Increasing of Plant Resistance to Nematodes Using RNAi-Technology

ISSN 0095�4527, Cytology and Genetics, 2013, Vol. 47, No. 4, pp. 222–230. © Allerton Press, Inc., 2013.Original Ukrainian Text © V.A. Tsygankova, A.I. Yemets, H.O. Iutinska, L.O. Beljavska, A.P. Galkin, Ya.B. Blume, 2013, published in Tsitologiya i Genetika, 2013, Vol. 47, No. 4,pp. 35–45.

222

INTRODUCTION

Parasitic nematodes belong to the most widespreadpathogenic organisms that cause diseases of culturalplants and prevent the successful development ofmodern plant cultivation across the world. Annualharvest losses from these pests in the world are morethan 20% which is in monetary terms equivalent to125 billion USD [1]. Currently, more than 4100 differ�ent species of parasitic nematodes are identified. InUkraine’s agriculture, the greatest losses due to theglobal spread and capacity to destroy a wide range ofcrops, in particular, important crops like sugar beetand rape, is caused by an endoparasitic nematode ofthe superfamily Tylenchoidea, which includes familiesof root cysts forming the nematodes Heteroderidae andGloboderidae, as well as family of the gallic nematodeMeloidogynidae [2]. The physiological manifestationof nematode invasion in plants can be poor growth;chlorosis; withering; leaf thinning and curling of leafsor a change in their color (reddening or browning);insufficient ripening and untimely drop of fruits;increased sensitivity to other diseases, caused byintense usage of water and nutrients by nematodesfrom vessels of plants, the lack of which inhibits thegrowth and development of the latter [3].

The currently existing methods for controlling thedistribution of nematodes and the reduction in theyield of important crops caused by them are chemi�cally synthesized soil fumigants, nematicides (belong�

ing to the classes of organophosphates and carbam�ates), and different types of insecticides of natural ori�gin, for example, phytoinsecticide pyrethryn and itssynthetic analogs, i.e., pyrethroids [4]. In most coun�tries worldwide, however, a trend is observed towardspractically restricting their use because of their hightoxicity to humans and contamination of the environ�ment. Traditional methods to regulate the amount ofparasite nematodes also include different biocontroltechnologies, i.e., application of different organic soilfertilisers and industrial waste of vegetable or animalorigin, compost, and changes in soil pH (acidificationof up to pH 4 or alcalinization of up to pH 8); intro�duction of antagonistic and competitive microorgan�isms (bacteria of the strains Burkholderia cepacia andBacillus chitinosporus and the fungi�micromycetesMyrothecium verrucaria and Paecilomyces lilacinus) tosoil; crop rotation with the development of culturesresistant to nematodes, using biopreparations thatcontain essential oils of different herbs with an antine�matodic effect (for example, the oil of sesame, garlic,rosemary, or white pepper); etc. Unfortunately, a com�bination of the above�listed methods can only depressthe high viability of this pest class.

Alternative antiparasitic means, which are notharmful to human health and the environment, arebiopreparations of domestic production: (1) bioprepa�ration Averkom developed at the Zabolotny Instituteof Microbiology and Virology, National Academy of

Increasing the Resistance of Rape Plants to the Parasitic Nematode Heterodera schachtii Using RNAi Technology

V. A. Tsygankovaa, A. I. Yemetsb, H. O. Iutinskac, L. O. Beljavskac, A. P. Galkinb, and Ya. B. Blumeb

a Institute of Bioorganic Chemistry and Petrochemistry, National Academy of Sciences of Ukraine, Kyivb Institute of Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv

c Zabolotny Institute of Microbiology and Virology, National Academy of Sciences of Ukraine, Kyive�mail: [email protected]

Received June 8, 2012

Abstract—A vector for the constitutive expression of antisense to the conservative region of the 8H07 gene ofthe nematode H.schachtii dsRNA is constructed and a genetic transformation of rape plants is conducted bymeans of A. tumefaciens. Using molecular genetic methods, the presence of the vector expression of antine�matode dsRNA in the genome of transgenic rape plants is shown, as well as the high level of their silencingactivity is confirmed both in nematodes and in infected plants. In laboratory studies, a considerable increasein the tolerance of transgenic rape plants to the root parasitic nematode H. schachtii was shown for physio�logical signs.

Keywords: RNA interference, small regulatory si/miRNA, root parasitic nematode H. schachtii, expressionvectors of antinematode dsRNA, A. tumefaciens–mediated genetic transformation, transgenic rape plantsresistant to nematodes

