INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF...
155
1 INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE By MEGAN ELIZABETH MEYER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2010
Transcript of INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF...
1
INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE
By
MEGAN ELIZABETH MEYER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2010
2
© 2010 Megan E. Meyer
3
To the Meyer family
4
ACKNOWLEDGMENTS
This project was funded in part by the T-32 NIH training grant in Cancer Biology
(CA09126) by providing support for my studies while pursuing this degree.
I would like to thank my advisor, Dr. Nigel Richards, for allowing me to work on this
project and providing me with the opportunities and guidance to succeed. I would like
acknowledge my committee: Dr. Nicole Horenstein, Dr. Aaron Aponick, Dr. Gail
Fanucci, and Dr. Mike Kilberg for their support. A special thanks to Dr. James and Ale
Maruniak, without their help this project would not have succeeded. I would also like to
thank Drs. Inari Kursula and Rosie Bradshaw for their guidance and hospitality while I
was visiting their labs overseas.
A special thanks to the members of the Richards group, past and present, for
providing a fun environment to work in for the past 5 years. I would especially like to
thank Dr. Cory Toyota for his friendship, useful scientific discussions, and endless
patience.
I would like to thank all of the friends I have met here in Gainesville, especially
Dan, Travis, Jen, and Lindsay for providing a sense of belonging when I was far away
from home. I also thank Dustin for his unconditional love, support, and understanding
while I was finishing this degree. I am forever grateful to my parents and family for their
unconditional love and support throughout my life and always believing in my ability to
succeed.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ...................................................................................................... 4
LIST OF TABLES ................................................................................................................ 8
LIST OF FIGURES .............................................................................................................. 9
LIST OF ABBREVIATIONS .............................................................................................. 13
ABSTRACT........................................................................................................................ 15
CHAPTER
1 INTRODUCTION ........................................................................................................ 17
Acute Lymphoblastic Leukemia ................................................................................. 17 Asparagine Synthetase .............................................................................................. 18
Enzyme Mechanism ............................................................................................. 21 Enzyme Structure................................................................................................. 25 Inhibitor Studies of ASNS .................................................................................... 31
Research Objectives................................................................................................... 33
2 A CRITICAL ELETROSTATIC INTERACTION MEDIATES INHIBITOR RECOGNITION BY HUMAN ASPARAGINE SYNTHETASE ................................... 36
Introduction ................................................................................................................. 36 Results and Discussion .............................................................................................. 39 Experimental Section .................................................................................................. 50
Materials ............................................................................................................... 50 Expression and Purification of Recombinant Human Asparagine Synthetase .. 51 Enzyme Assays .................................................................................................... 51 Cloning, Expression, Purification, and Characterization of K449 Mutants......... 54
3 FUNCTIONAL ROLE OF A CONSERVED ACTIVE SITE GLUTAMATE IN GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE FROM Escherichia coli ............................................................................................................................... 57
Introduction ................................................................................................................. 57 Results ........................................................................................................................ 62
Cloning of asnB to Contain a C-terminal Poly-histidine Tag .............................. 62 Expression and Purification His6-tagged AS-B and E348 Mutants .................... 64 Characterization of His6-tagged AS-B ................................................................. 64 Glutaminase Activity of AS-B and E348 Mutants................................................ 67 Asparagine,Pyrophosphate, and Glutamate Production ..................................... 69 Kinetic Parameters for E348D mutant ................................................................. 71
6
18O transfer experiments...................................................................................... 72 Positional Isotope Exchange ............................................................................... 74
Discussion ................................................................................................................... 81 Characterization of His6-AS-B ............................................................................. 81 Steady-State Kinetic Assays with E348 mutants ................................................ 82 18O Isotopic Labeling Studies .............................................................................. 86
Conclusions ................................................................................................................ 90 Experimental Section .................................................................................................. 90
Materials ............................................................................................................... 90 Cloning of His6-tagged AS-B and E348 Mutants ................................................ 91 Expression and Purification of His6-tagged AS-B and E348 Mutants ................ 91 Glutaminase Activity ............................................................................................ 92 Pyrophosphate Production .................................................................................. 93 Asparagine and Glutamate Production ............................................................... 93 Synthesis of 18O Aspartic Acid............................................................................. 94 18O transfer studies .............................................................................................. 94 PIX Experiments .................................................................................................. 96
4 CRYSTALLIZATION TRIALS OF GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE ............................................................................................................ 97
Introduction ................................................................................................................. 97 Results and Discussion ............................................................................................ 105
Expression and Purification of hASNS for Crystallography Trials .................... 105 Inhibition of hASNS with DON ........................................................................... 106 Inhibition of hASNS with AMP-CPP .................................................................. 106 Characterization of His6-tagged AS-B Truncation Mutants .............................. 111 Small-angle X-ray Scattering of His6-AS-B and Δ40 mutant ............................ 115 Crystallization Trials of His6-tagged AS-B Truncation Mutants ........................ 118
Conclusions .............................................................................................................. 118 Materials and Methods ............................................................................................. 120
Materials ............................................................................................................. 120 Obtaining a High Titer Viral Inoculum ............................................................... 120 Expression and Purification of hASNS for Crystallization ................................ 121 Inhibition of hASNS with DON ........................................................................... 121 Inhibition of hASNS with AMP-CPP .................................................................. 122 Preparation of hASNS for Crystallization Trials ................................................ 122 Crystallization Trials of hASNS.......................................................................... 122 Cloning, Expression and Purification of His6-tagged AS-B Truncation
Mutants ........................................................................................................... 123 Characterization of His6-tagged AS-B Truncation Mutants .............................. 125 Crystallization Trials and SAXS measurements of His6-tagged AS-B and
Truncation Mutants ......................................................................................... 126
5 CONCLUSIONS AND FUTURE WORK .................................................................. 127
Conclusions .............................................................................................................. 127
7
Inhibition of hASNS ............................................................................................ 127 Functional Role of a Conserved Glutamate Residue ....................................... 127 Crystallization of hASNS and AS-B ................................................................... 128
Future Work .............................................................................................................. 128 Design of Future Inhibitors................................................................................. 128 Crystallization of hASNS .................................................................................... 129 Expression of hASNS in E. coli ......................................................................... 129 Thrombin Cleavage of His6-tagged AS-B.......................................................... 130 ASNS from Mycobacterium tuberculosis........................................................... 131
APPENDIX
A PROTEIN AND DNA SEQUENCES OF ASPARAGINE SYNTHETASE ............... 132
B PRIMERS USED FOR MUTAGENSIS AND CLONING ......................................... 134
C 31P NMR SPECTRA OF PIX EXPERIMENTS UTILIZING β,γ 18O6-ATP ............... 135
LIST OF REFERENCES ................................................................................................. 141
BIOGRAPHICAL SKETCH.............................................................................................. 155
8
LIST OF TABLES
Table page 2-1 Glutaminase activity of Wild-type AS-B and K449 mutants .................................. 48
3-1 Steady-state kinetic parameters for His6-tagged AS-B determined at pH 8.0 ..... 67
3-2 Kinetic constants for the glutaminase activity of His6-tagged AS-B and E348 mutants at pH 8.0 with or without added ATP. ...................................................... 68
3-3 Product ratios for the ammonia and glutamine-dependent synthetase activities of His6-tagged AS-B and E348 mutants at pH 8.0 measured under saturating substrate conditions. ............................................................................. 69
3-4 Kinetic constants for the ammonia and glutamine-dependent synthetase activity of His6-tagged AS-B and E348D determined at pH 8.0............................ 72
3-5 Relative abundance of 18O4-Aspartic Acid based upon [M-H]-ions. ..................... 95
4-1 Glutaminase activity of His6-tagged AS-B and truncation mutants at pH 8.0. ... 114
4-2 Ammonia and glutamine-dependent production of PPi, Asn, and Glu in wild type His6-tagged AS-B and truncation mutants determined under saturating conditions at pH 8.0 ............................................................................................. 114
4-3 List of experimental conditions screened for crystallization of hASNS .............. 124
B-1 Sequence of primers for cloning and site-directed mutagenesis studies ........... 134
9
LIST OF FIGURES
Figure page 1-1 Reaction catalyzed by glutamine-dependent asparagine synthetase. ................. 20
1-2 Proposed mechanism of glutamine-dependent asparagine synthetase. ............. 22
1-3 Proposed kinetic model for glutamine- dependent asparagine synthetase. ........ 24
1-4 Crystal structure of E. coli AS-B (1CT9) complexed to AMP and glutamine.. ..... 26
1-5 Residues defining the PPi loop motif in computational model of AS-B/PPi/βAspAMP. .............................................................................................. 27
1-6 Intramolecular tunnel of AS-B connects the glutaminase domain active site to the synthetase domain active site. ........................................................................ 29
1-7 AS-B and βLS catalyze similar reactions and are structurally homologous......... 30
1-8 Chemical structures of previously characterized inhibitors of hASNS.. ............... 32
1-9 Effect of the N-adenylated sulfoximine on MOLT-4 proliferation in the absence and presence of 1U ASNase. ................................................................. 34
2-1 Chemical structures of adenylated sulfoximine derivative 1 and adenylated sulfamide 2, which are nanomolar inhibitors of hASNS. Chemical structures of adenylated sulfoximine derivatives 3 and 4, the novel compounds to be characterized. ......................................................................................................... 38
2-2 Ammonia-dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3 ......................................................... 40
2-3 Glutamine-dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3. ........................................................ 41
2-4 Ammonia-dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4. ................................................................. 43
2-5 Glutamine-dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4 .................................................................. 44
2-6 Ratio of asparagine to pyrophosphate production (µM) in the presence and absence of 1 mM of the functionalized sulfoximine 3 and 4.. ............................... 45
2-7 Conjugate base of the functionalized acylsulfamate 2 and functionalized acylsulfamide 3 ...................................................................................................... 47
10
2-8 Chemical structures of N-benzoylsulfamate 5, sulfanilamide, and methanesulfonamide compounds that were used to estimate pKa values of 2 and 3. ...................................................................................................................... 47
2-9 The interaction between the Lys-449 side chain and the phosphate group of the βAspAMP intermediate .................................................................................... 49
2-10 Kinetic model for slow-onset inhibition .................................................................. 53
3-1 Computational model of the N-adenylated sulfoximine inhibitor docked into the synthetase site of AS-B.................................................................................... 58
3-2 Proposed reaction mechanism for the synthetase reaction of ASNS. ................. 60
3-3 Reactions catalyzed by AS-B, βLS, and CPS and structural overlay of the conserved catalytic dyad in βLS, CPS with the substituted residues in AS-B ..... 61
3-4 Construction of pET-21 c (+) vector to contain a poly-histidine tag. .................... 63
3-5 Purification of His6-tagged AS-B using IMAC ........................................................ 65
3-6 Silver stained SDS-PAGE gel of untagged and His6-tagged AS-B and E348 mutants. .................................................................................................................. 66
3-7 Production of PPi in the presence and absence of aspartate for the ammonia-dependent and glutamine-dependent reactions of AS-B and E348 mutants. .... 70
3-8 18O transfer reaction using 18O-labeled aspartic acid. .......................................... 73
3-9 31P NMR spectrum of the reaction mixture obtained with His6-tagged AS-B and 18O-labeled aspartate acid. ............................................................................. 73
3-10 31PNMR spectrum of the reaction mixture obtained from 18O-labeled aspartate and E348D mutant. ................................................................................ 75
3-11 31P NMR spectrum of reaction mixture obtained from E348A mutant.................. 76
3-12 Comparison of the relative amounts of each 31P containing compound detected in wild type, E348D, and E348A reactions. ............................................ 77
3-13 Two possible PIX reactions catalyzed by AS-B. ................................................... 79
3-14 31P NMR spectra of the α-P of ATP and γ- P of ATP indicate that no PIX is observed for wild type, E348A, or E348D after 3.5 hours .................................... 80
3-15 E348 is the only charged residue at the base of the intramolecular tunnel. . ..... 83
3-16 Proposed kinetic model for glutamine dependent asparagine synthetase. ......... 85
11
3-17 Structural overlay of the P loop of AS-B, argininosuccinate synthetase and βLS.......................................................................................................................... 89
3-18 Representative HPLC chromatogram for the separation and quanitification of asparagine and glutamate. .................................................................................... 95
4-1 Crystallization by vapor diffusion ........................................................................... 99
4-2 DON reacts with the Cys-1 residue of ASNS to form a covalent adduct. .......... 101
4-3 Fraction of original glutaminase activity remaining after treatment of hASNS with 5.88 mM DON. .............................................................................................. 103
4-4 The solved crystal structure of AS-B is missing the final 37 residues of the protein. .................................................................................................................. 104
4-5 Fraction of glutaminase, ammonia-dependent synthetase, and glutamine-dependent synthetase activity remaining after treatment of hASNS with 15 mM DON. .............................................................................................................. 107
4-6 Chemical structure of AMP-CPP and production of PPi (µM) in the presence of 0.1 mM and 1 mM of AMP-CPP. ..................................................................... 109
4-7 Number of clear drops in comparison to the number of drops containing precipitated protein as a function of pH or precipitating reagent for the pHclear suite......................................................................................................... 110
4-8 Formation of microcrystals in a protein drop containing hASNS, 15 mM DON, 0.2 M sodium/potassium phosphate, 20 % (w/v) PEG 3350. ............................. 112
4-9 SDS-PAGE analysis of His6-tagged AS-B truncation mutants stained with Commassie Brillant blue.. .................................................................................... 113
4-10 Distance distribution for wild type His6-tagged AS-B and Δ40 mutant. .............. 116
4-11 Wild type His6-AS-B and Δ40 SAXS structure superimposed on AS-B crystal structure dimer. .................................................................................................... 117
4-12 Glutaminase activity of His6-tagged AS-B in the presence and absence of 15 mM DON. ......................................................................................................... 119
A-1 DNA sequence of asnB ........................................................................................ 132
A-2 Protein sequence of AS-B.................................................................................... 132
A-3 DNA sequence of hASNS. ................................................................................... 133
A-4 Protein sequence of hASNS ................................................................................ 133
12
C-1 Full 31P NMR spectra of β,γ 18O6-ATP prior to the addition of enzyme. ........... 136
C-2 Full 31P NMR spectra of the PIX reaction of His6-AS incubated with L-aspartic acid and β,γ 18O6-ATP for 210 minutes. .............................................................. 137
C-3 Full 31P NMR spectra of the PIX reaction of E348A incubated with L-aspartic acid and β,γ 18O6-ATP for 210 minutes. .............................................................. 138
C-4 31PMR spectra of the α-P of ATP as a function of time for the reaction of His6-tagged AS-B and E348A in the presence of [β,γ-18O6]-ATP and aspartic acid. ...................................................................................................................... 139
C-5 31PMR spectra of the γ-P of ATP as a function of time for the reaction of His6-tagged AS-B and E348A in the presence of [β,γ-18O6]-ATP and aspartic acid.. 140
13
LIST OF ABBREVIATIONS
ADP Adenosine diphosphate
ALL Acute lymphoblastic leukemia
AMP Adenosine monophosphate
AMP-CPP α,β-Methyleneadenosine 5′ -triphosphate
AS-B Glutamine-dependent asparagine synthetase from E. coli
ASNS Glutamine-dependent asparagine synthetase
Asp L-Aspartic acid
Asn L-Asparagine
ATP Adenosine triphosphate
βAspAMP Beta-aspartyl adenosine monophosphate intermediate
βLS Beta-lactam synthetase
CPS Carbapenam synthetase
CEA N2-(carboxylethyl)-L-arginine
D2O Deuterium oxide
DGPC Deoxyguandinoproclavaminic acid
DMSO Dimethyl sulfoxide
DNFB 2,4-Dinitro-1-flurobenzene
dNTP Deoxyribonucleotide triphosphate
DON 6-diazo-5-oxo-L-norleucine
DTT 1,4-dithio-DL-threitol
EDTA Ethylenediaminetetraacetic acid
EMBL The European Molecular Biology Laboratory
EPPS 4-(2-hydroxyethyl)piperazine-1-propanesulfonic acid
Glu L-Glutamic Acid
14
Gln L-Glutamine
GPAT Glutamine 5’phosphoribosyl pyrophosphate amidotransferase
GFAT Glutamine fructose 6-phosphate amidotransferase
HEPES 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid
HPLC High Performance Liquid Chromatography
hASNS Glutamine-dependent asparagine synthetase from Homo Sapiens
GTP Guanosine triphosphate
IMAC Immobilized metal affinity chromatography
Lys L-Lysine
MOI Multiplicity of infection
Ni-NTA Nickel-nitriloacetic acid
NAD+ Nicotinamide adenine dinucleotide
NADH Nicotinamide adenine dinucleotide (reduced form)
NMR Nuclear magnetic resonance
PCR Polymerase chain reaction
PEG Polyethylene glycol
PIX Positional isotope exchange
PPi Pyrophosphate
ppm Parts per million
SAXS Small-angle X-ray scattering
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Sf9 Cell line derived from pupal ovarian tissue of the Fall armyworm Spodoptera frugiperda
TCEP Tris(2-carboxyethyl)phosphine
15
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
INHIBITION, CHARACTERIZATION, AND CRYSTALLIZATION OF GLUTAMINE –
DEPENDENT ASPARAGINE SYNTHETASE
By
Megan Elizabeth Meyer
May 2010
Chair: Nigel Richards Major: Chemistry Acute lymphoblastic leukemia is commonly treated using the enzyme
L-asparaginase, which hydrolyzes asparagine to aspartic acid, leaving the tumor cells
unable to obtain asparagine from the circulating plasma. Several lines of evidence
suggest that resistance to L-asparaginase treatment is correlated to up-regulation of the
enzyme responsible for the biosynthesis of asparagine, asparagine synthetase. Recent
work has shown that a sulfoximine derived inhibitor of asparagine synthetase with
nanomolar potency can suppress the proliferation of drug-resistant MOLT-4 leukemia
cells in the presence of L-asparaginase, a result that supports the use of inhibitors of
asparagine synthetase in the clinical treatment of acute lymphoblastic leukemia. This
work strives to develop second-generation inhibitors of asparagine synthetase by
gaining a better understanding of the active site-inhibitor interactions, reaction
mechanism, and structure of this enzyme.
Sulfoximine derived inhibitors of asparagine synthetase were designed to
increase the bioavailability and potency of the molecule. Steady-state kinetic analysis of
these compounds found that a localized negative charge on the inhibitor that mimics the
phosphate group is essential to ligand binding in asparagine synthetase. These
16
findings place an important constraint on the design of future inhibitors of asparagine
synthetase.
Work to understand the reaction mechanism and validate a computational model
of asparagine synthetase focused on a conserved glutamate residue which was
hypothesized to act as the general base for the deprotonation of ammonia in the
transition state. However, site-directed mutagenesis, kinetic analysis, and isotopic
labeling studies of the glutamine-dependent asparagine synthetase from E. coli found
that this residue is critical to formation of the βAspAMP intermediate.
Finally in an effort to understand the structure-function relationships of
asparagine synthetase, we sought to obtain a high resolution crystal structure of
asparagine synthetase. Through the preparation of a doubly inhibited form of the
enzyme, we hoped to lock the enzyme into an active conformation that promoted
crystallization. Unfortunately, preliminary crystallization trials did not produce crystals
suitable for diffraction but important information regarding the stability of the enzyme
was obtained.
17
CHAPTER 1 INTRODUCTION
Acute Lymphoblastic Leukemia
Acute lymphoblastic leukemia (ALL) is a cancer of the white blood cells,
characterized by an excess of lymphoblasts in the blood. Over 5,000 new cases were
diagnosed in the United States in 2008. ALL is ten times more likely to be diagnosed in
children than in adults, with 72% of all childhood leukemia cases diagnosed as ALL.
Survival rates have increased significantly over the last 40 years as treatment regiments
have improved and now exceed 65% for adults and 85% for children (1).
The most widely used chemotherapeutic treatment for ALL employs
L-asparaginase (2-4), an enzyme that catalyzes the hydrolysis of L-asparagine to
L-aspartic acid (5). The exact mechanism by which this treatment works is still poorly
understood; however, it is believed that leukemic blasts cannot produce sufficient levels
of asparagine and therefore must rely on the uptake of asparagine from the circulating
plasma (6, 7). L-asparaginase depletes the levels of asparagine in the blood, which
leaves leukemic blasts unable to obtain this essential amino acid. This leads to cell
cycle arrest likely due to impaired protein synthesis (8-10). Although this treatment is
successful in a large number of cases, patients who relapse often show resistance to
further L-asparaginase treatment.
Resistance to L-asparaginase treatment has been correlated with up-regulation
of asparagine synthetase (ASNS) (11-16), an enzyme that catalyzes the biosynthesis of
L-asparagine. The inverse relationship between ASNS levels and resistance to
L-asparaginase treatment was first observed in the late 1960’s in mouse lymphoma (12,
17, 18) and leukemia cells (16) and later identified in a human lymphoma cell line (14).
18
These studies found that cells resistant to L-asparaginase treatment showed elevated
levels of ASNS activity. The first studies on patient blood and bone marrow samples
were conducted in 1969. In this study, Haskell and Canellos observed that samples
taken from patients resistant to L-asparaginase treatment had a 7-fold increase in
ASNS levels (11). A more recent study using patient bone marrow samples found that
low levels of ASNS expression correlated with sensitivity to L-asparaginase
treatment (13) although other studies have argued against this hypothesis (19-21). In
addition, studies on ovarian cancer cells lines have found that ASNS expression levels
can predict the susceptibility of ovarian cancer cells to L-asparaginase activity (22, 23).
These studies suggest that understanding the underlying mechanisms by which L-
asparaginase treatment and ASNS expression are correlated could further the use of L-
asparaginase for the treatment of other types of cancer.
Detailed studies involving a MOLT-4 human leukemia cell line have begun to
better explain the correlation between L-asparaginase resistance and ASNS levels.
One study demonstrated that asparagine synthetase mRNA levels, protein levels, and
enzyme activity are all elevated in a drug-resistant cell line after short term exposure to
L-asparaginase, an effect that is not fully reversible (15). A more striking observation
demonstated that overexpression of asparagine synthetase by a retrovirus can induce
the drug-resistance phenotype (24). Furthermore, a potent inhibitor of ASNS was found
to suppress the proliferation of a drug resistant MOLT-4 cell line (25), a finding that
supports the use of potent inhibitors of ASNS in the clinical treatment of ALL.
Asparagine Synthetase
Glutamine-dependent asparagine synthetase (EC 6.3.5.4) is an enzyme that
catalyzes the biosynthesis of L-asparagine from L-aspartic acid in an ATP dependent
19
reaction that utilizes glutamine as a nitrogen source in vivo (Figure 1-1). In the absence
of glutamine, the enzyme can utilize ammonia as a nitrogen source, and in the absence
of aspartate, the enzyme functions as a glutaminase by catalyzing the hydrolysis of
glutamine to ammonia and glutamate. The three distinct reactions catalyzed by
asparagine synthetase are listed below:
1) L-Gln + L-Asp + ATP L-Asn + L-Glu + AMP + PPi 2) NH3 + L-Asp + ATP L-Asn + AMP + PPi 3) L-Gln + H2O L-Glu + NH3
Reactions 1 and 2 indicate the glutamine and ammonia-dependent reactions of
asparagine synthetase, respectively and reaction 3 is the glutaminase reaction.
Glutamine-dependent asparagine synthetase (ASNS) belongs to the glutamine-
dependent amidotransferase family of enzymes that catalyze the transfer of amide
nitrogen from glutamine to an acceptor substrate (26). ASNS has been cloned or
isolated from yeast (27), bacteria (28-30), plants (31, 32), and mammals (33-36). Early
studies on the mammalian enzyme utilized asparagine synthetase isolated from bovine
(37-40) and remain the only studies on the native mammalian enzyme to date. Early
recombinant expression systems for human asparagine synthetase in Saccharomyces
cerevisiae (41) and Escherichia coli (42) yielded low amounts of protein and enzymes
with irreproducible kinetic values. However, the recent development of a baculovirus
expression system for the expression of recombinant human asparagine synthetase has
allowed for the production of milligram quantities of kinetically reproducible enzyme and
has greatly enabled the studying of the enzyme’s mammalian form (25, 43, 44).
Due to the previous difficulties in obtaining sufficient quantities of mammalian
asparagine synthetase, the glutamine-dependent asparagine synthetase from
20
Figure 1-1. Reaction catalyzed by glutamine-dependent asparagine synthetase.
21
Escherichia coli (AS-B) has been the primary source for kinetic studies (45-47),
although some work has also been done on the enzyme from Vibrio cholera (29).
