Research Collection

Doctoral Thesis

Apolipoprotein A-I transcytosis through aortic endothelial cells

Author(s): Cavelier, Clara

Publication Date: 2006

Permanent Link: https://doi.org/10.3929/ethz-a-005296945

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

DISS. ETH NO. 16679

APOLIPOPROTEIN A-I TRANSCYTOSIS

THROUGH AORTIC ENDOTHELIAL CELLS

A dissertation submitted to the

SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH

for the degree of Doctor of Sciences

Presented by

CLARA CAVELIER

Ingénieur de l’Institut National Agronomique Paris-Grignon (INA P-G)

born 21.10.1979

from France

Accepted on the recommendation of

Prof. Matthias PETER, examiner

Prof. Ari HELENIUS, co-examiner

Prof. Arnold von ECKARDSTEIN, co-examiner

Dr. Lucia ROHRER, co-examiner

2006

Table of contents

3

TABLE OF CONTENTS

TABLE OF CONTENTS .................................................................................... 3

ABSTRACT ....................................................................................................... 7

RESUME............................................................................................................ 9

ABBREVIATIONS ........................................................................................... 11

INTRODUCTION.............................................................................................. 13

1. Atherosclerosis and High Density Lipoproteins ................................. 13

1.1. Atherosclerosis................................................................................ 13

1.2. High Density Lipoproteins (HDL).................................................... 15

1.2.1. HDL form a Heterogeneous Class of Lipoproteins...................... 15

1.2.2. HDL Metabolism ......................................................................... 16

1.2.3. HDL and Apolipoprotein A-I are Atheroprotective ....................... 18

1.3. HDL and ApoA-I Binding Proteins.................................................. 20

1.3.1. ABCA1........................................................................................ 22

1.3.2. SR-BI .......................................................................................... 23

1.3.3. F0F1 ATPase............................................................................... 24

2. Transport of Macromolecules through Continuous Endothelia ........ 26

2.1. Transport Pathways......................................................................... 26

2.1.1. Protein Transport through Large Pores ...................................... 27

2.1.2. Interjunctional Protein Transport................................................. 27

2.1.3. Vesicular Transport..................................................................... 30

2.2. Caveolae mediated Transcytosis ................................................... 31

2.3. Lipoprotein Transport through the Endothelium.......................... 35

3. Problematic ............................................................................................ 36

Table of contents

4

MATERIALS AND METHODS.........................................................................37

RESULTS.........................................................................................................45

1. Apolipoprotein A-I Interaction with Aortic Endothelial Cells..............45

1.1. ApoA-I Binding (4°C)........................................................................45

1.2. ApoA-I Cell Association (37°C) .......................................................47

1.3. ApoA-I Internalisation and Degradation.........................................49

1.4. ApoA-I Transport through a Monolayer of Endothelial Cells .......53

2. Which Proteins mediate ApoA-I Transcytosis? ...................................57

2.1. Role of ABCA1 in ApoA-I Transcytosis..........................................57

2.1.1. Role of ABCA1 in ApoA-I Binding and Cell Association ..............57

2.1.2. Role of ABCA1 in ApoA-I Internalisation .....................................61

2.1.3. Role of ABCA1 in ApoA-I Transport ............................................62

2.2. Role of SR-BI in ApoA-I Binding and Cell Association .................64

2.3. Role of Cell Surface F0F1 ATPase in ApoA-I Transcytosis ...........66

2.3.1. Role of Cell Surface β-ATPase in ApoA-I Binding.......................66

2.3.2. Role of Cell Surface F0F1 ATPase in ApoA-I Internalisation........69

2.3.3. Role of Cell Surface F0F1 ATPase in ApoA-I Transport...............70

2.3.4. Effect of Extracellular Nucleotides on ApoA-I Internalisation ......71

2.3.5. Cell Surface F0F1 ATPase Activity...............................................72

3. Which Pathway is implicated in ApoA-I Transcytosis? ......................73

3.1. Role of Caveolin-1 in ApoA-I Transcytosis ....................................73

3.2. Role of Clathrin in ApoA-I Internalisation ......................................77

Table of contents

5

DISCUSSION................................................................................................... 79

1. ApoA-I Interaction with Aortic Endothelial Cells................................. 79

2. Which Proteins mediate ApoA-I Transcytosis?................................... 82

2.1. Role of ABCA1 in ApoA-I Transport............................................... 82

2.2. Role of SR-BI in ApoA-I Transport ................................................. 86

2.3. Role of F0F1 ATPase in ApoA-I Transport ...................................... 87

3. Which Pathway is implicated in ApoA-I Transcytosis? ...................... 90

OUTLOOK ....................................................................................................... 93

REFERENCES................................................................................................. 96

ACKNOWLEDGEMENTS.............................................................................. 115

CURRICULUM VITAE ................................................................................... 117

Abstract

7

ABSTRACT

Atherosclerosis is the major cause of death worldwide. It is a progressive

disease, characterised by the subendothelial accumulation of cholesterol-

engorged macrophages. High-density lipoproteins (HDL) are cholesterol

carriers in plasma, which major protein constituent is apolipoprotein A-I (apoA-

I). The plasma levels of both apoA-I and HDL are inversely correlated with the

risk of atherosclerotic cardiovascular diseases. Most of the atheroprotective

properties of apoA-I and HDL are exerted within the vascular wall rather than in

the plasma compartment. In deed, HDL are the most abundant lipoproteins

within the arterial intima. However, very little is known about apoA-I and HDL

transport through the endothelium. In this project, three issues were addressed:

the characterisation of apoA-I interaction with endothelial cells, the identification

of the receptors involved and the description of the pathway implicated.

First, apoA-I interaction with endothelial cells was characterised. Endothelial

cells were found to bind, internalise and transport apoA-I in a specific manner.

In immunofluorescence microscopy experiments, apoA-I was observed in

vesicles, which partially colocalised with early endosomes markers.

Furthermore, apoA-I transport was inhibited at 16°C and apoA-I was modified,

probably lipidated, in parallel to its transport. Therefore, it seems that apoA-I is

transcytosed through endothelial cells.

Second, we analysed the role of known apoA-I/HDL binding proteins (i.e.

ABCA1, SR-BI and the beta chain of F0F1 ATPase) in apoA-I interaction with

endothelial cells. Using diverse pharmacological treatments and RNA

interference, we observed that in endothelial cells ABCA1 was modulating

apoA-I binding, internalisation and transport. By contrast, reducing SR-BI

expression did not change apoA-I binding and internalisation but lowered HDL

binding. This result is consistent with the current consensus that SR-BI is a

receptor for intact HDL. Besides, F0F1 ATPase, which was found on the surface

of endothelial cells, modulated apoA-I binding, internalisation and transcytosis.

Interestingly, extracellular ADP stimulated apoA-I internalisation. In agreement

Abstract

8

with this result, F0F1 ATPase hydrolysed ATP on the surface of endothelial cells

and upon binding of apoA-I.

Third, the implication of the clathrin- and caveolin-mediated pathways in apoA-I

transcytosis was analysed. Clathrin silencing did not alter apoA-I internalisation

although it reduced LDL degradation. On the contrary, lowering caveolin-1

expression diminished apoA-I internalisation and transport. Moreover, apoA-I

bound preferentially to caveolin-1 enriched rafts transferred onto a nitrocellulose

membrane and both ABCA1 and β-ATPase were found to be expressed in

these rafts.

To conclude, three proteins were found to play a role in the transcytosis of

apoA-I: ABCA1, cell surface F0F1 ATPase and caveolin-1. It is still unclear

whether these proteins are cooperating in the same pathway to mediate apoA-I

transcytosis, but it would be a very challenging hypothesis to address.

Résumé

9

RESUME

L’athérosclérose est la première cause de mortalité dans le monde. Cette

maladie est caractérisée par l’accumulation d’éléments fibreux et de lipides

dans la paroi artérielle. Les HDL (High Density Lipoproteins) sont des

transporteurs de cholestérol dans le plasma. De faibles concentrations

plasmatiques en HDL et en apolipoprotéine A-I (apoA-I, leur principale

apolipoprotéine) sont des facteurs de risque importants de l’athérosclérose. La

majorité des effets préventifs des HDL et d’apoA-I doit être exercée dans la

paroi artérielle. Pourtant, le transport des HDL et d’apoA-I à travers

l’endothélium est un phénomène qui n’est toujours pas élucidé. Les objectifs de

ce projet sont de caractériser l’interaction d’apoA-I avec les cellules

endothéliales, d’identifier les récepteurs impliqués et de définir la voie de

transport intracellulaire.

Tout d’abord, il a été démontré qu’apoA-I s’associe à la surface des cellules

endothéliales pour être ensuite internalisée et transportée par ces cellules de

manière spécifique. ApoA-I est observée dans des vésicules intracellulaires,

dont une partie colocalise avec les marqueurs des endosomes précoces EEA1

(early endosome antigen 1) et transferrine. De plus, à 16°C le transport d’apoA-

I est significativement réduit. La majorité d’apoA-I transportée est modifiée,

probablement par association avec des lipides. Ces résultats indiquent que le

transport d’apoA-I est un phénomène de transcytose.

Par ailleurs, l’implication dans la transcytose d’apoA-I de trois protéines

importantes pour le métabolisme des HDL (ABCA1, SR-BI et F0F1 ATPase) a

été étudiée. La présente étude montre qu’ABCA1 est impliqué dans

l’association d’apoA-I avec les cellules endothéliales, son internalisation et son

transport. Au contraire, SR-BI ne semble pas être capital pour l’internalisation

d’apoA-I. Plus surprenant, la protéine mitochondriale F0F1 ATPase est

également exprimée à la surface des cellules endothéliales et est impliquée

dans l’internalisation et la transcytose d’apoA-I. Il semble, qu’à la surface des

cellules endothéliales, apoA-I stimule la production d’ADP par F0F1 ATPase.

Résumé

10

Enfin, le rôle de la clathrine et de la cavéoline-1 dans la transcytose d’apoA-I a

été étudié. Il semble que seule la cavéoline-1 soit impliquée dans la régulation

du transport d’apoA-I. Par ailleurs, il a été constaté qu’ABCA1 et F0F1 ATPase

sont exprimés dans les rafts enrichis en cavéoline-1, soulignant la possibilité

que ces protéines pourraient interagir pour réguler la transcytose d’apoA-I.

Pour conclure, cette étude montre l’implication d’ABCA1, de F0F1 ATPase et de

la cavéoline-1 dans la transcytose d’apoA-I à travers les cellules endothéliales.

Pour l’instant, rien n’a encore été démontré quant à l’interaction de ces

protéines. Néanmoins, il serait très intéressant de considérer cette hypothèse.