DOI: 10.3103/S0095452713040105

CYTOLOGY AND GENETICS Vol. 47 No. 4 2013

INCREASING THE RESISTANCE OF RAPE PLANTS TO THE PARASITIC NEMATODE 223

Sciences of Ukraine, on the basis of metabolites of thesoil streptomycete Streptomyces avermitilis UKMAc�2179, which contains antiparasitic antibioticsavermectines and a complex of biologically activecompounds, namely, aminoacids, lipids (includingfree fatty acids), vitamins of the B group, and phyto�hormones [5]; (2) regulators Biogene, Stimpo, andRegoplant, created at the Institute of BioorganicChemistry and Petrochemistry, National Academy ofSciences of Ukraine, in association with NationalEnterprise Interdepartmental Science and Technol�ogy Center “Agrobiotech” of the National Academy ofSciences and the Ministry of Education, Science andSport of Ukraine. These regulators contain antipara�sitic antibiotics aversectines (metabolism products ofthe soil streptomycete S. avermitilis) and products ofvital functions (aminoacids, fatty acids, polysaccha�rides, phytohormones, and microelements) in vitroculture of fungus�micromycete isolated from thePanax ginseng root system [6]. At the same time, a newperspective direction of the plant defence from agri�cultural pests is to increase plant resistance usinggenetic engineering techniques, among which RNAinterference technologies (RNAi or posttranscrip�tional gene silencing) are of considerable interest. Themain role in RNAi process belongs to small regulatorysi/miRNA (with a size of 21–25 nt), at the participa�tion of which, together with exo� and endonucleasesof the RISC complex (RNA�induced silencing com�plex) and AGO proteins, either blocking mRNAtranslation of pathogenic and parasitic organisms ortheir ensymatic destruction and degradation [7, 8]occurs.

Currently, methods have been developed andexpression vectors of antinematode si/miRNA havebeen designed. To this end, as target genes for silencingthe most important genes for the vital cycle of nema�todes are selected, in particular genes for the control ofDNA replication, transcription, RNA processing,synthesis of tRNA, translation, control of ribosomefunctioning and tRNA, control of modification pro�cesses, secretion and protein transfer, control of theirstability and degradation, and control of the function�ing of mitochondrions and the metabolism of proteinmediators; genes for the control of the cell cycle (pro�teins of cytoskeleton, i.e., tubulins) and the cell struc�ture, transfer of endo� and intercell signals, processesof endocytose, and ionic regulation; genes of nema�todes ensimes, destroying cell walls in plant roots;genes of the secretory proteins of esophageal glands(the expression of which is necessary for the penetra�tion of nematode stylet into special root cells, i.e.,feeding sites); genes of the reproductive cycle (majorsperm proteins); and the genes of chitinsynthetase(with the participation of which the solid chitinouscover on the nematode eggs is formed) [9–15].

Genetic constructions with si/miRNA expressionvectors for silencing genes of plants hosts, whichhyperexpress in the period of plant infection and

thereof promote the penetration and reproduction ofparasitic nematodes in roots, were also created. Themost important ones include the following gene fami�lies: pathogenesis�related proteins (PRPs), proteintransporter of auxin PIN2 (EIR), proteins of ethyl�ene�responsive factors (ERFs) and of some transcrip�tion factors (AP2, MADS�box, bZIP, bHLH, andNAC genes), gibberellin regulatory proteins, enrichedwith the proline the extensin�similar proteins, pro�teins�transporters of nitrates NTP2, as well as thegenes of pectinesterase, ferritin, cytochrome P450,chalcon synthaze, cell wall metabolism proteins, etc.[16, 17].

Previously, we cloned the 8H07 gene which codesone important secretary protein of esophageal glandsof the parasitic nematode H. schachtii, as well as con�ducted PCR amplification of the conservative regionof this gene. Using the Northern blot hybridizationmethod, we confirmed the high level of homologybetween its sequences and the sequences of antinema�tode (antisense to the CR�region of the gene) smallregulatory si/miRNA isolated from rape plants (Bras�sica rapa ssp. oleifera), which were infected andtreated with growth regulator Regoplant [18]. That iswhy the aim of this work was to create vector consruc�tions with constitutive si/miRNA expression specificto the conservative 8H07 gene region of the parasiticnematode H. schachtii and obtaining transgenic rapeplants with increased tolerance to pests.

MATERIALS AND METHODS

Vector constructions for RNA interference. Toachieve the effect of RNA interference against theconservative region of the 8H07 gene of the nematodeH. schachtii, we created constructions, using thepHannibal vector [10, 19], which were then subclonedin the NotI site of the binary pArt27 vector [20] (Fig. 1).Restriction, ligation of DNA, and preparation of plas�mid DNA were performed in accordance with recom�mendations [21, 22].

Using a standard heat shock, a binary vector wasintroduced into the Agrobacterium tumefaciens C58strain, which was later cultivated on a nutrient LBmedium, containing 25 mg/mL of kanamycin [22].The verification of the A. tumefaciens C58 strain for thepresence of the pArt27 plasmid was carried out by thealkali isolation of the plasmid, followed by fraction�ation using electrophoresis in a 0.8% agar gel (Fig. 2)[22].

Obtaining of transgenic RNA�interferenced rapeplants and verification of their tolerance for nematodeH. schachtii. Rape plants were grown until the flower�ing stage under greenhouse conditions in sterile soil at20–24°C (at night and during the day, respectively).The first leaf buds were cut off for the removal of apicaldomination and the synchronized occurrence ofrepeated secondary buds. Transformation was per�

224


TSYGANKOVA et al.

formed with the help of the deep floral method (at theflowering stage, which is the most susceptible to trans�formation) with the help of immersion of developedfloral tissues in a solution containing A. tumefaciens,5% of sucrose, and a 0.05% solution (500 μL/L) ofsurfactant Silwet L�77 (to improve the efficiency oftransformation) [23]. Treatment of flowers of the rape

with the A. tumefaciens was performed more than onceand covered with a polyethylene cap to preserve mois�ture. After transformation, the plants were transferredto a dark box for 24 h and were then placed under dif�fused light and grown during the vegetation period.

