Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

71
Incest and folk-dancing ….

Transcript of Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Page 1: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Incest and folk-dancing ….

Page 2: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

                                    

      Steve Jones 2001 Pan Pacific

Bodybuilding Champion

Steve jones

Page 3: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Elephant seal

Page 4: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Testosterone Molecule

Page 5: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

M-f mortality

Page 6: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Female anglerfish and her partners

Page 7: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The Y

Page 8: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

MaleMale

Page 9: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Thames at Westminster

Page 10: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Thames near Source

Page 11: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Drosophila bifurca – testis, the single sperm, and a standard of comparison

Page 12: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The Apocalypse according to William Blake

Page 13: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The city of Megiddo – the biblical Armageddon

Armageddon

Page 14: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

THE ARITHMETIC OF ARMAGEDDON – 722 BC

2, 4, 8, 16, 32 …… fifty times: comes to

100,000,000,000,000,(a hundred million million) supposed ancestors.

At a generous guess the real number of people then was 100,000,000 (a hundred million).

Ie not enough ancestors - which means SHARED ANCESTRY AND UNIVERSAL INBREEDING!

Page 15: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

Page 16: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

Page 17: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

Page 18: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

Page 19: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

Page 20: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

Page 21: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

Page 22: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

Page 23: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

Page 24: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

Page 25: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

Page 26: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

Page 27: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

Page 28: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

Page 29: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

Page 30: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

2 ancestors

Page 31: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

22 individuals

18 ancestors

16 ancestors

14 ancestors

12 ancestors

9 ancestors

8 ancestors

8 ancestors

7 ancestors

7 ancestors

5 ancestors

5 ancestors

3 ancestors

3 ancestors

3 ancestors

2 ancestors

2 ancestors

1 ancestor

Page 32: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

Page 33: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Present

Time

Most recent common ancestor(MRCA)

Page 34: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 35: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Inbreedign euro royalty

Serious inbreeding among European Royals (max at 7 generations = 128 ancestors)Generations 4 5 6 7 Ift de Espana (1901-1964) 8 12 12 12

Gottfried of Tuscany (1901-) 8 10 15 18

Alfonso XII King of Spain (1857-1885) 4 4 6 8

Francesco, Duke of Marchena (1861-1923) 2 4 8 8

Maria Antonia of Austria (1669-1692) 4 4 6 10

Louis XV King of France (1710-1774) 4 8 12 16

Page 36: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 37: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Tutankhamun’s pedigree - incest

Page 38: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Feet of an inbred God - Tutankhamun

Page 39: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

3000 lines of descent 4000 lines of descent

Inbred – identity by descent

Page 40: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Charles Darwin’s cousin marriage

Page 41: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The Bulldog in 1817

Page 42: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The Bulldog in 2008

Page 43: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Rare surnames (Attenborough but not Smith) share a Y chromosome

Page 45: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Consang marriage rates ww

Page 46: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Finnish genetic disease

Page 47: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

VLINCL pedigrees in Finland

Page 48: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Inbreeding loops in Finland

Page 49: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 50: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Likely world colonisation routes, and genetic distance from E Africa (shades of green)

Page 51: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 52: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Extent of diversity against distance to Addis Ababa – lowest in Americas

Page 53: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Runs of homozygosity – shared names, and shared lengths of DNA

attenboroughattenborough

agccccttaattaagccccttaatta

Page 54: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Inbreeding in Croatia

Page 55: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Runs of homozygosity of different lengths, island and mainland

Page 56: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Close correlation between inbreeding as measured from pedigrees and from runs of homozygosity

Page 57: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Runs of homozygosity: more inbreeding in hunter-gatherers than farmers

Page 58: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Runs of homozygosity (green blocks) in boy with multiple medical problems. May be son of incestuous relationship

Page 59: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

The locations of the identified IBD segments (black horizontal bars) among the genomes of the colon cancer patients and the control data sets.

Page 60: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Runs of homozygosity and schizophrenia: odds increase by 17% for every 1% increase in genome-wide autozygosity.

Page 61: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

ROH in Early Onset Parkinson’s Disease; cases blue controls red. Black line – ratio.

Page 62: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Increase in infection rates with inbreeding

Page 63: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Sex and the 747 – American flight patterns

Page 64: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Decline in US runs of homozygosity (inbreeding) with birth date from 1900 to 2000

Page 65: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Jones in 1881

Page 66: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Jones in 1998

Page 67: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 68: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.
Page 69: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Fig. 1 Language locations and regional variation in phonemic diversity – bottlenecks on the way across the world.

Q D Atkinson Science 2011;332:346-349

Published by AAAS

Page 70: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.

Outbred and inbred slug populations

Oxfordshire (left); Skye (right)

Page 71: Incest and folk-dancing ….. Steve Jones 2001 Pan Pacific Bodybuilding Champion Steve jones.