Abbreviations

11

ABBREVIATIONS

ABC transporter: ATP binding cassette transporter

AC: adenylate cyclase

ACAT: acyl-CoA:cholesterol acyltransferase

ADP: adenosine diphosphate

Apo: apolipoprotein

ATP: adenosine triphosphate

β-ATPase: beta-chain of the F0F1 ATPase

C: cholesterol

cAMP: cyclic adenosine monophosphate

CE: cholesterol ester

CETP: cholesteryl ester transfer protein

CsA: cyclosporin A

C-terminus: carboxy-terminus

EEA1: early endosome antigen 1

eNOS: endothelial nitric oxid synthase

GTP: guanidine triphosphate

HC: 22-R-hydroxycholesterol

HDL: high density lipoprotein

IDL: intermediate density lipoprotein

IEJ: interendothelial junctions

IP3: inositol-3 phosphate

kDa: kilo Dalton

LCAT: lecithin:cholesterol acyltransferase

LDL low density lipoprotein

LDLR: LDL receptor

LpE: apolipoprotein E containing lipoprotein

PLC: phospholipase C

NEM: N-ethyl maleimide

NSF: NEM sensitive factor

N-terminus: amino-terminus

PLTP: phospholipids transfer protein

Abbreviations

12

PM: plasma membrane

PS: phosphatidylserine

RA: 9-cis retinoic acid

RT-PCR: reverse transcription and polymerisation chain reaction

siRNA: small interfering RNA

SNAP: soluble NSF attachment protein

SNARE: soluble NSF attachment protein receptor

SR-BI: scavenger receptor type B class I

VAMP: vesicle associated membrane protein

VE-cadherin: vascular endothelial cadherin

VEGF: vascular endothelial growth factor

VLDL: very low density lipoprotein

ZO: zonula occludens

Introduction

13

INTRODUCTION

1. Atherosclerosis and High Density Lipoproteins

1.1. Atherosclerosis

Atherosclerotic cardiovascular diseases are the leading cause of death

worldwide. Atherosclerosis is a progressive disease characterised by the

accumulation of lipids and fibrous elements in the intima of large arteries. The

most common clinical complication is an occlusion of the vessel due to the

formation of a blood clot, resulting in myocardial infarction or stroke. An early

hallmark of atherosclerosis is the presence of cholesterol-loaded macrophages

(foam cells) in the intima of arteries (Fig. 1A) [10]. In contrast to most other cells

of the body, macrophages can accumulate large amounts of cholesterol by

uncontrolled scavenger receptor-mediated uptake. To circumvent the

cytotoxicity of unesterified cholesterol, they esterify cholesterol via the enzyme

acyl-CoA:cholesterol acyltransferase (ACAT). The cholesteryl esters are stored

intracellularly, mostly as cytosolic lipid droplets but also in lysosomes [11]. This

process turns macrophages into activated foam cells, which produce various

growth factors, cytokines, and proteases and thereby influence the course of

atherosclerosis [12]. These inflammatory signals stimulate the expression of cell

adhesion molecules on the surface of endothelial cells, thus facilitating the

recruitment of monocytes to the arterial wall and their subsequent differentiation

into macrophages. Progressively, the migration of smooth muscle cells and the

production of matrix proteins lead to the formation of a fibrous cap that covers

the lesion from the lumen (Fig. 1B) [4]. This cap represents a sort of healing or

fibrous response to the injury. Although advanced atherosclerotic lesions can

lead to ischemic symptoms due to progressive narrowing of the vessel lumen,

acute cardiovascular events that result in myocardial infarction and stroke are

generally caused by plaque rupture and resulting thrombosis. Exposure of lipids

and tissue factor to the blood components initiates the coagulation cascade,

causing platelets adherence and ultimately thrombosis. This generally occurs at

Introduction

14

the shoulder region of the plaque and is more likely to happen at sites of

thinning of the fibrous cap [4, 10, 12].

Figure 1: Development of an atherosclerotic lesion. An early atherosclerotic lesion

(A) consists of the accumulation of macrophages-derived foam cells. The

recruitment of monocyte is triggered by the expression of adhesion molecules by

endothelial cells. In advanced lesions (B), smooth muscle cells tent to form a fibrous

cap, which may rupture leading to thrombosis and myocardial infarction. From

reference [4].

Introduction

15

1.2. High Density Lipoproteins (HDL)

Lipoproteins are the major lipid carriers in plasma. According to their density

and diameter they can be divided in six major classes: chylomicrons,

chylomicron remnants, very low density lipoproteins (VLDL), intermediated

density lipoproteins (IDL), low density lipoprotein (LDL) and high density

lipoproteins (HDL). Important risk factors for atherosclerosis are high LDL

plasma levels and low plasma levels of both HDL and its major apolipoprotein

(apolipoprotein A-I, apoA-I). The following part focuses on HDL and their role in

atherosclerosis.

1.2.1. HDL form a Heterogeneous Class of Lipoproteins

High density lipoproteins (HDL) form a heterogeneous class of lipoproteins but

they share a high density (>1.063g/mL), small size (Stoke’s diameter 5-17nm)

and the absence of apolipoprotein B (apoB). On average, lipids constitute 50%

of total HDL mass, namely 30% phospholipids, 10-20% cholesterol and

cholesterol esters and 5% triglycerides. Phospohatidylcholine (about 80% of

phospholipids) and sphingomyelin (about 20% of phospholipids) are

indispensable structural components of HDL and are also needed to dissolve

unesterified cholesterol. Differences in the qualitative and quantitative content of

lipids and proteins result in the formation of distinct HDL subclasses (Fig. 2),

which are characterised by shape, density, size, charge and antigenicity [13].

Following agarose gel electrophoresis of plasma and anti-apoA-I-

immunoblotting, the majority of apoA-I is present in a fraction which migrates

with an α-electrophoretic mobility and is designated α-HDL. This fraction can be

further differentiated according to size and density into HDL2 and HDL3.

Approximately 5-15% of apoA-I in plasma is associated with particles which

have an electrophoretic pre-β mobility. Pre-β-HDL particles are small and

discoidal and they contain apoA-I and apoM either as lipid free apolipoproteins

or in association with a few molecules of phospholipids and free cholesterol [14-

16]. Importantly, relative to the concentration of lipid rich α-HDL, the

Introduction

16

concentration of lipid poor pre-β-HDL particles is increased in extravascular

compartments [17-19].

1.2.2. HDL Metabolism

Lipid free apoA-I or lipid poor pre-β-HDL are produced in the liver and in the

intestine, shed during lipolysis of triglyceride-rich lipoprotein by lipoprotein

lipase or formed by remodelling of HDL in plasma by cholesteryl ester transfer

protein (CETP), phospholipid transfer protein (PLTP), hepatic lipase or

endothelial lipase [13]. HDL precursors become mature lipid rich and spherical

α-HDL by acquisition of additional phospholipids and unesterified cholesterol

either from cells or from apoB-containing lipoproteins. PLTP facilitates the

transfer of phospholipids from cell onto lipoproteins and in between lipoproteins

apoA-I

Hydrophobic Coreof Cholesteryl Esters

Surface Monolayerof Phospholipids and

Free Cholesterol

pre-β-HDL α-HDL

Figure 2: Pre-β-HDL and α-HDL. HDL vary in shape, size and composition.

However, most HDL particles contain apoA-I as major apolipoprotein. Pre-β-HDL

are small, discoidal and consist of apoA-I as lipid free apolipoprotein or in

association with a few molecules of phospholipids and free cholesterol. Mature α-

HDL are large, spherical and lipid-rich particles.

Introduction

17

[20]. Free cholesterol is converted to cholesterol esters by lecithin:cholesterol

acyltransferase (LCAT) to form larger, spherical HDL particles that transport

cholesterol to the liver [21]. Moreover, in the presence of plasma CETP, a

portion of cholesterol esters is transferred to apoB containing lipoprotein

particles for clearance by the liver via the LDL receptor (LDLR) [22]. Finally,

selective uptake of cholesterol ester from circulating HDL is occurring in the

liver via the scavenger receptor BI (SR-BI) [23].

apoA-I

SR-BI

ABCA1 ABCA1

Bile

pre-β-HDLHDL3

CE C CE

LIVER PERIPHERAL TISSUE

C

LDL

LDLR

CETP

LCAT

HDL2

LCATPLTP

ABCG1

apoA-I

SR-BI

ABCA1 ABCA1

Bile

pre-β-HDLHDL3

CE C CE

LIVER PERIPHERAL TISSUE

C

LDL

LDLR

CETP

LCAT

HDL2

LCATPLTP

ABCG1

Figure 3: Schematic representation of HDL metabolism. ApoA-I (lipid-free or lipid-

poor) is secreted by the liver and acquires additional phospholipids and free

cholesterol from hepatic and peripheral tissues via ABCA1 and ABCG1 to become

spherical α-HDL (HDL2 and HDL3). These mature particle transport cholesterol to

the liver where it is used for the production of bile acids. Diverse enzymes such as

LCAT (lecithin cholesterol acyltransferase), PLTP (phospholipid transfer protein)

and CETP (cholesteryl ester transfer protein) are facilitating lipid transfers among

lipoproteins or from cells onto lipoproteins.

C: cholesterol, CE: cholesterol esters. Adapted from reference [5].

Introduction

18

1.2.3. HDL and Apolipoprotein A-I are Atheroprotective

Numerous epidemiological studies have demonstrated that plasma levels of

HDL and apoA-I are inversely correlated with the risk of atherosclerosis [24].

Moreover, rising HDL cholesterol inhibits atherogenesis in several genetic

animal models [25, 26]. HDL and apoA-I are exerting diverse potentially

atheroprotective functions. For example, they reduce oxidative damage, correct

endothelial dysfunction, inhibit inflammation and mediate lipid efflux [27]. The

most classical atheroprotective function of apoA-I and HDL, however, is the

catalysis of cholesterol efflux from the peripheral tissues including macrophages

from the vessel wall [28].

Efflux of lipids mediated by HDL and its apolipoproteins is a crucial process

regulating the cholesterol homeostasis of the organism. Efflux is the only

mechanism by which macrophages can limit or reverse the cellular cholesterol

accumulation [27]. In the absence of ATP-binding cassette (ABC) transporters

A1 or G1 macrophages accumulate massively cholesteryl esters in their

cytoplasm, highlighting the physiological importance of cholesterol efflux for

cholesterol homeostasis in macrophages [29-31]. In addition, as shown by

studies in mice with a targeted knockout of hepatic ABCA1, the lipid efflux from

liver cells mediated by ABCA1 is a rate-limiting step in the assembly of HDL and

is required for the maintenance of normal HDL cholesterol concentrations [32,

33].

Cholesterol efflux requires the conversion of intracellular cholesteryl esters into

free cholesterol as well as active transport of cholesterol to and through the

plasma membrane. This can be reached through three principal pathways (Fig.

4). First, hepatic and intestinal cells secrete lipoproteins, VLDL and

chylomicrons respectively. Macrophages and glia cells can also secrete lipids

together with endogenously produced apolipoproteins (particularly apoE) [34].

Second, some cells convert cholesterol into more hydrophilic bile acids (liver

cells) or oxysterols, notably 24S-hydroxcycholesterol (neurons) or 27-

hydroxycholesterol (macrophages), which are then secreted [35]. Third,

Introduction

19

cholesterol efflux in the proper sense is the transfer of cholesterol from or

through the plasma membrane onto extracellular acceptor particles. Only this

pathway will be further discussed.

Two major mechanisms for cholesterol efflux onto extracellular acceptors have

been described. The first process is passive aqueous diffusion of cholesterol

from the cell surface onto various extracellular acceptors including HDL, LDL,

albumin and protein-free unilamellar phospholipid vesicles. Net cholesterol

efflux by this process requires a concentration gradient between the donor cell

membrane and the various extracellular acceptor particles. Physiologically, this

is reached by extracellular cholesterol esterification through the enzyme LCAT.

