiating the G0 programhas been well established, particularly in yeast (10, 11), and morerecently, Rim15p was shown to directly phosphorylate andthereby enhance the activities of Msn2/4p and Hsf1p associatedwith G0 entry (12). In addition, deletion of the RIM15 gene mark-edly reduces stress tolerance and accelerates alcoholic fermenta-tion by both laboratory and industrial yeast strains (8, 13). Takentogether, these findings revealed the main underlying cause for the

high fermentation rates of sake yeast; however, the mechanism bywhich Rim15p-mediated stress signaling acts to impede ethanolproduction remains unclear.

In S. cerevisiae, the major metabolic fate of glucose is mainlydivided among the Embden-Meyerhoff-Parnass glycolytic andpentose phosphate pathways, glycerol production, and biomassformation. In addition to ethanol and carbon dioxide, the metab-olism of glucose yields numerous products, including acetate,glycerol, carbohydrates, and macromolecules, such as RNA, DNA,and protein. Multiple independent lines of evidence indicate thatthe genetic background and the culture environment influencecarbon metabolic flux and that mechanisms involving transcrip-tional regulation, such as glucose sensing, glucose repression, andoxygen responses, mediate the metabolic changes (14–18). There-fore, Rim15p may negatively regulate ethanol production throughthe activities of the downstream transcriptional activators Msn2/4p

Received 11 September 2015 Accepted 20 October 2015

Accepted manuscript posted online 23 October 2015

Citation Watanabe D, Zhou Y, Hirata A, Sugimoto Y, Takagi K, Akao T, Ohya Y,Takagi H, Shimoi H. 2016. Inhibitory role of Greatwall-like protein kinase Rim15p inalcoholic fermentation via upregulating the UDP-glucose synthesis pathway inSaccharomyces cerevisiae. Appl Environ Microbiol 82:340 –351.doi:10.1128/AEM.02977-15.

Editor: D. Cullen

Address correspondence to Hitoshi Shimoi, simoi@iwate-u.ac.jp.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

crossmark

340 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

and Hsf1p, which induce the expression of genes involved in aer-obic respiration, trehalose and glycogen metabolism, cell wall bio-synthesis, pentose phosphate shuttling, and fatty acid metabolism(19, 20). Consistent with this speculation, we previously reportedthat the K7-related sake yeast strain K701 with a rim155055insA mu-tation shows severe decreases in the expression of several targetsassociated with various carbon metabolic pathways during sakefermentation (8). This observed diversity in transcriptional regu-lation, however, complicates identification of the metabolic reac-tions that are responsible for the Rim15p-mediated control ofethanol production. To investigate this point, we examined herethe effects of functional impairment of Rim15p on the metabolicprofiles of S. cerevisiae cells during alcoholic fermentation.

MATERIALS AND METHODSYeast strains. Sake yeast strain Kyokai no. 7 (K7) and its relatives (K6 andK9 to K15) were provided by the Brewing Society of Japan (Tokyo, Japan).Strain K701 is a derivative strain of K7 and has a nonfoaming phenotype(21). Laboratory S. cerevisiae strain X2180 was provided by the American

Type Culture Collection (USA). Strains BY4741 and BY4743 and theirsingle-deletion mutants were provided by EUROSCARF (Germany).Strain R1158 and its pUGP1::Kanr-tetO7-TATA mutant were purchasedfrom Thermo Scientific (USA). Yeast cells were routinely grown in liquidYPD medium (1% yeast extract, 2% peptone, 2% glucose) at 30°C, unlessotherwise stated.

The oligonucleotides used in this study are listed in Table 1. Disrup-tion of the ZWF1, TKL1, TKL2, and TAL1 genes in X2180-1A was per-formed using a PCR-based method (22) with primers ZWF1-DF andZWF1-DR, TKL1-DF and TKL1-DR, TKL2-DF and TKL2-DR, orTAL1-DF and TAL1-DR, respectively, and plasmids pFA6-kanMX4,pAG25 (22), and pYC140 (23) as the templates to generate mutant yeaststrains X2180-1A zwf1�::natMX (X2180-1A zwf1�) and X2180-1A tkl1�::kanMX tkl2�::natMX tal1�::hphMX (X2180-1A tkl1/2� tal1�). Mutationof ZWF1, TKL1, TKL2, and TAL1 was confirmed by PCR with the primerpairs ZWF1-F and ZWF1-R, TKL1-F and TKL1-R, TKL2-F and TKL2-R,and TAL1-F and TAL1-R, respectively. Disruption of the GLG1, GLG2,GSY1, and GSY2 genes in BY4741 was performed using a PCR-basedmethod (22) with primers GLG1-DF and GLG1-DR, GLG2-DF andGLG2-DR, GSY1-DF and GSY1-DR, and GSY2-DF and GSY2-DR, re-

TABLE 1 Oligonucleotides used in this study

Primer Sequence (5= to 3=)GLG1-DF GTGGTGGAGACTTAGTAGGGATTCTATTTTCGCGTACTAGTGTGACGTACGCTGCAGGTCGACGLG1-DR TACTGCATACTCAAAAATATCATCAGGGAAACACCTCTCTACTTTATCGATGAATTCGAGCTCGGLG1-F TCAGGAGTCAAAACGTACTAACGLG1-R TCAGTCACTATAAACGTTGTGAGGLG2-DF ATGAGGGGAGTAGATCAAGGATAGCGCATCCACCTCCAAAAGCATCGTACGCTGCAGGTCGACGLG2-DR GGTATCAGGCTTTGGGAATGCTCTTTGGACGCGGTCTAAATAATCATCGATGAATTCGAGCTCGGLG2-F AGGCACTGATGTGCCAATCTAGGLG2-R TTCGTCTGATGTGACGACTGTACGSY1-DF TATATCTAAACTCCAAATATACTAGTTAGCACAGCCTGGAAACCTCGTACGCTGCAGGTCGACGSY1-DR ATTATCCTCGTAGTATGCAGACGTATCGTTGTCATCATCGTCATTATCGATGAATTCGAGCTCGGSY1-F TGAATAAGGGCAGACAAGAGGCGSY1-R AAGTATCCCACGTAAAAGGTTCCGSY2-DF GATAACTGTGATTGAAGTTTTGACTACCTCAGAGAAAAATTTTGACGTACGCTGCAGGTCGACGSY2-DR ACTGTCATCAGCATATGGGCCATCGTCGTCATCGTCAGCTGCAGGATCGATGAATTCGAGCTCGGSY2-F TTGGACATGGAATTAGGCCAGCGSY2-R TTTGGATCGCTCAAAACTCCTAGTAL1-DF ACGATAGTAAAATACTTCTCGAACTCGTCACATATACGTGTACATATGCCCGGGCTTAATTAAGTAL1-DR AACGTGCATAAGGACATGGCCTAAATTAATATTTCCGAGATACTTTAGCACGTGATGAAAAGGTAL1-F ACATGCGCGCGCTTCCTATATACTAL1-R ATTGCTATTGGATTTGGTGTGGTKL1-DF AGGAAGCTCATCCCAAGCAACTCTACATAGTTACCTCTTTAGCAACGTACGCTGCAGGTCGACTKL1-DR TTTCACAAATAATATCATATCAAATCTGATGATCTACGATCAGAAATCGATGAATTCGAGCTCGTKL1-F AGGTACGATCGTAGGCATGATTCTKL1-R AGGACTGAGTGTTTGGAATATTGTKL2-DF TCTTCGATTTGTAACCTCTACGTAGACGATTATACCTTACTAATCCGTACGCTGCAGGTCGACTKL2-DR TATTTCAGGCAGCAAGTGACCATCAACCAGGAAGTGTGAAATAGCATCGATGAATTCGAGCTCGTKL2-F AGTGTCGAATATAGGGAGCTTCTKL2-R TGCCTCTAGAAGCGGTCAGCAAGZWF1-DF TATAGACAGAAAGAGTAAATCCAATAGAATAGAAAACCACATAAGCGTACGCTGCAGGTCGACZWF1-DR AGTAGAGAGGAGTTGGTGGGGGGAAGATGCCATTATAGAGGAGAAATCGATGAATTCGAGCTCGZWF1-F AAGGGTGGCGAATTCTTCAATGZWF1-R AGACGTGGAATGGTGGGAAAGCCACT1-RT-F GGTTGCTGCTTTGGTTATTGAACT1-RT-R TTTTGACCCATACCGACCATPGM1-RT-F CTGATTTCGGCGGTTTACATPGM1-RT-R GAACGTGCCAAGCCATAAATPGM2-RT-F GGTGACTCCGTCGCAATTATPGM2-RT-R CGTCGAACAAAGCACAGAAAUGP1-RT-F ATCGAGCAATTTGGAGATGGUGP1-RT-R AACCAGCAACAAATCGGAAC

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 341Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

spectively, and plasmids pFA6-kanMX4 and pAG25 (22) as the templatesto generate the mutant yeast strains BY4741 glg1�::natMX glg2�::kanMX(BY4741 glg1/2�) and BY4741 gsy1�::natMX gsy2�::kanMX (BY4741gsy1/2�). The mutation of GLG1, GLG2, GSY1, and GSY2 was confirmedby PCR with the primer pairs GLG1-F and GLG1-R, GLG2-F andGLG2-R, GSY1-F and GSY1-R, and GSY2-F and GSY2-R, respectively.