Interestingly, prokaryotes encode two genes for asparagine synthetase, asnA and asnB,
which encode for the ammonia and glutamine-dependent asparagine synthetases,
respectively (48); however, the two enzymes are not structurally or evolutionarily
related (49) and the ammonia-dependent enzyme will not be discussed in further detail.
Enzyme Mechanism
In the proposed mechanism for ASNS (Figure 1-2), the side chain carboxylate of
aspartic acid attacks the α-phosphate of ATP to form the β-aspartyl AMP (βAspAMP)
intermediate and pyrophosphate (PPi). The formation of the βAspAMP intermediate has
been confirmed by isotopic labeling experiments utilizing 18O-labeled aspartic acid for
both the E. coli (46, 48) and bovine enzyme (36). In a distinct active site, glutamine is
hydrolyzed to glutamate and ammonia via a thioester intermediate utilizing the N-
terminal cysteine residue of the protein(50). Replacement of this fully conserved
residue (Cys-1) in asparagine synthetase with a serine or alanine residue abolishes all
glutaminase and glutamine-dependent activity of the enzyme, although the ammonia-
dependent synthetase activity is unaffected (43, 51, 52). The ammonia then travels
through an intramolecular tunnel where it attacks the βAspAMP intermediate to form
asparagine and AMP via a tetrahedral intermediate.
Although this mechanism suggests that the two active sites should be tightly
coupled, glutamate and asparagine production are not fully coordinated in ASNS (46).
ASNS maintains high levels of glutaminase activity in the absence of other substrates
and glutaminase activity is only slightly stimulated in the presence of other substrates
(46). This is in stark contrast to other glutamine-dependent amidotransferases where
22
Figure 1-2. Proposed mechanism of glutamine-dependent asparagine synthetase.
23
the active sites are strictly coordinated and glutaminase activity is significantly
enhanced in the presence of the correct acceptor molecule (53, 54). However, studies
on AS-B (46) and the enzyme isolated from Vibrio cholera (29) have found that
asparagine is a competitive inhibitor of the glutaminase reaction (KI: 50-60 µM) and thus
represents a potential method for regulating and preventing futile glutamine hydrolysis
in vivo (55).
Based on previous studies several models for the order of substrate binding and
product release have been suggested (46, 47, 56). However, only one kinetic model can
explain the hyperbolic relationship of the glutamate to asparagine ratio observed as the
concentration of glutamine is increased. This model suggests that the active sites are
only weakly coupled (47). In this proposed kinetic model (Figure 1-3), ATP or glutamine
can bind to the free form of the enzyme. If glutamine binds first, it is subsequently
hydrolyzed to glutamate and ammonia. The E.ATP complex can either bind glutamine,
resulting in glutamine hydrolysis, or it can bind aspartate. Once the E.Asp.ATP complex
is formed and if concentration of glutamine is low, the reaction proceeds thru formation
of the βAspAMP intermediate (k3), then binds glutamine and subsequently forms
products (k7). However, as the concentration of glutamine is increased, the enzyme
favors formation of the quaternary complex (E.ATP.Asp.Gln). From this point, the
enzyme can undergo futile hydrolysis to form glutamate (k10) or it may catalyze
formation of the intermediate (k12) and formation of products (k7). This branching point
for the E.ATP.Asp complex explains the previously observed glutamate:asparagine ratio
of 1.8:1 under saturating substrate conditions (46). This model assumes that ammonia
cannot leak from the tunnel, as has been demonstrated for other glutamine-dependent
24
Figure 1-3. Proposed kinetic model for glutamine- dependent asparagine synthetase. Reprinted with permission from Archive of Biochemistry and Biophysics vol 413. Tesson, A.R, Soper, T.S., Ciusteau, M., Richards, N.G.J. Pages 23-31. Copyright 2003.
25
amidotransferases (57), and that the active sites are coordinated after formation of the
βAspAMP intermediate.
Enzyme Structure
In 1999, the crystal structure of AS-B was solved to 2.0 Å (58). The structure
was solved for the C1A mutant, which can bind but not hydrolyze glutamine (51),
complexed with AMP and glutamine (Figure 1-4). The crystal structure showed, as was
expected from sequence alignments (26, 59) and studies using monoclonal antibodies
on bovine ASNS (39), that the enzyme is composed of two distinct domains that
catalyze two reactions, the N-terminal glutaminase domain and C-terminal synthetase
domain. The N-terminal domain is responsible for the binding and hydrolysis of
glutamine and belongs to the class II or Ntn glutamine-dependent amidotransferase
family of enzymes. This family of enzymes includes glutamine 5’phosphoribosyl
pyrophosphate amidotransferase (GPAT) (60, 61), glutamine fructose 6-phosphate
amidotransferase (GFAT) (62), and glutamine synthase (63). All members of this family
use a conserved N-terminal cysteine residue as the nucleophile for hydrolysis of
glutamine (26). The C-terminal domain of ASNS is responsible for the binding of
aspartate and ATP and catalyzes formation of the βAspAMP intermediate as well as
breakdown of the intermediate to form asparagine. The C-terminal domain belongs to
the ATP pyrophosphatase family of enzymes that are characterized by a signature
SGGXDS sequence, a motif referred to the P loop. This motif is observed in enzyme
domains that catalyze hydrolysis of ATP to AMP and PPi (Figure 1-5) (64). This family
includes GMP synthetase (65), arginosuccinate synthetase (66), ATP sulfurylase (67),
β-lactam synthetase (68, 69), carbapenam synthetase(70), 4-thiouridine synthetase (71)
NAD+ synthetase (72). The two domains are separated by approximately 20 Å and
26
Figure 1-4. Crystal structure of E. coli AS-B (1CT9) complexed to AMP and glutamine. The glutaminase and synthetase domains are shown in green and blue, respectively. Bound glutamine and AMP are shown in sphere representation. Image rendered in PyMOL (73).
27
Figure 1-5. Residues defining the PPi loop motif in computational model of AS-B/PPi/βAspAMP. The signature SGGXDS residues are shown in yellow interacting with bound Mg/PPi (both shown in stick representation) The βAspAMP intermediate is also shown in stick representation. Color scheme: C-green, H-yellow, N-blue, O-red, P-orange, Mg-light green. Image rendered in PyMOL (73).
28
are connected via a solvent-inaccessible intramolecular tunnel responsible for the
translocation of ammonia between the two active sites (Figure 1-6) (58). Unfortunately,
disorder in the C-terminal domain of the crystal structure did not allow observation of
several loop regions (Ala 250-Leu 267 and Cys422-Ala 426) as well as the final 37
amino acids of the protein. It is possible that these terminal residues are important for
binding of aspartic acid and may become ordered upon binding (58).
In 1999, Ding generated a computational model of the AS-B active site using the
evolutionarily related β-lactam synthetase (βLS) as a homology model (74, 75). βLS is
an essential enzyme in the biosynthesis of clavulanic acid (68) and catalyzes the
formation of deoxyguandinoproclavaminic acid (DGPC) from N2-(carboxylethyl)-
L-arginine (CEA). Both enzymes catalyze adenylation of the substrate to form an
activated AMP derivative followed by attack of the carbonyl group by a nucleophilic
nitrogen. However, βLS catalyzes intramolecular attack whereas AS-B utilizes
ammonia to catalyze intermolecular attack (Figure 1-7 A). These two enzymes are
clearly evolutionarily related, as their overall three dimensional structures are nearly
identical and the residues for substrate adenylation are highly conserved (Figure 1-7B).
Therefore, using the βLS/CEA/AMPCPP structure as a model, as well as knowledge
about the binding of aspartic acid from studies involving constrained analogs (76), a
model of AS-B was generated (Ding, unpublished results) where the missing loops
regions were modeled in and the βAspAMP/MgPPi complex is bound in the active site.
This model has been useful in gaining an understanding of the critical residues involved
in catalysis, although some work must be done to further validate this computational
model, and determine if it will be a useful model for drug discorvery (77).
29
Figure 1-6. Intramolecular tunnel of AS-B connects the glutaminase domain active site to the synthetase domain active site. The glutaminase domain is shown in blue and the synthetase domain shown in cyan. AMP and glutamine are represented as spheres. Color scheme: C-gray, N-blue, O-yellow, P-orange. Image rendered in PyMOL (73).
30
Figure 1-7. AS-B and βLS catalyze similar reactions and are structurally homologous. A) Chemical reactions catalyzed by AS-B and βLS. B) Structure overlay of AS-B (pdb1CT9) (red) and βLS from Strepomyces clavuligerus (pdb 1JGT) (blue). Image rendered in PyMOL (73).
A
B
31
Inhibitor Studies of ASNS
The observation that resistance to L-asparaginase was correlated to elevated
levels of ASNS provoked interest in the identification of inhibitors of ASNS. Several
studies involving substrate analogs of glutamine and aspartic acid failed to identify any
compounds with significant ability to inhibit ASNS either in vitro or in vivo (78, 79).
Because there are a large number of enzymes that utilize glutamine as a nitrogen
source, the design of future inhibitors was targeted to the synthetase domain. Kinetic
studies suggested that the βAspAMP intermediate must be stabilized within the active
site (46) and suggested that analogs of this intermediate and the transition state leading
to asparagine formation should act as tight-binding inhibitors (80). This important
kinetic information as well as the recent development of an efficient expression system
for the human enzyme (43) prompted identification and characterization of the first two
nanomolar inhibitors of human asparagine synthetase (Figure 1-8) (25, 81). The N-
acylsulfonamide (81) was synthesized as a non-hydrolyzable analog for the βAspAMP
intermediate. In this compound, the sulfonamide group acts as a stable analog for the
phosphate group. This compound exhibited slow onset inhibition with a KI* value of
728 nM. The N-adenylated sulfoximine was initially synthesized as a transition state
analog for the attack of ammonia of the βAspAMP intermediated of ammonia-dependent
asparagine synthetase (AS-A)(82). However, it was also found to be a potent inhibitor
of both ammonia and glutamine-dependent asparagine synthetase from E. coli (82, 83).
It has also been fully characterized (as a mixture of diastereomers) in vitro as a
transition state analog that is a slow-onset, tight-binding inhibitor of human ASNS with
low nanomolar affinity (KI* of 2.46 nM) (25). In this compound, the tetrahedral sulfur
atom is a good mimic for the rehybridization of the tetrahedral carbonyl carbon in the
32
Figure 1-8. Chemical structures of previously characterized inhibitors of hASNS. A) The N-acylsulfonamide is a stable analog for the βAspAMP intermediate. B) The N-adenylated sulfoximine is a transition state analog for the attack of ammonia on the intermediate.
A
B
33
transition state after attack by ammonia. Furthermore, examination of the electrostatic
potential shows that the methyl group has a positive electrostatic potential that mimics
the attack of ammonia in the transition state. The most significant aspect of this
compound is its ability to inhibit the proliferation of drug-resistant MOLT-4 human
leukemia cells in a concentration-dependent manner, an effect that was stimulated by
the presence of 1U of ASNase (Figure1-9) (25). This effect provides the first direct
evidence that sulfoximine derived compounds can act as potential therapeutic agents in
the treatment of drug-resistant ALL.
Research Objectives
The long-term goal of this research project is to obtain a small molecule inhibitor of
glutamine-dependent asparagine synthetase that can be utilized in the clinical treatment
of ALL. The development of an expression system for human asparagine synthetase as
well as the identification of potent, small molecule inhibitors is a large step forward in
achieving this goal. However, the N-adenylated sulfoximine is limited in its clinical utility
due to the high concentrations necessary (up to 1 mM) to exert its biological effect.
Therefore, new compounds are desired that have increased bioavailability and potency.
The design of new inhibitors of human ASNS is greatly facilitated by a detailed
knowledge of the ASNS active site as well as a better understanding of the residues
involved in the reaction mechanism. Although the crystal structure for ASNS from E.
coli has been solved, the crystal structure of human asparagine synthetase has proved
elusive and will aid in the development of new inhibitor compounds of ASNS.
Furthermore, site-directed mutagenesis of highly conserved residues in ASNS provide a
better understanding of the reaction mechanism as well as test our current
computational model and understanding of the ASNS active site.
34
Figure 1-9. Effect of the N-adenylated sulfoximine on MOLT-4 proliferation in the absence and presence of 1U ASNase. Reprinted with permission from Chemistry and Biology vol 13. Gutierrez, J.A., Pan, Y., Koroniak, L., Hiritake, J., Kilberg, M.S., Richards, N.G.J. Pages 1339-1347. Copyright 2006.
35
The specific goals of this presented work are the following: 1) characterization of
second-generation sulfoximine based inhibitors of human asparagine synthetase,
2) understanding the specific role of E348 in the reaction mechanism of AS-B, and
3) obtaining a crystal structure of human asparagine synthetase.
36
CHAPTER 2 A CRITICAL ELETROSTATIC INTERACTION MEDIATES INHIBITOR RECOGNITION
BY HUMAN ASPARAGINE SYNTHETASE1
Introduction
Approximately 5,000 new cases of ALL are diagnosed in the United States each
year with a vast majority of those cases in children. The clinical treatment for ALL
utilizes the enzymatic depletion of asparagine from the blood and along with other
chemotherapeutic agents, such as prednisone and vincristine, remission rates in
childhood ALL have reached 95% (4); although those patients that relapse are often
resistant to further L-asparaginase treatment. The effectiveness of L-asparaginase as a
treatment protocol is a topic of debate but it is believed that leukemic blasts rely on the
uptake of asparagine from the blood (6, 7) and L-asparaginase works by depleting the
levels of asparagine in the blood leading to cell cycle arrest (8-10).
It is hypothesized that resistance to L-asparaginase is the result of increased
levels of L-asparagine due to up-regulation of asparagine synthetase (ASNS), the
enzyme responsible for the biosynthesis of L-asparagine (84). A human leukemia cell
line (MOLT-4) has shown that exposure to L-asparaginase causes an increase in ASNS
levels (both mRNA and protein) and that over-expression of ASNS can result in the
L-asparaginase resistant phenotype (24). The most recent evidence to support this
hypothesis has come as a result of work by the Richard’s lab, which has demonstrated
that proliferation of L-asparaginase resistant cells is suppressed in the presence of L-
asparaginase and the N-adenylated sulfoximine 1 (Figure 2-1)(25). This compound acts
as a transition state analog for the attack of ammonia on the βAspAMP intermediate
1 Reprinted in part with permission from Bioorganic and Medicinal Chemistry, vol 17. Ikeuchi, H., Meyer, M E., Hiratake, J., and Richards, N.G.J. Pages 6641-6650. Copyright 2009.
(A)
37
and acts as a potent inhibitor of human asparagine synthetase (hASNS)(25) as well as
both bacterial forms of asparagine synthetase (82, 83).
Although compound 1 acts as a low nanomolar inhibitor of human asparagine
synthetase in vitro, concentrations of 0.1-1 mM were required to observe an effect in
vivo (25). Several factors may contribute to the necessity of using high concentrations
of the compound but our hypothesis is that the presence of ionized groups on the
molecule prevents its entry into the cell. One possible way around this issue is to use
pro-drugs with groups that are chemically labile within cells to substitute for the
phosphate group (85). However, compound 1 is difficult to synthesize and modifications
to the synthetic pathway to allow for the development of pro-drugs did not represent an
ideal situation. Therefore, we wanted to pursue the design and synthesis of novel
molecules where the phosphate group was substituted for a functional group with more
drug-like properties (86). In addition, previous work in our lab demonstrated that the
phosphate group can be replaced with a sulfamate group to yield an acyl-sulfamide
(compound 2), which was previously shown to be a high nanomolar inhibitor of hASNS
(81). Therefore, we decided to prepare and characterize functionalized sulfoximines 3
and 4 (Figure 2-1). Sulfoximine 3, where an amine connects the sulfur to the ribose ring,
was preferred to adenosylsulfamate 4 because of the tendency of 4 to cyclize to form
cycloadenosine due to the leaving group ability of the sulfamate group (87).
Synthesis of compounds 3 and 4 was completed by Hideyuki Ikeuchi and Jun
Hiratake at the Institute of Chemical Research, Kyoto University, Kyoto, Japan and
details of the synthetic route can be found in (44). This chapter will report of the ability of
3 and 4 to act as inhibitors of hASNS in vitro.
38
Figure 2-1. Chemical structures of adenylated sulfoximine derivative 1 and adenylated sulfamide 2, which are nanomolar inhibitors of hASNS. Chemical structures of adenylated sulfoximine derivatives 3 and 4, the novel compounds to be characterized.
39
Results and Discussion
The effect of sulfoximine 3 (as a mixture of four diastereoisomers) on ammonia
and glutamine-dependent asparagine synthesis was assayed by measuring the rate of
inorganic pyrophosphate (PPi) production (88) (Figures 2-2 and 2-3). Although the
compound exhibited slow-onset kinetics (89), these experiments showed that 3 was a
much less effective inhibitor of hASNS than the adenylated sulfoximine 1. A control
experiment confirmed that 3 did not affect the coupling enzyme.
The observed progress curves were analyzed using a standard kinetic model for
slow-onset inhibition (89), where it is assumed that the inhibitor binds to the free
enzyme and is competitive with ATP, as was shown previously for functionalized
sulfoximine 1 (25). Curve fitting gave values for k5 and k6 of 0.0024 ± 0.0004 s-1 and
0.0025 ± 0.0005 s-1, respectively, and values of 20 ± 10 µM and 10 ± 6 µM for KI and
KI*, respectively, when glutamine was used as a nitrogen source.
Although this compound was assayed as a mixture of four diastereoisomers,
there is strong evidence that tight-binding inhibition of functionalized sulfoximines show
stereochemical dependence (82, 90, 91). When diastereoisomeric and/or enantiomeric
sulfoximine derivatives have been separated, one enatiomer acts as a potent inhibitor;
wheras the other enatiomer shows weak inhibition (92, 93). This idea is supported by
experimental (94) and computational (95) studies involving serine proteases, where
hydrogen bonds stabilize one epimer of the tetrahedral intermediate when activated
carbonyls are attacked by nucleophiles. Therefore, if only one of the four
diastereoisomers of 3 is active, then the KI* value for the resolved compound would be
expected to be approximately four fold lower. However, this represents a KI* value
40
Figure 2-2. Ammonia-dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3: open circles, 0 µM; open squares, 10 µM; open diamonds, 50 µM; crosses, 100 µM; closed diamonds, 500 µM; closed triangles, 1 mM; closed circles, 10 µM N-adenylated sulfoximine 1. Solid lines represent the best fit lines using equation (2-1) (see experimental section).
41
Figure 2-3. Glutamine-dependent production of PPi in the presence of increasing amounts of the functionalized sulfoximine 3: open circles, 0 µM; open squares, 10 µM; open diamonds, 50 µM; crosses, 100 µM; closed diamonds, 500 µM; closed triangles, 1 mM; closed circles, 10 µM N-adenylated sulfoximine 1. Solid lines represent the best fit lines using equation (1) (see experimental section).
42
that is three orders of magnitude higher than the adenylated sulfoximine 1, indicating
this compound is a much weaker inhibitor of hASNS than the previously studied
sulfoximine 1. Given the significant increase in KI* and the difficulty in finding
chromatographic conditions to separate sulfoximine 3, we decide to pursue the
characterization of functionalized sulfoximine 4.
There are numerous examples of potent inhibitors where the phosphate moiety
has been replaced by either sulfamide or sulfamate functional groups (96-98), including
the acylsulfonamide 2 which showed sub-micromolar potency in human ASNS (81).
Surprisingly, these experiments showed that the functionalized sulfamate 4 had no
effect on either the ammonia or glutamine-dependent synthetase activity of the human
enzyme at concentrations up to 1 mM (Figures 2-4 and 2-5). An important control
experiment was performed in the presence and absence of 1 mM of 3 and 4 to verify
that neither compound perturbed the 1:1 Asn:PPi ratio by stimulating ATP hydrolysis. It
was found, within experimental error, that neither compound affected the Asn: PPi ratio
(Figure 2-6).
Comparison of the previously characterized nanomolar inhibitors with the
observations made here are consistent with a model where the presence of a negative
charge on the phosphate group of the βAspAMP intermediate is essential to ligand
recognition by the synthetase site of human ASNS. This conclusion, however, assumes
that the compounds bind in a similar or identical fashion within the synthetase active
site. The adenosyl moieties will most certainly bind within the well-defined ATP pocket,
which is very tightly defined to ensure the use of ATP rather than GTP as a substrate
(99). Furthermore, previous studies indicate that ASNS binds the carboxylate and
43
Figure 2-4. Ammonia-dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4: open circles, 0 µM; open squares, 10 µM; open diamonds, 50 µM; crosses, 100 µM; closed diamonds, 500 µM; closed triangles, 1 mM. Solid line represents the linear production of PPi as a function of time in the absence of inhibitor for ASNS.
44
Figure 2-5. Glutamine-dependent production of PPi in the presence of increasing amounts of functionalized sulfamate 4: open circles, 0 µM; open squares, 10 µM; open diamonds, 50 µM; crosses, 100 µM; closed diamonds, 500 µM; closed triangles, 1 mM. Solid line represents the linear production of PPi as a function of time in the absence of inhibitor for ASNS
45
Figure 2-6. Ratio of asparagine to pyrophosphate production (µM) in the presence and absence of 1 mM of inhibitor. A) Asparagine to pyrophosphate prodution in the presence and absences of functionalized sulfoximine 3. B) Asparagine to pyrophosphate production in the presence and absences of functionalized sulfoximine 4. Error bars represent the standard deviation of three individual experiments.
0
10
20
30
40
50
60
0 mM 3 1 mM 3
µM
05
10152025303540
0 mM 4 1 mM 4
µM
A B
46
amino groups of aspartate with high specificity (76). Therefore, because the adenylated
sulfoximine 1 bears an ionized phosphoramidate moiety, it can bind to the synthetase
active site with high affinity, and is the most potent inhibitor of hASNS reported to date.
The functionalized sulfamate 2 and sulfamide 3 derivatives can only form this interaction
within the active site if they bind as their negatively charged conjugate bases
(Figure 2-7).
The pKa of the sulfamate 2 NH, based on chemical consideration, is expected to
be much lower than that of sulfamide 3, thus resulting in sulfamate 2 acting as a more
potent inhibitor than that of sulfamide 3. Sulfamate inhibitor studies on the adenylating
enzyme, MbtA(100) from Mycobacterium tuberculosis, quantified the acylsulfamate
linkage of a N-benzoyl derivative 5 as 2.8 (Figure 2-8) (101). Therefore, the pKa of N-
acylsulfamate 2 is likely in the range of 4-5 because the carbonyl group on 2 is less
electron deficient. The pKa’s of methansulfonamide and sulfanilamide are 10.87 and
10.43 (Figure 2-8), respectively, thus the pKa of fuctionalized sulfamide 3 is likely in the
range of 9-10. Therefore, under the conditions used in the assay, pH 8.0, more N-
acylsulfamate 2 is present in the ionized form than the N-acylsulfamide 3 which leads to
a lower KI* value. Finally, this model explains why functionalized sulfamate 4 cannot act
as an inhibitor of hASNS. The absence of an ionizable group in 4 means that this
compound can only interact with the enzyme in its neutral form and thus cannot bind
within the active site.
This model is consistent with a computational model where the βAspAMP
intermediate is bound within the synthetase active site of Escherchia coli AS-B (Ding,
unpublished). Although the model is based on the E. coli variant, all residues within the
47
Figure 2-7. Conjugate base of the functionalized acylsulfamate 2 and functionalized
acylsulfamide 3.
Figure 2-8. Chemical structures of N-benzoylsulfamate 5 (101), sulfanilamide, and methanesulfonamide compounds that were used to estimate pKa values of 2 and 3.
48
active site are conserved. In this model, a lysine residue, 449 (E. coli numbering),
which corresponds to Lys-466 in the human enzyme, is positioned directly above the
phosphate group of the βAspAMP intermediate (Figure 2-9). This residue is fully
conserved in all known glutamine-dependent asparagine synthetases, which suggests
that this electrostatic interaction is critical for ATP binding and catalysis.
This is further supported by site-directed mutagenesis of the Lys 449 in E. coli to
alanine and arginine. The arginine mutant retained glutaminase activity similar to the
wild type indicating that the overall protein structure was intact. However, the alanine
mutant showed significant deviations from wild type behavior suggesting the overall
integrity of the protein had been compromised (Table 2-1). Both mutants lacked any
detectable levels of synthetase activity, even at elevated levels of ATP. With no further
means with which to assay the synthetase activity of the K449A/R mutants of AS-B, all
we can conclude is that this residue is critical for enzyme catalysis.