LpE

cholesterylesters cholesterol

27-hydroxy-cholesterol

ApoA-I

HDL

ApoE

1

2

3

INOUT

ABCA1

ABCG1

SR-BI

LpE

cholesterylesters cholesterol

27-hydroxy-cholesterol

ApoA-I

HDL

ApoE

1

2

3

INOUT

ABCA1

ABCG1

SR-BI

Figure 4: Principal cholesterol efflux pathways in macrophages. 1 secretion of apoE

containing lipoproteins (LpE) 2 oxidation of cholesterol by CYP27 into more

watersoluble and secretable 27-hydroxycholesterol, 3 cholesterol efflux in the

proper sense onto extracellular acceptor particles.

Introduction

20

The cholesterol exchange rate between the cell membrane and lipoproteins can

be enhanced by plasma membrane receptors, for example SR-BI, which tether

lipoproteins to the cell surface and induce a redistribution of cholesterol in

lateral plasma membrane domains [36-38]. The second process requires the

interaction of apoA-I with ABCA1 or HDL with ABCG1 and may involve

retroendocytosis of apoA-I or HDL. In other words, HDL/apoA-I may be

internalised via receptor-mediated endocytosis, interact with lipid droplets for

lipidation and be resecreted without being degraded [39].

1.3. HDL and ApoA-I Binding Proteins

Several proteins have been shown to interact either with apoA-I or with HDL on

the surface of cells and thereby to play an important role in HDL metabolism:

ATP binding cassette A1 (ABCA1), scavenger receptor BI (SR-BI) and F0F1

ATPase (Fig. 5). The principal characteristics of these proteins and their role in

HDL metabolism are introduced in this section.

Introduction

21

Figure 5: Topological models of ABCA1, SR-BI and mitochondrial F0F1 ATPase.

ABCA1, SR-BI and the beta chain of F0F1 ATPase have been shown to interact with

either apoA-I or HDL and to play critical functions in HDL metabolism. ABCA1

belong to the ATP binding cassette transporter family and consist of 2 6-helix

transmembrane domains and two nucleotide binding domains (A and B design the

Walker domains A and B). SR-BI comprises two transmembrane domains, two

cytoplasmic domains and a large extracellular loop. F0F1 ATPase is a large complex

arrange in two domains: a transmembrane domain F0 (subunits a, b, c) and a

catalytic domain F1 (subunits α, β, γ, δ and ε). Adapted from [7-9]

Introduction

22

1.3.1. ABCA1

ABCA1 is a 2261 amino acid, 240 kDa protein belonging to the large ATP

binding cassette (ABC)-transporter family. ABC transporters use ATP as an

energy source that drives the transport of a wide variety of molecules. Full ABC

transporters typically consist of two six-helix transmembrane domains that make

up a pathway for the translocation of substrates across membranes and two

nucleotide binding domains that bind ATP and provide the energy for the

transport [28].

Recently, mutations in the ABCA1 gene were identified as the cause of Tangier

disease [40-43], a rare disease characterised by very low levels of plasma HDL

and accumulation of cholesterol and cholesteryl esters in macrophage foam

cells in tonsils, liver, spleen and many other tissues [44]. Furthermore,

cholesterol and phospholipid efflux to apoA-I from fibroblasts and macrophages

of Tangier disease patients is markedly reduced [44, 45]. Like Tangier disease

patients, ABCA1 knock-out mice exhibit HDL deficiency and reduced cellular

cholesterol efflux activity [33]. Both systemic and selective hepatic

overexpression of ABCA1 in mice results in an increase of HDL plasma levels

[46, 47]. Vice versa, apoA-I and HDL plasma levels are dramatically reduced in

mice with a liver specific deletion of ABCA1 [32]. Interestingly, the selective

inactivation or expression of ABCA1 in macrophages has little or no effect on

the plasma concentration of HDL [48]. Hence, hepatic ABCA1 expression is a

rate limiting factor for plasma HDL production whereas macrophages do not

contribute significantly to the formation of HDL. However, the selective knock-

out of ABCA1 in macrophages of either apoE-null or LDL receptor-null mice

significantly enhances the development of atherosclerosis [31]. Thus, although

ABCA1 in macrophages has little influence on HDL plasma levels, it crucially

prevents the excessive cholesterol accumulation in macrophages of the arterial

wall and their transformation into foam cells. However, whether ABCA1 directly

interact with apoA-I for cholesterol efflux, and hence has to be considered as a

receptor, is still ambiguous [39].

Introduction

23

Interestingly ABCA1 has been implicated in diverse endocytic processes. The

loss of ABCA1 function in Tangier fibroblasts is associated with enhanced

transferrin and dextran uptake [49]. Moreover, ABCA1, which is homologous to

the product of ced-7, one of the engulfment genes in nematode, has been

shown to promote engulfment of apoptotic cells [50]. To explain these results,

ABCA1 has been proposed to function as a phosphatidylserine translocase [50,

51], which would supply phosphatidylserine to the exofacial leaflet of the

membrane while depleting phosphatidylserine from the internal leaflet. Both of

these movements favour outward membrane bending [52, 53] and would

explain the role of ABCA1 in transferrin endocytosis, fluid phase uptake and

engulfment of apoptotic cells. However, it is still challenging to understand how

a phosphatidylserine translocase can possibly facilitate lipid efflux.

1.3.2. SR-BI

SR-BI is a 509 amino acid cell surface glycoprotein with a molecular mass of 82

kDa. Its predicted secondary structure comprises two transmembrane domains

and two cytoplasmic domains as well as a large extracellular loop containing

several N-glycosylation sites [54]. SR-BI is expressed in various mammalian

tissues and cells, including endothelial cells. The highest expression of SR-BI,

however, is in organs with critical roles in cholesterol metabolism (liver) and in

steroidogenesis (adrenal, ovary and testis) [55]. Distinct binding sites on SR-BI

have been implicated in the binding of a wide array of ligands, including anionic

phospholipids, advanced glycation end products, apoptotic cells as well as

native and modified lipoproteins (HDL, LDL acetylated, LDL, oxidized LDL and

VLDL), but not lipid free apoA-I [56].

Importantly, SR-BI mediates the selective uptake of cholesteryl esters from HDL

by cells through a process in which the cholesteryl esters are internalised

without the net uptake and degradation of the lipoprotein itself [57]. However,

the exact mechanisms for selective uptake of cholesteryl esters are largely

unknown. SR-BI reconstituted into liposomes mediates high affinity lipoprotein

binding and selective cholesterol uptake, indicating that selective uptake is an

Introduction

24

intrinsic quality of the receptor that does not require cellular structures or

compartments [58]. Alternatively, several recent studies have indicated a so-

called retroendocytosis pathway, which involves the holoparticle uptake of HDL

followed by resecretion of cholesteryl esters poor HDL leading to the net uptake

of lipids [59]. The relative contribution of each pathway is currently unknown. In

addition to its role in selective uptake of HDL cholesteryl esters, SR-BI

stimulates the bi-directional flux of free cholesterol between cells and HDL and

the rate of cholesterol efflux from various cell types correlates with the

expression of SR-BI [37, 60]. Furthermore, in endothelial cells SR-BI mediates

the activation of endothelial nitric oxide synthase (eNOS) by HDL [61]. This last

phenomenon is dependent on the presence of HDL but not lipid-free apoA-I.

Finally, Van Eck et al. showed that while hepatic cholesterol homeostasis is

maintained in SRBI-/- mice, SR-BI deficiency is associated with deregulation of

the cholesterol homeostasis in the arterial wall, resulting in increased

susceptibility to atherosclerosis [62]. Expression of SR-BI in macrophages

protects mice against atherosclerotic lesions development [63]. These data

strongly suggest a critical antiatherogenic role of SR-BI not only in the liver but

also in the arterial wall.

1.3.3. F0F1 ATPase

F0F1 ATPase is an enzymatic complex responsible for ATP synthesis in

mitochondria, prokaryote membranes and chloroplasts. The mitochondrial F0F1

ATPase (about 600 kDa) is composed of two domains: an extra-membranous

catalytic domain (F1) and a transmembrane domain (F0). Unexpectedly, it has

been found on the cell surface of endothelial cells, adipocytes, hepatocytes and

tumor cells, by immunofluorescence or after biotinylation of the cell surface [64-

68]. Although the mechanism leading to ectopic expression is unknown, F0F1

ATPase is not the only mitochondrial-matrix protein found at extramitochondrial

sites and shown to play functional roles in their unusual location [69, 70]. For

example, the cell surface fatty acid binding protein (FABP) is encoded by the

same gene as the mitochondrial aspartate aminotransferase (AspAT) [71]. It

has been shown that the mitochondrial AspAT precursor has an N-terminal

Introduction

25

mitochondrial targeting sequence, whose post-translational cleavage generates

FABP. In deed, transfection of mitochondrial AspAT in cells that do not express

it results in uptake of saturable fatty acid [72]. In addition, proteins from the

mitochondrial inner membrane (mitofilin, prohibitin, NADH-dehydrogenase,

ubiquinol-cytochrome c-reductase and F0F1 ATPase subunits α, β, γ, b, d, e, F6

and OSCP) have been found in proteomic studies performed on lipid rafts,

purified using detergent resistance or cationic silica [66, 73, 74]. Interestingly, F1

components and other mitochondrial proteins are enriched in the raft fraction

containing caveolin-1 [73]. By confocal microscopy, the α and β subunits of F0F1

ATPase were colocalised with the raft marker cholera toxin B [66].

The beta chain of F0F1 ATPase (β-ATPase) belongs to the F1 domain, which

contains the binding sites for ATP and ADP and the catalytic site for ATP

synthesis and hydrolysis [75]. In endothelial cells, angiostatin binds to and

inhibits cell surface F0F1 ATPase and anti-F0F1 ATPase antibodies reduce

endothelial cell proliferation [65, 76]. In hepatocytes, F0F1 ATPase hydrolyses

ATP upon binding of apoA-I, which triggers the uptake of HDL holoparticle [67].

It was found that the ADP produced by F0F1 ATPase stimulates P2Y13, which

ultimately regulate HDL endocytosis [67, 77]. Extracellular ADP can act through

the P2Y receptor family, which consists of 8 subtypes. P2Y1, P2Y2 and P2Y11

are the major nucleotide receptors on human vascular endothelial cells [78].

They contain seven membrane spanning domains and are coupled via G-

protein to adenylate cyclase or to phospholipase C, resulting in IP3 and Ca2+

release from intracellular stores [79, 80]. Interestingly, P2Y receptors on the

surface of endothelial cells have been involved in the regulation of cell adhesion

and permeability [81-83].

Introduction

26

2. Transport of Macromolecules through Continuous Endothelia

2.1. Transport Pathways

The endothelium forms an exchange barrier between plasma and tissues

(including the vascular wall), which is highly permeable to small molecules but

little permeable to macromolecules such as proteins. This relative

impermeability to large solutes is a prerequisite for the maintenance of fluid

equilibrium between plasma and interstitium. Still, macromolecules do cross the

endothelium to provide tissues with antibodies, protein-bound hormones, or

other macromolecules. Two mechanisms of transendothelial protein transport

have been controversially discussed. One view is that macromolecules are

shuttled by vesicles across the endothelium by “transcytosis”. The other view

favours a passive and convective transport mode across large pores located

either paracellularly or transcellularly, i.e. “porous transport” (Fig.6).