Fermentation tests. For measurement of fermentation rates in YPDmedium, yeast cells were precultured in YPD medium at 30°C, inoculatedinto 50 ml of 20% glucose-containing YPD medium at a final opticaldensity at a wavelength of 660 nm (OD660) of 0.1, and then further incu-bated at 30°C without shaking. The course of the fermentation was con-tinuously monitored by measuring the volume of evolved carbon dioxidegas using a Fermograph II apparatus (Atto) (3). The ethanol concentra-tion in the medium was determined using a GC-14B gas chromatograph(Shimadzu) equipped with a flame ionization detector and a DB-WAXcolumn (30 m by 0.25 mm [internal diameter], 0.25-�m film thickness;Agilent Technologies). The cell number was determined using a hemocy-tometer. For the analysis of cell weight, cells in 50 ml of each culturesample were pelleted by centrifugation at 3,000 rpm for 5 min andweighed (cell fresh weight). Cells were further desiccated in an evaporatorand weighed (cell dry weight).

For small-scale sake brewing experiments, a single-step sake mash wasprepared by mixing 40 g pregelatinized rice, 10 g dried koji (rice cultivatedwith A. oryzae), 20 �l 90% lactic acid, and 80 ml water containing yeastcells at a final OD660 of 1.0 and was then incubated at 15°C without shak-ing. To analyze yeast cells in the viscous sake mash, cells were collected byfiltration through a sterile Miracloth (Calbiochem). The isolated yeast cellsamples contained similar amounts of particulate matter derived frompartially degraded rice starch and proteins. As much particulate matter aspossible was removed from the samples using a microspatula. Intracellu-lar trehalose and glycogen levels were then determined according to themethod of Parrou and François (24). Quantitative cell lysis tests usingZymolyase were performed as previously described (25).

Analysis of intracellular metabolic profiles. During the fermentationtests in 20% glucose-containing YPD medium, BY4743 wild-type orrim15� cells corresponding to an OD600 of 10 (5.72 � 107 or 5.65 � 107

cells, respectively) were collected when the fermentation rate was maximal(1 day after inoculation). All pretreatment procedures for the sampleswere performed according to the protocols provided by Human Metabo-lome Technologies, Inc. Briefly, cells were harvested using a suction-fil-tration system equipped with a 0.4-�m-pore-size filter (Isopore mem-brane filter HTTP; Millipore) and were then washed twice with 10 mlMilli-Q water at room temperature. The filter containing the cells wasimmersed in 2 ml methanol containing 5 �M internal standard solution 1(Human Metabolome Technologies) and then sonicated for 30 s to resus-pend the cells in the methanol at room temperature. Cationic and anionicmetabolites were separated by capillary electrophoresis (CE) with a fusedsilica capillary (50 �m by 80 cm) and commercial buffer solutions H3301-1001 and H3302-1201 (Human Metabolome Technologies), respectively.For time of flight mass spectrometry (TOFMS), electrospray ionization-mass spectrometry was conducted in both positive- and negative-ionmodes. CE-TOFMS analysis was performed using an Agilent CE-TOFMSsystem (Agilent Technologies). For data acquisition, MasterHands soft-ware (version 2.9.0.9; Human Metabolome Technologies) was used. Sig-nal peaks were annotated on the basis of the migration times and m/zvalues determined by TOFMS for putative metabolites in the HMT me-tabolite database (Human Metabolome Technologies).

qRT-PCR assay. Total RNA was isolated from BY4743 wild-type orrim15� cells cultured in YPD medium for the fermentation tests using anRNeasy minikit (Qiagen) and was quantified using a BioSpec-Nano spec-trophotometer (Shimadzu). cDNA was synthesized from 1 �g total RNAin a final volume of 20 �l using a high-capacity cDNA reverse transcrip-tion kit (Applied Biosystems). The PCR mixtures (total volume, 25 �l)contained cDNA (2 �l for each sample), 0.1 �M primers, and 12.5 �l PCRmaster mix (2�; Power SYBR green master mix; Applied Biosystems).

The primer pairs used were as follows: PGM1-RT-F and PGM1-RT-R,PGM2-RT-F and PGM2-RT-R, UGP1-RT-F and UGP1-RT-R, and ACT1-RT-F and ACT1-RT-R. Gene-specific quantitative real-time PCR (qRT-PCR) was performed using a 7300 real-time PCR system (Applied Biosys-tems), and the expression data were processed using sequence detectionsoftware (version 1.2.3; Applied Biosystems). Delta cycle threshold (�CT)values were calculated by subtracting the �CT value for of the wild-typecell sample from the �CT value for the rim15� cell sample. Fold changeswere calculated using the 2���CT method (26).

TEM. For transmission electron microscopy (TEM), cells were fixedwith 3% glutaraldehyde in potassium phosphate buffer (pH 7.0) for 2 h,washed several times in water, and then fixed with 2.5% potassium per-manganate for 2 h. After washing in distilled water, the cells were dehy-drated in a series of increasing concentrations of ethanol and absoluteacetone and were then embedded in Spurr’s resin. After polymerization incapsules for 5 h at 50°C, followed by 3 days at 60°C, ultrathin sections werecut on a Leica Ultracut UCT microtome and stained with uranyl acetateand lead citrate. The obtained sections were viewed on an H-7650 electronmicroscope (Hitachi) at 100 kV.

RESULTSFermentation kinetics and carbon metabolic profile of rim15�cells. To elucidate how the dysfunction of Rim15p acceleratesalcoholic fermentation by S. cerevisiae, we examined the fermen-tation kinetics and intracellular metabolites of BY4743 wild-typeand rim15� cells. During alcoholic fermentation in 20% glucose-containing YPD medium, the cell densities measured by both de-termination of the OD600 (Fig. 1A) and direct counting on a he-mocytometer (Fig. 1B) were similar between the wild-type andrim15� strains. However, the weight of individual rim15� cellswas estimated to be significantly lower than that of wild-type cells(Fig. 1C to E). Consistent with our previous report (8, 13), dele-tion of the RIM15 gene accelerated alcoholic fermentation (Fig.1F) by increasing the maximum fermentation rate (wild-typecells, 177.4 � 6.5 ml/6 h; rim15� cells, 196.9 � 5.5 ml/6 h) andslowing the rapid reduction in fermentation that was observed inwild-type cultures (Fig. 1G). Although the fermentation rate ofthe rim15� strain appeared to be lower than that of the wild-typestrain at the end of the fermentation (4 to 6 days after inoculation),the lower rates of CO2 emission by rim15� cells were likely attrib-utable to glucose starvation. If the fermentation rates were com-pared at identical stages of fermentation progression, the fermen-tation rate of the rim15� strain was consistently higher than thatof wild-type cells throughout the fermentation period (Fig. 1H).The ethanol concentrations during fermentation were also ele-vated by deletion of the RIM15 gene (Fig. 1I). Taken together,these data suggest that the dysfunction of Rim15p increased thefermentation rate by enhancing the ethanol productivity of indi-vidual cells (Fig. 1J), rather than increasing cell growth. Specificethanol productivity, calculated as the ethanol production rate perunit of cell biomass, was also estimated to be higher in the rim15�strain, on the basis of its low cell dry weight (Fig. 1D). For thisreason, we next analyzed the intracellular metabolic profiles of therim15� strain to identify potential factors contributing to the highfermentation rate caused by the loss of Rim15p function.

Metabolites were extracted from cells sampled 1 day after in-oculation of 20% glucose-containing YPD medium. This timepoint was selected because wild-type cells showed a drastic de-crease in the fermentation rate after 1 day of culture, whereas therim15� cells maintained a high fermentation rate (Fig. 1G). Themetabolite analysis revealed that only a few glycolytic intermedi-ates, including glucose-6-phosphate (G6P), 2-phosphoglycerate

Watanabe et al.

342 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

(2PG), and phosphoenolpyruvate (PEP), were increased by dele-tion of the RIM15 gene; however, more distinctive alterations intwo other carbon metabolic pathways branching from glycolysis,namely, the pentose phosphate and carbohydrate synthetic path-ways, were detected in rim15� cells (Fig. 2). Two products of theoxidative pentose phosphate shunt, ribulose-5-phosphate (Ru5P)and ribose-5-phosphate (R5P), in rim15� cells were decreased toapproximately 60% to 70% of the levels found in wild-type cells.In addition, the levels of UDP-glucose/galactose (UDPG; isomersof UDP-glucose and UDP-galactose were not separated in thepresent CE analysis) and trehalose-6-phosphate (T6P) of the tre-halose synthetic pathway declined to between 70% and 80% of thelevels in wild-type cells, whereas the level of glucose-1-phosphate(G1P) increased by approximately 50% in rim15� cells, althoughthis difference did not represent a statistically significant increase.These results suggest that the conversion of G1P to UDPG cata-lyzed by the UDPG pyrophosphorylase Ugp1p is markedly inhib-ited by deletion of the RIM15 gene.

