In Vitro and In Vivo Studies with Measles Virus and its Interaction with the Mouse Innate Immune System

by

Michael Neul Ha

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Graduate Department of Medical Biophysics University of Toronto

© Copyright by Michael Neul Ha 2012

ii

In Vitro and In Vivo Studies with Measles Virus and its Interaction

with the Mouse Innate Immune System

Michael Neul Ha

Doctor of Philosophy

Graduate Department of Medical Biophysics University of Toronto

2012

Abstract

Measles is one of the most contagious diseases known to mankind. Despite the availability of a

safe and effective vaccine, approximately 164,000 measles-related deaths were recorded in 2008.

The inherent restricted host tropism of MV means that the development of authentic rodent

models will be a valuable research tool in testing new vaccines and antivirals. In addition to the

receptor requirement, mouse innate immunity has been shown to inhibit MV growth. In this

thesis, the contributions of several key components of the mouse innate immune system on the

inhibition of MV replication were examined. The transcription factor interferon regulatory factor

3 (IRF3), which normally plays a key role in mediating innate immune signaling, contributed

relatively little in inhibiting MV replication both in vitro and in vivo. In contrast, the JAK/STAT

pathway and the double-stranded RNA inducible protein kinase, PKR, played more important

roles in controlling virus replication.

The resurgence of measles in areas where the virus was once thought to be eradicated

makes the development of anti-MV treatments essential. Concurrent to the development of an

animal model to better study its pathogenesis, we wanted to look at the effect of MV inhibitors

on its replication. The MV fusion inhibitor, carbobenzoxy-D-phenylalanine-L-phenylalanine-

iii

glycine (ZfFG), was developed in the past to study fusion; however, its mechanism of action has

not yet been elucidated. To examine this, spontaneous ZfFG-resistant mutants were generated

and characterized. Mutations were found in the HRB region of the fusion (F) protein, and when

these were modeled using published paramyxovirus F crystal structures, data suggested that

ZfFG targeted a small pocket present between the head and stalk regions of its pre-fusion

conformation.

An authentic mouse model of measles developed from findings in this study may allow

for in vivo efficacy testing of ZfFG in the future.

iv

Acknowledgments

This thesis is the final product of many (!!!) years of work. And I will never forget all the support

and advice that I have received from those around me while I proceeded through my doctoral

studies.

I would like to start by thanking my mentor and friend, Dr. Chris Richardson, who taught me

about his love of science and the people behind the discoveries. He also taught me that

persistence pays dividends. Chris, I will never forget where I am from. My supervisory

committee members, Drs. Fei-Fei Liu and Jeff Medin, were also instrumental in helping me

complete this journey and I am thankful for the support and advice that they provided from

Toronto. I would especially like to thank Dr. Dwayne Barber for his moral support and for

remaining as my link to Medical Biophysics.

Dr. Elizabeth Acosta was my expert mentor when it came to performing the experiments with

mice. I would also like to thank Dr. Gil Privé for providing us with the pieces to make the ZfFG

story complete.

Special mention is reserved for all the past and present members of the lab. I will always be

grateful to Dr. Ryan Noyce and Gary Sisson for their endless words of encouragement and their

willingness to lend their ears.

This thesis would not have been possible without the support I received from my parents, and

parent in-laws. I wish to express my utmost gratitude to them for all the moral support that they

provided from the beginning until the very end.

Lastly, I am infinitely grateful to my wife, Clare, for her endless patience and encouragement.

Often playing the role of my sternest critic, she was the voice of reason that anchored my life.

This thesis is dedicated to her, our son, Linus, and little Dewy (who we can’t wait to meet) to

whom I hope, one day, to teach the life lessons that I have learned during this journey.

Excelsior!

v

Table of Contents

Acknowledgments  ...............................................................................................................................  iv  

Table  of  Contents  ..................................................................................................................................  v  

List  of  Tables  ......................................................................................................................................  viii  

List  of  Figures  ........................................................................................................................................  ix  

List  of  Appendices  ................................................................................................................................  xi  

List  of  Abbreviations  .........................................................................................................................  xii  

Chapter  1        Introduction  .................................................................................................................  1  

  Measles  ..............................................................................................................................................  2  1

1.1   Milestone  Discoveries  ........................................................................................................................  2  1.2   Measles  Pathology  ...............................................................................................................................  4  1.2.1   Classic  Measles  ..................................................................................................................................................  4  1.2.2   Adaptive  Immune  Response  .......................................................................................................................  5  1.2.3   Immune  Suppression  .....................................................................................................................................  6  1.2.4   Neurological  Complications  ........................................................................................................................  6  

1.3   Treatments  .............................................................................................................................................  7  1.4   Vaccination  .............................................................................................................................................  7  1.5   Molecular  Biology  of  Measles  ..........................................................................................................  8  1.5.1   Measles  Virus  Genetics  ..................................................................................................................................  8  1.5.2   Physical  Characteristics  of  Measles  Virus  .............................................................................................  9  1.5.3   Measles  Proteins  ...........................................................................................................................................  10  1.5.4   Measles  Life  Cycle  .........................................................................................................................................  12  

1.6   Measles  Virus  Receptors  .................................................................................................................  14  1.6.1   CD46/Membrane  Cofactor  Protein  (MCP)  .........................................................................................  14  1.6.2   CD150/Signaling  Lymphocyte  Activation  Molecule  (SLAM)  .....................................................  15  1.6.3   Nectin  4/Poliovirus  receptor-­‐related  4  (PVRL4)  ............................................................................  15  1.6.4   CD209/Dendritic  Cell-­‐Specific  Intracellular  Adhesion  Molecule  3-­‐Grabbing  Nonintegrin  

(DC-­‐SIGN)  ........................................................................................................................................................................  16  1.6.5   CD147/Extracellular  Matrix  Metalloproteinase  Inducer  (EMMPRIN)  ..................................  16  1.6.6   Neurokinin-­‐1  (NK-­‐1)  ...................................................................................................................................  17  

vi

1.7   Animal  Models  of  Measles  ...............................................................................................................  17  1.7.1   Primate  Models  ..............................................................................................................................................  17  1.7.2   Cotton  Rat  Model  ...........................................................................................................................................  18  1.7.3   Transgenic  Mouse  Models  .........................................................................................................................  18  1.7.4   Ferret  Model  of  Canine  Distemper  Virus  ............................................................................................  19  

  Innate  Immunity  .........................................................................................................................  20  2

2.1   First  Encounter  ...................................................................................................................................  20  2.2   Toll-­Like  Receptors  (TLRs)  .............................................................................................................  21  2.2.1   Toll-­‐Like  Receptor  2/4  (TLR2/4)  ..........................................................................................................  22  2.2.2   Toll-­‐Like  Receptor  3  (TLR3)  ....................................................................................................................  23  2.2.3   Toll-­‐Like  Receptor  7/8  (TLR7/8)  ..........................................................................................................  24  2.2.4   Toll-­‐Like  Receptor  9  (TLR9)  ....................................................................................................................  24  

2.3   RIG-­I  Like  Receptors  (RLRs)  ...........................................................................................................  25  2.3.1   Retinoic  acid-­‐Inducible  Gene-­‐I  (RIG-­‐I)  ................................................................................................  25  2.3.2   Melanoma  Differentiation  Associated  Gene  5  (MDA5)  ................................................................  26  2.3.3   Laboratory  of  Genetics  and  Physiology  (LGP2)  ...............................................................................  26  

2.4   NOD-­Like  Receptors  (NLRs)  ...........................................................................................................  26  2.5   DNA  Sensors  .........................................................................................................................................  27  2.6   Type  I  Interferon  Response  ............................................................................................................  28  2.6.1   Interferon  Regulatory  Factors  (IRFs)  ..................................................................................................  28  2.6.2   Type  I  and  III  Interferon  Signaling  ........................................................................................................  29  2.6.3   Type  II  Interferon  Signaling  .....................................................................................................................  31  2.6.4   Interferon-­‐Stimulated  Genes  (ISGs)  .....................................................................................................  31  

2.7   Plasmacytoid  Dendritic  Cells  (pDCs)  ...........................................................................................  35  2.8   Modulation  of  Innate  Immunity  by  Measles  Virus  ..................................................................  38  

  F  Protein-­Mediated  Fusion  ......................................................................................................  41  3

3.1   Details  of  F  Protein  ............................................................................................................................  41  3.2   Fusion  Process  ....................................................................................................................................  43  3.3   Carbobenzoxy-­D-­Phe-­L-­Phe-­Gly  ...................................................................................................  44  

  Research  Objectives  ...................................................................................................................  46  4

Chapter  2        In  vitro  role  of  mouse  innate  immunity  on  measles  virus  .........................  48  

Introduction  ........................................................................................................................................  49  

vii

Materials  and  Methods  ....................................................................................................................  51  

Results  ...................................................................................................................................................  55  

Discussion  ............................................................................................................................................  65  

Chapter  3        In  vivo  role  of  mouse  innate  immunity  on  measles  virus  ..........................  69  

Introduction  ........................................................................................................................................  70  

Materials  and  Methods  ....................................................................................................................  71  

Results  ...................................................................................................................................................  76  

Discussion  ............................................................................................................................................  93  

Chapter  4        Characterization  of  the  fusion  proteins  from  measles  virus  resistant  to  

Z-­D-­Phe-­L-­Phe-­Gly,  a  membrane  fusion  inhibitor  ..................................................................  98  

Introduction  ........................................................................................................................................  99  

Materials  and  Methods  ..................................................................................................................  101  

Results  .................................................................................................................................................  106  

Discussion  ..........................................................................................................................................  118  

Chapter  5        Conclusions  and  future  directions  ......................................................................  122  

Research  Summary  .........................................................................................................................  123  

Future  Directions  .............................................................................................................................  125  

Conclusion  ..........................................................................................................................................  130  

Appendix  I:  Tumor  Cell  Marker  PVRL4  (Nectin  4)  Is  an  Epithelial  Cell  Receptor  for  

Measles  Virus  ....................................................................................................................................  131  

Appendix  II:  Generation  of  transgenic  mouse  which  constitutively  expresses  the  

vaccinia  virus  E3L  protein  ............................................................................................................  156  

Appendix  III:  Characterization  of  the  Nipah  virus  receptor  using  pseudotype  

technology  ..........................................................................................................................................  162  

References  ..........................................................................................................................................  171  

viii

List of Tables Table  2.1  List  of  RT-­PCR  primers.  ................................................................................................................................................................  54  Table  III.1.  Summary  of  cell  lines  screened  ..........................................................................................................................................  168  

ix

List of Figures Figure  1.1.    Global  annual  reported  measles  incidence  and  measles  vaccine  coverage,  1980-­2009  (From  World  

Health  Organization  2011).  ..............................................................................................................................................................................  3  Figure  1.2.  Appearance  of  clinical  measles  symptoms  over  time  (Adapted  from  (Moss  and  Griffin,  2006)).  ................  4  Figure  1.3.  Course  of  measles  virus  spread  in  infection  (Modified  from  (Moss  and  Griffin,  2006)).  ..................................  5  Figure  1.4.  Genome  structure  and  viral  proteins  of  measles  virus.  ..................................................................................................  9  Figure  1.5.  Schematic  diagram  of  measles  virus  (adapted  from  (Moss  and  Griffin,  2006)).  .............................................  10  Figure  1.6.  Measles  virus  life  cycle  (adapted  from  (Moss  and  Griffin,  2006)).  .........................................................................  12  Figure  1.7.  Summary  of  the  innate  immune  signaling  pathways  that  recognize  virus  infection  (adapted  from  

(Hiscott,  2007)).  ..................................................................................................................................................................................................  21  Figure  1.8.  Type  I  interferon  signaling  pathway.  .................................................................................................................................  30  Figure  1.9.  Role  of  plasmacytoid  dendritic  cells  in  linking  innate  and  adaptive  immunity  (adapted  from  

(Fitzgerald-­Bocarsly  et  al.,  2008)).  .............................................................................................................................................................  38  Figure  1.10.  Measles  virus  fusion  protein.  ................................................................................................................................................  42  Figure  1.11.  A  model  of  paramyxovirus  fusion  process  (A)  (adapted  from  (Smith  et  al.,  2009)).  Interaction  

between  HRA  and  HRB  domains  in  the  six  helix  bundle  from  a  top  view  (B)  (adapted  from  (Morrison,  2003)).  ....  44  Figure  1.12.  A  ball-­and-­stick  model  of  ZfFG.  ...........................................................................................................................................  46  Figure  2.1.  Generation  of  SLAM  expressing  MEFs.  ...............................................................................................................................  56  Figure  2.2.  SLAM/E3L  MEFs  express  a  functional  E3L.  ......................................................................................................................  58  Figure  2.3.  SLAM/MEFs  are  permissive  for  MV  infection.  .................................................................................................................  59  Figure  2.4.  ISG  induction  in  MV  infected  MEFs.  .....................................................................................................................................  60  Figure  2.5.  IFN  bioassay  of  MV  infected  MEFs.  ......................................................................................................................................  62  Figure  2.6.  Innate  immune  deficiencies  enhance  MV  growth.  .........................................................................................................  63  Figure  2.7.  PKR  inhibition  enhances  MV  growth.  .................................................................................................................................  64  Figure  3.1.  Verification  of  SLAM/IRF3KO  mouse  ..................................................................................................................................  77  Figure  3.2.  MV  does  not  spread  systemically  in  SLAM/IRF3KO  mice  ...........................................................................................  79  Figure  3.3.  SLAM/IRF3KO  lymphoid  organs  fail  to  harbour  MV  ...................................................................................................  80  Figure  3.4.  Ex  vivo  infected  cells  from  lymph  node  and  the  spleen  secrete  interferon  .........................................................  81  Figure  3.5.  Selective  recruitment  of  plasmacytoid  dendritic  cells  to  the  mediastinal  lymph  node  and  the  spleen  in  

MV  infected  mice  .................................................................................................................................................................................................  83  Figure  3.6.  Plasmacytoid  dendritic  cells  are  activated  upon  intraperitoneal  MV  infection  ..............................................  84  Figure  3.7.  Plasmacytoid  dendritic  cells  are  among  the  cell  populations  infected  by  MV  in  SLAM/STAT1KO  mice

 ....................................................................................................................................................................................................................................  86  Figure  3.8.  Flt3-­ligand  producing  tumour  cell  injection  results  in  increase  in  pDC  population  ......................................  87  Figure  3.9.  Plasmacytoid  dendritic  cell-­enriched  splenocyte  population  from  SLAM/WT  and  SLAM/IRF3KO  

strains  are  activated  in  response  to  MV  infection  ................................................................................................................................  88  

x

Figure  3.10.  Flt3-­L  treated  splenocytes  from  SLAM/WT  and  SLAM/IRF3KO  strains  produce  IFNα  in  response  to  

MV  infection  ..........................................................................................................................................................................................................  90  Figure  3.11.  CD46/SLAM/STAT1KO  mice  are  susceptible  to  SLAM-­independent  MV  infection  ......................................  92  Figure  4.1.  ZfFG  does  not  inhibit  H  recognition  and  binding  to  the  cellular  receptor  ......................................................  107  Figure  4.2.  Production  of  ZfFG  resistant  MV  ........................................................................................................................................  109  Figure  4.3.  Fusion  activity  of  ZfFG  mutants  in  vitro  .........................................................................................................................  111  Figure  4.4.  ZfFG  resistant  mutants  do  not  become  surface  expressed  at  the  same  level  as  the  Edmonston  F  ........  113  Figure  4.5.  Computer  generated  models  of  ZfFG  resistant  mutants  ..........................................................................................  115  Figure  4.6.  Fusion  kinetics  of  various  F  mutants  ...............................................................................................................................  117  Figure  4.7.  A  proposed  ZfFG  mechanism  of  action  ............................................................................................................................  120  Figure  5.1.  Passaging  MV  (Montefiore)  in  SLAM/WT  MEFs.  ........................................................................................................  128  Figure  II.  Transgenic  mouse  expressing  vaccinia  virus  E3L  protein  constitutively  expresses  the  E3L  protein  in  all  

tissues.  ...................................................................................................................................................................................................................  159  Figure  III.1.  Production  of  VSV  pseudotyped  with  NV  glycoproteins  ........................................................................................  164  Figure  III.2.  Co-­expression  of  NV  surface  glycoproteins  .................................................................................................................  165  Figure  III.3.  VSV-­NV  exhibits  similar  tropism  to  wild-­type  NV  ....................................................................................................  166  Figure  III.4.  Nested  RT-­PCR  screen  for  the  NV  receptor,  EFNB2  .................................................................................................  167  Figure  III.5.  Site-­directed  mutagenesis  of  EFNB2  ..............................................................................................................................  169  Figure  III.6.  Cross-­species  analysis  of  EFNB2  ......................................................................................................................................  170  

xi

List of Appendices

Appendix  I:  Tumor  Cell  Marker  PVRL4  (Nectin  4)  Is  an  Epithelial  Cell  Receptor  for  

Measles  Virus  ....................................................................................................................................  131  

Appendix  II:  Generation  of  transgenic  mouse  which  constitutively  expresses  the  

vaccinia  virus  E3L  protein  ............................................................................................................  156  

Appendix  III:  Characterization  of  the  Nipah  virus  receptor  using  pseudotype  

technology  ..........................................................................................................................................  162  

xii

List of Abbreviations

aa Amino acid

ADAR1 Adenosine deaminase acting on RNA 1

AIM2 Absent in melanoma 2

AMEM Alpha modification minimum essential medium

AP1 Activator protein 1

APC Antigen presenting cell

ASC Apoptotic speck-like protein containing a CARD

ATP Adenosine triphosphate

ATRA All-trans-retinoic acid

BALT Bronchus-associated lymphoid tissue

BDCA Blood dendritic cell antigen

CARD Caspase-recruitment domain

CBP CREB binding protein

CD Cluster of differentiation

CDV Canine distemper virus

cDC Conventional dendritic cell

CNS Central nervous system

CREB cAMP response element binding protein

CTD C-terminal domain

CYT Cytoplasmic tail

DAI DNA-dependent activator of IRFs

xiii

DC Dendritic cell

DNA Deoxyribonucleic acid

DBD DNA binding domain

DMEM Dulbecco’s modified eagle’s medium

dsDNA Double-stranded DNA

dsRNA Double-stranded RNA

DT Diphtheria toxin

DTH Delayed hypersensitivity

EBV Epstein-Barr virus

eIF2α Eukaryotic translation initiation factor 2 alpha

EMCV Encephalomyocarditis virus

EpR Epithelial cell receptor

ER Endoplasmic reticulum

ERK Extracellular regulated kinase

F Fusion protein

FADD Fas-associated death domain

FCS Fetal calf serum

FLT3L FMS-like tyrosine kinase 3 ligand

FP Fusion peptide

GAS Gamma activated site

GATA3 Trans-acting T-cell-specific transcription factor GATA 3

Gr1 Granulocyte differentiation antigen 1

GTP Guanosine triphosphate

H Hemagglutinin protein

xiv

HCV Hepatitis C virus

HECT Homologous to the E6-associated protein C terminus

HERC HECT domain and RCC1-like domain containing protein

HHARI Human homolog of Drosophila Ariadne

HIN Hematopoeictic IFN inducible nuclear protein

HN Hemagglutinin-neuraminidase

hPIV3 Human parainfluenza virus type 3

HR Heptad repeat

HSV Herpes simplex virus

IAD IRF association domain

IE Immediate early

IFI16 IFNγ-inducible protein 16

IFIT IFN-induced protein with tetratricopeptide repeat

IFN Interferon

IFNAR Interferon α/β receptor

IKK IκB kinase related kinase

IL Interleukin

IP10 IFN-inducible protein 10

IPS1 IFNβ promoter stimulator 1

IRAK IL-1 receptor-associated kinase

IRES Internal ribosome entry site

IRF Interferon regulatory factor

ISG Interferon stimulated gene

ISG15 IFN-stimulated protein of 15 kDa

xv

ISGF3 IFN-stimulated gene factor 3

ISRE Interferon stimulated response element

JAK Janus activated kinase

JNK C-Jun N-terminal kinase

L Large protein

LCMV Lymphocytic choriomeningitis virus

LGP2 Laboratory of genetics and physiology 2

LN Lymph node

LPS Lipopolysaccharide

LRR Leucine-rich repeat

Ly6C Lymphocyte antigen 6C

M Matrix protein

MAL MyD88-adaptor-like

MAPK Mitogen activated protein kinase

MAVS Mitochondrial antiviral signaling

MCMV Mouse cytomegalovirus

MCP Membrane cofactor protein

MDA Melanoma differentiation-associated gene

MDG4 Fourth Millennium Development Goal

MEF Mouse embryonic fibroblast

MHC Major histocompatibility complex

MKK MAP kinase kinase

MOI Multiplicity of infection

mPDCA1 Mouse pDC antigen 1

xvi

mRNA Messenger RNA

MV Measles virus

Mx Myxovirus resistance

MyD88 Myeloid differentiation factor 88

N Nucleocapsid

NAK NF-κB-activating kinase

NAP1 NAK-associated protein 1

NDV Newcastle disease virus

NES Nuclear export signal

NFκB Nuclear factor κ B

NK Natural killer

NLS Nuclear localization signal

NLR NOD-like receptor

NLRP3 NLR family pyrin domain containing 3

NOD Nucleotide oligomerization domain

NS Nonstructural

OAS 2’,5’-oligoadenylate synthetase

ORF Open reading frame

P Phosphoprotein

PAMP Pathogen-associated molecular pattern

PCR Polymerase chain reaction

pDC Plasmacytoid dendritic cell

PFU Plaque forming units

PI3K Phosphoinositide-3 kinase

xvii

pIC Polyinosinic:polycytidylic acid

PIE Post-infectious encephalomyelitis

PIV5 Parainfluenza virus type 5

PKR dsRNA-dependent protein kinase R

PRD Positive regulatory domain

PRR Pattern-recognition receptor

PVRL4 Poliovirus receptor related 4

PYHIN Pyrin and HIN domain-containing protein

RAG2 Recombination activating gene 2

RACK1 Receptor of activated kinase 1

RANTES Regulated upon activation, normal T cell expressed and secreted

RD Repressor domain

RdRp RNA-dependent RNA polymerase

RIG-I Retinoic acid-inducible gene I

RIP Receptor interacting protein

RLR RIG-I-like receptor

RNA Ribonucleic acid

RNaseL Ribonuclease L

RNP Ribonucleoprotein

RSV Respiratory syncytial virus

SCR Short consensus repeat

SFV Semliki forest virus

SH2 Src homology 2

shRNA Short hairpin RNA

xviii

siRNA Small interfering RNA

SLAM Signaling lymphocyte activation molecule

SOCS Suppressor of cytokine signaling

SSPE Subacute sclerosing panencephalitis

ssRNA Single-stranded RNA

STAT Signal transducer and activator of transcription

STING Stimulator of IFN gene

TAK TGFβ-activating kinase

TANK TRAF family member-associated NFκB activator

TBK TANK binding kinase

TCID50 Tissue culture infectious dose 50

TIR Toll/interleukin-1 receptor

TIRAP TIR-associated protein

TLR Toll-like receptor

TM Transmembrane

TNF Tumour necrosis factor

TRADD TNF receptor-associated death domain

TRAF TNF receptor-associated factor

TRAM TRIF-related adaptor molecule

TRIF TIR domain-containing adaptor inducing IFNβ

TRIM Tripartite-motif containing protein

TYK2 Tyrosine kinase 2

USP Ubiquitin-specific protease

VSV Vesicular stomatitis virus

xix

VV Vaccinia virus

WHO World Health Organization

WNV West Nile virus

ZfFG Carbobenzoxy-D-phenylalanyl-L-phenylalanyl-glycine

ZfF(NO2)R Carbobenzoxy-D-phenylalanyl-L-phenylalanyl-L-nitroarginine

1

Chapter 1 Introduction

2

Measles 1

1.1 Milestone Discoveries

Measles is one of the most contagious diseases known to mankind. It has a reproductive index

(R0, defined as the average number of secondary cases produced by an infectious individual in a

totally susceptible population) of 15 to 20. In comparison, the 1918 influenza pandemic,

otherwise known as the ‘Spanish flu’ had an R0 value between 2 and 3 (Bettencourt et al., 2007).

The R0 of the more recent H1N1 influenza pandemic was approximately 1.5 (Flahault et al.,

2009). Despite the availability of a safe and cost-effective vaccine, it is estimated that 164,000

people, mainly children in developing countries, died as a result of the disease in 2008. More

than 95% of these measles related mortality occurred in developing countries with weak health

infrastructures (WHO, 2011a). However, sporadic measles outbreaks still occur in Canada, with

an average of 11 cases annually except in 2007 (102 cases in Quebec), 2008 (62 cases in

Ontario), and 2010 (99 cases in British Columbia) (Canada, 2011; WHO, 2011b).

Humans are the only natural hosts for measles virus (MV), and the clinical and scientific

discoveries concerning measles are entwined with that of the history of humankind. The

historical timeline of MV discoveries is excellently reviewed in Field’s virology (Griffin, 2007)

and is briefly reviewed here. It has been postulated that the virus may have jumped species from

a cattle-specific disease in 3000 BCE in ancient Sumaria. The Arab physician Abu Bakr al-Razi

(865-925 AD), otherwise known as Rhazes of Baghdad, is credited with first distinguishing

measles from small pox in the 9th century, and dated the first description of the disease to the 6th

century (Hajar, 2005). In 1757, measles was formally shown to be caused by an infectious agent

by the Scottish physician, Francis Home, who transmitted the disease to naïve individuals using

blood taken from infected patients. Since 1763, measles has also been known as rubeola, which

is sometimes confused with the disease, rubella (German measles). Much of the basic measles

epidemiology was elucidated by the Danish physician, Peter Panum, who went to the Faroe

Islands in 1846 and observed its highly contagious nature, the 14-day incubation period, and the

acquired lifelong immunity associated with measles. In 1905, Hektoen showed that measles was

caused by an agent other than bacteria. In 1908, von Pirquet, while working at a tuberculosis

hospital in Vienna, recorded the disappearance of delayed-type hypersensitivity skin test

responses to tuberculin in measles infected patients. Goldberger and Anderson in 1911 were able

3

to infect and passage the disease in monkeys with filtered respiratory tract secretions from

measles patients. Subacute sclerosing panencephalitis, a long-term neurological complication

caused by measles, was described in 1933 by Dawson in a 16 year-old patient. In 1954, Enders

and Peebles inoculated primary human kidney cells with the blood of David Edmonston, a child

patient, and were able to propagate the virus in various cell lines. This discovery led to the

development of attenuated strains of measles that are used as vaccines to this day.

Increasing vaccine coverage has resulted in a dramatic decrease in the number of

worldwide measles cases (Figure 1.1). The current aim of the World Health Organization’s

(WHO) fourth Millennium Development Goal (MDG4) is a two-thirds reduction of the under-

five age group mortality rate between 1990 and 2015 (WHO, 2011a).

Figure 1.1. Global annual reported measles incidence and measles vaccine coverage, 1980-2009 (From World Health Organization 2011).

4

1.2 Measles Pathology

1.2.1 Classic Measles

Measles is typically a childhood infection spread by coughing and sneezing, close personal

contact, or direct contact with infected nasal or throat secretions (Griffin, 2007; WHO, 2011a).

The disease is characterized by a latent period of 10 to 14 days and a 2 to 3 day prodrome of

fever, coryza, cough, and conjunctivitis followed by Koplik’s spots (small, white spots inside the

cheeks), and the appearance of the maculopapular rash, a hallmark of measles (Figure 1.2). The

rash then extends to the extremities. The onset of rash coincides with the appearance of the

immune response and initiation of virus clearance. In an immune-competent patient, the rash is

cleared in approximately 10 days, but a cough and general fatigue may last for up to a month.

Successful recovery from the disease confers a lifelong immunity against reinfection.

Figure 1.2. Appearance of clinical measles symptoms over time (Adapted from (Moss and Griffin, 2006)).

A model of the course of MV infection is depicted in Figure 1.3. The initial infection was

previously thought to be localized to the respiratory tract with initial viral replication taking

5

place in tracheal, bronchial and/or small airway epithelial cells. However, more recent evidence

suggests that alveolar macrophages, dendritic cells, and activated lymphocytes are the primary

targets for MV (de Swart et al., 2007; Lemon et al., 2011; Leonard et al., 2008; Ludlow et al.,

2010). Infected immune cells then migrate to the local lymph nodes, where infected monocytes,

T- and B-lymphocytes amplify the virus, establishing primary viremia. At this point, giant

multinucleated cells, or syncytia appear in the lymphoid or reticuloendothelial regions. Once

viremia is established, dissemination of the virus occurs to other lymphoid organs such as the

thymus, spleen, appendix, and tonsils. Secondary viremia results in viral spread throughout the

body to infect the skin, kidneys, lungs, gastrointestinal tract, liver, respiratory and genital

mucosa. Infection of the respiratory mucosa is thought to occur through the basolateral surface

via contact with the infected immune cells, and is important for amplification and release of virus

from the airways into the environment via aerosol droplets. Fusion between lymphoid and

epithelial cells could also occur to promote spread of virus.

Figure 1.3. Course of measles virus spread in infection (Modified from (Moss and Griffin, 2006)).

1.2.2 Adaptive Immune Response

Antibodies against measles are first detectable when rash appears 10-14 days after infection. IgM

is initially produced and switches first to IgG2 and IgG3, followed by a further switch to IgG1

6

and IgG4 in the memory phase. Biopsies of rash show infiltration of CD4+ and CD8+ T cells in

areas of MV infected epithelial cells (Permar et al., 2003). Early in the immune response, the

CD4+ T cells produce IFNγ and IL2 indicating activation of CD8+ T cells and type 1 CD4+ T

cells prior to and during the rash. IFNγ and IL2 activate macrophages and promote T-cell

proliferation, respectively. Plasma levels of IFNγ and CD8+ T cells decrease rapidly after the

clearance of the virus, but there is a slower decrease in the number of activated CD4+ T cells. As

the rash fades, there is a switch to a type 2 response with the presence of IL4, IL5, IL10, and

IL13 for several weeks after clearance of infectious virus. These cytokines are responsible for B-

cell growth and differentiation and for macrophage deactivation. IL10, in particular, plays an

important role in activating regulatory T cells.

1.2.3 Immune Suppression

The immune response induced by MV infection is paradoxical in that it is associated with

effective virus clearance, but depressed responses to other non-MV antigens. It is further

complicated in that this immune suppression lasts for weeks to months after resolution of the

initial infection. Measles was the first disease recognized to increase susceptibility to other

infections, and it is recognized that most deaths related to MV are due to pneumonia or diarrhea

caused by secondary infections. Pneumonia, the most common fatal complication of measles,

occurs in 56-86% of measles-related deaths. Following MV infection, delayed-type

hypersensitivity (DTH) responses to tuberculin are suppressed, and immune responses to new

antigens are impaired. Lymphocytes taken from infected individuals also do not respond to in

vitro mitogen stimulation. Several potential mechanisms of immune suppression have been

proposed: 1) lymphopenia resulting from infection of the MV receptor, CD150, expressing

immune cells; 2) suppression of lymphocyte proliferation as MV infection down-regulates

CD150 expression required for T-cell proliferation; and 3) inability of MV-infected dendritic

cells to stimulate proliferation of T-cells (Griffin, 2010).

1.2.4 Neurological Complications

MV infections can be complicated by the onset of encephalitis [reviewed in (Oldstone, 2009;

Young and Rall, 2009)]. The incidence of MV post-infectious encephalomyelitis (PIE) is 1 in

1000 cases, and clinical symptoms include high fever, ataxia, deafness and convulsions that can

lead to coma in an individual who had begun to recover from the initial acute infection.

7

Symptoms tend to manifest 5-14 days after the maculopapular rash appearance. The mortality

rate is approximately 25% with survivors likely to suffer permanent neurological defects.

In contrast to PIE, subacute sclerosing panencephalitis (SSPE) does not appear for 1-15

years following the acute MV infection, and occurrences range from 1 in 10,000 to 300,000.

During this latent period, MV enters the central nervous system (CNS) and gives rise to a

progressive cerebral dysfunction that is initially recognized by subtle cognitive losses,

progressing to more overt behavioral and mental dysfunction, motor loss, seizures, culminating

in organ failure, and death. SSPE has been attributed to mutated strains of MV (SSPE strains)

that are defective in virus budding but manage to spread efficiently in neuronal tissue by passing

its RNA from cell-to-cell, resulting in persistent viral infections within the CNS. SSPE strains

contain mutations in the matrix protein (Cathomen et al., 1998a), and it has been proposed that

interferon-inducible adenosine deaminase acting on RNA 1 (ADAR1), a host enzyme, is

responsible for the A to G hypermutations observed. Mutations in the cytoplasmic regions of H

and F genes have also been implicated in SSPE strains (Ayata et al., 2010).

1.3 Treatments

Treatment options for MV infection are largely supportive in nature with nutrient and electrolyte

supplementations shown to be helpful in reducing morbidity and mortality (WHO, 2011a).

Administration of high doses of vitamin A has been reported to reduce the rate of mortality by

30-50% (Barclay et al., 1987). This protective effect was examined in detail by Trottier and

colleagues, who determined that all-trans-retinoic acid (ATRA), an active form of vitamin A,

induces an antiviral state in a type I interferon-dependent manner (Trottier et al., 2009).

Treatment of measles with nucleoside analogues and inhibitory antibodies have also been

reported, and several synthetic compounds are being developed [reviewed in (Plemper and

Snyder, 2009)]. Furthermore, the small synthetic tripeptide, carbobenzoxy-D-phe-L-phe-gly

(ZfFG), resembling the N-terminal amino acid sequence of the F1 subunit of MV fusion (F)

protein, has demonstrated in vitro anti-fusion activity (Richardson et al., 1980).

1.4 Vaccination

The major breakthrough in MV vaccine development occurred in 1954, when Enders and

Peeples developed the ability to cultivate MV in tissue culture (Enders and Peebles, 1954). The

8

live attenuated vaccine, developed from the Edmonston isolate, was adapted to grow in primary

human and monkey kidney cells and further passaged in chicken embryos (Enders et al., 1962;

Enders et al., 1960). Initial trials with formalin inactivated measles vaccines proved to be poorly

protective, and caused atypical measles disease, characterized by a prolonged high fever, unusual

skin lesions and severe pneumonitis. Extensive passaging of the virus in chick embryo

fibroblasts resulted in the Schwarz and Moraten strains that are still in use today (Schwarz,

1962).

The duration of vaccine-induced immunity is variable. In general, antibody levels tend to

be lower after vaccination than after recovery from the natural disease, and MV-specific

antibody and CD4+ T cells decay with time [reviewed in (Griffin and Pan, 2009)].

Administration of the vaccine in developed countries normally follows a two-dose regimen with

the first occurring between 12-15 months after birth and a second dose given at age 4-5. In

contrast, a single dose is administered at 9 months after birth in countries where vaccine delivery

infrastructure is not as well developed (WHO, 2011a).

1.5 Molecular Biology of Measles

1.5.1 Measles Virus Genetics

MV belongs to the genus morbillivirus, a subgroup of the Paramyxoviridae family (Griffin,

2007). Aside from MV, this virus family includes other human pathogens such as mumps,

parainfluenza, respiratory syncytial and metapneumoviruses. Animal pathogens such as

Newcastle disease and Sendai viruses are also members. In early 2000, Hendra and Nipah

viruses were discovered from fatal encephalitis cases in humans, which had their origin from

horses and pigs, respectively. In turn, infections in these animals have been shown to originate

from the indigenous fruit bat populations. The genus morbillivirus includes several members that

infect other animals such as canine distemper virus in dogs and ferrets, phocine distemper virus

in seals, rinderpest virus in cattle, and peste des petits ruminants virus in sheep and goats.

Like other members of Paramyxoviridae, MV has a non-segmented, negative-sense

single-stranded RNA genome that encodes 6 non-overlapping gene products. The RNA genome

is approximately 16,000 nucleotides and serves as a template for mRNA transcription, giving

rise to 8 protein products. The genome contains both extracistronic 3’ leader and 5’ trailer

9

regions that are approximately 50 nucleotides in length, which serve regulatory roles in

transcription and replication. The genome also contains trinucleotide intergenic sequences that

separate the individual genes.

The organization of MV genome is shown in Figure 1.4. The gene order from the 3’ end

is as follows: nucleocapsid (N), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin (H),

and large (L). Transcription of the MV genome demonstrates polarity, producing more

transcripts of genes close to the 3’ end, and less of genes at the distal 5’ end. All genes with the

exception of the P gene encode one protein. The P gene also encodes V and C genes, which are

transcribed as results of a partial frame shift in the open reading frame (ORF) and an overlapping

ORF, respectively.

Figure 1.4. Genome structure and viral proteins of measles virus.

1.5.2 Physical Characteristics of Measles Virus

A generalized cartoon diagram of MV is shown in Figure 1.5. MV is a pleomorphic, enveloped

virus with a diameter that varies from 100 nm to 300 nm. The viral envelope, a lipid bilayer

derived from the host membrane during budding, contains two transmembrane glycoproteins, H

and F, which appear as protruding spikes. The inner leaflet of the virion membrane is lined with

the hydrophobic M protein, to which H and F are anchored. The ribonucleoprotein (RNP)

complex, comprised of the genomic RNA and the N, P and L proteins exists as a helical structure

10

and forms the basic unit of infectivity (Rima and Duprex, 2009). Many particles incorporate

more than one RNP per virion.

Figure 1.5. Schematic diagram of measles virus (adapted from (Moss and Griffin, 2006)).

1.5.3 Measles Proteins

The viral envelope is derived from the host membrane and contains two transmembrane

glycoproteins, F and H. The hemagglutinin (H) protein is a 617 amino acid (aa), 78 kDa,

glycoprotein that spans the viral envelope. Its primary function is receptor recognition and

binding, which in turn determines host tropism. As a type II transmembrane protein, the C-

terminus of H is exposed to the external milieu, while the N-terminus associates with the matrix

proteins within the viral membrane. H forms homodimers via disulfide bonds and further

associate to form tetramers (Brindley and Plemper, 2010). The crystal structure of H has been

solved in recent years (Hashiguchi et al., 2011; Santiago et al., 2009), allowing detailed

examinations of the interactions between H and its receptors.

The fusion protein is a 553 aa, type I transmembrane glycoprotein, which is translated as

an inactive precursor, F0. This 60 kDa precursor is enzymatically cleaved by furin protease in the

11

trans-Golgi network, resulting in two fragments, F1 (41 kDa) and F2 (18 kDa) that are linked by

disulfide bonds. Viral attachment to the cell, mediated by the binding of H to its cellular

receptor, provides the signal for F to initiate fusion. Following insertion of the hydrophobic

fusion peptide into the target membrane, a conformational change in the F protein brings the

target and viral membranes close together, allowing the two membranes to fuse. Cell-to-cell

fusion is a hallmark of measles virus infection, and leads to giant multinucleated cell formation

called syncytia.

The M protein (335 aa; 37 kDa) is important for virion assembly at the cell membrane

and viral budding. This hydrophobic protein is located underneath the viral envelope, associates

with viral nucleocapsids, and serves to anchor the transmembrane glycoproteins. In M-deleted

virus, the production of infectious virus is impaired and cell-to-cell fusion is enhanced

(Cathomen et al., 1998a). This has been attributed to the possible fusion-refractory role of the M

protein upon binding to the cytoplasmic tail of H and F. M mutations are also thought to

contribute to SSPE (Hirano et al., 1993).

The RNP, consisting of the viral genome, N, P and L proteins is required for transcription

and replication. The N protein (525 aa) interacts with the M protein as well as the viral genome

inside the virion, and has the additional function of protecting the genome from nuclease

digestion. The polymerase cofactor P protein is 507 aa in length (72 kDa). It functions to tether

the L protein to the RNP complex for viral transcription. P also acts as a chaperone protein for

newly synthesized nucleoproteins, preventing inappropriate self-assembly (Huber et al., 1991).

The viral RNA also associates with the L protein (250 kDa). The 2183 aa L protein functions in

cohort with the N and P proteins as an RNA-dependent RNA polymerase (RdRp), and contains

the active catalytic site.

The coding sequence of the V protein (40 kDa) shares the N-terminal 231 aa of the P

protein. Insertion of a non-template directed guanosine residue at position 751 results in the two

proteins that have different C-termini. The C-terminus of the V protein is cysteine rich with Zn2+

binding properties (Cattaneo et al., 1989). The V protein is mainly responsible for suppression of

the innate immune system via inhibition of STAT1 and STAT2 phosphorylation (Ramachandran

and Horvath, 2009), as well as MDA5 inhibition (Ikegame et al., 2010).

12

The area encoding the P gene also includes an overlapping open reading frame that codes

for the non-structural C protein (186 aa; 21 kDa). C is believed to have an active role in

immunosuppression of the target cell. Similar to the action of V protein, C protein perturbs

signaling through type I interferons (Shaffer et al., 2003). Although the V and C accessory

proteins are dispensable for virus replication in vitro, they are absolutely required for viral

replication in a host environment (Patterson et al., 2000).

1.5.4 Measles Life Cycle

A simplified diagram of the MV life cycle is presented in Figure 1.6.

Figure 1.6. Measles virus life cycle (adapted from (Moss and Griffin, 2006)).

MV uses two surface glycoproteins, H and F, to enter its target cell [reviewed in (Yanagi

et al., 2009)]. The first step in this process is the attachment of the H protein to one of three

known cellular receptors, CD46, CD150, or PVRL4. CD150 (also known as signaling

13

lymphocyte activation molecule, SLAM) is the receptor recognized by both wild type and

vaccine strains of measles (Hsu et al., 2001; Tatsuo et al., 2000), whereas CD46 (membrane

cofactor protein, MCP) is recognized only by vaccine strains (Dörig et al., 1993; Naniche et al.,

1993). CD150 is present on macrophages, dendritic cells and activated B and T cells, and

functions as a co-stimulatory molecule (Calpe et al., 2008). It has also been recently

characterized as a pathogen recognition molecule which interacts with E.coli membrane proteins

to activate bacteriocidal activity of phagosomes in macrophages (Berger et al., 2010). The

presence of CD150 on immune cells accounts for the immunotropism of MV. CD46, on the other

hand, is a ubiquitously expressed molecule that deactivates components of the complement

system (Kemper and Atkinson, 2009). The widely sought, third receptor present on epithelial

cells, recognized by both wild type and vaccine strains, was recently identified in our laboratory

as PVRL4 (poliovirus receptor-related 4 or Nectin 4) (Appendix I; (Noyce et al., 2011)). The

discovery of this novel receptor shed further light onto MV pathogenesis and explained the

spread of MV into non-immune cells.

Binding of H to the receptor is postulated to either shift one of the H dimers relative to

the other in a tetramer (Hashiguchi et al., 2011), or induce the two heads within the H dimer to

twist relative to each other (Navaratnarajah et al., 2011). In any case, this conformational change

disrupts the H-F interaction at the H stalk regions and triggers F to initiate fusion of the cellular

and viral membranes [reviewed in (Plemper et al., 2011)]. Successful fusion results in release of

the viral RNP into the cytoplasm, where the viral genome is transcribed and then replicated by

the RdRp, comprised of L and P proteins.

Transcription starts immediately using the RdRp associated with the incoming virus

[reviewed in (Griffin, 2007; Rima and Duprex, 2009)]. The 3’ leader sequence contains

recognition sites for RdRp to sequentially transcribe viral genes. At the intergenic regions that

separate each gene, the RdRp may detach itself from the RNP or continue on to transcribe

downstream genes. This purely stochastic detachment process acts to regulate mRNA levels of

different viral genes as genes distal to the 3’ leader sequence have progressively less mRNAs

transcribed. As such, the relative frequencies of mRNA products when compared to N mRNA

are as follows: N (100%), P (34%), M (25%), F (20%), H (15%) and L (1.5%) (Cattaneo et al.,

1987). MV mRNA are capped and polyadenylated.

14

Translation of most of the viral genes is done by free ribosomes. H and F proteins are

exceptions in that they are translated and modified in the endoplasmic reticulum (ER) and the

Golgi apparatus for export to the cell surface. A hallmark of MV infection is the formation of

multinucleated giant cells (syncytia), which occurs as a result of an infected cell fusing with an

adjacent, receptor expressing cell. This feature allows the virus to efficiently recruit increasing

amounts of cellular machinery without the need for an additional infection cycle.

The first step in replication involves the production of a positive-sense antigenome. It is

thought that the expression level of N acts as the switch between transcription and replication

with increased levels of N switching the RdRp to its replication mode. In contrast to the mRNAs,

full-length copies of both the genome and the antigenome are encapsidated by N proteins, and

have 5’ triphosphates at their ends. Once the antigenome is produced, it is used as a template to

generate the negative-stranded viral genome. The P protein, which interacts with N, serves to

anchor some RdRp to the new RNPs. The M protein functions to target the RNP to the internal

portion of the cell membrane through its interaction with the N protein on RNPs; and during the

budding process the H and F incorporated plasma membrane forms an envelope around the RNP,

forming an infectious virion.

1.6 Measles Virus Receptors

MV uses two well-characterized cellular receptors for gaining entry into cells. The locations of

expression of these receptors, in addition to a third receptor shown to be expressed on epithelial

cells, explain the viral tropism [reviewed in (Yanagi et al., 2009)]. Additional attachment

receptors have also been discovered, but the physiological significance of these molecules in a

natural course of infection requires further examination.

1.6.1 CD46/Membrane Cofactor Protein (MCP)

CD46 is a receptor for vaccine and cell culture-adapted strains of MV [reviewed in (Kemper and

Atkinson, 2009)]. Its physiological function is to protect cells from complement-mediated cell

death by acting as a cofactor for factor I-mediated proteolytic inactivation of C3b and C4b

(Liszewski et al., 1991). It is a type I glycoprotein with a broad molecular weight of 45-70 kDa,

due to the presence of multiple splice variants and differential glycosylation patterns (Cole et al.,

1985; Liszewski et al., 1991). CD46 is expressed by all nucleated cells except erythrocytes in

15

humans (Cole et al., 1985; Seya et al., 1988). It contains 4 extracellular short consensus repeats

(SCRs) with SCR1 and SCR2 being utilized by MV H for attachment (Devaux et al., 1996; Hsu

et al., 1997; Iwata et al., 1995; Manchester et al., 1995). N481Y and/or S546G mutations in wild-

type MV H is sufficient to allow CD46 usage (Bartz et al., 1996; Hsu et al., 1998; Lecouturier et

al., 1996; Li and Qi, 2002; Rima et al., 1997) and A428, F431, V451, Y452, L464, Y481, P486,

I487, A527, S546, S548, and F549 have been shown to be critical in CD46 attachment (Masse et

al., 2004; Masse et al., 2002; Santiago et al., 2002; Vongpunsawad et al., 2004). These residues

are located at the bottom half of the H dimer, and are adjacent to but distinct from the SLAM and

PVRL4-specific sites (Hashiguchi et al., 2007; Navaratnarajah et al., 2009; Navaratnarajah et al.,

2008).

1.6.2 CD150/Signaling Lymphocyte Activation Molecule (SLAM)

Wild-type, clinical strains of MV exclusively use SLAM as the cellular receptor (Hsu et al.,

2001; Tatsuo et al., 2000). SLAM is a 70 kDa type I transmembrane glycoprotein found on

thymocytes, activated lymphocytes, mature dendritic cells, and macrophages (Calpe et al., 2008).

It has two extracellular immunoglobulin superfamily domains, V and C2, and a cytoplasmic tail

with SH2 docking sites. SLAM interacts with SLAM on adjacent cells, and its binding in T cells

results in phosphorylation of SLAM, and up-regulation of the transcription factor, GATA3, for

induction of Th2 cytokine production when the T cell receptor is also engaged (Calpe et al.,

2008; Mavaddat et al., 2000). SLAM also plays a role in lipopolysaccharide-induced production

of IL12, tumour necrosis factor α, and nitric oxide by macrophages in mice (Wang et al., 2004a).

MV H interacts with the V domain (Ono et al., 2001), and I194, D505, D507, Y529, D530,

T531, R533, H536, Y553, and P554 on H have been shown to be important for SLAM-

dependent fusion (Masse et al., 2004; Navaratnarajah et al., 2008; Vongpunsawad et al., 2004).

These residues are centrally located on the top of the H dimer (Hashiguchi et al., 2007;

Navaratnarajah et al., 2009; Navaratnarajah et al., 2008).

1.6.3 Nectin 4/Poliovirus receptor-related 4 (PVRL4)

In MV infected patients, the virus has been observed to form multinucleated syncytia in such

epithelial organs as the skin, oral cavity, pharynx, and the trachea (Griffin, 2007). Since

epithelial cells lack SLAM expression, a distinct epithelial cell-specific receptor has been

suggested to be used by wild-type MV (Andres et al., 2003; Hashimoto et al., 2002; Tahara et al.,

16

2008; Takeda et al., 2007; Takeuchi et al., 2003b). While the identity of the receptor itself has

been a mystery until recently, two groups have identified L482, F483, P497, Y541, and Y543

residues on H to be involved in mediating the epithelial receptor-dependent fusion (Leonard et

al., 2008; Tahara et al., 2008). These residues are laterally located at the top of the H dimer

(Hashiguchi et al., 2007; Navaratnarajah et al., 2009; Navaratnarajah et al., 2008).

Using microarray analyses, our laboratory identified PVRL4 as an entry receptor on

epithelial cells for both wild-type and vaccine strains of MV (Appendix I; (Noyce et al., 2011)).

This 56 kDa transmembrane protein is normally present at the adherens junctions and interacts

with itself and the V domain of PVRL1, a closely related molecule. It is expressed in moderate

amounts in the epithelium of tonsils, oral mucosa, esophagus, and the nasopharynx. The

identification of PVRL4 as the epithelial receptor significantly broadens our current

understanding of MV pathology.

1.6.4 CD209/Dendritic Cell-Specific Intracellular Adhesion Molecule 3-Grabbing Nonintegrin (DC-SIGN)

DC-SIGN has been shown to play a role in MV infection of dendritic cells (de Witte et al.,

2006). DC-SIGN binds to both F and H proteins of vaccine and wild-type MV strains, but the

expression of DC-SIGN on CHO cells does not confer susceptibility to MV. DC-SIGN binding

appears to facilitate the subsequent binding of H to other entry receptors (e.g. SLAM). Therefore,

DC-SIGN acts as an attachment but not entry receptor for DCs. DC-SIGN+ cells were shown to

be present in abundance in the sub-epithelial tissues of the respiratory tract in macaques, and it

was shown that these DCs transferred uninternalized MV to the lymph nodes where the infection

was spread to the T-lymphocytes (de Witte et al., 2008).

1.6.5 CD147/Extracellular Matrix Metalloproteinase Inducer (EMMPRIN)

EMMPRIN was recently shown to be a functional entry receptor for wild-type MV entry into

epithelial cells in a CD46- and SLAM-independent manner (Watanabe et al., 2010). EMMPRIN

is a glycoprotein found on epithelial and neuronal cells, and its expression on tumour cells

stimulates the production of matrix metalloproteinases that break down the extracellular matrix

and allows tumour progression and metastasis (Polette et al., 1997; Tang et al., 2004). MV N

protein was shown to bind to cyclophilin A and B, which are EMMPRIN ligands. The binding of

cyclophilin B to MV N results in preferential incorporation of cyclophilin B into progeny virions

17

where it can then bind to surface expressed EMMPRIN. Since EMMPRIN mediated entry is

dependent on N, but not H, the physiological role of this receptor remains to be elucidated.

1.6.6 Neurokinin-1 (NK-1)

The trans-synaptic spread of MV in neurons observed in SSPE has been attributed to the usage of

NK-1 as a receptor for the MV F protein (Makhortova et al., 2007). The neurotransmitter

substance P, the ligand for NK-1, efficiently inhibited MV transmission in neurons. Furthermore,

neonatal CD46+/NK-1KO mice were resistant to MV neuronal infection whereas the CD46+/NK-

1+ mice succumbed to CNS disease.

1.7 Animal Models of Measles

1.7.1 Primate Models

Since MV is a human virus, animal models had to be developed to study many aspects of the

virus in a more rigorous setting. Two primate models have been developed, but in marmosets

(Saguinus mystax), a New World monkey, MV infection caused a disease with a different

pathology (i.e. gastroentercolitis and pneumonitis) than that of humans and was associated with

high mortality rates (Albrecht et al., 1980). Rhesus macaques (Macaca mulatta), in contrast, can

be experimentally infected with MV and exhibit similar clinical, immunological and pathological

parameters to those associated with measles in humans [reviewed in (de Swart, 2009)]. With the

advent of recombinant MV technology, many elegant studies involving in vivo rhesus work have

recently been published (de Swart et al., 2007; Lemon et al., 2011; Leonard et al., 2010; Leonard

et al., 2008). GFP expression-capable MV was used to show that MV targets CD150 expressing

lymphocytes and myeloid dendritic cells (de Swart et al., 2007). This group has further shown

that large mononuclear cells with alveolar macrophage and dendritic cell phenotypes were the

first cells to be infected via aerosolized MV, and that the infection spreads to the bronchus-

associated lymphoid tissue (BALT) to infect B- and T-cell populations (Lemon et al., 2011).