Table 2-1. Glutaminase activity of Wild-type AS-B and K449 mutants Enzyme Km (app) Gln (mM) kcat (s-1) kcat/Km (M-1 s-1)
Wild Type 2.4 ± 0.2 2.2 ± 0.1 920
K449R 1.9 ± 0.3 3.1 ± 0.1 1600
K449A 29 ± 7 1.3 ± 0.2 45
Recent work on the evolutionarily related enzymes, βLS and carbapenam
synthetase (CPS) further confirmed the importance of this conserved lysine residue in
the reaction mechanism. Crystallographic snapshots of βLS showed that Lys-443
(corresponds to Lys 449 or Lys 466 in ASNS) is hydrogen bonded to the non-bridging
oxygen on the γ -phosphate of ATP (74, 75) and near the β-lactam carbonyl oxygen of
DGPC. It was proposed through site-directed mutagenesis and pH dependent studies
49
Figure 2-9. The interaction between the Lys-449 side chain and the phosphate group of the βAspAMP intermediate (both shown in “stick” representations) in a computational model of the AS-B/Gln/acyl-adenylate complex (Ding, unpublished). The protein backbone is shown by the blue ribbon. Color scheme: C, green; H, white; N, blue; O, red; P, orange. This image was generated in PYMOL(73).
Lys 449
βAspAMP
50
to be a critical residue for stabilization of the oxyanion intermediate in β-lactam
synthesis(102). In addition, recent work on carbapenam synthetase (CPS), another
evolutionarily related enzyme, demonstated that mutation of Lys-443 to alanine and
methionine results in complete loss of activity; it was proposed to act as a general acid
in the mechanism and to be required for stabilization of the intermediate (103).
We conclude that potent inhibitors of ASNS must possess functional groups that
mimic the negative charge of the phosphate group in order to maintain this critical
interaction with the lysine side chain. This is an important finding for the future design of
sulfoximine derived libraries and future ASNS inhibitors that can be easily taken up into
leukemia cells.
Experimental Section
Materials
Functionalized sulfoximines 3 and 4 were synthesized and generously provided
by Hideyuki Ikeuchi and Jun Hiratake at the Institute for Chemical Research, Kyoto,
Japan. Details of the synthesis can be found in the following reference (44). Unless
otherwise stated, all chemicals and reagents were purchased from Sigma Aldrich (St.
Louis, MO) and were of the highest purity available. Protein concentrations were
determined using the Bradford Assay (104) (Pierce, Rockford, IL), and are corrected as
previously described (47). L-glutamine was recrystallized prior to use in all kinetic
assays (47). PCR primers were obtained from Integrated DNA technologies, Inc.
(Coraville, IA) and DNA sequencing reactions were performed by the DNA sequencing
core of the Interdisciplinary Center for Biotechnology Research at the University of
Florida (Gainesville, FL).
51
Expression and Purification of Recombinant Human Asparagine Synthetase
C-terminally tagged recombinant human asparagine synthetase was expressed
and purified from Sf9 cells as previously described (43). Briefly, 1 L of Sf9 cells at 1 x
106 cells/mL were infected at a MOI of 1 with recombinant baculovirus containing the
hasns insert. Cells were harvested 64 hours post infection by centrifugation at
2,000 x g for 10 min. The cellular pellet was lysed by sonication and cellular debris
removed by centrifugation at 50,000 x g for 20 min. The resulting supernatant was
filtered using a 0.45 µm filter and loaded onto a 3 mL Ni-NTA (Qiagen, Valencia, CA)
column equilibrated with lysis buffer (50 mM EPPS, pH 8.0, 300 mM NaCl, 1% triton X,
10 mM imidazole, and 1 mM DTT). Human ASNS was eluted using buffer containing 50
mM EPPS, pH 8.0, 300 mM NaCl, 250 mM imidazole, and 1 mM DTT. Fractions
containing human ASNS were identified by SDS-PAGE, pooled, and dialyzed
exhaustively versus 50 mM EPPS, pH 8.0, 100 mM NaCl, and 5 mM DTT. Glycerol was
added to 20% final concentration and the protein was stored at -80 °C.
Enzyme Assays
The ability of 3 and 4 to inhibit ASNS was measured by monitoring their effect on
the production of PPi under steady state conditions. Production of PPi was determined
using a continuous based assay (88) in which the production of PPi is coupled to the
consumption of NADH monitored at 340 nm (Sigma Technical Bulletin B1-100). The
concentration of sulfamide derivative 3 was varied (0, 10, 50, 100, 500, 1000 µM) in the
presence of 100 mM EPPS, pH 8.0, 0.5 mM ATP, 25 mM L-Gln or 100 mM NH4Cl,
10 mM L-Asp, 10 mgM MgCl2, and 350 µL of pyrophosphate reagent (1 mL final
volume). The reaction was initiated by the addition of 2 µg of ASNS and the production
of PPi monitored spectrophotometrically at 37 °C for 20 min. Sulfamate derivative 4
52
was examined under identical conditions, except that progress curves were generated
at 25 °C because this compound can undergo cyclization to form the cycloadenosine at
higher temperatures. Each data point represents the average of triplicate experiments.
Control experiments using known amounts of PPi in the presence of 3 and 4 confirmed
that coupling reagent was unaffected by the presence of the inhibitors.
Progress curves were analyzed by fitting the data, using the Kaleidagraph v3.5
software package (Synergy, Reading, PA), to equation 2-1 (89) where [PPi] is the
concentration of inorganic pyrophosphate formed at time t, vo and vss are the initial and
steady-state rates, respectively, and k is the apparent first-order rate constant for the
isomerization of EI to EI*.
[PPi] = 𝑣𝑣𝑠𝑠𝑠𝑠𝑡𝑡 + (𝑣𝑣0− 𝑣𝑣𝑠𝑠𝑠𝑠)𝑘𝑘
(1 − 𝑒𝑒−𝑘𝑘𝑡𝑡 ) (2-1)
It was assumed that compound 3 binds to the free enzyme and is competitive with
respect to ATP, in accordance with the known behavior of the adenylated sulfoximine 1
(25), as shown in the kinetic model for slow-onset inhibition (Figure 2-10) (89): Values
for k, vo, and vss were obtained by curve fitting to equation 2-1 for each concentration of
the functionalized sulfoximine 3 and used to compute an estimate of k6, using equation
2-2.
𝑘𝑘6 = 𝑘𝑘 𝑣𝑣𝑠𝑠𝑠𝑠𝑣𝑣0
(2-2)
Using the calculated value for k6 , the values of KI and k5 were determined by fitting the
variation of k with the concentration of 3 using equation 2-3, where I is the concentration
of the inhibitor, Ka is the Km for ATP (0.1 mM) (43), and [ATP] = 0.5 mM..
k=k6+ k5 �I
KI
(1+[ATP]Ka
+ I/KI� (2-3)
53
Figure 2-10. Kinetic model for slow-onset inhibition
54
The overall inhibition constant, KI* was then computed using equation 2-4. Error
measurements on KI, KI*l, k5, and k6 represent the error in the fit.
𝐾𝐾𝐼𝐼∗ = 𝐾𝐾𝐼𝐼𝑘𝑘6
𝑘𝑘5+ 𝑘𝑘6 (2-4)
An HPLC-based assay (47) was performed to measure the amount of
L-asparagine produced under the conditions of the inhibitor assay. Recombinant human
ASNS (2 µg) was incubated in the presence and absence of 1 mM of compound 3 or 4
(at 37 °C and 25 °C, respectively) for 20 minutes in 100 mM EPPS, pH 8.0, containing
0.5 mM ATP, 100 mM NH4Cl, 10 mM MgCl2, 10 mM aspartic acid (1 mL total volume).
The reaction was quenched with tricholoroacetic acid (TCA) to a final concentration of
4% (v/v). Following enzyme precipitation, the solution was neutralized using 10 M
NaOH, and a portion of the reaction mixture (40 µL) was taken for derivatization in a
mixture of 400 mM Na2CO3 buffer, pH 9 (80 µL), DMSO (20 µL), and a solution of
1-fluoro-2,4 dinitrobenzene (DNFB) dissolved in absolute ethanol (60 µL). This reaction
was incubated at 50 °C for 50 min before the addition of glacial acetic acid to quench
the reaction. The derivitized reaction mixture was separated by reverse-phase HPLC
on a Varian C18 Microsorb column (Varian, Palo Alto, CA) using a step gradient of 40
mM formic acid, pH 3.6, and CH3CN. DNP-L-asparagine was detected at 365 nm and
quantified by comparison to asparagine derivatized in the same manner.
Cloning, Expression, Purification, and Characterization of K449 Mutants
Site-directed mutagenesis of residue K449 to arginine and alanine in AS-B was
completed using QuickChange Mutagenesis kit (Stratagene, La Jolla, CA). The pET-
21c (+) vector (Novagen, San Diego, CA) containing the asnb insert followed by a 6X
poly-histidine tag was used as a template and the primers were designed to introduce
55
the respective mutation (see appendix B for primer sequences). Each PCR consisted of
the appropriate primer pairs (~125 ng of each primer), 10 ng of pET-21c (+) vector
containing the asnb insert followed by a 6X poly-histidine tag, 1X Pfu turbo buffer, 20
µM dNTPs, and 1 µL of Pfu turbo DNA polymerase (2.5U) in a 50 µL volume. The
reaction was heated to 95 °C for 30 sec, followed by 15 cycles of 95 °C for 30 sec,
55 °C for 1 min, and 68 °C for 8 min. A final extension at 68 °C was performed for 10
minutes following the 15 cycles. The reaction mixture was treated with 1 µL of Dpn1
(New England Biolabs, Ipswich, MA) at 37 °C for 1 hr in order to digest the methylated
template DNA. Super competent JM109 E. coli were subsequently transformed with
nicked plasmid containing the desired mutation. Plasmid DNA isolated from successful
transformants was sent for sequencing to confirm the desired mutation. Expression of
K449R and K449A was performed as previously described for AS-B(51) and purified by
Ni-NTA affinity chromatography following the same protocol as described in chapter 3.
Glutaminase activity was determined by an end-point assay in which the
glutamate produced in the reaction is converted by L-glutamic dehydrogenase to α-
ketoglutarate in a reaction that reduces a molecule of NAD+ to NADH. Reaction mixtures
(100 mM EPPS, pH 8.0, 100 mM NaCl, 8 mM MgCl2, and 0.2-50 mM of L-glutamine in a
200 µL total volume) were initiated by the addition of 1.5 µg of enzyme and run for 20
minutes at 37 °C before quenching with TCA to a final concentration of 4%. This
solution was added to a solution containing 300 mM glycine -250 mM hydrazine buffer,
pH 9.0, 1.5 mM NAD+, and 1 mM ADP followed by the addition of 2 units of L-glutamic
dehydrogenase in a final volume of 500 µL(Sigma G2626). Absorbance readings at 340
nm were taken after 30 minutes and corrected for the absorbance at 340 nm before the
56
addition of coupling enzyme. The amount of glutamate produced was quantified by
comparison to glutamate standards. Error represents the error in the fit.
57
CHAPTER 3 FUNCTIONAL ROLE OF A CONSERVED ACTIVE SITE GLUTAMATE IN
GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE FROM Escherichia coli
Introduction
Potent inhibitors of asparagine synthetase (ASNS) are useful tools to study the
inverse correlation between ASNS activity and L-asparaginase resistance in acute
lymphoblastic leukemia (ALL) patients and represent a viable method for the treatment
of L-asparaginase resistant ALL patients (84). Using information obtained from kinetic
studies of AS-B as well as structural information obtained from an x-ray crystal structure
of AS-B, our group has recently reported two mechanism-based, potent inhibitors of
ASNS (25, 81) that are nanomolar inhibitors of the enzyme. However, analogs of these
compounds lacked a localized negative charge found to be critical to inhibitor
binding (44). This finding highlights the importance of understanding the critical
interactions in the synthetase active within the context of the enzymatic mechanism.
As part of this work, computational studies involving the N-adenylated
sulfoximine, a potent transition state analogue of E. coli asparagine synthetase A (82),
E. coli asparagine synthetase B (83), and human asparagine synthetase (25), found
that one diastereoisomer could be positioned correctly in the synthetase active site of
the glutamine-dependent asparagine synthetase from E. coli (AS-B) relative to the base
of the tunnel (84). In this computational model (Figure 3-1), a glutamate residue is
positioned directly below the methyl group, thus possibly acting as a mimic for the
nucleophilic attack of ammonia. This glutamate residue (E348) is fully conserved in all
known glutamine-dependent asparagine synthetases and represents the only charged
residue within the interior of the intramolecular tunnel.
58
Figure 3-1. Computational model of the N-adenylated sulfoximine inhibitor docked into the synthetase site of AS-B. Note the close distance (approximately 4 Å) between the carboxylate side chain of E348 and the electron deficient methyl group (cyan) of the adenylated sulfoximine. Computational model was generated by Dr. Nigel Richards and figure modified from (84). Image rendered in PyMOL (73).
59
Furthermore, in the proposed mechanism of asparagine synthetase, the
carboxylate side chain of aspartate is adenylated by ATP to form the βAspAMP
intermediate (46). Ammonia, produced from the hydrolysis of glutamine, travels through
the intramolecular tunnel to the synthetase domain where it attacks the βAspAMP
intermediate to produce AMP and asparagine via a tetrahedral intermediate. One
consequence of this mechanism is the need for the ammonia molecule to be
deprotonated in the tetrahedral transition state before asparagine and AMP can be
formed (Figure 3-2). Therefore, we hypothesized that this conserved glutamate residue
acts as the general base for the deprotonation of ammonia in the transition state.
In support of this hypothesis, recent work on the evolutionarily related-enzymes
β-lactam synthetase (βLS) and carbapenam synthetase (CPS) identified a conserved
tyrosyl-glutamyl catalytic dyad that was found to be the critical base leading to β-lactam
formation (105). AS-B, βLS and CPS catalyze acyl-adenylation of their substrate to
form an activated intermediate; however, βLS and CPS catalyze intramolecular attack
with a secondary amine rather than intermolecular attack with ammonia, as in AS-B
(Figure 3-3A). Alanine mutants of the tyrosine and glutamate residues in βLS and CPS
catalyze the first half-reaction (acyl-adenylation) but cannot catalyze the second half-
reaction (nuceleophilic acyl substitution, i.e., β lactam formation). This supports the role
of these residues as a general base for deprotonation of the secondary amine leading to
β-lactam formation. Based on sequence alignments and a structural overlay of the
enzymes, this catalytic dyad (Y345 and E380 in CPS and Y348 and E382 in βLS is
replaced by residues E348 and D384 in AS-B (Figure 3-3B) (105). Residue D348 is
involved in binding the α-amine of aspartic acid (74) and mutagenesis of this residue
60
Figure 3-2. Proposed reaction mechanism for the synthetase reaction of ASNS. Asparagine is activated to form the βAspAMP intermediate and subsequently attacked by ammonia to form asparagine and AMP via a tetrahedral intermediate.
61
Figure 3-3. AS-B, CPS, and βLS catalyze similar reactions and utilize conserved residues for chemistry. A) Reactions catalyzed by AS-B, βLS, and CPS B) Structural overlay of the conserved catalytic dyad in βLS (Y348 and E382) and CPS (Y345 and E380) with the substituted residues in AS-B (E348 and D348). AS-B (pdb 1CT9), βLS (pdb 1MBZ), and CPS (pdb 1Q19) are shown in yellow, blue, and green, respectively. Figure modified from (105). Image rendered in PyMOL (73).
A
B
62
resulted in loss of all synthetase activity. However, E348 may act as the general base
necessary for asparagine formation and thus represent a critical divergence in the
structure of asparagine synthesizing enzymes and how their chemistry is altered to
perform intermolecular attack with ammonia.
This chapter presents a detailed mechanistic study of this conserved glutamate
residue (E348) of the glutamine-dependent asparagine synthetase from E. coli (AS-B).
Substitution of this glutamate residue to alanine, aspartate, and glutamine probed the
functional role of this conserved residue. Through the use of steady-state kinetics and
18O-isotope labeling studies, the functional role of this conserved residue was examined
in the context of the reaction mechanism.
Results
Cloning of asnB to Contain a C-terminal Poly-histidine Tag
Previous studies (77) involving E348D and E348A substituted AS-B proteins
resulted in conflicting and unreliable results that indicated the presence of a
contaminant in the enzyme stock due to the purification procedure. Therefore, a poly-
histidine tag for purification by immobilized metal-ion affinity chromatography (IMAC)
was added to the protein construct. The asnB gene was previously cloned into the
pET-21c (+) vector using the Nde1 restriction site. However, the pET-21c (+) vector
contains an optional C-terminal poly-histidine tag and removal of the plasmid DNA
fragment between the 3’ end of the asnB gene and the vector’s poly-histidine tag
resulted in a gene that encodes for a C-terminal poly-histidine tagged AS-B protein
(Figure 3-4A). A thrombin site was also engineered between the asnB gene and the
poly-histidine tag for removal of the tag, if desired. Upon re-construction of the vector,
the HindIII restriction site was destroyed, which allowed for screening of the desired
63
Figure 3-4. Construction of pET-21 c (+) vector to contain a poly-histidine tag. A) Cloning strategy for placing the optional C-terminal poly-histidine tag directly after asnB. (B) 1% DNA agarose gel stained with ethidium bromide of pET-21c (+) vector containing tagged and untagged asnB. Lane 1 is the 1 kb DNA ladder. Lanes 2-4 are the vector containing un-tagged asnB uncut, cut with Nde1, and cut with HindIII, respectively. Lanes 5-7 are the vector containing tagged asnB uncut, cut with Nde1, and cut with HindIII, respectively. Note that Nde1 cuts the vector twice due to an Nde1 site within the asnB gene.
A B
64
clone by restriction digest analysis (Figure 3-4B). The vector containing the untagged
asnB is linearized by both Nde1 and HindIII restriction enzymes (lanes 3 and 4),
whereas the vector with the poly-histidine tag in frame with asnB cannot be cut with
HindIII. The final clone was isolated and fully sequenced to confirm the addition of the
thrombin site and C-terminal poly-histidine tag.
Expression and Purification His6-tagged AS-B and E348 Mutants
The pET-21c (+) expression vector places asnB under control of the T7lac
promoter (106) and when established in a DE3 lysogen, such as BL21(DE3) E. coli
cells, is inducible by IPTG (107). Upon addition of IPTG, T7 RNA polymerase is
transcribed by the E. coli RNA polymerase, which then readily transcribes the asnB
gene, ultimately resulting in overexpression of the target protein. The cells are then
collected and lysed for purification of the soluble protein. The addition of a C-terminal
poly-histidine tagged greatly aided in the purification procedure, resulting in pure protein
using a Ni-NTA affinity column (Figure 3-5). Although some protein was lost in the flow
through and wash fractions, approximately 20 mg of purified enzyme per liter of cell
culture was obtained. A silver stained SDS-PAGE gel indicated that no contaminating
proteins were detected in the purified His6-tagged AS-B and E348 mutants, whereas a
large amount of contaminating proteins are evident when no purification tag was used
(Figure 3-6).
Characterization of His6-tagged AS-B
His6-tagged AS-B was assayed for steady-state kinetic parameters to ensure the
addition of a C-terminal tag did not affect enzyme catalysis. It was previously reported
that placing a C-terminal tag on human asparagine synthetase displayed reproducible
steady-state kinetic parameters (43). His6-tagged AS-B demonstrated reproducible
65
Figure 3-5. Purification of His6-tagged AS-B using IMAC. Lane 1: Protein molecular weight marker, lane 2: whole cell fraction 3 hours post induction, lane 3: lysate, lane 4: cleared lysate, lane 5: IMAC column flow though, lane 6: wash fraction, lane 7: pooled elution fractions. Gel stained with Commassie Brillant blue. Details of the purification procedures can be found in materials and methods. The molecular weight of His6-tagged AS-B is 64 kDa
66
Figure 3-6. Silver stained SDS-PAGE gel of untagged and His6-tagged AS-B and E348 mutants. Lane 1: Protein molecular weight marker, lane 2: untagged AS-B, lane 3: His6-tagged AS-B, lane 4: His6-tagged E348D, lane 5: His6-tagged E348A, lane 6: His6-tagged E348Q. Approximately 2 µg of each protein was loaded into each lane.
67
kinetic parameters for both the ammonia and glutamine-dependent activities (Table 3-1)
as well as the glutaminase activity (Table 3-2). Overall, the values for KM (app) are in
agreement with the previously reported kinetic parameters for un-tagged AS-B (47,
108). For instance, the previously reported values of KM (app) for ATP and Asp were
0.26 mM and 0.85 mM, respectively, for glutamine-dependent synthetase activity as
opposed to the newly reported values of 0.10 mM and 0.58 mM. The synthetase
activity, kcat, is consistently 2-fold less than previously reported numbers. This reduction
in kcat is likely due to removal of a contaminating enzyme that was overestimating the
concentration of pyrophosphate produced in the reaction. However, all catalytic
efficiencies, measured as kcat/ KM, are similar to those previously reported (47, 108).
Based on these kinetic results, placing a C-terminal poly-histidine tag on AS-B does not
significantly alter enzyme catalysis.
Table 3-1. Steady-state kinetic parameters for His6-tagged AS-B determined at pH 8.0 KM (app) (mM) kcat (s-1) kcat/ KM (M-1 s-1) Ammonia-dependent synthetase ATP 0.11 ± 0.03 0.96 ± 0.02 8700 Aspartic Acid 1.2 ± 0.1 (0.53)a 0.75 ± 0.03 (1.09)a 630 (800)a
Glutamine-dependent synthetase ATP 0.10 ± 0.01 (0.26)b 0.90 ± 0.01 (2.18)b 9000 (8384)b
Aspartic Acid 0.58 ± 0.04 (0.85)b 0.67 ± 0.02 (1.56)b 1200 (1835) b
a Values in parentheses are the previous values of kinetic constants at pH 8.0 for the ammonia-dependent synthetase activity of AS-B reported in (108) and values of kcat have been corrected for the overestimation of enzyme concentration by a factor a 2.73 (109). b Values in parentheses are the previous values of the kinetic constants as for AS-B reported in (47). Glutaminase Activity of AS-B and E348 Mutants
One consequence of site-directed mutagenesis studies is the possibility of gross
structural damage to the enzyme caused by the amino acid substitution. AS-B is
68
comprised of two distinct active sites that catalyze distinct reactions. Therefore, if a
point mutation is made in the synthetase domain, the structural integrity of the whole
enzyme can be assessed by monitoring the glutaminase activity of the mutant enzyme.
If glutaminase activity is unaffected, it is assumed that the enzyme is correctly folded.
Although, this assumes that correct folding of one domain ensures the correct folding of
the second domain.
All substituted proteins retained glutaminase activity similar to the wild type
(Table 3-2) indicating that the mutation does not cause gross structural damage to the
enzyme. Although ATP is not required for glutaminase activity, it was previously
reported that glutaminase activity is stimulated in the presence of 5 mM ATP (110).
When 5 mM ATP was added to the reaction, the specificity constant, kcat/ Km, was
stimulated 3-fold for wild type AS-B, in accordance with previous results (110). E348D
showed a 6-fold increase in glutaminase activity in the presence of ATP, whereas
E348A and E348Q showed only minimal stimulation of glutaminase activity in the
presence of ATP. This suggests that E348 may be important for coordination of the two
active sites and removal of the negatively charged carboxylate group affects
communication between the two active sites.
Table 3-2. Kinetic constants for the glutaminase activity of His6-tagged AS-B and E348 mutants at pH 8.0 with or without added ATP.
ATP absent 5.0 mM ATP present Km kcat kcat/Km Km kcat kcat/Km mM s-1 M-1 s-1 mM s-1 M-1 s-1
Wild typea 5.2 ± 1.4 6.2 ± 0.2 1200 1.7 ± 0.5 6.6 ± 0.1 3900
E348D 2.7 ± 0.4 4.09 ± 0.09 1500 1.1 ± 0.2 10.02 ± 0.07 9100 E348A 5.8 ± 0.8 6.37 ± 0.04 1100 3.5 ± 0.7 5.8 ± 0.2 1700 E348Q 5.0 ± 0.9 3.8 ± 0.2 760 4.0 ± 0.3 4.45 ± 0.07 1100
a Previously reported values for glutaminase activity of AS-B were reported in (47) as 1.67 mM, 3.38 s-1 and 2020 M-1s-1 in the absence of ATP and 1.30 mM, 5.91 s-1, and 4540 M-1s-1 for Km, kcat, and kcat/Km, respectively.
69
Asparagine,Pyrophosphate, and Glutamate Production
Pyrophosphate (PPi) and asparagine are formed in a 1:1 ratio for His6-tagged
AS-B in the ammonia-dependent (Table 3-3) and glutamine-dependent reactions (data
not shown) in accordance with previous results (111). E348D also forms PPi to
asparagine in a 1:1 ratio, although at approximately half the rate of wild type. E348A
and E348Q produced no detectable level of asparagine and retained very little ability to
produce PPi (less than 10% of wild type activity), even when the concentration of
aspartic acid was over 100 times Km.