As previously reported (27, 28), defective UDPG synthesisleads to decreased levels of not only trehalose but also glycogen,cell wall �-glucans, and N-glycosylated proteins. It was thereforeexpected that the accumulation of these products would also bedecreased in rim15� cells during alcoholic fermentation. Consis-tent with this speculation, it was previously shown that the syn-

thesis of trehalose and glycogen induced upon entry into the sta-tionary phase or by rapamycin treatment is severely defective inrim15� cells (8, 10). In the present study, we further examined theeffects of Rim15p on cell wall �-glucans during alcoholic fermen-tation by observing the cell wall ultrastructure using TEM (Fig. 3).In the early stage of fermentation (6 h after inoculation), the cellwalls of both the wild-type and rim15� strains were indistinguish-able (Fig. 3A and E). However, after the fermentation rates of thewild-type and rim15� strains reached the maximum (after 1 dayand 4 days), the cell wall of wild-type cells had clearly thickened,whereas that of rim15� cells appeared unchanged (Fig. 3B, D, F,and H). Under higher magnification, it was observed that internalelectron-transparent layers composed of �-glucans and chitin(29) increased in thickness in the wild-type cells (Fig. 3C and G).Specifically, the thickness of the cell wall inner layer of wild-typecells increased from 93 � 14 nm after 6 h of fermentation to 124 �19 nm after 1 day of fermentation and 139 � 18 nm after 4 days offermentation, whereas that of rim15� cells did not exhibit prom-inent changes, as the cell wall inner layer increased only from 85 �13 nm after 6 h of fermentation to 98 � 12 nm after 1 day offermentation and 110 � 14 nm after 4 days of fermentation (Fig.3I). These results demonstrate that Rim15p plays an essential rolein the accumulation of cell wall �-glucans through UDPG synthe-sis during alcoholic fermentation.

FIG 1 Effects of deletion of the RIM15 gene on the fermentation kinetics of a laboratory strain in YPD medium. Gray and black lines, data for the BY4743wild-type and rim15� strains, respectively. All fermentation tests were performed in 50 ml of 20% glucose-containing YPD medium at 30°C. Data represent theaverages from three or more independent experiments, and error bars indicate standard deviations. WT, wild type; d, day. *, significantly lower than the value forthe wild type (t test, P � 0.05); **, significantly higher than the value for the wild type (t test, P � 0.05). (A) OD600. (B) Cell density. (C) Cell fresh weight. (D)Cell dry weight. (E) Cell dry weight per cell. Each value was calculated by dividing the mean cell dry weight shown in panel D by the mean cell number shown inpanel B. (F) Total amount of carbon dioxide evolved. (G) Amount of carbon dioxide evolved every 6 h. Arrow, the sampling point (1 day after inoculation) forthe metabolome analysis whose results are presented in Fig. 2. (H) Graph of panel G modified to compare the carbon dioxide emission rates between the samplesin which fermentation progressed to the same degree (represented by total carbon dioxide emission in panel F). (I) Ethanol concentration. (J) Carbondioxide emission rate per cell. Each value was calculated by dividing the mean carbon dioxide emission rate shown in panel G by the mean cell numbershown in panel B.

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 343Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Effects of impairment of specific carbon metabolic/anabolicpathways on alcoholic fermentation. To determine if the de-creased metabolite levels caused by the loss of Rim15p (Fig. 2) arerelated to the enhancement of alcoholic fermentation, we furtherexamined the effects of disruption of genes related to specific car-bon metabolic/anabolic pathways on the fermentation rate. Wefirst examined gene deletions that affect the pentose phosphatepathway. Deletion of the ZWF1 gene, which encodes a G6P dehy-drogenase that catalyzes the first step of the oxidative pentosephosphate shunt (30, 31), did not significantly change the fermen-tation profile of the X2180-1A strain when cultured in 20% glu-cose-containing YPD medium (Fig. 4A; maximum fermentationrates, 200.2 ml/6 h for wild-type strain X2180-1A and 197.8 ml/6 hfor the zwf1� mutant). In contrast, the fermentation rate of thetkl1/2� tal1� triple disruptant, in which the nonoxidative branchof the pentose phosphate pathway is inhibited (31, 32), was ex-tremely low (Fig. 4B; fermentation rate for the tkl1/2� tal1�strain, 77.4 ml/6 h). These results demonstrate that impairment ofthe pentose phosphate pathway does not lead to higher fermenta-tion rates. In addition, single deletions of the GPD1 and GPD2genes, which encode the glycerol-3-phosphate dehydrogenase en-zymes involved in glycerol synthesis, did not alter the fermenta-tion rate under the present experimental conditions (Fig. 4C and

D). These results, together with the fact that the glycerol syntheticpathway was not significantly affected by Rim15p (Fig. 2), indicatethat glycerol synthesis does not have a critical role in Rim15p-mediated fermentation control.

We next tested the influence of UDPG synthesis-related geneson alcohol fermentation by S. cerevisiae. Deletion of the PGM1and PGM2 genes, encoding phosphoglucomutases involved in theconversion of G6P to G1P (33), increased the fermentation rate(Fig. 4E and F; BY4743 wild type, 153.5 ml/6 h; pgm1� mutant,194.8 ml/6 h; pgm2� mutant, 189.4 ml/6 h). Because loss of theUDPG pyrophosphorylase Ugp1p, which catalyzes the formationof UDPG from G1P and UTP, is lethal for yeast cells (27), we useda laboratory strain (R1158 pUGP1::Kanr-tetO7-TATA) in whichthe expression of UGP1 was under the control of a doxycycline(Dox)-repressible promoter (34, 35) (Fig. 4G to L). Although Doxdid not affect the fermentation profile of the R1158 wild-typestrain (Fig. 4G to I; fermentation rates, 182.2 ml/6 h with 0 �g/mlDox, 182.1 ml/6 h with 0.1 �g/ml Dox, 183.6 ml/6 h with 1 �g/mlDox, and 199.2 ml/6 h with 10 �g/ml Dox), the addition of 0.1 or1 �g/ml Dox to the fermentation medium markedly increased thecarbon dioxide emission rate by the pUGP1::Kanr-tetO7-TATAstrain in a Dox concentration-dependent manner (Fig. 4J and K;fermentation rates, 170.6 ml/6 h with 0 �g/ml Dox, 185.4 ml/6 h

FIG 2 Effects of deletion of the RIM15 gene on the metabolic profile of a laboratory strain during alcoholic fermentation. The metabolic profiling data (numberof picomoles per 107 cells; except for UDPG and T6P, the data for which are represented by the relative peak area per 107 cells) for glucose metabolites in BY4743wild-type (green bars) and rim15� (orange bars) cells were mapped onto known pathways, including glycolysis and alcoholic fermentation (gray arrows), thepentose phosphate pathway (blue arrows), glycerol biosynthesis (purple arrows), and the UDPG and carbohydrate anabolic pathway (pink arrows). Cells werecultured in YPD medium containing 20% glucose at 30°C, and metabolites were extracted when the fermentation rate was maximized (1 day after inoculation)and analyzed by CE-TOFMS. G6P, glucose-6-phosphate; F6P, fructose-6-phosphate; F1,6BP, fructose-1,6-diphosphate; G3P, glyceraldehyde-3-phosphate;DHAP, dihydroxyacetone phosphate; 1,3BPG, 1,3-diphosphoglycerate; 3PG, 3-phosphoglycerate; 2PG, 2-phosphoglycerate; PEP, phosphoenolpyruvate; Pyr,pyruvate; AcAld, acetaldehyde; 6PGL, 6-phosphogluconolactone; 6PG, 6-phosphogluconate; Ru5P, ribulose-5-phosphate; R5P, ribose-5-phosphate; Xu5P,xylulose-5-phosphate; E4P, erythrose-4-phosphate; S7P, sedoheplulose-7-phosphate; Gly3P, glycerol-3-phosphate; G1P, glucose-1-phosphate; UDPG, UDP-glucose/galactose; T6P, trehalose-6-phosphate; ND, not detected; WT, wild type. Data represent the averages from two independent experiments, and error barsindicate standard errors. *, significantly lower than the value for wild-type cells (t test, P � 0.05); **, significantly higher than the value for wild-type cells (t test,P � 0.05).

Watanabe et al.