Seeds obtained from the transgenic plants weresterilized during 1 min with 96% ethanol and during20 min in a 30% aqueous solution of the commercialBilyzna preparation with the addition of 0.02% ofTween and then washed with sterile distilled water.Seeds were left to germinate for 7–10 days in Petricups in an aqueous kanamycin solution (20 mg/L) onan infectious background (with a suspension of thecyst nematode H. schachtii, from which nematode lar�vae appeared during the incubation process at 23°C onabout the fifth to seventh day) [24]. Identification ofthe transformed plants was conducted in the presenceof 3–5 formed green leaves and well�developed roots.

The resistance of 7�day�old seedlings of transgenicrape plants to parasite nematodes was determinedaccording to morphological signs as compared to theinfected control plants (Fig. 3). Rape roots for the cal�culation of the number of larvae parasitizing on themwere carefully washed under running water and thendipped in a solution of lactic acid, glycerol, aniline,and distilled water for few minutes, heated for 2 min ina microvawe oven, and air�dried. Root pieces 1.5 cmin length were put in a homogenizer. After this, thehomogenized roots were transferred in cylinders150 mL in volume with 100 mL of water and carefullyshaken and the number of nematodes, which had pen�etrated into the roots, was calculated [24]. Adult vege�tative plants were transplanted in sterile soil in flowerpots (Fig. 4).

Molecular biological analysis of genetically modi�fied plants. Isolation of total RNA preparations fromcells of the transgenic plants and larvae of H. schachtiinematodes parasiting on them was conducted accord�ing to the method in [18]. The polymerity of the iso�lated total RNA preparations was analyzed using elec�trophoresis in a 1.5% agar gel in the presence of 7 Murea (the gels were stained with a solution of ethidiumbromide).

The availability of the pArt27expression vector inthe presence of intron pyruvate orthophosphate diki�nase (pdk) [19] was verified by the method of RТ�PCRamplification of cDNA intron pdk, using primers spe�cific to its sequences (table) on the template of totalmRNA isolated from transgenic rape plants [18]. Anamplified fragment was fractioned using electrophore�sis in a 15% polyacrylamide gel PAGE, stained withethidium bromide (Fig. 5).

An expression analysis of antinematode si/miRNAin the transformed rape plants was carried out by theNorthern blot hybridization method of the sense andantisense si/miRNA sequences obtained from totalmRNA of plants with radioactive low�molecular�weight antisense� and sense [α�32P]�labeled RNA

NotI

EcoRI HindIII

XbaI NotIXnoI

SalI NotI BamHI

SalI

pHannibal

OCS terminatorIntrok pdk

CaMV 35S

S AS

RB

LB

pnos�np

nos3

Tn7SpR/StR

pArt27(10.9 kb)

oriT

oriCo1E1

oriVRK2

trfA*

lacZ'

tII�Fig. 1. Scheme of the insertion of amplified by PCRinverted cDNA sequences of a fragment of the conserva�tive region of the H. schachtii nematode 8H07 gene underthe control of the 35S promoter in the pHannibal vector,followed by subcloning at the NotI site of the pArt27 binaryvector: S, sense sequences containing XhoI�EcoRI restric�tion sites; AS, antisense fragments containing the HindIII�XbaI restriction sites.

Fig. 2. Fragments of the pArt27 plasmid, fractionated byelectrophoresis in a 0.8% agar gel.



probes [21] (Fig. 6). Originally, si/miRNA was isolatedaccording to the recommendations of Hamilton et al.[25], in compliance with which plant material cooledin liquid nitrogen and crushed was introduced forextraction in a buffer: 50 mM of Tris�HCl (pH 9),10 mM of EDTA, 100 mM of sodium chloride, and2% of SDS (5 mL/1 g of plant material). After extrac�tion, with the aim to remove proteins and polysaccha�rides, the homogenate was treated with equal volumesof buffer saturated with phenol–chloroform; nucleicacids were precipitated with the help of a solution con�tained 1/10 of the volume of 3 M sodium acetate(pH 5.0) and three volumes of absolute ethanol. After

incubation for 2 h at –20°C, the precipitate was cen�trifuged, washed with 70% ethanol, dried, and repeat�edly dissolved in double�distilled water. High�molecu�lar�weight nucleic acids were precipitated from thissolution by the addition of polyethylene glycol (with amolecular mass of 8000) and sodium chloride up tofinal concentrations of 5% and 500 mM, respectively,followed by incubation on ice for 30 min. After theprecipitate was removed by centrifugation, the low�molecular�weight si/miRNA that remained in thesupernatant was precipitated with the help of sodiumacetate and ethanol as described above; 50 μg of thisfraction containing si/miRNA was fractioned by 15%PAGE in the presence of 7 M urea.