Recently, by using a recombinant virus unable to utilize SLAM, Leonard and colleagues showed

that SLAM recognition is necessary for MV pathogenesis, but the SLAM-blind virus is still

capable of inducing a strong and lasting immune response (Leonard et al., 2010). Furthermore, in

the search for the elusive epithelial cell receptor (EpR; now known as PVRL4), a recombinant

EpR-blind virus was developed and shown to be virulent, but incapable of being shed via

18

pulmonary routes, further giving support to the theory that this receptor plays a role in virus

egress rather than the initial infection (Leonard et al., 2008). Rhesus monkeys have also been

shown to be good tools for studying different MV vaccine delivery routes (Lin et al., 2011).

1.7.2 Cotton Rat Model

Cotton rats (Sigmodon hispidus) are susceptible to MV infection and exhibit such symptoms as

suppression of selective T cell responses and immunosuppression upon MV infection [reviewed

in (Niewiesk, 2009)]. Receptor usage studies using recombinant virus have shown that wild type

and Edmonston strain (vaccine strain) H proteins confer different pathological phenotypes in

these animals, indicating that MV may also use discrete receptors in cotton rats (Pfeuffer et al.,

2003). Further development of cotton rat-specific tools will enhance this model’s usefulness in

studying MV pathogenesis.

1.7.3 Transgenic Mouse Models

Although primate models have the advantage of reproducing many aspects of measles pathology,

more practical and less expensive small animal models are also invaluable research tools. Once

CD46 was discovered to be a receptor for MV, several groups developed transgenic mice that

expressed human CD46 under various promoters (Blixenkrone-Møller et al., 1998; Horvat et al.,

1996; Mrkic et al., 1998; Oldstone et al., 1999; Rall et al., 1997; Thorley et al., 1997). Although

splenocytes could be infected ex vivo, the expression of CD46 was found to be insufficient to

allow productive infection in vivo and the mice did not exhibit any disease symptoms (Horvat et

al., 1996; Rall et al., 1997; Thorley et al., 1997). The block in viral spread was suggested to be

due to immune response activation, as CD46 transgenic mice that do not express the interferon

α/β receptor (IFNAR) were susceptible to MV lymphatic dissemination and pathogenesis (Mrkic

et al., 2000; Mrkic et al., 1998). In addition, crossing the mice into the T- and B-lymphocyte

deficient RAG2 knockout background also increased susceptibility in the CNS (Lawrence et al.,

1999). These studies, however, were limited to examining the vaccine strains of MV, since wild

type MV does not utilize CD46 for cell entry.

Since the discovery of CD150 as the receptor for wild type MV, several groups have

generated CD150 transgenic mice (Hahm et al., 2003; Hahm et al., 2004; Ohno et al., 2007;

Sellin et al., 2006; Welstead et al., 2005). In mice in which CD150 expression was limited to T

19

cells, ex vivo infection of splenocytes showed that cell proliferation was inhibited by MV (Hahm

et al., 2003). In mice in which CD150 expression is restricted to CD11c+ dendritic cells,

intravenous MV infection showed that 2-5% splenic dendritic cells (DCs) were infected, and that

ex vivo infected DCs failed to activate T cells (Hahm et al., 2004). Study by the same group later

found that MV infection interfered with development and expansion of DCs through generation

of type I interferon by DCs (Hahm et al., 2005). Yanagi and colleagues generated a CD150

knock-in mouse in which the MV-binding V domain of human SLAM replaced the non-virus

recognizing mouse counterpart. The expression profile of SLAM in this model is thus that of the

natural host, and upon crossbreeding with the IFNAR-null line, MV infection in the double

transgenic line exhibited immunosuppression (Koga et al., 2010; Ohno et al., 2007). Our lab

generated a transgenic SLAM mouse using the endogenous human promoter, and have shown

that MV spreads to the lymphoid organs in a STAT1 knockout background (Welstead et al.,

2005). Crossing this mouse with an IFNAR knockout strain, instead, Ferreira and colleagues

have identified alveolar macrophages and DCs to be key target cells in the initial stages of

infection (Ferreira et al., 2010).

To date, one group has generated a double transgenic mouse which expresses both

receptors (Shingai et al., 2005). In this study, intraperitoneal infection in IFNAR-null

background resulted in DC infection and highlighted the role DCs have in viral spread in vivo.

Many different transgenic mouse lines have been generated to study MV pathogenesis,

but none of them have reproduced all the aspects of infections in humans. Despite imperfections,

these different models have proved to be useful tools in examining diverse aspects of MV

pathogenesis, and require further development and study.

1.7.4 Ferret Model of Canine Distemper Virus

Canine distemper virus (CDV) is a morbillivirus that has a broader host range than most other

members of this genus [reviewed in (Sawatsky et al., 2011)]. It naturally infects carnivores such

as dogs and ferrets and causes severe and often lethal disease (Barrett, 1999; Harder and

Osterhaus, 1997). CDV also uses SLAM as an entry receptor (von Messling et al., 2006), and

through the use of recombinant CDV with a mutation in the region analogous to the PVRL4

recognition site in the MV H, it was suggested that PVRL4 is also utilized as an exit receptor in

ferrets. Shedding seems to be an important part of disease progression since PVRL4-blind CDV

20

failed to cause clinical symptoms in these animals (Sawatsky et al., 2012). One of the foreseeable

problems with developing MV as an oncolytic virus is that MV antiserum is already present in

most patients as a result of vaccination or natural infection. Use of CDV would theoretically

allow researchers to exploit the natural tumour targeting properties inherent in morbillivirus

while at the same time using a virus that is not subject to neutralization by the existing humoral

immunity. The oncolytic potential of CDV has already been demonstrated as it has been shown

to target canine B and T cell lymphoma and cause apoptosis in these cells (Suter et al., 2005).

The genetic and clinical similarities between MV and CDV make the study of CDV in its natural

host an attractive model for the characterization of MV pathogenesis.

Innate Immunity 2

2.1 First Encounter

Although the adaptive immune response to MV infection has been the main focus of research

due to its links to immune suppression, viral clearance and life-long immunity, recent advances

in the field of innate immunity has greatly expanded our knowledge of the initial sequence of

events that occur when a cell encounters the virus for the first time. The innate immune system

provides cellular defense against numerous foreign pathogens whose specific signatures or

pathogen-associated molecular patterns (PAMPs) are recognized by an array of pattern

recognition receptors (PRRs) (Yoneyama and Fujita, 2009). These receptors are present on a

variety of locations and provide surveillance of the cell’s immediate external environment, the

endosomal lumen, and the cytoplasm. Major classes of PRRs are the Toll-like receptors (TLRs),

the RIG-I-like receptors (RLRs), and the NOD-like receptors (NLRs). Upon PAMP recognition,

these PRRs are rapidly activated to induce secretion of proinflammatory cytokines (e.g. IL1β and

TNFα (tumour necrosis factor α)), chemokines (e.g. IP10 (IFN-inducible protein 10) and

RANTES (regulated upon activation, normal T cell expressed and secreted)), and type I (IFNα

and IFNβ) and type III (IFNλ) interferons, which serve to activate the immune system and arm

the cell and its neighbours against the incoming pathogen. These factors not only drive the

antiviral response, but also serve to recruit and orchestrate the adaptive immune system by

enhancing NK cell function, activating immature DCs, and priming T and B lymphocytes for

their survival and effector functions. Of the three PRR classes mentioned, TLRs and RLRs have

21

been shown to play critical roles in virus detection and are detailed here. A generalized pathway

is shown in Figure 1.7.

Figure 1.7. Summary of the innate immune signaling pathways that recognize virus infection (adapted from (Hiscott, 2007)).

2.2 Toll-Like Receptors (TLRs)

TLRs are a family of single-transmembrane proteins expressed predominantly in immune cells,

such as macrophages and DCs (Akira et al., 2006; Kawai and Akira, 2010). At least 13 members

have been discovered in mammals, but functional characterizations of some receptors are

incomplete. Defining features of TLRs include extracellular leucine-rich repeats (LRR) that

recognize specific PAMPs, and an intracellular signal-transduction domain known as the TIR

(Toll/IL1 receptor) domain. TLRs 1, 2, 4, 5, and 6 are expressed on the cell surface and detect

various bacterial and fungal cell wall components as well as some viral structural proteins. In

22

contrast, TLRs 3, 7, 8, and 9 recognize viral nucleic acids in the endosomal compartment. This

receptor compartmentalization not only allows rapid induction of innate immune response upon a

virus uncoating event, it also allows antigen cross-presentation to occur in the antigen-presenting

cell populations, providing an important link to the induction of adaptive immune responses

(Schulz et al., 2005). TLR activation generally induces production of proinflammatory cytokines

such as IL6 and TNFα via activation of NF-κB; however, the endosomal TLRs specifically

activate type I IFN production in addition to these cytokines.

2.2.1 Toll-Like Receptor 2/4 (TLR2/4)

TLRs 2 and 4 are surface expressed PRRs which have been shown to be able to detect structural

components of viruses. TLR2 recognizes a diverse range of PAMPs such as lipoteichoic acid

from Gram-positive bacteria, lipoarabinomannan from mycobacteria, zymosan from fungi, and

the H protein of MV (Bieback et al., 2002). The diversity of ligands may be attributed to the fact

that it heterodimerizes with TLR1 or TLR6. TLR4 was initially identified as the receptor for

bacterial lipopolysaccharide of Gram-negative bacteria (Poltorak et al., 1998). It has since been

shown to be able to recognize such viral structural proteins like the respiratory syncytial virus

(RSV) fusion protein (Kurt-Jones et al., 2000), and mouse mammary tumor virus envelope

protein (Rassa et al., 2002).

TLR2 activation results in recruitment of TIRAP (TIR-associated protein) and MyD88

(myeloid differentiation factor 88). This pathway is known as the MyD88 dependent pathway.

MyD88 then forms a complex with IRAK4 (IL-1 receptor-associated kinase 4), and IRAK1.

IRAK1 phosphorylates TRAF6 (TNFR-associated factor 6), which acts as an E3 ubiquitin ligase

and catalyzes the K63-linked polyubiquitin reaction on itself and IKKγ with the E2 ubiquitin

ligase complex (UBC13 and UEV1A). TRAF6 ubiquitination activates the TAK1 (TGFβ-

activating kinase 1) complex, resulting in phosphorylation of IKKγ and activation of the IKK

complex. Phosphorylated IκB undergoes K48-linked ubiquitination and degradation by

proteasome, freeing NF-κB to translocate to the nucleus and transcribe proinflammatory cytokine

genes. TAK1 also activates the MAPK (mitogen activated protein kinase) cascades, leading to

the activation of AP1 (activator protein 1), which is also critical for the induction of cytokine

genes.

23

TLR4 initially triggers the same signal pathway as the one just described for TLR2, but it

is then internalized and retained in the endosome, where it triggers signal transduction by

recruiting TRAM (TRIF-related adaptor molecule) and TRIF (TIR domain containing adaptor

inducing IFNβ). This TRIF-dependent pathway, described for TLR3 in the following section,

activates both NF-κB and interferon regulatory factors (IRFs).

2.2.2 Toll-Like Receptor 3 (TLR3)

TLR3 detects dsRNA, which is found as part of dsRNA virus genomes or as replication or

transcription intermediates of ssRNA viruses or DNA viruses. Expression of TLR3 is

predominantly observed in conventional dendritic cells (cDCs) and macrophages. It has also

been reported to bind to the synthetic dsRNA, polyinosinic:polycytidylic acid (pIC)

(Alexopoulou et al., 2001), as well as recognize ssRNA from viruses such as RSV, West Nile

virus, encephalomyocarditis virus (EMCV), Semliki forest virus (SFV), and influenza A virus

(Le Goffic et al., 2006; Rudd et al., 2006; Wang et al., 2004b; Yoneyama and Fujita, 2009). It

can also play a defensive role against DNA viruses such as mouse cytomegalovirus (MCMV),

and herpes simplex virus (HSV) (Tabeta et al., 2004; Zhang et al., 2007).

Engagement of TLR3 to its ligand initiates a signal cascade which utilizes the specific

adapter molecule TRIF. TLR3-TRIF interaction occurs via homotypic interaction between the

two TIR domains. The TLR-TRIF complex initiates two distinct signals. First, it recruits a set of

signaling molecules that include TRAF3 and NAP1 (NF-κB-activating kinase (NAK)-associated

protein 1), and activates the two IKK family kinases, TBK1 (TANK (TRAF-family member-

associated NF-κB activator)-binding kinase 1), and IKKi (also known as IKKε), which

phosphorylate C-terminal serine residues of both IRF3 and IRF7. These transcription factors play

an instrumental role in IFN production. Concurrent to the first complex formation, the TLR3-

TRIF complex also recruits and activates TRAF6 and RIP1 (receptor interacting protein 1) and

cooperatively activate TAK1. This leads to the activation of the canonical IKK complex,

IKKα/β/γ, resulting in activation of NF-κB, and the production of inflammatory cytokines.

Signaling through TAK1 complex also causes activation of the MAPK pathway, which results in

phosphorylation of JNK (c-Jun N-terminal kinase) and p38 to activate AP1. The transcription

factors IRF3, NF-κB, and AP1 serve to initiate transcription of IFN and proinflammatory

cytokines.

24

2.2.3 Toll-Like Receptor 7/8 (TLR7/8)

TLRs 7 and 8 are structurally homologous and known to be sensors for ssRNA. Mouse TLR8 is

believed to be non-functional. It has been reported that Sendai virus, vesicular stomatitis virus

(VSV), Coxsackie B virus, parechovirus 1, and Dengue Virus are recognized by TLR7/8

(Yoneyama and Fujita, 2009). In humans, TLR7 is predominantly expressed in plasmacytoid

dendritic cells (pDCs), whereas TLR8 is observed in myeloid DCs and monocytes. Not only are

endosomal degradation products of viral particles a trigger for TLR7/8, but cytoplasmic viral

ssRNA transported into lysosomes by autophagy is recognized by TLR7 in pDCs (Lee et al.,

2007).

Like all other TLRs, with the exception of TLR3, TLR7/8 transmit signal through the

adaptor molecule MyD88, which contains a TIR domain. In TLR8 signaling, upon ligand

binding, TLR interacts with MyD88, and recruits downstream signaling molecules, IRAK1,

IRAK2, IRAK4, and TRAF6. IRAK4 is activated initially and has an essential role in activation

of NF-κB and MAPK downstream of MyD88. IRAK1 and IRAK2 are activated sequentially and

activation of these kinases is required for robust activation of NF-κB and MAPK. IRAK

activation results in interaction with TRAF6. TRAF6 then activates TAK1, which forms a

complex with IKK, leading to NF-κB activation. TAK1 simultaneously activates the MAPKs

ERK1 (extracellular regulated kinase 1), ERK2, p38, and JNK by activating MAPK kinases,

which then activate various transcription factors including AP1. Furthermore, IRF5 can be

stimulated by TRAF6 for induction of inflammatory response.

In pDCs, TLR7 signaling relies on MyD88 for induction of both proinflammatory

cytokines as well as type I IFNs. In these cells, constitutively expressed IRF7 is recruited to the

signaling complex with IRAK1, IRAK4, TRAF3, TRAF6, and IKKα, and is directly activated by

IRAK1 or IKKα via phosphorylation. Activation of IRF7 results in production of IFNs. TRAF6

in the complex serves to activate NF-κB in the same manner as in TLR8 signaling.

2.2.4 Toll-Like Receptor 9 (TLR9)

TLR9 is predominantly expressed in the endosomal compartment of pDCs and B cells and is

implicated in detection of CpG-containing DNA (Yoneyama and Fujita, 2009). TLR9-mediated

signaling, which leads to production of both proinflammatory cytokines and type I and III IFNs,

25

is almost identical to the TLR7/8 pathway. TLR9 has been shown to recognize unmethylated

CpG DNA, characteristic of bacterial genomic DNA, as well as viral DNA such as HSV1/2,

MCMV and adenovirus.

2.3 RIG-I Like Receptors (RLRs)

RLRs, a family of DExD/H-box-containing RNA helicases, are PRRs for the detection of viral

RNA in the cytoplasm of infected cells. In mammals, three family members have been

discovered: RIG-I (retinoic acid-inducible gene I), MDA5 (melanoma differentiation associated

gene 5) and LGP2 (laboratory of genetics and physiology 2) (Yoneyama and Fujita, 2009). All

three RLRs contain a RNA helicase domain with RNA-dependent ATPase activity. The N-

terminal portion of RIG-I and MDA5 contain two CARDs (caspase recruitment domains), while

LGP2 does not have this domain. All RLRs contain a C-terminal domain (CTD), also known as a

repressor domain (RD) because it represses RIG-I activity in the absence of viral infection. RLRs

are constitutively expressed in most cell types, and expression is up-regulated upon interferon

stimulation.

2.3.1 Retinoic acid-Inducible Gene-I (RIG-I)

RIG-I appears to preferentially recognize 5’-triphosphate (ppp)-containing ssRNA of various

lengths with some partial double-stranded structure (e.g. panhandle structures) (Onoguchi et al.,

2011; Rehwinkel et al., 2010). Short dsRNA (<1kb) also behave as ligands for RIG-I in a

sequence and 5’-ppp-independent manner (Kato et al., 2008). These RNA species are

differentially recognized by RIG-I as foreign, since cellular RNA is typically capped or

processed upon maturation. RIG-I deficiency disrupts responses to ssRNA viruses including

Sendai virus, Newcastle disease virus (NDV), Japanese encephalitis virus, hepatitis C virus

(HCV), influenza A virus, and VSV (Kato et al., 2006; Saito et al., 2008); however, IFN

response to EMCV, a picornavirus, is unaffected (Kato et al., 2006). Picornavirus 5’ ends are

protected by a viral protein and as a result, are undetectable by RIG-I.

Ligand binding by CTD induces a conformational change in RIG-I that allows the CARD

to interact with MAVS (mitochondrial antiviral signaling; also known as IPS1, CARDIF, VISA).

Formation of the RIG-I/MAVS complex on mitochondria induces the assembly of protein

complexes that include TRAF3, TRAF6, caspase 8, caspase 10, RIP1, FADD (Fas-associated

26

death domain) and TRADD (TNF receptor-associated death domain). These complexes induce

kinase activities of both IKKα /IKKβ and TBK1/IKKi complexes to activate NF-κB and IRF3,

respectively.

2.3.2 Melanoma Differentiation Associated Gene 5 (MDA5)

MDA5 is responsible for the detection of members of Picornaviridae, including EMCV,

Theiler’s virus, and Mengo virus (Gitlin et al., 2006; Kato et al., 2006). Murine norovirus 1,

murine hepatitis virus, and long segments of reovirus are also recognized by MDA5 (Kato et al.,

2008; Loo et al., 2008; McCartney et al., 2008; Roth-Cross et al., 2008). Relatively long pIC

(>1kb) was also shown to be recognized by MDA5 (Kato et al., 2008). RIG-I and MDA5 are

known to use the same signal transduction pathways in the activation of NF-κB and IRFs.

2.3.3 Laboratory of Genetics and Physiology (LGP2)

LGP2 lacks the CARD domain that is present on the other two RLRs. Experiments have

demonstrated that it plays an inhibitory role in RIG-I mediated signaling (Rothenfusser et al.,

2005; Yoneyama et al., 2005). In one possible scenario, the LGP2 RD interacts directly with

RIG-I to inhibit activation. LGP2 may also play a role in cooperative recognition of dsRNA with

MDA5, since LGP2-null mice showed enhanced EMCV growth (Satoh et al., 2010;

Venkataraman et al., 2007). Upon VSV infection, LGP2-deficient DCs produced less IFN, but

IFN production was not affected following influenza A virus infection (Satoh et al., 2010). This

suggests that LGP2 functions in a virus-specific manner.

2.4 NOD-Like Receptors (NLRs)

Nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) family members have

been studied intensely for their function in regulation of inflammatory and apoptotic responses;

and as PRRs, they have been characterized mostly in the context of bacterial PAMP recognition

(Philpott and Girardin, 2010). However, various members of this family including NOD2,

NLRC5, and NLRP3 have recently been found to respond to viral infections. NOD2 (nucleotide-

binding oligomerization domain 2), a well-characterized PRR for bacterial muramyl dipeptide,

has been shown to recognize ssRNA from RSV, VSV and human parainfluenza virus type 3

(hPIV3) to activate IRF3-mediated responses via MAVS (Sabbah et al., 2009). The cytosolic

NLRC5 (NLR family CARD domain containing 5) was observed to be inducible upon pIC

27

treatment or Sendai virus infection, and siRNA-knockdown of this protein reduced virus and

pIC-mediated type I IFN responses (Neerincx et al., 2010). Additionally, NLRP3 (NLR family

pyrin domain containing 3; also known as NALP3 or cryopyrin) has recently been implicated in

the inflammatory response to several DNA and RNA viruses. Adenovirus, vaccinia virus (VV),

and influenza virus infections stimulated the NLRP3 inflammasome, which consists of NLRP3,

ASC (apoptotic speck-like protein containing a CARD) and caspase1, and resulted in the

production of IL1β (interleukin 1β), and cell death (Allen et al., 2009; Delaloye et al., 2009;

Muruve et al., 2008). Currently, the mechanisms through which these NLRs sense viral nucleic

acids remain to be elucidated. Moreover, their relative contributions to innate immune

surveillance in the context of the TLR and RLR systems require further examination.

2.5 DNA Sensors

Besides intracellular RNA sensors, cytosolic sensors that recognize dsDNA have also been

reported (Barbalat et al., 2011; Barber, 2011). The growing list includes DAI (DNA-dependent

activation of interferon regulatory factors; also known as ZBP1) and AIM2 (absent in melanoma

2), a member of the PYHIN (pyrin and hematopoietic IFN inducible nuclear protein (HIN)

domain-containing protein) family of proteins. Using a DNA chip screening approach, DAI was

identified as a putative DNA sensor (Takaoka et al., 2007). Knockdown of DAI led to a decrease

in the type I IFN in response to transfected dsDNA, and DAI was shown to bind to DNA and

activate IRF3 via STING (stimulator of IFN gene; also known as MITA (Ishikawa et al., 2009)).

Despite its ability to induce IFN production in overexpression models, mouse embryonic

fibroblasts (MEFs) and DCs from DAI knockout mice had no immune defect in response to

transfected DNA (Ishii et al., 2008). STING has been shown to play an important part in

transducing dsDNA- and RIG-I, but not MDA5-mediated IFNβ production. STING-null mice

succumbed to lethal HSV infection due to lack of type I IFN production (Ishikawa et al., 2009).

AIM2, on the other hand, induces the production of IL1β via inflammasomes (Rathinam

et al., 2010). Inflammasomes cleave pro-IL1β to its active form and induces a form of rapid cell

death termed pyroptosis (Mariathasan and Monack, 2007). Further complicating the picture is the

recent findings that point to the involvement of RLRs in sensing cytoplasmic DNA. In this

pathway, viral dsDNA is transcribed by RNA polymerase III (RNA pol III) into 5’-ppp-

containing dsRNA, which then activates RIG-I and triggers downstream type I IFN production

28

(Ablasser et al., 2009; Chiu et al., 2009). However, ligand recognition was rather restricted in

that only transfected poly (dA:dT) (synthetic AT-rich dsDNA), but not other types of DNA

including poly (dG:dC) (synthetic GC-rich dsDNA), calf thymus DNA, PCR fragments or

plasmid DNA were found capable of inducing a response. DNA viruses such as adenovirus,

HSV, and Epstein-Barr virus (EBV) were noted to be recognized via this pathway.

Exogenous DNA can induce IFNβ independently of DAI or RNA Pol III. Recent

identification of another intracellular DNA sensor, IFI16 (IFNγ-inducible protein 16), another

PYHIN family member, has been found to fill this role (Unterholzner et al., 2010). IFI16 senses

dsDNA from VV and HSV and induces IFNβ via IRF3 and NF-κB activation. The subject of

ligand specificity and the signal pathways utilized by these sensors is currently an actively

researched field.

2.6 Type I Interferon Response

2.6.1 Interferon Regulatory Factors (IRFs)

The detection of viral signatures by PRRs results in the phosphorylation and activation of the

transcription factors, IRF3 and/or IRF7 (Hiscott, 2007). The virus activated kinase TBK1/IKKi

phosphorylates IRF3 at Ser396/398/402/404/405, which alleviates auto-inhibition and permits

nuclear translocation and interaction of IRF3 with the CBP (cyclic-AMP response element

binding protein (CREB)-binding protein)/p300. Interaction with CBP facilitates phosphorylation

of Ser385/386, permitting dimerization of IRFs. IRF7 undergoes similar phosphorylation events

on Ser477/479 and then on Ser471/472. As a result, a holocomplex containing dimerized IRF3

and IRF7, either as a homodimer or heterodimer, and co-activators such as CBP/p300 is formed

in the nucleus. This holocomplex binds to target IFN-stimulated response elements (ISREs)

within the promoters of type I IFN genes. The IFNβ promoter contains at least four cis regulatory

elements involved in gene induction: PRDI (positive regulatory domain I), PRDII, PRDIII, and

PRDIV. IRF dimers bind PRDI and PRDIII, whereas activated NF-κB and AP1 bind PRDII and

PRDIV, respectively. In contrast, promoters of IFNα genes contain only IRF-binding elements.

In most cell types including fibroblasts, IRF3 is constitutively expressed in the cytoplasm

whereas IRF7 is only expressed upon induction by IFNs (Sato et al., 1998). The constitutive

expression of IRF3 allows rapid induction of IFNβ response upon PAMP detection.

29

Expression of additional IFNα subtypes and amplification of the IFN response occur

upon the induction of IFNβ, produced during the first wave, binding to its receptor to act in an

autocrine/paracrine manner. This second phase requires the activation of the transcription factor,

IRF9, as well as those induced by IFNs such as IRF7 (Sato et al., 2000). Both IRF3 and IRF7 can

form homodimers or heterodimers with each other, permitting differential activation of the IFN

genes (Hiscott, 2007). DNA binding site studies demonstrated that IRF3 and IRF7 both bound to

the GAAANNGAAANN consensus motif found in ISREs, but a single nucleotide substitution in

either GAAA eliminated IRF3, but not IRF7 binding (Civas et al., 2006; Lin et al., 2000). Thus,

the preferential activation of the IFNβ promoter by IRF3 is due to its more restricted DNA

binding specificity and its interaction with CBP. In contrast, IRF7 has a broader DNA binding

specificity and is capable of inducing both IFNα and IFNβ efficiently. This contributes to the

diversification of IFNα subtype secretions and the amplification of the primary IFN response.

Therefore, the observed biphasic IFNα/β gene induction is attributed to the differential

expression and use of the IRFs, and also to the binding specificities provided by these

transcription factors. The broader range of genes induced upon IRF7 activation explains why the

plasmacytoid dendritic cells, unique in their constitutive expression of IRF7, are potent IFNα

producers (Honda et al., 2005).

The importance of IRF3 and IRF7 in regulating early and late phase IFN expression was

demonstrated through the generation of IRF3 and IRF7 knockout mice (Honda et al., 2005; Sato

et al., 2000). IRF3 knockout mice showed increased susceptibility to EMCV virus infection and

serum IFN levels from virus-infected mice were significantly lower in the IRF3 knockouts

compared to the wild type controls (Sato et al., 2000). Using IRF7 knockout mice, it was

demonstrated that IRF7 is essential for the induction of type I IFN via virus mediated, TLR-

dependent pathways. Increased susceptibility to EMCV and HSV, as well as inhibition of IFNα

induction and reduced IFNβ levels were reported (Honda et al., 2005).

2.6.2 Type I and III Interferon Signaling

Type I IFNs (one IFNβ, over 14 IFNα subtypes, IFNω, -ε, and –κ) play an essential role in the

host immune response and mediate critical antiviral functions (Stark et al., 1998). The recently

discovered type III IFNs (3 IFNλ subtypes) are produced by a similar mechanism as type I IFNs,

but use a different set of receptors (IFNλR1 and IL10R2) [reviewed in (Donnelly and Kotenko,

30

2010)]. IFNs are the most commonly induced cytokines during a viral infection. Once secreted,

these multifunctional proteins act in an autocrine and paracrine manner to activate the infected

cell’s antiviral responses and alert the surrounding cells of the viral invasion. Secreted IFNα/β

binds to its receptor, the IFNAR (IFNα/β receptor) on the cell surface (Uze et al., 2007) (Figure

1.8). Most cell types express IFNAR, but type III IFN receptors are limited to expression in cells

of epithelial origin (Mordstein et al., 2010). Both type I and type III IFN binding results in

activation of the JAK (Janus kinase)- STAT (signal transducer and activator of transcription)

pathway (Schindler et al., 2007). The cytoplasmic tail of IFNAR1 associates with Tyk2 (tyrosine

kinase 2), while IFNAR2 associates with JAK1. IFN-mediated association of IFNAR1 and

IFNAR2 results in phosphorylation of Tyr466 of IFNAR1 by JAK1, creating a docking site for

STAT2. STAT2 is subsequently phosphorylated on Tyr690, and recruits STAT1 for its

phosphorylation of Tyr701. The phosphorylated STATs translocate to the nucleus and recruit

IRF9 to form a heterotrimeric complex named ISGF3 (IFN-stimulated gene factor 3) to activate

transcription of IFN-stimulated genes (ISGs) by binding to ISREs present in the target gene

promoter regions.

Figure 1.8. Type I interferon signaling pathway.

31

The critical role played by the type I IFN signal can be appreciated by the increased

susceptibility to various virus infections observed in mice that are selectively deficient in certain

components of this pathway. IFNAR null mice are highly susceptible to VSV, SFV, VV, and

lymphocytic choriomeningitis virus (LCMV) (Muller et al., 1994). Similarly, STAT1 knockout

mice are highly susceptible to infections by viruses such as VSV, and MCMV (Durbin et al.,

1996; Meraz et al., 1996). Finally, MEFs from IRF9 knockout mice consistently yielded higher

viral titers in response to EMCV, VSV, and HSV infections (Kimura et al., 1996).

2.6.3 Type II Interferon Signaling

Type II IFN consists only of IFNγ in humans, and is produced by activated T cells and NK cells

[reviewed in (Pestka et al., 2004; Stark et al., 1998)]. IFNγ released by Th1 cells recruit

leukocytes to sites of infection, increasing inflammation, and regulates Th2 responses. It also

stimulates macrophages to kill engulfed bacteria. IFNγ binds to the IFNγ receptor, composed of

IFNγR1 and IFNγR2 subunits, and activates JAK1/2 to phosphorylate STAT1 at Tyr701. The

dimerized, phosphorylated STAT1 translocates to the nucleus to induce genes containing

gamma-activated site (GAS) elements in the promoter.

2.6.4 Interferon-Stimulated Genes (ISGs)

Interferon-stimulated genes (ISGs), which number over 300 genes (de Veer et al., 2001; Der et

al., 1998), serve to arm the host against viruses while concurrently limiting virus spread and

marking virus-infected cells for elimination. Some of these antiviral proteins include ISG15

(IFN-stimulated protein of 15 kDa), Mx (myxovirus resistance) proteins, 2’,5’-OAS (2’,5’

oligoadenylate synthetase)/RNase L (ribonuclease L), PKR (dsRNA dependent protein kinase

R), ISG56, and ADAR1 (adenosine deaminase acting on RNA 1).

2.6.4.1 Interferon Stimulated Gene 15 (ISG15)

One of the most prominent ISGs to be induced during viral infection and the ensuing type I IFN

response is ISG15. ISG15 is an ubiquitin-like molecule which undergoes ISGylation in an

analogous manner as ubiquitylation (Zhang and Zhang, 2011). UbE1L (ubiquitin activating

enzyme E1-like) activates ISG15, UbCH8 conjugates it, and TRIM25 (tripartite-motif containing

32

protein 25), HERC5 (homologous to the E6-associated protein C terminus (HECT) domain and

RCC1-like domain containing protein 5), or HHARI (human homolog of Drosophila Ariadne)

act in E3 ligase roles to transfer it to the substrate. USP18 (ubiquitin-specific proteases 18) acts

as a deISGylation enzyme. Many of the target substrates of ISG15 such as JAK1, STAT1, RIG-I

and IRF3 have important roles in the type I IFN response. Although the specific role of

ISGylation still has to be elucidated in many of these interactions, ISG15 conjugation in the case

of IRF3 results in inhibition of Pin1-mediated ubiquitylation and degradation, leading to

sustained IFNβ secretion (Shi et al., 2010). ISG15 knockout mice are more susceptible to

infections by influenza A and B viruses, HSV1, murine gamma herpesvirus 68, and Sindbis virus

(Lenschow et al., 2007). However, no difference in susceptibility to VSV or LCMV infections

were observed compared to the wild type (Osiak et al., 2005). This illustrates that while

ISGylation plays an important antiviral role in certain situations, more work is required in clearly

elucidating its roles.

2.6.4.2 Myxovirus Resistance Protein (Mx)

The Mx family of GTPases, which comprise MxA and MxB in humans and Mx1 and Mx2 in

mice, also play important antiviral roles (Sadler and Williams, 2008). Gene expression is induced

through specific binding of ISRE by the ISGF3 complex (Dupuis et al., 2003). The main viral

target seems to be viral nucleocapsid-like structures, as MxA can block nuclear import of

Thogoto virus nucleocapsids (Kochs and Haller, 1999). Furthermore, both MxA and Mx1

associate with subunits of the influenza virus polymerase to block viral gene transcription (Turan

et al., 2004). MxA targets both nuclear and cytoplasmic viruses such as orthomyxoviruses,

paramyxoviruses, rhabdoviruses, togaviruses, and bunyaviruses.

2.6.4.3 2’,5’-Oligoadenylate Synthetase/RNase L (2’,5’-OAS/RNaseL)

Another potent antiviral effector is the IFN-inducible 2’,5’-OAS system, which involves the

endoribonuclease RNase L. Upon viral infection, binding of dsRNA stimulates 2’,5’-OAS to

produce adenosine oligomers which activate the latent form of RNase L (Sadler and Williams,

2008). The activation of RNase L results in cleavage of cellular and viral RNAs into short duplex

RNAs. As the cleavage products from this endonuclease can also activate RIG-I (Malathi et al.,

2007), the RLR signaling response is amplified during an antiviral response, and can further

potentiate RNase L activity. Since the OAS proteins are constitutively expressed at low levels,

33

they can act as PRRs for detection of viral dsRNA in the cytoplasm. RNaseL-deficient mice

show increased susceptibility to RNA viruses from Picornaviridae, Reoviridae, Togaviridae,

Paramyxoviridae, Orthomyxoviridae, Flaviviridae and Retroviridae families (Silverman, 2007).

2.6.4.4 Double-stranded RNA dependent Protein Kinase R (PKR)

PKR, a constitutively expressed serine/threonine kinase, is activated by its binding of dsRNA

from viral genomes or replicative intermediates. Upon ligand binding, it becomes

autophosphorylated, which permits it to then phosphorylate the α subunit of the eukaryotic

translation initiation factor-2 (eIF2α) at Ser51. Phosphorylation of eIF2α causes it to

competitively bind to the guanine nucleotide exchange factor eIF-2β, thereby rendering eIF-2β

unable to mediate exchange for GTP (guanosine triphosphate) (Pindel and Sadler, 2011). Due to

the low abundance of eIF-2β with respect to eIF2, a small quantity of phosphorylated eIF2α can

cause an immediate stop to translation, thereby effectively preventing viral protein synthesis. In

transgenic mice in which PKR function is inhibited, infection studies have shown that they are

more susceptible to VSV, influenza virus, and Bunyawera virus (Bergmann et al., 2000; Stojdl et

al., 2000). PKR also contributes to dsRNA-induced activation of NF-κB and the p38 mitogen-

activated protein kinase pathways by forming a complex with TAK1, and TAB2 and through its

interaction with MKK6 to feed into the inflammatory cytokine production pathway (Jiang et al.,

2003; Silva et al., 2004). Furthermore, PKR also affects various signal transduction cascades in

response to cellular stresses and has been shown to affect transcription regulation and apoptosis

(Garcia et al., 2006).

2.6.4.5 Interferon Stimulated Gene 56 (ISG56)

Also known as IFIT1 (IFN-induced protein with tetratricopeptide repeat (TPR) 1), ISG56 was

among the first ISGs to be discovered (Fensterl and Sen, 2011). Promoters of both human and

mouse genes contain two ISREs and as a consequence, ISG56 is efficiently induced by type I

IFN signaling, and also upon infection with viruses such as Sendai virus, RSV, VSV, West Nile

virus (WNV), LCMV, influenza virus, reovirus, HSV, CMV, and adenovirus, by IRF3 or IRF7

transcriptional activity (Barnes et al., 2004; Chattopadhyay et al., 2010). The best-characterized

function of ISG56 is the inhibition of translation by binding to subunits of eIF3, a critical part of

the translation initiation machinery. Human ISG56 binds to eIF3e to inhibit ternary complex

formation (Guo et al., 2000), while mouse ISG56 binds to eIF3c to inhibit the 48S complex

34

formation (Hui et al., 2005). ISG56 also specifically inhibits HCV-IRES translation initiation by

virtue of its interaction with eIF3 (Wang et al., 2003). Furthermore, ISG56 blocks human

papillomavirus replication by direct binding with the viral E1 helicase (Terenzi et al., 2008). Not

all its functions are antiviral, however, since it has been observed that human ISG56 binds to

STING, a scaffolding protein required in the RLR signal transduction, and disrupts the

STING/MAVS/TBK1 complex during Sendai virus infection to act as a negative regulator to

IFNβ production (Li et al., 2009).

2.6.4.6 Adenosine Deaminase acting on RNA (ADAR1)

ADAR1 catalyzes the deamination of carbon 6 in the purine, adenosine (A), to produce inosine

(I) in RNA substrates that possess regions of double-stranded character (George et al., 2011).

Editing by ADARs results in nucleotide substitutions in the RNA sequence, because the I is

recognized as a G instead of an A, both by ribosomes during translation and by RNA-dependent

polymerases during RNA replication. Furthermore, because stable A:U base pairs are changed to

less stable I:U mismatch base pairs, A-to-I editing leads to destabilization of the dsRNA

structure. Mammals have two ADAR genes (ADAR1 and ADAR2), but only ADAR1 is linked

to innate immunity. ADAR1 transcription initiates from multiple promoters, one of which

contains an ISRE, while the other is constitutively, and ubiquitously active (George and Samuel,

1999). Upon transcription, the mRNA undergoes alternative splicing to encode two different

sized proteins: the IFN-inducible p150, and the constitutively expressed p110. The p150 form of

ADAR1 has a longer N-terminus than the p110 form, and has two Z-DNA binding regions as

opposed to only one in the p110. The IFN-mediated induction of p150 is dependent on JAK1 and

STAT2, but not on STAT1 (George et al., 2008). A-to-G mutations attributed to ADAR activity

during virus infections have been described for different viruses including MV, hPIV3, RSV,

influenza virus, LCMV, Rift Valley fever virus, mumps virus, HCV, and mouse polyoma virus

(Samuel, 2011). In addition, two viral gene products, the VV E3L protein, and adenovirus VAI

RNA have been demonstrated to antagonize ADAR1 activity (Lei et al., 1998; Liu et al., 2001).

ADAR1 knockout mice are embryonic lethal; however, recent work with p150-selective

knockout MEFs showed that MV growth was enhanced in this cell line and p150 protected

against cytopathic events from NDV, Sendai, canine distemper virus (CDV), and influenza virus

infections, while growth of VSV, reovirus, or LCMV were unaffected (Ward et al., 2011).

35

Furthermore, ADAR1 is a necessary component for replication of hepatitis delta virus (Casey,

2006). The role of ADAR1 during viral infection is not clear, and requires further elucidation.

2.7 Plasmacytoid Dendritic Cells (pDCs)

Plasmacytoid dendritic cells (pDCs) are a rare population of bone-marrow-derived cells that

specialize in type I IFN production (Fitzgerald-Bocarsly and Feng, 2007; Swiecki and Colonna,

2010). pDCs were initially characterized based on their plasma cell-like morphology and their

ability to rapidly secrete abundant quantities of type I IFNs upon virus stimulation. They

comprise 0.3-0.5% of the human peripheral blood or of murine lymphoid organs, and reside

primarily in lymphoid organs such as T cell areas of lymph nodes (LNs), spleen, mucosal-

associated lymphoid tissues, thymus and liver. Although pDCs are thought to be derived from

the same hematopoietic stem cells that give rise to conventional DCs (cDCs) (Watowich and Liu,

2010), cDCs are characterized by a dendritic morphology; a rapid turn over; expression of a

broad range of PRRs (TLRs 2, 3, 4, and 5); expression of high levels of MHC class II, but not of

B220; and capacity to prime naïve T cells. pDCs, in contrast, have the rounded morphology of

secretory lymphocytes, a relatively long lifespan of approximately 2 weeks, and express low

levels of MHC class II and co-stimulatory molecules.

As previously mentioned, pDCs sense virus infections through TLRs 7 and 9, which are

present in the endosomes. Viruses that utilize a receptor-mediated endocytosis pathway (e.g.

HSV, Coxsackie B virus) are delivered to TLR containing endosomes (Lund et al., 2003; Wang

et al., 2007), whereas viruses that enter via fusion (e.g. VSV and Sendai virus) generate

replicative intermediates that are redirected from the cytosol into the TLR containing endosomes

by autophagy (Lee et al., 2007). pDCs also express RLRs but they do not appear to play a major

role in activation unless type I IFN signaling is impaired (Kumagai et al., 2009). Constitutive

expression of IRF7 is also a pDC-defining feature, and is due to the presence of pDC lineage

specific transcription factor, E2-2 (Cisse et al., 2008). Activation of pDCs results in increased

expression of MHC class II and co-stimulatory molecules such as CD80, CD86, and CD40,

resulting in the capacity to present antigens. Temporal factors are important as TLR engagement

in early endosomes leads to type I IFN production while late endosome engagement result in

pDC maturation and cytokine productions (Cao and Liu, 2007; Guiducci et al., 2006).

36

Although still incomplete, extensive characterization of the pDC surface markers has

been conducted (Barchet et al., 2005). Human pDCs express a variety of surface markers

including BDCA2 (blood dendritic cell antigen 2), ILT7, CD4, MHC class II, CD123, and CD2.

It lacks the following common lineage markers: CD3 (T cells), CD14 (myeloid cells), CD16 (NK

cells), CD19 (B cells) and the DC marker CD11c. In mice, pDCs are defined by their surface

phenotype of CD11clow CD11b- B220+ SiglecH+. They also express mPDCA1 (mouse pDC

antigen 1; also known as BST2/tetherin), Ly6C (lymphocyte antigen 6C), Gr1 (granulocyte-

differentiation antigen 1; also known as Ly6G), and CD8α. As in humans, pDCs in mice lack

certain common lineage markers: CD19, CD3, DX5 (NK cells), and CD11b (myeloid cells). In

mice, cDCs have a CD11chigh CD11b+ Ly6C- B220- mPDCA1- expression profile. While

mPDCA1 is selectively expressed on pDCs in naïve mice, it has been found to be up-regulated

on most cell types following exposure to type I IFN or IFNγ (Blasius et al., 2006).

pDC development requires Flt3L (FMS-like tyrosine kinase 3 ligand) and its receptor

Flt3 (CD135), a member of the tyrosine-kinase receptor family that regulates the steady state

pDC/cDC generation from bone marrow progenitors (Watowich and Liu, 2010). Mice with

targeted gene deletion of Flt3L or Flt3 have severely reduced cDCs and pDCs, with the pDCs

being affected to a greater extent (Kingston et al., 2009; McKenna, 2001; Waskow et al., 2008).

In addition, repetitive injection or conditional expression of Flt3L leads to massive expansion of

cDCs, pDCs, and myeloid cells but not B or T lymphocytes (Bjorck, 2001; Brasel et al., 1996;

Maraskovsky et al., 1996). Whereas Flt3L administration induces proliferative expansion of

common cDC/pDC progenitors (Naik et al., 2007), little or no proliferation seems to occur after a

cell has committed to the pDC lineage. This can account for the comparatively greater expansion

of cDCs (Vollstedt et al., 2004).

Due to their capacity to rapidly produce type I IFN, pDCs are thought to provide an

initial line of defense against viral infections. To study the role of pDCs in mice, initial attempts

were made to deplete pDCs through the use of various antibodies such as those against Ly6C

(Asselin-Paturel et al., 2001; Dalod et al., 2002), and mPDCA1 (Asselin-Paturel et al., 2003;

Blasius et al., 2006; Krug et al., 2004). These studies found that the depletion of pDCs impaired

the systemic type I IFN response to MCMV but did not affect NK cell responses or overall

survival (Dalod et al., 2002; Krug et al., 2004). Also, pDCs produced IFN in response to VSV

and influenza virus, yet were dispensable for their clearance (GeurtsvanKessel et al., 2008;

37

Swiecki et al., 2010; Wolf et al., 2009). In RSV infections, pDC deletion resulted in decreased

type I IFN and increased viral titer (Smit et al., 2006; Wang et al., 2006). And in mouse hepatitis

virus infection, an acute disease that requires TLR7 and IFN for viral clearance, pDC depletion

abolished IFN response, increased viral replication and exacerbated collateral tissue damage

(Cervantes-Barragan et al., 2007). However, due to the fact that these approaches may have

targeted non-pDC populations such as granulocytes in the case of anti-Ly6C, and other type I

IFN-stimulated cells in the case of anti-mPDCA1, further study may be required. Recently a

pDC knockout mouse which expresses the diphtheria toxin (DT) receptor under the control of

human BDCA-2 promoter was created (Swiecki and Colonna, 2010; Swiecki et al., 2010). In this

model, in which pDCs are selectively depleted upon DT administration, VSV infection showed

that only early type I IFN response (6 hpi) was affected in the absence of pDCs, and a decrease

in virus specific CD8+ T cell population was observed. pDC depletion also had no impact on

IFNα level upon LCMV infection, but low dose MCMV infections were controlled in an NK cell

independent manner. Taken together, these findings suggest that pDCs act in a virus and dose

dependent manner, but due to the multiple redundant mechanisms of virus sensing and interferon

secretion of the innate immune pathway, other cells maybe able to substitute pDC’s roles in

producing an antiviral response.

IFNα and the cytokines secreted by activated pDCs play an important role in bridging the

innate and adaptive immune systems (Figure 1.9) (Fitzgerald-Bocarsly et al., 2008).

Macrophages and cDCs are the major beneficiaries to the protection conferred by pDC-secreted

IFN, and it has been estimated that a single pDC can protect 10E3~10E4 macrophages. IFNα

mediates the maturation of cDCs allowing them to effectively present and cross-present antigens

to CD8+ T cells (Kolumam et al., 2005; Le Bon et al., 2003), and induces naïve T cell

differentiation into T helper 1 cells (Hibbert et al., 2003). These cDCs also induced Treg cells

(Ito et al., 2001). Type I IFNs derived from pDCs have been shown to induce monocytes to

differentiate into DCs. These DCs express higher levels of MHC class I and express TLR7, the

triggering of which induces CD8+ T cell activation (Mohty et al., 2003). pDCs also secrete IL12,

IL6, TNFα, and inflammatory cytokines. Type I IFN and IL12 promote multiple T cell functions

including long-term T cell survival and memory generation, Th1 polarization of CD4+ T cells,

CD8+ T cell cytolytic activity, and IFNγ production (Swiecki and Colonna, 2010). Furthermore,

pDCs have also been observed to increase NK-mediated cytotoxicity and IFNγ production

38

(Swiecki and Colonna, 2010). IFN and IL6 induce the differentiation of B cells into

immunoglobulin-secreting plasma cells, and induce isotype switching from IgM to IgG (Jego et

al., 2003; Le Bon et al., 2001). Lastly, chemokines such as CXCL9, CXCL10, CCL3, CCL4, and

RANTES produced by pDCs can attract activated CD4+ and CD8+ cells to infection sites

(Swiecki and Colonna, 2010).

Figure 1.9. Role of plasmacytoid dendritic cells in linking innate and adaptive immunity (adapted from (Fitzgerald-Bocarsly et al., 2008)).

2.8 Modulation of Innate Immunity by Measles Virus

MV infection in vitro and in vivo activates innate immunity with induction of type I IFN

responses. MV has demonstrated multiple, redundant means to modulate and exploit the host

innate responses (Gerlier and Valentin, 2009; Goodbourn and Randall, 2009).

39

One of the ways in which MV modulates components of the host innate immune system

is through its interaction with TLR2 (Bieback et al., 2002). The H protein of wild type but not

vaccine strains of MV can activate cells via interaction with either human or murine TLR2. TLR

2 activation induces surface expression of CD150/SLAM and secretion of pro-inflammatory

cytokines such as IL6 in human monocytic cells and macrophages. While this can contribute to

the activation of the immune system, it can also act to spread the virus by increasing the target

population of the virus.

Despite the fact that MV efficiently encapsidates its genomic and antigenomic RNAs,

IFNβ gene transcription kinetics during MV infection parallels virus transcription. This was

found to be due to the recognition of 5’ppp-ended leader/trailer RNA generated during viral

transcription by RIG-I (Plumet et al., 2007). From this perspective, it is curious that the MV V

protein interacts with MDA5 rather than RIG-I (Andrejeva et al., 2004; Childs et al., 2007).

Binding occurs through interaction of the V protein’s C-terminal domain with the helicase

domain of MDA5 and results in inhibition of IFN induction mediated by MDA5. It was also

shown that MDA5 activity is species specific, but the V protein of parainfluenza virus type 5

(PIV5) could inhibit its activity in multiple species.

MV infection or transfection of N results in phosphorylation of IRF3 at Ser385 and

Ser386 and thereby induce RANTES expression (tenOever et al., 2002). It was also shown that

in the infection model, activation of IRF3 required active MV transcription. Moreover, IRF3 and

TBK1/IKKi could be co-immunoprecipitated with N in HEK293 cells and the binding regions

were mapped to aa 376-523 on N and aa 198-394 on IRF3. However, this interaction seems to be

dependent on the cell environment since in vitro biochemical techniques failed to replicate the

interactions (Colombo et al., 2009). N can also bind to eIF3-p40 (eukaryotic initiation factor 3)

to inhibit host cell translation (Sato et al., 2007).

The JAK/STAT pathway which mediates IFN signaling is also targeted by MV. The N-

terminus of the P protein binds to STAT1, with Tyr110 acting as a critical residue in blocking

STAT1 phosphorylation (Caignard et al., 2007; Devaux et al., 2007; Ohno et al., 2004). Since

both P and V proteins share the same first 231 N-terminus residues, both proteins can inhibit

STAT1 phosphorylation and the resulting signal cascade (Caignard et al., 2007; Devaux et al.,

2007; Takeuchi et al., 2003a; Yokota et al., 2003). The V protein has also been shown to bind to

40

the kinase domain of JAK1, with its C-terminus stabilizing the interaction between JAK1 and

STAT1, and blocking subsequent STAT1 phosphorylation by JAK1 (Caignard et al., 2007).

Later, two groups also reported a direct interaction between V and STAT2, via the C-terminal

domain of V (Caignard et al., 2009; Ramachandran et al., 2008). This interaction was

independent of V’s interaction with STAT1. Another group has also found that V complexes

with STAT1, STAT2, STAT3 and IRF9, and that this causes a defect in STAT nuclear

translocation, although it does not affect STAT phosphorylation (Palosaari et al., 2003). Still

another group found that C and V proteins form a complex with IFNAR1, RACK1 (receptor of

activated kinase 1), and STAT1, fixing this complex in place so as to reduce JAK1

phosphorylation and STAT1 detachment (Yokota et al., 2003).

MV is highly immunotropic and possesses the ability to infect both pDCs and cDCs.

Infection of these cells with MV was shown to down-regulate type I IFN production in response

to TLR7/9 agonists (Schlender et al., 2005). As mentioned, pDCs activate type I IFN

transcription through a distinct pathway that leads to IRF7 phosphorylation. It has been shown

that V can block the IKKα-mediated IRF7 activation by directly binding to IKKα and acting as

its substrate (Pfaller and Conzelmann, 2008). In addition, V binds directly to IRF7 to inhibit its

transcriptional abilities independent of its phosphorylation status. V has also been shown to

inhibit NF-κB induction by binding to the p65 subunit via its C-terminal region (Schuhmann et

al., 2011).

MV C protein has also been reported to be capable of inhibiting IFNAR signaling, but the

effects are weak and variable depending on the strain tested (Fontana et al., 2008; Shaffer et al.,

2003). Giving support to the innate immunity modulating role of C was the finding that

recombinant MV based on the wild-type Ichinose strain, made to be deficient in C expression,

caused higher levels of IRF3 nuclear translocation and IFNβ production compared to the

unmodified wild type virus (Nakatsu et al., 2006). C protein has been observed in complex with

the IFNAR, STAT1 and the scaffolding protein RACK1, but its precise role in the inhibition

process is unknown since V protein was also a part of the complex (Yokota et al., 2003). MV C

has also been shown to negatively regulate viral RNA synthesis in mini-replicon systems. By

limiting the production of RNA, C may act by blocking PAMP production that can potentially

initiate an antiviral response (Nakatsu et al., 2008).