344 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

with 0.1 �g/ml Dox, and 217.5 ml/6 h with 1 �g/ml Dox). Aspreviously reported (28), strong repression of the UGP1 gene bythe addition of 10 �g/ml Dox to the fermentation medium de-layed cell growth (data not shown); however, the maximum fer-mentation rate was only slightly decreased (Fig. 4L; 146.5 ml/6 h).Taken together, these results demonstrate that impairment ofUDPG synthesis specifically accelerates alcoholic fermentationthrough the redirection of glucose flux.

To determine whether the impaired synthesis of carbohydratescaused the enhancement of alcoholic fermentation in rim15�cells, the effects of deletion of the trehalose, glycogen, and 1,3-�-glucan synthesis genes on fermentation rates in 20% glucose-con-taining YPD medium were further examined. Unexpectedly, noneof the deletions in the trehalose synthesis genes (TPS1 and TPS2,encoding T6P synthase and T6P phosphatase, respectively) or gly-cogen synthesis genes (glycogenin glucosyltransferases GLG1 andGLG2, glycogen synthases GSY1 and GSY2, and glycogen-branch-ing enzyme GLC3) (36) accelerated alcoholic fermentation (Fig.4M to Q). It is noted that the tps1� strain used in this study mightcontain suppressor mutations because disruption of the TPS1gene has been reported to be lethal to yeast cells with a certaingenetic background on fermentable carbon sources (37). Consis-tent with a previous report (38), a high intracellular level of T6Pcaused by the deletion of TPS2 may have inhibited hexokinasefunction and restricted glucose influx into glycolysis, leading toseverely delayed fermentation (Fig. 4N). In contrast, loss of eitherthe FKS1 or FKS2 gene (FKS1 and FKS2 encode redundant cata-lytic subunits of 1,3-�-glucan synthase [39, 40]) significantly in-creased carbon dioxide emissions during the 5-day fermentation(Fig. 4R and S). Although the maximum fermentation rate of thefks1� strain (144.4 ml/6 h) was slightly lower than that of theBY4743 wild-type strain (150.3 ml/6 h), a difference that was likelyattributable to the slower growth phenotype of the deletion strain(39), the fermentation rate was highly maintained until most ofthe glucose was consumed. The maximum fermentation rate of

the fks2� strain (167.8 ml/6 h) was clearly higher than that of thewild-type strain, although the effects of fks2� on total carbon di-oxide emissions were weaker than those of fks1�. Based on thesedata, we concluded that the synthesis of 1,3-�-glucan by the ana-bolic products of UDPG specifically and negatively affects alco-holic fermentation.

Roles of Rim15p in UDPG synthetic gene induction in theearly stages of alcoholic fermentation. How does Rim15p, to-gether with the putative downstream effectors Msn2/4p andHsf1p (12), contribute to UDPG synthesis to negatively affect themaximum fermentation rate? In the present study, we focused ontranscriptional regulation of the PGM1, PGM2, and UGP1 genesby Rim15p via Msn2/4p and Hsf1p during the initial stage of al-coholic fermentation. A search for conserved recognition sites ofMsn2/4p and Hsf1p using the YEASTRACT database (Fig. 5A)identified three Msn2/4p sites in PGM1 (at positions �489, �482,and �313 in the 5= upstream region), seven Msn2/4p sites inPGM2 (at positions �719, �535, �406, �354, �300, �254, and�211), five Msn2/4p sites in UGP1 (at positions �529, �478,�440, �272, and �260), and one Hsf1p site each in PGM1 andUGP1 (at positions �613 and �257, respectively). Previous ge-nome-wide studies have confirmed the Msn2/4p- and/or Hsf1p-dependent induction of these genes in response to various stresses(19, 20, 41–43). Although the 5= upstream region of the PGM2gene does not contain typical Hsf1p sites, it was reported that aloss-of-function hsf1 mutation reduces the expression of PGM2upon heat shock (41). Therefore, we speculated that deletion ofRIM15 would suppress the induction of these UDPG synthesis-related genes via both Msn2/4p and Hsf1p during alcoholic fer-mentation.

qRT-PCR analysis indicated that PGM2 and UGP1 were signif-icantly upregulated in BY4743 wild-type cells cultivated in 20%glucose-containing YPD medium before the maximum fermenta-tion rate was reached (24 h) but not in rim15� cells (Fig. 5B). Incontrast, the PGM1 mRNA level was not clearly elevated in either

FIG 3 Rim15p is essential for thickening of the cell wall �-glucan layers during alcoholic fermentation. (A to H) Ultrastructural images of wild-type (A to D) andrim15� mutant (E to H) BY4743 cells isolated from cell suspensions 6 h, 1 day, and 4 days after inoculation into YPD medium. Higher magnifications of the boxedregions in B and F are shown in panels C and G, respectively. N, nucleus; V, vacuole; PM, plasma membrane; IL, electron-translucent inner layer of the cell wall;OL, electron-dense outer layer of the cell wall. Bars, 1 �m (A, B, D to F, H) and 200 nm (C, G). (I) Distribution of cell wall inner layer thickness for wild-typeBY4743 cells (top) and rim15� BY4743 cells (bottom), as quantified by TEM analyses. Cell wall thickness was measured from the cross sections of cells that werecut approximately in the middle of the cell body. For each cell, the measurements at 3 or more positions were averaged, and 50 individual cells were tested for eachsample.

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 345Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

the wild-type or rim15� strain during this stage of the fermenta-tion. Despite the presence of multiple Msn2/4p and Hsf1p sites inPGM1, few reports have examined the stress-induced expressionof PGM1 (19), suggesting that Rim15p and its related downstreamtranscription factors play only a limited role in the transcriptionalcontrol of PGM1. Thus, the present results indicate that Rim15pspecifically targets the PGM2 and UGP1 genes in the early stages ofalcoholic fermentation. Consistent with this finding, in our previ-ous comparative transcriptomic analysis of laboratory strainX2180 with functional Rim15p and sake strain K701 harboring therim155055insA loss-of-function mutation (5, 8), K701 showed de-fective induction of the PGM2 and UGP1 genes before the maxi-mum fermentation rate was reached (3 to 5 days) during sakefermentation (Fig. 5C).

Decreased synthesis of structural and storage carbohydratesin sake yeast during sake fermentation. The above-described re-sults suggest that sake yeast K7 and its relatives exhibit high fer-mentation rates due to defective synthesis of UDPG and 1,3-�-glucan during a 20-day sake fermentation. To confirm this

speculation, we observed the cell wall ultrastructure of strainsX2180 and K7 in sake mash on days 2 and 10 by TEM. Althoughthe cell walls of the two strains could not be distinguished on day2 (Fig. 6A and B), the cell wall of X2180 was clearly thickened,whereas that of K7 appeared to be almost unchanged (Fig. 6C, D,K, and L). As observed in the fermentation tests using 20% glu-cose-containing YPD medium, marked thickening of electron-transparent internal �-glucan layers was observed in X2180 cells(Fig. 6G and H). In X2180 cells, the thickness of the cell wall innerlayer increased from 149 � 34 nm on day 2 to 263 � 37 nm on day10, whereas that of K7 increased only from 118 � 24 nm on day 2to 140 � 24 nm on day 10 (Fig. 6M). The related sake strain K9also exhibited similar defects in the thickening of the inner cellwall layer (131 � 27 and 158 � 21 nm on days 2 and 10, respec-tively). In addition to these features, the sake yeast cells exhibiteddefective cell surface structures, such as cell walls lacking a distinc-tive outer layer (Fig. 6E and I) and ruptured cell membranes(Fig. 6F and J). The thickening of yeast cell walls, which are pre-dominantly composed of 1,3-�-glucan, during the stationary

FIG 4 Effects of modifying carbon metabolic/anabolic genes on fermentation progression, as monitored by measurement of carbon dioxide emissions. (A, B)Fermentation profiles of strain X2180-1A (wild type [WT], gray) and its zwf1� (A) and tkl1/2� tal1� (B) mutants (black). All fermentation tests were performedin 20% glucose-containing YPD medium (YPD20) at 30°C. (C to F) Fermentation profiles of strain BY4743 (wild type, gray) and its gpd1� (C), gpd2� (D), pgm1�(E), and pgm2� (F) mutants (black). All fermentation tests were performed in 20% glucose-containing YPD medium at 30°C. (G to L) Fermentation tests in 20%glucose-containing YPD medium supplemented or not supplemented with doxycycline (Dox) at 30°C using strain R1158 (G to I) and its pUGP1::Kanr-tetO7-TATA mutant (J to L). Gray, no doxycycline; black, 0.1, 1, or 10 �g/ml doxycycline. (M, N) Fermentation profiles of strain BY4743 (wild type, gray) and its tps1�(M) and tps2� (N) mutants (black). (O, P) Fermentation profiles of strain BY4741 (wild type, gray) and its glg1/2� (O) and gsy1/2� (P) mutants (black). Allfermentation tests were performed in 20% glucose-containing YPD medium at 30°C. (Q to S) Fermentation profiles of strain BY4743 (wild type, gray) and itsglc3� (Q), fks1� (R), and fks2� (S) mutants (black). All fermentation tests were performed in 20% glucose-containing YPD medium at 30°C. The averaged datafrom two or more independent experiments, in which both exhibited similar results, are shown. *, significantly lower than the value for the wild-type strain (t test,P � 0.05); **, significantly higher than the value for the wild-type strain (t test, P � 0.05).