Sense and antisense RNA probes were synthesizedwith the help of the in vitro Riboprobe TranscriptionSystem (Promega) [21] with the use of ribonucleotidesATP, GTP, and CTP and radiolabelled [α�32P] UTP(125 μCi on 20 μL of reaction mixture with a specificactivity of 3000 Ci/mmol), as well as T7 RNA poly�merase on the DNA template of a linearized pArt27plasmid denaturated at +80°C [26]. After conductinga transcription reaction, the probes were treated for20 min by DNase I at 37°C to remove DNA. To obtainlow�molecular�weight probes (with a size between 25and 50 bp), which are specific to isolated si/miRNA[27], we performed subsequent alkali hydrolysis offull�sized [α�32P]�labeled RNA probes at 60°C for2.5 h using 300 μL of carbonate buffer, which con�

(c)

(d)

(a) (b)

Fig. 4. General view of control and transgene rape plants grown on an artificially infected background (in the presence ofH. schachtii nematode larvae) and their seeds: (a) control plants; (b) experimental plants transformed by A. tumefaciens with thedsRNA expression vector which are specific to the conservative region of the 8H07 gene of the parasitic nematode H. schachtii;(c) seeds of control plants; and (d) seeds of transgenic plants.

(a) (b)

Fig. 3. Seven�day�old rape sprouts grown in laboratoryconditions on a background of H. schachtii infection,obtained from seeds of (b) control and (a) transgenicplants.

226


TSYGANKOVA et al.

tained 120 mM of Na2CO3 and 80 mM of NaHCO3 in20 μL of reaction mixture [25, 27]. After hydrolysis, weconsistently conducted neutralization of the solutionup to pH 5.0 with 20 μL of 3 M sodium acetate solu�tion. Low�molecular�weight RNA was later precipi�tated with 0.1 volume of 3 M solution of sodium ace�tate (pH 5.2), 2 μL of glycogen solution (10 mg/mL),and two volumes of 96% ethanol at –20°C for 30 min.After that, it was washed with 80% ethanol, dried, anddissolved in 30 μL of distilled water free fromnucleases, followed by their denaturation at +80°C for5 min.

From the gel, si/miRNA were transferred on anylon Zeta�Probe membrane by electroblotting (at300 mA for 1 h), and Northern blot hybridization ofsense and antisense sequences of si/miRNA with thecorresponding antisense and sense [α�32P]�labeledlow�molecular�weight RNA probes (for 24 h at 42°C)was carried out in a buffer containing 125 mM sodiumphosphate (pH 7.2), 250 mM sodium chloride, 7%SDS, and 50% deionized formamide, followed bydouble washing with a solution of 2 × SSC (1 × SSC =

150 mM of sodium chloride and 15 mM of sodium cit�rate, pH 7.0) and 0.2% of SDS for 30 min at 42°C.Nonhybridized (unspecified) regions were removed bythe incubation of membranes for 1 h at 37°C in abuffer containing 20 mM Tris�HCl (pH 7.5), 5 mMEDTA, 60 mM sodium chloride, and 10 mg/mLRNase. After this, the membranes were washed for 1 hwith a solution (2 × SSC and 96° ethanol) and exposedwith an X�ray film for 72 h [21, 22, 25, 27].

The changes in the expression level of the conser�vative region of the 8H07 gene of the nematodeH. schachtii (silencing efficiency) in cells of controllarvae of nematodes and nematodes parasitizing onroots of transgenic rape plants were verified by theNorthern blot hybridization of the total mRNA ofnematodes, previously fractioned by 15% PAGE withthe presence of 7 M urea [18], with antisense to theconservative region of the 8H07 gene [α�32P]�dCTPcDNA�probes (Fig. 7) [21, 22, 28]. To this end, thetotal preparation of RNA from nematode cells wasseparated into poly(A)+RNA (i.e., mRNA) andpoly(A)–mRNA on an oligo (dT)�cellulose column;cDNA was synthesized on template of poly(A)+RNAusing reverse transcriptase and [α�32P]�labeleddCTP; and PCR amplification of cDNA sequences ofthe conservative 8H07 gene region was performed withthe use of primers (F5'�ACAACTGCAGCAACAA�CAGAATCAGG�3'; R5'�CTTCCTCGCCATTCA�TCATCTTGCTC�3') specific to the gene sequencesallocated outside of the regions, which are the targetsfor RNAi�interference, deoxyoligonucleotides: dATP,dCTP, dTTP, and dCTP and radiolabelled [α�32P]dCTP ((10 μCi/μL), followed by the fractionation ofamplified cDNA by 15% PAGE with 7 M of urea. Thehybridization of the total mRNA of nematodes withantisense [α�32P]�labeled cDNA probes were con�ducted on nylon Zeta�Probe membranes for 24 h at42°C (the conditions of hybridization and the compo�sition of the hybridization buffer are similar to thosedenoted above).

(a) (b)

~22–25 bp

Fig. 6. Northern blot hybridization of sense and antisensesi/mi RNA sequences obtained from the total mRNA ofplants with [α�32P]�labeled (a) antisense and (b) senseRNA probes.

List of the primer sequences used for the amplification ofpdk intron

Primer Sequences

Number of nucleotide pairs obtained

by PCR

PDK�RT�R

5'�ATCAATGATAACA�

CAATGACATGATCT�3'

pIntronF 5'�GACGAAGAAGAT�AAAAGTTGAGAG�3'

300

pIntronR 5'�TTGATAAATTACA�AGCAGATTGGA�3'

Note: R and F designate reverse and forward sequences, respec�tively; RT�R is reverse sequences for the synthesis of a singlestrand of the cDNA template.