41

C protein has also been proposed to antagonize the antiviral pro-apoptotic actions of PKR

(Toth et al., 2009a). In shRNA-mediated PKR knocked down HeLa cells, reduction in PKR

partially rescued the growth defect of recombinant C-deficient MV virus. Defective growth and

decreased protein expression observed with this virus in PKR-expressing cells correlated with

increased PKR and eIF2α phosphorylation. Also, less apoptosis was observed in PKR

knockdown cells upon virus infection, suggesting PKR mediated MV induced apoptosis. It was

later found that PKR also played a key role in IFNβ induction by C-deficient MV (McAllister

and Samuel, 2009). The same group performed a similar study in ADAR1 knockdown cells

(Toth et al., 2009b). In these cells, C- and V-deficient MV production was much lower in the

ADAR1 knockdown cells compared to wild-type cells, suggesting that ADAR1 facilitates virus

replication. The enhanced apoptosis and virus-induced cytotoxicity observed in ADAR1

knockdown cells correlated with enhanced activation of PKR and IRF3. In contrast, infection of

ADAR1/p150 knockout MEFs showed increased viral production in the absence of ADAR1

(Ward et al., 2011). Although the precise role of ADAR1 in virus replication still remains to be

elucidated, a general model is emerging where ADAR1 acts by inhibiting PKR activation

(Gelinas et al., 2011).

MV infection causes the formation of multinucleated syncytia, a hallmark of MV

infection. MV infected human epithelial cells or mature cDCs form syncytia and express higher

levels of type I IFN (Herschke et al., 2007). The amplification of IFNβ signal was associated

with sustained nuclear localization of IRF3 in the syncytia, while IRF7 up-regulation was not

observed during the fusion process. Therefore, syncytia formation may also contribute

significantly to the antiviral response in vivo.

F Protein-Mediated Fusion 3

3.1 Details of F Protein

Both virus entry and multinucleated syncytia formation require the concerted actions of H and F

proteins. Various modifications to the H protein have been reported in terms of retargeting

(Russell and Peng, 2009; Schneider et al., 2000) or de-targeting its natural receptors (Leonard et

al., 2008). The actual fusion between the viral and cellular membranes is mediated by the F

42

protein through a well conserved process in nature, as evidenced by the multiple virus families

that use variations of the same mechanism (Lamb and Jardetzky, 2007).

As mentioned previously, MV F is a 553 aa type I transmembrane glycoprotein (Figure

1.10) (Richardson et al., 1986). Upon translation, a 28 aa signal sequence at the N-terminus of

the nascent polypeptide, which is later cleaved, directs it to the ER. The transmembrane domain

(TM) near the C-terminal end anchors it to the membrane, leaving a short 33 aa cytoplasmic tail

(CYT). The F protein is synthesized as a precursor polypeptide F0 (60 kDa), which forms a trimer

in the ER (Plemper et al., 2001). F0 is then cleaved by the ubiquitous intracellular protease furin

in the trans-Golgi at the RRHKR cleavage sequence, resulting in a metastable F protein that

consists of a membrane-spanning F1 (40 kDa), and a membrane-distal F2 (20 kDa) subunits (Bolt

and Pedersen, 1998; Watanabe et al., 1995). A disulfide bond covalently links the two subunits.

The newly exposed N-terminus of the F1 fragment contains a hydrophobic stretch of amino acids,

which comprises the fusion peptide (FP) that is inserted into the target membrane at fusion

initiation. The sequences immediately adjacent to the FP and TM exhibit a 4–3 heptadic pattern

of hydrophobic residue repeats and are named HRA and HRB, respectively. 4-3 heptads refer to

a repeated sequence of amino acids from ‘a’ to ‘g’ so that amino acids in positions ‘a’ and ‘d’ are

hydrophobic and ‘e’ and ‘g’ are predominantly polar. The HRA and HRB domains are separated

by approximately 250 residues and mutagenesis of these regions adversely affect fusion

(Buckland et al., 1992). The F2 subunit is glycosylated at 3 residues and these are necessary for

proper proteolytic processing and transport of the protein to the cell surface (Hu et al., 1995).

Figure 1.10. Measles virus fusion protein.

43

3.2 Fusion Process

The trigger for fusion initiation is currently thought to be the change in the interaction between

the stalk of H and the globular head of F, which occurs as result of receptor binding of H

(Navaratnarajah et al., 2009; Plemper et al., 2011; Smith et al., 2009; White et al., 2008). The

elucidation of the crystal structures of the pre-fusion form of PIV5 F protein and of the

postulated post-fusion forms of NDV and hPIV3 F proteins have greatly contributed to the

general understanding of paramyxovirus fusion (Chen et al., 2001; Swanson et al., 2010; Yin et

al., 2005; Yin et al., 2006). A general model for paramyxovirus fusion is presented in Figure

1.11A. The cleavage of F0 into F1–F2 in the cell initially primes the protein for membrane fusion.

In the pre-fusion form, the HRA domains (Blue) are separated and form a globular head with the

hydrophobic fusion peptides buried in a central hollow. The HRB domains (Red) interact in a

coiled-coil conformation forming the stalk. Upon triggering, conformational changes result in

dissociation of the trimeric HRB stalk, formation of a long HRA coiled-coil, and subsequent

insertion of the fusion peptide into the target membrane. The refolding of the separated HRB

domains leads to formation of a hairpin structure that positions HRB in an anti-parallel fashion

within the grooves of the HRA trimeric coiled-coil, forming a stable six helix bundle (6HB)

(Figure 1.11B). As a result of these conformational changes, the FP and TM domains, and by

association the target and donor membranes, come in close proximity to each other and fuse. It is

hypothesized that the 6HB complex formation provides at least a portion of the energy required

for the merging of the lipid bilayers (Baker et al., 1999). Finally, the fusion pore expands, in

what is hypothesized to be the most energetically costly stage of the membrane fusion process

(Chernomordik et al., 2006).

44

Figure 1.11. A model of paramyxovirus fusion process (A) (adapted from (Smith et al., 2009)). Interaction between HRA and HRB domains in the six helix bundle from a top view (B) (adapted from (Morrison, 2003)).

3.3 Carbobenzoxy-D-Phe-L-Phe-Gly

During screening for biologically active peptides, it was found that a tripeptide, carbobenzoxy-D-

phenylalanyl-L-phenylalanyl-L-nitroarginine (ZfF(NO2)R), was able to effectively inhibit MV

induced plaque formation in cultured cells (Miller et al., 1968; Nicolaides et al., 1968). Noting

45

the similarity of the amino acid sequence in ZfF(NO2)R with the FP sequence of

paramyxoviruses (e.g. MV, Sendai virus: Phe-Phe-Gly; PIV5: Phe-Ala-Gly; NDV: Phe-Ile-Gly),

Richardson and colleagues developed oligopeptides that resemble this region while introducing

variables in amino acid sequence, steric configuration, and adding different groups to the N- and

C-terminus (Richardson et al., 1980). It was found that carbobenzoxy-D-phenylalanyl-L-

phenylalanyl-glycine (ZfFG) had similar inhibitory properties as ZfF(NO2)R, but was also

moderately active against CDV. A ball-and-stick model of ZfFG is shown in Figure 1.12.

Among the compounds tested, only carbobenzoxy-D-Phe-L-Phe-Gly-D-Ala-D-Val-D-Ile-Gly had

a lower effective concentration. Because hemolysis and radiolabelled virus adsorption on cells

was unaffected in the presence of ZfFG, it was concluded that ZfFG did not inhibit virus

adsorption (Richardson and Choppin, 1983). The same study showed that ZfFG bound to cells

rather than virus particles. However, it was also shown that ZfFG were possibly bound to the

virus in Sendai virus infections (Asano and Asano, 1985). ZfFG was also capable of inhibiting

fusion in non-F mediated vesicle-to-vesicle fusion, and this was attributed to ZfFG’s roles in

bilayer membrane stabilization, inhibition of vesicle content leakage and reduction of lipid

intermixing rate (Epand et al., 1993; Kelsey et al., 1990). Furthermore it was shown that ZfFG

inhibited the formation by sonication of highly curved, small unilamellar vesicles and that its site

of action was most likely at the membrane’s outer surface (Dentino et al., 1995; Kelsey et al.,

1991). These observations suggest that ZfFG binds to and stabilizes the membrane leaflets,

thereby altering the lateral mobility of membrane components, and ultimately inhibiting

membrane distortion that is required at the initiation stage of fusion. Indeed, Weidmann and

colleagues demonstrated through a dye transfer assay in labeled cells with MV F that ZfFG

likely inhibits membrane fusion at the hemifusion stage, where mixing of the two outer

membrane bilayers occur (Weidmann et al., 2000b).

46

Figure 1.12. A ball-and-stick model of ZfFG.

Research Objectives 4The main body of this thesis is divided into three chapters. At the onset of this project, the toll-

like receptor and RIG-I like receptor signaling pathways were actively being mapped out (Akira

et al., 2006). In addition, our lab had just reported on the successful generation of a transgenic

mouse that expressed CD150/SLAM in a human-like manner (Welstead et al., 2005). We had

reported that mice with CD150/SLAM expression in a wild-type C57BL/6 background were

resistant to measles virus infection, and this block could be reduced when CD150/SLAM was

expressed in a STAT1 knockout background. Other groups had reported that the absence of

IFNAR also made transgenic CD46/MCP mice susceptible to measles infection (Mrkic et al.,

1998; Shingai et al., 2005). Since both IFNAR and STATs play a crucial role in induction of

innate immunity, it was hypothesized that measles was able to trigger the innate immune

system in mice. We propose to identify the exact nature of the block in rodents that inhibits

MV growth, with the ultimate goal of producing a measles-mouse model which replicates

authentic human-MV infections. To approach this problem, we set about testing mouse

embryonic fibroblast cell lines with various defects in the innate immune pathway. The results

from this in vitro model are presented in chapter 2. At the same time, a transgenic mouse with a

defect in IRF3 was produced in the CD150/SLAM background. Experimental results from the in

vivo model are presented in chapter 3.

47

An ideal small animal model will not only allow more detailed studies to be conducted on

basic MV pathology, but will have applications in testing efficacies of antiviral drugs as well.

Although measles is a virus targeted by the WHO for worldwide eradication (WHO, 2011),

break-through cases due to insufficient herd immunity and decreasing serum antibody titer can

result in sporadic outbreaks. Furthermore, there is great interest in developing MV as an

oncolytic treatment. Together, these factors underline the importance of the need for an effective

antiviral treatment. The small hydrophobic peptide, Z-D-Phe-L-Phe-Gly, was found to inhibit

MV-induced fusion (Richardson et al., 1980). Although some progress has been made about its

mechanism of action on the cell, its specific effect on MV is still unknown. The mechanism of

action of this peptide was examined by generating spontaneous resistant mutants, and the results

of these experiments are presented in chapter 4.

48

Chapter 2 In vitro role of mouse innate immunity on measles virus

49

Introduction

Measles is caused by measles virus (MV) which belongs to Paramyxoviridae, a family of viruses

which includes other notable pathogens such as Newcastle disease virus, Sendai virus,

respiratory syncytial virus and Nipah virus (Lamb, 2007). Despite the availability of an effective

vaccine, measles was still responsible for causing approximately 164,000 deaths in 2008, mainly

in developing countries due to inadequate vaccine coverage (WHO, 2011a). MV causes immune

suppression, leading to a higher incidence of secondary opportunistic infections that ultimately

cause death. Measles is a human disease in that the virus only infects the human population and

no animal reservoir for the virus has been found.

Since MV is a human pathogen, tools to examine different aspects of natural viral

infections such as the infectious cycle, tissue tropism, and viral interactions with the immune

system in vivo are limited. Similar obstacles exist in the development and testing of antiviral

treatments. Given that the vaccine has proven to be safe and effective, recombinant MV is also

being developed as an antigen delivery vehicle to vaccinate against other pathogens (Billeter et

al., 2009). Lastly, due to its natural oncolytic attributes (Bluming and Ziegler, 1971), there is

great interest in developing recombinant MV to treat specific types of cancers (Russell and Peng,

2009). All of these avenues of research make an authentic small animal model a much-needed

tool to study MV pathogenesis.

Clinical strains of MV use the signaling lymphocyte activation molecule (SLAM)/CD150

as an entry receptor (Hsu et al., 2001; Tatsuo et al., 2000). This molecule is present on

macrophages, dendritic cells, activated B and T lymphocytes (Cocks et al., 1995; Detre et al.,

2010; Godfrey et al., 2010; Veillette et al., 2007). With the discovery of the receptors, many

groups set out to create a transgenic mouse model, only to find that the expression of the receptor

alone did not result in a productive infection (Ohno et al., 2007; Sellin et al., 2006; Shingai et al.,

2005; Welstead et al., 2005). Productive infection was only observed when the mice were either

crossed into interferon alpha receptor (IFNAR) knockout or signal transducer and activator of

transcription 1 (STAT1) knockout lines, implying that the innate immune system played a

significant role in controlling MV infections within rodents (Druelle et al., 2008; Ferreira et al.,

2010; Ohno et al., 2007; Shingai et al., 2005).

50

Incoming viral pathogens are sensed by various cellular pathogen-associated molecular

pattern (PAMP) recognition receptors (PRR), which in turn lead to the establishment of an

antiviral state to limit further virus replication and spread (Yoneyama and Fujita, 2009). In most

cells, the detection of pathogen signatures such as dsRNA via toll-like receptor 3 (TLR3),

retinoic acid-inducible gene I (RIG-I) or melanoma differentiation-associated gene 5 (MDA5)

trigger a cascade of events that results in the phosphorylation of interferon regulatory factor 3

(IRF3), and the production of interferon beta (IFNβ). The secreted IFNβ acts in an autocrine and

paracrine manner and binds to the IFNα receptor (IFNAR), which initiates the Janus

kinase/signal transducer and activator of transcription (JAK/STAT) pathway. The

phosphorylated STAT1/STAT2 heterodimer associates with IRF9, and translocates to the

nucleus to initiate transcription of IFN-stimulated response element (ISRE) containing genes.

The induction of IFN-stimulated genes (ISGs) further limit virus replication and spread (Der et

al., 1998).

Many viral proteins have been shown to modulate the IRF-3/type I IFN pathway. The

influenza virus NS1 protein inhibits the RIG-I pathway by interacting with TRIM25 (tripartite

motif-containing protein 25), a ubiquitin ligase which normally activates RIG-I. NS1 has also

been shown to inhibit dsRNA-activated protein kinase (PKR), 2’,5’-oligoadenylate synthetase

(2’-5’-OAS), and interferon stimulated gene 15 (ISG15) (Wolff and Ludwig, 2009). The

hepatitis C virus (HCV) NS3/4A protein has been shown to cleave mitochondrial antiviral

signaling (MAVS) to block the TLR/RLR signal transduction pathway (Li et al., 2005b).

Vaccinia virus (VV) also expresses an arsenal of immune antagonists within the infected cell

(Perdiguero and Esteban, 2009). One of these is the E3L protein, a well-characterized inhibitor

of the innate immune system, which has double-stranded RNA binding capabilities. The E3L

gene encodes two different molecular weight proteins (25 and 20 kDa) with no known

differences in function, which are expressed early during infection. They are present in both the

nucleus and the cytoplasm during infection. E3L has two domains, an N-terminal Z-DNA

binding domain, and a C-terminal dsRNA-binding domain. The Z-DNA binding domain

modulates host cellular gene expression at the transcriptional level and inhibits host cell

apoptosis through Z-DNA binding (Kwon and Rich, 2005). It also inhibits the function of the

ISG, adenosine deaminase acting on RNA 1 (ADAR1) (Liu et al., 2001). The C-terminal domain

inhibits the activation of both PKR and 2’-5’-OAS by sequestering dsRNA which is needed to

51

activate these ISGs (Chang et al., 1992; Rivas et al., 1998). E3L also blocks the induction of

IFNα/β through inhibition of phosphorylation of IRF3 and IRF7 (Myskiw et al., 2009; Smith et

al., 2001; Xiang et al., 2002). A mutant VV lacking the E3L gene (VVdelE3L) is highly sensitive

to IFN, exhibits a restricted host range, as well as a greatly reduced virulence in animal models

of lethal poxvirus infection (Beattie et al., 1996; Brandt et al., 2005; Brandt and Jacobs, 2001).

MV has also been shown to interact with IRF3/type I IFN-dependent pathways in

humans. The MV N protein has been shown to bind to IRF3 (tenOever et al., 2002), but this

binding seems to be dependent on the cell context (Colombo et al., 2009). The V protein of MV

has also been shown to block the RLR pathway by interacting with MDA5 and also downstream

to inhibit STAT1/2 translocation to the nucleus (Devaux et al., 2007; Ikegame et al., 2010;

Ramachandran et al., 2008). V has also been shown to act as a decoy substrate for the IkappaB

kinase alpha, preventing the TLR7 pathway in human plasmacytoid dendritic cells (Pfaller and

Conzelmann, 2008). In a study with HeLa cells, it was also shown that the MV C protein

antagonizes the pro-apoptotic and antiviral activities of PKR (Toth et al., 2009b). The MV M

protein has been suggested to act as a decoy substrate for ADAR1, based on its dispensability for

replication and its accumulation of ADAR1-specific mutations (Ward et al., 2011; Young and

Rall, 2009).

To identify components of the innate immune system responsible for MV replication

block in mice, MEF lines with deficiencies in IRF3 (IRF3KO), and both IRF3 and IRF9

(IRF3/9DKO), were engineered to express SLAM to allow viral entry. A MEF line, which

constitutively expresses the vaccinia E3L protein and SLAM, was also produced to test the

effects of a broader inhibition of innate immunity. The ability of MV to induce an antiviral

response in these cells was examined in the following study.

Materials and Methods

Antibodies and modulators of signal transduction

Phycoerythrin (PE)-conjugated anti-human SLAM antibody (clone A12), and isotype control

were purchased from BD Bioscience (Mississauga, ON). Mouse anti-vaccinia virus E3L

52

monoclonal antibody was a kind gift from S. Isaacs (University of Pennsylvania, Philadelphia,

PA) (Weaver et al., 2007). Rabbit anti-phospho-eIF2α (Ser51) antibody (clone 119A11) was

purchased from Cell Signaling Technology (Danvers, MA). Rabbit anti-eIF2α (FL-315) and anti-

β-actin (AC15) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant

mouse IFNβ was from Sigma (St. Louis, MO). The double-stranded RNA analog,

polyinosinic:polycytidylic acid (pIC) was from Sigma. The PKR specific inhibitor, C16, and a

negative control product, shown to have no effect on PKR activation (Jammi et al., 2003), were

purchased from Calbiochem (Gibbstown, NJ).

Cell lines

Vero (African Green monkey kidney), B95a (Epstein-Barr virus transformed Marmoset

lymphoblastoma), and BHK21 (baby hamster kidney) cell lines were obtained from American

Type Culture Collection (Manassas, VA) and maintained in Dulbecco’s modified essential

medium (DMEM) (Wisent, St. Bruno, QC) supplemented with 10% (v/v) fetal calf serum (FCS),

50 µg/mL gentamycin (Invitrogen, Mississauga, ON), and 0.5 µg/mL amphotericin B

(Invitrogen). Vero-SLAM cells were generated by Dr. G. Welstead and maintained in the

presence of 800 µg/mL of G418 (Invitrogen). C57BL/6 MEFs from wild-type (WT), IRF3-/-

(IRF3KO), and IRF3-/-IRF9-/- (IRF3/9DKO) mice (originally obtained from Dr. Tadatsugu

Taniguichi, University of Tokyo, Tokyo, Japan (Sato et al., 2000)) were grown in alpha

modification of minimal essential medium (AMEM) (Wisent) supplemented as above. SLAM

expressing MEFs were produced by co-transfecting pCAGGS-SLAM and pcDNA3.1hygro

(Invitrogen) into the MEFs using Lipofectamine 2000 (Invitrogen) and selecting for hygromycin

(Invitrogen) resistance. The plasmid, pCAGGS-E3L (a kind gift from Dr. Grant McFadden,

University of Florida, Gainesville, FL), was co-transfected with pcDNA3.1zeo (Invitrogen) into

SLAM/WT and selected for zeocin (Invitrogen) resistance to generate SLAM/E3L.

SLAM/MEFs were subsequently screened by fluorescence activated cell sorting (FACS) for

SLAM expression.

Viruses

The recombinant Ichinoise 323 (IC323) wild-type measles virus expressing enhanced green

fluorescent protein (EGFP) was obtained from Dr. Roberto Cattaneo (Mayo Clinic, Rochester,

MN). Montefiore 89 wild-type strain of MV was from Drs. Ilya Spigland and Amy Fox

53

(Montefiore Medical Centre, Bronx, NY). Both viruses were grown in B95a cells and titered by

determining the tissue culture infectious dose 50 (TCID50) in Vero-SLAM cells. Vaccinia virus

deleted for the E3L gene (VVdelE3L) was obtained from Dr. Michele Barry (University of

Alberta, Edmonton, AB). It was grown and titered via plaque assay on BHK21 cells.

Recombinant vesicular stomatitis virus (Indiana strain) encoding green fluorescent protein

(VSVgfp) was a gift from Dr. Brian Lichty (McMaster University, Hamilton, ON). VSVgfp was

grown and titered via plaque assay on Vero cells.

Virus infections

Cells were counted and plated on the day before infection. On the day of the infection, cells were

counted and the multiplicity of infection (MOI) was calculated. Virus was diluted in OptiMEM

(Invitrogen) in a minimum volume necessary to cover the well surface. Infection was allowed to

proceed at 37°C for 90 min with occasional rocking. After the incubation, cells were washed 3

times with PBS and replaced in media containing serum. Images of GFP-positive syncytia were

captured using a Leica inverted microscope (Leica Microsystems, Richmond Hill, ON).

Polymerase chain reaction (PCR)

Polymerase chain reaction was conducted using Taq polymerase (Invitrogen) on a GeneAmp

Thermocycler (Perkin Elmer, Woodbridge, ON). For IRF3 status verification by PCR, the

following primers were used. Primer 1, GAACCTCGGAGTTATCCCGAAGG, primer 2,

GTTTGAGTTATCCCTGCACTTGGG, primer 3, TCGTGCTTTACGCTATCGCCGCTCCC-

GATT. The unmodified, wild-type IRF3 gene yields a product that is 360 bps (from primers 1

and 2), whereas the mutant yields a 470 bp band (from primers 1 and 3).

Reverse transcription polymerase chain reaction (RT-PCR)

Samples were dissolved in TRIzol (Invitrogen), and RNA was purified according to the

manufacturer’s protocol. RNA was quantitated using spectrophotometry, and 0.5 µg was used in

a reverse-transcriptase reaction using Moloney murine leukemia virus reverse transcriptase

(Invitrogen) according to the manufacturer’s protocol. 2 µL of the RT reaction was used in the

subsequent PCR reaction.

54

Table 2.1 List of RT-PCR primers.

Oligonucleotide

name

Sequence (5’ to 3’) length Expected

band size

Reference

mMx1-F GACCATAGGGGTCTTGACCAA 21 182 http://pga.mgh

.harvard.edu/

primerbank/in

dex.html

mMx1-R AGACTTGCTCTTTCTGAAAAGCC 23 As above

mIFNB-F CAGCTCCAAGAAAGGACGAAC 21 138 As above

mIFNB-R GGCAGTGTAACTCTTCTGCAT 21 As above

mISG15-F GGTGTCCGTGACTAACTCCAT 21 131 As above

mISG15-R TGGAAAGGGTAAGACCGTCCT 21 As above

mISG56-F CTGAGATGTCACTTCACATGGAA 23 117 As above

mISG56-R GTGCATCCCCAATGGGTTCT 20 As above

mßactin-F GATGACGATATCGCTGCGCTG 21 450

mßactin-R GTACGACCAGAGGCATACAGG 21

Fluorescence-activated cell sorting (FACS)

Cells grown in monolayers were treated with cell dissociation buffer (Sigma) to make single-cell

suspensions. A million cells were then labeled with antibody on ice for 30 min in the dark. Cells

were subsequently washed with FACS buffer (PBS, 5% FCS) and samples were run on a

Beckman Cyan ADP fluorescence activated cell sorter (Mississauga, ON).

55

Immunoblotting

Sodium dodecyl sulfate-polyacrylamide (9%) gel electrophoresis (SDS-PAGE) was performed

(100 V) and transferred onto polyvinylidene fluoride (PVDF) membranes (356 mA for 1 hr).

Membranes were blocked with 5% (w/v) skim milk in PBS-Tween (0.5%) for 1 h and probed

with appropriate antibody overnight at 4°C. After washing, the membrane was probed with horse

radish peroxidase-conjugated anti-rabbit antibody, and developed using the ECL plus reagent

(GE Healthcare, Baie d’Urfe, QC) on a Kodak ImageStation 4000MM (Mandel Scientific,

Guelph, ON).

VSV protection assay

Cells were plated on 6 well plates, and mock treated, transfected with pIC or infected with wtMV

(Montefiore 89). 24 h post-treatment, the supernatant was collected, centrifuged to pellet cell and

debris, and incubated with a naïve monolayer of IRF3KO MEFs plated on a 12 well plate

(7x10E4 / well). 18 h post-treatment, cells were infected with VSVgfp at an MOI of 1 diluted in

OptiMEM. 90 min post-infection, the virus inoculum was replaced with 1% (w/v)

methylcellulose (Sigma) in AMEM. After 3 days, GFP signal was captured using the Typhoon

phosphorimager (GE Healthcare). Fluorescence signal was quantified using ImageQuant TL

software (GE Healthcare). Data were expressed as a percentage of the total fluorescence

observed in mock-treated monolayers.

Results

Verification of SLAM expressing MEFs

To study the effects of IRF3 deficiency in cell culture models, MEFs from wild-type C57BL/6

(WT), IRF3KO, and IRF3/9DKO strains were used to stably express SLAM. MEFs were not

derived from the mice crossed into the SLAM transgenic line generated in our lab, since SLAM

expression in that line is driven by the endogenous human SLAM promoter which is only active

in immune cells (Welstead et al., 2005). Once a stable line was established, IRF3 status was

verified by PCR (Figure 2.1A). SLAM/E3L lines, designed to constitutively express the vaccinia

56

E3L protein, were subsequently generated from a SLAM/WT line. Colonies were screened by

immunoblotting against the E3L protein (Figure 2.1B). The E3L gene is expressed as two

different molecular weight products with no known functional differences (Yuwen et al., 1993)

and both were visible on immunoblots. At least two different clonal lineages were generated for

each of the SLAM expressing MEF lines and the included results are representative results of

different clonal populations. Human SLAM expression in each cell line was verified by FACS

(Figure 2.1C).

Figure 2.1. Generation of SLAM expressing MEFs.

57

SLAM/E3L MEFs express a functional E3L

To verify that the E3L protein in SLAM/E3L MEFs was functional, we grew vaccinia virus with

a deletion in the E3L gene (VVdelE3L) in the MEFs. Functional E3L protein provided in trans

can complement the replication of this defective virus (Chang et al., 1995). As expected, the titer

obtained from SLAM/E3L MEFs was over a log unit greater than those obtained from non-E3L

expressing SLAM/WT MEFs (Figure 2.2A). This increase was less than the 1000-fold increase

in titer observed in HeLa cells by Chang et al (Chang et al., 1992), and may be due to differences

in protein expression level since only transiently transfected E3L was tested in that study.

E3L functions by inhibiting PKR-mediated phosphorylation of the translation initiation

factor, eIF2α, that occurs when innate immunity is triggered. To examine whether the E3L

expressed in the MEFs can prevent eIF2α phosphorylation, polyinosinic:polycytidylic acid (pIC),

a synthetic double-stranded RNA analogue was transfected in increasing amounts (0, 1 µg, 2 µg,

4 µg, 5 µg) into MEFs and lysates were harvested for immunoblotting. Immunoblots with

phosphospecific antibodies revealed progressive eIF2α phosphorylation in the WT MEFs but not

in the E3L MEFs (Figure 2.2B), indicating that the E3L protein was functional in inhibiting PKR

activation.

58

Figure 2.2. SLAM/E3L MEFs express a functional E3L.

59

SLAM expressing MEFs are permissive for infection by MV

To test whether the various SLAM expressing MEF lines were susceptible to MV entry and

permissive for viral RNA transcription and translation, monolayers were infected with IC323gfp

at MOI 5 for 24 h (Figure 2.3). It was observed that all cell lines expressed GFP and fused to

form syncytia. Qualitatively, it was noted that syncytia formation was the greatest in the E3L

expressing line, followed by IRF3/9DKO, then by IRF3KO, and WT.

Figure 2.3. SLAM/MEFs are permissive for MV infection.

60

MV infection induces IFN and ISGs in SLAM-expressing mouse fibroblasts

Interferon stimulated genes (ISGs) are a group of antiviral genes synthesized as a result of

PAMP recognition (Fensterl and Sen, 2011; Sadler and Williams, 2008). In order to examine the

range of ISGs being induced by MV in the various SLAM/MEF lines, RT-PCR was performed to

look at the accumulation of ISGs. SLAM/MEFs were mock-treated, transfected with pIC, or

infected with MV, and RNA was subsequently extracted 24 h post-treatment. RT-PCR was

performed for Mx1, ISG15, ISG56, and IFNβ (Figure 2.4). In the SLAM/WT, pIC treatment

strongly induced ISG15 and ISG56, while Mx1 and IFNβ were induced at a lower level. A

similar profile was observed for SLAM/E3L, although no IFNβ transcript was obtained. In the

SLAM/IRF3KO cell line, ISG15 and ISG56 were induced to a much lower degree with no Mx1

and IFNβ transcripts being visible. No ISG induction was seen in the IRF3/9DKO cells

following pIC stimulation. In response to MV infection, only SLAM/WT and SLAM/E3L

showed ISG15 and ISG56 induction. These results suggested that neither the absence of IRF3,

nor the presence of constitutively expressed E3L were completely effective at inhibiting ISG

induction in MEFs. On the other hand, the absence of both IRF3 and the IFN signal-mediating

IRF9 resulted in complete inhibition of ISG induction.

Figure 2.4. ISG induction in MV infected MEFs.

61

MEFs secrete a soluble factor that protects an IRF3KO MEF monolayer against VSVgfp

challenge

To examine whether infection of the SLAM/MEFs resulted in expression of interferons, a

VSVgfp protection assay was undertaken (Figure 2.5). This analysis has been shown to be a

valid method for assaying biologically functional IFN in innate immunity studies (Lin et al.,

2010; Noyce et al., 2009). Naïve IRF3KO MEFs were chosen as target cells due to their inability

to be infected with MV or respond to residual pIC in the media. SLAM/MEFs were mock-

treated, transfected with pIC, or infected with MV, and the cell-free supernatant was used to treat

naïve IRF3KO MEF monolayers against VSVgfp challenge. The presence of a biologically

active, antiviral state-inducing soluble factor (i.e. IFN) would inhibit the growth of VSV, a virus

that is exquisitely sensitive to the host cell’s antiviral state. Supernatant from mock-treated

SLAM/MEFs provided no protection to IRF3KO MEFs against VSVgfp challenge. As expected,

pIC induced secretion of IFN from the SLAM/WT, but not from SLAM/IRF3KO and

SLAM/IRF3/9DKO MEFs, due to the fact that IRF3 deficiency inhibits type I IFN synthesis.

Furthermore, in agreement with the RT-PCR data, SLAM/E3L MEFs also responded to pIC

stimulation by producing IFN. In response to MV infection, only the media from SLAM/WT

MEFs were able to protect the IRF3KO MEF monolayer from VSVgfp challenge. Taken

together, this and the RT-PCR data indicate that MV induces a graded IRF3/type I IFN antiviral

response ranging from a robust response in WT MEFs to a total absence of response in

IRF3/9DKOs. The discrepancy in the E3L MEF’s ability to respond to pIC and MV raised the

possibility that E3L was not fully functional in inhibiting the IFN induction pathway in the

transgenic MEF cell lines.

62

Figure 2.5. IFN bioassay of MV infected MEFs.

Deficiencies in innate immune components enhance MV growth

In order to examine the consequences of IRF3 and IRF9 deficiencies on virus production, MV

was grown in the SLAM/MEFs and the resulting progeny virus was titered (Figure 2.6).

Compared to SLAM/WT, an increased amount of virus was obtained from SLAM/IRF3KO, but

the difference was not statistically significant. MV titer from SLAM/IRF3/9DKO was increased

by more than 2 log units (p<0.05) over that obtained from SLAM/WT. Virus production in

63

SLAM/E3L was also much greater than that of SLAM/WT (p<0.05). This result was somewhat

unexpected since the RT-PCR data had indicated that ISGs are induced to a certain extent in the

E3L MEFs in response to MV infection. Since the E3L was shown to be functional in inhibiting

PKR-mediated phosphorylation of eIF2α, this suggested that PKR inhibition alone was sufficient

to enhance MV growth.

Figure 2.6. Innate immune deficiencies enhance MV growth.

Inhibition of double-stranded RNA inducible protein kinase (PKR) enhances MV growth

The vaccinia virus E3L protein was initially observed to inhibit PKR-mediated phosphorylation

of eIF2α, which is critical for translation and protein synthesis (Chang et al., 1992). Inhibition of

mRNA translation is one of the most effective methods by which a cell can prevent virus

replication and spread. To determine whether the enhanced virus titer obtained from SLAM/E3L

was due to inhibition of PKR, a commercially available PKR inhibitor, C16 (Jammi et al., 2003),

64

was used (Figure 2.7). When the virus was grown in the presence of the inhibitor, MV titers from

SLAM/WT MEFs were increased nearly to that of SLAM/E3L MEFs treated with a control

compound (p<0.1). Slight increases in the virus titer were obtained for all other MEFs with the

PKR inhibitor treatment, but the differences were not statistically significant. Only a minimal

increase in titer was obtained from SLAM/E3L MEFs upon PKR inhibitor treatment, suggesting

that the E3L protein was already effectively inhibiting the activation of PKR. It also suggests that

E3L is more efficient in inhibiting PKR activation than preventing induction of other ISGs.

Moreover, the data suggest that PKR activation may play a more important role than ISG

induction in restricting MV growth.

Figure 2.7. PKR inhibition enhances MV growth.

65

Discussion

In our aim to generate a mouse model of measles that authentically mimics the human disease, it

was found that mice were naturally resistant to MV infection, even when the receptor was

provided in trans. Since we and other groups had observed successful MV growth in SLAM

expressing mice with various deficiencies in the innate immune system, we decided to examine

the effect of several key components of this system. To this end, we took several approaches;

namely the use of MEFs from IRF3KO and IRF3/9DKO strains, as well as producing a line that

constitutively expresses the vaccinia E3L protein. The E3L protein has been well established as a

general inhibitor of the innate immune system and it was chosen in our studies to inhibit both the

initial induction phase (i.e. RIG-I/IRF3 mediated IFN production) as well as the later effector

stages (i.e. PKR/eIF2α mediated inhibition of translation) of innate immunity (Perdiguero and

Esteban, 2009).

IRF3 plays a central role in the initial IFNβ induction phase in response to TLR and RLR

signaling (Yoneyama and Fujita, 2009). Deficiency in IRF3 has been reported to hamper the

cell’s response to Newcastle disease virus and its ability to produce IFNα/β (Sato et al., 2000).

Decreased IRF3 activation has also been reported to facilitate hepatitis C virus replication (Foy

et al., 2003; Li et al., 2005a; Lin et al., 2010). The knockout mice have also been shown to be

more susceptible to encephalomyocarditis virus (Sato et al., 2000). Since it has been

demonstrated that MV 5’-triphosphate ended leader transcript acts as an activator for RIG-I

(Plumet et al., 2007), and that the H protein is a PAMP for TLR2 (Bieback et al., 2002), it is not

all that surprising that the absence of the IRF3 transcription factor inhibits induction of the

antiviral response. However, Diamond and colleagues, in their study of cells from IRF3KO mice,

reported that while basal expression level of ISGs such as ISG56 and RIG-I were dependent on

IRF3 expression, their induction was independent of IRF3 in West Nile virus infections (Daffis

et al., 2007). Furthermore, IRF3 independent pathways to trigger antiviral responses have now

been shown to exist (DeWitte-Orr et al., 2009; Prescott et al., 2007). All these factors may

contribute to the differences in ISG induction levels that were observed between IRF3KO and

IRF3/9DKO MEFs.

IRF9 is also an important component in the innate immune system, and forms IFN-

stimulated gene factor 3 (ISGF3) along with STAT1 and STAT2 to subsequently induce several

66

hundred ISGs upon type I IFN binding to its receptor. Deficiency of this transcription factor

inhibits a cell’s antiviral response to EMCV, VSV and herpes simplex virus (Kimura et al.,

1996). We used MEFs that had deficiencies in both IRF3 and IRF9 to examine the role of these

transcription factors in MV infection. ISG induction and IFN production in these cells were

impaired against both pIC stimulation and MV infection. One of the ISGs induced upon IFN

signaling is PKR, and IRF9KO MEFs have been shown to lack the ability to induce PKR upon

IFNα stimulation (Kimura et al., 1996). Since PKR activation is required to inhibit mRNA

translation in response to viral infection, the deficiency in IRF9 or the presence of E3L is

expected to have a similar effect on viral protein translation. Indeed, MV titers from the

IRF3/9DKO and E3L MEFs were similar (Figure 2.6). The fact that some PKR is expressed

constitutively (Sadler, 2010) may explain the greater increase in MV titer upon PKR inhibitor

treatment in IRF3/9DKO MEFs compared to the E3L line, where PKR is already inhibited to

some extent (Figure 2.7).

The results obtained with the SLAM/E3L line were perplexing in that these cells were

still able to respond quite competently to pIC stimulation, both in terms of ISG induction and

IFN secretion (Figures 2.4 and 2.5). Furthermore, this cell line still responded to MV challenge

by inducing ISGs, although it did not secrete enough IFN to provide protection in a VSV

challenge. However, given that the E3L still seemed quite functional in its main role of inhibiting

eIF2α phosphorylation in response to pIC stimulation (Figure 2.2B), it may be that inhibition of

PKR alone is enough to allow enhanced virus replication (Figure 2.6), despite the cell being in an

antiviral state. Indeed, in the presence of a PKR inhibitor, MV titers from WT MEFs approached

that of control treated E3L MEFs. This result is contrary to what was reported by Toth and

colleagues (Toth et al., 2009a), who knocked down PKR expression in HeLa cells and found no

difference in measles virus (vaccine strain) growth. This difference in the impact of PKR

activation on MV growth may be attributable to the differences in virus strains and host species

that were used, since we used a wild-type strain of MV and examined PKR’s role in mice, an

organism normally resistant to MV. Given that E3L has been reported to be able to block various

pathways in the innate immune pathway, it is possible that the amount of transfected pIC or MV

input simply exceeded E3L’s capacity to block the initial induction stage, but not the later

effector stage. It is also possible that inhibition of IRF3 phosphorylation is not as efficient as its

67

ability to inhibit eIF2α phosphorylation. These possibilities could account for the intermediate

phenotype of ISG induction and high MV titer.

The possibility exists that innate immunity may not be the only block preventing efficient

MV growth in murine cells. Previous groups working to generate a cell culture model of measles

with rodent cells had reported that MV encounters a block in replication in rodent cells (Vincent

et al., 2002), and that the budding process is impaired (Vincent et al., 1999). However, recent

work with rodent cells (Ward et al., 2011) and transgenic mice have shown that the innate

immune system clearly plays a major role in allowing successful virus production (Ferreira et al.,

2010; Welstead et al., 2005).

The SLAM expressing mouse cell lines generated in this study are useful tools that will

allow more detailed studies to be conducted on the interactions between MV and rodent cells.

Furthermore, many published studies use human cell lines and are thus limited to using the

vaccine strains of measles virus, which utilize CD46 as an entry receptor. The fibroblast cell

lines generated in this study can be infected with clinical strains of the virus, which can help shed

new light onto MV biology. Since MV V and C proteins have been shown to play innate immune

inhibitory roles (Caignard et al., 2009; Caignard et al., 2007; Palosaari et al., 2003;

Ramachandran et al., 2008; Toth et al., 2009a; Yokota et al., 2003), it would be interesting to

examine the role these proteins have in modulating the innate immune function of the various

MEF lines. It has been shown that the V protein efficiently interacts with human STAT1 and

STAT2 to prevent their nuclear translocation (Palosaari et al., 2003), and that this is mainly due

to its interaction with STAT2 (Ramachandran et al., 2008). Although the human and mouse

STAT2 share a 76% amino acid identity over the first 712 of 925 amino acid sequence, the

mouse version diverges considerably after this sequence and is 75 amino acids longer (Park et

al., 1999). It would be interesting to see if this difference alters the interaction between the

STAT2 and V proteins. To conduct such studies, the cloning of V and C proteins into an

expression vector, or the generation of a recombinant virus with deletions in these genes would

be crucial. Interaction between IRF3 and MV nucleoprotein has also been reported in 293T cells

(tenOever et al., 2002). This interaction could also be investigated in murine cells.

68

In conclusion, our data suggest that although IRF3 plays an integral part in initiating the

innate immune response in MEFs, the effector phase mediated by the JAK/STAT pathway or by

PKR may play a more important role in enhancing virus production.

69

Chapter 3 In vivo role of mouse innate immunity on measles virus

I would like to gratefully acknowledge Dr. Elizabeth Acosta for her help with the plasmacytoid

dendritic cell work in the mice.

70

Introduction

Measles is thought to have evolved into a human-restricted pathogen after being derived from a

cattle virus in 3000 BC (Griffin, 2007). Although much knowledge has been gained by studying

experimentally infected rhesus macaques, various factors such as cost and availability limit the

widespread use of these models (de Swart, 2009). A small animal model (i.e. rat or mouse) can

be a useful tool in studying disease pathology and developing antiviral treatments. In particular,

advances in transgenic mouse production has allowed experimental designs that examine the role

of specific genes in a given disease process.

The innate immune system plays a critical role in establishing a first-response against

invading pathogens. It relies on a number of PRRs that recognize certain structural motifs that

are inherent to specific classes of pathogens. Once triggered, signal pathways of the immune

system activate a series of molecules to initiate a pathogen-specific response (Yoneyama and

Fujita, 2009). Both TLR- and RLR-mediated innate immune responses converge to activate the

ubiquitously expressed transcription factor IRF3 and the IFN-inducible IRF7, which initiate

transcription of type I IFNs (Hiscott, 2007). The innate immune response can be broadly divided

into the initial induction phase with IRF3-mediated IFNβ production and the subsequent

amplification phase that occurs once IFN binds to its receptors. This second phase requires

JAK/STAT proteins as well as IRF9 for proper signal transduction.

The importance of IRF3 is illustrated by the increased susceptibility to virus infections in

IRF3KO mice, as well as the number of viruses that have evolved a way to inhibit its activation.

EMCV infection in IRF3 knockout mice was lethal while 4 out of 10 wild-type mice recovered

(Sato et al., 2000). IRF3KO newborn mice were also less likely to survive reovirus infections

(Holm et al., 2010). Furthermore, WNV infection in IRF3KO mice resulted in 0% survival

compared to a 65% survival rate in wild-type controls (Daffis et al., 2007). Viruses such as

Ebola, HCV and RSV inhibit IRF3 phosphorylation, while KSHV encodes a viral IRF

homologue that exerts a dominant-negative effect (Weber et al., 2004). Similarly, STAT1KO

mice are also highly susceptible to viral infections by VSV and Crimean-Congo hemorrhagic

fever virus, in addition to infection by Listeria monocytogenes (Bente et al., 2010; Meraz et al.,

1996).

71

One of the primary immune responders to a virus infection is the plasmacytoid dendritic

cell (pDC). These cells, which share a common lineage with the conventional dendritic cell

(cDC) population, are unique in their ability to respond to an infection by rapid secretion of type

I IFNs (Fitzgerald-Bocarsly et al., 2008). In pDCs, foreign nucleic acid recognition occurs

through TLRs 7 and 9, and the triggering of IFN production occurs via the activation of

constitutively expressed IRF7. Comparison between pDCs derived from IRF3KO and IRF7KO

mice revealed that IFN induction via TLR7/9 was normal in IRF3KO cells but completely

ablated in IRF7KO cells, indicating the essential role of IRF7 in MyD88-mediated induction of

type I IFN genes in pDCs (Honda et al., 2005).

Previously, our lab generated a SLAM expressing mouse, which mimics the receptor

expression in humans (Welstead et al., 2005). We found that MV replicated very inefficiently in

these mice and that replication was enhanced upon crossing this line with a STAT1KO line.

Other groups have also generated SLAM transgenic lines, but have only been able to study MV

infection once the line had been crossed with an IFNα receptor (IFNAR) null line (Ferreira et al.,

2010; Ohno et al., 2007; Shingai et al., 2005).

In our work with IRF3KO, IRF3/9 double knockout (IRF3/9DKO) and vaccinia E3L

expressing MEF lines, we observed the deleterious effects of having different innate immune

pathways inhibited in MV infections (Chapter 2). To test whether our in vitro findings could be

translated into observable effects in vivo, we generated SLAM expressing mice in an IRF3KO

background. The use of SLAM/IRF3KO mice in conjunction with the previously described

SLAM/STAT1KO mice (Welstead et al., 2005) allowed us to interrogate the effects of inhibiting

molecules involved in either the early stages of IFN production or the later phase of IFN

signaling. Furthermore, in line with our continuing effort to generate an ideal rodent model, we

describe the generation of a transgenic mouse that expresses both CD46 and SLAM.

Materials and Methods

Reagents, cell lines, viruses and antibodies

72

Anti-IRF3 antibody (D83B9) was purchased from Cell Signaling Technology (Danvers, MA). R-

Phycoerythrin (PE)-conjugated anti-Ly6C, PE-conjugated anti-Gr1, PerCP-Cy5.5-conjugated

anti-CD11c, biotin-conjugated anti-CD8α, anti-MHC II, anti-B220, anti-CD86, Streptavidin-

Allophycocyanin (SAv-APC), and APC-conjugated anti-PDCA1 were purchased from BD

Bioscience (Mississauga, ON). Anti-CD11c microbeads, and anti-mPDCA1 microbeads were

purchased from Miltenyi Biotec (Auburn, CA). Flt3-ligand (Flt3L) expressing melanoma cells

(Mach et al., 2000) were obtained from Dr. Jun Wang (Dalhousie University, NS) and cultured

in DMEM. The recombinant SLAM-blind MV expressing GFP (Vongpunsawad et al., 2004) was

obtained from Dr. Roberto Cattaneo (Mayo Clinic, Rochester, MN) and grown and titered in

Vero cells.

SLAM/IRF3KO mouse generation

The generation of SLAM and SLAM/STAT1KO mice was described previously (Welstead et al.,

2005). The SLAM/STAT1KO strain had to be regenerated at the IWK vivarium as a

consequence of losing the strain during the colony relocation to Halifax from STAT1KO mice

(Meraz et al., 1996) obtained from Dr. Dwayne Barber (OCI, ON). SLAM/IRF3KO mice were

generated by crossing our SLAM mice with IRF3KO strain (Sato et al., 2000) provided by Dr.

Karen Mossman (McMaster University, ON).

CD46/SLAM/STAT1KO mouse generation

A transgenic mouse which expresses the human CD46 ubiquitously was generated by a previous

graduate student in our lab (Bilimoria, 1998). The CD46 mice were mated with the SLAM mice

to generate CD46/SLAM mice. To generate CD46/SLAM/STAT1KO mice, the CD46/SLAM

mice were mated with SLAM/STAT1KO mice. PCR genotyping was performed to screen for

positive pups. To test for CD46 homozygosity, candidates were testcrossed with C57BL/6 mice

and the progeny were genotyped to ensure that all pups were positive for the CD46 gene.

73

Mice genotyping polymerase chain reaction

Mice were genotyped by PCR with DNA obtained from ear punch/tail samples. For SLAM

genotyping, 2 sets of primers were used (Ferreira et al., 2010). PCR1 produced a band in the

presence of the SLAM transgene and used primer 1 (GTGTCACCTAAATAGCTTGGCG-

TAATCATG) and primer 2 (GTTAATATAGACAATGCCCATCTCCAGCAG). PCR2

produced a band in the absence of the SLAM gene and used primer 1 (AGCTTTCTGAA-

TAGGGGTGTTACTTAATGC) and primer 2 (CTTTGCATTAGGTATTTAGGGCATGTC-

CTG). IRF3 status was verified using the primer sets described in Chapter 2. STAT1 status was

checked by PCR using the following primers: primer 1 (GAGATAATTCACAAAATCAGA-

GAG), primer 2 (CTGATCCAGGCAGGCGTTG), and primer 3 (TAATGTTTCATAGTTGGA-

TATCAT). The unaltered wild-type produced a 220 bp band whereas the mutant produced a 270

bp band. For verifying CD46 status, the following primer set was used: Primer 1 (CGGTTTC-

CTGGGTTGCTTC), and primer 2 (TAAGACACTTTGGAACTGGG). To test for

homozygosity, candidates were testcrossed and the progeny were screened. Control PCR for

GAPDH was carried out using the following set of primers: primer 1 (ACCCAGAAGACTGT-

GGATGG), and primer 2 (CACATTGGGGGTAGGAACAC).

Mouse infection and isolation of lymphocytes

All animal experiments were conducted in accordance with the Dalhousie Animal Ethics

Committee approval. Mice were infected intraperitoneally with 1x10E7 PFU MV in a total

volume of 0.5 mL PBS. Various lymph nodes and the spleen were harvested on day 3 post-

infection. The organs were passed through a 0.45 µm mesh in RPMI 1640 supplemented with

10% (v/v) FBS, sodium pyruvate, L-glutamine, non-essential amino acids, β-mercaptoethanol

and antibiotics. Red blood cells were lysed using RBC lysis buffer (Sigma, St. Louis, MO).

Quantification of virus load in lymphatic organs

Single cell suspensions from cervical, inguinal, mesenteric, and mediastinal LNs and spleen were

obtained as described above. Serial dilutions of cells (1x10E6 per initial dilution) were co-

74

cultured with Vero-SLAM cells (1x10E4 per well) in 96 wells. Cultures were scored for

fluorescence and cytopathic effects 72 hpi. Virus titers were expressed as log TCID50 per 1x10E6

cells.

Flt3-ligand expressing cell injection

For pDC expansion experiments, 3x10E6 Flt3-L expressing cells, resuspended in PBS, were

injected subcutaneously into the skin over the neck area. The tumour was then allowed to grow

for 2 weeks before mice were sacrificed and the splenocytes were harvested.

Plasmacytoid dendritic cell purification

Spleens were injected with 0.5 mL of collagenase D solution (2 mg/mL in HEPES) and

incubated at 37°C for 30 min prior to straining. Single cells were isolated from the spleen and the

lymph nodes as above and labeled with anti-mPDCA1 microbeads according to the

manufacturer’s protocol. Samples were isolated using the autoMACS system (Miltenyi Biotec).

For conventional dendritic cell (cDC) purification, the flow-through population from the initial

pDC purification was subsequently labeled with anti-CD11c microbeads and isolated with

autoMACS.

Fluorescence-activated cell sorting

Cells were incubated with anti-CD16/CD32 (Mouse Fc Block, BD Pharmingen) at 4°C for 5 min.

Cells were then incubated with the appropriate dilution of the antibody for 30 min at 4°C (anti-

CD8α (1:100), -MHCII (1:600), -B220 (1:600), -CD86 (1:600)). After the incubation, cells were

washed with FACS buffer then incubated with the appropriate second antibody for another 30

min (SAv-APC (1:600), anti-CD11c (1:200), -Ly6C (1:600), -Gr1 (1:200), PDCA1 (1:800)).

Cells were then fixed and surface staining on cells was monitored via four-colour visualization

75

on the FACSCalibur flow cytometer (Becton Dickinson). Data were analyzed using FlowJo

software (Ashland, OR).

VSV plaque reduction assay

Isolated cells were plated on 24 well plates, and mock treated, transfected with pIC (10 µg/well)

or infected with wtMV (Montefiore 89) at an MOI of 5. Spin infection was performed by

centrifuging the plates at 120 x g for 30 min at RT. 24 h post-treatment, the supernatant was

collected, centrifuged to pellet cell debris, and used to treat a monolayer of IRF3KO MEFs

plated on a 12 well plate (7x10E4/well) for 15h. Cells were infected with VSVgfp at an MOI of

1 diluted in OptiMEM. 90 min post-infection, virus inoculum was replaced with 1% (w/v)

methylcellulose in AMEM supplemented with 10% FCS. After 3 days, GFP signal was

quantitated using the Typhoon phosphorimager (GE Healthcare, Baie d’Urfe, QC). After

subtracting the background value (mean of 3 no treatment/no infection wells), the GFP signals

from 3 no treatment/VSV infection were calculated as 100%. Treated samples were calculated as

a percentage of the no treatment/infection group after subtraction of the background values.