Watanabe et al.

346 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

phase results in elevated resistance to digestion by Zymolyase (44).Here, we revealed that the Zymolyase sensitivity of K701 cells wasnearly identical on days 2 and 10, whereas X2180 cells displayedmarked resistance to Zymolyase treatment on day 10 (Fig. 6N).These results demonstrate that the synthesis of 1,3-�-glucan insake yeast with the rim155055insA mutation is severely reduced dur-ing sake fermentation, consistent with the impaired �-glucan syn-thesis found in the rim15� strain (Fig. 3).

We also examined the intracellular levels of trehalose and gly-cogen, which are representative storage carbohydrates synthesizedfrom UDPG, throughout the 20-day sake fermentation (Fig. 7A

and B). In laboratory strain X2180, the levels of both trehalose andglycogen sharply increased during the earlier stages of sake fer-mentation and peaked on days 10 and 15, respectively, whereas insake yeast strain K7, the levels of these storage carbohydrates didnot display such drastic changes. These results further supportedthe finding that UDPG synthesis is impaired in sake yeast. Fur-thermore, among the UDPG and carbohydrate anabolic path-ways, we identified a novel sake yeast-specific loss-of-functionmutation in the GLG2 gene (Fig. 7C), which encodes a glucosyl-transferase glycogenin that initiates glycogen synthesis (45, 46).On the basis of the whole-genome sequence of K7 (47), a singleG-to-A point mutation at nucleotide 1086 in the GLG2 genechanges a tryptophan codon (TGG) into a stop codon (TGA)(W362*) and truncates 19 amino acids at the carboxyl terminus ofGlg2p. We confirmed that the other sake strains related to K7(strains K6, K701, and K9 to K15) also possess this mutation.Although the functions of the carboxyl-terminal truncated aminoacids conserved between Glg2p and its homolog, Glg1p, remainunknown, the identical mutation consisting of a G-to-A change atposition 1086 in glg2 (glg2G1086A) was previously identified to be aloss-of-function mutation decreasing the in vitro ability of oligo-saccharide elongation by the glycogen synthase Gsy2p (46).

DISCUSSION

Sake yeast strains have long been considered to possess enhancedstress response machineries, particularly against increasing levelsof ethanol, thereby allowing these strains to achieve high ethanolyields (1). We recently discovered, however, that K7 and its relatedsake strains exhibit unexpectedly low stress tolerance (2). A spe-cific loss-of-function mutation in the RIM15 gene encoding aGreatwall-like protein kinase (8) and subsequent inactivation ofthe downstream stress-responsive transcription factors Msn2/4pand Hsf1p (5, 6) are predominantly responsible for this increasedstress sensitivity. In the present study, we revealed that the im-paired synthesis of UDPG and 1,3-�-glucan resulting from theloss of Rim15p function is associated with the enhanced fermen-tation rate of these strains (Fig. 8). This conclusion is based on thefindings that the loss of function of Rim15p leads to weak or noupregulation of PGM2 and UGP1 (Fig. 5B) and decreased accu-mulation of cell wall �-glucans (Fig. 3) during alcoholic fermen-tation and that the loss or downregulation of synthetic genes forUDPG or 1,3-�-glucan enhances the fermentation rate of labora-tory strains (Fig. 4). Defective UDPG synthesis leads to the de-creased accumulation of not only structural carbohydrates, suchas �-glucans, but also storage carbohydrates, particularly treha-lose and glycogen (27, 28), which are both essential for the main-tenance of cell viability under stress conditions. Blockage of thesecarbon anabolic pathways also likely redirects carbon flow intoglycolysis and other carbon metabolic pathways. This speculationis consistent with the finding that the mass of individual cells ofthe rim15� strain was lower than that of wild-type cells (Fig. 1E),indicating that the increased fermentation rate of rim15� cellscomes at the expense of biomass formation. Therefore, low-stress-tolerance and high-fermentation-rate phenotypes can coexist inRim15p-deficient strains.

It is important to note that sake yeast strains are not geneticallyidentical to the rim15� laboratory strain, because K7 and relatedsake yeast strains contain a number of mutations other than therim155055insA mutation, such as a loss-of-function mutation in thenutrient-responsive transcriptional factor Adr1p (7), which pos-

FIG 5 Effects of deletion of the RIM15 gene on the expression of UDPGsynthesis genes. (A) Distribution of the transcription factor binding siteswithin the 5= untranslated regions (1,000 bases immediately upstream fromthe start codon) of the PGM1, PGM2, and UGP1 mRNAs. White, gray, andblack dots, the potential binding sites for Msn2/4p (CCCCT), Hsf1p (NGAANNTTCN or NTTCNNGAAN), and Adr1p (TTGGRG), respectively. Eachpotential binding site was determined by searches of the YEASTRACT data-base. (B) Expression levels of PGM1, PGM2, and UGP1 mRNAs in the BY4743wild-type strain (gray) and its rim15� disruptant (black). mRNA was preparedfrom cells in the early stage of the fermentation test performed with 20%glucose-containing YPD medium at 30°C and analyzed by qRT-PCR. Therelative expression levels are given as fold differences compared to the induc-tion levels obtained for wild-type cells at 6 h, using ACT1 as a reference gene.Data represent the averages from three independent experiments. *, signifi-cantly lower than the level for the wild-type strain (t test, P � 0.05). (C)Expression levels of PGM1, PGM2, and UGP1 mRNAs in laboratory strainX2180 carrying the RIM15 wild type (RIM15WT; gray) and sake strain K701carrying rim155055insA (black). mRNA was prepared from the cells in the earlystage of the sake fermentation test and analyzed by DNA microarray analysis,as previously described (5). Raw microarray data were normalized per chip bydividing each measurement by the 50th percentile. Data represent the averagesfrom three independent experiments.

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 347Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

sibly targets the UGP1 gene (Fig. 5A) (47). It is striking, however,that K7 and its relatives share common features with the rim15�laboratory strains with respect to the impaired induction of PGM2and UGP1 (Fig. 5C), decreased accumulation of cell wall �-glu-cans (Fig. 6), and high fermentation rates (1–4). Furthermore, it isalso worth noting that the expression levels of the genes encodingenzymes that function downstream of UDPG synthesis, such asthose involved in trehalose synthesis (TPS1 and TPS2), glycogensynthesis (GLG1, GLG2, GSY2, and GLC3), and 1,3-�-glucan syn-thesis (FKS1 and FKS2), were lower in K701 than in X2180 on day3 and/or day 5 of sake fermentation (1, 5). As the 5= upstreamregions of these genes also contain multiple binding sites forMsn2/4p or Hsf1p (1), the formation of several anabolic productsappears to be cooperatively and redundantly mediated by Rim15p

via both the supply of the UDPG substrate and the upregulation ofsynthetic enzymes. Once the synthesis of structural and storagecarbohydrates has been severely inhibited in sake yeast due todefective Rim15p function, the generation of a novel loss-of-func-tion glg2G1086A mutation (Fig. 7C) might be nearly neutral withoutany apparent effects. Thus, our present findings provide impor-tant clues as to how the loss of function of Rim15p elicits changesat the transcriptional and metabolic levels to markedly enhancethe fermentation performance of sake yeast cells.

The present study also examined the specific roles of carbonmetabolic pathways in antagonizing glycolysis and alcoholic fer-mentation. Metabolomic analysis revealed that although impair-ment of the UDPG anabolic pathway led to enhanced fermenta-tion rates, inhibition of the pentose phosphate shunt, another

FIG 6 Impaired synthesis of cell wall �-glucans in sake yeast. (A to L) Ultrastructural images of strain X2180 (A, C, G, K) and K7 (B, D to F, H to J, L) cells isolatedfrom sake mash on days 2 and 10. Higher magnifications of the boxed regions in panels C, D, E, and F are shown in G, H, I, and J, respectively. N, nucleus; V,vacuole; PM, plasma membrane; IL, electron-translucent inner layer of the cell wall; OL, electron-dense outer layer of the cell wall; S/P, rice starch and proteins.Arrowheads in panel F, the sites of cell bursting due to severely defective cell wall structures. Bars, 1 �m (A to F), 200 nm (G to J), and 10 �m (K, L). (M)Distribution of cell wall inner layer thickness for strains X2180 (top), K7 (middle), and K9 (bottom), as quantified by TEM analyses. Cell wall thickness wasmeasured from the cross sections of cells that were cut approximately in the middle of the cell body. For each cell, the measurements at 3 or more positions wereaveraged, and more than 100 individual cells were tested for each sample. (N) Cell lysis test under Zymolyase treatment. Lysis of X2180 (left) and K701 (right)cells isolated from sake mash on days 2 (gray) and 10 (black) was monitored by measurement of the OD660 of cell suspensions containing 33 �g/ml Zymolyaseat 30°C. The initial value (OD660 1) corresponds to 100%. Data represent the averages from three independent experiments, and error bars indicate standarddeviations.