Figure 6: The different transport pathways through endothelial cells. Paracellular

transport refers to widened interendothelial junctions (IEJ). Transcellular transport

includes transport across transendothelial channels formed by fusion of caveolae

vesicles and transcytosis (vesicular transport). Adapted from reference [1].

PM: plasma membrane

Introduction

27

2.1.1. Protein Transport through Large Pores

Papenheimer described the transport of small hydrophilic molecules and

formulated the “pore theory" of capillary permeability [84]. This theory predicts

the diffusion across capillary walls of small hydrophilic solutes through water-

filled channels with a radius of 3-4 nm. It is generally accepted that small

hydrophilic molecules (such as water, sugars, amino acids and urea) are

transported paracellularly through discontinuities in the tight junctions. In 1956,

Grotte described the permeability of dextran with diverse molecular weight and

presented evidence for a two-pore barrier partitioning blood from lymph [85].

Large molecular size dextrans appeared in canine leg lymph in concentration

that decreased rapidly as a function of increasing molecular size for molecules

smaller than albumin (< 4.5 nm in radius). Larger molecules still appeared in

lymph, but at concentrations that were only slightly affected by molecular size.

This suggests that the pathway for transport of macromolecules differs from that

of small solutes. Therefore, it was proposed that a few large pores (1/30,000 of

the small pores) with a radius of 25-60 nm would account for the transport of

plasma proteins.

In an alternative hypothesis to the two-pores theory, the fibre-matrix model, the

sieving properties were attributed to the endothelial glycocalyx in series with the

interendothelial junctions [86]. The large pores theory is however not supported

by morphological studies and the structure of the large pores is still unknown. In

contrast, studies of the endothelial barrier at an ultrastructural level conclusively

showed the involvement of vesicles or vesicles-derived structures in the

transport of macromolecules through continuous endothelia [87-89].

2.1.2. Interjunctional Protein Transport

Endothelial cells adhere to one another through junctional structures formed by

transmembrane adhesive proteins. The transmembrane proteins are linked to

specific intracellular partners, which mediate anchorage to the actin

cytoskeleton and as a consequence stabilise junctions. Two major types of

Introduction

28

junctions have been described in endothelial cells: adherens junctions and tight

junctions (Fig. 7).

Adherens junctions are formed by transmembrane adhesion proteins of the

cadherin family, which mediate homophilic adhesion and are able to organise in

multimeric complexes at the cell border [90, 91]. Endothelial cells express a

specific cadherin called vascular endothelial cadherin (VE-cadherin). The

cytosolic tail of VE-cadherin is homologous to that of other classic cadherins

and through its carboxy- (C-) terminal region it binds β-catenin and

plakoglobulin. These two proteins are homologous and contain 10-13 armadillo

repeats, which are also present in many other signalling proteins. Both β-

catenin and plakoglobulin bind α-catenin, which anchors the complex to actin

[92].

Tight junctions were defined by electron microscopy as a specialisation of the

plasma membrane. In thin sections, tight junctions appear as a sequence of

fusions formed between two adjacent cells by the outer leaflets of the plasma

membrane. At higher magnification, however, it becomes clear that the

membranes are not fused but in tight contact to each other. Occludin and

claudin are transmembrane proteins at the tight junctions [93, 94]. They are

predicted to contain two extracellular loops and four membrane-spanning

regions. Both N- and C-termini are localised in the cytoplasm. The cytoplasmic

domains of occludin and claudin bind ZO-1, a cytoplasmic plaque protein from

the family of membrane-associated guanylate kinase, which plays an important

role in organising paracellular seal (Fig. 7). ZO-2 is another well-characterised

protein in the cytoplasmic plaque that links the tight junction to cytoskeletal

filaments including actin. Finally, tight junction components interact with several

signal transduction molecules, such as G proteins and protein kinases, which

ultimately regulate cell proliferation, polarity and permeability. Interestingly,

expression of occludin in the endothelium correlates with the permeability of

different segments in the vascular tree [95].

In non-absorptive epithelia (e.g. urinary bladder), tight junctions represent a

waterproof barrier. In endothelial cells, however, tight junctions only restrict but

do not block the passage of fluids. It is generally accepted that discontinuities in

the tight junctions accommodate most of the water and small solutes transport

Introduction

29

through the endothelium but would not normally allow significant passage of

macromolecules. However, in case of inflammation paracellular permeability to

plasma proteins is increased. Among extracellular stimuli acting on tight

junctions there are inflammatory cytokines. For example interferon-γ enhances

permeability of the T84 epithelial cell line, reduces ZO-1 expression, causes the

redistribution of occludin and ZO-2 and disrupts apical actin [96]. Similarly,

VEGF provokes the phosphorylation of occludin, the disassembly of tight

junctions and the increase in transport of 70 kDa dextran [97, 98].

Figure 7: The arrangement of the tight junction (ZO: zonula occludens) and the

adherens junction. The integral proteins occludin and claudin, which form the tight

junction, are displayed along with peripheral membrane proteins associated with the

tight junction, such as ZO-1 and ZO-2. The adherens junction involves homophilic

adhesion of the transmembrane protein VE-cadherin. Cadherins are linked to the

cytoskeleton via catenins and plakoglobulin. Adapted from reference [6].

Introduction

30

2.1.3. Vesicular Transport

The relative contribution of transcytosis versus large-pore transport to the

transport of macromolecules across endothelia has been controversial for the

last 50 years. Ultrastructural studies showed that electron opaque protein

tracers (albumin, insulin) in transit through the endothelium do not label

interendothelial junctions. Intravascular albumin tracers were rather detected on

the luminal endothelial membrane, in vesicles and in the interstitial space [99].

Moreover, the transport of tracers is inhibited by N-ethyl maleimide (NEM), a

reagent known to interfere with vesicular docking and fusion to target

membranes [100]. Caveolae preparations from lung vasculature contain

molecules involved in docking and fusion of vesicles such as vesicle-associated

membrane protein VAMP-2, NEM sensitive factor (NSF) and SNAP-25 as well

as in vesicle fission such as dynamin [101-104]. The use of cholesterol-binding

agents (filipin or methyl-β-cyclodextrin) which disassemble caveolae

demonstrated the implication of caveolae in albumin transcytosis [105, 106]. In

addition, the caveolin-1 (key structural component of caveolae) knockout mice

exhibit a loss of caveolae and of vesicular albumin transport. Interestingly, the

interendothelial junctions were open and capable of transporting albumin.

Although this might represent a compensatory adjustment, this result raises the

possibility that caveolae contribute also to the regulation of paracellular

endothelial permeability. Finally, as the radius of the neck region of vesicles

(~25 nm) approximates the dimension of large pores, it has been proposed that

caveolae constitute the postulated large pore system [99]. In other words, short-

lived channels might be formed by transient fusions of endothelial cell vesicles.

This last hypothesis would satisfy both the convective nature of macromolecule

transport and the ultrastructural data.

Introduction

31

2.2. Caveolae mediated Transcytosis

In endothelial cells, caveolae mediated internalisation contributes to more than

85% of the uptake process, as evaluated using cell surface biotinylated proteins

or biotinylated cholera toxin [107]. Caveolae were first identified in the 1950s by

Palade in endothelium as rounded or flask-shaped plasma membrane

invaginations of 50-80 nm in diameter (Fig. 8). They were thought to be sessile

structures but recently the highly dynamic nature of caveolae trafficking was

demonstrated [108]. In this study two subset of caveolae are described. One

subset is transport-incompetent and is found as clusters in multicaveolar

assemblies as previously described. The second subset undergoes continuous

“kiss and run” cycles in small volume below the plasma membrane and

occasionally long distance trafficking to intracellular pools.

Although caveolae do not show an electron-dense layer on their cytosolic

surface in thin-section electron microscopy, they do have a protein "coat"

composed primarily of a protein called caveolin-1 (Fig. 8). Caveolin-1 is an

integral membrane protein of 22 kDa required for the formation of caveolae. In

deed, in caveolin-1 knock-out mice caveolae are absent [109, 110]. It has an

unusual hairpin topology in that the N- and C- terminal domains are cytosolic,

connected by a hydrophobic sequence that is buried in the membrane but does

not span the bilayer. Caveolin-1 is palmitoylated in the C-terminal segment, can

be phosphorylated on tyrosine residues, binds cholesterol and forms dimers

and higher oligomers [111]. The caveolin oligomerisation is in part responsible

for the striations visualised on the cytosolic surface by electron microscopy. In

general, caveolae are highly enriched in cholesterol and sphingomyelin.

Cholesterol is required for caveolin-1 oligomerisation and recruitment at the

plasma membrane.

Introduction

32

The caveolae vesicular system is supported in endothelial cells by proteins

involved in fission, targeting and fusion (dynamin, intersectin, SNARE, etc).

Dynamin is a 100 kDa GTPase which undergoes GTP dependent self-assembly

to form higher order structures: dynamin rings and spirals [112]. The GTPase

activity generates a constricting force around the collar of vesicles undergoing

fission (Fig. 9) [113]. In endothelial cells, overexpression of a mutant dynamin

lacking normal GTPase activity not only inhibits GTP induced fission and

Figure 8: Caveolae in endothelial cells. Endothelial cells are very thin (0.2-0.5 µm) in

regions excluding nuclei (A). At a higher magnification (B and C), they present flask-

shaped invaginations attached to both the luminal and the interstitial surfaces, the

caveolae. D is a schematic representation of caveolae and its oligomeric coat

protein, caveolin-1. E is an enlarged version of D. Caveolin-1 forms hairpin

structures with both its N- and C-terminal ends facing the cytoplasm. Three

palmitoyl chains at the caveolin C-terminal tail are inserted into the bilayer.

Caveolae are enriched in cholesterol and glycosphingolipids. Adapted from [2].

Introduction

33

budding of caveolae but also prevents internalisation of cholera toxin and

albumin transcytosis [114, 115].

Intersectin is an important partner of dynamin. Two highly similar genes,

interesectin-1 and intersectin-2 have been identified, each producing two

isoforms by alternative splicing. Intersectin-1 has been localised at the caveolae

neck region and seems to recruit dynamin to generate a high local

concentration required for collar formation, caveolae fission and internalisation

[107]. Intersectin interacts also with the SNARE (soluble N-ethylmaleimide-

sensitive factor attachment protein receptor) proteins SNAP-25 and SNAP-23

[116, 117], indicating that intersectin might not only be involved in vesicle fission

but also fusion with the targeted membrane.

Normal intracellular trafficking of cholera toxin B, a caveolae marker, is impaired

when the vesicle associated membrane protein VAMP-2 is cleaved by

botulinum toxin D, suggesting that caveolar trafficking requires intact SNARE

machinery (vesicle-associated v-SNARE and target membrane-associated t-

SNARE) [104]. Diverse proteins involved in vesicle docking and fusion were

localised to endothelial caveolae: VAMP-2, syntaxin-4, SNAP-23, SNAP-25,

NSF and α-SNAP [102, 104]. Syntaxin-4 and SNAP-23 seems to cluster to

regulate caveolar fusion with the basolateral plasma membrane of endothelial

cells [117].