Interferon-alpha enzyme linked immunosorbent assay (IFNα ELISA)

IFNα ELISA kit was purchased from PBL Interferon Source (Piscataway, NJ). The assay was

performed according to the manufacturer’s protocols. IFN concentration was calculated from an

IFNα standard curve. The limit of detection of the kit was stated to be 12.5 pg/mL.

Immunoblotting

Organs were harvested from 9 wk old mice. Tissue samples in RIPA buffer (50 mM Tris-HCl,

pH 7.4, 1% (w/v) NP-40, 0.25% (w/v) sodium deoxycholate, 150 mM NaCl, 1mM EDTA)

supplemented with protease inhibitors (Complete protease inhibitor cocktail (Roche,

Mississauga, ON), 1 mM PMSF, 1 mM sodium orthovanadate, 1 mM NaF) were homogenized

76

using the Polytron Homogenizer. Protein concentration was quantitated using Bradford assay.

9% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was run and

transferred onto polyvinylidene fluoride (PVDF) membrane. Membrane was blocked with 5%

(w/v) skim milk in PBS-Tween (0.5%) for 1 h and probed with appropriate antibody overnight at

4°C. After washing with PBS-Tween (0.5%), the membrane was probed with horse radish

peroxidase-conjugated anti-rabbit antibody, and developed using the ECL plus reagent (GE

Healthcare) on a Kodak ImageStation 4000MM.

Results

Verification of SLAM/IRF3KO mouse

To study the role of the importance of the induction phase of the innate immune response during

a MV infection, we decided to examine the role of IRF3, a critical transcription factor involved

in multiple signaling pathways. For this purpose, SLAM transgenic mouse in WT (C57BL/6)

background were mated with IRF3KO mice. Mice were genotyped by PCR to screen for

homozygosity of SLAM and IRF3-null status. Once homozygotes were generated, the absence of

IRF3 protein expression was confirmed by immunoblotting for IRF3 (Figure 3.1A). To test for

expression of SLAM, splenocytes were isolated and activated to express SLAM by stimulation

with concanavalin A (ConA) or lipopolysaccharide (LPS). SLAM expression was then examined

via FACS (Figure 3.1B). The SLAM expression profile was observed to be similar in both WT

and IRF3KO strains and recapitulated the data that was reported earlier (Welstead et al., 2005).

77

Figure 3.1. Verification of SLAM/IRF3KO mouse

78

SLAM/IRF3KO fails to sustain a systemic infection of MV

Next, the mice were tested for their susceptibility to MV infection. SLAM/WT,

SLAM/STAT1KO, and SLAM/IRF3KO were infected intranasally or intraperitoneally (IP) with

IC323gfp. Infection was also performed in non-SLAM expressing WT, IRF3KO, and STAT1KO

mice. Various lymph nodes and the spleen were harvested and monitored for GFP expression, a

marker of successful virus infection. No GFP expression was observed in intranasally infected

SLAM/WT and SLAM/IRF3KO in any of the tissues examined (results not shown). In IP

infections, few GFP positive cells were observed in the mediastinal lymph node of the

SLAM/IRF3KO mouse (Figure 3.2A, top centre panel). The GFP expression was also observed

by FACS (Figure 3.2B). The mediastinal lymph node is of particular interest since it is the lymph

node that immediately drains the peritoneum, and other groups have observed that in IP infected

mice, infected cells tend to localize here (Ferreira et al., 2010; Ohno et al., 2007). No GFP

expression was observed in other organs in these mice, and in any of the samples obtained from

the SLAM/WT mice. GFP expression could not be detected in any of the non-SLAM expressing

mice including the STAT1KO mice (results not shown). This was in contrast to the GFP

expression visible in all the lymph nodes taken from the SLAM/STAT1KO mice (Figure 3.2A

top right, and bottom rows). The differences in susceptibility between STAT1KO and

SLAM/STAT1KO emphasized the requirement of a receptor in mediating viral entry into cells.

To test whether there were differences in long-term survival, SLAM/WT and SLAM/IRF3KO

were infected IP, and monitored for 3 wks. In both strains, there were no deaths and all mice

remained healthy (results not shown).

79

Figure 3.2. MV does not spread systemically in SLAM/IRF3KO mice

80

SLAM/IRF3KO lymphoid organs fail to harbour MV

To quantitate the extent of virus infection in mice, virus production was measured from cells

isolated from infected mouse organs (Figure 3.3). No virus was obtained from any of the organs

obtained from SLAM/WT mice. Only a single SLAM/IRF3KO mouse yielded virus from its

mediastinal lymph node sample and the titer obtained was just above the threshold of detection

for the assay. In contrast, MV was readily isolated from all the organs harvested from the

SLAM/STAT1KO mice. In particular, mediastinal LN samples yielded the highest virus titer.

Taken together, these results suggest that SLAM/STAT1KO mice may support a systemic MV

infection while the infection appeared to be limited to the mediastinal LN in the SLAM/IRF3KO

mice.

Figure 3.3. SLAM/IRF3KO lymphoid organs fail to harbour MV

81

Cells from lymph node and the spleen infected ex vivo secrete interferon

The inability of the SLAM/IRF3KO mice to sustain a systemic infection suggested that the

innate immune system was still being activated in these mice. To study this, lymph node cells

and splenocytes from naïve mice were isolated, and used in a VSVgfp protection assay similar to

that performed for the MEF studies. Cells were mock treated, treated with pIC or infected with

MV (Montefiore strain) and the clarified media from these cells were incubated with naïve

IRF3KO MEF monolayers. This monolayer was later challenged with VSVgfp and the

subsequent GFP expression was measured (Figure 3.4). Surprisingly, all the MV infected

samples were able to provide protection against subsequent VSVgfp challenge, indicating an

antiviral response was still being triggered in the absence of IRF3.

Figure 3.4. Ex vivo infected cells from lymph node and the spleen secrete interferon

82

Plasmacytoid dendritic cells are recruited to the mediastinal lymph node and spleen in MV

infected mice

In contrast to what was predicted from the experiments in MEFs, IRF3 deficiency did not

enhance MV replication in these mice. In normal tissue, IRF3 is constitutively expressed and is

activated upon PRR triggering. In these cells, IRF7 is transcribed in response to type I IFN

receptor activation which in turn acts to further amplify the antiviral signal (Hiscott, 2007).

However, in a small subpopulation of dendritic cells called plasmacytoid dendritic cells (pDCs),

IRF7 is constitutively expressed and mediates the antiviral signal initiated by TLRs. Therefore

these cells are able to initiate an innate immune response in the absence of IRF3. Since the lack

of IRF3 expression did not seem to affect the mouse’s ability to sense MV and produce IFN, we

hypothesized that pDCs may be able to perform this role.

Activated pDCs are known to migrate to LNs in order to act as antigen presenting cells, and we

asked whether pDC numbers increased at certain sites upon MV infection. To establish whether

pDCs migrate to the lymphatic organs where virus is being drained, we quantitated the number

of pDCs in the mediastinal LN and the spleen in naïve mice and compared it to the numbers

obtained after MV infection (Figure 3.5). pDCs are relatively infrequent in the body and, as

expected, very few were observed in naïve mice. Increased numbers of pDCs were observed in

all lymph node samples, with the SLAM/IRF3KO and SLAM/STAT1KO samples yielding a

greater increase over that of the mock-infected mice. An increase in pDC number was also

observed in the spleen after infection, with the SLAM/STAT1KO samples showing the greatest

cell frequency.

83

Figure 3.5. Selective recruitment of plasmacytoid dendritic cells to the mediastinal lymph node and the spleen in MV infected mice

84

Plasmacytoid dendritic cells are activated upon intraperitoneal MV infection

Activation of pDCs results in increased surface expression of molecules such as MHCII, B220,

CD86 and PDCA1. To examine if MV infection via the IP route results in pDC activation,

splenocytes from infected animals were analyzed for expression of these surface markers by

FACS (Figure 3.6). Splenocytes from all mouse strains showed increased expression of these

molecules upon infection, suggesting that pDCs were activated in these mice.

Figure 3.6. Plasmacytoid dendritic cells are activated upon intraperitoneal MV infection

85

Plasmacytoid dendritic cells are infected by MV

Dendritic cells act as sentinels due to their antigen-presenting capacity, and pDCs are special in

that their ability to function as APCs does not require them to be infected (Kumagai et al., 2009).

Other groups have shown that MV can target dendritic cell populations in SLAM expressing

IFNAR KO mice (Ferreira et al., 2010; Hahm et al., 2004; Shingai et al., 2005). Furthermore,

MV can use DC-SIGN to target DCs in humans (de Witte et al., 2006; de Witte et al., 2008). To

determine whether DCs were among the infected cell population, pDC and cDC populations

from infected mice were sequentially purified using PDCA1, followed by CD11c microbeads,

and MV production from these cells were quantitated (Figure 3.7). As expected, no SLAM/WT

samples yielded virus. In the SLAM/IRF3KO mice, only the cDC population from the

mediastinal LN yielded virus, but this amount was just above the limit of detection as before. In

the SLAM/STAT1KO samples, the pDC and non-DC populations yielded approximately

equivalent amount of virus in both the LN and spleen samples. The cDC population yielded the

least amount of virus. PDCA1 is a unique marker on naïve pDCs but is up-regulated upon IFN

stimulation on many different cell types (Blasius et al., 2006). Since the cells from

SLAM/STAT1KO mice cannot respond to type I IFN to up-regulate PDCA1 expression, only

pDCs were assumed to express PDCA1 in these mice.

86

Figure 3.7. Plasmacytoid dendritic cells are among the cell populations infected by MV in SLAM/STAT1KO mice

Flt3-ligand producing tumour cell injection results in an increase in the pDC population

pDCs comprise a very small population among the peripheral blood cell population. We asked

whether experimentally expanding the pDC population by injecting Flt3L producing melanoma

87

cells (Mach et al., 2000) would allow us to look at the role pDCs have in MV infection with

greater efficiency. Flt3L producing cells were injected subcutaneously and tumours were allowed

to develop for two weeks before splenocytes were harvested. pDC expansion was monitored by

FACS and compared to mock treated mice (Figure 3.8). Expansion of the pDC population was

observed in all three strains of mice. Although pDC expansion was similar in both SLAM/WT

(0.4% mock, 9.22% Flt3L) and SLAM/STAT1KO (0.42% mock, 8.15% Flt3L) strains, greater

increases in pDC numbers were frequently observed in SLAM/IRF3KO (9.54% mock, 16.9%

Flt3L) mice.

Figure 3.8. Flt3-ligand producing tumour cell injection results in increase in pDC population

Plasmacytoid dendritic cell-enriched splenocytes from SLAM/WT and SLAM/IRF3KO strains

are activated in response to MV infection

88

To test whether pDC-enriched splenocyte populations responded to infectious stimuli,

splenocytes from Flt3L treated mice were harvested and treated with pIC or wtMV (Montefiore

89), ex vivo. Cell surface activation markers were then examined via FACS (Figure 3.9). In

SLAM/WT, there was a marked increase in B220, CD86 and PDCA1 expression in response to

pIC treatment, while MV infection only increased the expression of CD86 and PDCA1. A

similar pattern of up-regulation of cell surface proteins was observed in SLAM/IRF3KO

splenocytes. In contrast, no activation marker up-regulation was observed in SLAM/STAT1KO

samples.

Figure 3.9. Plasmacytoid dendritic cell-enriched splenocyte population from SLAM/WT and SLAM/IRF3KO strains are activated in response to MV infection

89

Plasmacytoid dendritic cell-enriched splenocytes from SLAM/IRF3KO strains produce IFNα in

response to MV infection

Although MV infected cells could not be isolated from SLAM/WT or SLAM/IRF3KO mice

following in vivo infections, limited viral replication could be observed once the splenocytes

were isolated and infected ex vivo (result not shown). To examine whether the presence of

enriched populations of pDCs can prevent ex vivo infection from occurring, pDC-enriched

splenocytes were infected with MV IC323gfp and GFP expression was monitored via FACS

(Figure 3.10A). SLAM/WT and SLAM/IRF3KO splenocytes were infected to a similar extent of

0.47% and 0.44%, respectively. In contrast, 1.03% of SLAM/STAT1KO splenocytes were

infected, which demonstrated that increased pDC numbers did not prevent against ex vivo

infections.

To test whether the infected cells were producing type I IFNs, IFNα ELISA were

performed on the media from the infected cells (Figure 3.10B). Both SLAM/WT and

SLAM/IRF3KO strains secreted similar amount of IFNα, whereas SLAM/STAT1KO samples

failed to secrete significant amounts of IFN.

90

Figure 3.10. Flt3-L treated splenocytes from SLAM/WT and SLAM/IRF3KO strains produce IFNα in response to MV infection

CD46/SLAM/STAT1KO mice are susceptible to SLAM-independent MV infection

In order to generate an authentic human-like model of measles in mice, it is important that the

mice express the known receptors for MV with a profile similar to that of humans. To this end,

CD46/SLAM expressing mice were generated by interbreeding the two independently generated

CD46 and SLAM strains. As expected, the mice in the C57BL/6 background were resistant to

91

MV infection (results not shown). Therefore, the mice were crossed into the STAT1 knockout

background to study MV entry. IP infection with IC323gfp, a wild-type strain, indicated similar

levels of infection in both SLAM/STAT1KO and CD46/SLAM/STAT1KO mice when

splenocytes were observed by microscopy and FACS (Figure 3.11). To verify that MV can gain

entry into the cells in a CD46-dependent, SLAM-independent manner, a recombinant MV which

does not recognize SLAM (Vongpunsawad et al., 2004) was used in a parallel infection. This

virus was generated from the Edmonston B vaccine strain backbone, and has the Y529A,

D530A, H533A, Y553A targeted mutations in the H gene, which disrupts its ability to utilize

SLAM, while leaving its usage of CD46 intact (Vongpunsawad et al., 2004). Increased infection

of CD46/SLAM/STAT1KO splenocytes were observed when this SLAM-blind virus was used,

indicating that these mice expressed CD46 that allowed virus entry in a SLAM-independent

manner.

92

Figure 3.11. CD46/SLAM/STAT1KO mice are susceptible to SLAM-independent MV infection

93

Discussion

The innate immune system plays a critical role in sensing infection by a pathogen and initiating

an antiviral response. In the previous chapter, the importance of the initial IRF3-mediated

transcription of IFNβ was compared to the compounded effect of deficiencies in both the initial

and amplification arms in the context of MV infection. We observed that deficiency of IRF3

enhanced MV growth to a certain extent, and that deletion of both IRF3 and IRF9 further

enhanced this effect. In this chapter, we examined the in vivo contribution of these two pathways

individually in the form of IRF3 and STAT1 knockout mice. Contrary to our in vitro findings, IP

infection in SLAM/IRF3KO mice did not result in systemic spread of the virus (Figure 3.2) and

splenocytes from IRF3KO animals did not harbour any virus (Figure 3.3). Furthermore, in

contrast to the MEF experiments where MV infection did not stimulate IFN production in either

IRF3KO or IRF3/9DKO cell lines, IRF3KO and STAT1KO splenocytes infected ex vivo were

still able to produce IFN (Figure 3.4). These results suggested the possibility that IRF3 played a

redundant role in countering MV infection. Indeed, WNV infected IRF3KO mice have been

shown to maintain normal peripheral IFN responses, despite the increased susceptibility of the

mice themselves to infection (Daffis et al., 2007). Evidence in the literature suggested that

plasmacytoid dendritic cells, which constitutively express IRF7 and initiate innate immunity via

TLR7/9 through a MyD88-dependent pathway, may play a critical role (Swiecki and Colonna,

2010).

We examined pDC involvement by examining its migration to lymphoid organs of

interest, the expression of surface activation markers, and whether they were among the infected

cell population. pDCs have previously been shown to migrate to draining LNs upon activation

(Lehmann et al., 2010; Yoneyama et al., 2004). In all MV injected mice, an increase in pDC

numbers was observed in both mediastinal LN and the spleen. In the mediastinal LN samples,

SLAM/IRF3KO and SLAM/STAT1KO showed comparable increases in pDC numbers, which

were much greater than those observed for the SLAM/WT. This observation may be due to

efficient activation of both cDCs and pDCs in the SLAM/WT, which could result in only partial

pDC involvement at the draining LN. In the absence of IRF3, the TLR- and RLR-mediated IFN

signaling is impaired in non-pDCs including cDCs. In this case, pDC activation may be more

important and could result in increased pDC recruitment to the draining LN (Figure 3.5B).

Increases in splenic cell numbers may indicate a need for the immune system to fight the

94

infection systemically, but if the infection is controlled very effectively at the site of infection,

pDC recruitment to the spleen may be unnecessary (Figure 3.5C). It has been shown that pDCs

require positive feedback from type I IFN to maintain activation (Kumagai et al., 2009). In the

absence of STAT1, pDCs may initially be activated and/or recruited, but the cells may not be

able to sustain a proper antiviral response due to the deficiency in IFN signaling. Hence, their

numbers may still increase at the draining LN and the spleen as the virus spreads systemically,

despite having a crippled immune response. Furthermore, our observation that MV causes a

systemic infection in SLAM/STAT1KO mice (Figure 3.2) suggests that infected peripheral blood

mononuclear cells migrate to the spleen.

In response to MV infection, all surface activation markers that we examined were

increased. Since all the mouse strains that we tested should not have any defect in the primary

TLR7/MyD88/IRF7 signal transduction pathway, it is not that surprising to see that all the pDCs

were activated similarly. pDCs mount an antiviral response through the recognition of viral

nucleic acids by TLRs together with a type I IFN positive feedback system. pDCs are normally

resistant to virus infections due to autocrine signaling of IFN, but viruses can infect and replicate

in pDCs in the absence of this positive feedback (Kumagai et al., 2009). It is currently unclear

whether viral replication is absolutely necessary for pDC activation. A study indicated that

autophagy, a process by which the cell degrades intracellular proteins, is essential for the

antiviral response in pDCs by capturing replicating VSVs in the autophagosome and then

transferring it to the endosome for presentation to TLR7 (Lee et al., 2007). Another study using

RSV also suggested that viral replication is essential for initiation of the antiviral response in

pDCs (Hornung et al., 2004). However, heat- or UV-inactivated Sendai virus could induce low

levels of type I IFN production from splenic cells or pDCs (Ito and Hosaka, 1983; Lee et al.,

2007). Inactivated influenza viruses and NDV retained their ability to induce antiviral responses

(Kumagai et al., 2009; Lee et al., 2007; Marcus et al., 2005). Our finding that pDCs are among

the infected population (Figure 3.7) and yet are capable of producing IFN (Figure 3.4) further

indicates that pDCs can respond to replicating virus. Dendritic cells have been shown to be

infected by MV in several SLAM/IFNAR KO models. Ferreira and colleagues found 1.4% of

cDCs in the mediastinal LN to be infected by 3 dpi (Ferreira et al., 2010). Shingai and colleagues

found that the DC population was infected by MV and possibly played a role in disseminating

the virus from its initial site of infection in CD46/SLAM/IFNAR KO mice (Shingai et al., 2005).

95

However, the specific role of pDCs in MV infection was not examined in the above studies as

DCs were defined as MHCIIhighCD11chighMac-1low or as CD11c+ (i.e. cDCs or all DCs),

respectively. Our data seems to suggest that MV replicates better in pDCs compared to cDCs in

the absence of type I IFN signal transduction (Figure 3.7). One possible explanation for this is

that cDCs may counter MV better in the absence of type I IFN whereas pDCs are more

susceptible to virus infection. It is also possible that an increased number of pDCs in the LN and

spleen may have presented as a larger target population for MV. Examining the cDC numbers in

these locations will allow for a clearer picture to emerge. The non-DC populations that sustain

MV growth have been identified as B- and T-lymphocytes as well as alveolar macrophages

(Ferreira et al., 2010; Ohno et al., 2007). It is also possible that pDCs have more frequent

encounters with these cells, which will increase their chance of becoming infected.

Because pDCs comprise a very small component of the peripheral blood cell population,

we amplified the pDC population in vivo by injecting the mice with Flt3L producing melanoma

cells. Ex vivo treatment of the splenocytes from these mice showed that MHCII and B220 were

not up-regulated upon MV infection in SLAM/WT and SLAM/IRF3KO mice, and the

SLAM/STAT1KO sample were not activated (Figure 3.9) and produced minimal IFNα (Figure

3.10). Currently, there is no clear explanation for the discrepancy observed between Flt3L and

non-Flt3L treated animals. Autocrine production of IFNα by pDC is known to be a survival

factor, as well as a maturation factor to a certain extent, and is required for activation and

migration of pDCs (Asselin-Paturel et al., 2005; Fitzgerald-Bocarsly et al., 2008). The possibility

exists that over-abundance of pDCs without proper IFNα stimulation results in non-functional

cells. It is also possible that Flt3L injection and the resulting gross tumor and supra-physiological

Flt3L levels could have affected the pDC ground state and functionality, accounting for the

differences observed in WT and IRF3KO splenocytes’ responses to MV.

The type I IFN produced in response to pDC activation results in the establishment of an

antiviral state in neighbouring, uninfected cells, limiting the spread of virus (Fitzgerald-Bocarsly

et al., 2008). Activated pDCs also acquire the ability to migrate to LNs, where they can act as

APCs to CD4 and CD8 T cells. It also plays roles in NK cell activation, which target virus-

infected cells for death. Since MV infection seems limited to the site of infection, if not the

draining LN (i.e. mediastinal LN) in WT and IRF3KO mice, it seems likely that the initial IFN

production and its protective function plays the most important role in limiting MV. Yanagi and

96

colleagues have reported that in IFNAR KO mice with the mouse SLAM replaced by human

SLAM, MV infection resulted in lymphopenia, inhibition of both T-cell proliferation and

antibody production, increased production of IL4 and IL10, and suppression of contact

hypersensitivity. These observations mirror the immunological alterations in human MV

infections (Koga et al., 2010). It would be interesting to examine whether infection in

SLAM/STAT1KO mice yields similar results.

DC-SIGN (CD209), a C-type lectin receptor, which serves the dual role of regulating

adhesion by its interaction with integrins, as well as serving as a PRR for carbohydrate structures

is also a receptor for MV (de Witte et al., 2006; de Witte et al., 2008). The binding of MV to DC-

SIGN has been shown to activate cellular sphingomyelinases, which catalyze the conversion of

sphingomyelin to ceramides, and allows the formation of membrane platforms that recruit the

entry receptor, SLAM, from an intracellular storage compartment (Avota et al., 2011). The

presence of DC-SIGN on human pDCs is currently under debate (Soilleux et al., 2002; Turville

et al., 2002). However, in mice, the mouse homolog of DC-SIGN has been shown to be

expressed on pDCs (O'Keeffe et al., 2002). Whether mouse DC-SIGN can act as an attachment

receptor for MV remains to be determined; but the lack of infection in mice lacking human

SLAM expression suggests that mouse DC-SIGN alone is insufficient in mediating infection,

even in strains with defective innate immune systems (i.e. STAT1KO).

It has been reported that MV in humans inhibits IFN release by pDC by the V protein’s

interaction with IKKα and IRF7 (Pfaller and Conzelmann, 2008). Our ex vivo infection results in

which splenocytes were induced to produce IFN suggests that MV V may not inhibit murine

IKKα and IRF7 in the same way. The interaction between these proteins would help elucidate

the mouse innate immune system’s role in blocking MV infection. If inhibiting IRF7 can impair

pDC activation, MV infection may result in enhanced pathogenesis, similar to what was

observed for HSV and EMCV infections in IRF7 KO mice (Honda et al., 2005). Furthermore, to

better understand the role of pDCs in MV infection, our SLAM/WT mouse can be crossed with

the recently produced inducible pDC-null mice (Swiecki et al., 2010).

The clinical relevance of CD46 as a MV receptor poses an interesting avenue of

exploration. Is CD46 usage by MV an artifact resulting from growing the virus in culture? If so,

why was CD46 chosen among all the other possible candidates? And how long does it take (if at

97

all) for the virus to adapt to its use in vivo? The generation of the CD46/SLAM/STAT1KO

transgenic mouse allows experiments to be conducted to try to answer these questions. It may

also provide insight into the role (if any) CD46 plays in wild-type measles disease progression.

The CD46/SLAM mouse represents another advancement in the generation of an ideal small

animal model for measles, and will be a useful tool in future in vivo studies.

In conclusion, MV is able to counter the innate immune response very effectively in

humans, but it is inhibited by the same system in mice. We showed that deficiency in IRF3 does

not inhibit induction of type I IFN production in infected splenocytes and that plasmacytoid

dendritic cells are activated upon MV infection. We further showed that pDCs from IRF3KO and

STAT1KO mice are recruited to the draining LNs upon infection. Our results suggest that IRF3-

independent pathways may be able to compensate for the deficiency of this transcription factor

and that the amplification/effector arms of innate immunity play a much more critical role in

controlling MV growth in vivo.

98

Chapter 4 Characterization of the fusion proteins from measles virus

resistant to Z-D-Phe-L-Phe-Gly, a membrane fusion inhibitor

I would like to gratefully acknowledge Dr. Ryan Noyce for his work on the ZfFG binding assay

as presented in Figure 4.1. Acknowledgement is also due to Dr. Gil Privé for the computer-

generated models of the F mutants (Figure 4.5).

99

Introduction

Measles virus (MV) is a prototypic member of the morbillivirus genus, which belongs to the

Paramyxoviridae family of viruses that includes other notable pathogens such as mumps virus,

respiratory syncytial virus (RSV), human parainfluenza virus type 3 (hPIV3), and Nipah virus

(Lamb, 2007). Despite the availability of an effective vaccine, MV was responsible for almost

164,000 deaths in 2008 (WHO, 2011a). In most patients, MV causes the ‘classical’ measles

disease which is characterized by a ten to fourteen day incubation period, a two to three day

prodrome of fever, cough, coryza, conjunctivitis, and Koplik spots, followed approximately four

days later by the characteristic maculopapular rash. MV suppresses the immune system during

infection of its host and this immunosuppression is believed to increase susceptibility to

secondary infections that are ultimately responsible for the mortality associated with the disease.

There is no specific treatment for measles, although vitamin A is recommended by the WHO for

populations where the infant mortality due to measles is greater than 1% (D'Souza and D'Souza,

2002). This treatment is believed to enhance innate immunity and provide resistance against MV

(Trottier et al., 2009). In healthy patients without any complications, natural recovery takes about

seven to ten days following the appearance of the rash and the individual often acquires lifelong

immunity to the disease.

The negative-stranded RNA genome of MV encodes 6 viral genes with 2 additional

transcripts that specify V and C proteins, produced by RNA editing and via alternative start

codon usage, respectively (Griffin, 2007). Two structural proteins are responsible for viral entry

into cells. The hemagglutinin (H) protein recognizes and binds to the cellular receptors, whereas

the fusion (F) protein fuses the viral and cellular membranes to enable pH independent entry of

the virus at the cell surface. Clinical strains of MV target cells of the immune system by their

recognition and use of the signaling lymphocyte activation molecule (SLAM)/CD150 as its

receptor, whereas the vaccine strains use either SLAM or the ubiquitous membrane cofactor

protein (MCP)/CD46. In addition, vaccine and wild-type strains can use the newly discovered

PVRL4 (Nectin 4), which is present on airway epithelial cells and adenocarcinomas of the lung,

breast, colon, and ovary (Appendix I; (Noyce et al., 2011)). Upon binding to its receptor, the H

protein modifies the conformation of the F protein, allowing it to fuse the viral and cellular

membranes through a mechanism that still remains to be clearly elucidated (Hashiguchi et al.,

2011; Navaratnarajah et al., 2011; Plemper et al., 2011).

100

The F protein is present as a homotrimer and is produced as a precursor protein that is

cleaved by the host-resident protease, furin, to produce disulfide bonded F1 and F2 subunits that

are in a thermodynamically meta-stable position (Lamb and Jardetzky, 2007; Navaratnarajah et

al., 2009). The amino-terminus of the F1 subunit contains the fusion peptide, which is composed

of several hydrophobic amino acid residues. The fusion peptide is followed by the first of two

heptad repeats (HRA), which is a leucine zipper domain with the amino acid leucine being

present at every seven residues. A second heptad repeat (HRB) is present just proximal to the C-

terminal transmembrane region. HRA and HRB are separated by a spacer region that is

approximately 250 amino acids long.

The crystal structures of fragments of F proteins from several paramyxoviruses including

Newcastle disease virus (NDV), hPIV3, parainfluenza virus 5 (PIV5), and RSV have been solved

(Chen et al., 2001; Swanson et al., 2010; Swanson et al., 2011; Yin et al., 2005; Yin et al., 2006).

These have provided crucial insight into the structure and function of the various regions of F. In

the meta-stable pre-fusion state, HRA and HRB do not interact, and the F protein is thought to be

in close proximity to the H protein dimer/tetramer. The HRB, meanwhile, forms the stalk of the

F protein. Upon receptor recognition by the H protein, the F protein dissociates from the H

complex and the three HRA regions form a triple-stranded coiled-coil as the fusion peptide is

inserted into the target cell membrane. This is followed by the formation of an anti-parallel

coiled-coil or a six-helix bundle (6HB) among the HRA and HRB domains. The formation of the

6HB brings together the viral and the cellular membranes and results in fusion of the two

membranes.

Recently, there has been a resurgence of measles in certain populations due to a decrease

in vaccination rates worldwide (Moss, 2009). Furthermore, it has been shown that approximately

1.5% of the population is seronegative for MV antibody after their first MMR vaccine (Broliden

et al., 1998). Antivirals could be used to alleviate infections in these cases. In addition, the use of

MV as an oncolytic agent (Russell and Peng, 2009) would benefit from the existence of an

antiviral to control potential infections in immunosuppressed individuals. Anti-fusion peptides

have proven to be a viable way of controlling viral infections with the FDA approval of the HIV

entry inhibitor, enfuvirtide (T-20) (Wild et al., 1993). Recently, Plemper and colleagues

developed MV entry inhibitors based on structural modeling of F (Plemper et al., 2004) and have

elaborated upon the theoretical mechanism of action of this peptide (Prussia et al., 2008).

101

Previously, a fusion inhibition peptide, carbobenzoxy-D-phenylalanine-L-phenylalanine-glycine

(ZfFG), which inhibits the F protein-mediated fusion event between the viral and cellular

membranes was developed (Richardson et al., 1980). Despite ZfFG being developed close to

three decades ago, the exact mechanism of its action has yet to be shown; although there is some

evidence to suggest that it prevents hemifusion by inhibiting outer lipid bilayer mixing

(Weidmann et al., 2000a). Regardless, this compound continues to be used extensively in

studying diverse aspects of MV biology (Demotz et al., 1998; Firsching et al., 1999; Klagge et

al., 2000; Makhortova et al., 2007; Weidmann et al., 2000b).

In the present study, we generated ZfFG resistant variants of MV from the Edmonston

vaccine strain, and have characterized the F proteins of these mutants. We found that one of the

isolated mutants had a mutation that was also found in a strain that was resistant to the entry

inhibitor developed by Plemper and colleagues (Doyle et al., 2006). From our observations, we

further clarified the mechanism through which ZfFG inhibits MV fusion.

Materials and Methods

Reagents, cells and virus

The Edmonston strain of MV was obtained from Dr. Erling Norrby (Karolinska Institute,

Stockholm) and was passaged on Vero cells. Vero cells and HEK293 cells were obtained from

the American Type Culture Collection (Rockville, MD) and maintained at 37°C in Dulbecco’s

modified Eagle’s media (DMEM) (Wisent, St. Bruno, QC), 10% (v/v) fetal calf serum (Wisent),

10 µg/ml gentamycin (Invitrogen, Mississauga, ON), and 0.25 µg/ml fungizone (Invitrogen).

Vero-SLAM cells were produced by transfecting pcDNA3.1-SLAM into Vero cells and selecting

for G418 (Invitrogen) resistant colonies. They were maintained in DMEM supplemented with

800 µg/mL of G418. ZfFG was purchased from Sigma-Aldrich (Oakville, ON) and solubilized in

80% (w/v) ethanol/phosphate buffered saline (PBS) as a concentrated stock solution of 10 mM

and heated to 50°C prior to use.

102

Virus infection and titer determination

Virus was diluted in OptiMEM (Invitrogen) in a minimum volume necessary to cover the

monolayer for infection. Vero cells were infected at 37°C for 1.5 h while being rocked at regular

intervals. MV was titered on Vero cells using a modified TCID50 protocol (Hierholzer, 1996).

MV binding assay

To assess whether ZfFG prevented measles binding to the cell surface, Vero cells were incubated

with 100 PFU/cell of MV (Edmonston) for 90 min on ice in the presence or absence of 100 µM

ZfFG. Cells were washed three times with PBS containing 1% (w/v) BSA, 5 mM EDTA

(ethylenediaminetetraacetic acid), and 0.1% (w/v) sodium azide, and incubated with an anti-MV

hemagglutinin antibody (MAB8905, Millipore, Billerica, MA) on ice for 60 min. The cells were

washed prior to incubation with an alexa fluor 488-conjugated anti-mouse antibody for 45 min

on ice. Cells were washed again to remove any unbound antibodies, fixed in 1% (w/v)

paraformaldehyde, and run on a Cyan ADP Flow Cytometer (Beckman Coulter). Data was

processed using FCS Express (De Novo Software).

Production of ZfFG resistant measles virus

ZfFG resistant MV was produced by passaging the virus in the presence of ZfFG. Vero cells

were infected at an MOI of 0.1 and overlaid with 1% (w/v) sea plaque agarose/DMEM in the

presence of 50 or 100 µM ZfFG. Well-isolated, single plaques were picked at 72 hpi. The virus

was further amplified in 6 well plates in the presence of 100 µM ZfFG.

Cloning the fusion and hemagglutinin genes from ZfFG resistant measles

A single well of a 6 well plate of Vero cells was infected with the ZfFG resistant MV in the

presence of ZfFG. When approximately 90% of the cells had fused, total RNA was extracted

using the Trizol reagent (Invitrogen) according to the manufacturer’s protocols. Reverse

103

transcription reactions were carried out using the Moloney Leukemia Virus reverse-transcriptase

(Invitrogen) following the manufacturer’s protocols and using 0.5 µg of RNA and a random

hexamer primer. PCR was performed using 1 unit of Taq (Invitrogen), 0.1 unit of Pfu

polymerase (Agilent Technologies, Cedar Creek, TX) and using the following primers:

F5’ CGGAATTCCATGGTAATGTCCATCATGGGTCTCAAGG

F3’ ACTGAACCTGAGGTCAGAGCGACCTTACATAGG

H5’ CGGAATTCCATGGTAATGTCACCACAACGAGACC

H3’ CTGCAGAACCAGGGCATTGGCTATCTGCGATTGGTTCCATCTTCC

A single 1.8 kb band was extracted from the agarose gel following gel electrophoresis using QIA

extract kit (Qiagen, Mississauga, ON). The purified band was digested with BstXI and EcoRI for

H, and Bsu36I and EcoRI for F and ligated with a similarly digested pCAGGS vector (Niwa et

al., 1991). Amplified plasmid DNA was verified via restriction digest and sequencing analysis

(ACGT corporation, Toronto, ON).

Luciferase fusion assay

HEK293 cells (3x10E5 cells / 12 well) were transfected with 0.33 µg each of pCAGGS-H,

pCAGGS-F and 1 µg of T7 luciferase reporter plasmid, which contains a firefly luciferase gene

under the T7 promoter. In parallel, Vero-SLAM cells (3x10E5 cells / well) were transfected with

a plasmid that expressed T7 polymerase under the CMV promoter. All transfections were carried

out using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocols. 16 h post-

transfection, Vero-SLAM cells were detached by addition of cell dissociation buffer (Sigma) and

added to the transfected HEK293 cells in the presence of varying amounts of ZfFG. Cell lysates

were harvested after 4 h in cell culture lysis buffer (Promega, Madison, WI), and luciferase

activity was read using a Glomax luminometer (Promega).

Western immunoblot analysis

104

Sodium dodecyl sulfate-polyacrylamide (9%) gel electrophoresis (SDS-PAGE) was performed

and proteins were transferred onto polyvinylidene fluoride membrane. The membrane was

blocked with 5% (w/v) skim milk in PBS-Tween (0.5%) for 1 h and probed with antisera against

the carboxy-terminus of the F protein (Vialard et al., 1990) in 1:1000 dilution overnight. After

washing, the membrane was probed with horse radish peroxidase-conjugated anti-rabbit

antibody, and developed using the ECL plus reagent (GE Healthcare, Baie d’Urfe, QC) on a

Kodak ImageStation 4000MM (Mandel Scientific, Guelph, ON).

Cell surface protein biotinylation and pull-down

HEK293 cells (1x10E6 cells/ 6 well) were transfected with 0.5 µg each of pCAGGS-H, and

pCAGGS-F. 17 h post-transfection, cells were washed with PBS, resuspended and surface

proteins were biotinylated with 2 mM EZ-Link Sulfo-NHS-Biotin (Thermo Scientific, Rockford,

IL) for 1 h at 4°C. Adding serum-free media quenched the reaction. Following washes with PBS,

cells were lysed in 300 µL RIPA (radio-immunoprecipitation assay) buffer (50 mM Tris-HCl,

pH 7.4, 1% (w/v) NP-40, 0.25% sodium deoxycholate, 150 mM sodium chloride, 1mM EDTA)

supplemented with protease inhibitors (Complete protease inhibitor cocktail (Roche,

Mississauga, ON), 1 mM PMSF (phenylmethylsulfonyl fluoride), 1 mM sodium orthovanadate,

1 mM sodium fluoride). 150 µL of NeutrAvidin agarose resin (Thermo Scientific) was added to

the lysate and the tubes were rocked at 4°C overnight. After adsorption, the resin was washed 3

times with RIPA buffer and resuspended in reducing sample buffer for immunoblotting.

Densitometric analysis of the immunoblot was performed using the software accompanying the

Kodak ImageStation.

Endoglycosidase H treatment of cell extract

Whole cell extracts from transfected cells were harvested in RIPA buffer. Ten micrograms of

extract was digested with endoglycosidase H or PNGase F (New England Biolabs, Pickering,

ON) at 37°C for 1 h. Reducing sample buffer was added to complete the reaction. Samples were

subsequently analyzed by SDS-PAGE.

105

Homology Modeling of the F mutant structures

HHpred (Soding et al., 2005) was used to search for profile Hidden Markov Models based on

structures in the Protein Data Bank that were compatible with the MV F protein sequence. The

wild type sequence for the MV F protein used in this study corresponded to genbank id 9626950,

except for a glutamic acid at residue position 460. The two highest scoring hits corresponded to

PDB entries 2B9B and 1ZTM, both with HHpred probability scores of 100.0%. Entry 2B9B

(PubMed ID 16397490) corresponds to the PIV5 F protein in its metastable pre-fusion

conformation, and the HHpred alignment with MV F had 30% sequence identity over 497

residues with only two short indels at the N-terminal region. Entry 1ZTM (PubMed ID

15964978) corresponds to a post-fusion state of the hPIV3 F protein. The HHpred alignment of

the sequence from 1ZTM with MV F had 28% sequence identity over 490 residues with only one

short indel, also at the N-terminal region.

The HHpred-based alignments were used for the subsequent 3D modeling with

MODELLER 9.9 (Sali and Blundell, 1993). Models for wild-type and mutant MV F protein were

generated for residues 26-489 based on structure 2B9B and for residues 27-487 based on

structure 1ZTM. Trimers were generated by including three chains (labeled A, B, and C) for both

the input sequence and the template model. In order to preserve the three-fold symmetry of both

the pre- and post fusion conformations of the trimers, restraints were applied between all Cα

atoms between the pairs of chains (A,B), (B,C) and (A,C). All MV F mutant structures were

generated independently from the template PDB files 2B9B and 1ZTM. Figures were generated

with PyMOL (The PyMOL Molecular Graphics System).

Fusion kinetics assay

Pore formation was followed by a modified pore formation assay as described (Barry and

Duncan, 2009). Subconfluent HEK293 cells (3x10E6 cells / 6 well) were co-transfected with 0.1

µg of plasmid encoding enhanced green fluorescent protein (EGFP), 0.5 µg of H and an

empirically determined amount of F plasmid to make surface expression levels comparable to

106

Edmonston F. At 17 h post-transfection, cells were overlaid with Vero-SLAM cells labeled with

10 µM calcein violet, a small viability dye (eBioscience, San Diego, CA). Cells were co-cultured

at 37°C for the indicated times and then resuspended, fixed, and run on the Cyan ADP Flow

Cytometer (Beckman Coulter, Mississauga, ON). 10,000 EGFP-positive cells were gated and

analyzed for acquisition of the calcein violet dye using FlowJo software (Ashland, OR).

Results

ZfFG does not inhibit H recognition and binding to the cellular receptor

ZfFG was developed based on its ability to prevent fusion and syncytia formation (Richardson et

al., 1980). Although its sequence similarity with the fusion peptide sequence of the F protein has

been well established, its interaction with the H protein, if any, has not been examined to any

extent. Fusion is normally triggered when H recognizes its receptor and its interaction with the F

protein is modified to trigger fusion (Navaratnarajah et al., 2009). In order to exclude the

possibility of the interaction between ZfFG and H preventing fusion, the ability of ZfFG to

inhibit virus binding to MV receptor-expressing cells was tested. MV was allowed to bind to

Vero cells, which express CD46, in the presence or absence of ZfFG, and the attached viruses

were quantitated by FACS. The mock-infected Vero sample failed to exhibit fluorescence,

whereas both ZfFG treated and untreated samples in the presence of virus shifted the

fluorescence peak to a similar magnitude (Figure 4.1, top box). This indicated that inhibition of

virus attachment step was not the mechanism through which ZfFG prevented fusion.

107

Figure 4.1. ZfFG does not inhibit H recognition and binding to the cellular receptor

108

Isolation of ZfFG-resistant mutants of MV

In order to study the mechanism of action of ZfFG, we proceeded to isolate ZfFG-resistant

mutants by growing the Edmonston strain of measles virus in the presence of ZfFG. Vero cells

were infected with the virus in the presence of 50 or 100 µM ZfFG (Figure 4.2A). Forty-eight

individual plaques were isolated, and amplified. The F gene from these isolates were cloned and

sequenced. Analyses of cloned sequences revealed that the following 9 mutually exclusive

mutations and 1 double mutation occurred in a very specific stretch of the MV fusion protein

(Figure 4.2B): I452T, L454W, D458G, D458N, D458G/V459A, N462H, N462K, G464E,

G464R, and I483R. Of these, L454W, D458G, and I483R mutants were previously generated

independently by D. Bilimoria, a former M.Sc. student (Bilimoria, 1998). The mutations

occurred between amino acid residues 452 and 487, which constitute the second heptad repeat

region (HRB) of the stalk. Mutations were not found in other regions of the F gene and no

mutations were detected in the H gene sequence (results not shown). To verify the stability of

each mutation in the virus genome, the mutant viruses were passaged three times in Vero cells in

the presence of ZfFG, and the F gene was re-cloned and re-sequenced. Sequencing analyses

showed that the mutations persisted after the three passages (data not shown).

To assess whether the presence of the mutation was deleterious to virus growth, each mutant

virus was passaged three times in Vero cells in the absence of ZfFG. Upon re-cloning F, it was

found that all the mutants had reverted back to the parental wild-type F sequence (data not

shown).

109

Figure 4.2. Production of ZfFG resistant MV

110

Fusogenicity of ZfFG resistant MV F

The ten mutant constructs were transfected individually with an Edmonston H-expressing

plasmid in the presence and absence of 100 µM ZfFG (Figure 4.3A). Two constructs, D458G

and G464R, failed to form syncytia. Neither increasing the amount of transfected DNA, nor

letting the transfected cells grow longer (7 days) allowed syncytia formation to occur (data not

shown). To quantitate the membrane fusion activity of each F mutant in the presence of ZfFG,

luciferase-based fusion assays were performed. HEK293 cells were co-transfected with H, F and

an inducible firefly luciferase expression construct and allowed to fuse with T7 polymerase-

expressing Vero-SLAM cells which induces expression of luciferase following the fusion event.

This was carried out with increasing ZfFG concentrations of 0, 50 and 100 µM. The luciferase

activity in the presence of ZfFG was expressed as a percentage of the enzymatic activity

produced in the absence of the inhibitor (Figure 4.3B). Inhibitor concentrations greater than 200

µM could not be used since the carrier/inhibitor combination proved to be toxic to the cells

(results not shown). Although no syncytia were visible when viewed under the microscope, 100

µM ZfFG was only able to inhibit approximately 50% of luciferase activity in the parental

Edmonston F transfected cells. These data suggest the possibility that ZfFG allows hemifusion

and fusion pore formation but inhibits the wide-spread fusion between the pores.

111

Figure 4.3. Fusion activity of ZfFG mutants in vitro

112

D458G and G464R F mutants are not expressed on the cell surface

To understand why the D458G and G464R mutants failed to fuse membranes, cell lysates from F

and H co-transfected cells were subjected to immunoblot analysis using antibodies directed

against the carboxy-terminus of the F protein. All the mutant constructs expressed the 60 kDa F0

precursor protein. D458G and G464R constructs, however, failed to produce the cleaved 40 kDa

F1 product (Figure 4.4A). To determine the level of F expression on the cell surface, surface

proteins were biotinylated, collected with streptavidin beads and immunoblotted for F (Figure

4.4B). In all experiments, the expression of the mutant F constructs at the cell surface was lower

than that of the wild-type F protein. Levels of surface expression of D458G and G464R were the

lowest, which indicated that the near absence of protein on the surface accounted for their

diminished membrane fusion activity. To investigate whether traffic through the endoplasmic

reticulum and Golgi were affected, H and F co-transfected whole cell lysates were subjected to

endoglycosidase H treatment. All F0 constructs were sensitive to endoglycosidase H treatment,

indicating that it remained in the endoplasmic reticulum (Figure 4.4C). Furthermore, a faint trace

of the cleaved F1 band for G464R was visible. However, no syncytia formation was ever

observed for this construct even after increasing the amount of the plasmid DNA in transfections

(data not shown). Taken together, these results suggest that D458G and G464R are translated in

the cytoplasm, but fail to be transported into the Golgi apparatus.

113

Figure 4.4. ZfFG resistant mutants do not become surface expressed at the same level as the Edmonston F

114

ZfFG-resistant mutations are localized to a small pocket between the head and stalk regions of

the pre-fusion conformation of F

Modeling of the MV F protein by Prussia et al. found that mutations at N462, found in this

pocket, destabilize a network of non-covalent interactions between HRB and the base of the

globular head (Prussia et al., 2008). Based on the published crystal structures of other

paramyxovirus F proteins (Chen et al., 2001; Swanson et al., 2010; Swanson et al., 2011; Yin et

al., 2005; Yin et al., 2006), the ZfFG-resistance mutations were mapped onto computer-

generated models of pre- and post-fusion conformations of the MV F protein (Figure 4.5). In the

pre-fusion conformation, the mutations localized to a small pocket present between the globular

head, formed by HRA and the linker regions, and the stalk, formed by the HRB region (Figure

4.5A). Mutations were also mapped to the post-fusion conformation model (Figure 4.5B). In this

case, all the mutant residues were located facing away from the hydrophobic core of the 6HB.

115

Figure 4.5. Computer generated models of ZfFG resistant mutants

116

117

Fusion kinetics of F mutants

From their computer-generated model of MV F, Prussia and colleagues reported that N462K was

a hyperfusogenic variant as a result of the disruption of the non-covalent interactions which

normally keeps the stalk engaged to the globular head region (Prussia et al., 2008). A

hyperfusogenic F protein can hypothetically overcome the ZfFG-mediated fusion block by

initiating fusion before the peptide has a chance to act. To test whether our mutants also

possessed hyperfusogenicity, a time course of fusion over a one-hour period was performed

using a FACS-based fusion assay (Figure 4.6). Contrary to this model, all mutants that we tested

exhibited slower fusion kinetics when compared to the wild-type F protein. It is worth noting that

the N462K mutant was among the faster fusing mutants. The absolute extent of fusion was also

less than that of the wild-type protein for the mutants at the end of the one-hour period.

Figure 4.6. Fusion kinetics of various F mutants

118

Discussion

Paramyxovirus infections constitute a large portion of biologically and economically important

diseases of man and livestock. Understanding the mechanism used by these viruses to gain entry

into a host can lead to development of novel entry inhibitors which can be used to treat active

infections. ZfFG was developed as a specific fusion inhibitor nearly three decades ago, and has

been used extensively to study measles entry. However, the mechanism through which it works

has not been fully elucidated.

In the present study, we attempted to dissect the site of action of ZfFG through generation

of spontaneous mutants that were resistant to ZfFG. Our screen isolated 10 mutants, of which 8

were shown to be functional when expressed in conjunction with H in Vero cells. Of the mutants,

N462K mutant was previously isolated and characterized by Doyle and colleagues when they

were attempting to generate spontaneous mutants against the MV entry inhibitor, AS-48,

designed to interact with the area between the head and neck domains of F (Doyle et al., 2006).

Through further computer modeling, this group suggested that the mutation was less stable in its

pre-fusion form, resulting in a more active variant (Prussia et al., 2008). In their computer model,

the HRB residues P450, P451, I452, L454, L457, and V459 were indicated to take part in key

hydrophobic interactions with the head region of F in the pre-fusion configuration. It is

interesting to note that the I452T, and L454W mutations, found in our study, would disrupt the

hydrophobic interactions predicted there. The N462 mutants would also introduce a positive

charge to this normally hydrophobic environment. It is postulated that the concentrated

hydrophobic region is critical for holding the three HRB domains together as the stalk in the pre-

fusion conformation, and that disruption in this region will most likely decrease the barrier for

dissociation of the linker domains from the head region. Furthermore, Russell and colleagues

have reported that mutation of PIV5 F protein L447 and I449 residues (equivalent to L457 and

V459 in MV, respectively) influence the activation barrier of the metastable, pre-fusion F, with

aromatic substitutions promoting hyperactive fusion (Russell et al., 2003).

The most obvious explanation of why the ZfFG-resistant mutant production yielded the

mutants that it did is that ZfFG binds to the regions where mutations occurred. However, the

independent derivation of the N462K mutant in an unrelated study (Doyle et al., 2006) suggests

that we cannot rule out the possibility that these mutations are naturally occurring variants that

119

are resistant to the inhibitory effects of ZfFG. This group showed that the N462K mutation

confers hyperfusogenicity leading to greater overall fusion compared to the wild-type

Edmonston F (Prussia et al., 2008). Our data shows that the N462K mutant does not fuse as

quickly as the wild-type F, and the overall fusion at the end of the 1 hr period is less than that of

the wild-type F (Figures 4.6). The difference between our results and those of the other group

may be due to several possible factors including the total time fusion was allowed to proceed (1

hr in our study versus 7 hrs in Prussia et al.), and the fact that they were looking at CD46-H

mediated fusion, whereas we looked at SLAM-H mediated fusion. In our hands, overexpression

of Edmonston H and F never resulted in syncytia formation in HEK293 and Vero cells, both of

which express CD46. This situation differs from expression of H and F during infections by

Edmonston MV where extensive syncytia formation is evident. Another discrepancy is the

presence of a glutamate residue at position 460 instead of a glycine residue in our wild-type

Edmonston strain F sequence. Although the NCBI deposited sequences show a glycine residue at

this position, repeated sequencing analysis of our Edmonston F has shown this to be a glutamate

residue. Therefore, the difference observed in fusogenicity between the two laboratories may be

due to the difference in this residue, which is also located in the HRB region. An interesting

experiment would be to mutate this residue into a glycine through site-directed mutagenesis and

test for its capacity for fusion.

Other groups have suggested that paramyxoviruses must carefully regulate their

fusogenicity with a compromise between hyper- and hypo-active forms of the F protein. Lack of,

or too much fusion could have an impact on virus production (Cathomen et al., 1998a; Cathomen

et al., 1998b; Tahara et al., 2007). Indeed, our observation that the mutants do not fuse to the

same extent and at a slower rate than that of the wild-type F suggest that they have a

disadvantage over wild-type F. Our observation that the mutant viruses spontaneously revert

back to the wild-type F sequence when passaged in the absence of ZfFG also seems to support

this hypothesis. Similarly, Plemper and colleagues (Prussia et al., 2008) showed that infection

with the N462K mutation-harboring virus resulted in fewer, but bigger plaques compared to the

parental Edmonston strain. This observation supports our hypothesis as well, since it shows that

infectivity of the mutant virus was reduced within a given dose.