300 bp

Fig. 5. 15% PAGE of amplified by RT PCR sequences ofthe pdk intron.



The changes in the expression level of the conser�vative 8H07 gene region of transgenic rape plants (theefficiency of self�silencing) were identified by North�ern blot hybridization method of the sense sequencesof total mRNA of plants with antisense [α�32P]�labeled cDNA probes, obtained by the amplificationof cDNA sequences of the CR region of the 8H07 geneof plants using deoxyoligonucleotides dATP, dGTP,dTTP, and dCTP and radiolabelled [α�32P] dCTP(~10 μCi/μL), as well as primaries specific to this gene(F5'�TTATATCGATATGTCCGAGTCAAACAAG�3',R5'�ATATCGATCTAGAAAAAATTAGGGTTG�3'),followed by the fractionation of amplified cDNA in15% PAAG with 7 M of urea (the conditions ofhybridization and the composition of the hybridiza�tion buffer are similar to those defined above) [21,22, 28].

RESULTS AND DISCUSSION

It is known that a necessary condition to achievethe effective posttranscription silencing of genes isproviding a high and stable level of expression of het�erologous genes in transgenic plants [29–32]. To thisend, we selected the pHannibal vector [19] (Fig. 1).The sequences amplified with the help of PCR of thecDNA sequences of the fragment of the conservative8H07 gene region of the nematode H. schachtii wereplaced under the control of the constitutive 35S pro�moter and the OCS terminator (the region of termina�tion of transcription of the octopin–synthetase gene)as sense (S) (containing restriction sites XhoI�EcoRI)and inverted antisense (AS) fragments (containingrestriction sites HindIII�XbaI) into the pHannibalvector. An important feature of this vector is the pres�ence of sense and inverted antisense sequences, whichare templates for the synthesis of dsRNA moleculesinvolving RdRP�polymeraze (RNA�dependent RNApolymerase). This gives the possibility to avoid unde�sirable antisense suppression or cosuppression, whichoccurs in the case of transformation by vectors con�taining only one sense or antisense sequence [19]. Inaddition, the presence of the pdk intron as a spacer inthe pHannibal vector between sense and antisensesequences can increase the level of heterologous geneexpression and improve the silencing efficiency to100% compared to vectors without introns (48–58%)and those containing only antisense sequences (12%)[29–31]. This phenomenon can be explained byincreasing the transcription level of antisense dsRNAon a template of inserted si/miRNA sequences, thestability of si/miRNA in splicing processes, and theexport from nuclei to the cytoplasm. Hereinafter, thepHannibal vector is subcloned at the NotI site ofbinary vector pArt27 (Fig. 1).

We selected binary vector pArt27 [20], which has anumber of advantages: it contains Ri� and Ti�replicons(compared to other binary vectors that have only oneRi�plasmide minireplikon, which makes possible to

insert it at both A. rhizogenes and A. tumefaciensstrains) and minimum replicon RK2 for replication inEscherichia coli and Agrobacterium [33], as well as inthe ColE1 region for high�copy�number replication inE. coli. Owing to the presence of bacterial selectivemarkers, i.e., resistance genes to spectinomycin/strep�tomycin Tn7, obtained from the binary pMON530vector [34], and the chimeric gene of resistance tokanamicin, obtained from the pGA643 vector [35,36], for the selection of transgenic plants, media withthe addition of 100 mg/mL of spectinomycin,25 mg/mL of streptomycin, or 20 mg/mL of alterna�tive selective marker, namely, kanamycin, can be used.

The unique organizational structure of the pArt27vector contains the lacZ region with an enhancer ele�ment to the right of the 3'�end of T�DNA [37], fol�lowed by the chimeric selective marker of resistance tokanamycin (placed between the promoter of nopalinesynthase gene and the terminator of phosphotrans�pherase nopaline synthase gene), and to the left of the3'�end of T�DNA, i.e., a borderline fragment avoidinga reduction in the frequency of accidental termina�tions of transformation that frequently occurs duringusing vectors with other constructions [20, 35].

From the left section of T�DNA to the right, àmodified fragment (with the deletion of the SalI�NdeIsites) is located [20] which contains the marker gene ofβ�galactosidase that allows one to conduct histochem�ical screening in pArt27 recombinants on media with5�bromo�4�chloro�3�indolyl�β�D�galactosidase. Withthe aim to facilitate the cloning of sequences of thepHannibal expression vector, the unique NotI site wasplaced at the lacZ ' region [20].

The obtained agrobacterial strain A. tumefaciensC58 was verified for the presence of the pArt27 plasmidby the alkaline isolation of plasmid, followed by the

(a) (b) (c) (d)

Fig. 7. Northern blot analysis of the expression levels of theconservative 8H07 gene section: (a) in cells of nematodeH. schachtii larvae from roots of control plants; (b) in cellsof nematode H. schachtii larvae from roots of transgenicrape plants; in cells of control (c) and transgenic (d) rapeplants grown during the vegetation period on an infectiousbackground.

228


TSYGANKOVA et al.

subsequent fractioning on linear and ring moleculesusing electrophoresis in a 0.8% agar gel [22] (Fig. 2).