Table 3-3. Product ratios for the ammonia and glutamine-dependent synthetase activities of His6-tagged AS-B and E348 mutants at pH 8.0 measured under saturating substrate conditionsa.
Ammonia-dependent synthetase Glutamine-dependent synthetase Asn PPi Asn: PPi Asn Glu Glu: Asn
µmol min-1 mg-1 µmol min-1 mg-1 Wild type 0.63 ± 0.03 0.59 ± 0.05 1:1± 0.1 0.64 ± 0.04 4.6 ± 0.2 7.2: 1 ± 0.5 E348D 0.328 ± 0.007 0.33 ± 0.06 1:1 ± 0.2 0.36 ± 0.04 6.5 ± 0.7 18: 1 ± 3 E348A no Asn 0.04 ± 0.01 --- no Asn 2.8 ± 0.3 --- E348Q no Asn 0.07 ± 0.01 --- no Asn 4.1 ± 0.4 ---
aSaturating conditions were 10 mM Asp, 5 mM ATP, 10 mM MgCl2 and either 100 mM NH4Cl or 20 mM Gln.
Production of PPi in the absence of aspartate was approximately 10% of activity
in the presence of aspartate for the wild type enzyme (Figure 3-7), confirming that the
enzyme catalyzes ATP hydrolysis in the absence of aspartate. For E348A and E348Q,
the activity in the presence and absence of aspartate was identical. Interestingly for
E348D, the level of ATP hydrolysis in the absence of aspartate exceeds 50% of the
activity in the presence of aspartate for both the glutamine and ammonia-dependent
reactions. However when aspartate is present, futile ATP hydrolysis must cease in this
mutant because only one molecule of PPi is produced for every one molecule of
asparagine produced (Table 3-3). Although this is an interesting observation, it does
70
Figure 3-7. Production of PPi in the presence and absence of aspartate for AS-B and E348 mutants. A) Ammonia dependent activity. B) Glutamine-dependent activity. Error bars represent the standard deviation of triplicate measurements.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
WT WT no Asp
E348D E348D no Asp
E348A E348A no Asp
E348Q E348Q no Asp
Spe
cific
Act
ivity
(µ
mol
PP
i/min
/mg
E)
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
WT WT no Asp
E348D E348D no Asp
E348A E348A no Asp
E348Q E348Q no Asp
Spe
cific
Act
ivity
(µ
mol
PP
i/min
/mg
E)
B
71
appear to affect the enzyme when all substrates are present. The amount of PPi
produced in the absence of added enzyme was subtracted from all activities.
His6-tagged AS-B produces 7 molecules of glutamate for each molecule of
asparagine produced (Table 3-4). Previous work on AS-B found a Glu:Asn ratio of 1.8:1
for high concentrations of glutamine (46, 47). We suspect that the C-terminal tag may
be affecting this ratio. However, all mutants also contain a C-terminal poly-histidine tag
so a direct comparison of properties is possible. E348D further uncouples the Glu:Asn
ratio to 18:1; a result of slightly increased glutamate production and decreased
production of asparagine. This is highly inefficient as 17 molecules of glutamine (and
ammonia) are wasted for the production of one molecule of asparagine. E348Q
produces glutamate at the same level as wild type, whereas E348A produces glutamate
at approximately 60% of wild type. However, neither E348A nor E348Q produces any
detectable levels of asparagine. Therefore, any ammonia (measured by Glu
production) produced by this mutant is wasted, as no asparagine can be formed. These
results suggest that the formation of the intermediate is slowed in the E348D mutant
and impossible for the E348A and E348Q mutants. As a control, the ratio of PPi to
asparagine was determined to be 1:1 for His6-tagged AS-B and E348D in the glutamine-
dependent reaction.
Kinetic Parameters for E348D mutant
Steady-state kinetic parameters for the E348D mutant are shown below in Table
3-4. Most striking is the 5-fold reduction of the aspartate KM (app) for both ammonia
and glutamine-dependent synthetase activity when compared to the His6-tagged wild
type AS-B. In addition, there is a reduction of the KM (app) for ATP for both glutamine
and ammonia-dependent activities, an effect that is more pronounced in the glutamine-
72
dependent reaction. In all cases, the kcat was approximately one-half of the wild type, in
agreement with the measurements of asparagine and PPi production under saturating
conditions. The lowering of KM (app) and lowering of kcat causes an overall increase in
kcat/ KM, an effect that is most pronounced for the glutamine-dependent reaction when
the concentration of ATP is varied. However, the greatest overall change in kcat/ KM is a
4-fold difference, which corresponds to approximately 3 kcal/mol in energy (112) and is
not an overly significant enhancement in the rate. Kinetic parameters were not
determined for E348A and E348Q as the production of PPi at low concentrations is
below the linear range of the assay.
Table 3-4. Kinetic constants for the ammonia and glutamine-dependent synthetase activity of His6-tagged AS-B and E348D determined at pH 8.0.
ATP Aspartic Acid Km kcat kcat/Km Km kcat kcat/Km mM s-1 M-1 s-1 mM s-1 M-1 s-1
Ammonia-dependent synthetase
Wild type 0.11 ± 0.03 0.96 ± 0.02 8700 1.2 ± 0.1 0.75 ± 0.03 630 E348D 0.03 ± 0.01 0.43 ± 0.03 14000 0.23 ± 0.07 0.30 ± 0.02 1304
Glutamine-dependent synthetase Wild type 0.10 ± 0.01 0.90 ± 0.01 9000 0.58 ± 0.04 0.67 ± 0.02 1200
E348D 0.013 ± 0.004 0.51 ± 0.02 39000 0.13 ± 0.01 0.451 ± 0.007 3500
18O transfer experiments 18O transfer experiments can be used to verify the formation of acyl-adenylated
intermediates by phosphorous NMR. When an 18O-labeled substrate (such as aspartic
acid) is used and an acyl-adenylated intermediate is formed, the 18O label is transferred
from the substrate to AMP upon breakdown of the intermediate (Figure 3-8). 31P NMR
is used to detect this transfer as a phosphorous bonded to 18O has a higher chemical
shift (0.02 ppm) than a phosphorous bonded to 16O (113). In 1998, Boehlein et al. used
18O-labeled aspartic acid to confirm the formation of the βAspAMP intermediate in the
73
Figure 3-8. 18O transfer reaction using 18O-labeled aspartic acid. Upon formation of the β-aspartyl AMP intermediate the 18O-label is transferred to AMP.
Figure 3-9. 31P NMR spectrum (300 MHz) of the reaction mixture obtained with His6-tagged AS-B and 18O-labeled aspartate acid. Peaks are referenced to the β-phosphorous of ATP. The peaks for 18O and 16O labeled AMP are separated by 0.02 ppm (inset).
18O
16O
AMP
74
AS-B reaction via 31P-NMR (46). This technique was used to characterize His6-tagged
AS-B and the E348 mutants on their ability to form the βAspAMP intermediate.
Incubation of His6-tagged AS-B with 18O-labeled aspartic acid, ATP, and ammonia
produced a spectrum that consisted of 10 peaks (Figure 3-9). Seven of the peaks can
be attributed to unreacted ATP (using β-P of ATP as reference peak): a triplet for the β-
P at 0.00 ppm, a doublet for the α-P at 10.14 ppm, and a doublet for the γ-P at 15.50
ppm. Two peaks, separated by 0.02 ppm, were observed for AMP, which confirms the
formation of the intermediate (Figure 3-9 inset) (113-115). The remaining peak is for
PPi , a singlet at 15.11 ppm,(115) . Identification of the 18O labeled AMP peak was
confirmed by the addition of 16O-AMP. When E348D was incubated with 18O-labeled
aspartic acid, ATP, and ammonia, the same 10 peaks were produced (Figure 3-10). In
addition, two peaks, separated by 0.02 ppm, were observed for the AMP peak,
indicating the formation of the intermediate in this mutant. The relative levels of AMP
and PPi are decreased, in accordance with the reduced synthetase activity of this
mutant (Figure 3-12). In contrast, the spectrum for E348A (Figure 3-11) consisted of
only unreacted ATP indicating that no detectable levels of AMP or PPi were produced in
this reaction. Although this result, along with kinetic studies, suggests that this mutant
cannot for the βAspAMP intermediate, positional isotope exchange was used in an
effort to verify that E348A cannot for the intermediate.
Positional Isotope Exchange
Positional isotope exchange (PIX) was first used as a mechanistic tool to
investigate the reaction catalyzed by glutamine synthetase (116) and has since been
used extensively as a tool to understand mechanisms for a variety of enzyme-catalyzed
reactions, most notably those that utilize ATP as a substrate (117-120). PIX is used to
75
Figure 3-10. 31PNMR spectrum (300 MHz) of the reaction mixture obtained from 18O-labeled aspartate and E348D mutant. Peaks are referenced to β-phosphorous of ATP. The peaks for 18O and 16O-labeled AMP are separated by 0.02 ppm (inset).
16O
18O
AMP
76
Figure 3-11. 31P NMR spectrum (300 MHz) of reaction mixture obtained from E348A mutant. No detectable levels of AMP or PPi was produced in the reaction.
77
Figure 3-12. Comparison of the relative amounts of each 31P containing compound
detected in wild type, E348D, and E348A reactions. The β-P of ATP was the smallest peak detected and set as a value of 1.
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
β-P ATP γ-P ATP α-P ATP PPi AMP
Rel
ativ
e am
ount
31P nuclei
Wild- type
E348D
E348A
78
study a reaction in which one of the functional groups within a substrate becomes
torsionally equivalent upon formation of an intermediate; thus, it is ideally suited for
reactions in which phosphate or PPi is formed during the reaction. The use of
isotopically labeled ATP and the coupling of this technique to 31P NMR allows for easy
detection of the PIX (114) due to the change in chemical shift when an 18O is bonded to
the phosphorous of ATP (113).
The two possible PIX reactions catalyzed by AS-B are detailed in Figure 3-13.
Incubation of AS-B in the presence of [β,γ-18O6]-ATP and aspartic acid (in the absence
of a nitrogen source), results in formation of the βAspAMP intermediate and PPi (46).
Upon formation of PPi, the 18O labels on this molecule scramble either by rotation
around the original β-phosphorous or by flipping within the active site. If the reaction is
reversible and rotation occurs, upon reformation of ATP, the 18O label has a 67%
chance of being incorporated into the α,β-bridging oxygen and lost from one of the
non-bridging β oxygens. If PPi can flip within the active site or dissociate from the active
site, the 18O-label will again be transferred to the α,β-bridging oxygen but a 16O will be
found in the γ position. If both rotation and flipping are possible, a mixture of the two
results will be obtained. However, it is possible that the rotation of oxygen around the
PPi is restricted, or formation of the intermediate is not fully reversible. In either of these
cases, no PIX will be observed.
No change was observed in the α-P peak of ATP when [β,γ-18O6]-ATP was
incubated for 3.5 hours with aspartic acid and either His6-tagged AS-B, E348A, or
E348D in the absence of a nitrogen source (Figure 3-14A). Furthermore, no change
was detected upon the addition of His6-tagged AS-B, E348A, or E348D in the relative
79
Figure 3-13. Two possible PIX reactions catalyzed by AS-B.
80
Figure 3-14. No PIX was observed for Wild-type, E348A, or E348D after 3.5 hours.
A) 31P NMR spectra of the α-P of ATP. B) 31P NMR spectra of the γ- P of ATP.
A
B
81
size of the 18O or 16O peak for the γ-P peak of ATP (Figure 3-14B). Taken together, this
suggests that no PIX occurred for either His6-tagged AS-B, E348A or E348D.
Importantly, a control experiment confirmed that the addition of EDTA quenched the
reaction by measuring the peak area of Asn by HPLC following the standard quench
(4% TCA) versus the peak area after quenching with EDTA. The peak areas were
found to be 960 ± 90 and 930 ± 6 for the TCA and EDTA quench, respectively.
Discussion
Characterization of His6-AS-B
Previous work in our lab involving this residue gave conflicting results due to the
presence of a contaminant in the purified enzyme stock that became evident during the
slow turnover of the alanine mutant. The addition of a C-terminal His6-tag removed this
contaminant while retaining similar kinetic constants to those in the literature (46, 121).
Surprisingly, AS-B will hydrolyze ATP to AMP and PPi in the absence of aspartic acid;
however, because the Asn:PPi ratio is 1:1, this hydrolysis must cease when aspartic
acid is present. Further confirmation of the purity of the enzyme was determined from
the 31P NMR spectrum. For the first time, the products of the reaction, AMP and PPi
were detected using 31P NMR for both wild type and E348D enzymes (Figures 3-9 and
3-10) confirming the removal of the pyrophosphatase contaminant (46). Previous work
involving AS-B resulted in 31P NMR spectra with signals for ADP, further indicating
contamination in the enzyme stock, which complicated interpretation of kinetic data (77).
The 31P NMR spectra collected using the His6-tagged enzymes contain peaks for only
the substrates and products of the reaction, indicating the enzyme purification is free of
interfering contaminants.
82
Previous studies on AS-B found that the production of glutamate and asparagine
was not strictly coordinated, resulting in glutamine hydrolysis without the production of
asparagine. When the concentration of glutamine is high, the glutamate to asparagine
ratio was reported as 1.8:1 for AS-B (47). This uncoupling of activities is in contrast to
most other class II amidotransferases, such as IGPS (122) and CPS (123, 124), where
the glutaminase and synthetase activities are well coordinated. The addition of a
C-terminal His6-tag further uncoupled these activities to produce 7 molecules of
glutamate per molecule of asparagine. Unfortunately, the crystal structure of AS-B (99)
is missing the last 40 amino acid residues and it is therefore difficult to imagine where
the C-terminal tag is located with respect to the synthetase site. Attempts to remove the
tag were unsuccessful. However, because all kinetic constants and product ratios are
compared to His6-tagged AS-B, a direct comparison is possible. It is interesting to note
that this further uncoupling of activities was not seen when a C-terminal tag was placed
on hASNS (25) and represents another slight difference between the two enzymes.
Steady-State Kinetic Assays with E348 mutants
Glutaminase activity is stimulated 3-fold in the wild type enzyme upon the
addition of 5 mM ATP, in accordance with previous results (121). However, this effect is
more pronounced in the E348D mutant (Table 3-2). The 6-fold increase in the
glutaminase activity upon the addition of 5 mM ATP in E348D suggests that
mutagenesis of this residue changes the coordination between the two active sites.
E348 is the only charged residue at the base of the intramolecular tunnel and may act
as a “gatekeeper” for access to the intermediate (Figure 3-15). When ATP is present,
glutaminase activity is switched on (possibly by a conformational change) and more
glutamate (and hence ammonia) is produced. In the case of E348A and E348Q, the
83
Figure 3-15. E348 is the only charged residue at the base of the intramolecular tunnel. Glutaminase and synthetase domain are shown as ribbons in blue and cyan, respectively. AMP and glutamine are rendered as spheres and selected residues (R30, A399 V401, M329, L232, and E348) are shown as sticks. Color scheme: C- green, N- blue, O- red, S- yellow, P- orange. Image rendered in PyMOL (73).
84
enzyme does not stimulate glutaminase activity when ATP is present in the reaction.
Therefore, when the carboxylate moiety is removed, coordination between the active
sites is lost. E348 is the first residue indentified within the synthetase domain to be
involved in coordination of the active sites; whereas previous studies on residues in the
glutaminase domain found that Arg 30 was involved in coordination of the
activesites (121). Although the mechanism by which these residues act to coordinate
the two active sites is unclear, it is clear that they are both key players.
The E348D mutant works at approximately half the rate of the wild type enzyme,
although it does not uncouple the Asn:PPi ratio for either the glutamine or
ammonia-dependent reactions. However, it does uncouple the glutamate to asparagine
ratio to 18:1 by increasing the production of glutamate while slowing the asparagine
production. This enzyme wastes 17 molecules of ammonia (measured by production of
glutamate) for each molecule of asparagine formed. This suggest that formation of the
βAspAMP intermediate is slowed in the E348D mutant and the changes in Asn:Glu can
be understood in the context of the proposed kinetic mechanism of AS-B (47). When
formation of intermediate becomes more difficult (i.e., k3 and k12 are decreased), the
mutant favors the pathway that forms the E.ATP.Asp.Glu complex (Figure 3-16).
Because the rate of glutamine hydrolysis (k8, k9, and k10) is unchanged (or possibly
even increased in this mutant) more glutamine is hydrolyzed prior to formation of the
intermediate. This results in glutamate production without the production of asparagine
and a further uncoupling of the Asn:Glu ratio. In the case of E348A and E348Q, the
intermediate cannot be formed and thus no asparagine is formed. Therefore, glutamate
production is governed by the rates of k3, k9, and k12; all of which result in glutamate
85
Figure 3-16. Proposed kinetic model for glutamine dependent asparagine synthetase. Reprinted with permission from
Archive of Biochemistry and Biophysics vol 413. Tesson, A.R, Soper, T.S., Ciusteau, M., Richards, N.G.J. Pages 23-31. Copyright 2003.
86
production without production of asparagine. This argues against the role of this
residue as a general base in the reaction; although it is possible that E348 plays a role
in the formation of the intermediate and also acts as a general base in the reaction.
The role of this residue in the formation of the intermediate is not clear within the
structural context of the enzyme. The residue may play a role in positioning aspartic
acid and ATP within the active site or stabilizing the pentacoordinate intermediate that
leads to βAspAMP formation. Furthermore, the residue could coordinate to the second
Mg2+ ion required for synthetase activity (Boehlein, unpublished results); however, a
structural overlay of βLS with AS-B found that this residue was at located least 3.9 Å
away from the Mg2+ ion. It should be noted that only one crystal structure of AS-B is
currently available and different conformations of the enzyme may show different
conformation of E348 which will help to shed light onto its role in βAspAMP formation.
18O Isotopic Labeling Studies
Although kinetic studies suggest that E348A cannot form the intermediate, a PIX
experiment was performed in an effort to prove that removal of the carboxylate group
prevented the enzyme from forming the βAspAMP intermediate. However, because no
PIX was observed for the wild type, E348D, or E348A, it is not possible, using the
methods described here, to confirm formation of the intermediate without the formation
of products in AS-B.
However, the lack of observable PIX for AS-B is an interesting observation, as
most enzymes that catalyze acyl-adenylation undergo PIX. This result stands in
contrast to 18O transfer studies using 18O-labeled aspartic acid, which confirmed the
formation of the acyl-adenylate intermediate for both His6-tagged AS-B and E348D.
The observation of PIX in an enzymatic reaction is not possible if (1) all substrates must
87
be present prior to formation of the intermediate, (2) the phosphate group cannot rotate
on the enzyme, or (3) formation of the intermediate is not fully reversible (114, 125).
The first caveat can be eliminated because it has been demonstrated for AS-B that
incubation of ATP and aspartic acid in the absence of a nitrogen source exhibited burst
kinetics when either the production of AMP or PPi was monitored (46, 83). However, it
is possible that PIX was not observed due to either reason 2 or 3.
Asparagine synthetase may restrict rotation of the oxygen atoms around the
phosphate group by coordination of the oxygen atoms of PPi to a Mg2+ ion. In the
structurally related agininosuccinate synthetase, no PIX was observed even though this
enzyme does form an adenylated intermediate in the absence of the nucleophile (126,
127). It was concluded that rotation of the phosphate group must be restricted in this
enzyme which prevented the observation of PIX. Argininosuccinate synthetase and the
C-terminal domain of AS-B belong to the ATP pyrophosphatases family of enzymes (58,
64, 66). Other members of this family include GMP synthetase (65), ATP sulfurylase
(67), β-lactam synthetase (68, 69), carbapenam synthetase(70), 4-thiouridine
synthetase (71), and NAD+ synthetase (72). They all contain a signature SGGXDS
sequence, referred to as the P loop, that is seen in enzymes domains that catalyze
hydrolysis of ATP to AMP and PPi (64). In a structural overlay of AS-B, βLS, and
argininosuccinate synthetase, the P loops superimpose directly on top of each other
(Figure 3-17). In addition, the PPi is coordinated to at least one Mg2+ ion, which likely
restricts rotation of the oxygen atoms around the phosphorous. Furthermore in this
structural motif, PPi is bound deep within the active site and likely cannot dissociate
from the active site or regain access to the active site. Therefore, it is possible that this
88
structural motif may prevent the observation of PIX by restricting bond rotation and
preventing PPi from dissociating from the active site. To date, GMP synthetase is the
only member of the P loop family of enzymes reported to undergo PIX, although the
experiment has not been reported for a number of the enzymes (128).
It is also possible that PIX was not observed because formation of the βAspAMP
intermediate is not fully reversible in AS-B. Analogous to the PIX results and in contrast
to most other acyl-adenylating enzymes, no conditions were found in which AS-B
exhibited ATP/PPi exchange (46). This was proposed to result from a large forward
commitment to asparagine formation that made formation of the intermediate
functionally irreversible. In the evolutionarily related βLS and CPS, ATP/PPi exchange
was only observed when the pH was lowered or when mutants critical to the second half
reaction, β-lactam formation, were studied (102, 105). This, presumably, lowered the
commitment of β-lactam formation thus allowing reversible formation of the acyl-
adenylate intermediate. Unfortunately, no PIX experiment has been reported to date on
these enzymes.
Irreversible formation of the intermediate is arguably necessary in AS-B because,
in contrast to other glutamine-dependent amidotransferases, the glutaminase and
synthetase activities of AS-B are not well coordinated. Thus, if formation of the
intermediate is not coupled to glutamine hydrolysis, the enzyme must tightly bind and
protect the intermediate to ensure it is present in the active site when ammonia arrives.
Previous studies found that the hydrolysis of the intermediate is approximately 1500
times slower than the rate in the presence of a nitrogen source, suggesting that the
intermediate is protected by the residues in the active site (46). Therefore, once the
89
Figure 3-17. Structural overlay of the P loop of AS-B, argininosuccinate synthetase (pdb1KP3) and βLS (pdb 1MBZ) shown in green, yellow, and blue respectively. Mg2+ ion is shown as a sphere in magenta. E348 and D238 residues of AS-B and the βAspAMP intermediate are shown in stick representation. Color scheme: C- green, N- blue, O- red, P- orange, Mg- magenta. Image rendered in PyMOL (73).
90
intermediate is formed, the enzyme locks down so as to prevent either re-attack by PPi
or hydrolysis of the intermediate.
Conclusions
Based on 18O labeling and PIX experiments, the formation of the intermediate in
E348 cannot be fully excluded. However, with no means by which to verify acyl-
adenylation without formation of asparagine for the wild type enzyme (i.e. the enzyme
does not PIX), it is also impossible to prove that E348A does form the intermediate.
Based on the currently proposed kinetic model for AS-B and the kinetic data of E348D,
E348Q, and E348A, we conclude that this residue is involved in formation of the
βAspAMP intermediate, a finding that is in contrast to the proposed role of this residue.
We also find that E348 is involved in the coordination of the glutaminase and synthetase
domains and removal of the carboxylate group prevents coordination of these two
domains.
Experimental Section
Materials
Unless otherwise stated, all chemicals were purchased from Sigma (St. Louis,
MO) or Fischer Scientific (Pittsburgh, PA) and were of the highest purity available. L-
glutamine was recrystallized prior to use as previously described (109). Protein
concentration was determined using the Bradford Assay (Pierce, Rockford, IL) based on
a standard curve using bovine serum albumin (104) and corrected as previously
described (47). PCR primers were obtained from Integrated DNA technologies, Inc.
(Coraville, IA) and DNA sequencing reactions were performed by the DNA sequencing
core of the Interdisciplinary Center for Biotechnology Research at the University of
Florida, Gainesville, FL.
91
Cloning of His6-tagged AS-B and E348 Mutants
The gene encoding asnB was cloned into pET-21c (+) vector to contain a
thrombin site followed by a C-terminal poly-histidine tag. The pET-21c (+) vector
containing asnB insert was used as a template and primers were designed to remove
the vector portion between the stop codon and the poly-histidine tag on pET 21c(+) as
well as introduce a thrombin cleavage site (see Appendix B for primer sequences).
Reactions consisted of 200 ng of each primer, 5 ng of template DNA, 200 µM
dNTPs, 1X Pfu turbo buffer, and 1 µL (2.5 U) of Pfu turbo DNA polymerase in a 50 µL
volume. Reactions were heated at 95 °C for 30 seconds, cooled to 55 °C for 30
seconds, and then heated at 68 °C for 7 minutes. This cycle was repeated 16 times
and the resulting reactions were purified using Wizard PCR preps DNA purification kit
(Promega, Madison, WI). Purified DNA was ligated at room temperature for 24 h using
T4 DNA ligase and transformed into JM109 E. coli cells. Successful transformants were
screened by the loss of HindIII restriction site and sequences verified. E348 mutants
were cloned using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) using the
pET-21c (+) vector containing asnB followed by a poly-histidine tag as the template and
primers containing the desired mutations.