The unexpected observation that the wild-type Edmonston F protein still allowed

luciferase expression in the presence of ZfFG without the formation of observable syncytia may

120

point to another mechanism through which this inhibitor works. We hypothesize that pore

formation and enlargement may occur just enough to allow plasmid/T7 polymerase to pass

between the cells, but the pores fail to coalesce into bigger pores that ultimately form syncytia

(Figure 4.7). Indeed, Weidmann and colleagues have shown that ZfFG inhibited fusion after the

hemifusion stage (Weidmann et al., 2000a). This observation would support our model, since the

transfer of lipid dye (hemifusion) from the donor population does not rule out the possibility of

fusion pore formation.

Figure 4.7. A proposed ZfFG mechanism of action

There is a body of work which suggests that ZfFG works to inhibit general membrane-to-

membrane fusion by depositing onto the membrane surface and inhibiting the formation of

membrane curvature necessary for fusion initiation (Dentino et al., 1995; Epand et al., 1993).

However, this mechanism does not fully explain what makes MV, in particular, so sensitive to

the action of ZfFG (Richardson et al., 1980). It is possible that the lower level of surface

expression, in conjunction with the slower kinetics of fusion allow the mutant F proteins to avoid

the inhibitory actions of ZfFG. Furthermore, the mutants generated may contain slightly

increased potential energy for pore enlargement, since this is thought to be the most energetically

121

costly stage of syncytia formation (Chernomordik et al., 2006). An alternative explanation is that

the mutation allows F to overcome the membrane’s ZfFG-induced resistance to curvature

formation, perhaps by decreasing the minimum curvature deformity required in fusion initiation.

At this point we cannot explain why the D458G and G464E mutations fail to form

syncytia when expressed via plasmid. The furin cleavage sites in both constructs are intact and

were verified via sequencing. It is also interesting to note that other mutations that occur at the

same residue successfully become expressed on the surface and recapitulate the ZfFG-evasion

observed with the virus. Since the measles matrix protein is known to interact with the

cytoplasmic tails of both H and F (Naim et al., 2000), co-expression of the matrix protein may

play a role in the surface expression of these two mutants.

Early experiments conducted by injecting rats or orally administering dogs with

carbobenzoxy-D-phenylalanyl-D-phenylalanine (SV3936), a closely related derivative of ZfFG,

and determining the serum antiviral activity showed that it was able to reduce MV plaques by 56

and 40%, respectively (Miller et al., 1968). Although the same study only looked at 2-6 h post-

injection levels, oral dosing of this compound in monkeys also showed serum antiviral activity.

These findings show the in vivo antiviral potential of this class of fusion inhibitors.

Presently, work is ongoing in our lab to generate a computer-based model to simulate

possible docking sites for ZfFG to the HRB region where most of the mutations are localized.

122

Chapter 5 Conclusions and future directions

123

Research Summary

Measles virus infects only primates and presents several challenges to researchers. Studies in

humans are restricted for ethical reasons, and experimental models in non-human primates are

both expensive and not readily accessible. A mouse model, in contrast, has the advantage of

being amenable to drug discovery and immune therapy, and can be conducted with a large

number of animals enabling robust statistical analyses. To this end, many groups have tried to

develop a murine model by expressing the MV receptor in various cell types, but have

consistently found that the innate immune system and type I interferon signal transduction

pathways in these animals presented an insurmountable block in virus replication (Ferreira et al.,

2010; Mrkic et al., 1998; Ohno et al., 2007; Shingai et al., 2005).

To overcome the block in viral replication imposed by cellular innate immunity, we

produced SLAM-expressing MEFs that had deficiencies in IRF3 and IRF3/9, as well as a cell

line that constitutively expressed the innate immune inhibitor, vaccinia E3L (Chapter 2). MV

infection in these cell lines did not induce interferon production, and the production of ISGs was

also impaired. Virus yield was enhanced to varying degrees, with IRF3/9DKO and E3L-

expressing MEFs showing the highest increase, followed by the IRF3KO MEFs.

Pharmacological inhibition of PKR enhanced MV replication in both wild-type and IRF3KO

MEFs. These data suggest that although the initial IRF3 dependent signal transduction pathway

is important, redundancies in the innate immune system provided by PKR and IRF7 are

sufficient to limit MV replication in murine fibroblasts.

We next examined whether deficiencies in IRF3 or STAT1 expression would enhance the

spread of MV in mice (Chapter 3). In IP infected mice, it was observed that MV spread

systemically only in the SLAM/STAT1KO mice, and that the infection was largely limited to the

mediastinal lymph node in SLAM/IRF3KO mice. IP infected mice showed recruitment of

activated plasmacytoid dendritic cells to the draining lymph node (i.e. mediastinal node) as well

as the spleen. Ex vivo infection of splenocytes from the same mice indicated that the cells

produced interferon in response to MV infection. SLAM/STAT1KO mice infected with MV

showed that the highest number of virus-containing cells were located in the mediastinal lymph

node, and that pDCs and non-DCs were infected more than cDCs. To elaborate upon the role of

pDCs, we artificially increased the number of pDCs by injecting Flt3-ligand producing

124

melanoma cells. Ex vivo MV infection of splenocytes from these animals showed a different

response compared to mock treated mice. The difference was particularly noticeable in the

STAT1KO mice, in that pDCs from these mice failed to be activated and produce IFN. Our data

suggest that even in the absence of IRF3 or STAT1, pDCs are activated, but artificially

expanding the pDC population alters their capacity to respond to MV infections. We also

attempted to generate a mouse that constitutively expresses the vaccinia E3L protein in all of its

tissues (Appendix II). Although the initial mouse generation was successful, the male mice in

this strain exhibited signs of diabetes and failed to thrive during the course of crossing the mice

into an appropriate background strain for study. It will probably be necessary to develop

additional E3L transgenic mouse lines since another investigator was successful in producing a

similar mouse (Domingo-Gil et al., 2008).

The involvement of the innate immune system in inhibiting MV replication in mice has

been documented since attempts were made to generate a transgenic mouse that expresses the

first identified MV receptor, CD46 (Mrkic et al., 1998). Although much progress has been made

in determining MV tissue tropism in these and SLAM expressing mice (Ferreira et al., 2010;

Mrkic et al., 2000; Welstead et al., 2005), details concerning the exact nature of the virus

replication block have been lacking. One of the goals of my project was to identify and

overcome these inhibitory pathways, and the data suggests that IRF3 does not play a major role.

Rather, data obtained from fibroblast infections indicate that PKR may play a more critical role

in determining virus titer. With respect to how the immune system reacts to a MV challenge in

vivo, our data suggest that pDCs are activated upon MV infection regardless of IRF3 deficiency,

and the ability to respond to type I IFN is crucial in preventing a systemic MV infection. The

demonstration that CD46/SLAM/STAT1KO mice can be infected in both a SLAM-dependent

and SLAM–independent manner (Chapter 3) is an encouraging step towards generating a viable

model for MV infections in mice.

There is much interest in developing recombinant MV that contains antigens for other

diseases to yield a multivalent vaccine (Billeter et al., 2009), as well as its utilization as a

treatment for certain types of cancers (Russell and Peng, 2009). The widespread usage of live

vaccines, coupled with decreasing rates of vaccination in developed countries, define potential

situations that could benefit from effective antiviral therapy. ZfFG was synthesized and studied

in the 1980’s and found to inhibit MV fusion (Richardson et al., 1980). Although this peptide has

125

been used widely to study MV infection in vitro, its exact molecular mechanism of action has not

been elucidated. In Chapter 4, we generated spontaneous ZfFG resistant mutants and

characterized their F proteins. We found that all the resistant mutants had mutations localized to

the HRB region of F, and that most of these residues lined a small pocket between the head and

stalk regions of the pre-fusion conformation of the F protein. In transfection assays, two of the F

mutants failed to form syncytia, and this was attributed to their lack of expression on the cell

surface. The remaining mutants were expressed at lower levels when compared to the parental

Edmonston F, and fused at a slower rate. These mutant F proteins affected viral fitness, as all the

isolates reverted back to the parental sequence once the selection pressure of ZfFG was lifted.

We propose that ZfFG acts by allowing membrane pore formation to occur but inhibits the

expansion of these pores during the fusion process. Furthermore, in silico mapping of the

mutated residues suggest that ZfFG may interact with a small pocket that is located between the

head and stalk regions of the pre-fusion F complex. These findings help to elucidate the

mechanism of action of this widely used inhibitor of MV-mediated fusion, but it may also help

shed light on the general mechanism of the fusion process for other type I fusion proteins.

Future Directions

Innate immunity

The innate immune system is a complicated pathway with multiple redundancies, checks, and

balances. The pathways of the innate immune system converge on a couple of transcription

factors, IRF3 and IRF7, which initiate transcription of IFNs that amplify the signals of immune

protection. Our data suggest that deletion of IRF3 alone may not enhance MV growth to a

significant extent. Since inhibiting PKR improved virus yield, it would be interesting to see if

pharmacological inhibition of PKR by C16 improves virus growth in vivo. The fact that injected

C16 has been used to decrease PKR activity in rats (Ingrand et al., 2007) supports the feasibility

of this experiment. The generation of a SLAM expressing mouse in a PKR knockout background

(Yang et al., 1995) will also allow this hypothesis to be tested.

Another possible direction would be to examine the effects of IRF7 deletion alone or in

conjunction with IRF3. Indeed, our observation that pDCs play a role in responding to MV

126

infection further supports studying the protective roles of these factors, since IRF7 plays a

central role in transducing innate immune signaling in these cells and triggering the activation of

pDCs (Honda et al., 2005). To this end, IRF7KO mice could be obtained and crossed with the

SLAM mice to generate SLAM/IRF7KO mice in order to compare the effects we obtained with

the SLAM/IRF3KO mice. Mice deficient in both IRF3 and IRF7 have also been generated

(Daffis et al., 2009), and this may allow us to ask whether both factors are required for protection

or if pathways independent of these two transcription factors control MV replication in mice. It is

worth noting that studies by Diamond and colleagues have shown that mice lacking IRF3 or

IRF7 had relatively normal IFNβ production and this was only slightly abrogated in

IRF3/7DKOs in response to West Nile virus challenge (Daffis et al., 2007; Daffis et al., 2008;

Daffis et al., 2009).

To elaborate upon the role of pDCs, we may be able to obtain the recently developed,

inducible pDC KO mice (Swiecki et al., 2010) and subsequently cross these with the SLAM

mouse. Data from VSV infection in these mice suggest, however, that the roles of pDCs may be

redundant in an otherwise fully immune-competent mouse. The suggested experiments thus far

are by nature subtractive, and although they will be useful in clarifying the specific roles of each

gene/cell type in an infection, it is questionable whether a mouse that is deficient in a single

innate immune component can serve as a general model for MV.

Literature suggests that the MV V protein plays a very important role in inhibiting the

innate immune response in humans (Ramachandran and Horvath, 2009). With the interaction

between the V protein and human STAT1/2 well established, it is possible that a transgenic

mouse, which expresses the human STAT2 in place of mouse STAT2, may be able to replicate

the clinical symptoms of MV in mice. Indeed, a similar approach to this was taken by Horvath

and colleagues in looking at human STAT2 interaction with parainfluenza virus 5, another

paramyxovirus which was observed to possess a similar replication block in murine cells (Kraus

et al., 2008). This study found that while expression of human STAT2 in mice did not affect the

normal IFN response, PIV5 was able to overcome the replication block in these mice. Therefore,

generating a hSLAM/hSTAT2 mouse may be a reasonable approach to produce a measles-

susceptible mouse model. In advance of the in vivo work, human STAT2 could be expressed in

existing SLAM-expressing MEF cell lines and experiments could be conducted in these cells as

proof in principle. In theory, the overexpressed human STAT2 would out-compete the

127

endogenous mouse STAT2 in interacting with the mouse STAT1, allowing the V protein to

successfully sequester these complexes from entering the nucleus. The MEF cell lines will also

allow further work to be done on studying the interaction between MV N and IRF3 (tenOever et

al., 2002) and between MV V and IKKα/IRF7 (Pfaller and Conzelmann, 2008).

Replication block in mouse cells

Historically, passaging the wild-type MV isolate in chicken and monkey cells allowed the virus

to adapt to theses cells, and cleared the way for many of the fundamental discoveries in MV

research (Griffin, 2007). In a similar manner, the SLAM-expressing MEFs may be used to

further passage wild-type MV to attempt to generate a rodent-adapted MV. There is some

evidence to suggest that MV transcription is inefficient in rodent cells and that this could be

alleviated by the trans complementation of MV N, P and L proteins (Vincent et al., 2002).

Therefore, it is tempting to hypothesize that a rodent adapted MV could have mutations that

allow increased production of N, P, and L proteins. We have already started to passage the wild-

type MV in SLAM/WT MEFs and have found that there was an inexplicable increase in

cytopathic effects at passage 9 (Figure 5.1). Further blind-passaging of the cell lysate has so far

failed to produce additional cytopathic effects (passage 30), and it will be necessary to verify that

viral proteins are being expressed in the cells that exhibit CPE.

128

Figure 5.1. Passaging MV (Montefiore) in SLAM/WT MEFs.

It is interesting to note the absence of a rodent-specific morbillivirus when species-

specific viruses exist for dogs (canine distemper virus), seals (phocine distemper virus),

ruminants (peste des petits ruminants virus), cattle (Rinderpest virus), dolphins and whales

(cetacean morbillivirus). There is always the possibility that such a virus will be discovered in

the future and that characterizing the mutations found in a murine-adapted MV may help in

anticipating some of its features.

129

Receptor usage

The generation of CD46/SLAM/STAT1KO mouse allows the testing of whether receptor usage

adaptation occurs in vivo. This question can be approached by repeated passaging of the wild-

type MV in mice, with sequencing of the H gene at each passage to monitor the mutation

occurrence. The recent identification of PVRL4 as a MV receptor present on epithelial cells

(Appendix I) adds an interesting avenue of research for future mouse models. MV recognizes

murine PVRL4, but it seems to function less efficiently as a receptor since COS-1 cells

expressing the murine PVRL4 resulted in smaller and fewer syncytia compared to cells

expressing the human gene upon MV infection. The infection status of the airway epithelial cells

expressing PVRL4 in systemically infected SLAM/STAT1KO or CD46/SLAM/STAT1KO mice

remains to be determined. Furthermore, the transmissibility of MV by blood or sputum from

systemically infected mice has never been examined. It will be interesting to test whether

bronchoalveolar lavage samples from IP infected mice contain infectious MV as a result of virus

crossing over the alveolar epithelial barrier using PVRL4. It will also be interesting to see

whether a human PVRL4 knock in mouse will further improve the infectious nature of MV in the

rodent model.

ZfFG mechanism

The ZfFG mutants that were characterized in chapter 4 provide an opportunity to dissect the

mechanism of action of ZfFG, and also a chance to gain insight into the general fusion process

utilized by MV. The crystal structure for the F protein has not been solved to date, so most

studies have had to rely on computer models based on the available crystallographic data from

other paramyxovirus F proteins (Chen et al., 2001; Swanson et al., 2010; Yin et al., 2005; Yin et

al., 2006). It is possible that one of the ways ZfFG functions is by interacting with the specific

stretch of amino acids where the mutations were found. To this end, a ligand-docking model may

be generated based on in silico mapping of the mutations on the available models.

Short peptides with sequences matching the HRA and HRB regions of F can be added to

inhibit fusion at various stages (Lambert et al., 1996; Vitiello and Galdiero, 2009). Furthermore,

other non-peptide fusion inhibitors have been generated in recent years (Plemper et al., 2004;

130

Plemper et al., 2003). It will be interesting to compare the site of action of these other inhibitors

with ZfFG. The finding that the N462K mutation was also observed in a resistant mutant against

an unrelated fusion inhibitor highlights the importance this residue plays in mediating fusion

(Doyle et al., 2006). Several other fusion inhibitor resistant mutations including N462S, N462D

and A367T mutations could also be generated through site-directed mutagenesis and tested for

their resistance to ZfFG. Kinetics studies can be conducted to differentiate rate of fusion. Also,

fusion assays could be conducted to elucidate the stage at which fusion is arrested in each case.

A clearer understanding of how ZfFG inhibits fusion will allow a more accurate

understanding of the fusion process, which in turn may lead to developing more effective

antiviral peptides for other viruses with type I fusion proteins.

Conclusion

The research presented in this thesis helps to further characterize the block preventing MV

replication in rodents. It also contributes to the molecular mechanism of action of a widely used

fusion inhibitor. A small animal model of MV containing both CD46 and human SLAM

receptors was generated in a STAT-1 deficient background and will prove useful in testing MV

vaccines and antivirals, as well as documenting the spread of virus throughout the mouse, from

lymphocytes to epithelial cells. Furthermore, future studies may take advantage of the numerous

mouse cancer models available for validating the use of MV as an oncolytic virus to treat cancer.

131

Appendix I: Tumor Cell Marker PVRL4 (Nectin 4) Is an Epithelial Cell Receptor for Measles Virus

Ryan S. Noyce1,2, Daniel G. Bondre1,2., Michael N. Ha2,3, Liang-Tzung Lin1,2, Gary Sisson1,2, Ming-

Sound Tsao3,4, and Christopher D. Richardson1,2,5*

1 Department of Microbiology & Immunology, Dalhousie University, Halifax, Nova Scotia,

Canada

2 IWK Health Sciences Centre, Canadian Center for Vaccinology, Halifax, Nova Scotia

3 Department of Medical Biophysics, University of Toronto, Toronto, Canada

4Ontario Cancer Institute and Princess Margaret Hospital, Toronto, Canada

5 Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia

*Corresponding author:

Christopher D. Richardson, Department of Microbiology & Immunology, Dalhousie University,

Halifax, Nova Scotia, Canada, B3H 1X5; Tel: +1-902-494-6876; Fax: +1-902-494-5125; E-mail:

chris.richardson@dal.ca.

Keywords: measles virus, PVRL4, nectin 4, receptor, epithelial cell, adenocarcinoma, oncolytic

virus, tight junctions, adherens junctions

132

Tumor Cell Marker PVRL4 (Nectin 4) Is an Epithelial CellReceptor for Measles VirusRyan S. Noyce1,2, Daniel G. Bondre1,2, Michael N. Ha2,3, Liang-Tzung Lin1,2, Gary Sisson1,2, Ming-Sound

Tsao3,4, Christopher D. Richardson1,2,5*

1 Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada, 2 IWK Health Sciences Centre, Canadian Center for Vaccinology,

Halifax, Nova Scotia, Canada, 3 Department of Medical Biophysics, University of Toronto, Toronto, Canada, 4 Ontario Cancer Institute and Princess Margaret Hospital,

Toronto, Canada, 5 Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia, Canada

Abstract

Vaccine and laboratory adapted strains of measles virus can use CD46 as a receptor to infect many human cell lines.However, wild type isolates of measles virus cannot use CD46, and they infect activated lymphocytes, dendritic cells, andmacrophages via the receptor CD150/SLAM. Wild type virus can also infect epithelial cells of the respiratory tract through anunidentified receptor. We demonstrate that wild type measles virus infects primary airway epithelial cells grown in fetal calfserum and many adenocarcinoma cell lines of the lung, breast, and colon. Transfection of non-infectable adenocarcinomacell lines with an expression vector encoding CD150/SLAM rendered them susceptible to measles virus, indicating that theywere virus replication competent, but lacked a receptor for virus attachment and entry. Microarray analysis of susceptibleversus non-susceptible cell lines was performed, and comparison of membrane protein gene transcripts produced a list of11 candidate receptors. Of these, only the human tumor cell marker PVRL4 (Nectin 4) rendered cells amenable to measlesvirus infections. Flow cytometry confirmed that PVRL4 is highly expressed on the surfaces of susceptible lung, breast, andcolon adenocarcinoma cell lines. Measles virus preferentially infected adenocarcinoma cell lines from the apical surface,although basolateral infection was observed with reduced kinetics. Confocal immune fluorescence microscopy and surfacebiotinylation experiments revealed that PVRL4 was expressed on both the apical and basolateral surfaces of these cell lines.Antibodies and siRNA directed against PVRL4 were able to block measles virus infections in MCF7 and NCI-H358 cancer cells.A virus binding assay indicated that PVRL4 was a bona fide receptor that supported virus attachment to the host cell. Severalstrains of measles virus were also shown to use PVRL4 as a receptor. Measles virus infection reduced PVRL4 surfaceexpression in MCF7 cells, a property that is characteristic of receptor-associated viral infections.

Citation: Noyce RS, Bondre DG, Ha MN, Lin L-T, Sisson G, et al. (2011) Tumor Cell Marker PVRL4 (Nectin 4) Is an Epithelial Cell Receptor for Measles Virus. PLoSPathog 7(8): e1002240. doi:10.1371/journal.ppat.1002240

Editor: Glenn F. Rall, The Fox Chase Cancer Center, United States of America

Received February 3, 2011; Accepted July 20, 2011; Published August 25, 2011

Copyright: ! 2011 Noyce et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: The experiments performed in this paper were funded through a Canadian Institutes of Health (www.cihr-irsc.gc.ca) operating grant (CIHR MOP 10638)and the Nova Scotia Health Research Foundation (www.nshrf.ca) health research grant (#1200). Additional funds were received from the Canadian Breast CancerFoundation Atlantic Region Grant #2189 (www.cbcf.org). RSN is supported by the Nova Scotia Health Research Foundation and held a trainee award from theBeatrice Hunter Cancer Research Institute with funds provided by the Terry Fox Foundation Strategic Health Research Training Program in Cancer Research atCIHR. CDR is a Canada Researth Chair (Tier I) in Vaccinology and Viral Therapeutics and received an equipment grant from the Canadian Foundation forInnovation. The funding agencies had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: chris.richardson@dal.ca.

Introduction

In spite of the success of an attenuated measles virus (MV)vaccine in the modern world [1] measles virus (MV) is still a majorkiller of children in developing countries [2]. MV strikes anestimated 20 million children a year and killed around 164,000individuals in 2008 according to the World Health Organization(http://www.who.int/mediacentre/factsheets/fs286/en/). MVcauses an acute disease characterized by fever, photophobia,coughing, running nose, nausea, and a macular red rash over mostof the body. In rare instances, persistent MV infections can occurin the brain and lead to encephalitis. Humans and monkeys arehosts for MV [3-7] while most rodents are not normally infectedby the virus [8–10]. The recent discovery that attenuated strains ofMV possess oncolytic properties and can be used to destroy tumorcells, has kindled an interest in this virus as a gene therapy agent[11,12].

Measles virions contain a negative strand RNA genome fromwhich viral mRNAs are transcribed to encode a nucleocapsidprotein (NP), a phosphoprotein (P), virulence factors (C and V),matrix protein (M), membrane fusion protein (F), the hemagglu-tinin/receptor binding protein (H), and an RNA polymerase (L)[13]. Surrounding the nucleocapsid is a membrane which containsthe two viral glycoproteins, H and F. The H protein is required forviral attachment to the host cell receptor, while F mediatesmembrane fusion and entry at the host plasma membrane and isalso responsible for syncytia (multi-nucleated cell) formation.

Interaction of the H protein of MV with a cellular attachmentfactor is the initial event of infection. The binding of H to the hostcell receptor triggers and activates the F protein to induce fusionbetween virus and host cell membranes [14–16]. The search forMV cellular receptors initially began with vaccine/laboratorystrains and progressed to more relevant receptors used by wildtype MV (wtMV) isolates [17]. Human membrane cofactor

PLoS Pathogens | www.plospathogens.org 1 August 2011 | Volume 7 | Issue 8 | e1002240

133

protein (MCP/CD46) is a receptor for the Edmonston labora-tory/vaccine strain of MV [18,19]. CD46 is a complementregulatory protein that is expressed on most cell types in thehuman body, with the exception of red blood cells (although it ison monkey erythrocytes) [20]. Natural isolates of wtMV can beadapted to grow in Vero monkey kidney cells and this isaccompanied by mutations in the H protein that convey theCD46 receptor binding phenotype [21–23]. Strains of wtMV areroutinely isolated in marmoset B95-8 cells, a B cell lineimmortalized with Epstein-Barr virus, which allows the virus togrow without the need for adaptation [24]. These isolates cannotuse CD46 as a receptor [22,25]. Our laboratory and othershypothesized that another lymphotropic receptor could be usedby wild type isolates of MV [22,26,27]. Signaling lymphocyteactivation molecule (SLAM) or CD150 was identified to be alymphotropic receptor for both clinical isolates and vaccinestrains of MV [28–30]. SLAM/CD150 is a signaling moleculethat is expressed on activated B, T, monocyte, and dendritic cells[31].

Recent evidence indicates that CD150+ alveolar macrophages,dendritic cells, and lymphocytes are the initial targets for measlesvirus infections in macaques [32–35]. However, wild type MV, inautopsied human patients and some experimentally infectedmonkeys, has been shown to infect the epithelial cells of thetrachea, bronchial tubes, lungs, oral cavity, pharynx, esophagus,intestines, liver, and bladder [36,37]. These epithelial cells do notexpress SLAM/CD150, but the infected cells do shed virus [37–39]. Epithelial cells may be important later on in infection and forthe spread of MV by aerosol droplets. Wild type MV does notreadily infect most common laboratory epithelial, endothelial, orfibroblast cell lines. In addition, cryo-preserved primary humansmall airway epithelial cells (SAEC) grown in serum free epithelialcell growth medium are not normally susceptible to wtMV, butcan be made susceptible by culturing them in 2% fetal calf serum[39]. These cells do not express CD150/SLAM and the wtMVcannot use CD46/MCP, suggesting that there is another receptoron epithelial cells [39]. The third receptor has been postulated to

lie on the basolateral side of epithelial cells in close context toinfected lymphocytes and dendritic cells, and it may play asecondary role following infection of the lymphatic system that isimportant for MV transmission [33,34,40–42]. Virus is postulatedto infect epithelial cells using the unidentified basolateral receptor,and MV is subsequently shed from the apical surface of these cells[33,42,43]. Other investigators have been searching for an elusivereceptor on polarized epithelial and cancer cell lines [41,44–46].Recently it was shown that loss of tight junction proteins, duringan epithelial-mesenchymal cell transition induced by the tran-scription repressor SNAIL, blocked infections by wtMV [45]. Ithas become clear that tight junction proteins can serve as entryfactors for other viruses that target polarized epithelial cells. Theseinclude hepatitis C virus, reovirus, herpes simplex virus andcoxsackie virus [47–50]. The region of the H protein that interactswith the putative epithelial receptor was recently mapped on the 3-D structure of the viral attachment protein to include residuesI456, L464, L482, P497, Y541, and Y543 [33,41].

Here we show that wild type MV infects primary airwayepithelial cells grown in fetal calf serum and many adenocarci-noma cell lines of the lung, breast, and colon. A microarrayanalysis of susceptible versus non-susceptible cell lines showedthat transcripts for many adherens junction and tight junctionproteins are up-regulated in virus receptive cells. However, theintegrity of these junctions was not a prerequisite for infection.Non-susceptible cell lines could be infected following transfectionwith a CD150/SLAM expression vector, indicating that theywere replication competent. Analysis of the microarray data,filtered for membrane protein genes, produced a short list of 11candidate receptors. Of these only human PVRL4 (Nectin 4), atumor cell marker found on breast, lung, and ovariancarcinomas, rendered cells amenable to MV infections. Transientknockdown of PVRL4 using siRNA abolished wtMV infection inthese cell lines. The identification of this receptor could provideimpetus for MV as an oncolytic treatment for lung, breast, andcolon adenocarcinomas.

Results

Wild type MV infects serum activated SAECindependently of CD46 (MCP) and CD150 (SLAM)

Human primary SAEC were previously shown to supportwtMV replication and produce syncytia when grown in thepresence of 2% fetal calf serum but not in serum free media. Thesecells did not express CD150 (SLAM) [39]. We confirmed theseresults and further demonstrated that infections with a recombi-nant wtMV engineered to express EGFP (IC323-EGFP wtMV)were independent of CD46 (MCP) and CD150 (SLAM)expression. Infections with IC323-EGFP wtMV were unaffectedby the presence of monoclonal antibodies directed against CD46and CD150, that were previously shown to neutralize MVinfections [44,51] (Figure 1A). SLAM blind virus, which containsmutations in the H protein that prevents CD150 recognition,along with an EGFP reporter gene [52], also infected these cells.Marmoset cell lines do not express the critical SCR1 virus bindingdomain of CD46 [53,54]. Deletion of SCR1 in the marmosetSAEC was confirmed by diagnostic RT-PCR of CD46 mRNAusing conserved primer sequences (Figure 1B). However, marmo-set SAEC were still susceptible to IC323-EGFP wtMV (Figure 1B).The marmoset cells could also be infected with Edmonston-EGFP,SLAM blind and CD46 blind recombinant MV [52] (Figure 1B).These results provide further support for the existence of a uniqueMV epithelial cell receptor.

Author Summary

Measles virus is a primate-specific virus that causes acuterespiratory disease and can also lead to short termimmune suppression resulting in secondary infections bybacteria or parasites. Wild type measles virus attaches toand infects lymphocytes using the receptor CD150(signaling lymphocyte activation molecule, SLAM). Measlesvirus is also known to infect epithelial cells of the upperrespiratory system and lungs. However, the viral receptoron these cells was previously unknown. Adenocarcinomasare derived from glandular epithelial cells of organsincluding the lung, breast, or colon. We showed that wildtype isolates of measles virus can infect human airwayepithelial cells and many adenocarcinoma cell lines. Acomparative analysis of membrane genes expressed incells susceptible and non-susceptible for measles virusinfections revealed candidate receptor proteins. OnlyPVRL4 (Nectin 4) converted cells that were resistant tomeasles viral infections, to cells that could support virusinfections. PVRL4 is a tumor cell marker that is highlyexpressed on embryonic cells such as those of theplacenta, but it is also expressed at lower levels in thetrachea, oral mucosa, nasopharynx, and lungs. It is highlyexpressed on many lung, breast, colon, and ovarian tumorssuggesting that they could be targeted with oncolyticmeasles virus.

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 2 August 2011 | Volume 7 | Issue 8 | e1002240

134

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 3 August 2011 | Volume 7 | Issue 8 | e1002240

135

Table 1. Adenocarcinoma cell lines tested for susceptibility to wt MV-EGFP infection.

Tissue Type Cell Line Tumour Type % Infection

Efficiency

Lung MGH24 adenocarcinoma +++++

NCI-H358 adenocarcinoma +++++

NCI-H125 adenocarcinoma ++++

Calu-3 adenocarcinoma ++++

RVH6847 adenocarcinoma +

A549 adenocarcinoma -

SBC-3 small cell carcinoma -

MGH7 squamous cell carcinoma -

NCI-H157 squamous cell carcinoma -

NCI-H460 large cell carcinoma -

NCI-H661 large cell carcinoma -

NCI-H520 squamous cell carcinoma -

NCI-H226 squamous cell carcinoma -

Breast MCF7 adenocarcinoma +++++

MDA-MB-468 adenocarcinoma +++++

T47D adenocarcinoma ++++

MDA-MB-231 adenocarcinoma -

Colon DLD-1 adenocarcinoma +++++

LoVo adenocarcinoma +++++

T84 adenocarcinoma ++++

HT29 adenocarcinoma ++++

HCT116 adenocarcinoma -

Liver Huh7 adenocarcinoma +

Hep3B adenocarcinoma +

Pancreas HS766T adenocarcinoma -

Cervix HeLa adenocarcinoma -

Kidney MDCK (dog) n.a. +/2

Vero (green monkey) n.a. +/2

HEK 293 (human) n.a. +/2

COS-1 (green monkey) n.a. +/2

OMK (owl monkey) n.a. -

NZP60 (marmoset) n.a. -

BHK21 (hamster) n.a. +/2

Ovary CHO (hamster) n.a. -

See also Figure S1 in Text S1.+++++ 100% cells infected; ++++ 80% cells infected; +++ 60% cells infected; ++ 40% cell infected; + 20% cells infected; +/2 5% cells infected; - 0% cells infected.doi:10.1371/journal.ppat.1002240.t001

Figure 1. A new receptor for MV is present on smooth airway epithelial cells (SAEC). (A) Human SAEC were incubated with receptorneutralizing antibodies against CD46 (M75 and B97) or CD150 (IPO-3 and A12) and challenged with the Edmonston vaccine, CD150 Blind, or IC323wild type strains of MV. Each virus strain contained the EGFP reporter gene. In virus control experiments antibodies against CD46 inhibited infectionby Edmonston MV in HeLa cells while antibodies against CD150 blocked infection of Vero-CD150/SLAM by wild type IC323 MV. (B) Marmoset SAECcontain a deletion of the SCR1 domain of CD46 and do not express CD150/SLAM. The panel on the right shows a diagnostic PCR spanning the SCR1domain revealed by agarose gel electorphoresis in the presence of ethidium bromide, that confirms the deletion in marmoset SAEC. However, themarmoset SAEC could be infected with either the Edmonston or IC323 strains of MV. Virus containing H protein that was mutated in either its CD150binding site (CD150 Blind) or its CD46 binding site (CD46 Blind) also replicated in the marmoset SAEC. Scale bar = 100 mm.doi:10.1371/journal.ppat.1002240.g001

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 4 August 2011 | Volume 7 | Issue 8 | e1002240

136

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 5 August 2011 | Volume 7 | Issue 8 | e1002240

137

Wild type MV infects adenocarcinoma cells derived fromlung, breast, and colon tumors

Since adenocarcinomas are defined as tumors which are derivedfrom glandular epithelial cells, we decided to test the susceptibilityof a number of different tumor cell lines to infection with IC323-EGFP wtMV. Infectivity assays were performed on 12 lung, 4breast, 6 colon, 3 liver, 1 pancreatic, 1 cervix and 5 kidney celllines. The relative infectivity in the different cell lines was assessedqualitatively, as the percentage of fluorescent cells due to virus-mediated EGFP expression (Table 1). Most adenocarcinomas weresusceptible to IC323-EGFP MV infection, and the exceptions wereA549 (lung), MDA-MB-231 (breast), HCT116 (colon), HepG2(liver), HS766T (pancreas), and HeLa (cervix) cells, which werenon-susceptible to the virus (Figure S1 in Text S1). Large cell andsmall cell carcinoma cell lines from the lung also did not supportinfection. To determine whether the non-susceptible property ofnegative cell lines was due to the absence of a particular receptor,non-susceptible cell lines were transfected with a cDNA expressionplasmid for the lymphotropic receptor CD150/SLAM. Expressionof CD150 rendered A549, MDA-MB-231, HeLa, Vero, andOMK cells susceptible to IC323-EGFP wtMV, indicating that thecells were competent for MV replication, but lacked the entryprotein(s) for viral infection (Figure S2 in Text S1).

Microarray analysis reveals that PVRL4 (Nectin 4) is areceptor for wtMV

Microarray analysis and a comparison between susceptible andnon-susceptible cells were previously used to identify the cellularreceptor for Nipah virus [55]. In our case the mRNA transcriptsfrom cells that were susceptible to wtMV infection were comparedto those from non-susceptible cells using the Affymetrix HumanGene ST 1.0 Array. RNA was prepared from breast adenocar-cinoma (MCF7, MDA-MB-468, T47D, MDA-MB-231), lungadenocarinoma (NCI-H358, MGH24, NCI-H125, A549), andSAEC (with and without serum treatment) cell lines. Following theanalysis it was apparent that many of the up-regulated membraneproteins were associated with the tight junctions and adherensjunctions found in polarized epithelial cells (Table S1). Recentlyanother laboratory reported that loss of tight junctions, during anepithelial-mesenchymal cell transition induced by the transcriptionrepressor SNAIL, blocked receptor-dependent infections by wtMV[45]. The percentage up-regulation of gene expression formembrane proteins in susceptible cells compared to non-susceptible cells was calculated for breast, lung, and SAECcategories of cell lines (Table S1). These values were ordered andonly gene products which were up-regulated greater than 20%were considered in our analysis. Evaluation of potential receptorswas conducted in 2 phases. Gene products that were up-regulatedin susceptible breast adenocarcinomas were first compared tothose up-regulated in susceptible lung adenocarcinomas. Toinvestigate whether this subset of candidate receptor genes fromthe initial microarray screens might act as an epithelial receptorfor wtMV, we cloned these genes from a cDNA library ofmembrane proteins from Open Biosystems (Huntsville, AL) or

purchased the genes not represented in this library from OrigeneSystems (Rockville, MD). We chose to introduce the expressionplasmids into COS-1 monkey kidney cells due to their hightransfection efficiency. Expression of the individual candidatereceptor genes was verified by Western immunoblot analysis forthe V5 peptide tag that was fused to the carboxy terminus of eachmembrane protein from the Open Biosystems vectors or the Myc-DDK(Flag) tag from the Origene vectors (Figure 2, Figure S3 inText S1). At 36 hours post-transfection, COS-1 cells wereinoculated with wtMV-EGFP and infections were monitoredbetween 24-72 hours p.i. Over 48 membrane protein genes thatwere the most highly up-regulated in both breast and lungadenocarinoma cells were originally tested without success(indicated with * in Table 2). Subsequently, in the next phase oftesting, the up-regulated genes common to both breast and lungadenocarcinomas were compared to those in serum activatedSAEC cells. The results are presented in Table 2, and 11 commongene products were over-expressed in all 3 tissue types. Thesecandidate receptor genes included SLC6A14, STEAP4,TMPRSS11E, MUC1, ERBB3, PVRL4, MUC15, PCDH1,ANO1, MUC20, and CLDN7. Of these, 10 were tested (indicatedwith ** in Table 2) and it became immediately evident thatPVRL4 could act as a receptor and facilitate infection (Figure 2).(Both PVRL4 (Nectin 4) and the CD150/SLAM positive controlyielded infections that were characterized by syncytia formationwith typical MV cytopathology. A background of single infectedCOS-1 cells which did not fuse and form syncytia was also evident.Infections in these cells did not progress and could be due toanother route of entry such as macropinocytosis. These singleinfected cells were previously reported in MV infected CHO andVero monkey kidney cells and occurred at frequency of 2–3 logsbelow that of SLAM-dependent infections [44]. This backgroundcould not be eliminated with siRNAs directed against PVRL4(data not shown). Expression of exogenous PVRL4 in other non-susceptible cell lines (OMK, HeLa, A549, and MDA-MB-231) alsorendered them susceptible to IC323-EGFP wtMV infection(Figure S2 in Text S1).

Related proteins (PVR, PVRL1, PVRL2, PVRL2) cannotfunction as a receptor for wtMV

PVR, PVRL1, PVRL2, and PVRL3 are nectin proteins that areclosely related in structure and sequence to PVRL4 (Figure S4 inText S1). The proteins PVR, PVRL1, and PVRL2 havepreviously been shown to function as receptors for polio (PVR)and herpes simplex (PVRL1, PVRL2) viruses. We tested theability of PVR, PVRL1, PVRL2, and PVRL3 to function asreceptors for MV following transfection into COS-1 cells.Fluorescence microscopy of non-permeabilized cells that over-expressed PVRL1, PVRL2, PVRL3, and PVRL4 confirmed cellsurface expression of these proteins (data not shown). OnlyPVRL4 was capable of converting the non-susceptible cells to awtMV susceptible phenotype (Figure 3A). Infected cells expressingPVRL4 produced virus particles based upon plaque assays(Figure 3B). Expression of the various nectin proteins was

Figure 2. PVRL4 (Nectin 4) can function as an entry factor for IC323-EGFP wtMV. COS-1 cells were transfected with expression plasmidscontaining the coding sequences for candidate membrane protein receptors. After 36 hrs the cells were infected with IC323-EGFP wtMV. Virusspecific fluorescence was observed between 24–48 hrs infection at 100x magnification using a Leica inverted microscope. Both PVRL4 (Nectin 4) andthe positive control CD150/SLAM were capable of converting the non-susceptible COS-1 cells to a virus susceptible phenotype that producedsyncytia. Other candidate receptor proteins including SLC6A14, STEAP4, TMPRSS11E, MUC1, ERBB3, and MUC20 were ineffective in producinginfections, and yielded only isolated background single-cell infections that did not produce syncytia. Whole cell protein lysates were separated bySDS-PAGE followed by Western Immunoblot using Flag (IB: DDK) and V5 (IB: V5) antibodies to detect expression of these candidate receptors. GAPDHwas used as a loading control. Scale bar = 100 mm. See also Figures S2 and S3 in Text S1.doi:10.1371/journal.ppat.1002240.g002

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 6 August 2011 | Volume 7 | Issue 8 | e1002240

138

Table 2. Gene products up-regulated in susceptible breast, lung, and SAEC cell lines compared to non-susceptible cells.

Common GenesUp-regulated inBreast & Lung Cells

% GeneUp- Regulationin Breast Cells

% GeneUp- Regulationin Lung Cells

Common GenesUp-regulated inBreast, Lung, SAEC

% GeneUp- Regulationin SAEC

SLC6A14* 173.1415 61.90872 SLC6A14** 46.87437

RAB25 * 161.964 188.6348

CDH1* 131.1153 45.16778

GPC4* 103.9329 129.3733

STEAP4* 100.7787 109.9432 STEAP4** 64.64598

TMPRSS11E* 96.91898 118.1558 TMPRSS11E** 46.68319

NCAM2* 94.40557 43.07266

CDH3* 93.77679 123.3686

FXYD3 86.12615 41.92274

MUC1* 75.34311 49.158 MUC1** 32.83022

MME 73.32612 82.94319

ERBB3* 72.10978 45.78744 ERBB3** 23.24152

PCDHB8* 70.45194 89.7596

ST14* 68.33217 106.8741

GABRA3 65.42129 50.05689

PRSS8 58.427 52.65615

PCDHB4* 57.51795 53.33358

SLC16A14* 55.81763 38.13178

ANK3 51.61145 44.22223

PVRL4 50.68993 38.80007 PVRL4** 27.6538

MUC15* 47.35872 60.32913 MUC15** 23.22254

SYK 47.19083 68.0141

SCNN1A* 47.04117 64.89888

PCDH1* 41.70316 41.02153 PCDH1** 22.85412

FAP 40.45849 38.08091

OR8G5 40.37826 51.7274

ANO1 38.69293 45.62884 ANO1 40.30204

MUC20* 37.97506 45.12805 MUC20** 44.45975

PROM2* 37.844 50.14194

SUSD4* 37.46031 27.36689

EPCAM* 37.39759 116.3044

FGFBP1* 36.91295 38.48566

EPHA1* 35.75165 50.02149

EPCAM * 35.06523 95.96663

ENPEP 34.85825 77.82285

IGSF9 34.23295 35.2908

CHRM3 32.84461 47.77368

PCDHB15 30.85493 45.72636

CLDN7* 29.9608 84.29241 CLDN7** 26.90155

RAB19 28.47934 39.00469

DSC2 27.83151 45.32287

MMP16 27.7552 27.27076

PSD4 26.42839 37.93089

MAL2* 25.88348 184.0902

GJB5 25.58353 43.39558

GPR81 25.39142 115.9613

ADAP1 25.17025 43.49649

VEPH1 24.12028 35.18223

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 7 August 2011 | Volume 7 | Issue 8 | e1002240

139

confirmed by SDS PAGE followed by immunoblot analysis usingantibodies directed against the DDK tag (Figure 3C). Cellscontaining PVRL4 but not the other nectins also synthesized MVproteins as shown by an immunoblot for viral matrix (M) protein(Figure 3D).

Susceptible but not non-susceptible cell lines expressPVRL4 (Nectin 4) on their cell surface

Flow cytometry was used to determine whether epithelial oradenocarcinoma cells that are susceptible for wtMV infectionexpressed PVRL4 on their surfaces. Cells susceptible for wtMVinfection bound fluorescent antibodies specific for PVRL4(Figure 4A). Non-susceptible cells, on the other hand, exhibitedno difference in fluorescence when compared to the isotypecontrol antibody (Figure 4B). NCI-H358, NCI-H125, MGH24,and Calu-3 lung adenocarcinoma cells expressed PVRL4 whileA549 adenocarcinoma, squamous cell (NCI-H157), small cell(SBC-3), and large cell (NCI-H460) lung carcinomas did not.MCF7, MDA-MB-468, and T47D breast adenocarcinomas werePVRL4 positive, while the non-susceptible MDA-MB-231 cellswere not. Of the colon tumor cell lines, HT29, T84, and DLD-1cells were positive for PVRL4, while HCT116 cells were negative.Other adenocarcinomas of the liver (HepG2), cervix (HeLa), andkidney epithelial cell lines were negative for PVRL4 on theirsurfaces. Interestingly, SAEC treated with FCS for 24 h exhibitedan increased level of PVRL4 on their surface (SAEC + FCS),whereas the SAEC cultured in the absence of serum did not. Sincewe and others have shown that SAEC grown in the presence ofserum acquire the ability to become infected with wtMV, thesedata suggest that PVRL4 is an authentic epithelial cell receptor forMV. MDCK cells, which were originally derived from dogkidneys, also express PVRL4 on their surface. However, they arenot susceptible to wtMV infections, suggesting that differences inthe protein sequence of canine PVRL4 may reduce its ability toserve as a receptor for wtMV. In all epithelia derived cell lines thatwere tested, the presence of cell surface PVRL4 correlates withtheir ability to be infected with wtMV.

The epithelial cell receptor is expressed on the apical andbasolateral surfaces of polarized adenocarcinoma cells

Many of the epithelial cell lines susceptible to wtMV havepreviously been shown to be polarized. In order to determinewhether the putative epithelial receptor was situated on either theapical or basal surface of the cellular monolayer, cells werecultivated on polyester Transwell filter supports (0.4 mm pore size,24 mm diameter). Cells were ascertained to be polarized bymeasuring their transepitheilal electrical resistance (TEER). Inuninfected cells the TEER maximized at 1200 V-cm2 at 4 daysand remained constant for 10 days from the time of initial culture.Confluent cell monolayers were infected from either the apical orbasolateral side with IC323-EGFP wtMV and visualized by

fluorescence microscopy. The virus preferentially infected bothMCF7 and NCI-H358 cells via the apical route, althoughbasolateral infection was seen at later times post infection(Figure 5A and 5B). To control for the ability of the virus totraverse through the membrane pores, CHO cells stablyexpressing PVRL4 were inoculated with wtMV from either theapical or basolateral side of the transwell filter (Figure 5C). Thesenon-polarized cells express PVRL4 on both their apical andbasolateral surfaces. A lag in MV replication revealed by EGFPexpression was observed in the basolateral infections compared tothe apical infections. These data suggest that the Transwellmembrane may play a role in hindering the ability of MV to infectcells via the basolateral surface. To increase the efficiency ofbasolateral infections, we prolonged viral adsorption times to 4 hrand decreased the stringency of washing non-adsorbed virus fromthe cells, but this had no effect. We concluded that wtMV couldinfect polarized MCF7 and NCI-H358 cells via either the apical orbasolateral route, suggesting that PVRL4 is expressed on both cellsurfaces.

To investigate the expression pattern of PVRL4 on adenocar-cinoma cell lines, susceptible (MCF7 and NCI-H358 cells) andnon-susceptible (MDA-MB-231 and A549) cells were stained withPVRL4 antibodies (Figure 6A and 6B). PVRL4 expression waslocalized to the junctions between cells in susceptible cells only.Upon further examination, PVRL4 appeared to be expressed onboth the apical and basolateral side of MCF7 and NCI-H358 cells(Figure 6C & 6D). Surface biotinylation of MCF7 cells alsoconfirmed that PVRL4 was expressed on both the apical and basalsurfaces (Figure 6D). Membrane proteins were biotinylated oneither the apical or basolateral sides of the cell, precipitated withNeutravidin, resolved by SDS-PAGE, and PVRL4 was detectedon immunoblots with specific antibodies. The data confirmed thatPVRL4 was expressed on both the apical and basolateral surfacesof adenocarcinoma cell, although the band intensities did notappear to be quantitative. Apical labeling of PVRL4 did notappear to be as efficient as that of the basolateral protein. Thismay be due to cell surface factors such as mucous formation orglycocalyx, and this observation will require further investigation.However, the biotin labeling studies do confirm qualitatively thatPVRL4 is situated on both surfaces of the cell.

PVRL4 is also localized to the cellular junctions of normal andcancerous tissues. The protein is abundantly expressed in mostlung adenocarcinomas, some lung squamous carcinomas, an NIC-H358 xenograft from mice, and placenta microvilli. Reactivepneumocytes derived from normal lungs and tonsils exhibitedlower levels of expression (Figure S5 in Text S1). Recent reportsfrom The Human Protein Atlas Project (www.proteinatlas.org)have shown that PVRL4 is expressed abundantly in placentaltrophoblasts, glandular cells of the stomach, and adenocarcinomasof the lung, breast, and ovary. According to this study, moderateamounts of this protein are expressed in the epithelium of tonsils,

Common GenesUp-regulated inBreast & Lung Cells

% GeneUp- Regulationin Breast Cells

% GeneUp- Regulationin Lung Cells

Common GenesUp-regulated inBreast, Lung, SAEC

% GeneUp- Regulationin SAEC

PCDHB13 23.84833 85.86242

See also Table S1.*Primary screening of candidate receptors with cDNA expression vectors following comparison of lung and breast cancer cell lines0.**Secondary screening of candidate receptors with cDNA expression vectors following comparison of lung, breast, and SAEC cell lines.doi:10.1371/journal.ppat.1002240.t002

Table 2. Cont.

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 8 August 2011 | Volume 7 | Issue 8 | e1002240

140

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 9 August 2011 | Volume 7 | Issue 8 | e1002240

141

oral mucosa, esophagus, and the respiratory cells of thenasopharynx. Smaller amounts are expressed in the lungmacrophages and neuronal cells of the cerebral cortex.

siRNA directed against PVRL4 blocks infections by wtMVTo investigate whether PVRL4 was a bona fide receptor for

wtMV, siRNA against PVRL4 was used in the susceptible MCF7and NCI-H358 cell lines. A pool of siRNA specific for PVRL4 or ascrambled siRNA control were transfected into MCF7 or NCI-H358 cells for 72 hrs. FACS analysis demonstrated that PVRL4surface expression was effectively reduced following siRNAknockdown (Figure 7A). The cells were subsequently infectedwith IC323-EGFP wtMV and fluorescence was monitored after afurther 48 hr incubation, at which point virus was harvested.Scrambled siRNA did not inhibit MV infections (Figures 7B, 7C)while PVRL4 siRNA treatment clearly blocked the fluorescenceproduced by MV. Virus released from siRNA-treated MCF7 andNCI-H358 cells was subsequently quantified on Vero/SLAMcells. A decrease in approximately 1–2 logs was consistently seenwhen PVRL4 expression was knocked down prior to MVinfection. The siRNA inhibition experiments conclusively demon-strated that unrestricted PVRL4 surface expression was essentialfor wtMV infection.

Antibodies specific for human PVRL4 inhibit wtMVinfection in MCF7 cells

MCF7 cells grown on glass coverslips were incubated with10 mg/ml non-immune goat IgG (Figure 8A and 8B) or goat anti-PVRL4 (Figure 8C and 8D) for 30 min prior to, and during 1 hradsorption with IC323-EGFP MV via the apical surface.Fluorescence and syncytia formation due to viral infection at48 hrs was inhibited by the PVRL4 antibody treatment. Todetermine whether antibodies directed against PVRL4 alsoblocked infection by the basolateral route, MCF7 cells weregrown on Transwell permeable filter supports as described inFigure 5. Cells were incubated on the apical (Figure 8E, 8F, 8G,and 8H) or basal (Figue 8I, 8J, 8K, and 8L) surfaces withantibodies directed against human PVRL4 or non-immuneantibodies for 30 min and subsequently inoculated with IC323-EGFP MV (m.o.i. 10) for 4 hrs in the presence of antibody.Infections proceeded for 72 hrs and cells were viewed byfluorescence and bright field microscopy. Interaction of goatpolyclonal antibodies with PVRL4 blocked MV infection ofMCF7 cells when applied via either the apical or basal routes. Thisinhibition indicated that MV can infect adenocarcinoma cells in aPVRL4-dependent manner by either the apical or basolateralroute. The antibody inhibition provided further corroboration ofthe preceding RNA interference studies directed against PVRL4.

PVRL4 acts as an attachment receptor for wtMVTo assess the ability of MV to bind PVRL4, CHOpgsA745 cells,

which lack heparan and chondroitin sulfate on their surface, wereengineered to stably express PVRL4 (CHO-PVRL4). Flowcytometry with a monoclonal antibody specific for human PVRL4indicated extensive surface expression of this protein on the CHO-

PVRL4 cells (Figure 9A, inset). CHO and CHO-PVRL4 cellswere incubated with wtMV in the presence of blocking antibodiesto PVRL4 (gPVRL4) or an isotype control (gIgG). Virus bindingwas detected using a monoclonal antibody directed against the Hprotein and an alexa fluor 488-conjugated goat anti-mousesecondary antibody. Interestingly, background wtMV bindingwas consistently ,15–30% in CHO cells irrespective of whetherthe blocking antibody to PVRL4 was present (Figure 4A, CHO;Figure 9B). In CHO-PVRL4 expressing cells, however, there wasa shift in the histogram peak in the gIgG + wtMV treatment,indicating that wtMV had bound to these cells (Figure 9A). Whenblocking antibodies to PVRL4 were present, the MV bindingdecreased to background levels seen in the CHO cells (Figure 9B,compare CHO-huPVRL4 gIgG Ab to gPVRL4 Ab) irrespective ofthe MOI used. These data suggest that PVRL4 is an attachmentreceptor for wtMV. The CHO-PVRL4 cells were subsequentlyinfected with various multiplicities of infection (MOI) of IC323-EGFP wtMV for 48 h (Figure 9C). An increase in the level ofwtMV replication was detected with increasing amounts of MV inthe CHO-PVRL4 cells, but only background infections were seenin the CHO cells lacking PVRL4. These results clearly establishPVRL4 as an attachment receptor for MV.