Transformation of rape plants by the expressionvector of antinemate dsRNA specific to the conserva�tive region 8H07 gene of the nematode H. schachtiiwas conducted by the deep floral method during theflowering stage. In addition, the application of thismethod does not need using a culture of cells and tis�sues in vitro for the regeneration of transformants;there is another advantage in the fact that the progenyof the obtained plants is genetically homogeneous(i.e., homozygous in the transgene locus) and deliv�ered from somaclonal variations that occurs in tissuecultures in vitro [23].

Figure 3 shows 7�day�old rape seedlings grown on aninfectious background (in the presence of H. schachtiinematode larvae) from seeds of control and trans�formed plants. Obviously, the observed difference inmorphological signs between the control (b) and stud�ied (a) transgenic plants is explained by increasedresistance of obtained transgenic rape plants to thenematode H. schachtii. It was found that the numberof larvae of this nematode that parasitized on roots oftransgenic rape plants reduced essentially (up to 80%)relative to control plants. Figure 4 demonstrates thedifference in the morphological signs of the control (a)and transgenic (b) rape plants grown in laboratoryconditions on an infectious background and seeds (c,d) obtained from these plants.

Using RT�PCR amplification of sequences of thepdk intron, with primers specific to its sequences(table) on a template of total mRNA (through cDNA)isolated from transgenic rape, followed by the frac�tionation of the amplified segment by 15% PAGE,stained with ethidium bromide, it was possible to verifythe presence of the expression of pArt27 vector in thegenome of the transgenic plants (Fig. 5). The size ofthe pdk intron sequences, amplified by us, was 300 bp,which is consistent with literature data [19].

The Northern blot method of hybridization ofsense and antisense sequences of si/miRNA, obtainedfrom the total mRNA of rape plants transformed with[α�32P]�labeled antisense (Fig. 6a) and sense (Fig. 6b)low�molecular�weight RNA probes, obtained in vitrotranscription on a DNA template of linearized pArt27plasmid [21, 22, 25, 27], confirmed the presence of ahigh expression level of antinematode si/miRNA intransformed rape plants.

Verifying the effectiveness of silencing by antine�matode si/miRNA specific to the conservative regionof the 8H07 gene in cells of H. schachtii nematode lar�vae, which parasitize on roots of transgenic rapeplants, by the Northern blot method of hybridizationof nematode mRNA (preliminary fractionated by 15%PAGE with 7 M urea) with antisense [α�32P]�labeledcDNA probes [11, 21, 28], we found a considerabledecrease in the expression level (90 %) of the conser�vative region of the 8H07 gene (Fig. 7b) compared to

the high expression level of this gene in cells of nema�tode larvae, extracted from roots of control plants(Fig. 7a).

The decrease in the expression level was less (60%)for the conservative 8H07 gene region in cells of trans�genic rape plants grown during the vegetation periodon an infectious background in the presence of thenematode H. schachtii (Fig. 7d) compared to the con�trol plants (Fig. 7c). The difference between theexpression levels of the 8H07 genes in the nematodeand plants may be explained by the presence of anessential number of nucleotide sequences that differ[15, 18].

According to literature data [11, 15], the degree ofhomology between the CR regions of the 8H07 gene inplants and nematodes is 40%, although the 8H07 geneexpression products in nematodes and plants are iden�tical SKP1 proteins [15, 38–40], i.e., components ofthe SCF complex of proteolytic enzymes (protea�some). With the participation of this complex, the pro�cess of polyubiquitination and protein degradationoccurs. The nematode 8H07 gene, except the CRregion, was found to have a unique UR region, whichwas only specific to nematodes. The data obtained alsoindicate that the expression of the 8H07 gene inplants�hosts promotes their hypersensitivity to nema�tode infection. In nematodes, the peak of 8H07 geneexpression is observed during their penetration intospecial root cells of plants, i.e., feeding sites [11, 15,18]. Therefore, the creation of vector constructs withthe constitutive expression of antisense dsRNA forsilencing the 8H07 gene both in plants and phytone�matodes is an effective strategy for the enhancement ofplant resistance to nematode invasion.

CONCLUSIONS

During the research conducted, we first cloned andconstructed a vector with the constitutive dsRNAexpression of cDNA complementary to the amplifiedfragment of the conservative region of the H. schachtiinematode 8N07 gene and conducted genetic transfor�mation of rape using the agrobacterium A. tumefa�ciens. The RT�PCR method was used to analyze thetotal mRNA isolated from genetically modified rapeplants on the presence of the pArt27expression vectorin the genome of transgenic plants for the presence ofintron pdk. Applying Northern blot hybridization oftotal mRNA from plants with 32P�labeled sense andantisense low�molecular�weight RNA probes, we ver�ified of the presence of the expression of antynema�tode si/miRNA in transgenic rape plants. Similarly,using Northern blot hybridization of the total mRNAof nematodes and the total mRNA of plants with[P32]�labeled cDNA probes (antisense to the CRregion of the 8H07 gene), we confirmed the high levelof silencing activity of si/miRNA which is expressed intransgenic plants specific to the conservative region of



the 8H07 gene. The blocking translation (silencing) ofboth plant (owing to which their resistance to pestsincreases) and nematode mRNA explains the essentialreduction in their number (up to 80% compared to thecontrol). In laboratory conditions, according to phys�iological signs, there is a sufficient increase in the tol�erance of transgenic rape plants to the nematodeH. schachtii parasitizing on roots.