Expression and Purification of His6-tagged AS-B and E348 Mutants
Expression of His6-tagged AS-B was performed as previously described for AS-B
(51). A single colony was grown overnight in 5 mL of SOB media supplemented with 10
mM MgCl2, and 100 µg/mL of ampicillin at 37 °C. A small portion (0.5 mL) of the
overnight culture was inoculated into 500 mL of M9 minimal media supplemented with
0.75% glucose and 100 µg/mL of ampicillin. The cells were grown at 37 °C with
vigorous shaking for approximately 4-5 hours until an OD600 between 0.3 and 0.5 was
92
reached. Cells were induced at 37 °C by the addition of 100 µM IPTG and harvested
after 3 hours by centrifugation at 2,000 x g for 20 min. Cellular pellets were stored
overnight at -20 °C until use in purification procedures.
For purification, the cellular pellet was resuspended in 50 mL of lysis buffer
(50 mM EPPS pH 8.0, 300 mM NaCl, 10 mM imidazole, 1% Triton X, 0.5 mM DTT) and
lysed by sonication. Cellular debris was collected by centrifugation at 10,000 x g for
20 min at 4 °C and the resulting supernatant was loaded onto a 3 mL Ni-NTA column
(Qiagen, Valencia, CA). The column was washed with 15 mL of wash buffer (50 mM
EPPS pH 8.0, 300 mM NaCl, 20 mM imidazole, and 0.5 mM DTT) before elution with
30 mL of elution buffer (50 mM EPPS pH 8.0, 300 mM NaCl, 250 mM imidazole, 0.5
mM DTT). All purification procedures were completed at 4 °C. The fractions were
analyzed by SDS-PAGE and those containing AS-B were pooled and dialyzed
exhaustively against 50 mM EPPS and 5 mM DTT. Glycerol was added to a final
concentration of 20% and aliquots stored at -80 °C.
Glutaminase Activity
Glutaminase activity was determined by incubating reactions containing enzyme
(1.5 µg) in the presence or absence of 5 mM ATP, 100 mM EPPS, pH 8.0, 100 mM
NaCl, 8 mM MgCl2, and 0.2-50 mM of L-glutamine in a 200 µL volume for 20 minutes at
37 °C before quenching TCA to a final concentration of 4%. This solution was added to
a solution containing 300 mM glycine -250 mM hydrazine buffer, pH 9.0, 1.5 mM NAD+,
and 1 mM ADP followed by the addition of 2.5 units of L-glutamic dehydrogenase
(Sigma G2626) in a total volume of 500 µL. Reactions were incubated at room
temperature and absorbance readings at 340 nm were taken after 30 minutes and
93
corrected for the absorbance at 340 nm before the addition of coupling enzyme. The
amount of glutamate produced was quantified by comparison to glutamate standards.
Pyrophosphate Production
Production of pyrophosphate (PPi) was monitored spectrophotometrically during
the AS-B reaction using a coupled enzyme assay (Sigma Technical Bulletin No.
BI-100). The reaction consisted of 100 mM EPPS pH 8.0, 5 mM ATP, 100 mM NH4Cl or
20 mM L-glutamine, 10 mM MgCl2, 20 mM aspartic acid, and 350 µL of PPi reagent in a
1 mL total volume. Reactions were initiated by the addition of 2-4 µg of enzyme and
monitored at 37 °C for 20 min. The amount of PPi produced was determined by
monitoring the change in absorbance at 340 nm. Kinetic constants were determined
using the same assay by varying the concentration of either ATP (0-3 mM) or L-Asp
(0-10 mM) while holding the other substrates at saturating conditions. Kinetic constants
were fit using KaleidaGraph software, version 3.5 (Synergy software, Reading, PA) and
errors represent the error in the fit.
Asparagine and Glutamate Production
Asparagine and glutamate production was determined using an HPLC based end-
point assay following methods previously described (47). Reactions containing enzyme
(2-4 µg) and 100 mM EPPS pH 8.0, 5 mM ATP, 100 mM NH4Cl or 20 mM L-glutamine,
10 mM MgCl2, and 10 mM aspartic acid in a 1 mL volume were incubated for 20
minutes at 37 °C before being quenched with glacial acetic acid (4%). Following
precipitation of the enzyme, the solution was neutralized with 10 M NaOH. A portion of
the reaction mixture (40 µL) was taken for derivatization in a total volume of 200 µL with
400 mM Na2CO3, pH 9, 20 µL DMSO, and 60 µL of 2,4 dinitrofluorobenzene (DNFB)
saturated in absolute ethanol. Caution: Use extreme care when handling solutions of
94
2,4 dinitrofluorobenzene. It is a potent allergen that will penetrate many types of
laboratory gloves (129). Derivatization reactions were incubated at 50 °C for 50
minutes before quenching with glacial acetic acid. Derivatized amino acids were
separated by reverse-phase HPLC using a Varian C18 Microsorb column (Varian, Palo
Alto, CA) using a step gradient of 40 mM formic acid, pH 3.6 and acetonitrile. The initial
concentration of acetonitrile was 14%. After 30 minutes the concentration of acetonitrile
was increased to 20% for an additional 10 minutes. Derivatized asparagine and
glutamate were detected at 365 nm and the amount of asparagine and glutamate was
quantified by comparison to asparagine and glutamate standards derivatized in the
same manner. Figure 3-18 shows a representative chromatogram of the separation
between asparagine, aspartic acid, glutamine, and glutamate.
Synthesis of 18O Aspartic Acid
Aspartic acid labeled with 18O at all positions was synthesized following the
previously published method (109). Briefly, 0.0597 g of L-aspartic acid was added to
700 µL of 95% H2O18. Concentrated HCl was added to pH ~1 then the mixture was
sealed and heated to 80 °C for 14 days. The reaction mixture was lyophilized and the
remaining aspartic acid was dissolved in water to a final concentration of 2.1 M and the
pH adjusted with 10 M NaOH to pH 8. The presence of the 18O label was confirmed by
mass spectrometric analysis via isocratic C18 HPLC/UV/(-)ESI-MSn (Mass Spectrometry
Facility, Chemistry Department, UF) using a ThermoFinnigan LCQ MS (Table 3-5) and
was found to be approximately 87% enriched.
18O transfer studies
Samples were prepared following methods previously described (109).
Reactions were prepared with 100 mM EPPS, pH 8.0, 10 mM ATP, 100 mM NH4Cl,
95
Table 3-5. Relative abundance of 18O4-Aspartic Acid based upon [M-H]-ions. Number 18O [M-H]- Peak Area Percent Total 0 132 0 0.0 1 134 23,279 0.2 2 136 1,1026,361 7.9 3 138 4,832,736 37.4 4 140 7,046,859 54.9
Figure 3-18. Representative HPLC chromatogram for the separation and quanitification of asparagine and glutamate. The retention time for asparagine and glutamate are approximately 20 min and 41.5 min, respectively.
96
20 mM MgCl2, 20 mM labeled or unlabeled aspartic acid and 200 µg of enzyme in a 1
mL volume. Reactions were incubated for 3 hours at 37 °C then quenched with TCA to
4% final concentration. Enzyme was precipitated by centrifugation and 700 µL of the
supernatant was transferred to a new tube containing 0.0287 g of EDTA, 0.045 g of
glycine, and 200 µL of D2O. The pH was adjusted to 9.5 with 10M NaOH and 800 µL
was transferred to an NMR tube for analysis. The NMR instrument used was a Mercury
300 with a 7T (300 MHz) magnet (NMR facility, Chemistry Department, University of
Florida, Gainesville, FL). Spectra were obtained using 500 scans with an acquisition
time of 4.0 s using the β-phosphorous of ATP as a reference.
PIX Experiments
[β,γ-18O6]-ATP was a generous gift from Dr. Frank Raushel of Texas A &M
University, College Station, TX. Reactions contained 5 mM [β,γ-18O6]-ATP,10 mM L-
Asp, 10 mM MgCl2, 100 mM EPPS, pH 8.0, and 3 µM AS-B in a total volume of 4 mL.
Reactions were incubated at 37 °C and 500 µL aliquots removed every 30 minutes for
3.5 hours. Aliquots were quenched by the addition of 125 µL of 1.0M EDTA and 125 µL
of D2O and transferred to an NMR tube for analysis. A control reaction confirmed that
the addition EDTA was sufficient to quench the reaction by removing the Mg2+ ions.
The NMR instrument used was a Mercury 300 with a 7T (300 MHz) magnet (NMR
facility, Chemistry Department, University of Florida) . All spectra were obtained using
3000 scans with an acquisition time of 4 s.
97
CHAPTER 4 CRYSTALLIZATION TRIALS OF GLUTAMINE-DEPENDENT ASPARAGINE
SYNTHETASE
Introduction
In 1999, the crystal structure of glutamine-dependent asparagine synthetase
from E. coli (AS-B) was solved in a ternary complex with glutamine and AMP to 2 Å
resolution (58). The crystal structure revealed that the enzyme is composed of two
distinct domains, the N-terminal glutaminase domain and C-terminal synthetase
domain. The active sites of these two domains are connected by a solvent-inaccessible
intramolecular tunnel responsible for the translocation of ammonia (58). The
glutaminase domain is well-resolved in the structure and has been well characterized by
site-directed mutagenesis and kinetic studies (45, 121, 130, 131). Unfortunately, the
synthetase domain is not as well-resolved in the structure as it is missing several loop
regions and the final 37 residues of the protein. A computational model that positioned
the βAspAMP intermediate within the synthetase active site (Ding,unpublished) has
been useful for understanding structure-function relationships and the development of
small molecule inhibitors. However, a better understanding of the enzyme on a
structural level will be gained by solving a new crystal structure of asparagine
synthetase.
Although the active sites of E. coli and human asparagine synthetase are fully
conserved, slight differences have been observed between the two homologs (132).
Furthermore, the goal of identifying small molecule inhibitors is to target human
asparagine synthetase for the clinical treatment of ALL. Therefore, we will pursue the
crystal structure of the human enzyme, an endeavor that is now possible due to the
availability of large quantities of recombinant human asparagine synthetase (43).
98
Obtaining a crystal suitable for diffraction is a large obstacle to overcome when
pursuing a crystal structure. Crystals form when the concentration of protein is brought
from a soluble state to a state of supersaturation. Supersaturation is achieved at a
balance between the concentration of protein and the concentration of additives that
destabilize the protein solubility, commonly referred to as precipitation agents (133).
Common precipitating reagents include hydrophilic polymers (i.e. PEG), salts,
detergents, and alcohols. Also other conditions, including pH and buffer composition,
affect the protein solubility. These reagents and conditions can be altered to find
conditions that favor supersaturation and crystal formation.
Several methods have been developed for obtaining crystals; the most common
being vapor diffusion by either the hanging drop or sitting drop method. In vapor
diffusion, a drop containing the protein sample and reservoir solution is suspended
above the reservoir solution containing the precipitating reagent. To reach equilibrium,
water diffuses from the drop into the reservoir (Figure 4-1A) (133). This causes an
increase in protein concentration and precipitating agent which can ultimately result in
supersaturation of the protein drop (Figure 4-1B). Once nucleation conditions are
reached (blue drop), crystals begin to form. Microcrystal formation, precipitation,
denaturation, or inclusion of the protein into the growing crystal decreases the protein
concentration to a level that is better suited for crystal growth (red drop) (134).
Conversely, if the conditions are unfavorable for the protein structure, it will quickly
precipitate out of solution. It is also possible for the protein to remain in an unsaturated
state which will never lead to crystal formation (green drop). In either of the latter two
cases, the protein concentration and/or solubility decreasing parameter must be altered.
99
Figure 4-1. Crystallization by vapor diffusion. A) Schematic diagram of sitting-drop vapor diffusion technique. B) Phase diagram of crystallization by vapor diffusion
A B
100
It is impossible to predict the exact conditions that promote crystallization for a
particular protein, and given the nearly infinite combinations of possible conditions
obtaining a crystal is a major bottleneck in obtaining a high-resolution crystal structure.
Commercially available crystallization kits are designed to analyze conditions that
promote crystallization, based on both systematic and sparse matrix analysis of the
conditions previously found to successfully yield crystals (135, 136). Once initial
conditions are found to promote crystallization, samples can then be systematically
optimized to obtain crystals suitable for further analysis.
Proteins, especially enzymes, are dynamic systems that undergo conformational
changes during the catalytic cycle. Therefore, one must determine the enzymatic form
that produces the best crystals. Asparagine synthetase is a two domain, dynamic
enzyme that likely undergoes conformational changes during the catalytic cycle. Our
strategy is to “lock” the enzyme into an active conformation by preparing both the singly
and doubly inhibited form of the enzyme. The glutamine analog, 6-diazo-5-oxo-L-
norleucine (DON), will be used as an inhibitor of the glutaminase domain. DON is an
irreversible, competitive inhibitor of glutamine that forms a covalent complex with the N-
terminal cysteine residue (Figure 4-2) (50, 137, 138). This covalent complex (EDON)
mimics the putative glutamyl thioester covalent intermediate formed during glutamine
hydrolysis (26). DON has been used successfully for the crystallization of other
glutamine-dependent amidotransferases such as GPATase (54), GFAT (139),
glutamate synthase (GltS)(140), and NAD+ synthetase(141). The N-adenylated
sulfoximine, a transition state analog, will be used as the synthetase domain inhibitor
because it exhibits tight binding inhibition (KI* 2.46 nM) with a half life of 7.4 hours. This
101
Figure 4-2. DON reacts with the Cys-1 residue of ASNS to form a covalent adduct.
102
compound is competitive with ATP and binds to the free form of the enzyme.
Furthermore, it will provide a “snapshot” of the enzymatic structure during catalysis
because it is a transition state analog for the attack of ammonia on the βAspAMP
intermediate (25).
Previous work in the Richards lab found that incubation of hASNS with 5.88 mM
DON at 22 °C for 20 minutes resulted in a 90% loss of glutaminase activity, wheras the
ammonia-dependent synthetase activity remained unaffected (Berry, unpublished)
(Figure 4-3). Treatment of the DON inhibited enzyme (EDON) with 16 µM of the N-
adenylated sulfoximine resulted in near complete loss of the ammonia-dependent
activity. The calculated KI* value for the N-adenylated sulfoximine of the EDON complex
was determined to be 2.9 nM (Berry, unpublished). This number is in close agreement
with the previously reported KI* of 2.46 nM for free hASNS(25); this result confirms that
the N-adenylated sulfoximine binds to the EDON complex and acts as a slow-onset tight
binding inhibitor.
Although a crystal structure of hASNS is highly desired, there are several
technical advantages to also pursuing a crystal structure of AS-B. First, large quantities
of AS-B are readily expressed in E. coli and easily purified using Ni affinity
chromatography. In addition, a large number of mutant constructs have been generated
for AS-B, which may be more amiable to crystallization. Specifically, in the solved
crystal structure of AS-B, the last 37 amino acid residues are not resolved leaving a
visible hole in the synthetase active site (Figure 4-4). These residues are likely
important for the binding of aspartic acid and may become ordered upon binding. We
hypothesize that because these residues are not visible in the crystal structure they are
103
Figure 4-3. Fraction of original glutaminase activity remaining after treatment of hASNS with 5.88 mM DON. Figure courtesy of Alexandria Berry.
0
0.2
0.4
0.6
0.8
1
0 5 10 15 20 25 30 35
Frac
tion
of G
luta
min
ase
Act
ivity
Rem
aini
ng a
fter
Incu
batio
n w
ith 5
.88
mM
DO
N
Incubation Time (min)
104
Figure 4-4. The solved crystal structure of AS-B (pdb 1CT9) is missing the final 37 residues of the protein. The last residues seen in the structure are highlighted in yellow. The glutaminase and synthetase domains are shown in gray and blue, respectively. Bound AMP and glutamine are shown as spheres. Image rendered in PyMOL(73).
105
disordered or in motion; therefore, removal of these residues may help to stabilize the
protein structure for crystal formation. Furthermore, by studying AS-B truncation
mutants, we hope to gain an understanding of the structural and/or functional roles of
these residues in the AS-B reaction.
This chapter will detail the preparation of hASNS for crystallization trials in both
the single and doubly inhibited forms as well as discuss preliminary crystallographic
trials. In addition, the crystallization trials, kinetic studies, and SAXS measurements of
AS-B truncation mutants will be discussed.
Results and Discussion
Expression and Purification of hASNS for Crystallography Trials
Prior to expression of hASNS in Sf9 cells, a high titer viral stock of the baculovirus
inoculum containing the hasns gene must be obtained. This ensures that healthy Sf9
cells are infected at the appropriate multiplicity of infection (MOI) for efficient expression
of the recombinant protein. A fresh baculovirus inoculum was prepared and determined
to have a TCID50/mL (142) value of 1.58 x 108 infectious particles/mL. This fresh
inoculum was used for expression of hASNS for crystallography trials.
It is common practice amongst crystallographers to use freshly prepared, never
frozen enzyme for all crystallization trials. However, it was discovered during these
enzyme preparations that purified hASNS will precipitate out of solution at
concentrations higher than approximately 0.5 mg/mL when stored on ice in 50 mM
EPPS buffer, pH 8.0 and 1 mM TCEP for extended periods of time. Therefore, all
purified samples of hASNS were diluted directly following purification and stored as
dilute solutions until the protein was concentrated prior to crystallization trials.
106
Inhibition of hASNS with DON
DON acts as an irreversible inhibitor of hASNS by forming a covalent complex
with the Cys-1 residue of the protein (138). The glutaminase activity and both ammonia
and glutamine-dependent activities of hASNS were determined after incubation with
15 mM DON at room temperature for 20 minutes. All measurements were collected
after removal of excess DON from the EDON complex by filtration. This served to
insured that the enzyme was covalently modified as well as remove excess DON found
to interfere with the coupling assays. The presence of DON significantly affects the
glutaminase activity, whereas ammonia-dependent synthetase activity is unaffected
(Figure 4-5). The glutamine-dependent activity of the EDON complex is ~20% of the
uninhibited enzyme, in accordance with glutaminase activity. This confirms that 15 mM
DON does inhibit glutaminase activity while leaving the ammonia-dependent synthetase
activity unaffected and represents a useful approach for the preparation of enzyme for
crystallography trials.
Inhibition of hASNS with AMP-CPP
α,β-Methyleneadenosine 5′ -triphosphate (AMP-CPP) is a non-hydrolyzable
analog for ATP, where a methylene group replaces the α,β bridging oxygen of ATP.
(Figure 4-6A). This compound is expected to serve as a competitive inhibitor of ATP for
enzymes that utilize ATP to form an acyl-AMP intermediate and PPi. It has been
successfully used in the crystallization of βLS (75), NAD+ synthetase (143), and
carbapenam synthetase(70), which have homologous synthetase domains to
asparagine synthetase. We investigated the ability of this compound to act as an
inhibitor of hASNS with hopes to use this commercially available compound in
crystallization trials. However, at concentrations up to 1 mM, AMP-CPP showed only a
107
Figure 4-5. Fraction of glutaminase, ammonia-dependent synthetase, and glutamine-dependent synthetase activity remaining after treatment of hASNS with 15 mM DON. Error bars represent the standard deviation of three individual measurements.
0
0.2
0.4
0.6
0.8
1
1.2
No DON 15 mM DON
Frac
tion
of a
ctiv
ity
Glutaminase
Ammonia-dependent synthetase
Glutamine-dependent synthetase
108
slight decrease in the ability of the enzyme to produce PPi (Figure 4-6B). Therefore,
this compound does not represent a viable compound to use for crystallization trials as
it does not tightly bind to the enzyme at the concentrations tested.
Crystallization Trials of hASNS
Different forms of the enzyme were prepared for numerous crystallization
screens to identify conditions suitable for crystallization of hASNS. An initial screen
using the JCSG plus suite (136) and the EDON/sulfoxmine complex found that an initial
concentration of 10 mg/mL was too high for crystallization screens; all wells contained
precipitated protein immediately following set-up. The concentration was diluted to
7 mg/mL and used for crystallization screens utilizing the high-throughput crystallization
facility at the EMBL in Hamburg, Germany (see Table 4-3 for chosen crystallographic
screens) (144).
In these trials, zero conditions were found that promoted crystallization. Few
wells contained clear protein drops and most drops contained fully precipitated protein
immediately following set-up. Due to the large number of drops containing precipitated
protein, it was determined that the concentration of protein was still too high. Therefore,
hASNS was treated with 15 mM DON only, diluted to 3.5 mg/mL, and subjected to
another set of crystallization trials. In these trials, a clear trend was found using the
Qiagen pH clear suite. As the pH of the reservoir solution was increased, the number of
clear drops increased, an effect that was most pronounced when a high concentration
of salt (up to 4M NaCl) was included in solution (Figure 4-7). This suggests that the
protein is more soluble at a higher pH with the addition of NaCl. These conditions can
109
Figure 4-6. AMP-CPP is not an inhibitor of hASNS. A) Chemical structure of AMP-CPP B) Production of PPi (µM) in the presence of 0.1 mM and 1 mM of AMP-CPP. Error bars represent the standard deviation of three individual measurements.
0123456789
0 mm AMP-CPP 0.1 mM AMP-CPP 1 mM AMP-CPP
µM p
rodu
ctio
n of
PP
i
A
B
110
Figure 4-7. Number of clear drops in comparison to the number of drops containing precipitated protein for the pH clear suite. A) Number of clear drops as a function of pH. B) Number of clear drops as a function of precipitating reagent. The number of total wells containing a particular pH or precipitating reagent was 16 and 24, respectively.
02468
1012141618
pH 4 pH 5 pH 6 pH 7 pH 8 pH 9
Nm
ber o
f dro
ps
ppt
clear
0
5
10
15
20
25
30
sodium chloride
PEG ammonium sulfate
MPD
Num
ber o
f dro
ps
ppt
clear
A
B
111
be used for future enzyme preparations which will stabilize the protein and allow for
higher protein concentrations to be achieved (133).
After 11 days, several wells in the Qiagen PACT suite demonstrated
microcrystal formation. Figure 4-8 illustrates the progression of the drop from initial set-
up to the appearance of micro-crystals. The four wells contained 20% PEG 3350 and
0.2 M of either sodium bromide, sodium sulfate, sodium/potassium tartrate, or
sodium/potassium phosphate. Unfortunately, optimization of these conditions did not
lead to crystal formation.
Characterization of His6-tagged AS-B Truncation Mutants
Given the lack of initial success in the crystallization trials of hASNS, His6-tagged
truncation mutants were prepared by removing the last 10, 20, 30, and 40 amino acid
residues of the His6-tagged AS-B protein (full length AS-B contains 553 residues).
SDS-PAGE analysis of the truncation mutants confirms the different size of each
truncation mutant; as more residues are removed, the protein migrates at a slightly
slower rate (Figure 4-9). Removal of such a large number of residues, however, could
compromise the overall structural integrity of the enzyme. Glutaminase activities of Δ10
and Δ20 are only slightly lower than wild type; whereas, Δ30 and Δ40 demonstrated
slightly increased glutaminase activity (Table 4-1). However, these changes are within
the range of wild type activity and it was concluded that removal of these residues does
not interfere with the proper folding of the enzyme.
Truncation mutants demonstrated low levels of PPi production and no detectable
levels of asparagine (Table 4-2), even at concentrations up to 100 mM of aspartic acid.
The low levels of PPi production can be attributed to ATP hydrolysis, as the level
112
Figure 4-8. Formation of microcrystals in a protein drop containing hASNS, 15 mM DON, 0.2 M sodium/potassium phosphate, 20 % (w/v) PEG 3350.
113
Figure 4-9. SDS-PAGE analysis of His6-tagged AS-B truncation mutants stained with Commassie Brillant blue. Lane 1: molecular weight ladder, lane 2: His6-tagged AS-B, lane 3: Δ 10 His6-tagged AS-B, lane 4: Δ 20 His6-tagged AS-B, lane 5: Δ 30 His6-tagged AS-B, lane 6: Δ 40 His6-tagged AS-B. The molecular weight of His6-tagged AS-B is approximately 64 kDa.