Mouse PVRL4 functions less efficiently as a receptor forMV than the human homologue

Mouse PVRL4 shares 92% amino acid sequence identity withthe human homologue (Figure S6 in Text S1). Expression vectorscontaining the cDNA sequences for the Myc-DDK tagged versionsof human and mouse PVRL4 were transfected into COS-1 cells.These cells were infected with IC323-EGFP wtMV and viewed byfluorescence microscopy at 48 hrs post-infection (Figure 10A).COS-1 cells expressing mouse PVRL4 were less susceptible toinfection by IC323-EGFP wtMV and produced smaller and fewersyncytia than cells transfected with the human homologue(Figure 10A). Virus released from the infected cells was comparedusing quantitative plaque assays. As expected, COS-1 cellstransfected with mouse PVRL4 produced less MV than cellstransfected with the human PVRL4 homologue (Figure 10B).These results were consistent over the course of 4 separate experi-ments. Expression levels of mouse PVRL4 were compared tohuman PVRL4 by immunoblot analysis with antibodies specificfor the Myc-DDK tags and were found to be similar. Surfaceexpression of mouse and human forms of PVRL4 were alsocomparable (Figure 10C). Finally, MV proteins were synthesizedin the infected cells as shown by a Western immunoblot usingantibodies directed against the matrix (M) protein (Figure 10D).

Other MV strains can also use PVRL4 (Nectin 4) as areceptor

Other strains of MV were tested for their ability to use PVRL4as a cellular receptor. The Edmonston-EGFP vaccine strain(Figure S7A and S7B in Text S1), WTF-EGFP wtMV (Figure S7Cand S7D in Text S1), and Montefiore 89 wtMV (Figure S7E andS7F in Text S1), were inoculated onto cells transfected with thehuman PVRL4 expression vector. In the case of Edmonston-

Figure 3. Nectins closely related to PVRL4 cannot function as receptors for wtMV. COS-1 cells were transfected with expression vectorsencoding DDK-tagged versions of PVR, PVRL1, PVRL2, PVRL3, and PVRL4. Control cells were transfected with empty plasmid. After 36 hrs, thetransfected cells were infected with IC323-EGFP wtMV and incubated a further 48 hrs. (A) Cells were viewed by fluorescence and phase contrastmicroscopy. Scale bar = 200 mm. (B) Virus released from the infected cells was quantified by plaque assay. Data are expressed as the mean of threeindependent experiments, with error bars showing the SEM. (C) Total cell expression of the transfected proteins was evaluated by Westernimmunoblots using antibodies directed against the DDK(Flag). (D) Viral proteins were synthesized in PVRL4 transfected cells following MV infection asshown by Western immunoblot using an antibody specific for the viral matrix (M) protein.doi:10.1371/journal.ppat.1002240.g003

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 10 August 2011 | Volume 7 | Issue 8 | e1002240

142

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 11 August 2011 | Volume 7 | Issue 8 | e1002240

143

EGFP MV, we chose to use owl monkey kidney (OMK) cells,which are known to be deleted for the critical SCR1 domain ofCD46, and are normally resistant to infection by vaccine strains ofMV [53]. The WTF-EGFP wtMV and Montefiore 89 wtMVcannot use CD46 as a receptor, and were inoculated onto HeLaand 293 HEK cells, respectively, that expressed PVRL4. In bothexperiments, expression of PVRL4 converted the non-susceptibleOMK and COS-1 cells to a MV susceptible phenotype. Cellsinfected with Montefiore 89 wtMV were fixed with paraformal-dehyde and incubated with antibodies specific for MV proteins (H,M). Infections were detected by EGFP fluorescence or anti-measles H, M immune fluorescence microscopy (Figure S7 in TextS1).

PVRL4 surface expression is down regulated in MCF7cells following wtMV infection

An important aspect of MV infection is the down regulation ofCD46 and SLAM from the cell surface following MV-Hexpression [56–60] To determine whether PVRL4 expressionwas down regulated in a similar manner, FACS analysis of PVRL4surface expression was performed at 48 h post infection. Alexafluor conjugated 647 secondary antibodies were used to detectSLAM and PVRL4 surface expression (Figure 11). SLAM surfaceexpression on B95a cells was down regulated following infectionwith IC323-EGFP wtMV (Figure 11A) in the presence of thefusion inhibitory peptide, as expected. Similarly, IC323-EGFPwtMV infection caused a decrease in the level of PVRL4 surfaceexpression on MCF7 cells (Figure 11B). The level of MVreplication was assayed by the presence of GFP positive cells(Figure 11, inset). At 48 h post infection more GFP positive cellswere seen in the MV-infected B95a cells compared to the MV-infected MCF7 cells. Taken together, these data suggest that, likeSLAM (CD150), PVRL4 is also down regulated following wtMVinfection.

Discussion

PVRL4 (Nectin 4) was demonstrated to be an epithelial receptorfor MV. This protein is a member of the poliovirus receptor-likeproteins (PVRLs) that are adhesion receptors of the immunoglob-ulin superfamily [61]. It is a 510-amino acid transmembraneprotein with a predicted molecular mass of 55.5 kDa whichmigrates with a mass of 66 kDa on SDS polyacrylamide gels dueto N-glycosylation. PVRL4 is an embryonic protein which hasrecently been shown to be a tumor cell marker for lung, breast,and ovarian adenocarcinomas [62–64]. Like other nectins,PVRL4 is normally localized to the adherins junctions togetherwith the cadherins. PVRL4 interacts with itself and the V domainof PVRL1, but not with other members of the same molecularfamily. Its cytoplasmic tail associates with the intracellular actin-binding protein, afadin [65]. In humans it is expressed abundantlyin the placenta and weakly in the trachea. However, in the adultmouse, PVRL4 transcripts were also found in the brain, lung, andtestis [61]. More recently, The Human Protein Atlas Project(www.proteinatlas.org) has reported that PVRL4 is expressedabundantly in placental trophoblasts, glandular cells of thestomach, and adenocarcinomas of the lung, breast, and ovary.

Moderate amounts of this protein appear to be expressed in theepithelial cells of tonsils, oral mucosa, esophagus, and thecolumnar epithelial cells of the nasopharynx and trachea. Smalleramounts are expressed in the lung macrophages and neuronal cellsof the cerebral cortex.

The nectins can also function as entry receptors for several otherviruses. PVR (CD155) is the prototype member of the family andwas originally shown to be the receptor for poliovirus [66]. PVRL1(Nectin 1) serves as an entry receptor for herpes simplex virus(HSV). It is the major HSV receptor and mediates entry of allHSV-1 and HSV-2 strains as well as animal alphaherpesviruses[48]. PVRL2 (Nectin 2) can also function as an entry factor forsome herpesviruses [67]. Alternatively, HSV can use anotherreceptor of the TNF family called herpes virus entry molecule(HVEM). The fact that HSV-1 and HSV-2 use multiple receptorsfor cell entry appears to enable the virus to enter different celltypes [68]. This also appears to be the case with MV. Theexpression of Nectin 1 on the cell surface of tumors is also apredictor of oncolytic sensitivity to HSV in potential cancertherapy [69]. Tight junction proteins can also serve as receptorsfor some viruses. For example, occludin is a major component oftight junctions that is used by hepatitis C virus [50] and group Bcoxsackievirus as an entry factor [49]. However, occludin shRNAexperiments in MCF7 cells had no effect upon MV infectivity(data not shown).

The actual role of epithelial cells in MV infections has beencontroversial in light of recent experiments with macaques andSLAM transgenic mice. Alveolar macrophages, dendritic cells, andactivated lymphocytes have recently been reported to be primarytargets for IC323-EGFP wtMV and rMVKS-EGFP strains, andthere was only limited infection of epithelial cells in the studieswith macaques over 5 to 9 days infection [32–35]. Althoughlymphocytes and dendritic cells may be the major target andreservoir, virus has also been reported in the squamous stratifiedepithelium of the tongue and buccal mucosa and in the ciliatedepithelium of the trachea at the peak of infection [32]. It has beenproposed that immune cells transmit MV to airway epithelial cellsvia a receptor on their basolateral surface and that these infectedcells release virus from their apical cell surface to further infectionand spread [33,42]. It is possible that infected lymphocytes,expressing H and F proteins on their surface, attach to PVRL4expressing epithelial cells to facilitate cell to cell spread of MV andsyncytia formation late in infection. Again infected epithelial cellsappeared at later times of infection than infected lymphocytes anddendritic cells [70]. When a mutant MV that was blind to theepithelial receptor was used to inoculate macaques, clinicalsymptoms of measles were observed, but no virus was shed intothe airways of these animals [33]. This observation has led theresearchers to conclude that the infection of epithelial cellsoccurred later in the disease, and was important for aerosoltransmission of the virus.

We were initially surprised to observe that wtMV could infectadenocarcinoma cell lines from the apical surface in our Transwellfilter assays. However, this finding may not be unreasonable sincewe were working with cancer cells where PVRL4 is highlyupregulated, and it is expressed on both apical and basolateral cellsurfaces. We have carefully considered the possibility that MV

Figure 4. Flow cytometry analysis reveals PVRL4 (Nectin 4) surface expression on cells susceptible for wild type MV infections. (A)Susceptible cell lines were incubated with a phycoerythrin-conjugated mouse monoclonal antibody that was specific for human PVRL4 (redhistogram) or a PE-conjugated mouse IgG2a control antibody (shaded histogram). Cells were washed and analyzed with a Beckman-Coulter ADPCyan flow cytometer. The Y-axis represents cell counts and the X-axis represents fluorescence intensity. (B) Non-susceptible cell lines were analyzed asdescribed for Panel A.doi:10.1371/journal.ppat.1002240.g004

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 12 August 2011 | Volume 7 | Issue 8 | e1002240

144

Figure 5. MV infects polarized adenocarinoma cells via either the apical or basolateral surfaces. Wild type IC323 MV infects (A) MCF7(breast), (B) NCI-H358 (lung) adenocarcinoma and (C) CHO-PVRL4 cell lines via the apical and basolateral surface in Transwell filter assays. Cells werecultivated in Transwell permeable filter supports at a density of 7.06105 cells per Transwell filter (24 mm diameter) for 4 days (MCF7 & NCI-H358) or 2days (CHO-PVRL4). Cells were then infected from either the apical or basolateral side with IC323-EGFP wtMV. At various times post infectionfluorescent images were captured. Scale bar = 500 mm.doi:10.1371/journal.ppat.1002240.g005

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 13 August 2011 | Volume 7 | Issue 8 | e1002240

145

infection of adenocarcinoma cell lines using PVRL4 may not betotally relevant to understanding viral pathogenesis in the airwaysof the normal host. It has previously been reported that MVpreferentially infects differentiated primary epithelial cells via the

basolateral route, which is consistent with the location of PVRL4at the adherens junctions of normal cells [33,34,40]. Foci ofinfected cells derived from basolateral infections of primaryepithelial cells did not appear to fuse and produce syncytia. This

Figure 6. PVRL4 is localized to both the apical and basolateral surfaces in MCF7 and NCI-H358 cancer cells. (A) Breast (MCF7 and MDA-MB-231) and (B) lung (NCI-H358 and A549) cancer cell lines were grown to confluence on glass coverslips and then fixed with paraformaldehye,permeabilzed, and stained with goat-anti human PVRL4 antibodies (yellow). Nuclei were visualized with TO-PRO-3 nuclear stain (cyan). Images werecaptured on a Zeiss upright confocal microscope and analyzed using Zen 2008 image capture software (Zeiss). Scale bar = 20 mm. (C) Z-sections ofMCF7 and NCI-H358 cells stained with PVRL4 (yellow) and TO-PRO-3 (cyan). PVRL4 is localized to both the apical [A] and basolateral [B] surfaces ofthese cells. White arrowheads indicate the apical expression of PVRL4. (D) Surface biotinylation of MCF7 cells. MCF7 cells were grown for 96 h ontranswell filters (24 mm diameter). The cells were incubated with NHS-biotin from either the apical (lanes A) or basolateral (lanes B) side. After lysis,surface proteins were immunoprecipitated with Neutravidin, and immunocomplexes were subjected to SDS-PAGE and Western blot for PVRL4.Glyceraldehyde 3-phosphate (GAPDH) was used as a loading control.doi:10.1371/journal.ppat.1002240.g006

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 14 August 2011 | Volume 7 | Issue 8 | e1002240

146

Figure 7. siRNA specific for human PVRL4 inhibits wtMV infections. MCF7 and NCI-H358 cells were transfected with a scrambledoligonucleotide control (ctrl siRNA) or a siRNA pool specific for PVRL4 (PVRL4 siRNA). The transfected cells were incubated with IC323-EGFP wtMV andimages were captured 48 hr post infection. (A) PVRL4 surface expression was detected with a phycoerythrin conjugated PVRL4 antibody followinggene knockdown with control siRNA (red line) or PVRL4 siRNA (blue line). (B) PVRL4 siRNA-treated MCF7 and NCI-H358 cells showed less GFPexpression compared to ctrl siRNA-treated cells. (C) PVRL4 knockdown results in a decrease in wtMV titres in MCF7 and NCI-H358 cells. Forty-eighthours post infection, cells were harvested and TCID50 virus titrations were performed on Vero-SLAM cells. Data are the means from three independentexperiments, and error bars represent the SEM. Scale bar = 100 mm.doi:10.1371/journal.ppat.1002240.g007

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 15 August 2011 | Volume 7 | Issue 8 | e1002240

147

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 16 August 2011 | Volume 7 | Issue 8 | e1002240

148

also warrants explanation. In addition, we and others were able toconvert primary human SAEC grown in serum free to a MVsusceptible phenotype by culturing them in 2% fetal calf serum.Flow cytometry indicated that little PVRL4 was produced onSAEC grown in serum free media, but the nectin was inducedfollowing transfer to serum containing media. PVRL4 may beexpressed at higher levels on the apical surface during phases ofrapid growth. In support of this, PVRL4 is highly expressed duringembryogenesis [61]. Upon revisiting the literature, we discoveredthat laboratories looking at basolateral infections of polarizedprimary human epithelial cell monolayers were waiting from 3–7days post infection in order to see infected cell foci, and that apicalinfection of susceptible cancer cell lines was more efficient. Thiswas consistent with our observations in Figures 5 and 8. In ourhands, both MCF7 and NCI-H358 cells produced syncytia wheninfected via the basolateral route, although apical infection wasmuch more efficient. Similar results were reported by Tahara et al.who showed that polarized CaCo2 and HT-29 cells werepreferentially infected via the apical surface [41]. They alsocommented in their results section that the virus infected thebasolateral side of the polarized monolayer much less efficientlythan the apical side. Other investigators also obtained similarresults using a laboratory strain of MV to infect CaCo2 cells [40].However, when they infected primary human airway epithelia viathe basolateral surface, they saw more virus replication comparedto infection of the apical side. Mutations in the putative epithelialreceptor binding region of MV H protein, to produce an epithelialreceptor blind virus, blocked basolateral infection of primary cellsas well as apical infection of lung adenocarcinoma cell lines,indicating that the same receptor is probably used in each case[33,41].

Other laboratories have shown that PVRL4 (Nectin 4) is up-regulated on breast, lung, and ovarian cancer tumors and cell lines[62,63,71]. We extended this observation to colon carcinoma celllines including DLD-1, HT29, and LoVo cells. There are anecdotalreports in the literature where natural MV infections were shown toreverse cases of Burkitt’s lymphoma and Hodgkin’s disease [72–75].Given that these tumors express SLAM/CD150, one can presumethat wtMV infected the tumors and triggered immune attack againstthem. Vaccine strains of MV have previously been engineered torecognize cancer cells by artificially manipulating the H receptorbinding protein [12]. Clinical trials are currently in progress at theMayo Clinic (Rochester, MN) for ovarian cancer, pancreaticcancer, glioblastoma, medulloblastoma, and multiple myeloma[12]. It may be possible that a natural tropism of MV for lung,breast, colon, bladder, and ovarian adenocarcinomas can also beexploited for future oncolytic therapies. The use of SLAM/CD46blind MV that retained the ability to bind PVRL4 could constitute apotential therapeutic vaccine against adenocarcinoma. Safety issues,background infection, and the effect of pre-existing antibodies fromMMR vaccination will obviously have to be addressed beforehuman clinical trials could even be considered.

This study identifies PVRL4 (Nectin 4) as an epithelial receptorfor MV. PVRL4 is expressed at low to moderate levels in normal

tissues but is highly up-regulated on the surfaces of adenocarci-noma cells. The interaction is highly specific, since MV does notrecognize other members of the PVRL family and prefers thehuman receptor over homologues in the mouse. Furtherexperiments with differentiated primary epithelial cells in cultureand the use of human epithelial explants will be required tovalidate the role of PVRL4 in infections of normal epithelial cellsand establish its importance in measles pathogenesis. These studiesare currently underway in our laboratory.

Materials and Methods

AntibodiesM75 and B97 monoclonal antibodies, which neutralize CD46

binding to MV, were obtained from Seikugaku (Tokyo, Japan)and Dr. J. Schneider-Schaullies (Wurzburg, Germany), respec-tively. IPO-3 and A12 monoclonal antibodies, which inhibitCD150 binding to MV, were purchased from AbCam (Cam-bridge, MA). PE-conjugated mouse anti-human CD150/SLAM(clone A12) and PE-conjugated mouse IgG1 kappa isotypecontrol (clone MOPC-21) were from BD Biosciences. Unconju-gated mouse anti-human nectin-4 (MAB2659), PE-conjugatedmouse anti-human nectin-4 monoclonal (FAB2659P), PE-conju-gated mouse IgG2B isotype control (IC0041P), goat polyclonalanti-human PVRL4 (AF2659), and control goat (AB-108-C)antibodies came from R&D Systems (Minneapolis, MN).Monoclonal mouse anti-V5 (Sigma, clone V5-10) was used todetect V5 tagged proteins synthesized from the pcDNA3.2DEST/V5 expression vector. The anti-Flag antibody (Sigma) wasused to detect DYKDDDDK tagged proteins expressed from thepCMV6 entry vector.

Cell culture and virus infectionsHuman primary small airway epithelial cells (SAEC) were

obtained from Lonza Walkersville Inc., (Walkersville, MD).Marmoset SAEC were prepared by the custom service divisionof Lonza Walkersville Inc. Vero, B95a, OMK, HeLa, LoVo,Huh7, HepG2, Hep3B, and CHOpgsA745 cells, were purchasedfrom the American Type Culture Collection (Manassas, VA).NCI-H125, NCI-H157, NCI-H460, SBC-3, NCI-H661, NCI-H520, RVH6847, NCI-226, MGH-7, MGH-24, and NCI-H358cells came from Dr. Ming-Sound Tsao (Ontario Cancer Institute,Toronto, Canada). MDA-MB-468, MDA-MB-231, MCF7,T47D, HT-29, T84, HCT116, HS766T, DLD-1, and MDCKcells were acquired from Drs. David Hoskin and CraigMcCormick (Dalhousie University, Halifax, Canada). The Ed-monston vaccine/laboratory strain of MV was originally obtainedfrom Dr. Erling Norrby (Karolinska Institute, Stockholm,Sweden). The recombinant Ichinoise-B 323 (IC323) wild typeisolate expressing EGFP reporter gene (IC323-EGFP wtMV) anda recombinant Edmonston MV containing a WTF H protein (inplace of the H protein of the vaccine strain), Edmonston-EGFPMV, SLAM blind-EGFP and CD46 blind-EGFP recombinantviruses were obtained from Dr. Roberto Cattaneo [33,52]. The

Figure 8. Antibodies specific for human PVRL4 inhibit wtMV infection in MCF7 cells. MCF7 cells grown on glass coverslips were incubatedwith 10 mg/ml goat IgG (A,B) or goat anti-PVRL4 (C,D) for 30 min prior to, and during 1 hr adsorption with IC323-EGFP MV via the apical surface.Fluorescence and syncytia formation due to viral infection at 48 hrs was inhibited by the PVRL4 antibody treatment. To determine whether PVRL4antibodies would also inhibit MV infections via the basolateral route, MCF7 cells were grown on Transwell permeable filter supports as described inFigure 5. Cells were incubated with 25 mg/ml goat IgG on the apical (E,F,G,H) or basal (I,J,K,L) surface with antibodies specific for human PVRL4 ornon-immune antibodies (IgG) for 30 min. Cells were subsequently inoculated with IC323-EGFP MV (MOI = 10) for 4 hrs, also in the presence ofantibody. Infections were allowed to proceed for 72 hrs and cells were viewed by fluorescence and bright field microscopy. The interaction of goatpolyclonal antibodies with PVRL4 blocked MV infection of MCF7 cells via either the apical or basal routes. Scale bar = 100 mm.doi:10.1371/journal.ppat.1002240.g008

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 17 August 2011 | Volume 7 | Issue 8 | e1002240

149

Figure 9. IC323 wtMV binds to cells that stably express human PVRL4. CHO or CHO stably expressing human PVRL4 (CHO-huPVRL4) wereincubated with either 10 or 25 PFU/cell of IC323-EGFP wtMV in the presence of isotype (gIgG Ab) or blocking antibodies against PVRL4 (gPVRL4 Ab)for 1.5 h. Cells were incubated with a MV anti-H primary antibody followed by an anti-mouse alexa fluor 488 conjugated secondary antibody todetect MV-bound cells. (A) Binding of IC323 wtMV to cells stably expressing PVRL4 was detected by FACS. CHO and CHO-huPVRL4 cells wereinoculated with MV in the presence of blocking antibody against PVRL4 (gPVRL4, red line) or an isotype control (gIgG, blue line), washed, andincubated with anti-MV hemagglutinin antibody or an isotype matched control antibody (green line). Cells incubated in the absence of virus (Mock,filled histogram) were stained with anti-MV hemagglutinin antibody. Bound MV-specific primary antibody was detected with alexa fluor 488-

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 18 August 2011 | Volume 7 | Issue 8 | e1002240

150

Montefiore 89 strain of MV (wild type) was obtained from IlyaSpigland and Amy Fox (Montefiore Medical Center, Bronx, NY).

CD46 diagnostic RT-PCR and agarose gel electrophoresisTotal RNA was extracted from HeLa, marmoset kidney

NZP60, and marmoset SAEC using TRIzol (Invitrogen). Firststrand cDNA was prepared with a SuperScript III kit (Invitrogen).PCR was performed with conserved diagnostic CD46 primersspanning the SCR1 coding region of cDNA from the different celltypes [59oligo: gccgccgcgagtgtccctttccttc; 39oligo: cactttggaactgggg-gatcccaag]. PCR amplification was done using PFUultra II fusionHS polymerase (Stratagene). A 50 ml reaction volume was initiallyheated for 2 min at 95u, processed through 30 cycles of sequentialtemperatures of 95u (30 sec), 58u (30 sec), 72u (30 sec) and finallyincubated for 10 min at 72u, using an Applied BiosystemsGeneamp 9600 PCR machine. Samples were stored at 4u, priorto electrophoresis at 120 V on 0.9% agarose gels containingethidium bromide. The PCR product derived from full lengthhuman CD46 cDNA was 834 bp and that from marmoset CD46cDNA was 645 bp, as predicted from the sequences in the NCBIgenebank (NM_002389.4 and U87917).

Microarray analysisPrimary SAEC (Lonza) were cultured in a 6-well culture plate in

DMEM with and without 2% FCS for 22 hrs. Cell lines weregrown in 75 cm2 T-flasks containing DMEM and 10% FCS.Extraction of total RNA was performed using a Qiagen RNeasyKit (Qiagen). Analysis for mRNA transcripts was performed usingthe Affymetrix Human Gene ST 1.0 Array at The Centre forApplied Genomics located at The Hospital for Sick Children inToronto, Canada. cDNA’s from SAEC, susceptible (MCF7,MDA-MB-468, T-47D, NCI-H125, NCI-H358, and MGH-24)and non-susceptible (A549, MDA-MB-231) cell lines were biotinlabeled, hybridized to the microarray chip, washed, and stainedwith streptavidin-PE. Normalized probe set data was analyzedwith the Affymetrix Expression Console 1.1 software. Microarraydata was deposited in the NCBI GEO database (accession#GSE26636). Further details are provided in SupportingInformation.

Plasmid transfection of candidate epithelial receptorsA human plasma membrane open reading frame gene

collection (HS5016) was obtained from Open Biosystems (Hunts-ville, AL). The genes contained within pDONR223 entry vectorswere introduced into the Gateway pcDNA3.2/V5-Dest mamma-lian expression plasmid through recombination using the LRClonase II system (Invitrogen). These genes contained a V5 tag.Genes which were not contained in the Open BiosystemsMembrane Protein collection were purchased from OrigeneSystems (Rockville, MD) and contained a DDK (Flag) tag.Expression plasmids were introduced into non-susceptible cellsusing Lipofectamine 2000 (Invitrogen) according to the manufac-turer. Empty vector (pcDNA3.2-V5/Dest or pCMV6 DEST) aswell as EGFP and SLAM expressing plasmids were included ascontrols. At 36–48 hrs post transfection, cells were inoculated withIC323-EGFP wtMV in Opti-MEM media (Invitrogen) at an m.o.i.

of 10 for 2 hrs at 37uC. The inoculums were replaced withDulbecco’s minimum essential media containing 2% fetal calfserum. After 48 hrs, infected cells were visualized by phasecontrast and fluorescence microscopy.

To assess protein expression of the candidate receptors, cellmonolayers were lysed in radioimmunoprecipitation (RIPA) buffer(50 mm Tris-HCl, pH 7.4, 1% NP-40, 0.25% sodium deoxycho-late, 150 mM sodium chloride, 1 mM ethylenediaminetetraaceticacid, 1 mM sodium fluoride, 1 mM sodium orthovanadate, 1 mMphenylmethylsulfonyl fluoride, 2 mM dithiothreitol, 1x proteaseinhibitor cocktail [Roche]) for 15 min on ice. The lysate wascentrifuged at 13,000 x g for 15 min at 4uC, and protein quanti-fication was performed with the Bradford assay kit (ThermoScientific). SDS-PAGE and Western immunoblotting was carriedout using antibodies against DDK and V5 to detect expression ofthe candidate membrane receptors.

Flow cytometryCells were grown to confluence in 10 cm2 dishes, washed twice

in cold PBS, and harvested in non-enzymatic cell dissociationbuffer (Sigma). 250,000 cells were blocked with 2.5 mg of normalhuman IgG (R&D Systems) for 10 minutes on ice followed by theaddition of 10 ml of either PE-conjugated PVRL4 (R&D SystemsFAB2659P) or PE-conjugated mouse IgG2B isotype control (R&DSystems IC0041P) antibodies for 45 min on ice. Cells were washedtwice in PBS containing 1% BSA, 5 mM EDTA, and 0.1%sodium azide and then fixed in 1% paraformaldehyde. Sampleswere run on a Cyan ADP Flow Cytometer (Beckman Coulter) anddata were processed using FCS Express (De Novo Software).Unconjugated SLAM and mouse anti-human PVRL4 antibodieswere used in the receptor down regulation experiments. Secondaryantibodies conjugated to Alexa Fluor 647 were used to detectsurface expression of SLAM and PVRL4 using the FL8 channelon the Cyan ADP Flow Cytometer.

Infection of the basolateral and apical epithelial cellsurface with MV

MCF7, NCI-H358, and CHO-PVRL4 cells were seeded ontoTranswell permeable filter supports (Corning Inc., 0.4 mm poresize, 24 mm diameter) at a density of 7.06105 cells per well for 4days (MCF7 & NCI-H358) or 2 days (CHO-PVRL4). Polariza-tion of MCF7 cells was verified by measuring transepithelialelectrical resistance (TEER) with a Millipore-ERS Voltohmmeterequipped with STX electrodes (Millipore, Billerica MA). Animpedence of greater than 500 V-cm2 indicated that a cell linewas polarized. To infect the apical surface, 10 PFU/cell ofIC323-EGFP wtMV was added to the upper chamber of thetranswell filter and allowed to adsorb for 2 h. To infect thebasolateral surface, filter inserts were inverted and the virus wasadsorbed for 2 h. The virus innoculum was subsequentlyremoved from the apical or basolateral surface and themembranes were treated with citrate buffer to inactivate anynon-internalized virus. The transwell filters were then returned totheir normal orientation. Infected cells were viewed by fluores-cence and phase contrast microscopy using a Leica DMI4000Binverted microscope (Leica Microsystems).

conjugated goat anti-mouse secondary antibody. The relative fluorescence intensity was measured on a Cyan ADP Flow Cytometer. Inset: Receptorexpression was detected with a PE-conjugated PVRL4 antibody (red histogram) or isotype control (filled histogram). (B) Quantification of MV bindingto CHO cells expressing huPVRL4 in the presence of blocking antibody to PVRL4 (gPVRL4 Ab). The perecentage of MV-bound cells compared to mockcells was determined using FCS express (De Novo software). Data are expressed as the mean from three independent experiments, with error barsshowing the SEM. (C) Infection of CHO and CHO-huPVRL4 cells with varying multiplicities of infection using IC323-EGFP wtMV. Images were captured48 h post infection. Scale bar = 500 mm.doi:10.1371/journal.ppat.1002240.g009

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 19 August 2011 | Volume 7 | Issue 8 | e1002240

151

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 20 August 2011 | Volume 7 | Issue 8 | e1002240

152

Confocal microscopyCells grown on poly-D-lysine (Sigma) coated coverslips were

fixed in 4% paraformaldehyde (10 min) and permeabilzed with0.1% Triton X-100 in PBS (10 min). PVRL4 was detected byincubating the cells with goat anti-human PVRL4 (R&D SystemsAF2659) at 7.5 mg/ml in PBS containing 5% FCS for 45 min atroom temperature. Cells were subsequently stained with fluor-ophore-conjugated secondary antibodies for 30 min at roomtemperature. Nuclear DNA was stained (20 min) with TO-PRO-3stain (Invitrogen). Cells were mounted with fluorescent mountingmedium and images were acquired with ZEN 2008 imagingsoftware on a Zeiss LSM 510 upright laser scanning confocalmicroscope. Images were captured with a 100x Plan APOC-HRMOAT (1.4NA) objective lens and processed using ZEN 2009light and Adobe Photoshop CS3 using only linear adjustments.

Surface biotinylationLevels of PVRL4 on the cell surface of MCF7 cells were

determined by surface biotinylation. Cells were seeded onto transwellfilters (0.4 mm pore size, 24 mm diameter) at a density of 5.06105

cells per filter. Five days post seeding, cells were washed either theapical or basolateral side of the membrane was incubated for 1 hourwith PBS containing 2 mM S-NHS-biotin (Thermo Scientific) at4uC, while 0.1 M glycine was added to the opposite side of themembrane. After washing with 0.1 M glycine, filter membranes werecut and cells were lysed in RIPA buffer Cell lysates were clarified bycentrifugation at 21 000 x g and biotinyalted surface proteins wereimmunoprecipitated with agarose-conjugated NeutrAvidin (ThermoScientific). Following SDS-PAGE and immunoblotting onto poly-vinylidene fluoride (PVDF) (Millipore), proteins were detected withgoat anti-human PVRL4 antibodies (R&D Systems). Secondaryantibodies were conjugated to horseradish peroxidase and visualizedby chemiluminescence. Thirty micrograms of total whole cell lysatewas run and blotted with anti-human PVRL4 antibodies and anti-GAPDH antibodies to control for protein loading.

siRNA inhibitionsiRNA duplexes against human PVRL4 were purchased from

Dharmacon using a predesigned ON-TARGET plus SMARTpoolsiRNA (L-004301-00-0005). Non-targeting siRNA was used as anegative control (D-001810-10-05). MCF7 and NCI-H358 cellswere plated at 30–40% confluence in 35-mm dishes a day beforesiRNA transfection. One hundred picomoles of siRNA were mixedwith 5 ml of Lipofectamine 2000 (Invitrogen) in 500 ml Opti-MEM(Invitrogen) and added to cells in 500 ml Opti-MEM. Cells weretransfected at 0 hrs and 10 hrs and incubated an additional 16 hrs.At 26 hrs, Opti-MEM was replaced with DMEM containing 5%FCS and cells were allowed to grow for an additional 48 h, and at74 hrs into the experiment, cells were again transfected with siRNAand incubated another 18 hrs. At 92 hrs into the experiment, cellswere inoculated with IC323-EGFP wtMV at an m.o.i of 5 for 2 hrs.Following adsorption of virus, cells were treated with citrate bufferto remove non-internalized virus, washed 3 times with PBS,incubated with DMEM containing 5% FCS at 37uC for an

additional 36 hrs, and viewed by fluorescence and phase contrastmicroscopy and then harvested to determine MV titres.

Virus titrationMV-infected cell monolayers were harvested in media and

subjected to one freeze-thaw cycle to release virus particles.TCID50 titres were determined by 50% end-point titration onVero/hSLAM cells according to the Spearman-Karber method.Plaque assays using SeaPlaque agarose overlays were performed aspreviously described [76].

MV binding assayCHOpgsA745 cells that stably expressed PVRL4 were generated

from the pCMV6 AC-PVRL4 expression vector which contained aneomycinR selection marker. Cells were pre-treated with 15 mg/mlof either blocking PVRL4 antibody (R&D Systems AF2659) or anisotype control antibody (R&D Systems AB-108-C) for 30 minutesat 4uC. To assess the binding capacity of MV to PVRL4, CHO-PVRL4 cells were incubated with either 10 or 25 PFU/cell of MV-IC323 for 90 minutes on ice in the presence of isotype (gIgG) orblocking PVRL4 (gPVRL4) antibodies. Cells were washed threetimes with PBS containing 1% bovine serum albumin, 5 mMEDTA, and 0.1% sodium azide, and incubated with an anti-MVhemagglutinin antibody (Millipore MAB8905) on ice for 60minutes. The cells were washed prior to incubation with an alexafluor 488-conjugated goat anti-mouse antibody for 45 minutes onice. Cells were again washed to remove any unbound antibodies,fixed in 1% paraformaldehyde, and run on a Cyan ADP FlowCytometer (Beckman Coulter). Data were processed using FCSExpress (De Novo Software). To determine the percentage of cellsthat had MV bound to their surface, a marker was drawn on thehistogram so that the percentage of MV-bound cells in the mocksample was 1%. All samples were compared to mock. Data weregraphed using GraphPad 4.0 software.

PVRL4 down regulation following IC323-EGFP wtMVinfection

B95a and MCF7 cells were seeded in 6-well plates at a densityof 1.56106 and 7.06105 cells per well, respectively. Cells wereallowed to grow for 24 h and then infected with IC323-EGFPwtMV at 10 PFU/cell for 1.5 h. The virus innoculum wasreplaced with DMEM containing 5% FCS and 100 mM of thefusion inhibitory peptide, ZDfFG (Sigma C9405) to preventsyncytia formation. Forty-eight hours post infection, cells wereharvested in non-enzymatic cell dissociation buffer (Sigma) andstained for SLAM expression using SLAM antibody (BDBiosciences) or PVRL4 expression as described above. Sampleswere run on a Cyan ADP Flow Cytometer (Beckman Coulter) anddata processed using FCS Express (De Novo Software).

Accession numberMicroarray data was deposited in the NCBI GEO database

(accession #GSE26636).

Figure 10. Mouse PVRL4 functions less efficiently as a MV receptor than the human homologue. COS-1 cells were transfected withexpression vectors encoding DDK-tagged human and mouse homologues of PVRL4. Control cells were transfected with empty plasmid. After 36 hrs,the transfected cells were infected with IC323-EGFP wtMV and incubated a further 48 hrs. (A) Cells were viewed by fluorescence and phase contrastmicroscopy. Scale bar = 200 mm. (B) Virus released from the infected cells was quantified by plaque assay. Data are expressed as the mean from fourindependent experiments, with error bars showing the SEM. (C) Total and cell surface expression was evaluated by Western immunoblots usingantibodies directed against the DDK(Flag) tag or PVRL4. Surface expression was evaluated following biotinylation of plasma membrane proteins. (D)Viral proteins were synthesized in PVRL4 transfect cells following MV infection as shown by Western immunoblot using an antibody specific for theviral matrix (M) protein.doi:10.1371/journal.ppat.1002240.g010

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 21 August 2011 | Volume 7 | Issue 8 | e1002240

153

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 22 August 2011 | Volume 7 | Issue 8 | e1002240

154

Ethics statementThe experiments in this article were performed at Biological

Safety Level 2 in accordance with the regulations set forth byPublic Health Agency of Canada and the Canada Food and DrugInspection Agency. This work did not involve experimentationwith animals or human beings.

Supporting Information

Text S1 Supporting figures, legends, and methods. Figures S1-S7 are presented along with corresponding legends. Supplemen-tary methods that further describe the microarray analysis andimmune histology of human tissue sections using PVRL4antibodies are included.(PDF)

Table S1 Excel file showing normalized probe intensity valuesand % up-regulation of membrane protein expression in breast,lung, and primary SAEC. Related to Table 2 showing data used todetermine common gene products that were .20% up-regulated

in susceptible breast adenocarcinoma, lung adenocarcinoma, andserum activated SAEC.(XLSX)

Acknowledgments

The authors thank D. Hoskin, P. Lee, C. McCormick, and R. Hill for someof the cell lines used in these studies. IC323-EGFP wtMV and WTFH-EGFP MV came from R. Cattaneo and is gratefully acknowledged. Wealso thank E. Cowley for advice and use of the Millipore ERS-EpithelialVoltohmmeter. We appreciate the Halifax Nordic Walkers for theirinterest and encouragement for the work within our laboratory. We arealso grateful to J. Ho at the University Health Network/Princess MargaretHospital in Toronto for performing the immune histological analysis ofPVRL4 in human tissues.

Author Contributions

Conceived and designed the experiments: RSN DGB CDR. Performed theexperiments: RSN DGB GS CDR. Analyzed the data: RSN DGB LTLCDR. Contributed reagents/materials/analysis tools: MNH LTL MST.Wrote the paper: RSN CDR.

References

1. Enders JF, Katz SL, Holloway A (1962) Development of attenuated measles-virus vaccines. A summary of recentinvestigation. Am J Dis Child 103: 335–340.

2. Moss WJ (2009) Measles control and the prospect of eradication. Curr TopMicrobiol Immunol 330: 173–189.

3. Blake FG, Trask JD (1921) Studies on Measles : I. Susceptibility of Monkeys tothe Virus of Measles. J Exp Med 33: 385–412.

4. de Swart RL (2009) Measles studies in the macaque model. Curr Top MicrobiolImmunol 330: 55–72.

5. Kobune F, Takahashi H, Terao K, Ohkawa T, Ami Y, et al. (1996) Nonhumanprimate models of measles. Lab Anim Sci 46: 315–320.

6. McChesney MB, Miller CJ, Rota PA, Zhu YD, Antipa L, et al. (1997)Experimental measles. I. Pathogenesis in the normal and the immunized host.Virology 233: 74–84.

7. Zhu YD, Heath J, Collins J, Greene T, Antipa L, et al. (1997) Experimentalmeasles. II. Infection and immunity in the rhesus macaque. Virology 233:85–92.

8. Burnstein T, Jensen JH, Waksman BH (1964) The Development of aNeurotropic Strain of Measles Virus in Hamsters and Mice. J Infect Dis 114:265–272.

9. Griffin DE, Mullinix J, Narayan O, Johnson RT (1974) Age dependence of viralexpression: comparative pathogenesis of two rodent-adapted strains of measlesvirus in mice. Infect Immun 9: 690–695.

10. Liebert UG, Finke D (1995) Measles virus infections in rodents. Curr TopMicrobiol Immunol 191: 149–166.

11. Blechacz B, Russell SJ (2008) Measles virus as an oncolytic vector platform. CurrGene Ther 8: 162–175.

12. Russell SJ, Peng KW (2009) Measles virus for cancer therapy. Curr TopMicrobiol Immunol 330: 213–241.

13. Griffin DE (2006) Measles Virus. In: Knipe D.M., editor in chief, Fields’Virology. New York: Lippincott, Williams, and Wilkins. pp 1551–1585.

14. Navaratnarajah CK, Leonard VH, Cattaneo R (2009) Measles virusglycoprotein complex assembly, receptor attachment, and cell entry. CurrTop Microbiol Immunol 329: 59–76.

15. Hashiguchi T, Ose T, Kubota M, Maita N, Kamishikiryo J, et al. (2011)Structure of the measles virus hemagglutinin bound to its cellular receptorSLAM. Nat Struct Mol Biol 18: 135–141.

16. Navaratnarajah CK, Oezguen N, Rupp L, Kay L, Leonard VH, et al. (2011)The heads of the measles virus attachment protein move to transmit the fusion-triggering signal. Nat Struct Mol Biol 18: 128–134.

17. Yanagi Y, Takeda M, Ohno S, Hashiguchi T (2009) Measles virus receptors.Curr Top Microbiol Immunol 329: 13–30.

18. Dorig RE, Marcil A, Chopra A, Richardson CD (1993) The human CD46molecule is a receptor for measles virus (Edmonston strain). Cell 75: 295–305.

19. Naniche D, Varior-Krishnan G, Cervoni F, Wild TF, Rossi B, et al. (1993)Human membrane cofactor protein (CD46) acts as a cellular receptor formeasles virus. J Virol 67: 6025–6032.

20. Kemper C, Atkinson JP (2009) Measles virus and CD46. Curr Top MicrobiolImmunol 329: 31–57.

21. Lecouturier V, Fayolle J, Caballero M, Carabana J, Celma ML, et al. (1996)Identification of two amino acids in the hemagglutinin glycoprotein of measlesvirus (MV) that govern hemadsorption, HeLa cell fusion, and CD46downregulation: phenotypic markers that differentiate vaccine and wild-typeMV strains. J Virol 70: 4200–4204.

22. Hsu EC, Sarangi F, Iorio C, Sidhu MS, Udem SA, et al. (1998) A single aminoacid change in the hemagglutinin protein of measles virus determines its abilityto bind CD46 and reveals another receptor on marmoset B cells. J Virol 72:2905–2916.

23. Tahara M, Takeda M, Seki F, Hashiguchi T, Yanagi Y (2007) Multiple aminoacid substitutions in hemagglutinin are necessary for wild-type measles virus toacquire the ability to use receptor CD46 efficiently. J Virol 81: 2564–2572.

24. Kobune F, Sakata H, Sugiura A (1990) Marmoset lymphoblastoid cells as asensitive host for isolation of measles virus. J Virol 64: 700–705.

25. Shibahara K, Hotta H, Katayama Y, Homma M (1994) Increased bindingactivity of measles virus to monkey red blood cells after long-term passage inVero cell cultures. J Gen Virol 75(Pt 12): 3511–3516.

26. Bartz R, Firsching R, Rima B, ter Meulen V, Schneider-Schaulies J (1998)Differential receptor usage by measles virus strains. J Gen Virol 79(Pt 5):1015–1025.

27. Buckland R, Wild TF (1997) Is CD46 the cellular receptor for measles virus?Virus Res 48: 1–9.

28. Tatsuo H, Ono N, Tanaka K, Yanagi Y (2000) SLAM (CDw150) is a cellularreceptor for measles virus. Nature 406: 893–897.

29. Hsu EC, Iorio C, Sarangi F, Khine AA, Richardson CD (2001)CDw150(SLAM) is a receptor for a lymphotropic strain of measles virus andmay account for the immunosuppressive properties of this virus. Virology 279:9–21.

30. Erlenhoefer C, Wurzer WJ, Loffler S, Schneider-Schaulies S, ter Meulen V,et al. (2001) CD150 (SLAM) is a receptor for measles virus but is not involved inviral contact-mediated proliferation inhibition. J Virol 75: 4499–4505.

31. Schwartzberg PL, Mueller KL, Qi H, Cannons JL (2009) SLAM receptors andSAP influence lymphocyte interactions, development and function. Nat RevImmunol 9: 39–46.

32. de Swart RL, Ludlow M, de Witte L, Yanagi Y, van Amerongen G, et al. (2007)Predominant infection of CD150+ lymphocytes and dendritic cells duringmeasles virus infection of macaques. PLoS Pathog 3: e178.

Figure 11. Surface PVRL4 expression is down regulated following wtMV infection. (A) activated marmoset B-cell line B95a or (B) MCF7 cellswere infected with IC323-EGFP wtMV. The fusion inhibitory peptide (FIP) was added after the initial virus infection to prevent syncytia formation. At48 h post-infection SLAM and PVRL4 surface expression was analyzed by FACS. Blue lines, mock-infected cells stained with alexa anti-SLAM antibody(A) or anti-PVRL4 antibody (B); black lines, mock infected cells stained with the anti-mouse IgG2B isotype control antibody; filled orange histogram,cells infected with IC323-EGFP wtMV (MOI = 10) and stained with anti-SLAM (A) or anti-PVRL4 (B) antibodies, respectively. Alexa fluor conjugated 647secondary antibodies were used to detect SLAM and PVRL4 surface expression. Insets, level of eGFP positive cells following a 48 h infection withIC323-EGFP wtMV. The filled green histogram represents wtMV-infected cells; black lines represent mock-infected cells.doi:10.1371/journal.ppat.1002240.g011

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 23 August 2011 | Volume 7 | Issue 8 | e1002240

155

33. Leonard VH, Sinn PL, Hodge G, Miest T, Devaux P, et al. (2008) Measles virusblind to its epithelial cell receptor remains virulent in rhesus monkeys but cannotcross the airway epithelium and is not shed. J Clin Invest 118: 2448–2458.

34. Ludlow M, Rennick LJ, Sarlang S, Skibinski G, McQuaid S, et al. (2010) Wild-type measles virus infection of primary epithelial cells occurs via the basolateralsurface without syncytium formation or release of infectious virus. J Gen Virol91: 971–979.

35. Lemon K, de Vries RD, Mesman AW, McQuaid S, van Amerongen G, et al.(2011) Early target cells of measles virus after aerosol infection of non-humanprimates. PLoS Pathog 7: e1001263.

36. Craighead JE (2000) Pathology and pathogenesis of human viral disease. In:Craighead JE, ed. Rubeola (Measles). Philadelphia: Elsevier Inc. pp 397–410.

37. Sakaguchi M, Yoshikawa Y, Yamanouchi K, Sata T, Nagashima K, et al. (1986)Growth of measles virus in epithelial and lymphoid tissues of cynomolgusmonkeys. Microbiol Immunol 30: 1067–1073.

38. Griffin DE (2001) Measles Virus. In:Knipe D.M., editor in chief Fields’ Virology.New York: Lippincott, Williams, and Wilkins. pp 1401–1442.

39. Takeuchi K, Miyajima N, Nagata N, Takeda M, Tashiro M (2003) Wild-typemeasles virus induces large syncytium formation in primary human small airwayepithelial cells by a SLAM(CD150)-independent mechanism. Virus Res 94:11–16.

40. Sinn PL, Williams G, Vongpunsawad S, Cattaneo R, McCray PB, Jr. (2002)Measles virus preferentially transduces the basolateral surface of well-differentiated human airway epithelia. J Virol 76: 2403–2409.

41. Tahara M, Takeda M, Shirogane Y, Hashiguchi T, Ohno S, et al. (2008)Measles virus infects both polarized epithelial and immune cells by usingdistinctive receptor-binding sites on its hemagglutinin. J Virol 82: 4630–4637.

42. Takeda M (2008) Measles virus breaks through epithelial cell barriers to achievetransmission. J Clin Invest 118: 2386–2389.

43. Maisner A, Klenk H, Herrler G (1998) Polarized budding of measles virus is notdetermined by viral surface glycoproteins. J Virol 72: 5276–5278.

44. Hashimoto K, Ono N, Tatsuo H, Minagawa H, Takeda M, et al. (2002) SLAM(CD150)-independent measles virus entry as revealed by recombinant virusexpressing green fluorescent protein. J Virol 76: 6743–6749.

45. Shirogane Y, Takeda M, Tahara M, Ikegame S, Nakamura T, et al. (2010)Epithelial-mesenchymal transition abolishes the susceptibility of polarizedepithelial cell lines to measles virus. J Biol Chem 285: 20882–20890.

46. Takeda M, Tahara M, Hashiguchi T, Sato TA, Jinnouchi F, et al. (2007) Ahuman lung carcinoma cell line supports efficient measles virus growth andsyncytium formation via a SLAM- and CD46-independent mechanism. J Virol81: 12091–12096.

47. Barton ES, Forrest JC, Connolly JL, Chappell JD, Liu Y, et al. (2001) Junctionadhesion molecule is a receptor for reovirus. Cell 104: 441–451.

48. Geraghty RJ, Krummenacher C, Cohen GH, Eisenberg RJ, Spear PG (1998)Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1and poliovirus receptor. Science 280: 1618–1620.

49. Coyne CB, Shen L, Turner JR, Bergelson JM (2007) Coxsackievirus entry acrossepithelial tight junctions requires occludin and the small GTPases Rab34 andRab5. Cell Host Microbe 2: 181–192.

50. Ploss A, Evans MJ, Gaysinskaya VA, Panis M, You H, et al. (2009) Humanoccludin is a hepatitis C virus entry factor required for infection of mouse cells.Nature 457: 882–886.

51. Hsu EC, Sabatinos S, Hoedemaeker FJ, Rose DR, Richardson CD (1999) Use ofsite-specific mutagenesis and monoclonal antibodies to map regions of CD46that interact with measles virus H protein. Virology 258: 314–326.

52. Vongpunsawad S, Oezgun N, Braun W, Cattaneo R (2004) Selectively receptor-blind measles viruses: Identification of residues necessary for SLAM- or CD46-induced fusion and their localization on a new hemagglutinin structural model.J Virol 78: 302–313.

53. Hsu EC, Dorig RE, Sarangi F, Marcil A, Iorio C, et al. (1997) Artificialmutations and natural variations in the CD46 molecules from human andmonkey cells define regions important for measles virus binding. J Virol 71:6144–6154.

54. Riley RC, Tannenbaum PL, Abbott DH, Atkinson JP (2002) Cutting edge:inhibiting measles virus infection but promoting reproduction: an explanationfor splicing and tissue-specific expression of CD46. J Immunol 169: 5405–5409.

55. Bonaparte MI, Dimitrov AS, Bossart KN, Crameri G, Mungall BA, et al. (2005)Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus. ProcNatl Acad Sci U S A 102: 10652–10657.

56. Naniche D, Wild TF, Rabourdin-Combe C, Gerlier D (1993) Measles virushaemagglutinin induces down-regulation of gp57/67, a molecule involved invirus binding. J Gen Virol 74(Pt 6): 1073–1079.

57. Schneider-Schaulies J, Dunster LM, Kobune F, Rima B, ter Meulen V (1995)Differential downregulation of CD46 by measles virus strains. J Virol 69:7257–7259.

58. Bartz R, Brinckmann U, Dunster LM, Rima B, Ter Meulen V, et al. (1996)Mapping amino acids of the measles virus hemagglutinin responsible forreceptor (CD46) downregulation. Virology 224: 334–337.

59. Tanaka K, Minagawa H, Xie MF, Yanagi Y (2002) The measles virushemagglutinin downregulates the cellular receptor SLAM (CD150). Arch Virol147: 195–203.

60. Welstead GG, Hsu EC, Iorio C, Bolotin S, Richardson CD (2004) Mechanism ofCD150 (SLAM) down regulation from the host cell surface by measles virushemagglutinin protein. J Virol 78: 9666–9674.

61. Reymond N, Fabre S, Lecocq E, Adelaide J, Dubreuil P, et al. (2001) Nectin4/PRR4, a new afadin-associated member of the nectin family that trans-interactswith nectin1/PRR1 through V domain interaction. J Biol Chem 276:43205–43215.

62. Derycke MS, Pambuccian SE, Gilks CB, Kalloger SE, Ghidouche A, et al.(2010) Nectin 4 overexpression in ovarian cancer tissues and serum: potentialrole as a serum biomarker. Am J Clin Pathol 134: 835–845.

63. Takano A, Ishikawa N, Nishino R, Masuda K, Yasui W, et al. (2009)Identification of nectin-4 oncoprotein as a diagnostic and therapeutic target forlung cancer. Cancer Res 69: 6694–6703.

64. Fabre-Lafay S, Garrido-Urbani S, Reymond N, Goncalves A, Dubreuil P, et al.(2005) Nectin-4, a new serological breast cancer marker, is a substrate for tumornecrosis factor-alpha-converting enzyme (TACE)/ADAM-17. J Biol Chem 280:19543–19550.