REFERENCES

1. Chitwood, D.J., Research on plant�parasitic nematodebiology conducted by the United States department ofagriculture. Agricultural research service, Pest Manag.Sci., 2003, vol. 59, pp. 748–753.

2. Karczmarek, A., Overmars, H., Helder, J., andGoverse, A., Feeding cell development by cyst androot�knot nematodes involves a similar early, local andtransient activation of a specific auxin�inducible pro�moter element, Mol. Plant Path., 2004, vol. 5, no. 4,pp. 343–346.

3. Fuller, V.L., Lilley, C.J., and Urwin, P.E., Nematoderesistance, New Phytol., 2008, vol. 180, pp. 27–44.

4. Oka, Y., Mechanisms of nematode suppression byorganic soil amendments, Appl. Soil. Ecol., 2010,vol. 44, pp. 101–115.

5. Iutinskaya, G.A., Valagurova, E.V., Kozyritskaya, V.E.,Belyavskaya, L.A., Petruk, T.V., Ponomarenko, S.P.,and Eakin, D., Averkov—a new antiparasitic drug, inBioregulyatsiya mikrobno�rastitel’nykh sistem (Bioregu�lation of Microbe–Plant Systems), Iutinskaya, G.A.and Ponomarenko, S.P., Eds., Kyiv: Nichlava, 2010,pp. 276–396.

6. Tsygankova, V.A., Ponomarenko, S.P., and Blume, Ya.B.,Molecular–genetic mechanisms of growth regulationof plants with biologically active properties, Visn. Ukr.Tovar. Genet. Selekts., 2012, vol. 10, no. 1, pp. 86–94.

7. Yu, H. and Kumar, P.P., Post�transcriptional genesilencing in plants by RNA, Plant Cell Rep., 2003,vol. 22, pp. 167–174.

8. Padmanablhan, Ch., Zhang, X., and Jin, H., Hostsmall RNAs are big contributors to plant innate immu�nity, Curr. Opin. Plant Biol., 2009, vol. 12, pp. 465–472.

9. Gheysen, G. and Vanholme, B., RNAi from plants tonematodes, Trends Biotechnol., 2006, vol. 25, no. 3,pp. 89–92.

10. Fairbairn, D.J., Cavallaro, A.S., Bernard, M., et al.,Host�delivered RNAi: an effective strategy to silencegenes in plant parasitic nematodes, Planta, 2007,vol. 226, pp. 1525–1533.

11. Gao, B., Allen, R., Maier, T., et al., Identification ofputative parasitism genes expressed in the esophagealgland cells of the soybean cyst nematode Heteroderaglycines, Mol. Plant–Microbe Interact., 2001, vol. 14,no. 10, pp. 1247–1254.

12. Elling, A.A., Davis, E.L., Hussey, R.S., and Baum, T.J.,Active uptake of cyst nematode parasitism proteins intothe plant cell nucleus, Int. J. Parasit., 2007, vol. 37,pp. 1269–1279.

13. Veronico, P., Gray, J.L., Jones, J.T., et al., Nematodechitin synthases: gene structure, expression and func�

tion in Caenorhabditis elegans and the plant parasiticnematode Meloidogyne artiellia, Mol. Genet. Genom.,2001, vol. 266, pp. 28–34.

14. Rosso, M.N., Dubrana, M.P., Cimbolini, N., et al.,Application of RNA interference to root�knot nema�tode genes encoding esophageal gland proteins, Mol.Plant–Microbe Interact., 2005, vol. 18, no. 7, pp. 615–620.

15. Sindhu, A.S., Maier, T.R., Mitchum, M.G., et al.,Effective and specific in plant RNAi in cyst nematodes:expression interference of four parasitism genes reducesparasitic success, J. Exp. Bot., 2009, vol. 60, no. 1,pp. 315–324.

16. Ithal, N., Recknor, J., Nettleton, D., et al., Parallelgenome�wide expression profiling of host and pathogenduring soybean cyst nematode infection of soybean,Mol. Plant–Microbe Interact., 2007, vol. 20, no. 3,pp. 293–305.

17. Jammes, F., Lecomte, F., Almeida�Engler, J., et al.,Genome�wide expression profiling of the host responseto root�knot nematode infection in Arabidopsis, PlantJ., 2005, vol. 44, pp. 447–458.

18. Tsygankova, V.A., Andrusevich, Ya.V., Ponomarenko, S.P.,Galkin, A.P., and Blume, Ya.B., Isolation and amplifi�cation of cDNA from the conserved region of the nem�atode Heterodera schachtii 8H07 gene with a close sim�ilarity to its homolog in rape plants, Cytol. Genet., 2012,vol. 46, no. 6, pp. 335–341.

19. Wesley, S.V., Helliwell, C.A., Smith, N.A., et al., Con�struct design for efficient, effective and high throughputgene silencing in plants, Plant J., 2001, vol. 27, no. 6,pp. 581–590.