Watanabe et al.

348 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

representative carbon metabolic pathway, did not increase the fer-mentation rate (Fig. 4A and B) under the fermentation conditionsused in this study. This finding suggests that glucose flux into thepentose phosphate pathway during alcoholic fermentation may benegligibly low compared to the flux into UDPG synthesis. Thispossibility should be clarified in future studies by determining therates of glucose flux through both pathways. Even though deletionof RIM15 significantly decreased the levels of 6PG, Ru5P, and R5P

(Fig. 2), pentose phosphate shuttling may not be impaired inrim15� cells because it is also possible that the intracellular R5Ppool was simply reduced by enhanced consumption of R5Pthrough less effective G1 arrest/G0 entry and the subsequent G1/Stransition leading to DNA synthesis, both of which are hallmarksof K7 and its relatives (4, 8). Thus, the pentose phosphate pathwaymay not be closely associated with the Rim15p-mediated suppres-sion of alcoholic fermentation. Our present finding that thetkl1/2� tal1� strain displayed decreased fermentation rates (Fig.4B), together with the findings from previous reports that deletionof the TKL1 gene alone is sufficient to reduce glucose utilization(48, 49), suggests that Tkl1p plays a positive role in glycolysisand/or alcoholic fermentation.

Although impairment of UDPG synthesis led to acceleratedalcoholic fermentation, loss of the synthetic enzymes for trehaloseor glycogen, which are major anabolic products of UDPG, did notelevate the fermentation rate of laboratory strains (Fig. 4M to Q).In addition, the intracellular accumulation of trehalose was spec-ulated to inhibit the activities of different glycolytic enzymes byincreasing the cytoplasmic viscosity and stabilizing protein struc-tures, as previously reported (50–52); however, the present datado not support this speculation. In contrast, loss of either of theredundant catalytic subunits of 1,3-�-glucan synthase, Fks1p andFks2p, was sufficient to increase the fermentation rate (Fig. 4R andS). Thus, it is concluded that the synthesis of cell wall 1,3-�-glucanprincipally antagonizes glycolysis and alcoholic fermentation in S.cerevisiae under the fermentation conditions tested in this study.1,3-�-Glucan is the most abundant cell wall component in S.cerevisiae and has been defined to be a structural carbohydrate thatprotects cells from mechanical stresses (29, 53). However, thepresent findings suggest that 1,3-�-glucan also has novel physio-logical importance as a carbon reservoir. Therefore, the observedthickening of the �-glucan layers in the cell walls under stressfulconditions (Fig. 3 and 6) may contribute to the enhancement ofstress tolerance by increasing the rigidity of the cell surface andinhibiting the excess production of the cytotoxic compound eth-anol. Decreasing 1,3-�-glucan synthesis may be a good strategyfor the breeding of industrial yeast strains with high fermentationperformance, because strains with defective 1,3-�-glucan syn-thase activity can be isolated using nongenetic modification tech-niques by treating cells with antifungal drugs, such as echinocan-dins, as has been shown in several studies (38, 54, 55).

Taken together, the present findings provide insight into yeastGreatwall-mediated stress responses as major impediments of gly-colysis and alcoholic fermentation and shed light on the novelfunction of Greatwall protein kinases in carbon metabolic control.In mammals, Greatwall has recently been recognized to be a keyregulator of the mitotic cell cycle (56, 57). In yeast, however, it is

FIG 7 Impaired synthesis of storage carbohydrates in sake yeast. (A, B) Intra-cellular trehalose (A) and glycogen (B) levels in K7 (black) and X2180 (gray)cells isolated from sake mash on the indicated days. Data represent the averagesfrom three independent experiments, and error bars indicate standard devia-tions. (C) Comparison of S. cerevisiae laboratory strain S288C Glg1p(ScGlg1p) and Glg2p (ScGlg2p) and the putative GLG1 and GLG2 gene prod-ucts of sake yeast strain K7 (K7Glg1p and K7Glg2p, respectively). Rectangleswith light and dark shading, the amino- and carboxyl-terminal conservedregions between Glg1p and Glg2p, respectively; open circles, positions of singleamino acid substitutions. Amino acid sequences surrounding the loss-of-function mutation in K7Glg2p (W362*, corresponding to a guanine-to-ade-nine substitution at nucleotide 1086 of the ScGLG2 gene) are also shown. aa,amino acids.

FIG 8 Hypothetical model of how Rim15p affects UDPG synthesis and alcoholic fermentation. Dotted line, the Hsf1p-dependent induction of PGM2 has beenreported (40), despite the lack of typical Hsf1p sites in the 5= upstream region of this gene.

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 349Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

well established that Rim15p, together with the downstream -en-dosulfines Igo1p and Igo2p (Igo1/2p) and protein phosphatasePP2ACdc55p, is essential to promote G0 program initiation in re-sponse to nutrient deprivation (10, 11, 58, 59). Furthermore,Rim15p is also implicated in diverse biological processes, such asmeiosis, autophagy, and life span extension (60–62). Comparativemetabolic studies of yeast Rim15p and its orthologs may revealubiquitous and essential roles of Greatwall-family protein kinasesin the control of metabolic pathways that govern pleiotropic eu-karyotic cellular processes.

ACKNOWLEDGMENTS

The metabolome analysis was performed by Human Metabolome Tech-nologies, Inc. We also thank Yoshiyuki Fujitani, Chiemi Noguchi, andMasayuki Takahashi (National Research Institute of Brewing) for provid-ing technical assistance.

FUNDING INFORMATIONNoda Institute for Scientific Research (NISR) provided funding toDaisuke Watanabe. Japan Society for the Promotion of Science (JSPS)provided funding to Daisuke Watanabe under grant number 25850065.Kato Memorial Bioscience Foundation provided funding to Daisuke Wa-tanabe.

REFERENCES1. Watanabe D, Takagi H, Shimoi H. 2015. Mechanisms of high alcoholic

fermentation ability of sake yeast, p 57–74. In Takagi H, Kitagaki H (ed),Stress biology of yeasts and fungi: application for industrial brewing andfermentation. Springer, New York, NY.

2. Urbanczyk H, Noguchi C, Wu H, Watanabe D, Akao T, Takagi H,Shimoi H. 2011. Sake yeast strains have difficulty in entering a quiescentstate after cell growth cessation. J Biosci Bioeng 112:44 – 48. http://dx.doi.org/10.1016/j.jbiosc.2011.03.001.

3. Watanabe D, Ota T, Nitta F, Akao T, Shimoi H. 2011. Automaticmeasurement of sake fermentation kinetics using a multi-channel gasmonitor system. J Biosci Bioeng 112:54 –57. http://dx.doi.org/10.1016/j.jbiosc.2011.03.007.

4. Watanabe D, Nogami S, Ohya Y, Kanno Y, Zhou Y, Akao T, Shimoi H.2011. Ethanol fermentation driven by elevated expression of the G1 cyclingene CLN3 in sake yeast. J Biosci Bioeng 112:577–582. http://dx.doi.org/10.1016/j.jbiosc.2011.08.010.

5. Watanabe D, Wu H, Noguchi C, Zhou Y, Akao T, Shimoi H. 2011.Enhancement of the initial rate of ethanol fermentation due to dys-function of yeast stress response components Msn2p and/or Msn4p.Appl Environ Microbiol 77:934 –941. http://dx.doi.org/10.1128/AEM.01869-10.

6. Noguchi C, Watanabe D, Zhou Y, Akao T, Shimoi H. 2012. Associationof constitutive hyperphosphorylation of Hsf1p with a defective ethanolstress response in Saccharomyces cerevisiae sake yeast strains. Appl EnvironMicrobiol 78:385–392. http://dx.doi.org/10.1128/AEM.06341-11.

7. Watanabe D, Hashimoto N, Mizuno M, Zhou Y, Akao T, Shimoi H.2013. Accelerated alcoholic fermentation caused by defective gene ex-pression related to glucose derepression in Saccharomyces cerevisiae.Biosci Biotechnol Biochem 77:2255–2262. http://dx.doi.org/10.1271/bbb.130519.

8. Watanabe D, Araki Y, Zhou Y, Maeya N, Akao T, Shimoi H. 2012. Aloss-of-function mutation in the PAS kinase Rim15p is related to defectivequiescence entry and high fermentation rates of Saccharomyces cerevisiaesake yeast strains. Appl Environ Microbiol 78:4008 – 4016. http://dx.doi.org/10.1128/AEM.00165-12.