114
Table 4-1. Glutaminase activity of His6-tagged AS-B and truncation mutants at pH 8.0. Enzyme Km (Gln) (mM) kcat (s-1) kcat /Km Wild type 2.4 ± 0.2 2.22 ± 0.06 930 Δ 10 3.3 ± 0.8 1.54 ± 0.08 470 Δ 20 4.1 ± 0.5 2.18 ± 0.08 540 Δ 30 3.1 ± 0.7 6.0 ± 0.3 1900 Δ 40 3.3 ± 0.9 5.3 ± 0.3 1600
Table 4-2. Ammonia and glutamine-dependent production of PPi, Asn, and Glu in wild type His6-tagged AS-B and truncation mutants determined under saturating conditionsa at pH 8.0
Ammonia-dependent synthetase Glutamine-dependent synthetase PPi Asn PPi Asn Glu µmol min-1 mg-1 µmol min-1 mg-1
Wild type 2.3 ± 0.1 3.1 ± 0.3 1.1 ± 0.02 1.5 ± 0.1 8.3 ± 0.5 Δ 10 0.24 ± 0.05 No Asn 0.174 ± 0.002 No Asn 6.0 ± 0.1 Δ 20 0.22 ± 0.04 No Asn 0.11 ± 0.02 No Asn 7.31 ± 0.04 Δ 30 0.21 ± 0.02 No Asn 0.11 ± 0.02 No Asn 7.0 ± 0.4 Δ 40 0.25 ± 0.002 No Asn 0.34 ± 0.01 No Asn 9.6 ± 0.3
a Saturating conditions were 10 mM Asp, 5 mM ATP, 10 mM MgCl2 and either 100 mM NH4Cl or 20 mM Gln. is the same in the presence and absence of aspartic acid. Glutamate production is
unaffected in each of these mutants, confirming the results from the glutaminase assay.
Therefore, removal of the last 10 to 40 amino acid residues of the AS-B does not affect
the glutaminase domain or reaction, but significantly affects the synthetase activity of
the protein. It is likely that these residues are important in the binding of aspartic acid.
Previous work found that the C523A mutant of AS-B caused an 80-fold increase in the
Km for aspartic acid while only having a 2-fold decrease on the kcat suggesting its role in
the binding of aspartic acid (145). However, without further means by which to probe
the function of these residues, all that can be concluded is removal of the final 10, 20,
30, or 40 amino acid residues renders the protein unable to produce asparagine and
thus these residues must be critical to the enzyme’s structure and/ or function.
115
Small-angle X-ray Scattering of His6-AS-B and Δ40 mutant
Small-angle X-ray scattering (SAXS) is a technique that gives structural
information of a molecule based on the inhomogeneities in the electron density of the
solution (146, 147). The advantage of this technique is that macromolecules can be
studied in solution; as such, the process of crystallization is avoided. However, SAXS
can only give information regarding the global structure of the molecule, but will not
yield information on interatomic distances, thus making it a low resolution technique.
Nonetheless, useful information about the overall tertiary structure of the protein can be
obtained.
When SAXS was performed on the His6-tagged wild type protein and the Δ40
mutant, the distance distribution curves (Figure 4-10) indicated that the protein was
indeed a globular particle. As expected, the wild type protein is longer than the Δ40
mutant; however the part differing from the Δ40 appears to be unfolded. This finding
supports the lack of electron density observed for the final 40 residues of the protein in
the crystal structure(58). If these residues are highly unordered, they will likely be in
motion and not be resolved in the crystal structure. An overlay of the crystal structure of
the AS-B dimer and the SAXS structure for the His6-tagged wild type and Δ40 mutant
are shown in Figure 4-11. The SAXS structure roughly represents the global core shape
of the AS-B protein. The Δ40 mutant appears to be slightly more compact, which was
predicted by the distance distribution curve. The long tail of the SAXS structure is the
result of minor aggregation of the protein. Importantly, removal of the last 40 amino
acid residues did not affect the global fold of the protein, thus the use of truncation
mutants for crystallography experiments may represent a viable approach for obtaining
a crystal structure.
116
Figure 4-10. Distance distribution for wild type His6-tagged AS-B and Δ40 mutant. Figure courtesy of Dr. Inari Kursula, DESY, Hamburg, Germany.
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
0 5 10 15 20 25
Dis
trib
utio
n
Distance (nm)
Wild type
delta 40
117
Figure 4-11. Superimposition of the AS-B crystal structure and SAXS structure. A) Wild type His6-AS-B SAXS structure superimposed on AS-B crystal structure dimer. B) Δ40 SAXS structure superimposed on AS-B crystal structure dimer. The SAXS structure is represented by balls in purple and yellow, respectively, and the crystal structure is shown in cartoon representation in red. The extra tail present in both structures is an artifact of the SAXS measurement. Figure courtesy of Dr. Inari Kursula, DESY, Hamburg, Germany.
A B
118
Crystallization Trials of His6-tagged AS-B Truncation Mutants
Prior to crystallization trials involving the His6-tagged AS-B and other truncation
mutants, it was confirmed that, analogous to hASNS, DON could act as a covalent
inhibitor of the AS-B enzyme. The addition of 15 mM DON to His6-tagged AS-B
(incubated for 20 minutes at room temperature) eliminated nearly all glutaminase
activity (Figure 4-12), while the synthetase activity remained unaffected.
The crystallization trials of His6-tagged AS-B truncation mutants in the presence
of 15 mm DON and 1 mM of the N-adenylated sulfoximine found several conditions that
appeared to promote crystallization, with more crystal promoting conditions present as
more residues were removed. This provides evidence that removal of these residues
may stabilize the protein and help promote crystallization. The conditions are in the
process of being optimized by collaborators in the Kursula lab at DESY in Hamburg,
Germany.
Conclusions
Although no crystals suitable for diffraction were formed during these
crystallization trials, important information was obtained during enzyme preparation and
crystallization trials. hASNS is a sensitive to changes in concentration and must be kept
dilute if it is to be stored on ice for long periods of time This complicates the
crystallization attempts, as the protein is not stable for extended period of time on and
must be concentrated directly prior to use. However, the enzyme is stabilized at a
higher pH and with the addition of high concentrations of sodium chloride. The use of
these conditions in the purification and storage of hASNS may stabilize the protein and
allow for higher concentrations of protein to be used. Although AS-B truncation mutants
119
Figure 4-12. Glutaminase activity of His6-tagged AS-B in the presence and absence of 15 mM DON. Error bars represent the standard deviation in triplicate experiments.
0
0.2
0.4
0.6
0.8
1
1.2
No DON 15 mM DON
Rel
ativ
e A
ctiv
ity
120
were unable to produce asparagine, they did have significant levels glutaminase activity
indicating the removal of these residues did not disrupt the glutaminase domain. In
addition, SAXS measurements confirmed that the overall structure of the enzyme was
maintained. Initial crystallization trials with truncation mutants are promising and
removal of the last 40 amino acid residues may prove to be a viable method for the
crystallization of this protein.
Materials and Methods
Materials
Unless otherwise stated, all chemicals were purchased from Sigma (St. Louis,
MO) or Fischer Scientific (Pittsburgh, PA) and were of the highest purity available.
L-glutamine was recrystallized prior to use as previously described (109). The
N-adenylated sulfoxmine was synthesized as previously reported (82). PCR primers
were obtained from Integrated DNA technologies, Inc. (Coraville, IA) and DNA
sequencing reactions were performed by the DNA sequencing core of the
Interdisciplinary Center for Biotechnology Research at the University of Florida
(Gainesville, FL). Crystallization kits were purchased from Qiagen (Valencia, CA) or
Molecular dimensions (Cambridge, UK).
Obtaining a High Titer Viral Inoculum
Old viral inoculum with an estimated titer of 1 x 108 infectious particles/mL was
used to infect 100 mL of Sf9 cells at 1 x 106 cells/mL with an MOI of 1 for 3 days at
28 °C. Sf9 cells were collected by centrifugation and the viral containing supernatant
removed from the cellular pellet. Serial dilutions of the viral supernatant ranging from
10-1 to 10-8 were prepared and 100 µL of each dilution was added to 50 µL of cells (1 x
104 cells) in a 96 well plate. The virus and cells were covered with 2 drops of mineral oil
121
and placed at 28 °C for approximately 1 week. Importantly, a control well with cells in
the absence of virus was also prepared to monitor the health of uninfected cells.
The TCID50 was calculated according to the method of Reed and Muench (142)
using equation 4-1. In the equation, A is the last dilution where all lanes are infected, B
is the correction factor for the dilution of the virus, C is the number of infected wells in
the lane after the lane where all cells are infected (the lane used to get the value of A)
plus any infected wells in the preceding lane, and D is the number of wells used for
inoculation of each viral dilution.
𝑇𝑇𝑇𝑇𝐼𝐼𝑇𝑇50 = 10−𝐴𝐴 × 10 𝐵𝐵 × 10𝑇𝑇/𝑇𝑇 × 100.5 (4-1)
Expression and Purification of hASNS for Crystallization
hASNS was expressed and purified as described in Chapter 2. Following
purification, the enzyme was diluted approximately 2 fold with dialysis buffer, shipped to
Germany, and stored on ice until crystallization experiments commenced. No glycerol
was added to the purified enzyme and it was never frozen prior to crystallization
experiments.
Inhibition of hASNS with DON
hASNS (12 µg) was incubated with 15 mM DON for 20 minutes at room
temperature in a total volume of 17 µL. Excess DON was removed by filtration using
30,000 nominal molecular weight limit (Daltons) Microcon® Centrifugal Filter Devices
spin column (Millipore Corporation, Bedford, MA). A control reaction was prepared in
the same manner except no DON was added to the solution. Glutaminase activity was
determined by incubation of free enzyme or the EDON complex in the presence of
100 mM EPPS, pH 8.0, 10 mM NaCl, 8 mM MgCl2, and 25 mM L-Gln in a 200 µL total
volume. After 20 minutes the reaction was quenched by the addition of 30 µL of 20%
122
TCA and the amount of glutamine produced was determined using the glutamatic
dehydrogenase coupled assay as detailed in Chapter 2.
Inhibition of hASNS with AMP-CPP
hASNS (2.4 µg) was incubated with AMP-CPP (0 mM, 0.1mM, or 1 mM) in the
presence of 100 mM EPPS, pH 8.0, 10 mM Asp, 100 mM NH4Cl, 10 mM MgCl2, and
350 µL of pyrophosphate reagent in a 1 mL volume for 10 minutes at room temperature.
The reaction was initiated by the addition of 0.5 mM ATP (10 µL of 50 mM ATP) and the
production of pyrophosphate monitored at 340 nm for 10 minutes at 37 °C for the using
the coupled enzyme assay (Sigma Technical Bulletin No. BI-10).
Preparation of hASNS for Crystallization Trials
Purified protein was concentrated to 10 mg/mL using an Amicon ® Ultra-15
centrifugal filter unit with Ultracel-30 membrane (Millipore Corporation, Bedford, MA).
Enzyme was incubated with 15 mM DON for 30 min at room temperature and excess
DON was removed by dialysis versus 50 mM EPPS, pH 8.0, 100 mM NaCl, and 5 mM
DTT. In trials involving the N-adenylated sulfoximine, a final concentration of either
200 µM or 1 mM was added to the EDON complex prior to plate set-up (see Table 4-3).
The final concentration of MgCl2, when present, was 10 mM. Protein concentrations
were determined by measuring the absorbance at 280 nm using a NanoDrop 2000
spectrophotometer (Thermo Fisher Scientific, San Jose, CA) and the calculated
extinction coefficient for hASNS (ε= 80,220 M-1 cm-1).
Crystallization Trials of hASNS
All screens were performed using the sitting drop method. Manual screens were
set-up as 96 well plates on MRC 3 well crystallization plates (Hampton Research, Aliso
Viejo, CA) using 0.5 µL of the protein solution mixed with 0.5 µL of the mother liquor.
123
High-throughput screens were performed using the high-throughput crystallization
facility at EMBL Hamburg at DESY in Hamburg, Germany (144). Table 4-3 lists of all of
the screening suites used in these trials as well which ligands were present. The
detailed compositions of each screening suite can be found online at
www.moleculardimensions.com or www.qiagen.com. Optimization screen of the
Qiagen PACT conditions was performed by varying the concentration of PEG 3350 from
10-30% in 5% increments while also varying the concentration of sodium tartrate and
sodium sulfate from 0.1-0.5 M in 0.1 M increments.
Cloning, Expression and Purification of His6-tagged AS-B Truncation Mutants
The pet 21-c (+) vector containing the asnB insert followed by a polyhistidine tag
was used as a template, and primers were designed to anneal to the 6X polyhistidine
tag of the gene and the last residue desired in the truncation mutant. One primer
contained a 5’ phosphate group to allow for re-ligation of the vector following PCR.
Reactions consisted of 125 ng of each primer, 5 ng of template DNA, 200 µM dNTPs,
1X Pfu turbo buffer, and 1 µL (2.5 U) of Pfu turbo DNA polymerase in a 50 µL volume.
Reactions were heated at 95 °C for 30 seconds, cooled to 55 °C for 30 seconds, and
then heated at 68 °C for 7 minutes. This cycle was repeated 16 times and the resulting
reactions were purified using Wizard PCR preps DNA purification kit (Promega,
Madison, WI). Purified DNA was treated with Dpn1 to digest methylated template DNA
and ligated overnight at 16 °C using T4 DNA ligase. Ligation reactions were used to
transform JM109 E. coli cells. Successful transformants were purified and sequenced
to confirm the desired mutation. His6-tagged truncation mutants were expressed and
purified as detailed for His6-tagged wild type enzyme as described in Chapter 3.
124
Table 4-3. List of experimental conditions screened for crystallization of hASNS Screen Manufacturer Protein
concentration Ligands Manual or HTS
JCSG plus Molecular dimensions
10 mg/mL DONa Manual
Classics Qiagen 7 mg/mL DON, sulfoximineb HTS
Classics II Qiagen 7 mg/mL DON, sulfoximine HTS
PEG Qiagen 7 mg/mL DON, sulfoximine HTS
AmSO4 Qiagen 7 mg/mL DON, sulfoximine HTS
Classic Qiagen 3.5 mg/mL DON HTS
Classics II Qiagen 3.5 mg/mL DON HTS
PEG II Qiagen 3.5 mg/mL DON HTS
PACT Qiagen 3.5 mg/mL DON HTS
pH Clear Qiagen 3.5 mg/mL DON HTS
Morpheus Molecular dimensions
3.5 mg/mL None Manual
Morpheus Molecular dimensions
3.5 mg/mL DON Manual
Morpheus Molecular dimensions
3.5 mg/mL DON, sulfoximine, MgCl2
Manual
ProPlex Molecular dimensions
3.5 mg/mL None Manual
ProPlex Molecular dimensions
3.5 mg/mL DON Manual
ProPlex Molecular dimensions
3.5 mg/mL DON, sulfoximine, MgCl2c
Manual
JCSG plus Molecular dimensions
3.5 mg/mL DON, sulfoximined, MgCl2
Manual
a Concentration of DON used in all trials was 15 mM
b Sulfoximine refers to the N-adenylated sulfoximine. Concentration used in all trials was 200 µM. c Concentration of MgCl2 used in all trials was 10 mM. d Concentration used in this trial was 1 mM.
125
Characterization of His6-tagged AS-B Truncation Mutants
Glutaminase activity was determined by incubating reactions containing enzyme
(1.5 µg), 100 mM EPPS, pH 8.0, 100 mM NaCl, 8 mM MgCl2, and varied concentrations
of L-glutamine (between 0.2-50 mM ) in a 200 µL volume for 20 minutes at 37 °C before
quenching with TCA to a final concentration of 4% (v/v). This solution was added to the
coupled enzyme assay solution for L-glutamic dehydrogenase (Signma G2626) as
detailed in Chapter 2.
Production of pyrophosphate (PPi) was monitored spectrophotometrically during
the AS-B reaction using a coupled enzyme assay (Sigma Technical Bulletin No. BI-
100). The reaction consisted of 100 mM EPPS pH 8.0, 5 mM ATP, 100 mM NH4Cl or
20 mM L-glutamine, 10 mM MgCl2, 20 mM aspartic acid, and 350 µL of PPi reagent in a
1 mL total volume. Reactions were initiated by the addition of 2-4 µg of enzyme and
monitored at 37 °C for 20 min. The amount of PPi produced was determined by
monitoring the change in absorbance at 340 nm using the coupled enzyme assay.
Asparagine and glutamate production was determined using an HPLC based
end-point assay following methods previously described (47) and detailed in Chapter 3.
Briefly, reactions containing enzyme (2-4 µg) and 100 mM EPPS pH 8.0, 5 mM ATP,
100 mM NH4Cl or 20 mM L-glutamine, 10 mM MgCl2, and 10 mM aspartic acid in a
1 mL volume were incubated for 20 minutes at 37 °C before being quenched with TCA
(4%). Amino acids were derivatized using 2,4 dinitrofluorobenzene and separated using
a reverse-phase HPLC C18 Microsorb column (Varian, Palo Alto, CA) using step
gradient of 40 mM formic acid, pH 3.6 and acetonitrile. Derivitized amino acids were
detected at 365 nm and the concentration quantified by comparison to authentic
standards.
126
Crystallization Trials and SAXS measurements of His6-tagged AS-B and Truncation Mutants
His6-tagged truncation mutants were concentrated using an Amicon ® Ultra-15
Centrifugal filter unit with Ultracel-30 membrane to 5 mg/mL. Enzyme was incubated
with 15 mM DON for 30 min at room temperature and excess DON was removed by
dialysis versus 50 mM HEPES, pH 8.0, 100 mM NaCl, and 1 mM DTT. The EDON
complex was treated with 1 mM of the N-adenylated sulfoximine and 10 mM of MgCl2.
Trials were set-up using the JCSG plus suite and with a 1:1 ratio of protein to mother
liquor and stored at 25 °C. Protein concentrations were determined by measuring the
absorbance at 280 nm using a NanoDrop 2000 spectrophotometer(Thermo Scientific,
San Jose,CA) and the calculated extinction coefficient for AS-B (ε= 93,210 M-1 cm-1).
Samples for SAXS analysis were the apo enzyme concentrated to 5 mg/mL.
Measurements were collected by Dr. Petri Kursula, University of Oulu, Oulu, Finland.
127
CHAPTER 5 CONCLUSIONS AND FUTURE WORK
Conclusions
Inhibition of hASNS
The identification of the N-adenylated sulfoximine, potent inhibitor of hASNS that
suppresses the proliferation of drug-resistant MOLT-4 cells re-ignited the search for new
inhibitors of hASNS that could be used in the clinical treatment of ALL. The goal of the
first functional analogs was to substitute more drug-like functional groups for the
phosphate moiety of the N-adenylated sulfoximine. It was anticipated that these
compounds would exhibit similar binding affinity but improved bioavailability. Steady-
state kinetic characterization of these compounds found that the presence of a localized
negative charge that mimics the phosphate group is key to inhibitor recognition within
the active site. This finding is further supported by a computational model of AS-B,
where a conserved lysine residue was found to be positioned directly above the
phosphate group. Mutagenesis of this residue results in catalytically inactive enzyme.
This conclusion places a further constraint on the design of sulfoxmine-derived
compounds and the discovery of ASNS inhibitors with increased potency and
bioavailability.
Functional Role of a Conserved Glutamate Residue
A key step in the mechanism of AS-B is the deprotonation of ammonia in the
tetrahedral transition state prior to formation of asparagine and AMP. A computational
model with the N-adenylated sulfoximine docked into the synthetase active site
suggested that a conserved glutamate residue (E348) is correctly positioned to act as
the general base in this reaction. However, 18O-isotopic labeling experiments and
128
functional characterization of this residue suggest it is critical to formation of the
βAspAMP intermediate.
Crystallization of hASNS and AS-B
The use of DON and the N-adenylated sulfoxmine was shown to be a viable
approach to the crystallization of hASNS and AS-B. Unfortunately, initial crystallization
trials involving hASNS did not produce any crystals suitable for diffraction. However,
several important issues were resolved that will aid in future crystallization trials.
Although preliminary screens involving truncation mutants did not yield crystals suitable
for diffraction, results were more promising than screens involving full-length AS-B.
Therefore, these mutants may represent a viable method for obtaining crystals of the
enzyme by removing a highly flexible and unordered portion of the protein. Work on
these mutants as well as hASNS is currently ongoing in collaboration with Dr. Inari Ku at
DESY in Hamburg, Germany
Future Work
Design of Future Inhibitors
Although initial efforts to obtain inhibitors with more “”drug-like” functionality led to
compounds which were weaker inhibitors of hASNS, much information was gained in
the characterization of these compounds. New molecules must contain a localized
negative charge to maintain the critical electrostatic interaction with the lysine side-
chain. New compounds will strive to replace the adenosyl moiety with heterocycles as
well as alter the charged carboxylate and amine groups. Also, the use of prodrugs
should be explored. In addition, studies involving the fate of the N-adenylated
sulfoximine, when given to MOLT-4 cells, will help to guide the development of future
inhibitors of ASNS.
129
Crystallization of hASNS
More effort must be put forth in order to obtain a crystal suitable for X-ray
crystallography experiments. hASNS, either in the EDON form or EDON/sulfoximine
form, has been through a rigorous screening process with no success. Although the
use of a poly-histidine tag is helpful during the purification process, these tags are often
removed prior to crystallography screens. These tags are usually thought to be “floppy”
and prevent the protein from crystallization. In the case of ASNS, we hypothesize that
the C-terminal tail is already in motion, since it is not visible in the E. coli crystal
structure. Therefore, it is likely that the C-terminal poly histidine tag is also in motion. It
would be beneficial to re-design the baculovirus expression system to contain a
cleavage site that will allow for the removal of the poly-histidine tag following
purification. Another viable option for crystallography screens is to prepare the C1A
mutant of hASNS. This mutant binds but does not hydrolyze glutamine(130), and was
used previously in the determination of the crystal structure of AS-B (58). Finally, a
recent crystal structure was obtained by limited proteolysis of the protein with trypsin to
remove the solvent-accessible and flexible regions of the protein prior to crystallization
(148) and this technique should be explored for use with hASNS.
Expression of hASNS in E. coli
Although the baculovirus expression system is successful in the expression and
purification of milligram quantities of enzyme, it is expensive and time consuming to
prepare mutant forms of the enzyme due to re-transfecting and preparing a high titer
viral stock for each desired mutant. Ideally, expression of the human enzyme in E. coli
would allow for large quantities of the enzyme to be produced and mutants to be
prepared and characterized in a much shorter time period. Previous attempts to
130
express the enzyme in E. coli or yeast were unsuccessful (41, 42). However, protein
expression technologies evolved over the past few decades and the use of fusion
proteins has allowed for successful and soluble expression of many eukaryotic proteins
in E. coli (149, 150).
ASNS presents a difficult challenge in the use of N-terminal fusion proteins
because the Cys-1 residue is catalytic and absolutely required for glutamine-dependent
activity. Therefore, cleavage of the N-terminal fusion protein must occur to leave
cysteine as the first residue of the protein. Tobacco etch virus protease (TEV)
represents a viable solution to this problem as it has been shown to cleave with a
variety of amino acid residues in the P1’ position (151). Furthermore, cleavage of an N-
terminal His-tag of AS-B resulted in an enzyme with unaltered kinetics for the glutamine-
dependent reaction (Meyer, unpublished). This provides evidence that cleavage of an
N-terminal tag from ASNS by TEV is a viable approach for production of hASNS and the
use of fusion protein for the expression of hASNS should be explored.
Thrombin Cleavage of His6-tagged AS-B
Although it was not necessary for kinetic experiments involving AS-B, removal of
the 6X poly-histidine tag by thrombin may be beneficial to future work involving
crystallization of AS-B. Thrombin contains multiple disulfide bonds and reducing agents
severely affect its catalytic activity(152). On the other hand, reducing agents, such as
DTT and TCEP must be used when working with AS-B in order to keep the critical Cys-
1 residue of the protein reduced. Therefore, these two opposing conditions must be
carefully balanced. Unfortunately, preliminary experiments using thrombin yielded poor
cleavage and inactive enzyme. Future work involving the cleavage reaction may find
optimal conditions for cleavage that yield fully cut and active enzyme which would be
131
better suited for future crystallography trials. Furthermore, the use of other cleavage
sites, such as TEV (151) and TVMV (153),that do not contain critical disulfide bonds
may represent a better alternative to cleavage of the poly-histidine tag from AS-B.
ASNS from Mycobacterium tuberculosis
In 2006, Ren and Liu reported that inactivation of asnB gene in Mycobacterium
smegmatis has a dramatic effect on the sensitivity of M. smegmatis to antibiotics such
as rifampinn, erythromycin,and novobiocin (154). Given that most mycobacterium are
resistant to common antibiotics this finding suggests that inhibition of the asnB gene in
M. tuberculosis represents a method to re-sensitize the mycobacterium to antibiotics for
the treatment of tuberculosis. Although no further work has been done regarding this
correlation, characterization of ASNS from M. tuberculosis may give insight into
differences between the human and mycobacterium forms of the enzyme and suggest a
potential way to develop a specific inhibitor of the M. tuberculosis enzyme.