Introduction

34

Figure 9: Model for caveolar fission, docking and fusion mechanisms in endothelial

cells. Dynamin and proteins from the SNARE machinery (VAMP-2, syntaxin-4 and

SNAP-23) have been localised to endothelial caveolae. NSF and α-SNAP have also

been found associated with caveolae in endothelial cells. They are important

regulatory proteins which catalyse the ATP dependent disassembly of the SNARE

complex after membrane fusion. Adapted from [3].

Introduction

35

2.3. Lipoprotein Transport through the Endothelium

Within the arterial intima, HDL are the most abundant lipoproteins [15]. In

addition, relative to the amount of lipid rich mature HDL, the concentration of

lipid poor pre-β-HDL is increased in extravascular compartments, where they

are thought to exert their atheroprotective activity [118]. This suggests that HDL

and preferentially lipid poor apoA-I are transported through the aortic

endothelium. Furthermore, the flux of both pro-atherogenic LDL and anti-

atherogenic HDL into the vascular wall are considered as rate limiting steps in

atherosclerosis [12]. Studies demonstrated that the influx of lipoproteins into the

vascular wall increases with the plasma concentration and decreases with the

size of lipoproteins [119, 120]. Therefore, it is generally believed that

lipoproteins enter the vascular wall by passive leakage through damaged parts

of the endothelium [119]. Only a few experimental data on LDL transport are

available, some of them supporting transcytosis other passive filtration [121-

125]. Even less is known about the transendothelial transport of HDL [126-128].

De Vries et al. found high-affinity HDL binding sites on the surface of brain

capillary endothelial cells but observed that HDL transport is not saturable.

Thus, HDL was suggested to be transported paracellularly [128]. In another

study, HDL3 was saturably transcytosed across the blood brain barrier.

Basolateral resecreted HDL3 were partly depleted in lipid tracers and the

transcytosis was inhibited by antibodies against SR-BI, which is primarly

expressed on the apical side and colocalises with caveolin [126]. To conclude,

both paracellular and transcellular transport of HDL might occur in endothelial

cells.

Introduction

36

3. Problematic

The transport of lipoproteins into the vascular wall is considered as a rate

limiting step in the development of atherosclerosis [12]. However, little is known

about the transport of HDL and lipid poor apoA-I through endothelial cells.

Therefore, we studied the interaction of apoA-I with aortic endothelial cells and

addressed three questions:

1. How does apoA-I interact with endothelial cells and how is apoA-I

transported through a monolayer of endothelial cells?

2. Which receptor(s) or transporter(s) are involved?

3. Which pathways are involved?

The goal of the first question is to characterise apoA-I binding, cell association,

internalisation and transport in bovine aortic endothelial cells. With the second

question, we intend to study the involvement of known HDL/apoA-I binding

proteins (ABCA1, SR-BI and F0F1 ATPase) in binding, internalisation and

transport of apoA-I. The purpose of the third question is to find out whether

apoA-I transcytosis occurs via caveolae, clathrin coated pits pathway or an

alternative pathway.

Materials and Methods

37

MATERIALS AND METHODS

Isolation and Labeling of Lipoproteins and ApoA-I - Human LDL (1.019 < d <

1.063 kg/L) and HDL (1.063 < d < 1.21 kg/L) were isolated from normolipidemic

plasma of blood donors by sequential ultracentrifugation [129]. Lipid-free human

apoA-I was extracted from HDL as described previously [130] and labeled with 125I using Iodo-Beads iodination reagent (Pierce) and Na125I, according to the

manufacturer's instructions. In a typical reaction, we used 1 mCi Na125I, 1.5 mg

apoA-I, and two beads. Proteins were separated from unincorporated 125I on a

Sephadex G-25 (Amersham Biosciences) column, followed by extensive dialysis

(against 150 mM NaCl, 0.3 mM EDTA, pH 7.4) to remove residual free iodine.

The specific activity expressed as cpm/ng protein was calculated based on the

protein concentration, measured by the Dc protein assay (Bio Rad) and the 125I

counts. Specific activities of 600-1200 cpm/ng protein were obtained.

Cell Culture – Bovine aortic endothelial cells (BAEC) were isolated from bovine

aorta by collagenase digestion using standard protocols [131, 132] and cultured

in regular tissue culture dishes in Dulbecco's modified Eagle medium (DMEM)

supplemented with 5% fetal calf serum (FCS) at 37°C in a humidified 5% CO2,

95% air incubator .

125I-apoA-I 4°C Binding Assay - Cells were seeded in 24-well dishes at 100,000

cells/well and grown until confluence (2 days). On the assay day, cells were

prechilled on ice for 15 min, washed twice with DMEM and incubated in DMEM

Hepes 1% BSA containing 5 µg/mL 125I-apoA-I, in the absence (triplicate

determinations) or in the presence (at least double determinations) of a 40-fold

excess of unlabeled apoA-I (or the indicated competitor). After 2 h incubation at

4°C, cells were washed once with cold Tris/BSA wash buffer (50 mM Tris-HCl,

150 mM NaCl, pH 7.4, 2 mg/ml BSA) and twice with cold Tris wash buffer (50

mM Tris-HCl, 150 mM NaCl, pH 7.4). Cells were then solubilised in 0.5 ml of 0.1

M NaOH for 1 hour at room temperature. The amount of bound radioactivity

Materials and Methods

38

was determined using a Perkin Elmer γ-counter and the protein content was

measured with total protein urine/CSF assay, Cobas Integra, Roche.

For differential binding studies, endothelial cells were cultured for 2 days in a

two compartments system to form a tight monolayer. The label was added to

the upper (apical side) or to the lower compartment (basolateral side),

respectively with and without a 40-fold excess of unlabeled apoA-I. The

samples were analysed essentially as described before.

125I-apoA-I 37°C Cell Association Assay – Cell association of 125I-apoA-I was

performed as 4°C binding, except that the assays were conducted for 30

minutes at 37°C.

Total and Partial 125I-apoA-I Degradation Assay – Total degradation of 125I-

apoA-I was measured by quantifying the radiolabelled amino acids released in

the medium, as previously described [133]. BAEC were incubated 4 h at 37°C

with 5 µg/mL 125I-apoA-I in DMEM Hepes 1% BSA. The amount of 125I-apoA-I

degradation products in the medium was measured after TCA precipitation and

extraction (with trichlormethane) of hydrogen peroxide oxidised free iodide. The

radioactivity of the water phase containing the cellular degradation products

was measured and normalised to the protein content. Partial degradation was

assessed by loading on a SDS PAGE the cell lysate after 4 h incubation at 37°C

with 5 µg/mL apoA-I

125I-apoA-I Internalisation Assay - The assay was performed as described for

the cell association studies. After 30 min incubation with 125I-apoA-I, the cells

were washed as described earlier and chilled on ice 15 min. Cell surface

proteins were biotinylated at 4°C using 500 µg/mL EZ-link-sulfo-NHS-LC-biotin

(Pierce) in PBS containing 0.1 mM CaCl2 and 1mM MgCl2, lysed in 10 mM Tris

pH 7.4, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS. The

biotinylated cell-surface proteins were pulled down with streptavidin-conjugated

sepharose beads (Amersham Biosciences). The radioactive counts of the

supernatant containing the internal proteins were measured and normalised to

the protein contents. Alternatively, internalisation of 125I-apoA-I biotinylated with

Materials and Methods

39

EZ-link-sulfo-NHS-SS-biotin (Pierce) was studied. The biotin moiety from the

cell surface bound biotin-125I-apoA-I was cleaved at 4°C in the presence of 50

mM DTT. After lysis, internal biotinylated 125I-apoA-I was pulled down with

streptavidin sepharose.

125I-apoA-I Transport Studies – To study the transport of apoA-I, BAEC were

plated on the upper side of porous filter inserts (0.2 µm) (BD Biosciences)

coated with rat-tail collagen (BD Biosciences) (50 µg/ml in 0.05 M acetic acid) at

a density of 50’000 cells/cm2, 2 days prior the assay. Considering the

polarisation of the cells identical to the one in the vascular wall, we called the

upper compartment “apical compartment” and the lower compartment

“basolateral compartment”. A typical transport assay was conducted at 37°C for

30 min or otherwise in the indicated conditions. The tightness of the monolayer

was assessed by measuring the permeability of 3H-inulin. The medium in the

apical compartment was removed and substituted with assay medium

containing 2.5 µCi 3H-inulin/ml. Samples of 50 µl were taken in duplicate from

the basolateral compartment every 20 min (over 4 h) and replaced with 100 µl

fresh mediums. Permeability calculations were performed using equation

derived from Fick's first law, described by Youdim et al. [134].

Papp (cm/s)= VA / (A MA)*(∆MB / ∆t) (Equation 1)

Papp = apparent permeability coefficient, VA = apical volume (cm3), A =

membrane surface area (cm2), MA = apical 3H-inulin amount (cpm), ∆MB/∆t=

change in amount of 3H-inulin (cpm) in basolateral compartment over time.

For the transport studies, the growth medium was replaced with DMEM Hepes

1% BSA and 125I-apoA-I was added to the upper chamber with and without a

40-fold excess of unlabeled apoA-I or HDL at the indicated final concentrations.

During the incubation, aliquots of the medium from the basolateral compartment

were removed (100 µl) and substituted with fresh DMEM, and the radioactivity

was measured. At the end of the assay aliquots of the medium from the

basolateral compartment were collected, the radioactivity was measured and

Materials and Methods

40

the protein bound radioactivity was calculated from the difference of the total

radioactivity minus the non-trichloroacetic acid (TCA) precipitable radioactivity.

The cell permeability of 125I-apoA-I was determined using equation 2. The

equation 2 is derived from the equation 1 and takes into account mass balance

correction for 125I-apoA-I binding in the cell layer (Mcell).

Papp (cm/s)= VA / [A x (MA - Mcell)] x (∆M / ∆t) (Equation 2)

Furthermore, the medium in the basolateral compartment was analysed on a

1% agarose (50 mMol sodium barbitate, pH 8.6). Samples were loaded onto the

gels and the electrophoresis was performed at 4°C. For SDS-PAGE, the

samples were heated for 5 min at 95°C prior loading on a 10% SDS gels and

separated at room temperature. Both gels were exposed after fixation to a

phosphor imager screen.

Specific binding, cell association, internalisation, degradation and transport

were determined by subtracting the values obtained in the presence of

unlabeled apoA-I (nonspecific) from those obtained in the absence of excess

unlabeled apoA-I (total).