65. Meng W, Takeichi M (2009) Adherens junction: molecular architecture andregulation. Cold Spring Harb Perspect Biol 1: a002899.

66. Mendelsohn CL, Wimmer E, Racaniello VR (1989) Cellular receptor forpoliovirus: molecular cloning, nucleotide sequence, and expression of a newmember of the immunoglobulin superfamily. Cell 56: 855–865.

67. Lopez M, Cocchi F, Menotti L, Avitabile E, Dubreuil P, et al. (2000)Nectin2alpha (PRR2alpha or HveB) and nectin2delta are low-efficiencymediators for entry of herpes simplex virus mutants carrying the Leu25Prosubstitution in glycoprotein D. J Virol 74: 1267–1274.

68. Taylor JM, Lin E, Susmarski N, Yoon M, Zago A, et al. (2007) Alternative entryreceptors for herpes simplex virus and their roles in disease. Cell Host Microbe2: 19–28.

69. Yu Z, Adusumilli PS, Eisenberg DP, Darr E, Ghossein RA, et al. (2007) Nectin-1expression by squamous cell carcinoma is a predictor of herpes oncolyticsensitivity. Mol Ther 15: 103–113.

70. von Messling V, Milosevic D, Cattaneo R (2004) Tropism illuminated:lymphocyte-based pathways blazed by lethal morbillivirus through the hostimmune system. Proc Natl Acad Sci U S A 101: 14216–14221.

71. Fabre-Lafay S, Monville F, Garrido-Urbani S, Berruyer-Pouyet C, Ginestier C,et al. (2007) Nectin-4 is a new histological and serological tumor associatedmarker for breast cancer. BMC Cancer 7: 73.

72. Bluming AZ, Ziegler JL (1971) Regression of Burkitt’s lymphoma in associationwith measles infection. Lancet 2: 105–106.

73. Mota HC (1973) Infantile Hodgkin’s disease: remission after measles. Br Med J2: 421.

74. Taqi AM, Abdurrahman MB, Yakubu AM, Fleming AF (1981) Regression ofHodgkin’s disease after measles. Lancet 1: 1112.

75. Zygiert Z (1971) Hodgkin’s disease: remissions after measles. Lancet 1: 593.76. Richardson CD, Scheid A, Choppin PW (1980) Specific inhibition of

paramyxovirus and myxovirus replication by oligopeptides with amino acidsequences similar to those at the N-termini of the F1 or HA2 viral polypeptides.Virology 105: 205–222.

PVRL4 (Nectin 4) Is A Receptor for Measles Virus

PLoS Pathogens | www.plospathogens.org 24 August 2011 | Volume 7 | Issue 8 | e1002240

156

Appendix II: Generation of transgenic mouse which constitutively expresses the vaccinia virus E3L protein

Introduction and Rationale

Viruses deploy various means to disrupt the innate immune system. A well-characterized viral

inhibitor of innate immunity is the vaccinia virus E3L protein. E3L mainly acts by inhibiting

PKR activation and sequestering dsRNA to inhibit RIG-I activation (Perdiguero and Esteban,

2009). Recently, a transgenic mouse, which constitutively expresses the E3L protein, was

produced (Domingo-Gil et al., 2008). Sindbis virus replicated better in MEFs derived from this

mouse, and the mice were more susceptible to vaccinia virus and Leishmania major infections.

To study the role of innate immune deficiency on MV in vivo, we attempted to generate a human

SLAM transgenic mouse that constitutively expresses the E3L protein derived from vaccinia

virus.

Materials and Methods

Reagents

Monoclonal anti-vaccinia E3L antibody was a gift from Dr. Stuart Isaacs (University of

Pennsylvania, PA) (Weaver et al., 2007).

E3L transgenic mouse generation

E3L transgenic mice were produced at the OCI mouse facility (Toronto, ON). pCAGGS-E3L

(Western Reserve strain), obtained from Dr. Grant McFadden (University of Florida, FL) was

transfected into embryonic stem cells, and these cells were used to produce the chimeric mouse

in a CD-1 background. Clones were screened by PCR (see below). F0 were backcrossed into

C57BL/6 background (Jackson Labs, Bar Harbor, ME) for 8 generations. Some F6 mice were

157

also crossed into FvB background (Jackson Labs) after breeding difficulties were encountered

(see results). Both E3L (C57BL/6) and E3L (FvB) were crossed with the SLAM transgenic mice.

Mice genotyping polymerase chain reaction

E3L status was checked by using the following primer set: primer 1 (ATGTCTAAAAT-

CTATATCGACGAGC), and primer 2 (GGCATAAAATGTAGGAGAGTTACT).

Homozygosity was checked by test-crossing and screening the progeny. Control PCR for

GAPDH was carried out using the following set of primers: primer 1 (ACCCAGAAGA-

CTGTGGATGG), and primer 2 (CACATTGGGGGTAGGAACAC).

For screening of Insulin 2Akita mutants, genomic PCR was performed with primer 1

(TGCTGATGCCCTGGCCTGCT) and primer 2 (TGGTCCCACATATGCACATG). The

resulting PCR product was digested with Fnu4HI for 3 hrs as described (Wang et al., 1999). The

wild-type gene yields a 140 bp product while the mutant gene gives a 280 bp product.

Northern blot analysis

Organs were harvested from 9 wk old mice. Tissue samples in TRIzol (Invitrogen, Mississauga,

ON) were homogenized using the Polytron Homogenizer. RNA was isolated from the samples

following the manufacturer’s protocol. RNA samples were resolved by electrophoresis on a 1%

formaldehyde agarose gel, transferred by vacuum onto a nylon membrane and cross-linked to the

support using UV. The probe for E3L was made by purifying a restriction fragment derived from

the E3L gene contained in the pCAGGS-E3L plasmid. The fragment was labeled and detected

with the CDP-STAR labeling and alkaline phosphatase detection system (GE Healthcare). The

probe and membrane were hybridized at 37°C over-night. Detection was carried out using the

CDP-STAR detection reagent (GE Healthcare). Data was captured on the Kodak ImageStation

4000MM (Mandel Scientific, Guelph, ON).

Immunoblotting

158

Organs were harvested from 9 wk old mice. Tissue samples in RIPA buffer (50 mM Tris-HCl,

pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1mM EDTA) supplemented

with protease inhibitors (Complete protease inhibitor cocktail (Roche, Mississauga, ON), 1 mM

PMSF, 1 mM sodium orthovanadate, 1 mM NaF) were homogenized using the Polytron

Homogenizer. Protein concentration was quantitated using Bradford assay. 9% sodium dodecyl

sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was run and transferred onto

polyvinylidene fluoride (PVDF) membrane. Membrane was blocked with 5% skim milk in PBS-

Tween (0.5%) for 1 h and probed with appropriate antibody overnight at 4°C. After washing

with PBS-Tween (0.5%), the membrane was probed with horse radish peroxidase-conjugated

anti-rabbit antibody, and developed using the ECL plus reagent (GE Healthcare) on a Kodak

ImageStation 4000MM.

Results

Transgenic mouse expressing vaccinia virus E3L protein constitutively expresses the E3L protein

but fails to thrive

In order to study the effects of inhibiting other innate immune pathways, such as the PKR-

mediated arm, on MV growth, we attempted to generate a transgenic mouse that expresses the

vaccinia virus E3L protein in all tissues. Mice were generated successfully in the CD1

background. In order to breed the mice into the existing SLAM mice, which are in a C57BL/6

background, the E3L transgenic mice were backcrossed into the C57BL/6 line for 8 successive

generations with PCR genotyping performed at each generation to ensure proper gene transfer.

Northern blot was performed to test for E3L mRNA expression in the founder and F1 mice.

mRNA expression was observed in the lung, thymus and liver of the mice tested (Figure IIA).

Organ samples from F5 mice were immunoblotted against the E3L protein, which showed that

E3L was being expressed in the lungs, thymus, liver, spleen and the brain (Figure IIB).

159

Figure II. Transgenic mouse expressing vaccinia virus E3L protein constitutively expresses the E3L protein in all tissues.

Although no unusual breeding problems were encountered until F5, the mice failed to

thrive from F6 generation. The problem was more pronounced in males, which rarely managed

to live past 12 weeks. The cages housing the males emitted a sweet, pungent smell when the

mice were approximately 8 weeks old, and this odour came from the excessive amount of urine

that was produced by the mice. The mice progressively became thinner and weak, rarely

produced offspring when paired, and died prematurely. Testing conducted by the veterinary staff

revealed no infectious agent in the serum, no major pathological abnormalities, but urine which

contained an excessive amount of glucose. Many efforts were made into providing the mice with

160

glucose supplemented or electrolyte-balanced water in order to keep them hydrated, but these

methods failed to alleviate the symptoms.

C57BL/6 strains have been known to produce smaller litters than other strains such as

FvB. We attempted to breed the E3L (C57BL/6) mice into the FvB background to increase the

number of mice that can be generated. Although no abnormalities were encountered until F2

cross into the FvB background, later generation males began to show similar symptoms as the

C57BL/6 mice and died prematurely. Female E3L mice in either C57BL/6 or FvB background

lived longer than the males (~6-8 mo), but many started to show similar symptoms as the males

as they aged.

Research into mice with similar phenotypes yielded the Akita mutation in mice

(Yoshioka et al., 1997). In these mice, symptoms of heterozygotes include hyperglycemia,

hypoinsulinemia, polydipsia, and polyuria, with the males being affected more severely than

females. The spontaneous mutation was found to be a Cys96Tyr mutation in the insulin 2 gene,

and the mouse, whose genotype can be tested via restriction digest of a genomic PCR product, is

being studied as a model for diabetes (Wang et al., 1999). PCR testing revealed that the E3L

mice did not have this specific mutation, although other mutations in this gene cannot be ruled

out (results not shown).

E3L(C57BL/6) and E3L(FvB) were crossed with SLAM mice several times. Each time,

the litters were small, and the males failed to thrive. To date, no homozygous SLAM/E3L mice

have been generated.

Discussion

In our previous work with the MEFs, we found that expression of E3L enhanced MV growth to a

comparable extent as having deficiencies in both IRF3 and IRF9 (Chapter 2). In addition,

inhibition of PKR enhanced MV growth in SLAM/WT MEFs. PKR has also been found to

restrict MV replication in a study which used shRNA-mediated PKR knockdown in HeLa cells

(Toth et al., 2009a). Together, these observations suggest that the presence of E3L, due to its

inhibitory activity on PKR, can enhance MV production. We attempted to study the effect of

161

E3L-mediated innate immune system inhibition in vivo, by creating a transgenic mouse with

constitutive E3L expression. Unfortunately, during the backcross stage to place it in the proper

genetic background, these mice exhibited what seemed to be a sex-linked developmental defect.

The manifested symptoms suggested a defect in glucose metabolism and literature search found

a mouse with a mutation in the Insulin2 gene which was prone to diabetes mellitus (Akita

mouse) (Yoshioka et al., 1997), as having similar phenotype. This mutation is autosomal

dominant, yet affects males more severely than females. Furthermore, the mutation occurred

spontaneously and in the C57BL/6 background. As our mice were initially created in the CD1

background and symptoms began to appear during backcrossing, it is tempting to hypothesize

that a mutation similar to the Akita mouse occurred in our mice during the backcross. However,

our efforts to cross the mice into an alternative FvB background was also unsuccessful, which

suggests that the mutation may not be specific to the C57BL/6 strain. Our efforts to generate

double homozygous SLAM/E3L mice were also unsuccessful due to a very low birth rate. The

successful generation of an E3L transgenic mouse in C57BL/6 background indicates that the

presence of E3L in itself probably did not cause this phenotype (Domingo-Gil et al., 2008).

162

Appendix III: Characterization of the Nipah virus receptor using pseudotype technology

Introduction and Rationale

Nipah virus (NV) is a recently emergent virus that causes respiratory distress and severe febrile

encephalitis. It was responsible for two major outbreaks in Asia with the mortality rate

comparable to that of Ebola virus. The original outbreak originated from bats, spread to pigs, and

jumped to farmers and abattoir workers. The epidemic was eventually controlled after over a

million pigs were culled from the infected regions. NV belongs to the virus family

Paramyxoviridae, which includes other important human and animal pathogens such as the

measles, mumps, and Sendai viruses. NV’s high mortality rate has led to its classification as a

biosafety level 4 agent, preventing the study of this virus in standard level 2 laboratories. A

receptor used by this virus to gain entry into susceptible cells has recently been identified as

EphrinB2 (Negrete et al., 2005). A popular method to study the virus/host receptor interactions

of dangerous or difficult-to-grow viruses is the use of pseudotyped viruses. Pseudotypes are

viruses which mimic the host tropism and the entry properties of another virus that are created as

a result of replacing the viral envelope protein(s), which determine virus tropism, of a well-

characterized virus, such as vesicular stomatitis virus (VSV) or a retrovirus, with those of the

virus being studied. Recently, our lab was successful in generating a functional NV pseudotype

using a reporter VSV. The goal of my project is to utilize this reporter virus in further

characterizing the virus-cell interactions.

Materials and Methods

Production of NV pseudotyped VSV

Figure III.1 illustrates the pseudotype production process. pCAGGS-NVF and pCAGGS-NVG,

two plasmids encoding the envelope proteins of NV, were transfected into CHO cells. 24 h post-

transfection, cells were infected with VSV-G pseudotyped reporter VSV encoding green

163

fluorescent protein (courtesy of M. Whitt). At 72 hours post-infection, cell supernatant was

harvested, passed through a 0.22 µm filter and used in infection studies.

Nested RT-PCR of EphrinB2 (EFNB2)

RNA was extracted from cells using TRIzol reagent (Invitrogen). Reverse transcription (RT)

reaction was performed using First-strand cDNA synthesis kit (Amersham Biosciences). The

resulting cDNA product was used in first round PCR using primers based on published human

and murine EFNB2 sequences. 0.5 µL of the first round reaction was used in the subsequent

nested PCR.

Conclusions

• The production of a NV pseudotype (VSV-NV) was successful and this virus exhibits similar

tropism to that of the wild-type virus (Figure III.3).

• The virus receptor, EphrinB2, was detected by nested RT-PCR in cell lines that have been

shown to be permissive for NV infection (Figure III.4 and Table III.1).

• Screening results from various cell lines strongly correlate the presence of EFNB2 mRNA

with the cells’ permissiveness to infection by VSV-NV (Table III.1).

164

Figure III.1. Production of VSV pseudotyped with NV glycoproteins

165

Figure III.2. Co-expression of NV surface glycoproteins

166

Figure III.3. VSV-NV exhibits similar tropism to wild-type NV

167

Figure III.4. Nested RT-PCR screen for the NV receptor, EFNB2

168

Table III.1. Summary of cell lines screened

169

Figure III.5. Site-directed mutagenesis of EFNB2

170

Figure III.6. Cross-species analysis of EFNB2

171

References

Ablasser, A., Bauernfeind, F., Hartmann, G., Latz, E., Fitzgerald, K.A., Hornung, V., 2009. RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate. Nat Immunol 10, 1065-1072.

Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783-801.

Albrecht, P., Lorenz, D., Klutch, M.J., Vickers, J.H., Ennis, F.A., 1980. Fatal measles infection in marmosets pathogenesis and prophylaxis. Infect Immun 27, 969-978.

Alexopoulou, L., Holt, A.C., Medzhitov, R., Flavell, R.A., 2001. Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature 413, 732-738.

Allen, I.C., Scull, M.A., Moore, C.B., Holl, E.K., McElvania-TeKippe, E., Taxman, D.J., Guthrie, E.H., Pickles, R.J., Ting, J.P., 2009. The NLRP3 inflammasome mediates in vivo innate immunity to influenza A virus through recognition of viral RNA. Immunity 30, 556-565.

Andrejeva, J., Childs, K.S., Young, D.F., Carlos, T.S., Stock, N., Goodbourn, S., Randall, R.E., 2004. The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc Natl Acad Sci U S A 101, 17264-17269.

Andres, O., Obojes, K., Kim, K.S., ter Meulen, V., Schneider-Schaulies, J., 2003. CD46- and CD150-independent endothelial cell infection with wild-type measles viruses. J Gen Virol 84, 1189-1197.

Asano, K., Asano, A., 1985. Why is a specific amino acid sequence of F glycoprotein required for the membrane fusion reaction between envelope of HVJ (Sendai virus) and target cell membranes? Biochem Int 10, 115-122.

Asselin-Paturel, C., Boonstra, A., Dalod, M., Durand, I., Yessaad, N., Dezutter-Dambuyant, C., Vicari, A., O'Garra, A., Biron, C., Briere, F., Trinchieri, G., 2001. Mouse type I IFN-producing cells are immature APCs with plasmacytoid morphology. Nat Immunol 2, 1144-1150.

Asselin-Paturel, C., Brizard, G., Chemin, K., Boonstra, A., O'Garra, A., Vicari, A., Trinchieri, G., 2005. Type I interferon dependence of plasmacytoid dendritic cell activation and migration. J Exp Med 201, 1157-1167.

Asselin-Paturel, C., Brizard, G., Pin, J.J., Briere, F., Trinchieri, G., 2003. Mouse strain differences in plasmacytoid dendritic cell frequency and function revealed by a novel monoclonal antibody. J Immunol 171, 6466-6477.

Avota, E., Gulbins, E., Schneider-Schaulies, S., 2011. DC-SIGN mediated sphingomyelinase-activation and ceramide generation is essential for enhancement of viral uptake in dendritic cells. PLoS Pathog 7, e1001290.

172

Ayata, M., Takeuchi, K., Takeda, M., Ohgimoto, S., Kato, S., Sharma, L.B., Tanaka, M., Kuwamura, M., Ishida, H., Ogura, H., 2010. The f gene of the osaka-2 strain of measles virus derived from a case of subacute sclerosing panencephalitis is a major determinant of neurovirulence. J Virol 84, 11189-11199.

Baker, K.A., Dutch, R.E., Lamb, R.A., Jardetzky, T.S., 1999. Structural basis for paramyxovirus-mediated membrane fusion. Mol Cell 3, 309-319.

Barbalat, R., Ewald, S.E., Mouchess, M.L., Barton, G.M., 2011. Nucleic acid recognition by the innate immune system. Annu Rev Immunol 29, 185-214.

Barber, G.N., 2011. Innate immune DNA sensing pathways: STING, AIMII and the regulation of interferon production and inflammatory responses. Curr Opin Immunol 23, 10-20.

Barchet, W., Cella, M., Colonna, M., 2005. Plasmacytoid dendritic cells--virus experts of innate immunity. Semin Immunol 17, 253-261.

Barclay, A.J., Foster, A., Sommer, A., 1987. Vitamin A supplements and mortality related to measles: a randomised clinical trial. Br Med J (Clin Res Ed) 294, 294-296.

Barnes, B.J., Richards, J., Mancl, M., Hanash, S., Beretta, L., Pitha, P.M., 2004. Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection. J Biol Chem 279, 45194-45207.

Barrett, T., 1999. Morbillivirus infections, with special emphasis on morbilliviruses of carnivores. Vet Microbiol 69, 3-13.

Barry, C., Duncan, R., 2009. Multifaceted sequence-dependent and -independent roles for reovirus FAST protein cytoplasmic tails in fusion pore formation and syncytiogenesis. J Virol 83, 12185-12195.

Bartz, R., Brinckmann, U., Dunster, L.M., Rima, B., Ter Meulen, V., Schneider-Schaulies, J., 1996. Mapping amino acids of the measles virus hemagglutinin responsible for receptor (CD46) downregulation. Virology 224, 334-337.

Beattie, E., Kauffman, E.B., Martinez, H., Perkus, M.E., Jacobs, B.L., Paoletti, E., Tartaglia, J., 1996. Host-range restriction of vaccinia virus E3L-specific deletion mutants. Virus Genes 12, 89-94.

Bente, D.A., Alimonti, J.B., Shieh, W.J., Camus, G., Stroher, U., Zaki, S., Jones, S.M., 2010. Pathogenesis and immune response of Crimean-Congo hemorrhagic fever virus in a STAT-1 knockout mouse model. J Virol 84, 11089-11100.

Berger, S.B., Romero, X., Ma, C., Wang, G., Faubion, W.A., Liao, G., Compeer, E., Keszei, M., Rameh, L., Wang, N., Boes, M., Regueiro, J.R., Reinecker, H.-C., Terhorst, C., 2010. SLAM is a microbial sensor that regulates bacterial phagosome functions in macrophages. Nat Immunol 11, 920-927.

173

Bergmann, M., Garcia-Sastre, A., Carnero, E., Pehamberger, H., Wolff, K., Palese, P., Muster, T., 2000. Influenza virus NS1 protein counteracts PKR-mediated inhibition of replication. J Virol 74, 6203-6206.

Bettencourt, L.M.A., Nishiura, H., Chowell, G., 2007. Comparative estimation of the reproduction number for pandemic influenza from daily case notification data. Journal of The Royal Society Interface 4, 155-166.

Bieback, K., Lien, E., Klagge, I.M., Avota, E., Schneider-Schaulies, J., Duprex, W.P., Wagner, H., Kirschning, C.J., Ter Meulen, V., Schneider-Schaulies, S., 2002. Hemagglutinin protein of wild-type measles virus activates toll-like receptor 2 signaling. J Virol 76, 8729-8736.

Bilimoria, D., 1998. Studies involving measles virus receptor interaction and inhibitors of virus-mediated membrane fusion (A prelude to a small animal model and antiviral agents directed against measles virus), Department of Medical Biophysics. University of Toronto, Toronto, p. 91.

Billeter, M.A., Naim, H.Y., Udem, S.A., 2009. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Curr Top Microbiol Immunol 329, 129-162.

Bjorck, P., 2001. Isolation and characterization of plasmacytoid dendritic cells from Flt3 ligand and granulocyte-macrophage colony-stimulating factor-treated mice. Blood 98, 3520-3526.

Blasius, A.L., Giurisato, E., Cella, M., Schreiber, R.D., Shaw, A.S., Colonna, M., 2006. Bone marrow stromal cell antigen 2 is a specific marker of type I IFN-producing cells in the naive mouse, but a promiscuous cell surface antigen following IFN stimulation. J Immunol 177, 3260-3265.

Blixenkrone-Møller, M., Bernard, A., Bencsik, A., Sixt, N., Diamond, L.E., Logan, J.S., Wild, T.F., 1998. Role of CD46 in measles virus infection in CD46 transgenic mice. Virology 249, 238-248.

Bluming, A.Z., Ziegler, J.L., 1971. Regression of Burkitt's lymphoma in association with measles infection. Lancet 2, 105-106.

Bolt, G., Pedersen, I.R., 1998. The role of subtilisin-like proprotein convertases for cleavage of the measles virus fusion glycoprotein in different cell types. Virology 252, 387-398.

Brandt, T., Heck, M.C., Vijaysri, S., Jentarra, G.M., Cameron, J.M., Jacobs, B.L., 2005. The N-terminal domain of the vaccinia virus E3L-protein is required for neurovirulence, but not induction of a protective immune response. Virology 333, 263-270.

Brandt, T.A., Jacobs, B.L., 2001. Both carboxy- and amino-terminal domains of the vaccinia virus interferon resistance gene, E3L, are required for pathogenesis in a mouse model. J Virol 75, 850-856.

174

Brasel, K., McKenna, H.J., Morrissey, P.J., Charrier, K., Morris, A.E., Lee, C.C., Williams, D.E., Lyman, S.D., 1996. Hematologic effects of flt3 ligand in vivo in mice. Blood 88, 2004-2012.

Brindley, M.A., Plemper, R.K., 2010. Blue native PAGE and biomolecular complementation reveal a tetrameric or higher-order oligomer organization of the physiological measles virus attachment protein H. J Virol 84, 12174-12184.

Broliden, K., Levén, B., Arneborn, M., Böttiger, M., 1998. Immunity to measles before and after MMR booster or primary vaccination at 12 years of age in the first generation offered the 2-dose immunization programme. Scand J Infect Dis 30, 23-27.

Buckland, R., Malvoisin, E., Beauverger, P., Wild, F., 1992. A leucine zipper structure present in the measles virus fusion protein is not required for its tetramerization but is essential for fusion. J Gen Virol 73 ( Pt 7), 1703-1707.

Caignard, G., Bourai, M., Jacob, Y., Infection, M.p.I.M.A.P., Tangy, F., Vidalain, P.O., 2009. Inhibition of IFN-alpha/beta signaling by two discrete peptides within measles virus V protein that specifically bind STAT1 and STAT2. Virology 383, 112-120.

Caignard, G., Guerbois, M., Labernardiere, J.L., Jacob, Y., Jones, L.M., Infectious Mapping Project, I.M., Wild, F., Tangy, F., Vidalain, P.O., 2007. Measles virus V protein blocks Jak1-mediated phosphorylation of STAT1 to escape IFN-alpha/beta signaling. Virology 368, 351-362.

Calpe, S., Wang, N., Romero, X., Berger, S.B., Lanyi, A., Engel, P., Terhorst, C., 2008. The SLAM and SAP gene families control innate and adaptive immune responses. Adv Immunol 97, 177-250.

Canada, P.H.A.o., 2011. Vaccine-Preventable Diseases: Measles.

Cao, W., Liu, Y.J., 2007. Innate immune functions of plasmacytoid dendritic cells. Curr Opin Immunol 19, 24-30.

Casey, J.L., 2006. RNA editing in hepatitis delta virus. Curr Top Microbiol Immunol 307, 67-89.

Cathomen, T., Mrkic, B., Spehner, D., Drillien, R., Naef, R., Pavlovic, J., Aguzzi, A., Billeter, M.A., Cattaneo, R., 1998a. A matrix-less measles virus is infectious and elicits extensive cell fusion: consequences for propagation in the brain. EMBO J 17, 3899-3908.

Cathomen, T., Naim, H.Y., Cattaneo, R., 1998b. Measles viruses with altered envelope protein cytoplasmic tails gain cell fusion competence. J Virol 72, 1224-1234.

Cattaneo, R., Kaelin, K., Baczko, K., Billeter, M.A., 1989. Measles virus editing provides an additional cysteine-rich protein. Cell 56, 759-764.

Cattaneo, R., Rebmann, G., Schmid, A., Baczko, K., ter Meulen, V., Billeter, M.A., 1987. Altered transcription of a defective measles virus genome derived from a diseased human brain. EMBO J 6, 681-688.

175

Cervantes-Barragan, L., Zust, R., Weber, F., Spiegel, M., Lang, K.S., Akira, S., Thiel, V., Ludewig, B., 2007. Control of coronavirus infection through plasmacytoid dendritic-cell-derived type I interferon. Blood 109, 1131-1137.

Chang, H.W., Uribe, L.H., Jacobs, B.L., 1995. Rescue of vaccinia virus lacking the E3L gene by mutants of E3L. J Virol 69, 6605-6608.

Chang, H.W., Watson, J.C., Jacobs, B.L., 1992. The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced, double-stranded RNA-dependent protein kinase. Proc Natl Acad Sci U S A 89, 4825-4829.

Chattopadhyay, S., Marques, J.T., Yamashita, M., Peters, K.L., Smith, K., Desai, A., Williams, B.R., Sen, G.C., 2010. Viral apoptosis is induced by IRF-3-mediated activation of Bax. EMBO J 29, 1762-1773.

Chen, L., Gorman, J.J., McKimm-Breschkin, J., Lawrence, L.J., Tulloch, P.A., Smith, B.J., Colman, P.M., Lawrence, M.C., 2001. The structure of the fusion glycoprotein of Newcastle disease virus suggests a novel paradigm for the molecular mechanism of membrane fusion. Structure 9, 255-266.

Chernomordik, L.V., Zimmerberg, J., Kozlov, M.M., 2006. Membranes of the world unite! J Cell Biol 175, 201-207.

Childs, K., Stock, N., Ross, C., Andrejeva, J., Hilton, L., Skinner, M., Randall, R., Goodbourn, S., 2007. mda-5, but not RIG-I, is a common target for paramyxovirus V proteins. Virology 359, 190-200.

Chiu, Y.H., Macmillan, J.B., Chen, Z.J., 2009. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway. Cell 138, 576-591.

Cisse, B., Caton, M.L., Lehner, M., Maeda, T., Scheu, S., Locksley, R., Holmberg, D., Zweier, C., den Hollander, N.S., Kant, S.G., Holter, W., Rauch, A., Zhuang, Y., Reizis, B., 2008. Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development. Cell 135, 37-48.

Civas, A., Genin, P., Morin, P., Lin, R., Hiscott, J., 2006. Promoter organization of the interferon-A genes differentially affects virus-induced expression and responsiveness to TBK1 and IKKepsilon. J Biol Chem 281, 4856-4866.

Cocks, B.G., Chang, C.C., Carballido, J.M., Yssel, H., de Vries, J.E., Aversa, G., 1995. A novel receptor involved in T-cell activation. Nature 376, 260-263.

Cole, J.L., Housley, G.A., Jr., Dykman, T.R., MacDermott, R.P., Atkinson, J.P., 1985. Identification of an additional class of C3-binding membrane proteins of human peripheral blood leukocytes and cell lines. Proc Natl Acad Sci U S A 82, 859-863.

Colombo, M., Bourhis, J.-M., Chamontin, C., Soriano, C., Villet, S., Costanzo, S., Couturier, M., Belle, V., Fournel, A., Darbon, H., Gerlier, D., Longhi, S., 2009. The interaction between the

176

measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment. Virol J 6, 59.

D'Souza, R.M., D'Souza, R., 2002. Vitamin A for preventing secondary infections in children with measles--a systematic review. J Trop Pediatr 48, 72-77.

Daffis, S., Samuel, M.A., Keller, B.C., Gale, M., Jr., Diamond, M.S., 2007. Cell-specific IRF-3 responses protect against West Nile virus infection by interferon-dependent and -independent mechanisms. PLoS Pathog 3, e106.

Daffis, S., Samuel, M.A., Suthar, M.S., Keller, B.C., Gale, M., Jr., Diamond, M.S., 2008. Interferon regulatory factor IRF-7 induces the antiviral alpha interferon response and protects against lethal West Nile virus infection. J Virol 82, 8465-8475.

Daffis, S., Suthar, M.S., Szretter, K.J., Gale, M., Jr., Diamond, M.S., 2009. Induction of IFN-beta and the innate antiviral response in myeloid cells occurs through an IPS-1-dependent signal that does not require IRF-3 and IRF-7. PLoS Pathog 5, e1000607.

Dalod, M., Salazar-Mather, T.P., Malmgaard, L., Lewis, C., Asselin-Paturel, C., Briere, F., Trinchieri, G., Biron, C.A., 2002. Interferon alpha/beta and interleukin 12 responses to viral infections: pathways regulating dendritic cell cytokine expression in vivo. J Exp Med 195, 517-528.

de Swart, R.L., 2009. Measles studies in the macaque model. Curr Top Microbiol Immunol 330, 55-72.

de Swart, R.L., Ludlow, M., de Witte, L., Yanagi, Y., van Amerongen, G., McQuaid, S., Yuksel, S., Geijtenbeek, T.B., Duprex, W.P., Osterhaus, A.D., 2007. Predominant infection of CD150+ lymphocytes and dendritic cells during measles virus infection of macaques. PLoS Pathog 3, e178.

de Veer, M.J., Holko, M., Frevel, M., Walker, E., Der, S., Paranjape, J.M., Silverman, R.H., Williams, B.R., 2001. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol 69, 912-920.

de Witte, L., Abt, M., Schneider-Schaulies, S., van Kooyk, Y., Geijtenbeek, T.B., 2006. Measles virus targets DC-SIGN to enhance dendritic cell infection. J Virol 80, 3477-3486.

de Witte, L., de Vries, R.D., van der Vlist, M., Yüksel, S., Litjens, M., de Swart, R.L., Geijtenbeek, T.B.H., 2008. DC-SIGN and CD150 have distinct roles in transmission of measles virus from dendritic cells to T-lymphocytes. PLoS Pathog 4, e1000049.

Delaloye, J., Roger, T., Steiner-Tardivel, Q.G., Le Roy, D., Knaup Reymond, M., Akira, S., Petrilli, V., Gomez, C.E., Perdiguero, B., Tschopp, J., Pantaleo, G., Esteban, M., Calandra, T., 2009. Innate immune sensing of modified vaccinia virus Ankara (MVA) is mediated by TLR2-TLR6, MDA-5 and the NALP3 inflammasome. PLoS Pathog 5, e1000480.

177

Demotz, S., Ammerlaan, W., Fournier, P., Muller, C.P., Barbey, C., 1998. Processing of the DRB1*1103-restricted measles virus nucleoprotein determinant 185-199 in the endosomal compartment. Clin Exp Immunol 114, 228-235.

Dentino, A.R., Westerman, P.W., Yeagle, P.L., 1995. A study of carbobenzoxy-D-phenylalanine-L-phenylalanine-glycine, an inhibitor of membrane fusion, in phospholipid bilayers with multinuclear magnetic resonance. Biochim Biophys Acta 1235, 213-220.

Der, S.D., Zhou, A., Williams, B.R., Silverman, R.H., 1998. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci U S A 95, 15623-15628.

Detre, C., Keszei, M., Romero, X., Tsokos, G.C., Terhorst, C., 2010. SLAM family receptors and the SLAM-associated protein (SAP) modulate T cell functions. Semin Immunopathol 32, 157-171.

Devaux, P., Loveland, B., Christiansen, D., Milland, J., Gerlier, D., 1996. Interactions between the ectodomains of haemagglutinin and CD46 as a primary step in measles virus entry. J Gen Virol 77 ( Pt 7), 1477-1481.

Devaux, P., von Messling, V., Songsungthong, W., Springfeld, C., Cattaneo, R., 2007. Tyrosine 110 in the measles virus phosphoprotein is required to block STAT1 phosphorylation. Virology 360, 72-83.

DeWitte-Orr, S.J., Mehta, D.R., Collins, S.E., Suthar, M.S., Gale, M., Mossman, K.L., 2009. Long double-stranded RNA induces an antiviral response independent of IFN regulatory factor 3, IFN-beta promoter stimulator 1, and IFN. J Immunol 183, 6545-6553.

Domingo-Gil, E., Pérez-Jiménez, E., Ventoso, I., Nájera, J.L., Esteban, M., 2008. Expression of the E3L gene of vaccinia virus in transgenic mice decreases host resistance to vaccinia virus and Leishmania major infections. J Virol 82, 254-267.

Donnelly, R.P., Kotenko, S.V., 2010. Interferon-lambda: a new addition to an old family. J Interferon Cytokine Res 30, 555-564.

Dörig, R.E., Marcil, A., Chopra, A., Richardson, C.D., 1993. The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75, 295-305.

Doyle, J., Prussia, A., White, L.K., Sun, A., Liotta, D.C., Snyder, J.P., Compans, R.W., Plemper, R.K., 2006. Two domains that control prefusion stability and transport competence of the measles virus fusion protein. J Virol 80, 1524-1536.

Druelle, J., Sellin, C.I., Waku-Kouomou, D., Horvat, B., Wild, F.T., 2008. Wild type measles virus attenuation independent of type I IFN. Virol J 5, 22.

Dupuis, S., Jouanguy, E., Al-Hajjar, S., Fieschi, C., Al-Mohsen, I.Z., Al-Jumaah, S., Yang, K., Chapgier, A., Eidenschenk, C., Eid, P., Al Ghonaium, A., Tufenkeji, H., Frayha, H., Al-Gazlan, S., Al-Rayes, H., Schreiber, R.D., Gresser, I., Casanova, J.L., 2003. Impaired response to

178

interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat Genet 33, 388-391.

Durbin, J.E., Hackenmiller, R., Simon, M.C., Levy, D.E., 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84, 443-450.

Enders, J.F., Katz, S.L., Holloway, A., 1962. Development of attenuated measles-virus vaccines. A summary of recentinvestigation. Am J Dis Child 103, 335-340.

Enders, J.F., Katz, S.L., Milovanovic, M.V., Holloway, A., 1960. Studies on an attenuated measles-virus vaccine. I. Development and preparations of the vaccine: technics for assay of effects of vaccination. N Engl J Med 263, 153-159.

Enders, J.F., Peebles, T.C., 1954. Propagation in tissue cultures of cytopathogenic agents from patients with measles. Proc Soc Exp Biol Med 86, 277-286.

Epand, R.M., Epand, R.F., Richardson, C.D., Yeagle, P.L., 1993. Structural requirements for the inhibition of membrane fusion by carbobenzoxy-D-Phe-Phe-Gly. Biochim Biophys Acta 1152, 128-134.

Fensterl, V., Sen, G.C., 2011. The ISG56/IFIT1 gene family. J Interferon Cytokine Res 31, 71-78.

Ferreira, C.S., Frenzke, M., Leonard, V.H., Welstead, G.G., Richardson, C.D., Cattaneo, R., 2010. Measles virus infection of alveolar macrophages and dendritic cells precedes spread to lymphatic organs in transgenic mice expressing human signaling lymphocytic activation molecule (SLAM, CD150). J Virol 84, 3033-3042.

Firsching, R., Buchholz, C.J., Schneider, U., Cattaneo, R., ter Meulen, V., Schneider-Schaulies, J., 1999. Measles virus spread by cell-cell contacts: uncoupling of contact-mediated receptor (CD46) downregulation from virus uptake. J Virol 73, 5265-5273.

Fitzgerald-Bocarsly, P., Dai, J., Singh, S., 2008. Plasmacytoid dendritic cells and type I IFN: 50 years of convergent history. Cytokine Growth Factor Rev 19, 3-19.

Fitzgerald-Bocarsly, P., Feng, D., 2007. The role of type I interferon production by dendritic cells in host defense. Biochimie 89, 843-855.

Flahault, A., Vergu, E., Boëlle, P.-Y., 2009. Potential for a global dynamic of Influenza A (H1N1). BMC Infectious Diseases 9, 129.

Fontana, J.M., Bankamp, B., Bellini, W.J., Rota, P.A., 2008. Regulation of interferon signaling by the C and V proteins from attenuated and wild-type strains of measles virus. Virology 374, 71-81.

Foy, E., Li, K., Wang, C., Sumpter, R., Jr., Ikeda, M., Lemon, S.M., Gale, M., Jr., 2003. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 300, 1145-1148.

179

Garcia, M.A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M., 2006. Impact of protein kinase PKR in cell biology: from antiviral to antiproliferative action. Microbiol Mol Biol Rev 70, 1032-1060.

Gelinas, J.F., Clerzius, G., Shaw, E., Gatignol, A., 2011. ADAR1 enhancement of replication of RNA viruses via RNA editing and inhibition of PKR. J Virol.

George, C.X., Das, S., Samuel, C.E., 2008. Organization of the mouse RNA-specific adenosine deaminase Adar1 gene 5'-region and demonstration of STAT1-independent, STAT2-dependent transcriptional activation by interferon. Virology 380, 338-343.

George, C.X., Gan, Z., Liu, Y., Samuel, C.E., 2011. Adenosine deaminases acting on RNA, RNA editing, and interferon action. J Interferon Cytokine Res 31, 99-117.

George, C.X., Samuel, C.E., 1999. Human RNA-specific adenosine deaminase ADAR1 transcripts possess alternative exon 1 structures that initiate from different promoters, one constitutively active and the other interferon inducible. Proc Natl Acad Sci U S A 96, 4621-4626.

Gerlier, D., Valentin, H., 2009. Measles virus interaction with host cells and impact on innate immunity. Curr Top Microbiol Immunol 329, 163-191.

GeurtsvanKessel, C.H., Willart, M.A., van Rijt, L.S., Muskens, F., Kool, M., Baas, C., Thielemans, K., Bennett, C., Clausen, B.E., Hoogsteden, H.C., Osterhaus, A.D., Rimmelzwaan, G.F., Lambrecht, B.N., 2008. Clearance of influenza virus from the lung depends on migratory langerin+CD11b- but not plasmacytoid dendritic cells. J Exp Med 205, 1621-1634.

Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R.A., Diamond, M.S., Colonna, M., 2006. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci U S A 103, 8459-8464.

Godfrey, D.I., Stankovic, S., Baxter, A.G., 2010. Raising the NKT cell family. Nat Immunol 11, 197-206.

Goodbourn, S., Randall, R.E., 2009. The regulation of type I interferon production by paramyxoviruses. J Interferon Cytokine Res 29, 539-547.

Griffin, D.E., 2007. Measles Virus, in: Knipe, D.M.H., Peter M. (Ed.), Field's Virology, 5th Edition ed. Lippincott Williams & Wilkins, pp. 1551-1585.

Griffin, D.E., 2010. Measles virus-induced suppression of immune responses. Immunol Rev 236, 176-189.

Griffin, D.E., Pan, C.H., 2009. Measles: old vaccines, new vaccines. Curr Top Microbiol Immunol 330, 191-212.

Guiducci, C., Ott, G., Chan, J.H., Damon, E., Calacsan, C., Matray, T., Lee, K.D., Coffman, R.L., Barrat, F.J., 2006. Properties regulating the nature of the plasmacytoid dendritic cell response to Toll-like receptor 9 activation. J Exp Med 203, 1999-2008.

180

Guo, J., Hui, D.J., Merrick, W.C., Sen, G.C., 2000. A new pathway of translational regulation mediated by eukaryotic initiation factor 3. EMBO J 19, 6891-6899.

Hahm, B., Arbour, N., Naniche, D., Homann, D., Manchester, M., Oldstone, M.B.A., 2003. Measles virus infects and suppresses proliferation of T lymphocytes from transgenic mice bearing human signaling lymphocytic activation molecule. J Virol 77, 3505-3515.

Hahm, B., Arbour, N., Oldstone, M.B.A., 2004. Measles virus interacts with human SLAM receptor on dendritic cells to cause immunosuppression. Virology 323, 292-302.

Hahm, B., Trifilo, M.J., Zuniga, E.I., Oldstone, M.B., 2005. Viruses evade the immune system through type I interferon-mediated STAT2-dependent, but STAT1-independent, signaling. Immunity 22, 247-257.

Hajar, R., 2005. Al-Razi: Physician for all seasons. Heart Views 6, 39-43.

Harder, T.C., Osterhaus, A.D., 1997. Canine distemper virus--a morbillivirus in search of new hosts? Trends Microbiol 5, 120-124.

Hashiguchi, T., Kajikawa, M., Maita, N., Takeda, M., Kuroki, K., Sasaki, K., Kohda, D., Yanagi, Y., Maenaka, K., 2007. Crystal structure of measles virus hemagglutinin provides insight into effective vaccines. Proc Natl Acad Sci U S A 104, 19535-19540.

Hashiguchi, T., Ose, T., Kubota, M., Maita, N., Kamishikiryo, J., Maenaka, K., Yanagi, Y., 2011. Structure of the measles virus hemagglutinin bound to its cellular receptor SLAM. Nat Struct Mol Biol.

Hashimoto, K., Ono, N., Tatsuo, H., Minagawa, H., Takeda, M., Takeuchi, K., Yanagi, Y., 2002. SLAM (CD150)-independent measles virus entry as revealed by recombinant virus expressing green fluorescent protein. J Virol 76, 6743-6749.

Herschke, F., Plumet, S., Duhen, T., Azocar, O., Druelle, J., Laine, D., Wild, T.F., Rabourdin-Combe, C., Gerlier, D., Valentin, H., 2007. Cell-cell fusion induced by measles virus amplifies the type I interferon response. J Virol 81, 12859-12871.

Hibbert, L., Pflanz, S., De Waal Malefyt, R., Kastelein, R.A., 2003. IL-27 and IFN-alpha signal via Stat1 and Stat3 and induce T-Bet and IL-12Rbeta2 in naive T cells. J Interferon Cytokine Res 23, 513-522.

Hierholzer, J.C., Killington, R.A., 1996. Virus isolation and quantitation, in: Mahy, B.W.J., Kangro, H.O. (Ed.), Virology Methods Manual. Academic Press, London, pp. 25-46.

Hirano, A., Ayata, M., Wang, A.H., Wong, T.C., 1993. Functional analysis of matrix proteins expressed from cloned genes of measles virus variants that cause subacute sclerosing panencephalitis reveals a common defect in nucleocapsid binding. J Virol 67, 1848-1853.

Hiscott, J., 2007. Triggering the innate antiviral response through IRF-3 activation. J Biol Chem 282, 15325-15329.

181

Holm, G.H., Pruijssers, A.J., Li, L., Danthi, P., Sherry, B., Dermody, T.S., 2010. Interferon regulatory factor 3 attenuates reovirus myocarditis and contributes to viral clearance. J Virol 84, 6900-6908.

Honda, K., Yanai, H., Negishi, H., Asagiri, M., Sato, M., Mizutani, T., Shimada, N., Ohba, Y., Takaoka, A., Yoshida, N., Taniguchi, T., 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434, 772-777.

Hornung, V., Schlender, J., Guenthner-Biller, M., Rothenfusser, S., Endres, S., Conzelmann, K.K., Hartmann, G., 2004. Replication-dependent potent IFN-alpha induction in human plasmacytoid dendritic cells by a single-stranded RNA virus. J Immunol 173, 5935-5943.

Horvat, B., Rivailler, P., Varior-Krishnan, G., Cardoso, A., Gerlier, D., Rabourdin-Combe, C., 1996. Transgenic mice expressing human measles virus (MV) receptor CD46 provide cells exhibiting different permissivities to MV infections. J Virol 70, 6673-6681.

Hsu, E.C., Dorig, R.E., Sarangi, F., Marcil, A., Iorio, C., Richardson, C.D., 1997. Artificial mutations and natural variations in the CD46 molecules from human and monkey cells define regions important for measles virus binding. J Virol 71, 6144-6154.

Hsu, E.C., Iorio, C., Sarangi, F., Khine, A.A., Richardson, C.D., 2001. CDw150(SLAM) is a receptor for a lymphotropic strain of measles virus and may account for the immunosuppressive properties of this virus. Virology 279, 9-21.

Hsu, E.C., Sarangi, F., Iorio, C., Sidhu, M.S., Udem, S.A., Dillehay, D.L., Xu, W., Rota, P.A., Bellini, W.J., Richardson, C.D., 1998. A single amino acid change in the hemagglutinin protein of measles virus determines its ability to bind CD46 and reveals another receptor on marmoset B cells. J Virol 72, 2905-2916.

Hu, A., Cathomen, T., Cattaneo, R., Norrby, E., 1995. Influence of N-linked oligosaccharide chains on the processing, cell surface expression and function of the measles virus fusion protein. J Gen Virol 76 ( Pt 3), 705-710.

Huber, M., Cattaneo, R., Spielhofer, P., Orvell, C., Norrby, E., Messerli, M., Perriard, J.C., Billeter, M.A., 1991. Measles virus phosphoprotein retains the nucleocapsid protein in the cytoplasm. Virology 185, 299-308.

Hui, D.J., Terenzi, F., Merrick, W.C., Sen, G.C., 2005. Mouse p56 blocks a distinct function of eukaryotic initiation factor 3 in translation initiation. J Biol Chem 280, 3433-3440.

Ikegame, S., Takeda, M., Ohno, S., Nakatsu, Y., Nakanishi, Y., Yanagi, Y., 2010. Both RIG-I and MDA5 RNA helicases contribute to the induction of alpha/beta interferon in measles virus-infected human cells. J Virol 84, 372-379.

Ingrand, S., Barrier, L., Lafay-Chebassier, C., Fauconneau, B., Page, G., Hugon, J., 2007. The oxindole/imidazole derivative C16 reduces in vivo brain PKR activation. FEBS Lett 581, 4473-4478.

182

Ishii, K.J., Kawagoe, T., Koyama, S., Matsui, K., Kumar, H., Kawai, T., Uematsu, S., Takeuchi, O., Takeshita, F., Coban, C., Akira, S., 2008. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature 451, 725-729.

Ishikawa, H., Ma, Z., Barber, G.N., 2009. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461, 788-792.

Ito, T., Amakawa, R., Inaba, M., Ikehara, S., Inaba, K., Fukuhara, S., 2001. Differential regulation of human blood dendritic cell subsets by IFNs. J Immunol 166, 2961-2969.

Ito, Y., Hosaka, Y., 1983. Component(s) of Sendai virus that can induce interferon in mouse spleen cells. Infect Immun 39, 1019-1023.

Iwata, K., Seya, T., Yanagi, Y., Pesando, J.M., Johnson, P.M., Okabe, M., Ueda, S., Ariga, H., Nagasawa, S., 1995. Diversity of sites for measles virus binding and for inactivation of complement C3b and C4b on membrane cofactor protein CD46. J Biol Chem 270, 15148-15152.

Jammi, N.V., Whitby, L.R., Beal, P.A., 2003. Small molecule inhibitors of the RNA-dependent protein kinase. Biochem Biophys Res Commun 308, 50-57.

Jego, G., Palucka, A.K., Blanck, J.P., Chalouni, C., Pascual, V., Banchereau, J., 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19, 225-234.

Jiang, Z., Zamanian-Daryoush, M., Nie, H., Silva, A.M., Williams, B.R., Li, X., 2003. Poly(I-C)-induced Toll-like receptor 3 (TLR3)-mediated activation of NFkappa B and MAP kinase is through an interleukin-1 receptor-associated kinase (IRAK)-independent pathway employing the signaling components TLR3-TRAF6-TAK1-TAB2-PKR. J Biol Chem 278, 16713-16719.

Kato, H., Takeuchi, O., Mikamo-Satoh, E., Hirai, R., Kawai, T., Matsushita, K., Hiiragi, A., Dermody, T.S., Fujita, T., Akira, S., 2008. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med 205, 1601-1610.

Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis e Sousa, C., Matsuura, Y., Fujita, T., Akira, S., 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441, 101-105.

Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat Immunol 11, 373-384.

Kelsey, D.R., Flanagan, T.D., Young, J., Yeagle, P.L., 1990. Peptide inhibitors of enveloped virus infection inhibit phospholipid vesicle fusion and Sendai virus fusion with phospholipid vesicles. J Biol Chem 265, 12178-12183.

Kelsey, D.R., Flanagan, T.D., Young, J.E., Yeagle, P.L., 1991. Inhibition of Sendai virus fusion with phospholipid vesicles and human erythrocyte membranes by hydrophobic peptides. Virology 182, 690-702.

183

Kemper, C., Atkinson, J.P., 2009. Measles virus and CD46. Curr Top Microbiol Immunol 329, 31-57.

Kimura, T., Kadokawa, Y., Harada, H., Matsumoto, M., Sato, M., Kashiwazaki, Y., Tarutani, M., Tan, R.S., Takasugi, T., Matsuyama, T., Mak, T.W., Noguchi, S., Taniguchi, T., 1996. Essential and non-redundant roles of p48 (ISGF3 gamma) and IRF-1 in both type I and type II interferon responses, as revealed by gene targeting studies. Genes Cells 1, 115-124.

Kingston, D., Schmid, M.A., Onai, N., Obata-Onai, A., Baumjohann, D., Manz, M.G., 2009. The concerted action of GM-CSF and Flt3-ligand on in vivo dendritic cell homeostasis. Blood 114, 835-843.

Klagge, I.M., ter Meulen, V., Schneider-Schaulies, S., 2000. Measles virus-induced promotion of dendritic cell maturation by soluble mediators does not overcome the immunosuppressive activity of viral glycoproteins on the cell surface. Eur J Immunol 30, 2741-2750.

Kochs, G., Haller, O., 1999. Interferon-induced human MxA GTPase blocks nuclear import of Thogoto virus nucleocapsids. Proc Natl Acad Sci U S A 96, 2082-2086.

Koga, R., Ohno, S., Ikegame, S., Yanagi, Y., 2010. Measles Virus-Induced Immunosuppression in SLAM Knock-In Mice. J Virol.

Kolumam, G.A., Thomas, S., Thompson, L.J., Sprent, J., Murali-Krishna, K., 2005. Type I interferons act directly on CD8 T cells to allow clonal expansion and memory formation in response to viral infection. J Exp Med 202, 637-650.

Kraus, T.A., Garza, L., Horvath, C.M., 2008. Enabled interferon signaling evasion in an immune-competent transgenic mouse model of parainfluenza virus 5 infection. Virology 371, 196-205.

Krug, A., French, A.R., Barchet, W., Fischer, J.A., Dzionek, A., Pingel, J.T., Orihuela, M.M., Akira, S., Yokoyama, W.M., Colonna, M., 2004. TLR9-dependent recognition of MCMV by IPC and DC generates coordinated cytokine responses that activate antiviral NK cell function. Immunity 21, 107-119.

Kumagai, Y., Kumar, H., Koyama, S., Kawai, T., Takeuchi, O., Akira, S., 2009. Cutting Edge: TLR-Dependent viral recognition along with type I IFN positive feedback signaling masks the requirement of viral replication for IFN-{alpha} production in plasmacytoid dendritic cells. The Journal of Immunology 182, 3960-3964.

Kurt-Jones, E.A., Popova, L., Kwinn, L., Haynes, L.M., Jones, L.P., Tripp, R.A., Walsh, E.E., Freeman, M.W., Golenbock, D.T., Anderson, L.J., Finberg, R.W., 2000. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 1, 398-401.