132
APPENDIX A PROTEIN AND DNA SEQUENCES OF ASPARAGINE SYNTHETASE
1 atgtgttcaa tttttggcgt attcgatatc aaaacagacg cagttgagct gcgtaagaaa 61 gccctcgagc tgtcacgcct gatgcgtcat cgtggcccgg actggtccgg tatttatgcc
121 agcgataacg ccattctcgc ccacgaacgt ctgtcaattg ttgacgttaa cgcgggggcg 181 caacctctct acaaccaaca aaaaacccac gtactggcgg taaacggtga aatctacaac 241 caccaggcat tgcgcgccga atatggcgat cgttaccagt tccagaccgg gtctgactgt 301 gaagtgatcc tcgcgctgta tcaggaaaaa gggccggaat ttctcgacga cttgcagggc 361 atgtttgcct ttgcactgta cgacagcgaa aaagatgcct acctgattgg tcgcgaccat 421 ctggggatca tcccactgta tatggggtat gacgaacacg gtcagctgta tgtggcctca 481 gaaatgaaag cgctggtgcc agtttgccgc acgattaaag agttcccggc ggggagctat 541 ttgtggagcc aggacggcga aatccgttct tactatcatc gcgactggtt cgactacgat 601 gcggtgaaag ataacgtgac cgacaaaaac gagctgcgtc aggcactgga agattcagtt 661 aaaagccatc tgatgtctga tgtgccttac ggtgtgctgc tttctggtgg tctggattcc 721 tcaattattt ccgctatcac caagaaatac gcagcccgtc gcgtggaaga tcaggaacgc 781 tctgaagcct ggtggccgca gttacactcc tttgctgtag gtctgccggg ttcaccggat 841 ctgaaagcag cccaggaagt ggcaaaccat ctgggcacgg tgcatcacga aattcacttc 901 actgtacagg aaggtctgga tgccatccgc gacgtgattt accacatcga aacttatgat 961 gtgaccacta ttcgcgcttc aacaccgatg tatttaatgt cgcgtaagat caaggcgatg 1021 ggcattaaaa tggtgctgtc cggtgaaggt tctgatgaag tgttcggcgg ttatctttac 1081 ttccacaaag caccgaatgc caaagaactg catgaagaga cggtgcgtaa actgctggcc 1141 ctgcatatgt atgactgcgc gcgtgccaac aaagcgatgt cagcctgggg cgtggaagca 1201 cgcgttccgt tcctcgacaa aaaattcctt gatgtggcga tgcgtattaa cccacaggat 1261 aaaatgtgcg gtaacggcaa aatggaaaaa cacatcctgc gtgaatgttt tgaagcgtat 1321 ctgcctgcaa gcgtggcctg gcggcagaaa gagcagttct ccgatggcgt cggttacagt 1381 tggatcgaca ccctgaaaga agtggctgcg cagcaggttt ctgatcagca actggaaact 1441 gcccgcttcc gcttcccgta caacacgcca acctctaaag aagcgtactt gtatcgggag 1501 atctttgaag aactattccc gcttccgagc gccgctgagt gcgtgccggg cggtccttcc 1561 gtcgcttgtt cttccgctaa agcgatcgaa tgggatgaag cgttcaagaa aatggacgat 1621 ccgtctggtc gcgcggttgg tgttcaccag tcggcgtata agctcgttcc acgcggcagc 1681 caccaccacc accaccactg a Figure A-1. DNA sequence of asnB followed by a thrombin cleavage sequence and
poly-histidine tag sequence (underlined).
1 csifgvfdi ktdavelrkk alelsrlmrh rgpdwsgiya sdnailaher lsivdvnaga 61 qplynqqkth vlavngeiyn hqalraeygd ryqfqtgsdc evilalyqek gpeflddlqg 121 mfafalydse kdayligrdh lgiiplymgy dehgqlyvas emkalvpvcr tikefpagsy 181 lwsqdgeirs yyhrdwfdyd avkdnvtdkn elrqaledsv kshlmsdvpy gvllsgglds 241 siisaitkky aarrvedqer seawwpqlhs favglpgspd lkaaqevanh lgtvhheihf 301 tvqegldair dviyhietyd vttirastpm ylmsrkikam gikmvlsgeg sdevfggyly 361 fhkapnakel heetvrklla lhmydcaran kamsawgvea rvpfldkkfl dvamrinpqd 421 kmcgngkmek hilrecfeay lpasvawrqk eqfsdgvgys widtlkevaa qqvsdqqlet 481 arfrfpyntp tskeaylyre ifeelfplps aaecvpggps vacssakaie wdeafkkmdd 541 psgravgvhq sayklvprgs hhhhhh Figure A-2. Protein sequence of AS-B. Underlined residues correspond to the C-
terminal thrombin cleavage site and 6X poly-histidine tag.
133
1 atgtgtggca tttgggcgct gtttggcagt gatgattgcc tttctgttca gtgtctgagt 61 gctatgaaga ttgcacacag aggtccagat gcattccgtt ttgagaatgt caatggatac 121 accaactgct gctttggatt tcaccggttg gcggtagttg acccgctgtt tggaatgcag 181 ccaattcgag tgaagaaata tccgtatttg tggctctgtt acaatggtga aatctacaac 241 cataagaaga tgcaacagca ttttgaattt gaataccaga ccaaagtgga tggtgagata 301 atccttcatc tttatgacaa aggaggaatt gagcaaacaa tttgtatgtt ggatggtgtg 361 tttgcatttg ttttactgga tactgccaat aagaaagtgt tcctgggtag agatacatat 421 ggagtcagac ctttgtttaa agcaatgaca gaagatggat ttttggctgt atgttcagaa 481 gctaaaggtc ttgttacatt gaagcactcc gcgactccct ttttaaaagt ggagcctttt 541 cttcctggac actatgaagt tttggattta aagccaaatg gcaaagttgc atccgtggaa 601 atggttaaat atcatcactg tcgggatgaa cccctgcacg ccctctatga caatgtggag 661 aaactctttc caggttttga gatagaaact gtgaagaaca acctcaggat cctttttaat 721 aatgctgtaa agaaacgttt gatgacagac agaaggattg gctgcctttt atcagggggc 781 ttggactcca gcttggttgc tgccactctg ttgaagcagc tgaaagaagc ccaagtacag 841 tatcctctcc agacatttgc aattggcatg gaagacagcc ccgatttact ggctgctaga 901 aaggtggcag atcatattgg aagtgaacat tatgaagtcc tttttaactc tgaggaaggc 961 attcaggctc tggatgaagt catattttcc ttggaaactt atgacattac aacagttcgt 1021 gcttcagtag gtatgtattt aatttccaag tatattcgga agaacacaga tagcgtggtg 1081 atcttctctg gagaaggatc agatgaactt acgcagggtt acatatattt tcacaaggct 1141 ccttctcctg aaaaagccga ggaggagagt gagaggcttc tgagggaact ctatttgttt 1201 gatgttctcc gcgcagatcg aactactgct gcccatggtc ttgaactgag agtcccattt 1261 ctagatcatc gattttcttc ctattacttg tctctgccac cagaaatgag aattccaaag 1321 aatgggatag aaaaacatct cctgagagag acgtttgagg attccaatct gatacccaaa 1381 gagattctct ggcgaccaaa agaagccttc agtgatggaa taacttcagt taagaattcc 1441 tggtttaaga ttttacagga atacgttgaa catcaggttg atgatgcaat gatggcaaat 1501 gcagcccaga aatttccctt caatactcct aaaaccaaag aaggatatta ctaccgtcaa 1561 gtctttgaac gccattaccc aggccgggct gactggctga gccattactg gatgcccaag 1621 tggatcaatg ccactgaccc ttctgcccgc acgctgaccc actacaagtc agctgtcaaa 1681 gctgaacaa aaactcatc tcagaagag gatctgctc gagcaccac caccaccac 1741 cactag Figure A-3. DNA sequence of hASNS. Underlined sequences correspond to the C-
terminal c-myc and 6X poly-histidine tag.
1 cgiwalfgs ddclsvqcls amkiahrgpd afrfenvngy tnccfgfhrl avvdplfgmq 61 pirvkkypyl wlcyngeiyn hkkmqqhfef eyqtkvdgei ilhlydkggi eqticmldgv 121 fafvlldtan kkvflgrdty gvrplfkamt edgflavcse akglvtlkhs atpflkvepf 181 lpghyevldl kpngkvasve mvkyhhcrdv plhalydnve klfpgfeiet vknnlrilfn 241 navkkrlmtd rrigcllsgg ldsslvaatl lkqlkeaqvq yplqtfaigm edspdllaar 301 kvadhigseh yevlfnseeg iqaldevifs letydittvr asvgmylisk yirkntdsvv 361 ifsgegsdel tqgyiyfhka pspekaeees erllrelylf dvlradrtta ahglelrvpf 421 ldhrfssyyl slppemripk ngiekhllre tfedsnlipk eilwrpkeaf sdgitsvkns 481 wfkilqeyve hqvddamman aaqkfpfntp ktkegyyyrq vferhypgra dwlshywmpk 541 winatdpsar tlthyksavk aeqkliseedllehhhhhh
Figure A-4. Protein sequence of hASNS. Underlined residues correspond to the C-terminal c-myc and 6X poly-histidine tag.
134
APPENDIX B PRIMERS USED FOR MUTAGENSIS AND CLONING
Table B-1. Sequence of primers for cloning and site-directed mutagenesis studies Primer Sequence 5’ 3’ HisAS-B forward PHOSCGCGGCAGCCACCACCACCACCAC HisAS-B reverse TGGAACGAGCTTATACGCCGACTGGT K44R forward CTGGCGGCAGCGTGAGCAGTTCTCC K449R reverse GGAGAACTGCTCACGCTGCCGCCAG K449A forward TGGCGGCAGGCAGAGCAGTTCTCC K449A reverse GGAGAACTGCTCTGCCTGCCGCCAG E348D forward GGTGCTGTCCGGTGATGGTTCTGATGAAGTG E348D reverse CACTTCATCAGAACCATCACCGGACAGCACC E348A forward GGTGCTGTCCGGTGCTGGTTCTGATGAAGTG E348A reverse CACTTCATCAGAACCAGCACCGGACAGCACC E348Q forward GGTGCTGTCCGGTCAAGGTTCTGATG E348Q reverse CACATCAGAACCTTGACCGGACA AS-B delta 10 reverse TGGAACGAGGCGACCAGACGGAT AS-B delta 20 reverse TGGAACGAGCGCTTCATCCCATTC AS-B delta 30 reverse TGGAACGAGAGAACAAGCGACGGAA AS-B delta 40 reverse TGGAACAAGGCACTCAGCGGCGCT
135
APPENDIX C 31P NMR SPECTRA OF PIX EXPERIMENTS UTILIZING β,γ 18O6-ATP
136
Figure C-1. Full 31P NMR spectra of β,γ 18O6-ATP prior to the addition of enzyme. The triplet at -20 ppm, doublet at -10 ppm, and doublet at -4.5 ppm are the peaks for ATP. The other small speaks represent contaminants in the of β,γ 18O6-ATP.
137
Figure C-2. Full 31P NMR spectra of the PIX reaction of His6-AS incubated with L-aspartic acid and β,γ 18O6-ATP for 210 minutes. The triplet at -20 ppm, doublet at -10 ppm, and doublet at -4.5 ppm are the peaks for ATP. The other small speaks represent contaminants in the of β,γ 18O6-ATP
138
Figure C-3. Full 31P NMR spectra of the PIX reaction of E348A incubated with L-aspartic acid and β,γ 18O6-ATP for 210 minutes. The triplet at -20 ppm, doublet at -10 ppm, and doublet at -4.5 ppm are the peaks for ATP. The other small speaks represent contaminants in the of β,γ 18O6-ATP
139
Figure C-4. 31PMR spectra of the α-P of ATP as a function of time. A) α-P of ATP in the presence of His6-tagged AS-B, [β,γ-18O6]-ATP and aspartic acid. B) α-P of ATP in the presence of E348A, [β,γ-18O6]-ATP and aspartic acid.
B
A
140
Figure C-5. 3131PMR spectra of the γ-P of ATP as a function of time. A) γ-P of ATP in the presence of His6-tagged AS-B, [β,γ-18O6]-ATP and aspartic acid. B) γ-P of ATP in the presence of E348A, [β,γ-18O6]-ATP and aspartic acid.
A
B
141
LIST OF REFERENCES
1. (2008) Cancer Facts and Figures 2008, American Cancer Society. 2. Ertel, I. J., Nesbit, M. E., Hammond, D., Weiner, J., and Sather, H. (1979)
Effective Dose of L-Asparaginase for Induction of Remission in Previously Treated Children with Acute Lymphocytic-Leukemia - Report from Childrens Cancer Study-Group, Cancer Res. 39, 3893-3896.
3. Clarkson, B., Krakoff, I., Burchenal, J., Karnofsky, D., Golbey, R., Dowling, M.,
Oettgen, H., and Lipton, A. (1970) Clinical results of treatment with E. coli L-asparaginase in adults with leukemia, lymphoma, and solid tumors, Cancer 25, 279-305.
4. Muller, H. J., and Boos, J. (1998) Use of L-asparaginase in childhood ALL, Crit.
Rev. Oncol. Hematol. 28, 97-113. 5. Aghaiypour, K., Wlodawer, A., and Lubkowski, J. (2001) Structural basis for the
activity and substrate specificity of Erwinia chrysanthemi L-asparaginase, Biochemistry 40, 5655-5664.
6. Graham, M. L. (2003) Pegaspargase: a review of clinical studies, Adv. Drug
Delivery Rev. 55, 1293-1302. 7. Broome, J. D. (1981) L-Asparaginase: discovery and development as a tumor-
inhibitory agent, Cancer Treat. Rep. 65 Suppl 4, 111-114. 8. Ueno, T., Ohtawa, K., Mitsui, K., Kodera, Y., Hiroto, M., Matsushima, A., Inada,
Y., and Nishimura, H. (1997) Cell cycle arrest and apoptosis of leukemia cells induced by L-asparaginase, Leukemia 11, 1858-1861.
9. Cooney, D. A., and Handschumacher.Re. (1970) L-Asparaginase and L-
Asparagine Metabolism, Annu. Rev. Pharmacol. 10, 421-&. 10. Ohnuma, T., Holland, J. F., Freeman, A., and Sinks, L. F. (1970) Biochemical
and Pharmacological Studies with Asparaginase in Man, Cancer Res. 30, 2297-2305.
11. Haskell, C. M., and Canellos, G. P. (1969) L-asparaginase resistance in human
leukemia--asparagine synthetase, Biochem. Pharmacol. 18, 2578-2580. 12. Prager, M. D., and Bachynsky, N. (1968) Asparagine synthetase in normal and
malignant tissues: correlation with tumor sensitivity to asparaginase, Arch. Biochem. Biophys. 127, 645-654.
142
13. Leslie, M., Case, M. C., Hall, A. G., and Coulthard, S. A. (2006) Expression levels of asparagine synthetase in blasts from children and adults with acute lymphoblastic leukaemia, Br. J. Haematol. 132, 740-742.
14. Kiriyama, Y., Kubota, M., Takimoto, T., Kitoh, T., Tanizawa, A., Akiyama, Y., and
Mikawa, H. (1989) Biochemical characterization of U937 cells resistant to L-asparaginase: the role of asparagine synthetase, Leukemia 3, 294-297.
15. Hutson, R. G., Kitoh, T., Amador, D. A. M., Cosic, S., Schuster, S. M., and
Kilberg, M. S. (1997) Amino acid control of asparagine synthetase: Relation to asparaginase resistance in human leukemia cells, Am. J. Physiol. Cell. Physiol. 41, C1691-C1699.
16. Horowitz, B., Madras, B. K., Meister, A., Old, L. J., Boyse, E. A., and Stockert, E.
(1968) Asparagine Synthetase Activity of Mouse Leukemias, Science 160, 533-535.
17. Prager, M. D., and Bachynsky, N. (1968) Asparagine synthetase in asparaginase
resistant and susceptible mouse lymphomas, Biochem. Biophys. Res. Commun. 31, 43-47.
18. Broome, J. D., and Schwartz, J. H. (1967) Differences in the production of l-
asparagine in asparaginase-sensitive and resistant lymphoma cells, Biochim. Biophys. Acta Nucleic Acids and Protein Synthesis 138, 637-639.
19. Fine, B. M., Kaspers, G. J. L., Ho, M., Loonen, A. H., and Boxer, L. M. (2005) A
Genome-Wide View of the In vitro Response to L-Asparaginase in Acute Lymphoblastic Leukemia, Cancer Res. 65, 291-299.
20. Stams, W. A. G., den Boer, M. L., Beverloo, H. B., Meijerink, J. P. P., Stigter, R.
L., van Wering, E. R., Janka-Schaub, G. E., Slater, R., and Pieters, R. (2003) Sensitivity to L-asparaginase is not associated with expression levels of asparagine synthetase in t(12;21)+ pediatric ALL, Blood 101, 2743-2747.
21. Appel, I. M., den Boer, M. L., Meijerink, J. P. P., Veerman, A. J. P., Reniers, N.
C. M., and Pieters, R. (2006) Up-regulation of asparagine synthetase expression is not linked to the clinical response L-asparaginase in pediatric acute lymphoblastic leukemia, Blood 107, 4244-4249.
22. Lorenzi, P. L., and Weinstein, J. N. (2009) Asparagine Synthetase: A New
Potential Biomarker in Ovarian Cancer, Drug News Perspect. 22, 61-64.
143
23. Lorenzi, P. L., Reinhold, W. C., Rudelius, M., Gunsior, M., Shankavaram, U., Bussey, K. J., Scherf, U., Eichler, G. S., Martin, S. E., Chin, K., Gray, J. W., Kohn, E. C., Horak, I. D., Von Hoff, D. D., Raffeld, M., Goldsmith, P. K., Caplen, N. J., and Weinstein, J. N. (2006) Asparagine synthetase as a causal, predictive biomarker for L-asparaginase activity in ovarian cancer cells, Mol. Cancer Ther. 5, 2613-2623.
24. Aslanian, A. M., Fletcher, B. S., and Kilberg, M. S. (2001) Asparagine synthetase
expression alone is sufficient to induce l-asparaginase resistance in MOLT-4 human leukaemia cells, Biochem. J. 357, 321-328.
25. Gutierrez, J. A., Pan, Y. X., Koroniak, L., Hiratake, J., Kilberg, M. S., and
Richards, N. G. J. (2006) An inhibitor of human asparagine synthetase suppresses proliferation of an L-asparaginase-resistant leukemia cell line, Chem. Biol. 13, 1339-1347.
26. Zalkin, H., and Smith, J. L. (1998) Enzymes utilizing glutamine as an amide
donor, Adv. Enzymol. Relat. Areas Mol. Biol. 72, 87-144. 27. Dang, V.-D., Valens, M., Bolotin-Fukuhara, M., and Daignan-Fornier, B. (1996)
Cloning of the asns1 and asns2 genes encoding asparagine synthetases in Saccharomyces cerevisiae: differential regulation by the CCAAT-box-binding factor, Mol. Microbiol. 22, 681-692.
28. Reitzer, L. J., and Magasanik, B. (1982) Asparagine Synthetases of Klebsiella
aerogenes: Properties and Regulation of Synthesis, J. Bacteriol. 151, 1299-1313. 29. Fresquet, V., Thoden, J. B., Holden, H. M., and Raushel, F. M. (2004) Kinetic
mechanism of asparagine synthetase from Vibrio cholerae, Bioorg. Chem. 32, 63-75.
30. Scofield, M., Lewis, W., and Schuster, S. (1990) Nucleotide sequence of
Escherichia coli asnB and deduced amino acid sequence of asparagine synthetase B, J. Biol. Chem. 265, 12895-12902.
31. Rognes, S. E. (1975) Glutamine-dependent asparagine synthetase from Lupinus
luteus, Phytochemistry 14, 1975-1982. 32. Streeter, J. G. (1973) In vivo and in vitro studies on asparagine biosynthesis in
soybean seedlings, Arch. Biochem. Biophys. 157, 613-624. 33. Andrulis, I. L., Chen, J., and Ray, P. N. (1987) Isolation of human cDNAs for
asparagine synthetase and expression in Jensen rat sarcoma cells, Mol. Cell. Biol. 7, 2435-2443.
144
34. Sheng, S., Moraga, D. A., Van Heeke, G., and Schuster, S. M. (1992) High-level expression of human asparagine synthetase and production of monoclonal antibodies for enzyme purification, Protein Expression Purif. 3, 337-346.
35. Hongo, S., and Sato, T. (1983) Some molecular properties of asparagine
synthetase from rat liver, Biochim. et Biophys. Acta, Protein Structure and Mol. Enzymol. 742, 484-489.
36. Luehr, C. A., and Schuster, S. M. (1985) Purification and characterization of beef
pancreatic asparagine synthetase, Arch. Biochem. Biophys. 237, 335-346. 37. Markin, R. S., Luehr, C. A., and Schuster, S. M. (2002) Kinetic mechanism of
beef pancreatic L-asparagine synthetase, Biochemistry 20, 7226-7232. 38. Mehlhaff, P. M., Luehr, C. A., and Schuster, S. M. (2002) Studies of the
ammonia-dependent reaction of beef pancreatic asparagine synthetase, Biochemistry 24, 1104-1110.
39. Pfeiffer, N. E., Mehlhaff, P. M., Wylie, D. E., and Schuster, S. M. (1987)
Topographical separation of the catalytic sites of asparagine synthetase explored with monoclonal antibodies, J. Biol. Chem. 262, 11565-11570.
40. Larsen, M. C., and Schuster, S. M. (1992) The topology of the glutamine and
ATP binding sites of human asparagine synthetase, Arch. Biochem. Biophys. 299, 15-22.
41. Van Heeke, G., and Schuster, S. M. (1990) Expression of human asparagine
synthetase in Saccharomyces cerevisiae, Protein Eng. 3, 739-744. 42. Van Heeke, G., and Schuster, S. M. (1989) Expression of human asparagine
synthetase in Escherichia coli, J. Biol. Chem. 264, 5503-5509 . 43. Ciustea, M., Gutierrez, J. A., Abbatiello, S. E., Eyler, J. R., and Richards, N. G.
(2005) Efficient expression, purification, and characterization of C-terminally tagged, recombinant human asparagine synthetase, Arch Biochem Biophys 440, 18-27.
44. Ikeuchi, H., Meyer, M. E., Ding, Y., Hiratake, J., and Richards, N. G. J. (2009) A
critical electrostatic interaction mediates inhibitor recognition by human asparagine synthetase, Bioorg. Med. Chem. 17, 6641-6650.
45. Boehlein, S. K., Rosa-Rodriguez, J. G., Schuster, S. M., and Richards, N. G. J.
(1997) Catalytic Activity of the N-Terminal Domain of Escherichia coli Asparagine Synthetase B Can Be Reengineered by Single-Point Mutation, J. Am. Chem. Soc. 119, 5785-5791.
145
46. Boehlein, S. K., Stewart, J. D., Walworth, E. S., Thirumoorthy, R., Richards, N. G., and Schuster, S. M. (1998) Kinetic mechanism of Escherichia coli asparagine synthetase B, Biochemistry 37, 13230-13238.
47. Tesson, A. R., Soper, T. S., Ciustea, M., and Richards, N. G. J. (2003) Revisiting
the steady state kinetic mechanism of glutamine-dependent asparagine synthetase from Escherichia coli, Archives of Biochemistry and Biophysics 413, 23-31.
48. Cedar, H., and Schwartz, J. H. (1969) The asparagine synthetase of Escherichia
coli. II. Studies on mechanism, J. Biol. Chem. 244, 4122-4127. 49. Nakatsu, T., Kato, H., and Oda, J. (1998) Crystal structure of asparagine
synthetase reveals a close evolutionary relationship to class II aminoacyl-tRNA synthetase, Nat. Struct. Biol. 5, 15-19.
50. Schnizer, H. G., Boehlein, S. K., Stewart, J. D., Richards, N. G. J., and Schuster,
S. M. (1999) Formation and Isolation of a Covalent Intermediate during the Glutaminase Reaction of a Class II Amidotransferase, Biochemistry 38, 3677-3682.
51. Boehlein, S., Richards, N., and Schuster, S. (1994) Glutamine-dependent
nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad, J. Biol. Chem. 269, 7450-7457.
52. Van Heeke, G., and Schuster, S. (1989) The N-terminal cysteine of human
asparagine synthetase is essential for glutamine-dependent activity, J. Biol. Chem. 264, 19475-19477.