Pharmacological Treatments and Inhibitors – ABCA1 expression was stimulated

by a mixture of 22-R-hydroxycholesterol and 9-cis retinoic acid (Sigma), 10µM

each for 30 h. BAEC were also incubated with cyclosporin A (Sigma), 20 µM for

4 h prior the assay or with IF1 (Abnova, Taipei, Taiwan), 100 nM in DMEM

Hepes pH 6.4 containing 1% BSA for 30 minutes prior the assay. We also used

a β-ATPase blocking antibody (MS503, MitoSciences, Eugene, USA), 2 µg/mL

10 minutes prior the assay. Finally, internalisation was measured after

stimulating the cells 10 minutes before the assay with 100 nM ATP or 100 nM

ADP. Cyclosporin A, IF1, the β-ATPase blocking antibody ATP and ADP were

still present in the assay medium.

siRNA Transfection – BAEC were transfected when the monolayer were 90%

confluent. 67nM BLOCK-iTTM fluorescent oligo and 100nM Stealth siRNA

Materials and Methods

41

(Invitrogen) against SR-BI (GTCAGCAAGGTCAACTATTGGCATT), ABCA1

(GGGACTTAGTGGGACGAAATCTCTT), the beta chain of the F0F1 ATPase (G

CAGAATCCCTTCTGCTGTGGGTTA), clathrin heavy chain (GCGCTTAGTGTG

TACTTAAGGGCTA), caveolin-1 (TCTGGGCAGTTGTACCATGCATTAA) or not

coding siRNA (TCTACGTTGATGACCCGTTAGGTAA) were transfected with

Lipofectamine 2000 in OPTIMEM (Invitrogen), according to the manufacturer’s

protocol. 6 h after transfection, the medium was replaced by DMEM 5% FCS

without antibiotics. Binding, internalisation and transport assays were conducted

2-3 days after transfection. The efficiency of the silencing was evaluated by

quantitative RT-PCR and western blotting.

Quantitative RT-PCR – RNA was isolated with RNeasy mini (Qiagen) according

to the manufacturer’s protocol. Reverse transcription was performed using

Superscript II RT (Invitrogen) following the standard procedure. Quantitative

PCR was done with LightCycler FastStart DNA Master SYBR Green-I (Roche).

The primers used for the amplification were: ABCA1 (GTCATTATCATCTTCAT

CTGCTTCC, CCTCACATCTT CATCTTCATCATTC, 60°C, 5 mM MgCl2), SR-BI

(GGAATCCCCATGAACTG, CTTGGGAGCTGATGTCATC, 58°C, 5mM MgCl2),

the β-chain of the F0F1 ATPase (GGTAGCGCTGGTGTACGGTC, CGGGACAA

CACAGTGGTAGC, 64°C, 3mM), clathrin heavy chain (TGTGTAGGCCTGTAC

TTCA, CTGGACTGATACGCATAACA, 64°C, 3 mM MgCl2) and caveolin-1 (GG

AACAGGGCAACATCTACA, CAGACAGCAAGCGGTAA, 64°C, 3 mM MgCl2).

The transcription levels were normalised to GAPDH (GTCTTCACTACCATGGA

GAAGG, TCATGGATGACCT TGGCCAG, 58°C, 4mM MgCl2).

Cell Surface Biotinylation – Cell monolayers were biotinylated with 250 µg/mL

EZ-link-sulfo.NHS-LC-biotin (Pierce) in PBS containing 0.1 mM CaCl2 and 1

mM MgCl2 at 4°C for 1 hour. The reaction was terminated by a 5 min incubation

in DMEM. Cells were lysed in 10 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40, 1%

sodium deoxycholate, 0.1% SDS. The lysates were incubated with 25 µL

streptavidin-conjugated sepharose beads (Amersham Biosciences) at 4°C

Materials and Methods

42

overnight. The beads were washed 3 times with the lysis buffer and the pulled

down proteins were resolved on a SDS-PAGE.

Western Blotting – BAEC were lysed in RIPA buffer (10mM Tris pH 7.4, 150mM

NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, protease inhibitors

(complete EDTA, Roche)). 50 µg total protein were loaded on the gel. ABCA1

(ab18180, Abcam, Cambridge, UK), SR-BI (ab3, Abcam, Cambridge, UK), the

β-chain of the F0F1 ATPase (MS503, MitoSciences, Eugene, USA), clathrin

(ab11331, Abcam, Cambridge, UK), caveolin-1 (ab2910, Abcam, Cambridge,

UK) expression levels were normalised to actin (AC-15, Sigma).

Determination of Extracellular and Intracellular ATP Concentrations –

extracellular and intracellular ATP concentrations were measured by luciferase

driven bioluminescence (ATP bioluminescence assay kit HSII, Roche). Cells

were rinsed twice in DMEM prior incubation in DMEM Hepes 1% BSA

containing or not 5 µg/mL apoA-I. After 30 min incubation, the assay medium

was collected to measure the extracellular ATP concentration and the cells

were lysed in the provided lysis buffer to determine intracellular ATP

concentration.

Isolation of Caveolae-Enriched Membranes – BAEC were chilled on ice for 15

min and rinsed twice with ice cold PBS containing 0.1 mM Ca2+, 1 mM Mg2+.

Cells were scraped with 0.2% Triton X-100 in MBS (MES –buffered saline, 25

mM MES hydrate buffer, pH 6.5, containing 150 mM NaCl, 5mM EDTA, and

protease inhibitor (Complete, Roche)) and left on ice for 20 min. The lysate was

subjected to 10 strokes in a loose-fiting Dounce homogeniser and centrifuged

(500xg, 5 min, 4°C). The supernatant was mixed with an equal amount of 80%

(w/v) sucrose-MBS, transferred at the bottom of an ultracentrifuge tube and

overlaid with 6mL 35% sucrose-MBS and 3 mL 5% sucrose-MBS. After

centrifugation (40 000 rpm, 20 h, 4°C) in SW41 rotor (Beckman Coulter),

fractions of 1 mL were collected and analysed by western blotting or ligand

blotting [135].

Materials and Methods

43

125I-apoA-I Ligand Blot – Proteins were transferred by dot blotting onto

nitrocellulose membranes. Membranes were quickly rinsed in PBS, incubated in

PBS containing 20 mM sodium deoxycholate for 30 min, washed 3 times in PBS

and incubated with 5µg/mL 125I-apoA-I in 20mM Tris, pH 7.4, 150 mM NaCl, 1

mM EDTA at room temperature for 1hour. After washing the membrane 3 times

15 min with PBS, the membranes were exposed to a phosphor screen [136].

Immunofluorescence Confocal Microscopy – Cells were incubated 30 minutes

with 5 µg/mL apoA-I labelled with alexa-488 and 5 µg/mL alexa-594 transferrin,

washed 6 times 5 minutes in PBS, fixed in 3% paraformaldehyde for 15

minutes, permealised with 0.2% Triton X-100. The antibody used to stain the

intracellular marker EEA1 (ab15846) was purchased from Abcam and used

according to the manufacturer’s instructions. Confocal microscopy was

performed with a 63x oil-immersion lens in the sequential mode.

Results

45

RESULTS

1. Apolipoprotein A-I Interaction with Aortic Endothelial Cells

At first, the interaction of apoA-I with endothelial cells was characterised in

terms of binding at 4°C, cell association at 37°C, internalisation, degradation

and transport.

1.1. ApoA-I Binding (4°C)

The ability of apoA-I to function as a ligand for endothelial cells was tested

using lipid-free 125I-apoA-I. Nonspecific binding was measured in the presence

of a 40-fold excess of unlabeled apoA-I. At first, we verified that the

experimental data used to determine the equilibrium constant were obtained at

equilibrium. Indeed, binding of 18 nM apoA-I equilibrated in less than 2 hours

(data not shown). Using a global fitting approach, total and nonspecific binding

were fitted at once to the experimentally determined binding data (Fig 10 A).

Besides, the free apoA-I concentration was approximated to the added apoA-I

concentration, because less than 0.5 % of the apoA-I added bound to the cells

at 4°C. Bovine aortic endothelial cells (BAEC) bound 125I-apoA-I in a saturable

manner with a specific maximal binding Bmax = 1.5 ± 0.2 pmol / mg cell protein

(2.0 ± 0.3 105 binding sites per cell) and with an affinity Kd = 67 ± 20 nM. The

Scatchard plot (Fig. 10 A) gives an easier reading of the equilibrium constants

obtained after global fitting.

In addition, apoA-I binding was competable with a 40-fold excess of unlabeled

apoA-I and HDL (both over 70%) but not with an excess of BSA (Fig. 10 B).

Results

46

In the vessel wall the endothelial cells are polarised. To analyse the binding

affinity on both the apical and the basolateral side, BAEC were cultured on

collagen coated inserts to form a confluent and presumably polarised cell layer.

Figure 10: ApoA-I binding (4°C) to BAEC. (A) BAEC were incubated at 4°C with the

indicated concentration of 125I-apoA-I in the absence (total, ) or in the presence of

a 40-fold excess of unlabeled apoA-I (non-specific, ). Specific binding (-) was

obtained after fitting simultaneously total and non-specific binding. The Scatchard

plot gives an easier reading of the equilibrium constants obtained after global fitting.

(B) To study the specificity of binding, BAEC were incubated 2 h at 4°C with 5

µg/mL 125I-apoA-I in the absence or in the presence of 200 µg/mL of the indicated

competitor.

Results

47

The distribution of the apoA-I binding sites in these cells was studied by adding

the label either in the apical compartment or in the basolateral compartment.

The specific binding capacity of the apical side of the cell layer was more than

three times as high as the one of the basolateral side (Fig. 11).

1.2. ApoA-I Cell Association (37°C)

At 37°C, total and nonspecific apoA-I cell association were measured at

increased 125I-apoA-I concentrations. Specific cell association was calculated by

subtracting the nonspecific cell association values from the total cell association

values. The concentration dependence of apoA-I total, non-specific and specific

cell association is shown in Fig. 12 A. It may be noted about 5% of apoA-I

added associated with endothelial cells. In addition, apoA-I cell association was

competable with an excess of unlabeled apoA-I and HDL (both over 85%) but

not with an excess of BSA (Fig. 12 B).

Figure 11: ApoA-I binding to the apical and the basolateral side of BAEC. BAEC

were cultured on porous filter inserts and the binding of 125I-apoA-I was measured

by adding the label either into the apical compartment or into the basolateral

compartment.

Results

48

Figure 12: I-apoA-I cell association (37°C) to BAEC. (A) BAEC were incubated at

37°C with the indicated concentration of 125I-apoA-I in the absence (total, ) or in

the presence of a 40-fold excess of unlabeled apoA-I (non-specific, ). Specific cell

association (-) was obtained after fitting simultaneously total and non-specific cell

association. (B) To study the specificity of the cell association, BAEC were

incubated 2 h at 37°C with 5 µg/mL 125I-apoA-I in the absence or in the presence of

200 µg/mL of the indicated competitor.

Results

49

1.3. ApoA-I Internalisation and Degradation

The cellular distribution of labeled apoA-I was further analysed. Cell surface

biotinylation experiments clearly demonstrated that at 37°C about 20% of total

cell associated material was found internal (Fig. 13 B). Similar data were

obtained using cleavable biotinylated 125I-apoA-I for the internalisation studies

(Fig. 13 B). The uptake of 125I-apoA-I was competable with an excess of

unlabeled apoA-I and HDL and the process reached a steady-state level in

BAEC after about 2 h (Fig. 13 A).

Results

50

Figure 13: 125I-apoA-I internalisation in BAEC. (A) BAEC were incubated at 37°C

with 5 µg/mL 125I-apoA-I for the indicated time in the absence (total, ) or in the

presence of a 40-fold excess of unlabeled apoA-I (non-specific, ). Specific

internalisation ( ) was calculated by substracting the values of the non-specific

internalisation from those of the total internalisation. (B) shows the repartition of

specifically cell associated 125I-apoA-I and biotinylated 125I-apoA-I as cell surface

bound and internal.