Kwon, J.A., Rich, A., 2005. Biological function of the vaccinia virus Z-DNA-binding protein E3L: gene transactivation and antiapoptotic activity in HeLa cells. Proc Natl Acad Sci U S A 102, 12759-12764.

184

Lamb, R.A., Jardetzky, T.S., 2007. Structural basis of viral invasion: lessons from paramyxovirus F. Curr Opin Struct Biol 17, 427-436.

Lamb, R.A., Kolakofsky, D. , 2007. Paramyxoviridae: The Viruses and Their Replication., in: Fields, B.N., Knipe, D.M., Howley, P.M. (Ed.), Fields Virology, 5th Ed. ed. Lippincott-Raven Publishers, Philadelphia, pp. 1451-1496.

Lambert, D.M., Barney, S., Lambert, A.L., Guthrie, K., Medinas, R., Davis, D.E., Bucy, T., Erickson, J., Merutka, G., Petteway, S.R., Jr., 1996. Peptides from conserved regions of paramyxovirus fusion (F) proteins are potent inhibitors of viral fusion. Proc Natl Acad Sci U S A 93, 2186-2191.

Lawrence, D.M., Vaughn, M.M., Belman, A.R., Cole, J.S., Rall, G.F., 1999. Immune response-mediated protection of adult but not neonatal mice from neuron-restricted measles virus infection and central nervous system disease. J Virol 73, 1795-1801.

Le Bon, A., Etchart, N., Rossmann, C., Ashton, M., Hou, S., Gewert, D., Borrow, P., Tough, D.F., 2003. Cross-priming of CD8+ T cells stimulated by virus-induced type I interferon. Nat Immunol 4, 1009-1015.

Le Bon, A., Schiavoni, G., D'Agostino, G., Gresser, I., Belardelli, F., Tough, D.F., 2001. Type i interferons potently enhance humoral immunity and can promote isotype switching by stimulating dendritic cells in vivo. Immunity 14, 461-470.

Le Goffic, R., Balloy, V., Lagranderie, M., Alexopoulou, L., Escriou, N., Flavell, R., Chignard, M., Si-Tahar, M., 2006. Detrimental contribution of the Toll-like receptor (TLR)3 to influenza A virus-induced acute pneumonia. PLoS Pathog 2, e53.

Lecouturier, V., Fayolle, J., Caballero, M., Carabana, J., Celma, M.L., Fernandez-Munoz, R., Wild, T.F., Buckland, R., 1996. Identification of two amino acids in the hemagglutinin glycoprotein of measles virus (MV) that govern hemadsorption, HeLa cell fusion, and CD46 downregulation: phenotypic markers that differentiate vaccine and wild-type MV strains. J Virol 70, 4200-4204.

Lee, H.K., Lund, J.M., Ramanathan, B., Mizushima, N., Iwasaki, A., 2007. Autophagy-dependent viral recognition by plasmacytoid dendritic cells. Science 315, 1398-1401.

Lehmann, C., Lafferty, M., Garzino-Demo, A., Jung, N., Hartmann, P., Fatkenheuer, G., Wolf, J.S., van Lunzen, J., Romerio, F., 2010. Plasmacytoid dendritic cells accumulate and secrete interferon alpha in lymph nodes of HIV-1 patients. PLoS ONE 5, e11110.

Lei, M., Liu, Y., Samuel, C.E., 1998. Adenovirus VAI RNA antagonizes the RNA-editing activity of the ADAR adenosine deaminase. Virology 245, 188-196.

Lemon, K., de Vries, R.D., Mesman, A.W., McQuaid, S., van Amerongen, G., Yuksel, S., Ludlow, M., Rennick, L.J., Kuiken, T., Rima, B.K., Geijtenbeek, T.B., Osterhaus, A.D., Duprex, W.P., de Swart, R.L., 2011. Early target cells of measles virus after aerosol infection of non-human primates. PLoS Pathog 7, e1001263.

185

Lenschow, D.J., Lai, C., Frias-Staheli, N., Giannakopoulos, N.V., Lutz, A., Wolff, T., Osiak, A., Levine, B., Schmidt, R.E., Garcia-Sastre, A., Leib, D.A., Pekosz, A., Knobeloch, K.P., Horak, I., Virgin, H.W.t., 2007. IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proc Natl Acad Sci U S A 104, 1371-1376.

Leonard, V.H., Hodge, G., Reyes-Del Valle, J., McChesney, M.B., Cattaneo, R., 2010. Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol 84, 3413-3420.

Leonard, V.H., Sinn, P.L., Hodge, G., Miest, T., Devaux, P., Oezguen, N., Braun, W., McCray, P.B., Jr., McChesney, M.B., Cattaneo, R., 2008. Measles virus blind to its epithelial cell receptor remains virulent in rhesus monkeys but cannot cross the airway epithelium and is not shed. J Clin Invest 118, 2448-2458.

Li, K., Foy, E., Ferreon, J.C., Nakamura, M., Ferreon, A.C., Ikeda, M., Ray, S.C., Gale, M., Jr., Lemon, S.M., 2005a. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF. Proc Natl Acad Sci U S A 102, 2992-2997.

Li, L., Qi, Y., 2002. A novel amino acid position in hemagglutinin glycoprotein of measles virus is responsible for hemadsorption and CD46 binding. Arch Virol 147, 775-786.

Li, X.D., Sun, L., Seth, R.B., Pineda, G., Chen, Z.J., 2005b. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc Natl Acad Sci U S A 102, 17717-17722.

Li, Y., Li, C., Xue, P., Zhong, B., Mao, A.P., Ran, Y., Chen, H., Wang, Y.Y., Yang, F., Shu, H.B., 2009. ISG56 is a negative-feedback regulator of virus-triggered signaling and cellular antiviral response. Proc Natl Acad Sci U S A 106, 7945-7950.

Lin, L.-T., Noyce, R.S., Pham, T.N.Q., Wilson, J.A., Sisson, G.R., Michalak, T.I., Mossman, K.L., Richardson, C.D., 2010. Replication of subgenomic hepatitis C virus replicons in mouse fibroblasts is facilitated by deletion of interferon regulatory factor 3 and expression of liver-specific microRNA 122. J Virol 84, 9170-9180.

Lin, R., Genin, P., Mamane, Y., Hiscott, J., 2000. Selective DNA binding and association with the CREB binding protein coactivator contribute to differential activation of alpha/beta interferon genes by interferon regulatory factors 3 and 7. Mol Cell Biol 20, 6342-6353.

Lin, W.H., Griffin, D.E., Rota, P.A., Papania, M., Cape, S.P., Bennett, D., Quinn, B., Sievers, R.E., Shermer, C., Powell, K., Adams, R.J., Godin, S., Winston, S., 2011. Successful respiratory immunization with dry powder live-attenuated measles virus vaccine in rhesus macaques. Proc Natl Acad Sci U S A 108, 2987-2992.

Liszewski, M.K., Post, T.W., Atkinson, J.P., 1991. Membrane cofactor protein (MCP or CD46): newest member of the regulators of complement activation gene cluster. Annu Rev Immunol 9, 431-455.

186

Liu, Y., Wolff, K.C., Jacobs, B.L., Samuel, C.E., 2001. Vaccinia virus E3L interferon resistance protein inhibits the interferon-induced adenosine deaminase A-to-I editing activity. Virology 289, 378-387.

Loo, Y.M., Fornek, J., Crochet, N., Bajwa, G., Perwitasari, O., Martinez-Sobrido, L., Akira, S., Gill, M.A., Garcia-Sastre, A., Katze, M.G., Gale, M., Jr., 2008. Distinct RIG-I and MDA5 signaling by RNA viruses in innate immunity. J Virol 82, 335-345.

Ludlow, M., Rennick, L.J., Sarlang, S., Skibinski, G., McQuaid, S., Moore, T., de Swart, R.L., Duprex, W.P., 2010. Wild-type measles virus infection of primary epithelial cells occurs via the basolateral surface without syncytium formation or release of infectious virus. J Gen Virol 91, 971-979.

Lund, J., Sato, A., Akira, S., Medzhitov, R., Iwasaki, A., 2003. Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. J Exp Med 198, 513-520.

Mach, N., Gillessen, S., Wilson, S.B., Sheehan, C., Mihm, M., Dranoff, G., 2000. Differences in dendritic cells stimulated in vivo by tumors engineered to secrete granulocyte-macrophage colony-stimulating factor or Flt3-ligand. Cancer Res 60, 3239-3246.

Makhortova, N.R., Askovich, P., Patterson, C.E., Gechman, L.A., Gerard, N.P., Rall, G.F., 2007. Neurokinin-1 enables measles virus trans-synaptic spread in neurons. Virology 362, 235-244.

Malathi, K., Dong, B., Gale, M., Jr., Silverman, R.H., 2007. Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 448, 816-819.

Manchester, M., Valsamakis, A., Kaufman, R., Liszewski, M.K., Alvarez, J., Atkinson, J.P., Lublin, D.M., Oldstone, M.B., 1995. Measles virus and C3 binding sites are distinct on membrane cofactor protein (CD46). Proc Natl Acad Sci U S A 92, 2303-2307.

Maraskovsky, E., Brasel, K., Teepe, M., Roux, E.R., Lyman, S.D., Shortman, K., McKenna, H.J., 1996. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med 184, 1953-1962.

Marcus, P.I., Rojek, J.M., Sekellick, M.J., 2005. Interferon induction and/or production and its suppression by influenza A viruses. J Virol 79, 2880-2890.

Mariathasan, S., Monack, D.M., 2007. Inflammasome adaptors and sensors: intracellular regulators of infection and inflammation. Nat Rev Immunol 7, 31-40.

Masse, N., Ainouze, M., Neel, B., Wild, T.F., Buckland, R., Langedijk, J.P., 2004. Measles virus (MV) hemagglutinin: evidence that attachment sites for MV receptors SLAM and CD46 overlap on the globular head. J Virol 78, 9051-9063.

Masse, N., Barrett, T., Muller, C.P., Wild, T.F., Buckland, R., 2002. Identification of a second major site for CD46 binding in the hemagglutinin protein from a laboratory strain of measles virus (MV): potential consequences for wild-type MV infection. J Virol 76, 13034-13038.

187

Mavaddat, N., Mason, D.W., Atkinson, P.D., Evans, E.J., Gilbert, R.J., Stuart, D.I., Fennelly, J.A., Barclay, A.N., Davis, S.J., Brown, M.H., 2000. Signaling lymphocytic activation molecule (CDw150) is homophilic but self-associates with very low affinity. J Biol Chem 275, 28100-28109.

McAllister, C.S., Samuel, C.E., 2009. The RNA-activated protein kinase enhances the induction of interferon-beta and apoptosis mediated by cytoplasmic RNA sensors. J Biol Chem 284, 1644-1651.

McCartney, S.A., Thackray, L.B., Gitlin, L., Gilfillan, S., Virgin, H.W., Colonna, M., 2008. MDA-5 recognition of a murine norovirus. PLoS Pathog 4, e1000108.

McKenna, H.J., 2001. Role of hematopoietic growth factors/flt3 ligand in expansion and regulation of dendritic cells. Curr Opin Hematol 8, 149-154.

Meraz, M.A., White, J.M., Sheehan, K.C., Bach, E.A., Rodig, S.J., Dighe, A.S., Kaplan, D.H., Riley, J.K., Greenlund, A.C., Campbell, D., Carver-Moore, K., DuBois, R.N., Clark, R., Aguet, M., Schreiber, R.D., 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84, 431-442.

Miller, F.A., Dixon, G.J., Arnett, G., Dice, J.R., Rightsel, W.A., Schabel, F.M., Jr., McLean, I.W., Jr., 1968. Antiviral activity of carbobenzosy di- and tripeptides on measles virus. Appl Microbiol 16, 1489-1496.

Mohty, M., Vialle-Castellano, A., Nunes, J.A., Isnardon, D., Olive, D., Gaugler, B., 2003. IFN-alpha skews monocyte differentiation into Toll-like receptor 7-expressing dendritic cells with potent functional activities. J Immunol 171, 3385-3393.

Mordstein, M., Michiels, T., Staeheli, P., 2010. What have we learned from the IL28 receptor knockout mouse? J Interferon Cytokine Res 30, 579-584.

Morrison, T.G., 2003. Structure and function of a paramyxovirus fusion protein. Biochim Biophys Acta 1614, 73-84.

Moss, W.J., 2009. Measles control and the prospect of eradication. Curr Top Microbiol Immunol 330, 173-189.

Moss, W.J., Griffin, D.E., 2006. Global measles elimination. Nat Rev Microbiol 4, 900-908.

Mrkic, B., Odermatt, B., Klein, M.A., Billeter, M.A., Pavlovic, J., Cattaneo, R., 2000. Lymphatic dissemination and comparative pathology of recombinant measles viruses in genetically modified mice. J Virol 74, 1364-1372.

Mrkic, B., Pavlovic, J., Rülicke, T., Volpe, P., Buchholz, C.J., Hourcade, D., Atkinson, J.P., Aguzzi, A., Cattaneo, R., 1998. Measles virus spread and pathogenesis in genetically modified mice. J Virol 72, 7420-7427.

188

Muller, U., Steinhoff, U., Reis, L.F., Hemmi, S., Pavlovic, J., Zinkernagel, R.M., Aguet, M., 1994. Functional role of type I and type II interferons in antiviral defense. Science 264, 1918-1921.

Muruve, D.A., Petrilli, V., Zaiss, A.K., White, L.R., Clark, S.A., Ross, P.J., Parks, R.J., Tschopp, J., 2008. The inflammasome recognizes cytosolic microbial and host DNA and triggers an innate immune response. Nature 452, 103-107.

Myskiw, C., Arsenio, J., van Bruggen, R., Deschambault, Y., Cao, J., 2009. Vaccinia virus E3 suppresses expression of diverse cytokines through inhibition of the PKR, NF-kappaB, and IRF3 pathways. J Virol 83, 6757-6768.

Naik, S.H., Sathe, P., Park, H.Y., Metcalf, D., Proietto, A.I., Dakic, A., Carotta, S., O'Keeffe, M., Bahlo, M., Papenfuss, A., Kwak, J.Y., Wu, L., Shortman, K., 2007. Development of plasmacytoid and conventional dendritic cell subtypes from single precursor cells derived in vitro and in vivo. Nat Immunol 8, 1217-1226.

Naim, H.Y., Ehler, E., Billeter, M.A., 2000. Measles virus matrix protein specifies apical virus release and glycoprotein sorting in epithelial cells. EMBO J 19, 3576-3585.

Nakatsu, Y., Takeda, M., Ohno, S., Koga, R., Yanagi, Y., 2006. Translational inhibition and increased interferon induction in cells infected with C protein-deficient measles virus. J Virol 80, 11861-11867.

Nakatsu, Y., Takeda, M., Ohno, S., Shirogane, Y., Iwasaki, M., Yanagi, Y., 2008. Measles virus circumvents the host interferon response by different actions of the C and V proteins. J Virol 82, 8296-8306.

Naniche, D., Varior-Krishnan, G., Cervoni, F., Wild, T.F., Rossi, B., Rabourdin-Combe, C., Gerlier, D., 1993. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J Virol 67, 6025-6032.

Navaratnarajah, C.K., Leonard, V.H.J., Cattaneo, R., 2009. Measles virus glycoprotein complex assembly, receptor attachment, and cell entry. Curr Top Microbiol Immunol 329, 59-76.

Navaratnarajah, C.K., Oezguen, N., Rupp, L., Kay, L., Leonard, V.H., Braun, W., Cattaneo, R., 2011. The heads of the measles virus attachment protein move to transmit the fusion-triggering signal. Nat Struct Mol Biol 18, 128-134.

Navaratnarajah, C.K., Vongpunsawad, S., Oezguen, N., Stehle, T., Braun, W., Hashiguchi, T., Maenaka, K., Yanagi, Y., Cattaneo, R., 2008. Dynamic interaction of the measles virus hemagglutinin with its receptor signaling lymphocytic activation molecule (SLAM, CD150). J Biol Chem 283, 11763-11771.

Neerincx, A., Lautz, K., Menning, M., Kremmer, E., Zigrino, P., Hosel, M., Buning, H., Schwarzenbacher, R., Kufer, T.A., 2010. A role for the human nucleotide-binding domain, leucine-rich repeat-containing family member NLRC5 in antiviral responses. J Biol Chem 285, 26223-26232.

189

Negrete, O.A., Levroney, E.L., Aguilar, H.C., Bertolotti-Ciarlet, A., Nazarian, R., Tajyar, S., Lee, B., 2005. EphrinB2 is the entry receptor for Nipah virus, an emergent deadly paramyxovirus. Nature 436, 401-405.

Nicolaides, E., DeWald, H., Lipnik, M., Westland, R., Posler, J., 1968. Potential antiviral agents. Carbobenzoxy di- and tripeptides active against measles and herpes viruses. J Med Chem 11, 74-79.

Niewiesk, S., 2009. Current animal models: cotton rat animal model. Curr Top Microbiol Immunol 330, 89-110.

Niwa, H., Yamamura, K., Miyazaki, J., 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193-199.

Noyce, R.S., Bondre, D.G., Ha, M.N., Lin, L.T., Sisson, G., Tsao, M.S., Richardson, C.D., 2011. Tumor cell marker PVRL4 (nectin 4) is an epithelial cell receptor for measles virus. PLoS Pathog 7, e1002240.

Noyce, R.S., Collins, S.E., Mossman, K.L., 2009. Differential modification of interferon regulatory factor 3 following virus particle entry. J Virol 83, 4013-4022.

O'Keeffe, M., Hochrein, H., Vremec, D., Caminschi, I., Miller, J.L., Anders, E.M., Wu, L., Lahoud, M.H., Henri, S., Scott, B., Hertzog, P., Tatarczuch, L., Shortman, K., 2002. Mouse plasmacytoid cells: long-lived cells, heterogeneous in surface phenotype and function, that differentiate into CD8(+) dendritic cells only after microbial stimulus. J Exp Med 196, 1307-1319.

Ohno, S., Ono, N., Seki, F., Takeda, M., Kura, S., Tsuzuki, T., Yanagi, Y., 2007. Measles virus infection of SLAM (CD150) knockin mice reproduces tropism and immunosuppression in human infection. J Virol 81, 1650-1659.

Ohno, S., Ono, N., Takeda, M., Takeuchi, K., Yanagi, Y., 2004. Dissection of measles virus V protein in relation to its ability to block alpha/beta interferon signal transduction. J Gen Virol 85, 2991-2999.

Oldstone, M.B., Lewicki, H., Thomas, D., Tishon, A., Dales, S., Patterson, J., Manchester, M., Homann, D., Naniche, D., Holz, A., 1999. Measles virus infection in a transgenic model: virus-induced immunosuppression and central nervous system disease. Cell 98, 629-640.

Oldstone, M.B.A., 2009. Modeling subacute sclerosing panencephalitis in a transgenic mouse system: uncoding pathogenesis of disease and illuminating components of immune control. Curr Top Microbiol Immunol 330, 31-54.

Ono, N., Tatsuo, H., Tanaka, K., Minagawa, H., Yanagi, Y., 2001. V domain of human SLAM (CDw150) is essential for its function as a measles virus receptor. J Virol 75, 1594-1600.

Onoguchi, K., Yoneyama, M., Fujita, T., 2011. Retinoic acid-inducible gene-I-like receptors. J Interferon Cytokine Res 31, 27-31.

190

Osiak, A., Utermohlen, O., Niendorf, S., Horak, I., Knobeloch, K.P., 2005. ISG15, an interferon-stimulated ubiquitin-like protein, is not essential for STAT1 signaling and responses against vesicular stomatitis and lymphocytic choriomeningitis virus. Mol Cell Biol 25, 6338-6345.

Palosaari, H., Parisien, J.P., Rodriguez, J.J., Ulane, C.M., Horvath, C.M., 2003. STAT protein interference and suppression of cytokine signal transduction by measles virus V protein. J Virol 77, 7635-7644.

Park, C., Lecomte, M.J., Schindler, C., 1999. Murine Stat2 is uncharacteristically divergent. Nucleic Acids Res 27, 4191-4199.

Patterson, J.B., Thomas, D., Lewicki, H., Billeter, M.A., Oldstone, M.B., 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267, 80-89.

Perdiguero, B., Esteban, M., 2009. The interferon system and vaccinia virus evasion mechanisms. J Interferon Cytokine Res 29, 581-598.

Permar, S.R., Klumpp, S.A., Mansfield, K.G., Kim, W.K., Gorgone, D.A., Lifton, M.A., Williams, K.C., Schmitz, J.E., Reimann, K.A., Axthelm, M.K., Polack, F.P., Griffin, D.E., Letvin, N.L., 2003. Role of CD8(+) lymphocytes in control and clearance of measles virus infection of rhesus monkeys. J Virol 77, 4396-4400.

Pestka, S., Krause, C.D., Walter, M.R., 2004. Interferons, interferon-like cytokines, and their receptors. Immunol Rev 202, 8-32.

Pfaller, C.K., Conzelmann, K.K., 2008. Measles virus V protein is a decoy substrate for IkappaB kinase alpha and prevents Toll-like receptor 7/9-mediated interferon induction. J Virol 82, 12365-12373.

Pfeuffer, J., Puschel, K., Meulen, V., Schneider-Schaulies, J., Niewiesk, S., 2003. Extent of measles virus spread and immune suppression differentiates between wild-type and vaccine strains in the cotton rat model (Sigmodon hispidus). J Virol 77, 150-158.

Philpott, D.J., Girardin, S.E., 2010. Nod-like receptors: sentinels at host membranes. Curr Opin Immunol.

Pindel, A., Sadler, A., 2011. The role of protein kinase R in the interferon response. J Interferon Cytokine Res 31, 59-70.

Plemper, R.K., Brindley, M.A., Iorio, R.M., 2011. Structural and mechanistic studies of measles virus illuminate paramyxovirus entry. PLoS Pathog 7, e1002058.

Plemper, R.K., Erlandson, K.J., Lakdawala, A.S., Sun, A., Prussia, A., Boonsombat, J., Aki-Sener, E., Yalcin, I., Yildiz, I., Temiz-Arpaci, O., Tekiner, B., Liotta, D.C., Snyder, J.P., Compans, R.W., 2004. A target site for template-based design of measles virus entry inhibitors. Proc Natl Acad Sci USA 101, 5628-5633.

Plemper, R.K., Hammond, A.L., Cattaneo, R., 2001. Measles virus envelope glycoproteins hetero-oligomerize in the endoplasmic reticulum. J Biol Chem 276, 44239-44246.

191

Plemper, R.K., Lakdawala, A.S., Gernert, K.M., Snyder, J.P., Compans, R.W., 2003. Structural features of paramyxovirus F protein required for fusion initiation. Biochemistry 42, 6645-6655.

Plemper, R.K., Snyder, J.P., 2009. Measles control--can measles virus inhibitors make a difference? Current opinion in investigational drugs (London, England : 2000) 10, 811-820.

Plumet, S., Herschke, F., Bourhis, J.M., Valentin, H., Longhi, S., Gerlier, D., 2007. Cytosolic 5'-triphosphate ended viral leader transcript of measles virus as activator of the RIG I-mediated interferon response. PLoS ONE 2, e279.

Polette, M., Gilles, C., Marchand, V., Lorenzato, M., Toole, B., Tournier, J.M., Zucker, S., Birembaut, P., 1997. Tumor collagenase stimulatory factor (TCSF) expression and localization in human lung and breast cancers. J Histochem Cytochem 45, 703-709.

Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B., 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085-2088.

Prescott, J.B., Hall, P.R., Bondu-Hawkins, V.S., Ye, C., Hjelle, B., 2007. Early innate immune responses to Sin Nombre hantavirus occur independently of IFN regulatory factor 3, characterized pattern recognition receptors, and viral entry. J Immunol 179, 1796-1802.

Prussia, A.J., Plemper, R.K., Snyder, J.P., 2008. Measles virus entry inhibitors: a structural proposal for mechanism of action and the development of resistance. Biochemistry 47, 13573-13583.

Rall, G.F., Manchester, M., Daniels, L.R., Callahan, E.M., Belman, A.R., Oldstone, M.B., 1997. A transgenic mouse model for measles virus infection of the brain. Proc Natl Acad Sci USA 94, 4659-4663.

Ramachandran, A., Horvath, C.M., 2009. Paramyxovirus disruption of interferon signal transduction: STATus report. J Interferon Cytokine Res 29, 531-537.

Ramachandran, A., Parisien, J.P., Horvath, C.M., 2008. STAT2 is a primary target for measles virus V protein-mediated alpha/beta interferon signaling inhibition. J Virol 82, 8330-8338.

Rassa, J.C., Meyers, J.L., Zhang, Y., Kudaravalli, R., Ross, S.R., 2002. Murine retroviruses activate B cells via interaction with toll-like receptor 4. Proc Natl Acad Sci U S A 99, 2281-2286.

Rathinam, V.A., Jiang, Z., Waggoner, S.N., Sharma, S., Cole, L.E., Waggoner, L., Vanaja, S.K., Monks, B.G., Ganesan, S., Latz, E., Hornung, V., Vogel, S.N., Szomolanyi-Tsuda, E., Fitzgerald, K.A., 2010. The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses. Nat Immunol 11, 395-402.

Rehwinkel, J., Tan, C.P., Goubau, D., Schulz, O., Pichlmair, A., Bier, K., Robb, N., Vreede, F., Barclay, W., Fodor, E., Reis e Sousa, C., 2010. RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell 140, 397-408.

192

Richardson, C., Hull, D., Greer, P., Hasel, K., Berkovich, A., Englund, G., Bellini, W., Rima, B., Lazzarini, R., 1986. The nucleotide sequence of the mRNA encoding the fusion protein of measles virus (Edmonston strain): a comparison of fusion proteins from several different paramyxoviruses. Virology 155, 508-523.

Richardson, C.D., Choppin, P.W., 1983. Oligopeptides that specifically inhibit membrane fusion by paramyxoviruses: studies on the site of action. Virology 131, 518-532.

Richardson, C.D., Scheid, A., Choppin, P.W., 1980. Specific inhibition of paramyxovirus and myxovirus replication by oligopeptides with amino acid sequences similar to those at the N-termini of the F1 or HA2 viral polypeptides. Virology 105, 205-222.

Rima, B.K., Duprex, W.P., 2009. The measles virus replication cycle. Curr Top Microbiol Immunol 329, 77-102.

Rima, B.K., Earle, J.A., Baczko, K., ter Meulen, V., Liebert, U.G., Carstens, C., Carabana, J., Caballero, M., Celma, M.L., Fernandez-Munoz, R., 1997. Sequence divergence of measles virus haemagglutinin during natural evolution and adaptation to cell culture. J Gen Virol 78 ( Pt 1), 97-106.

Rivas, C., Gil, J., Melkova, Z., Esteban, M., Diaz-Guerra, M., 1998. Vaccinia virus E3L protein is an inhibitor of the interferon (i.f.n.)-induced 2-5A synthetase enzyme. Virology 243, 406-414.

Roth-Cross, J.K., Bender, S.J., Weiss, S.R., 2008. Murine coronavirus mouse hepatitis virus is recognized by MDA5 and induces type I interferon in brain macrophages/microglia. J Virol 82, 9829-9838.

Rothenfusser, S., Goutagny, N., DiPerna, G., Gong, M., Monks, B.G., Schoenemeyer, A., Yamamoto, M., Akira, S., Fitzgerald, K.A., 2005. The RNA helicase Lgp2 inhibits TLR-independent sensing of viral replication by retinoic acid-inducible gene-I. J Immunol 175, 5260-5268.

Rudd, B.D., Smit, J.J., Flavell, R.A., Alexopoulou, L., Schaller, M.A., Gruber, A., Berlin, A.A., Lukacs, N.W., 2006. Deletion of TLR3 alters the pulmonary immune environment and mucus production during respiratory syncytial virus infection. J Immunol 176, 1937-1942.

Russell, C.J., Kantor, K.L., Jardetzky, T.S., Lamb, R.A., 2003. A dual-functional paramyxovirus F protein regulatory switch segment: activation and membrane fusion. J Cell Biol 163, 363-374.

Russell, S.J., Peng, K.W., 2009. Measles virus for cancer therapy. Curr Top Microbiol Immunol 330, 213-241.

Sabbah, A., Chang, T.H., Harnack, R., Frohlich, V., Tominaga, K., Dube, P.H., Xiang, Y., Bose, S., 2009. Activation of innate immune antiviral responses by Nod2. Nature Immunology 10, 1073-1080.

Sadler, A.J., 2010. Orchestration of the activation of protein kinase R by the RNA-binding motif. J Interferon Cytokine Res 30, 195-204.

193

Sadler, A.J., Williams, B.R.G., 2008. Interferon-inducible antiviral effectors. Nat Rev Immunol 8, 559-568.

Saito, T., Owen, D.M., Jiang, F., Marcotrigiano, J., Gale, M., Jr., 2008. Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature 454, 523-527.

Sali, A., Blundell, T.L., 1993. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol 234, 779-815.

Santiago, C., Bjorling, E., Stehle, T., Casasnovas, J.M., 2002. Distinct kinetics for binding of the CD46 and SLAM receptors to overlapping sites in the measles virus hemagglutinin protein. J Biol Chem 277, 32294-32301.

Santiago, C., Celma, M.L., Stehle, T., Casasnovas, J.M., 2009. Structure of the measles virus hemagglutinin bound to the CD46 receptor. Nature structural & molecular biology.

Sato, H., Masuda, M., Kanai, M., Tsukiyama-Kohara, K., Yoneda, M., Kai, C., 2007. Measles virus N protein inhibits host translation by binding to eIF3-p40. J Virol 81, 11569-11576.

Sato, M., Hata, N., Asagiri, M., Nakaya, T., Taniguchi, T., Tanaka, N., 1998. Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7. FEBS Lett 441, 106-110.

Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., Taniguchi, T., 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13, 539-548.

Satoh, T., Kato, H., Kumagai, Y., Yoneyama, M., Sato, S., Matsushita, K., Tsujimura, T., Fujita, T., Akira, S., Takeuchi, O., 2010. LGP2 is a positive regulator of RIG-I- and MDA5-mediated antiviral responses. Proc Natl Acad Sci U S A 107, 1512-1517.

Sawatsky, B., Delpeut, S., von Messling, V., 2011. Canine Distemper Virus, in: Samal, S.K. (Ed.), The Biology of Paramyxoviruses. Caister Academic Press, Norfolk, pp. 275-292.

Sawatsky, B., Wong, X.X., Hinkelmann, S., Cattaneo, R., von Messling, V., 2012. Canine Distemper Virus Epithelial Cell Infection Is Required for Clinical Disease but not for Immunosuppression. J Virol.

Schindler, C., Levy, D.E., Decker, T., 2007. JAK-STAT signaling: from interferons to cytokines. J Biol Chem 282, 20059-20063.

Schlender, J., Hornung, V., Finke, S., Gunthner-Biller, M., Marozin, S., Brzozka, K., Moghim, S., Endres, S., Hartmann, G., Conzelmann, K.K., 2005. Inhibition of toll-like receptor 7- and 9-mediated alpha/beta interferon production in human plasmacytoid dendritic cells by respiratory syncytial virus and measles virus. J Virol 79, 5507-5515.

Schneider, U., Bullough, F., Vongpunsawad, S., Russell, S.J., Cattaneo, R., 2000. Recombinant measles viruses efficiently entering cells through targeted receptors. J Virol 74, 9928-9936.

194

Schuhmann, K.M., Pfaller, C.K., Conzelmann, K.K., 2011. The measles virus V protein binds to p65 (RelA) to suppress NF-kappaB activity. J Virol 85, 3162-3171.

Schulz, O., Diebold, S.S., Chen, M., Naslund, T.I., Nolte, M.A., Alexopoulou, L., Azuma, Y.T., Flavell, R.A., Liljestrom, P., Reis e Sousa, C., 2005. Toll-like receptor 3 promotes cross-priming to virus-infected cells. Nature 433, 887-892.

Schwarz, A.J., 1962. Preliminary tests of a highly attenuated measles vaccine. Am J Dis Child 103, 386-389.

Sellin, C.I., Davoust, N., Guillaume, V., Baas, D., Belin, M.F., Buckland, R., Wild, T.F., Horvat, B., 2006. High pathogenicity of wild-type measles virus infection in CD150 (SLAM) transgenic mice. J Virol 80, 6420-6429.

Seya, T., Ballard, L.L., Bora, N.S., Kumar, V., Cui, W., Atkinson, J.P., 1988. Distribution of membrane cofactor protein of complement on human peripheral blood cells. An altered form is found on granulocytes. Eur J Immunol 18, 1289-1294.

Shaffer, J.A., Bellini, W.J., Rota, P.A., 2003. The C protein of measles virus inhibits the type I interferon response. Virology 315, 389-397.

Shi, H.X., Yang, K., Liu, X., Liu, X.Y., Wei, B., Shan, Y.F., Zhu, L.H., Wang, C., 2010. Positive regulation of interferon regulatory factor 3 activation by Herc5 via ISG15 modification. Mol Cell Biol 30, 2424-2436.

Shingai, M., Inoue, N., Okuno, T., Okabe, M., Akazawa, T., Miyamoto, Y., Ayata, M., Honda, K., Kurita-Taniguchi, M., Matsumoto, M., Ogura, H., Taniguchi, T., Seya, T., 2005. Wild-type measles virus infection in human CD46/CD150-transgenic mice: CD11c-positive dendritic cells establish systemic viral infection. J Immunol 175, 3252-3261.

Silva, A.M., Whitmore, M., Xu, Z., Jiang, Z., Li, X., Williams, B.R., 2004. Protein kinase R (PKR) interacts with and activates mitogen-activated protein kinase kinase 6 (MKK6) in response to double-stranded RNA stimulation. J Biol Chem 279, 37670-37676.

Silverman, R.H., 2007. Viral encounters with 2',5'-oligoadenylate synthetase and RNase L during the interferon antiviral response. J Virol 81, 12720-12729.

Smit, J.J., Rudd, B.D., Lukacs, N.W., 2006. Plasmacytoid dendritic cells inhibit pulmonary immunopathology and promote clearance of respiratory syncytial virus. J Exp Med 203, 1153-1159.

Smith, E.C., Popa, A., Chang, A., Masante, C., Dutch, R.E., 2009. Viral entry mechanisms: the increasing diversity of paramyxovirus entry. FEBS J 276, 7217-7227.

Smith, E.J., Marie, I., Prakash, A., Garcia-Sastre, A., Levy, D.E., 2001. IRF3 and IRF7 phosphorylation in virus-infected cells does not require double-stranded RNA-dependent protein kinase R or Ikappa B kinase but is blocked by Vaccinia virus E3L protein. J Biol Chem 276, 8951-8957.

195

Soding, J., Biegert, A., Lupas, A.N., 2005. The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res 33, W244-248.

Soilleux, E.J., Morris, L.S., Leslie, G., Chehimi, J., Luo, Q., Levroney, E., Trowsdale, J., Montaner, L.J., Doms, R.W., Weissman, D., Coleman, N., Lee, B., 2002. Constitutive and induced expression of DC-SIGN on dendritic cell and macrophage subpopulations in situ and in vitro. J Leukoc Biol 71, 445-457.

Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H., Schreiber, R.D., 1998. How cells respond to interferons. Annu Rev Biochem 67, 227-264.

Stojdl, D.F., Abraham, N., Knowles, S., Marius, R., Brasey, A., Lichty, B.D., Brown, E.G., Sonenberg, N., Bell, J.C., 2000. The murine double-stranded RNA-dependent protein kinase PKR is required for resistance to vesicular stomatitis virus. J Virol 74, 9580-9585.

Suter, S.E., Chein, M.B., von Messling, V., Yip, B., Cattaneo, R., Vernau, W., Madewell, B.R., London, C.A., 2005. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clin Cancer Res 11, 1579-1587.

Swanson, K., Wen, X., Leser, G.P., Paterson, R.G., Lamb, R.A., Jardetzky, T.S., 2010. Structure of the Newcastle disease virus F protein in the post-fusion conformation. Virology 402, 372-379.

Swanson, K.A., Settembre, E.C., Shaw, C.A., Dey, A.K., Rappuoli, R., Mandl, C.W., Dormitzer, P.R., Carfi, A., 2011. Structural basis for immunization with postfusion respiratory syncytial virus fusion F glycoprotein (RSV F) to elicit high neutralizing antibody titers. Proc Natl Acad Sci U S A 108, 9619-9624.

Swiecki, M., Colonna, M., 2010. Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance. Immunol Rev 234, 142-162.

Swiecki, M., Gilfillan, S., Vermi, W., Wang, Y., Colonna, M., 2010. Plasmacytoid dendritic cell ablation impacts early interferon responses and antiviral NK and CD8(+) T cell accrual. Immunity 33, 955-966.

Tabeta, K., Georgel, P., Janssen, E., Du, X., Hoebe, K., Crozat, K., Mudd, S., Shamel, L., Sovath, S., Goode, J., Alexopoulou, L., Flavell, R.A., Beutler, B., 2004. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection. Proc Natl Acad Sci U S A 101, 3516-3521.

Tahara, M., Takeda, M., Shirogane, Y., Hashiguchi, T., Ohno, S., Yanagi, Y., 2008. Measles virus infects both polarized epithelial and immune cells by using distinctive receptor-binding sites on its hemagglutinin. J Virol 82, 4630-4637.

Tahara, M., Takeda, M., Yanagi, Y., 2007. Altered interaction of the matrix protein with the cytoplasmic tail of hemagglutinin modulates measles virus growth by affecting virus assembly and cell-cell fusion. J Virol 81, 6827-6836.

196

Takaoka, A., Wang, Z., Choi, M.K., Yanai, H., Negishi, H., Ban, T., Lu, Y., Miyagishi, M., Kodama, T., Honda, K., Ohba, Y., Taniguchi, T., 2007. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 448, 501-505.

Takeda, M., Tahara, M., Hashiguchi, T., Sato, T.A., Jinnouchi, F., Ueki, S., Ohno, S., Yanagi, Y., 2007. A human lung carcinoma cell line supports efficient measles virus growth and syncytium formation via a SLAM- and CD46-independent mechanism. J Virol 81, 12091-12096.

Takeuchi, K., Kadota, S.I., Takeda, M., Miyajima, N., Nagata, K., 2003a. Measles virus V protein blocks interferon (IFN)-alpha/beta but not IFN-gamma signaling by inhibiting STAT1 and STAT2 phosphorylation. FEBS Lett 545, 177-182.

Takeuchi, K., Miyajima, N., Nagata, N., Takeda, M., Tashiro, M., 2003b. Wild-type measles virus induces large syncytium formation in primary human small airway epithelial cells by a SLAM(CD150)-independent mechanism. Virus Res 94, 11-16.

Tang, W., Chang, S.B., Hemler, M.E., 2004. Links between CD147 function, glycosylation, and caveolin-1. Mol Biol Cell 15, 4043-4050.

Tatsuo, H., Ono, N., Tanaka, K., Yanagi, Y., 2000. SLAM (CDw150) is a cellular receptor for measles virus. Nature 406, 893-897.

tenOever, B.R., Servant, M.J., Grandvaux, N., Lin, R., Hiscott, J., 2002. Recognition of the measles virus nucleocapsid as a mechanism of IRF-3 activation. J Virol 76, 3659-3669.

Terenzi, F., Saikia, P., Sen, G.C., 2008. Interferon-inducible protein, P56, inhibits HPV DNA replication by binding to the viral protein E1. EMBO J 27, 3311-3321.

The PyMOL Molecular Graphics System, V.r.p., Schrödinger, LLC.

Thorley, B.R., Milland, J., Christiansen, D., Lanteri, M.B., McInnes, B., Moeller, I., Rivailler, P., Horvat, B., Rabourdin-Combe, C., Gerlier, D., McKenzie, I.F., Loveland, B.E., 1997. Transgenic expression of a CD46 (membrane cofactor protein) minigene: studies of xenotransplantation and measles virus infection. Eur J Immunol 27, 726-734.

Toth, A.M., Devaux, P., Cattaneo, R., Samuel, C.E., 2009a. Protein kinase PKR mediates the apoptosis induction and growth restriction phenotypes of C protein-deficient measles virus. J Virol 83, 961-968.

Toth, A.M., Li, Z., Cattaneo, R., Samuel, C.E., 2009b. RNA-specific adenosine deaminase ADAR1 suppresses measles virus-induced apoptosis and activation of protein kinase PKR. J Biol Chem 284, 29350-29356.

Trottier, C., Colombo, M., Mann, K.K., Miller, W.H., Ward, B.J., 2009. Retinoids inhibit measles virus through a type I IFN-dependent bystander effect. FASEB J 23, 3203-3212.

Turan, K., Mibayashi, M., Sugiyama, K., Saito, S., Numajiri, A., Nagata, K., 2004. Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome. Nucleic Acids Res 32, 643-652.

197

Turville, S.G., Cameron, P.U., Handley, A., Lin, G., Pohlmann, S., Doms, R.W., Cunningham, A.L., 2002. Diversity of receptors binding HIV on dendritic cell subsets. Nat Immunol 3, 975-983.

Unterholzner, L., Keating, S.E., Baran, M., Horan, K.A., Jensen, S.B., Sharma, S., Sirois, C.M., Jin, T., Latz, E., Xiao, T.S., Fitzgerald, K.A., Paludan, S.R., Bowie, A.G., 2010. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol 11, 997-1004.

Uze, G., Schreiber, G., Piehler, J., Pellegrini, S., 2007. The receptor of the type I interferon family. Curr Top Microbiol Immunol 316, 71-95.

Veillette, A., Dong, Z., Latour, S., 2007. Consequence of the SLAM-SAP signaling pathway in innate-like and conventional lymphocytes. Immunity 27, 698-710.

Venkataraman, T., Valdes, M., Elsby, R., Kakuta, S., Caceres, G., Saijo, S., Iwakura, Y., Barber, G.N., 2007. Loss of DExD/H box RNA helicase LGP2 manifests disparate antiviral responses. J Immunol 178, 6444-6455.

Vialard, J., Lalumière, M., Vernet, T., Briedis, D., Alkhatib, G., Henning, D., Levin, D., Richardson, C., 1990. Synthesis of the membrane fusion and hemagglutinin proteins of measles virus, using a novel baculovirus vector containing the beta-galactosidase gene. J Virol 64, 37-50.

Vincent, S., Spehner, D., Manié, S., Delorme, R., Drillien, R., Gerlier, D., 1999. Inefficient measles virus budding in murine L.CD46 fibroblasts. Virology 265, 185-195.

Vincent, S., Tigaud, I., Schneider, H., Buchholz, C.J., Yanagi, Y., Gerlier, D., 2002. Restriction of measles virus RNA synthesis by a mouse host cell line: trans-complementation by polymerase components or a human cellular factor(s). J Virol 76, 6121-6130.

Vitiello, M., Galdiero, M., 2009. Inhibition of viral-induced membrane fusion by peptides. Protein Pept Lett 16, 786-793.

Vollstedt, S., O'Keeffe, M., Odermatt, B., Beat, R., Glanzmann, B., Riesen, M., Shortman, K., Suter, M., 2004. Treatment of neonatal mice with Flt3 ligand leads to changes in dendritic cell subpopulations associated with enhanced IL-12 and IFN-alpha production. Eur J Immunol 34, 1849-1860.

von Messling, V., Svitek, N., Cattaneo, R., 2006. Receptor (SLAM [CD150]) recognition and the V protein sustain swift lymphocyte-based invasion of mucosal tissue and lymphatic organs by a morbillivirus. J Virol 80, 6084-6092.

Vongpunsawad, S., Oezgun, N., Braun, W., Cattaneo, R., 2004. Selectively receptor-blind measles viruses: Identification of residues necessary for SLAM- or CD46-induced fusion and their localization on a new hemagglutinin structural model. J Virol 78, 302-313.

Wang, C., Pflugheber, J., Sumpter, R., Jr., Sodora, D.L., Hui, D., Sen, G.C., Gale, M., Jr., 2003. Alpha interferon induces distinct translational control programs to suppress hepatitis C virus RNA replication. J Virol 77, 3898-3912.

198

Wang, H., Peters, N., Schwarze, J., 2006. Plasmacytoid dendritic cells limit viral replication, pulmonary inflammation, and airway hyperresponsiveness in respiratory syncytial virus infection. J Immunol 177, 6263-6270.

Wang, J., Takeuchi, T., Tanaka, S., Kubo, S.K., Kayo, T., Lu, D., Takata, K., Koizumi, A., Izumi, T., 1999. A mutation in the insulin 2 gene induces diabetes with severe pancreatic beta-cell dysfunction in the Mody mouse. J Clin Invest 103, 27-37.

Wang, J.P., Asher, D.R., Chan, M., Kurt-Jones, E.A., Finberg, R.W., 2007. Cutting Edge: Antibody-mediated TLR7-dependent recognition of viral RNA. J Immunol 178, 3363-3367.

Wang, N., Satoskar, A., Faubion, W., Howie, D., Okamoto, S., Feske, S., Gullo, C., Clarke, K., Sosa, M.R., Sharpe, A.H., Terhorst, C., 2004a. The cell surface receptor SLAM controls T cell and macrophage functions. J Exp Med 199, 1255-1264.

Wang, T., Town, T., Alexopoulou, L., Anderson, J.F., Fikrig, E., Flavell, R.A., 2004b. Toll-like receptor 3 mediates West Nile virus entry into the brain causing lethal encephalitis. Nat Med 10, 1366-1373.

Ward, S.V., George, C.X., Welch, M.J., Liou, L.Y., Hahm, B., Lewicki, H., de la Torre, J.C., Samuel, C.E., Oldstone, M.B., 2011. RNA editing enzyme adenosine deaminase is a restriction factor for controlling measles virus replication that also is required for embryogenesis. Proc Natl Acad Sci U S A 108, 331-336.

Waskow, C., Liu, K., Darrasse-Jeze, G., Guermonprez, P., Ginhoux, F., Merad, M., Shengelia, T., Yao, K., Nussenzweig, M., 2008. The receptor tyrosine kinase Flt3 is required for dendritic cell development in peripheral lymphoid tissues. Nat Immunol 9, 676-683.

Watanabe, A., Yoneda, M., Ikeda, F., Terao-Muto, Y., Sato, H., Kai, C., 2010. CD147/EMMPRIN Acts as a Functional Entry Receptor for Measles Virus on Epithelial Cells. J Virol.

Watanabe, M., Hirano, A., Stenglein, S., Nelson, J., Thomas, G., Wong, T.C., 1995. Engineered serine protease inhibitor prevents furin-catalyzed activation of the fusion glycoprotein and production of infectious measles virus. J Virol 69, 3206-3210.

Watowich, S.S., Liu, Y.J., 2010. Mechanisms regulating dendritic cell specification and development. Immunol Rev 238, 76-92.

Weaver, J.R., Shamim, M., Alexander, E., Davies, D.H., Felgner, P.L., Isaacs, S.N., 2007. The identification and characterization of a monoclonal antibody to the vaccinia virus E3 protein. Virus Res 130, 269-274.

Weber, F., Kochs, G., Haller, O., 2004. Inverse interference: how viruses fight the interferon system. Viral Immunol 17, 498-515.

Weidmann, A., Fischer, C., Ohgimoto, S., Ruth, C., ter Meulen, V., Schneider-Schaulies, S., 2000a. Measles virus-induced immunosuppression in vitro is independent of complex glycosylation of viral glycoproteins and of hemifusion. J Virol 74, 7548-7553.

199

Weidmann, A., Maisner, A., Garten, W., Seufert, M., ter Meulen, V., Schneider-Schaulies, S., 2000b. Proteolytic cleavage of the fusion protein but not membrane fusion is required for measles virus-induced immunosuppression in vitro. J Virol 74, 1985-1993.

Welstead, G.G., Iorio, C., Draker, R., Bayani, J., Squire, J., Vongpunsawad, S., Cattaneo, R., Richardson, C.D., 2005. Measles virus replication in lymphatic cells and organs of CD150 (SLAM) transgenic mice. Proc Natl Acad Sci USA 102, 16415-16420.

White, J.M., Delos, S.E., Brecher, M., Schornberg, K., 2008. Structures and mechanisms of viral membrane fusion proteins: multiple variations on a common theme. Crit Rev Biochem Mol Biol 43, 189-219.

WHO, 2011a. Measles.

WHO, 2011b. WHO vaccine-preventable diseases: monitoring system 2011 global summary.

Wild, C., Greenwell, T., Matthews, T., 1993. A synthetic peptide from HIV-1 gp41 is a potent inhibitor of virus-mediated cell-cell fusion. AIDS Res Hum Retroviruses 9, 1051-1053.

Wolf, A.I., Buehler, D., Hensley, S.E., Cavanagh, L.L., Wherry, E.J., Kastner, P., Chan, S., Weninger, W., 2009. Plasmacytoid dendritic cells are dispensable during primary influenza virus infection. J Immunol 182, 871-879.

Wolff, T., Ludwig, S., 2009. Influenza viruses control the vertebrate type I interferon system: factors, mechanisms, and consequences. J Interferon Cytokine Res 29, 549-557.

Xiang, Y., Condit, R.C., Vijaysri, S., Jacobs, B., Williams, B.R., Silverman, R.H., 2002. Blockade of interferon induction and action by the E3L double-stranded RNA binding proteins of vaccinia virus. J Virol 76, 5251-5259.

Yanagi, Y., Takeda, M., Ohno, S., Hashiguchi, T., 2009. Measles virus receptors. Curr Top Microbiol Immunol 329, 13-30.

Yang, Y.L., Reis, L.F., Pavlovic, J., Aguzzi, A., Schafer, R., Kumar, A., Williams, B.R., Aguet, M., Weissmann, C., 1995. Deficient signaling in mice devoid of double-stranded RNA-dependent protein kinase. EMBO J 14, 6095-6106.

Yin, H.-S., Paterson, R.G., Wen, X., Lamb, R.A., Jardetzky, T.S., 2005. Structure of the uncleaved ectodomain of the paramyxovirus (hPIV3) fusion protein. Proc Natl Acad Sci USA 102, 9288-9293.

Yin, H.-S., Wen, X., Paterson, R.G., Lamb, R.A., Jardetzky, T.S., 2006. Structure of the parainfluenza virus 5 F protein in its metastable, prefusion conformation. Nature 439, 38-44.

Yokota, S., Saito, H., Kubota, T., Yokosawa, N., Amano, K., Fujii, N., 2003. Measles virus suppresses interferon-alpha signaling pathway: suppression of Jak1 phosphorylation and association of viral accessory proteins, C and V, with interferon-alpha receptor complex. Virology 306, 135-146.

200

Yoneyama, H., Matsuno, K., Zhang, Y., Nishiwaki, T., Kitabatake, M., Ueha, S., Narumi, S., Morikawa, S., Ezaki, T., Lu, B., Gerard, C., Ishikawa, S., Matsushima, K., 2004. Evidence for recruitment of plasmacytoid dendritic cell precursors to inflamed lymph nodes through high endothelial venules. Int Immunol 16, 915-928.

Yoneyama, M., Fujita, T., 2009. Recognition of viral nucleic acids in innate immunity. Rev Med Virol 20, 4-22.

Yoneyama, M., Kikuchi, M., Matsumoto, K., Imaizumi, T., Miyagishi, M., Taira, K., Foy, E., Loo, Y.M., Gale, M., Jr., Akira, S., Yonehara, S., Kato, A., Fujita, T., 2005. Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 175, 2851-2858.

Yoshioka, M., Kayo, T., Ikeda, T., Koizumi, A., 1997. A novel locus, Mody4, distal to D7Mit189 on chromosome 7 determines early-onset NIDDM in nonobese C57BL/6 (Akita) mutant mice. Diabetes 46, 887-894.

Young, V.A., Rall, G.F., 2009. Making it to the synapse: measles virus spread in and among neurons. Curr Top Microbiol Immunol 330, 3-30.

Yuwen, H., Cox, J.H., Yewdell, J.W., Bennink, J.R., Moss, B., 1993. Nuclear localization of a double-stranded RNA-binding protein encoded by the vaccinia virus E3L gene. Virology 195, 732-744.

Zhang, D., Zhang, D.E., 2011. Interferon-stimulated gene 15 and the protein ISGylation system. J Interferon Cytokine Res 31, 119-130.

Zhang, S.Y., Jouanguy, E., Ugolini, S., Smahi, A., Elain, G., Romero, P., Segal, D., Sancho-Shimizu, V., Lorenzo, L., Puel, A., Picard, C., Chapgier, A., Plancoulaine, S., Titeux, M., Cognet, C., von Bernuth, H., Ku, C.L., Casrouge, A., Zhang, X.X., Barreiro, L., Leonard, J., Hamilton, C., Lebon, P., Heron, B., Vallee, L., Quintana-Murci, L., Hovnanian, A., Rozenberg, F., Vivier, E., Geissmann, F., Tardieu, M., Abel, L., Casanova, J.L., 2007. TLR3 deficiency in patients with herpes simplex encephalitis. Science 317, 1522-1527.