53. Miles, B. W., and Raushel, F. M. (2000) Synchronization of the Three Reaction
Centers within Carbamoyl Phosphate Synthetase Biochemistry 39, 5051-5056. 54. Kim, J. H., Krahn, J. M., Tomchick, D. R., Smith, J. L., and Zalkin, H. (1996)
Structure and Function of the Glutamine Phosphoribosylpyrophosphate Amidotransferase Glutamine Site and Communication with the Phosphoribosylpyrophosphate Site, J. Biol. Chem. 271, 15549-15557.
55. Li, K. K., Beeson, W. T. t., Ghiviriga, I., and Richards, N. G. (2007) A convenient
gHMQC-based NMR assay for investigating ammonia channeling in glutamine-dependent amidotransferases: studies of Escherichia coli asparagine synthetase B, Biochemistry 46, 4840-4849.
56. Markin, R. S., Luehr, C. A., and Schuster, S. M. (1981) Kinetic mechanism of
beef pancreatic L-asparagine synthetase, Biochemistry 20, 7226-7232.
146
57. Mullins, L. S., and Raushel, F. M. (1999) Channeling of Ammonia through the Intermolecular Tunnel Contained within Carbamoyl Phosphate Synthetase, Journal of the American Chemical Society 121, 3803-3804.
58. Larsen, T. M., Boehlein, S. K., Schuster, S. M., Richards, N. G. J., Thoden, J. B.,
Holden, H. M., and Rayment, I. (1999) Three-Dimensional Structure of Escherichia coli Asparagine Synthetase B: A Short Journey from Substrate to Product, Biochemistry 38, 16146-16157.
59. Richards, N. G., and Schuster, S. M. (1998) Mechanistic issues in asparagine
synthetase catalysis, Adv. Enzymol. Relat. Areas Mol. Biol. 72, 145-198. 60. Tso, J. Y., Zalkin, H., van Cleemput, M., Yanofsky, C., and Smith, J. M. (1982)
Nucleotide sequence of Escherichia coli purF and deduced amino acid sequence of glutamine phosphoribosylpyrophosphate amidotransferase., J. Biol. Chem. 257, 3525-3531.
61. Tso, J. Y., Hermodson, M. A., and Zalkin, H. (1982) Glutamine
phosphoribosylpyrophosphate amidotransferase from cloned Escherichia coli purF. NH2-terminal amino acid sequence, identification of the glutamine site, and trace metal analysis., J. Biol. Chem. 257, 3532-3536.
62. Badet, B., Vermoote, P., Haumont, P. Y., Lederer, F., and Le Goffic, F. (2002)
Glucosamine synthetase from Escherichia coli: purification, properties, and glutamine-utilizing site location, Biochemistry 26, 1940-1948.
63. van den Heuvel, R. H. H., Curti, B., Vanoni, M. A., and Mattevi, A. (2004)
Glutamate synthase: a fascinating pathway from L-glutamine to L-glutamate, Cell. Mol. Life Sci. 61, 669-681.
64. Bork, P., and Koonin, E. V. (1994) A P-loop-like motif in a widespread ATP
pyrophosphatase domain: Implications for the evolution of sequence motifs and enzyme activity, Proteins: Struct., Funct., Genet. 20, 347-355.
65. Tesmer, J. G., Klem, T. J., Deras, M. L., Davisson, V. J., and Smith, J. L. (1996)
The crystal structure of GMP synthetase reveals a novel catalytic triad and is a structural paradigm for two enzyme families, Nat. Struct. Biol. 3, 74-86.
66. Lemke, C. T., and Howell, P. L. (2001) The 1.6 Å Crystal Structure of E. coli
Argininosuccinate Synthetase Suggests a Conformational Change during Catalysis, Structure 9, 1153-1164.
67. Sun, M., and Leyh, T. S. (2006) Channeling in Sulfate Activating
Complexes Biochemistry 45, 11304-11311.
147
68. Bachmann, B. O., Li, R., and Townsend, C. A. (1998) β -Lactam synthetase: A new biosynthetic enzyme, Proc. Natl. Acad. Sci. U. S. A. 95, 9082-9086.
69. Bachmann, B. O., and Townsend, C. A. (2000) Kinetic Mechanism of the β-
Lactam Synthetase of Streptomyces clavuligerusae, Biochemistry 39, 11187-11193.
70. Miller, M. T., Gerratana, B., Stapon, A., Townsend, C. A., and Rosenzweig, A. C.
(2003) Crystal Structure of Carbapenam Synthetase (CarA), J. Biol. Chem. 278, 40996-41002.
71. Mueller, E. G., and Palenchar, P. M. (1999) Using genomic information to
investigate the function of ThiI, an enzyme shared between thiamin and 4-thiouridine biosynthesis, Protein Sci. 8, 2424-2427.
72. Rizzi, M., Bolognesi, M., and Coda, A. (1998) A novel deamido-NAD(+)-binding
site revealed by the trapped NAD-adenylate intermediate in the NAD(+) synthetase structure, Structure 6, 1129-1140.
73. DeLano, W. L. (2008) The PyMOL Molecular Graphics System, DeLano
Scientific Software LLC, Palo Alto, CA. 74. Miller, M. T., Bachmann, B. O., Townsend, C. A., and Rosenzweig, A. C. (2001)
Structure of β-lactam synthetase reveals how to synthesize antibiotics instead of asparagine, Nat. Struct. Biol. 8, 684-689.
75. Miller, M. T., Bachmann, B. O., Townsend, C. A., and Rosenzweig, A. C. (2002)
The catalytic cycle of β -lactam synthetase observed by x-ray crystallographic snapshots, Proc. Natl. Acad. Sci. U. S. A. 99, 14752-14757.
76. Parr, I. B., Boehlein, S. K., Dribben, A. B., Schuster, S. M., and Richards, N. G.
(1996) Mapping the aspartic acid binding site of Escherichia coli asparagine synthetase B using substrate analogs, J. Med. Chem. 39, 2367-2378.
77. Gutierrez, J. A. (2006) 2006, p 104, Univeristy of Florida, Gainesville, FL. 78. Cooney, D. A., Driscoll, J. S., Milman, H. A., Jayaram, H. N., and Davis, R. D.
(1976) Inhibitors of L-Asparagine Synthetase, Invitro, Cancer Treat. Rep. 60, 1493-1557.
79. Cooney, D. A., Jones, M. T., Milman, H. A., Young, D. M., and Jayaram, H. N. (1980) Regulators of the metabolism of -asparagine: A search for endogenous inhibitors, Int. J. Biochem. 11, 519-539.
80. Wolfenden, R. (1969) Transition State Analogues for Enzyme Catalysis, Nature
223, 704-705.
148
81. Koroniak, L., Ciustea, M., Gutierrez, J. A., and Richards, N. G. (2003) Synthesis and characterization of an N-acylsulfonamide inhibitor of human asparagine synthetase, Org. Lett. 5, 2033-2036.
82. Koizumi, M., Hiratake, J., Nakatsu, T., Kato, H., and Oda, J. i. (1999) A Potent
Transition-State Analogue Inhibitor of Escherichia coli Asparagine Synthetase A, Journal of the American Chemical Society 121, 5799-5800.
83. Boehlein, S. K., Nakatsu, T., Hiratake, J., Thirumoorthy, R., Stewart, J. D.,
Richards, N. G. J., and Schuster, S. M. (2001) Characterization of Inhibitors Acting at the Synthetase Site of Escherichia coli Asparagine Synthetase B, Biochemistry 40, 11168-11175.
84. Richards, N. G., and Kilberg, M. S. (2006) Asparagine synthetase chemotherapy,
Annu. Rev. Biochem. 75, 629-654. 85. Rooseboom, M., Jan N. M. Commandeur, Nico P. E. Vermeulen. (2004)
Enzyme-Catalyzed Activation of Anticancer Prodrugs, Pharmacol. Rev. 56, 53-102.
86. Lipinski, C. A., Lombardo, F., Dominy, B. W., and Feeney, P. J. (1997)
Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings, Adv. Drug Delivery Rev. 23, 3-25.
87. Shuman, D. A., Robins, R. K., and Robins, M. J. (2002) Synthesis of adenine 5'-
O-sulfamoyl nucleosides related to nucleocidin, J. Am. Chem. Soc. 91, 3391-3392.
88. O'Brien, W. E. (1976) A continuous spectrophotometric assay for
argininosuccinate synthetase based on pyrophosphate formation, Anal. Biochem. 76, 423-430.
89. Morrison, J. F., and Walsh, C. T. (1988) The behavior and significance of slow-
binding enzyme inhibitors, Adv. Enzymol. Relat. Areas Mol. Biol. 61, 201-301. 90. Tokutake, N., Hiratake, J., Katoh, M., Irie, T., Kato, H., and Oda, J. i. (1998)
Design, synthesis and evaluation of transition-state analogue inhibitors of Escherichia coli [gamma]-glutamylcysteine synthetase, Bioorg. Med. Chem. 6, 1935-1953.
91. Hiratake, J. (2005) Enzyme inhibitors as chemical tools to study enzyme
catalysis: rational design, synthesis, and applications, Chem. Rec. 5, 209-228.
149
92. Campbell, E. B., Hayward, M. L., and Griffith, O. W. (1991) Analytical and preparative separation of the diastereomers of -buthionine (SR)-sulfoximine, a potent inhibitor of glutathione biosynthesis, Anal. Biochem. 194, 268-277.
93. Manning, J. M., Moore, S., Rowe, W. B., and Meister, A. (1969) Identification of
L-methionine S-sulfoximine as the diastereoisomer of L-methionine SR-sulfoximine that inhibits glutamine synthetase, Biochemistry 8, 2681-2685.
94. Wilmouth, R. C., Edman, K., Neutze, R., Wright, P. A., Clifton, I. J., Schneider, T.
R., Schofield, C. J., and Hajdu, J. (2001) X-ray snapshots of serine protease catalysis reveal a tetrahedral intermediate, Nat. Struct. Biol. 8, 689-694.
95. Topf, M., Varnai, P., and Richards, W. G. (2002) Ab Initio QM/MM Dynamics
Simulation of the Tetrahedral Intermediate of Serine Proteases: Insights into the Active Site Hydrogen-Bonding Network, J. Am. Chem. Soc. 124, 14780-14788.
96. Bernier, S., Akochy, P.-M., Lapointe, J., and Chênevert, R. (2005) Synthesis and
aminoacyl-tRNA synthetase inhibitory activity of aspartyl adenylate analogs, Bioorg. Med. Chem. 13, 69-75.
97. Heacock, D., Forsyth, C. J., Shiba, K., and MusierForsyth, K. (1996) Synthesis
and aminoacyl-tRNA synthetase inhibitory activity of prolyl adenylate analogs, Bioorg. Chem. 24, 273-289.
98. Ueda, H., Shoku, Y., Hayashi, N., Mitsunaga, J., In, Y., Doi, M., Inoue, M., and
Ishida, T. (1991) X-Ray Crystallographic Conformational Study of 5'-O- N-(L-Alanyl)-Sulfamoyl Adenosine, a Substrate-Analog for Alanyl Transfer-Rna Synthetase, Biochim. Biophys. Acta 1080, 126-134.
99. Larsen, T. M., Boehlein, S. K., Schuster, S. M., Richards, N. G., Thoden, J. B.,
Holden, H. M., and Rayment, I. (1999) Three-dimensional structure of Escherichia coli asparagine synthetase B: a short journey from substrate to product, Biochemistry 38, 16146-16157.
100. Quadri, L. E. N., Sello, J., Keating, T. A., Weinreb, P. H., and Walsh, C. T. (1998)
Identification of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for assembly of the virulence-conferring siderophore mycobactin, Chem. Biol. 5, 631-645.
101. Somu, R. V., Boshoff, H., Qiao, C., Bennett, E. M., Barry, C. E., and Aldrich, C.
C. (2005) Rationally Designed Nucleoside Antibiotics That Inhibit Siderophore Biosynthesis of Mycobacterium tuberculosis, J. Med. Chem. 49, 31-34.
150
102. Raber, M. L., Freeman, M. F., and Townsend, C. A. (2009) Dissection of the Stepwise Mechanism to β-Lactam Formation and Elucidation of a Rate-determining Conformational Change in β-Lactam Synthetase, J. Biol. Chem. 284, 207-217.
103. Arnett, S. O., Gerratana, B., and Townsend, C. A. (2007) Rate-Limiting Steps
and Role of Active Site Lys443 in the Mechanism of Carbapenam Synthetase, Biochemistry 46, 9337-9345.
104. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye binding, Analytical Biochemistry 72, 248-254.
105. Raber, M. L., Arnett, S. O., and Townsend, C. A. (2009) A Conserved Tyrosyl-
Glutamyl Catalytic Dyad in Evolutionarily Linked Enzymes: Carbapenam Synthetase and β-Lactam Synthetase, Biochemistry 48, 4959-4971.
106. Dubendorff, J. W., and Studier, F. W. (1991) Controlling basal expression in an
inducible T7 expression system by blocking the targer T7 promoter with lac repressor, J. Mol. Biol. 219, 45-59.
107. Studier, F. W., and Moffatt, B. A. (1986) Use of Bacteriophage-T7 RNA-
Polymerase to direct selective high-level expresion of cloned genes, J. Mol. Biol. 189, 113-130.
108. Boehlein, S. K., Richards, N. G., Walworth, E. S., and Schuster, S. M. (1994)
Arginine 30 and asparagine 74 have functional roles in the glutamine dependent activities of Escherichia coli asparagine synthetase B, J Biol Chem 269, 26789-26795.
109. Boehlein, S. K., Stewart, J. D., Walworth, E. S., Thirumoorthy, R., Richards, N.
G. J., and Schuster, S. M. (1998) Kinetic Mechanism of Escherichia coli Asparagine Synthetase B, Biochemistry 37, 13230-13238.
110. Boehlein, S. K., Walworth, E. S., Richards, N. G., and Schuster, S. M. (1997)
Mutagenesis and chemical rescue indicate residues involved in beta-aspartyl-AMP formation by Escherichia coli asparagine synthetase B, J. Biol. Chem. 272, 12384-12392.
111. Sheng, S., Moraga-Amador, D., van Heeke, G., Allison, R., Richards, N., and
Schuster, S. (1993) Glutamine inhibits the ammonia-dependent activities of two Cys-1 mutants of human asparagine synthetase through the formation of an abortive complex, J. Biol. Chem. 268, 16771-16780.
112. Voet, D., and Voet, J. (l990) Biochemistry, John Wiley and Sons, New York.
151
113. Cohn, M., and Hu, A. (1980) Isotopic oxygen-18 shifts in phosphorus-31 NMR of adenine nucleotides synthesized with oxygen-18 in various positions, J. Am. Chem. Soc. 102, 913-916.
114. Villafranca, J. J. (1989) Positional isotope exchange using phosphorus-31
nuclear magnetic resonance, Methods Enzymol. 177, 390-403. 115. Vanwazer, J. R., Callis, C. F., Shoolery, J. N., and Jones, R. C. (1956) Principles
of Phosphorus Chemistry 2. Nuclear Magnetic Resonance Measurements, J. Am. Chem. Soc. 78, 5715-5726.
116. Midelfort, C. F., and Rose, I. A. (1976) A stereochemical method for detection of
ATP terminal phosphate transfer in enzymatic reactions. Glutamine synthetase, J. Biol. Chem. 251, 5881-5887.
117. Raushel, F. M., and Villafranca, J. J. (1980) Phosphorus-31 nuclear magnetic
resonance application to positional isotope exchange reactions catalyzed by Escherichia coli carbamoyl-phosphate synthetase: analysis of forward and reverse enzymic reactions, Biochemistry 19, 3170-3174.
118. Mullins, L. S., Hong, S.-B., Gibson, G. E., Walker, H., Stadtman, T. C., and
Raushel, F. M. (1997) Identification of a Phosphorylated Enzyme Intermediate in the Catalytic Mechanism for Selenophosphate Synthetase, J. Am. Chem. Soc. 119, 6684-6685.
119. Williams, L., Fan, F., Blanchard, J. S., and Raushel, F. M. (2008) Positional
Isotope Exchange Analysis of the Mycobacterium smegmatis Cysteine Ligase (MshC) Biochemistry 47, 4843-4850.
120. Williams, L., Zheng, R., Blanchard, J. S., and Raushel, F. M. (2003) Positional
Isotope Exchange Analysis of the Pantothenate Synthetase Reaction, Biochemistry 42, 5108-5113.
121. Boehlein, S., Richards, N., Walworth, E., and Schuster, S. (1994) Arginine 30
and asparagine 74 have functional roles in the glutamine dependent activities of Escherichia coli asparagine synthetase B, J. Biol. Chem. 269, 26789-26795.
122. Myers, R. S., Jensen, J. R., Deras, I. L., Smith, J. L., and Davisson, V. J. (2003)
Substrate-Induced Changes in the Ammonia Channel for Imidazole Glycerol Phosphate Synthase, Biochemistry 42, 7013-7022.
123. Miles, B. W., Banzon, J. A., and Raushel, F. M. (1998) Regulatory Control of the
Amidotransferase Domain of Carbamoyl Phosphate Synthetase, Biochemistry 37, 16773-16779.
152
124. Mullins, L. S., and Raushel, F. M. (1999) Channeling of Ammonia through the Intermolecular Tunnel Contained within Carbamoyl Phosphate Synthetase, J. Am Chem Soc 121, 3803-3804.
125. Raushel, F. M., and Villafranca, J. J. (1988) Positional Isotope Exchange, Crit.
Rev. Biochem. Mol. Biol. 23, 1-26. 126. Ghose, C., and Raushel, F. M. (1985) Determination of the mechanism of the
argininosuccinate synthetase reaction by static and dynamic quench experiments, Biochemistry 24, 5894-5898.
127. Hilscher, L. W., Hanson, C. D., Russell, D. H., and Raushel, F. M. (1985)
Measurement of positional isotope exchange rates in enzyme-catalyzed reactions by fast atom bombardment mass spectrometry: application to argininosuccinate synthetase, Biochemistry 24, 5888-5893.
128. Von der Saal, W., Crysler, C. S., and Villafranca, J. J. (1985) Positional isotope
exchange and kinetic experiments with Escherichia coli guanosine 5'-monophosphate synthetase, Biochemistry 24, 5343-5350.
129. Thompson, J. S., and Edmoinds, O. P. (1980) Safety Aspects of hadling the
potent allergen FDNB, Ann Occup Hyg 23, 27-33. 130. Boehlein, S. K., Richards, N. G., and Schuster, S. M. (1994) Glutamine-
dependent nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad, J. Biol. Chem. 269, 7450-7457.
131. Boehlein, S. K., Schuster, S. M., and Richards, N. G. (1996) Glutamic acid
gamma-monohydroxamate and hydroxylamine are alternate substrates for Escherichia coli asparagine synthetase B, Biochemistry 35, 3031-3037.
132. Li, K. (2007) Intramolecular tunnel and regulatory mechanisms of asparagine
synthetase, in Dept of Chemistry, p 120, University of Florida, Gainesville, FL. 133. Ducruix, A., Giege, R. , (Ed.) (1992) Crystallization of Nucleic Acids and Proteins:
A Practical Approach, Oxford University Press New York. 134. Weber, P. C., and Charles W. Carter, Jr. (1997) Overview of protein
crystallization methods, in Methods Enzymol., pp 13-22, Academic Press. 135. Jancarik, J., and Kim, S.-H. (1991) Sparse matrix sampling: a screening method
for crystallization of proteins, J. Appl. Crystallogr. 24, 409-411.
153
136. Newman, J., Egan, D., Walter, T. S., Meged, R., Berry, I., Ben Jelloul, M., Sussman, J. L., Stuart, D. I., and Perrakis, A. (2005) Towards rationalization of crystallization screening for small- to medium-sized academic laboratories: the PACT/JCSG+ strategy, Acta Crystallogr., Sect. D: Biol. Crystallogr. 61, 1426-1431.
137. Jayaram, H. N., Cooney, D. A., Milman, H. A., Homan, E. R., and Rosenbluth, R.
J. (1976) Don, conv and donv--I. Inhibition of L-asparagine synthetase in vitro, Biochem. Pharmacol. 25, 1571-1582.
138. Mehlhaff, P. M., and Schuster, S. M. (1991) Bovine pancreatic asparagine
synthetase explored with substrate analogs and specific monoclonal antibodies, Arch. Biochem. Biophys. 284, 143-150.
139. Mouilleron, S., Badet-Denisot, M.-A., and Golinelli-Pimpaneau, B. (2006)
Glutamine Binding Opens the Ammonia Channel and Activates Glucosamine-6P Synthase, J. Biol. Chem. 281, 4404-4412.
140. van den Heuvel, R. H. H., Svergun, D. I., Petoukhov, M. V., Coda, A., Curti, B.,
Ravasio, S., Vanoni, M. A., and Mattevi, A. (2003) The Active Conformation of Glutamate Synthase and its Binding to Ferredoxin, J. Mol. Biol. 330, 113-128.
141. LaRonde-LeBlanc, N., Resto, M., and Gerratana, B. (2009) Regulation of active
site coupling in glutamine-dependent NAD+ synthetase, Nat. Struct. Mol. Biol. 16, 421-429.
142. Reed, L. J., and Muench, H. (1938) A simple methods of estimating fifter per cent
endpoints, Am. J. Epidemiol. 27, 493-497. 143. McDonald, H. M., Pruett, P. S., Deivanayagam, C., Protasevich, I. I., Carson, W.
M., DeLucas, L. J., Brouillette, W. J., and Brouillette, C. G. (2007) Structural adaptation of an interacting non-native C-terminal helical extension revealed in the crystal structure of NAD+ synthetase from Bacillus anthracis, Acta Crystallographica Section D 63, 891-905.
144. Mueller-Dieckmann, J. (2006) The open-access high-throughput crystallization
facility at EMBL Hamburg, Acta Crystallogr., Sect. D: Biol. Crystallogr. 62, 1446-1452.
145. Boehlein, S. K., Walworth, E. S., and Schuster, S. M. (1997) Identification of
cysteine-523 in the aspartate binding site of Escherichia coli asparagine synthetase B, Biochemistry 36, 10168-10177.
146. Vachette, P., and Svergun, D. (1995) Small X-Ray Scattering by Solutions of
Biological Macromolecules, in Spectroscopic Techniques in Biophysics (Giacometti, G. M., and Giacometti, G., Eds.), IOS Press, Amsterdam.
154
147. Pilz, I. (1982) Proteins, in Small Angle X-Ray Scattering (Glatter, O., and Kratky,
O., Eds.), pp 239-293, Academic Press, New York. 148. Tremblay, L. W., Fan, F., Vetting, M. W., and Blanchard, J. S. (2008) The 1.6 Ã…
Crystal Structure of Mycobacterium smegmatis MshC: The Penultimate Enzyme in the Mycothiol Biosynthetic Pathway†Biochemistry 47, 13326-13335.
149. Georgiou, G., and Valax, P. (1996) Expression of correctly folded proteins in
Escherichia coli, Curr. Opin. Biotechnol. 7, 190-197. 150. Hammarstrom, M., Hellgren, N., van den Berg, S., Berglund, H., and Hard, T.
(2002) Rapid screening for improved solubility of small human proteins produced as fusion proteins in Escherichia coli, Protein Sci. 11, 313-321.
151. Kapust, R. B., Tozser, J., Copeland, T. D., and Waugh, D. S. (2002) The P1'
specificity of tobacco etch virus protease, Biochem. Biophys. Res. Commun. 294, 949-955.
152. Jenny, R. J., Mann, K. G., and Lundblad, R. L. (2003) A critical review of the
methods for cleavage of fusion proteins with thrombin and factor Xa, Protein Expression Purif. 31, 1-11.
153. Nallamsetty, S., Kapust, R. B., Tozser, J., Cherry, S., Tropea, J. E., Copeland, T.
D., and Waugh, D. S. (2004) Efficient site-specific processing of fusion proteins by tobacco vein mottling virus protease in vivo and in vitro, Protein Expression Purif. 38, 108-115.
154. Ren, H., and Liu, J. (2006) AsnB is involved in natural resistance of
Mycobacterium smegmatis to multiple drugs, Antimicrob. Agents Chemother. 50, 250-255.
155
BIOGRAPHICAL SKETCH
Megan Elizabeth Meyer was born in Lakewood, OH in September of 1983. After
graduating from Vermilion High School, she went to Seton Hall University in South
Orange, NJ to pursue a college softball career and biochemistry degree. After winning
two Big East softball championships with the Pirates and successfully obtaining a
biochemistry degree, she moved to Gainesville, FL to become a Florida Gator. While at
University of Florida, she pursued a PhD in chemistry under the direction of Dr. Nigel
Richards working on the characterization of asparagine synthetase.