9. Juanes MA, Khoueiry R, Kupka T, Castro A, Mudrak I, Ogris E,Lorca T, Piatti S. 2013. Budding yeast Greatwall and endosulfinescontrol activity and spatial regulation of PP2ACdc55 for timely mitoticprogression. PLoS Genet 9:e1003575. http://dx.doi.org/10.1371/journal.pgen.1003575.

10. Pedruzzi I, Dubouloz F, Cameroni E, Wanke V, Roosen J, WinderickxJ, De Virgilio C. 2003. TOR and PKA signaling pathways converge on theprotein kinase Rim15 to control entry into G0. Mol Cell 12:1607–1613.http://dx.doi.org/10.1016/S1097-2765(03)00485-4.

11. Cameroni E, Hulo N, Roosen J, Winderickx J, De Virgilio C. 2004. Thenovel yeast PAS kinase Rim15 orchestrates G0-associated antioxidant de-fense mechanisms. Cell Cycle 3:462– 468.

12. Lee P, Kim MS, Paik SM, Choi SH, Cho BR, Hahn JS. 2013. Rim15-dependent activation of Hsf1 and Msn2/4 transcription factors by directphosphorylation in Saccharomyces cerevisiae. FEBS Lett 587:3648 –3655.http://dx.doi.org/10.1016/j.febslet.2013.10.004.

13. Inai T, Watanabe D, Zhou Y, Fukada R, Akao T, Shima J, Takagi H,Shimoi H. 2013. Rim15p-mediated regulation of sucrose utilization dur-ing molasses fermentation using Saccharomyces cerevisiae strain PE-2. JBiosci Bioeng 116:591–594. http://dx.doi.org/10.1016/j.jbiosc.2013.05.015.

14. Pedler SM, Wallace PG, Wallace JC, Berry MN. 1997. The fate of glucosein strains S288C and S173-6B of the yeast Saccharomyces cerevisiae. Yeast13:119 –125. http://dx.doi.org/10.1002/(SICI)1097-0061(199702)13:2�119::AID-YEA67�3.0.CO;2-3.

15. Gombert AK, Moreira dos Santos M, Christensen B, Nielsen J. 2001.Network identification and flux quantification in the central metabolismof Saccharomyces cerevisiae under different conditions of glucose repres-sion. J Bacteriol 183:1441–1551. http://dx.doi.org/10.1128/JB.183.4.1441-1451.2001.

16. Raghevendran V, Gombert AK, Christensen B, Kötter P, Nielsen J.2004. Phenotypic characterization of glucose repression mutants of Sac-charomyces cerevisiae using experiments with 13C-labelled glucose. Yeast21:769 –779. http://dx.doi.org/10.1002/yea.1136.

17. Wiebe MG, Rintala E, Tamminen A, Simolin H, Salusjärvi L, Toivari M,Kokkonen JT, Kiuru J, Ketola RA, Jouhten P, Huuskonen A, MaaheimoH, Ruohonen L, Penttilä M. 2008. Central carbon metabolism of Saccha-romyces cerevisiae in anaerobic, oxygen-limited and fully aerobic steady-state conditions and following a shift to anaerobic conditions. FEMS YeastRes 8:140 –154. http://dx.doi.org/10.1111/j.1567-1364.2007.00234.x.

18. Heyland J, Fu J, Blank LM. 2009. Correlation between TCA cycle flux andglucose uptake rate during respiro-fermentative growth of Saccharomycescerevisiae. Microbiology 155:3827–3837. http://dx.doi.org/10.1099/mic.0.030213-0.

19. Gasch AP, Spellman PT, Kao CM, Carmel-Harel O, Eisen MB, Storz G,Botstein D, Brown PO. 2000. Genomic expression programs in the re-sponse of yeast cells to environmental changes. Mol Biol Cell 11:4241–4257. http://dx.doi.org/10.1091/mbc.11.12.4241.

20. Hahn JS, Hu Z, Thiele DJ, Iyer VR. 2004. Genome-wide analysis of thebiology of stress responses through heat shock transcription factor. MolCell Biol 24:5249 –5256. http://dx.doi.org/10.1128/MCB.24.12.5249-5256.2004.

21. Ouchi K, Akiyama H. 1971. Non-foaming mutants of sake yeasts; selec-tion by cell agglutination method and by froth flotation method. AgricBiol Chem 35:1024 –1032. http://dx.doi.org/10.1271/bbb1961.35.1024.

22. Goldstein AL, McCusker JH. 1999. Three new dominant drug resistancecassettes for gene disruption in Saccharomyces cerevisiae. Yeast 13:1541–1553.

23. Hansen J, Felding T, Johannesen PF, Piskur J, Christensen CL, OlesenK. 2003. Further development of the cassette-based pYC plasmid systemby incorporation of the dominant hph, nat and AUR1-C gene markers andthe lacZ reporter system. FEMS Yeast Res 4:323–327. http://dx.doi.org/10.1016/S1567-1356(03)00178-8.

24. Parrou JL, François J. 1997. A simplified procedure for a rapid andreliable assay of both glycogen and trehalose in whole yeast cells. AnalBiochem 248:186 –188. http://dx.doi.org/10.1006/abio.1997.2138.

25. Kitagaki H, Wu H, Shimoi H, Ito K. 2002. Two homologous genes,DCW1 (YKL046c) and DFG5, are essential for cell growth and encodeglycosylphosphatidylinositol (GPI)-anchored membrane proteins re-quired for cell wall biogenesis in Saccharomyces cerevisiae. Mol Microbiol46:1011–1022. http://dx.doi.org/10.1046/j.1365-2958.2002.03244.x.

26. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2���CT method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

27. Daran JM, Dallies N, Thines-Sempoux D, Paquet V, François J.1995. Genetic and biochemical characterization of the UGP1 gene en-coding the UDP-glucose pyrophosphorylase from Saccharomyces cerevi-siae. Eur J Biochem 233:520 –530. http://dx.doi.org/10.1111/j.1432-1033.1995.520_2.x.

28. Daran JM, Bell W, François J. 1997. Physiological and morphologicaleffects of genetic alterations leading to a reduced synthesis of UDP-glucose

Watanabe et al.

350 aem.asm.org January 2016 Volume 82 Number 1Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

in Saccharomyces cerevisiae. FEMS Microbiol Lett 153:89 –96. http://dx.doi.org/10.1111/j.1574-6968.1997.tb10468.x.

29. Klis FM, Mol P, Hellingwerf K, Brul S. 2002. Dynamics of cell wallstructure in Saccharomyces cerevisiae. FEMS Microbiol Rev 26:239 –256.http://dx.doi.org/10.1111/j.1574-6976.2002.tb00613.x.

30. Nogae I, Johnston M. 1990. Isolation and characterization of theZWF1 gene of Saccharomyces cerevisiae, encoding glucose-6-phosphatedehydrogenase. Gene 96:161–169. http://dx.doi.org/10.1016/0378-1119(90)90248-P.

31. Schaaff-Gerstenschläger I, Zimmermann FK. 1993. Pentose-phosphatepathway in Saccharomyces cerevisiae: analysis of deletion mutants fortransketolase, transaldolase, and glucose 6-phosphate dehydrogenase.Curr Genet 24:373–376. http://dx.doi.org/10.1007/BF00351843.

32. Schaaff-Gerstenschläger I, Mannhaupt G, Vetter I, Zimmermann FK,Feldmann H. 1993. TKL2, a second transketolase gene of Saccharomycescerevisiae. Cloning, sequence and deletion analysis of the gene. Eur JBiochem 217:487– 492.

33. Boles E, Liebetrau W, Hofmann M, Zimmermann FK. 1994. A family ofhexosephosphate mutases in Saccharomyces cerevisiae. Eur J Biochem 220:83–96. http://dx.doi.org/10.1111/j.1432-1033.1994.tb18601.x.

34. Gari E, Piedrafita L, Aldea M, Herrero E. 1997. A set of vectors with atetracycline-regulatable promoter system for modulated gene expressionin Saccharomyces cerevisiae. Yeast 13:837– 848. http://dx.doi.org/10.1002/(SICI)1097-0061(199707)13:9�837::AID-YEA145�3.0.CO;2-T.

35. Hughes TR, Marton MJ, Jones AR, Roberts CJ, Stoughton R, ArmourCD, Bennett HA, Coffey E, Dai H, He YD, Kidd MJ, King AM, MeyerMR, Slade D, Lum PY, Stepaniants SB, Shoemaker DD, Gachotte D,Chakraburtty K, Simon J, Bard M, Friend SH. 2000. Functional discov-ery via a compendium of expression profiles. Cell 102:109 –126. http://dx.doi.org/10.1016/S0092-8674(00)00015-5.

36. François J, Parrou JL. 2001. Reserve carbohydrates metabolism in theyeast Saccharomyces cerevisiae. FEMS Microbiol Rev 25:125–145. http://dx.doi.org/10.1111/j.1574-6976.2001.tb00574.x.