Results

51

The internalisation of apoA-I by endothelial cells was further investigated by

confocal fluorescence microscopy. BAEC were incubated with alexa 488 apoA-I

and vesicles containing fluorescent apoA-I were partially colocalising with the

early endosome markers EEA1 (early endosome antigen 1) and alexa 594

transferrin (Fig 14). This result confirms that apoA-I is internalised by

endothelial cells.

Figure 14: Internalisation of alexa 488 apoA-I. The internalisation of apoA-I in

endothelial cells was analysed by confocal fluorescence microscopy. Confluent

BAEC were incubated for 30 min with 5 µg/ml apoA-I alexa 488 conjugates (green).

Colocalisation of vesicles containing apoA-I with the early endosome marker EEA1

and transferring (red) was assessed.

Results

52

The degradation of 125I-apoA-I after 4h was analysed by measuring the release

of radiolabelled degraded amino acids into the medium in the presence or

absence of excess unlabeled apoA-I. The specific degradation was calculated

as the difference between total degradation (without competitor) and non-

specific degradation (with competitor) and was worth about 5 ng/mg cell protein

in 4h (Fig. 15 A) which is less than 3% of the specific cell association (Fig. 12).

The SDS-PAGE analysis of the cell lysate after 4 h incubation with 125I-apoA-I

confirmed that internalised 125I-apoA-I is not degraded.

Figure 15: ApoA-I total and partial degradation. (A) Total degradation was measured

as the release of radiolabelled degraded peptides in the assay medium, after 4 h

incubation at 37°C. (B) Partial degradation was evaluated by loading the cell lysate

on a SDS PAGE after 4 h incubation with 5 µg/mL 125I-apoA-I, the starting material

(apoA-I) was used as a control.

Results

53

1.4. ApoA-I Transport through a Monolayer of Endothelial Cells

To assess the barrier function we measured the permeability coefficient (PC) of 3H-inulin, which do not cross cell membranes and hence represent a

paracellular transport marker [137]. The tracer was added to the apical chamber

and the filtered radioactivity was measured in the basolateral compartment. The

PC for 3H-inulin across the endothelial cell layer was worth 1.32 ± 0.35x10-5

cm/s, calculated over a time period of 4 h. Furthermore, the influence of apoA-I

on the permeability was determined by analysing the filtration of 3H-inulin in the

presence of 5 µg/ml apoA-I in the apical compartment. The PC of 3H-inulin in

the presence of apoA-I was worth 1.30 ± 0.35 x 10-5 cm/s and, hence, not

significantly different from the PC of 3H-inulin alone. This indicates that apoA-I

does not impair the barrier function of the monolayer. With this model we

addressed the question of whether endothelial cells transport apoA-I through

the cell layer.

The appearance of 125I-apoA-I in the basolateral chamber was measured after

adding the tracer into the apical chamber in the presence and in the absence of

excess cold apoA-I at different time points. The specific transport was

calculated by subtracting the non-specific transport from the total transport (Fig.

16). The partial competition of 125I-apoA-I transport through the cell layer points

to the occurrence of a specific transport in addition to filtration. Interestingly, in

contrast to the apical to basolateral route, no specific transport was recorded for

the opposite basolateral to apical direction whereas inulin permeability was

similar in both directions (Fig. 16 C). The radioactive proteins recovered in the

basolateral compartment were analysed by SDS-PAGE and were found to

constist of intact apoA-I (Fig. 17 B). To further analyse the transport, the

experiment was repeated at 16°C, a temperature which prevents fusion of

vesicles with the plasma membrane. The transport capacity was almost

abolished, at this reduced temperature (Fig. 16 B), which indicates that apoA-I

might be transported transcellularly.

Results

54

Figure 16: ApoA-I transport through a monolayer of endothelial cells is. (A) BAEC

were cultivated on transwell, incubated at 37°C with 5 µg/mL 125I-apoA-I (added in

the apical compartment) for the indicated time in the absence (total, ) or in the

presence of a 40-fold excess of unlabeled apoA-I (non-specific, ). Specific

internalisation ( ) was calculated by substracting the values of the non-specific

from those of the total transport. (B) ApoA-I transport from the apical to the

basolateral compartment was analysed at 37°C and 16°C. (C) apoA-I transport from

the apical to the basolateral compartment and in the opposite direction were

measured and compared to inulin permeability in both directions.

Results

55

Interestingly, charge and size fractionation on a native agarose gel of the

content of the basolateral compartment revealed two species, one with preβ-

mobility corresponding to lipid-free 125I-apoA-I and another with faster mobility,

similar to that of 125I-HDL. These α-mobile particles were absent in all samples

containing an excess of cold apoA-I indicating that it represented the fraction of

the specifically transported cargo, Fig. 17 A. Analysis of the same samples from

the basolateral compartment by SDS-PAGE revealed a single band of 28 kDa

(Fig 17 B). The mobility shift (Fig. 17 C) as well as the transport capacity (Fig.

16 B) were both almost abolished at 16°C, indicating a temperature sensitive

modification and an energy dependent transport. Thus, it is very likely that

apoA-I is transcytosed through endothelial cells.

Results

56

Figure 17: Temperature dependent change of apoA-I mobility after transport. (A)

reveals a native 1% agarose gel loaded with equal cpms of 125I-HDL (1), 125I-apoA-I

(starting material) (2). The wells 3-5 were loaded with media harvested from the

basolateral compartment: from a control insert without cells (filtrated 125I-apoA-I,

mock) (3), from inserts with BAECs incubated with 125I-apoA-I in the absence of

excess unlabeled apoA-I (4) or in the presence of excess unlabeled apoA-I (5). (B)

The media described in (A) were loaded on a SDS-PAGE. (C) Reveals an agarose

gel loaded with the identical volumes of the media isolated from the basolateral

compartment of a transport experiment performed at 37°C and 16°C.

Results

57

2. Which Proteins mediate ApoA-I Transcytosis?

To identify proteins which mediate apoA-I transcytosis, a candidate based

approach was chosen. SR-BI, ABCA1 and the β-chain of the F0F1 ATPase were

considered as candidate receptors mediating the binding, the internalisation and

ultimately the transport of apoA-I in endothelial cells.

2.1. Role of ABCA1 in ApoA-I Transcytosis

2.1.1. Role of ABCA1 in ApoA-I Binding and Cell Association

At first, we verified that ABCA1 is expressed in BAEC by RT-PCR and by

western blotting (Fig. 18). In addition ABCA1 expression and/or function were

modulated by RNA interference and pharmacological treatments. ABCA1

transcription was reduced by 90% (Fig. 18 A) and ABCA1 expression by about

75% (Fig. 18 C) in cells transfected with ABCA1 specific siRNA in comparison

to the controls. Moreover, we verified (Fig. 18 B and D) that as in macrophages

ABCA1 expression is increased after treatment with 22-R-hydroxycholesterol

(HC) and 9-cis retinoic acid (RA) [138, 139]. Finally, BAEC were treated with

cyclosporin A (CsA), a broad-spectrum multidrug resistance modulator, which

has been reported to trap ABCA1 on the cell surface [140]. We confirmed that in

BAEC as well CsA enhanced ABCA1 cell surface expression (Fig. 18 E).

Results

58

Figure 18: ABCA1 expression, silencing and stimulation in BAEC. ABCA1

expression was evaluated by quantitative RT-PCR (A, B) and western-blotting (C, D,

E). First, endothelial cells were transfected with 100 nM ABCA1 specific siRNA or

not coding siRNA (A, C). Second, 22-R hydroxycholesterol (HC) and 9-cis retinoic

acid (RA), 10 µM each, were used to stimulate the expression of ABCA1 (B, D).

Third, treating endothelial cells with 20 µM cyclosporin A (CsA) increased the

amount of ABCA1 expressed on the cell surface (E), as measured after biotinylation

of the cell surface proteins and streptavidin pull down.

Results

59

The interventions previously described were used to evaluate the role of ABCA1

in apoA-I binding and cell association. First, apoA-I binding and cell association

to BAEC were enhanced when ABCA1 expression was stimulated by a mixture

of HC and RA. (Fig. 19). Second, we used CsA, which increases the expression

of ABCA1 on the cell surface and inhibits apoA-I uptake in macrophages [140].

After 4 h of treatment with CsA, apoA-I binding and cell association to BAEC

were increased (Fig. 19), consistent with the result that CsA traps ABCA1 on

the cell surface. Third, ABCA1 expression was diminished by RNA interference.

After ABCA1 silencing, apoA-I binding and cell association were significantly

lower. These results indicate that ABCA1 critically modulates apoA-I binding

and cell association. Therefore, the implication of ABCA1 in apoA-I

internalisation and transcytosis was further studied.

Results

60

Figure 19: Role of ABCA1 in apoA-I binding (A) and cell association (B). Diverse

pharmacological treatments were used to modulate ABCA1 and evaluate its

involvement in apoA-I binding and cell association. First, ABCA1 expression was

stimulated with a mixture 22-R-hydroxycholesterol (HC) and 9-cis-retinoic acid (RA).

Second, ABCA1 was trapped on the cell surface and functionally inhibited with

cyclosporin A (CsA). Third, ABCA1 expression was reduced after transfection of

specific siRNA. All conditions were used to study apoA-I binding (A) and cell

association (B).

Results

61

2.1.2. Role of ABCA1 in ApoA-I Internalisation

Whether ABCA1 is involved in apoA-I internalisation was further investigated,

using treatments previously described. Stimulating ABCA1 expression with HC

combined with RA increased apoA-I uptake. In addition, treating the cells with

CsA reduced apoA-I internalisation in BAEC, as previously reported in

macrophages [140],. Finally, apoA-I uptake was lower in cells transfected with

ABCA1 specific siRNA than in the control cells (Fig. 20). To sum up, altering

ABCA1 expression was modulating apoA-I internalisation.

Figure 20: Role of ABCA1 in apoA-I internalisation in BAEC. ApoA-I uptake was

measured after diverse treatments. First, ABCA1 expression was stimulated with a

mixture of 22R-hydroxycholesterol (HC) and 9-cis retinoic acid (RA). Second,

ABCA1 was inhibited on the cell surface by cyclosporin A (CsA). Thrid, ABCA1

expression was reduced by RNA interference.

Results

62

2.1.3. Role of ABCA1 in ApoA-I Transport

Finally, we characterised the role of ABCA1 in apoA-I transcytosis. Treating

BAEC with CsA, added either in the apical compartment, in the basolateral

compartment or in both compartments, led to a reduced apoA-I transport, by

more than 50% (Fig. 21). Moreover, when ABCA1 expression was lowered by

RNA interference, we observed a 70% reduction in apoA-I transport (Fig. 21). In

addition, apoA-I cell association was measured in parallel to apoA-I transport

after CsA treatment. As in the previous cell association assay (Fig. 19), we

found that CsA introduced either into the apical compartment or into both

compartments increased apoA-I cell association. Interestingly, apoA-I cell

association remained unchanged when CsA was added into the basolateral

compartment, although apoA-I transport was reduced by this treatment. This

result provides a hint that ABCA1 may not only modulate apoA-I uptake but may

also regulate apoA-I trafficking and even apoA-I secretion.