20. Gleave, A.P., A versatile binary vector system with aT�DNA organisational structure conductive to effi�cient integration of cloned DNA into the plant genome,Plant. Mol. Biol., 1992, vol. 20, pp. 1203–1207.

21. Promega Protocols and Applications Guide, 2nd ed.,USA: Promega Corporation, 1991.

22. Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecu�lar Cloning: A Laboratory Manual, New York: ColdSpring Harbor Lab., 1989.

23. Steven, J., Clough, S.T., and Bent, A.F., Floral dip: asimplified method for Agrobacterium�mediated trans�formation of Arabidopsis thaliana, Plant J., 1998,vol. 16, no. 6, pp. 735–743.

24. Tsygankova, V.A., Stefanovs’ka, T.R., Adrusevich, Ya.V.,Ponomarenko, S.P., Galkin, A.P., and Blume, Ya.B.,Induction of the biosynthesis of si/miRNAs with anti�patogenic and antiparasitic properties in plant cells bygrowth regulators, Biotekhnologiya, 2012, vol. 5, no. 3,pp. 62–74.

25. Hamilton, A.J. and Baulcombe, D.C., A species ofsmall antisense RNA in posttranscriptional gene silenc�ing in plants, Science, 1999, vol. 286, pp. 950–952.

26. Wang, M.B., Wesley, S.V., Finnegan, E.J., et al., Repli�cating satellite RNA induces sequence�specific DNAmethylation and truncated transcripts in plants, RNA,2001, vol. 7, pp. 16–28.

27. Mette, M.F., Aufsatz, W., Winden, J., et al., Transcrip�tional silencing and promoter methylation triggered bydouble�stranded RNA, EMBO J., 2000, vol. 19, no. 19,pp. 5194–5201.

230


TSYGANKOVA et al.

28. Lim, H.�S., Ko, T.�S., Lambert, K.N., et al., Soybeanmosaic virus helper component�protease enhancessomatic embryo production and stabilizes transgeneexpression in soybean, Plant Physiol. Biochem., 2005,vol. 43, pp. 1014–1021.

29. Wang, M.B., Upadhyaya, N.M., Brettell, R.I.S., andWaterhouse, P.M., Intron�mediated improvement of aselectable marker gene for plant transformation usingAgrobacterium tumefaciens, J. Genet. Breed., 1997,vol. 51, pp. 3256–334.

30. Smith, N.A., Singh, S.P., Wang, M.�B., et al., Totalsilencing by intron�spliced hairpin RNAs, Nature,2000, vol. 407, pp. 319–320.

31. Horiguchi, G., RNA silencing in plants: a shortcut tofunctional analysis, Differentiation, 2004, vol. 72,pp. 65–72.

32. Kerschen, A., Napoli, C.A., Jorgensen, R.A., andMuller, A.E., Effectiveness of RNA interference intransgenic plants, FEBS Lett., 2004, vol. 566, nos. 1/3,pp. 223–228.

33. Schmidhauser, T.J. and Helinski, D.R., Region ofbroad�host range plasmid rk2 involved in replicationand stable maintenance in nine species of gram�nega�tive bacteria, J. Bacteriol., 1985, vol. 164, pp. 446–455.

34. Rogers, S.G., Klee, H.J., Horsch, R.B., and Fraley, R.T.,Improved vectors for plant transformation: expressioncassette vectors and new selectable markers, MethodsEnzymol., 1987, vol. 153, pp. 253–277.

35. Jen, G.C. and Chilton, M.D., The right border regionof pTiT37 T�DNA is intrinsically more active than theleft border region promoting T�DNA transformation,Proc. Natl. Acad. Sci. U.S.A., 1986, vol. 83, pp. 3895–3899.

36. An, G., Abert, P.P., Mitra, A., and Ha, S.B., Binaryvectors, in Plant Molecular Biology Manual, Gelvin, S.B.,Schilperoort, R.A., and Verma, D.P.S., Eds., Dor�drecht: Kluwer Acad. Publ., 1988, pp. A3/1–A3/19.

37. Peralta, E.G., Hellmiss, R., and Ream, W., Overdrive,a T�DNA transmission enhancer on the a tumefacienstumor�inducing plasmid, EMBO J., 1986, vol. 5,pp. 1137–1142.

38. Drouaud, J., Marrocco, K., Ridel, C., et al., Brassicanapus skp1�like gene promoter drives gus expression inArabidopsis thaliana male and female gametophytes,Sex. Plant Rep., 2000, vol. 13, pp. 29–35.

39. Zhao, D., Ni, W., Feng, B., et al., Members of the Ara�bidopsis�skp1�like gene family exhibit a variety ofexpression patterns and may play diverse roles in Arabi�dopsis, Plant Physiol., 2003, vol. 133, pp. 203–217.

40. Chai, L., Biswas, M.K., Ge, X., and Deng, X., Isola�tion, characterization, and expression analysis of anskp1�like gene from “shatian” pummelo (Citrus grandisOsbeck), Plant Mol. Biol. Rep., 2010, vol. 28, pp. 569–577.

Translated by E. Kapinus

Increasing of Plant Resistance to Nematodes Using RNAi-Technology

Documents

Transcript of Increasing of Plant Resistance to Nematodes Using RNAi-Technology