37. Bell W, Klaassen P, Ohnacker M, Boller T, Herweijer M, Schoppink P,Van der Zee P, Wiemken A. 1992. Characterization of the 56-kDa sub-unit of yeast trehalose-6-phosphate synthase and cloning of its gene revealits identity with the product of CIF1, a regulator of carbon cataboliteinactivation. Eur J Biochem 209:951–959. http://dx.doi.org/10.1111/j.1432-1033.1992.tb17368.x.

38. Hohmann S, Bell W, Neves MJ, Valckx D, Thevelein JM. 1996. Evidencefor trehalose-6-phosphate-dependent and -independent mechanisms inthe control of sugar influx into yeast glycolysis. Mol Microbiol 20:981–991. http://dx.doi.org/10.1111/j.1365-2958.1996.tb02539.x.

39. Douglas CM, Foor F, Marrinan JA, Morin N, Nielsen JB, Dahl AM,Mazur P, Baginsky W, Li W, el-Sherbeini M, Clemas JA, Mandala SM,Frommer BR, Kurtz MB. 1994. The Saccharomyces cerevisiae FKS1(ETG1) gene encodes an integral membrane protein which is a subunit of1,3-�-D-glucan synthase. Proc Natl Acad Sci U S A 91:12907–12911. http://dx.doi.org/10.1073/pnas.91.26.12907.

40. Inoue SB, Takewaki N, Takasuka T, Mio T, Adachi M, Fujii Y, Miy-amoto C, Arisawa M, Furuichi Y, Watanabe T. 1995. Characterizationand gene cloning of 1,3-�-D-glucan synthase from Saccharomyces cerevi-siae. Eur J Biochem 231:845– 854. http://dx.doi.org/10.1111/j.1432-1033.1995.tb20770.x.

41. Yamamoto A, Mizukami Y, Sakurai H. 2005. Identification of a novelclass of target genes and a novel type of binding sequence of heat shocktranscription factor in Saccharomyces cerevisiae. J Biol Chem 280:11911–11919. http://dx.doi.org/10.1074/jbc.M411256200.

42. Capaldi AP, Kaplan T, Liu Y, Habib N, Regev A, Friedman N, O’SheaEK. 2008. Structure and function of a transcriptional network activated bythe MAPK Hog1. Nat Genet 40:1300 –1306. http://dx.doi.org/10.1038/ng.235.

43. Casado C, González A, Platara M, Ruiz A, Ariño J. 2011. The role of theprotein kinase A pathway in the response to alkaline pH stress in yeast.Biochem J 438:523–533. http://dx.doi.org/10.1042/BJ20110607.

44. Gray JV, Petsko GA, Johnston GC, Ringe D, Singer RA, Werner-Washburne M. 2004. “Sleeping beauty”: quiescence in Saccharomycescerevisiae. Microbiol Mol Biol Rev 68:187–206. http://dx.doi.org/10.1128/MMBR.68.2.187-206.2004.

45. Cheng C, Mu J, Farkas I, Huang D, Goebl MG, Roach PJ. 1995.Requirement of the self-glucosylating initiator proteins Glg1p and Glg2pfor glycogen accumulation in Saccharomyces cerevisiae. Mol Cell Biol 15:6632– 6640. http://dx.doi.org/10.1128/MCB.15.12.6632.

46. Mu J, Cheng C, Roach PJ. 1996. Initiation of glycogen synthesis in yeast.Requirement of multiple tyrosine residues for function of the self-glucosylating Glg proteins in vivo. J Biol Chem 271:26554 –26560.

47. Akao T, Yashiro I, Hosoyama A, Kitagaki H, Horikawa H, Watanabe D,Akada R, Ando Y, Harashima S, Inoue T, Inoue Y, Kajiwara S, Kita-moto K, Kitamoto N, Kobayashi O, Kuhara S, Masubuchi T, MizoguchiH, Nakao Y, Nakazato A, Namise M, Oba T, Ogata T, Ohta A, Sato M,Shibasaki S, Takatsume Y, Tanimoto S, Tsuboi H, Nishimura A, YodaK, Ishikawa T, Iwashita K, Fujita N, Shimoi H. 2011. Whole-genomesequencing of sake yeast Saccharomyces cerevisiae Kyokai no. 7. DNA Res18:423– 434. http://dx.doi.org/10.1093/dnares/dsr029.

48. Sundström M, Lindqvist Y, Schneider G, Hellman U, Ronne H. 1993.Yeast TKL1 gene encodes a transketolase that is required for efficient gly-colysis and biosynthesis of aromatic amino acids. J Biol Chem 268:24346 –24352.

49. Matsushika A, Goshima T, Fujii T, Inoue H, Sawayama S, Yano S. 2012.Characterization of non-oxidative transaldolase and transketolase en-zymes in the pentose phosphate pathway with regard to xylose utilizationby recombinant Saccharomyces cerevisiae. Enzyme Microb Technol 51:16 –25. http://dx.doi.org/10.1016/j.enzmictec.2012.03.008.

50. Singer MA, Lindquist S. 1998. Thermotolerance in Saccharomyces cerevi-siae: the Yin and Yang of trehalose. Trends Biotechnol 16:460 – 468. http://dx.doi.org/10.1016/S0167-7799(98)01251-7.

51. Sampedro JG, Uribe S. 2004. Trehalose-enzyme interactions result instructure stabilization and activity inhibition. The role of viscosity. MolCell Biochem 256-257:319 –327.

52. Araiza-Olivera D, Sampedro JG, Mújica A, Peña A, Uribe-Carvajal S.2010. The association of glycolytic enzymes from yeast confers resistanceagainst inhibition by trehalose. FEMS Yeast Res 10:282–289. http://dx.doi.org/10.1111/j.1567-1364.2010.00605.x.

53. Lesage G, Bussey H. 2006. Cell wall assembly in Saccharomyces cerevisiae.Microbiol Mol Biol Rev 70:317–343. http://dx.doi.org/10.1128/MMBR.00038-05.

54. Lesage G, Sdicu AM, Ménard P, Shapiro J, Hussein S, Bussey H. 2004.Analysis of �-1,3-glucan assembly in Saccharomyces cerevisiae using a syn-thetic interaction network and altered sensitivity to caspofungin. Genetics167:35– 49. http://dx.doi.org/10.1534/genetics.167.1.35.

55. Markovich S, Yekutiel A, Shalit I, Shadkchan Y, Osherov N. 2004.Genomic approach to identification of mutations affecting caspofunginsusceptibility in Saccharomyces cerevisiae. Antimicrob Agents Chemother48:3871–3876. http://dx.doi.org/10.1128/AAC.48.10.3871-3876.2004.

56. Glover DM. 2012. The overlooked Greatwall: a new perspective on mi-totic control. Open Biol 2:120023. http://dx.doi.org/10.1098/rsob.120023.

57. Lorca T, Castro A. 2013. The Greatwall kinase: a new pathway in thecontrol of the cell cycle. Oncogene 32:537–543. http://dx.doi.org/10.1038/onc.2012.79.

58. Talarek N, Cameroni E, Jaquenoud M, Luo X, Bontron S, Lippman S,Devgan G, Snyder M, Broach JR, De Virgilio C. 2010. Initiation of theTORC1-regulated G0 program requires Igo1/2, which license specific mR-NAs to evade degradation via the 5=-3= mRNA decay pathway. Mol Cell38:345–355. http://dx.doi.org/10.1016/j.molcel.2010.02.039.

59. Bontron S, Jaquenoud M, Vaga S, Talarek N, Bodenmiller B, AebersoldR, De Virgilio C. 2013. Yeast endosulfines control entry into quiescenceand chronological life span by inhibiting protein phosphatase 2A. Cell Rep3:16 –22. http://dx.doi.org/10.1016/j.celrep.2012.11.025.

60. Vidan S, Mitchell AP. 1997. Stimulation of yeast meiotic gene expressionby the glucose-repressible protein kinase Rim15p. Mol Cell Biol 17:2688 –2694. http://dx.doi.org/10.1128/MCB.17.5.2688.

61. Fabrizio P, Pozza F, Pletcher SD, Gendron CM, Longo VD. 2001.Regulation of longevity and stress resistance by Sch9 in yeast. Science292:288 –290. http://dx.doi.org/10.1126/science.1059497.

62. Yorimitsu T, Zaman S, Broach JR, Klionsky DJ. 2007. Protein kinase Aand Sch9 cooperatively regulate induction of autophagy in Saccharomycescerevisiae. Mol Biol Cell 18:4180 – 4189. http://dx.doi.org/10.1091/mbc.E07-05-0485.

Carbon Metabolism Governed by Yeast Greatwall

January 2016 Volume 82 Number 1 aem.asm.org 351Applied and Environmental Microbiology

on Septem

ber 15, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from