Results

63

Figure 21: Role of ABCA1 in apoA-I transport through a monolayer of BAEC.

ABCA1 expression was reduced after transfecting specific siRNA. Alternatively,

ABCA1 was inhibited on the cell surface using cyclosporin A (CsA), which was

added either in the apical compartment or in the basolateral compartment or in both

compartments. (A) ApoA-I transport was evaluated after both interventions. (B)

ApoA-I cell association was also measured in the transwell system after CsA

treatments.

Results

64

2.2. Role of SR-BI in ApoA-I Binding and Cell Association

SR-BI is a well characterised HDL binding protein. We investigated if it plays a

role in apoA-I binding and apoA-I cell association in endothelial cells. At first,

SR-BI expression was studied. SR-BI was expressed in BAEC as evaluated by

RT-PCR (Fig. 22 A) and western-blotting (Fig. 22 B). In addition, it was possible

to reduce its expression after transfecting SR-BI specific siRNA. SR-BI

expression was diminished by 90% on the RNA level and by more than 50% on

the protein level. As controls, we measured the expression of SR-BI in not

transfected cells and in cells transfected with not coding siRNA.

ApoA-I binding (4°C) and cell association (37°C) were as high in cells

transfected with SR-BI specific siRNA as in cells transfected with not coding

siRNA. However, the binding of HDL (known ligand of SR-BI [141]) was

significantly reduced when SR-BI expression was diminished (Fig. 23). Thus,

Figure 22: SR-BI expression and silencing in BAEC. SR-BI expression levels were

evaluated by quantitative RT-PCR (A) and western-blotting (B). In order to reduce

SR-BI expression, specific siRNA (100 nM) were transfected with lipofectamine.

SR-BI RNA and protein levels were measured 48h after transfection.

Results

65

the role of SR-BI in apoA-I internalisation or apoA-I transport was not further

studied.

Figure 23: Role of SR-BI in apoA-I binding and cell association. ApoA-I binding (A)

and apoA-I cell association (B) were measured after reducing the expression of SR-

BI by RNA interference. As a functional control, HDL binding (C) was also evaluated

after silencing SR-BI.

Results

66

2.3. Role of Cell Surface F0F1 ATPase in ApoA-I Transcytosis

2.3.1. Role of Cell Surface β-ATPase in ApoA-I Binding

At first, the presence of the beta chain of the F0F1 ATPase (β-ATPase) on the

surface of endothelial cells was verified, after cell surface biotinylation and

streptavidin pull-down (Fig. 24). Only biotinylated β-ATPase could be pulled

down and intracellular proteins such as GAPDH were not biotinylated.

The expression of β-ATPase was reduced using RNA interference by 90% on

the RNA level and by about 50% on the protein level (Fig. 25). Intracellular ATP

levels were measured and found unchanged after transfection of siRNA specific

for β-ATPase (Fig. 25). In contrast, in cells transfected with siRNA specific for β-

ATPase the binding of apoA-I was twice as low as in not coding siRNA

transfected cells and in not transfected cells (Fig. 26).

Figure 24: Cell surface expression of β-ATPase. The cell surface expression of β-

ATPase was assessed after biotinylation of the cell surface proteins at 4°C. We

verified that GAPDH, an intracellular protein, was not biotinylated and could not be

pulled down. 10 µg from the supernatant and 60 µg of the beads were loaded on a

SDS-PAGE.

Results

67

Figure 25: Expression and silencing of β-ATPase in BAEC. β-ATPase expression

was assessed by RT-PCR (A) and western blotting (B) after tansfecting β-ATPase

specific siRNA. The intracellular concentrations of ATP (C) were also measured

after reducing the expression of β-ATPase in the presence and in the absence of 5

µg/mL apoA-I.

Results

68

Figure 26: Role of β-ATPase in apoA-I binding to BAEC. ApoA-I binding was

evaluated after transfecting BAEC with β-ATPase specific siRNA.

Results

69

2.3.2. Role of Cell Surface F0F1 ATPase in ApoA-I Internalisation

The role of β-ATPase in apoA-I internalisation was evaluated after transfection

of specific siRNA and treatment with the inhibitor IF1 or an anti β-ATPase

antibody (Fig. 27). ApoA-I internalisation in BAEC was reduced by 50% after

transfecting β-ATPase specific siRNA as compared to the controls. Moreover,

the cells were treated with IF1, which binds to the β-subunit of F1-ATPase in a

pH dependent process and inhibits the ATPase activity [142, 143]. IF1 inhibited

apoA-I internalisation by about 60%. Finally, apoA-I internalisation was reduced

in the presence of an anti β-ATPase antibody.

Figure 27: Role of β-ATPase in apoA-I internalisation in BAEC. ApoA-I

internalisation was measured in cells transfected with β-ATPase specific siRNA.

ApoA-I internalisation was also evaluated after treating the cells with the inhibitor IF1

and with an anti β-ATPase antibody.

Results

70

2.3.3. Role of Cell Surface F0F1 ATPase in ApoA-I Transport

The treatments used to study the role of β-ATPase in apoA-I internalisation

were also applied to evaluate the involvement of β-ATPase in apoA-I transport.

We found that silencing β-ATPase drastically reduces (by about 80%) apoA-I

transport through a monolayer of BAEC (Fig. 28). Moreover, when IF1 was

present in the assay medium apoA-I transport was diminished by 50%. These

results indicate that cell surface F0F1 ATPase modulates not only apoA-I binding

and internalisation but also apoA-I transcytosis.

Figure 28: Role of β-ATPase in apoA-I transport in BAEC. ApoA-I transport through

through a monolayer of BAEC was measured after silencing β-ATPase with specific

siRNA and in the presence of the inhibitor IF1.

Results

71

2.3.4. Effect of Extracellular Nucleotides on ApoA-I Internalisation

In mitonchondria, F0F1 ATPase catalysed both the synthesis and the hydrolysis

of ATP. Therefore, we tested the effect of adding extracellularly ADP or ATP on

apoA-I internalisation. Cell association and internalisation of apoA-I were both

slightly (20%) increased in the presence of 100 nM ATP and much more

augmented (50%) in the presence of 100 nM ADP (Fig. 29). This indicates that

apoA-I uptake is stimulated by extracellular ADP rather than by extracellular

ATP.

Figure 29: Effect of extracellular ADP and ATP on apoA-I cell association and

internalisation. BAEC were preincubated with 100 nM ADP or ATP for 10 min prior

apoA-I internalisation assay.

Results

72

2.3.5. Cell Surface F0F1 ATPase Activity

F0F1 ATPase activity on the cell surface was assessed by measuring

extracellular ATP concentrations in the presence and in the absence of apoA-I

and after silencing β-ATPase. First, in not transfected cells (none, Fig. 31), the

extracellular ATP concentration is reduced by 50% when the cells were

preincubated with apoA-I for 30 min. This indicates that apoA-I stimulates the

extracellular hydrolysis of ATP. Moreover, in the absence of apoA-I, ATP

accumulated extracellularly when β-ATPase was silenced (Fig. 30, black bars),

suggesting that F0F1 ATPase ihydrolyses ATP on the surface of endothelial

cells. Finally, the apoA-I specific ATP hydrolysis was reduced (by about 50%)

when β-ATPase expression was diminished by RNA interference in comparison

to the controls. In a few words, on the surface of endothelial cells F0F1 ATPase

seems to hydrolyse ATP in an apoA-I induced manner.

Figure 30: F0F1 ATPase activity with and without apoA-I. BAEC were transfected

with 100nM siRNA specific for β-ATPase. The extracellular concentration of ATP

was measured after 30 min incubation with or without 5 µg/mL apoA-I.

Results

73

3. Which Pathway is implicated in ApoA-I Transcytosis?

Finally, in order to clarify the route of apoA-I transport, we focussed on caveolin-

1 and clathrin mediated pathways.

3.1. Role of Caveolin-1 in ApoA-I Transcytosis

The expression of caveolin-1, the major structural protein of caveolae, was

verified by RT-PCR and western blotting. Moreover, it was possible to reduce

the expression of caveolin-1 by 90% on the RNA level and by more than 60%

on the protein level by transfecting specific siRNA (Fig. 31).

ApoA-I internalisation and transport were studied in BAEC transfected with

siRNA specific for caveolin-1. ApoA-I internalisation and apoA-I transport were

reduced, by 50% and by 80% respectively, when caveolin-1 was silenced (Fig.

32 A). This intervention, however, did not affect LDL degradation (Fig. 32 B).

Figure 31: Caveolin-1 expression and silencing in BAEC. After transfecting 100 nM

siRNA specific for caveolin-1 with lipofectamine, caveolin expression levels were

assessed by quantitative RT-PCR (A) and western blotting (B).

Results

74

Figure 32: Role of caveolin-1 in apoA-I internalisation and transport. ApoA-I

internalisation and transport (A) were assessed in BAEC transfected with 100 nM

caveolin-1 specific siRNA. As a control, LDL degradation (B) was also measured

after reducing the expression of caveolin-1 by RNA interference.

Results

75

Moreover, Triton X-100 insoluble fractions were isolated by flotation in a

sucrose gradient. The fractions were analysed by western blotting and probed

with antibodies against caveolin-1 and clathrin heavy chain (Fig. 33 A and B).

The Triton X-100 insoluble rafts (fractions 3 and 4) were positive for caveolin-1

but negative for clathrin heavy chain. In addition, all fractions were directly

loaded onto a nitrocellulose membrane, which was probed with 125I-apoA-I and

exposed to a phosphor screen (Fig. 33 C). ApoA-I was binding essentially to the

fractions containing the caveolin-1 enriched rafts, i.e. fractions 3 and 4.

We previously reported that ABCA1 and β-ATPase modulate apoA-I binding.

Thus, the expression of ABCA1 and β-ATPase was evaluated in Triton X-100

soluble and insoluble fractions (Fig. 34). Both proteins seemed to be expressed

in caveolin-1 enriched rafts (Fig. 35).

Figure 33: ApoA-I binding to caveolin-1 enriched rafts. Caveolae enriched

membranes were prepared after lysis in Triton X-100 at 4°C and flotation in sucrose

gradient. The fractions were analysed by western blotting for caveolin-1 and clathrin

(A and B). Moreover, the fractions were also directly loaded on a nitrocellulose

membrane, which was probed with 125I-apoA-I (C).

Results

76

Figure 34: ABCA1 and β-ATPase in caveolin-1 enriched rafts. The expression of

ABCA1 and β-ATPase was measured by western blotting in Triton X-100 soluble

(pooled fractions 11 and 12) and insoluble rafts (pooled fraction 3-4). 18 µg total

proteins were loaded in all wells.

Results

77

3.2. Role of Clathrin in ApoA-I Internalisation

Clathrin heavy chain (HC) was expressed in endothelial cells and its expression

could be reduced by 90% on the RNA level and by about 50% on the protein

level using RNA interference (Fig. 35).

Figure 35: Clathrin heavy chain (HC) expression and silencing in BAEC. 100 nM

siRNA specific for clathrin HC were transfected with lipofectamine in BAEC. Clathrin

expression levels were checked 48 h after transfection by RT-PCR (A) and western

blotting (B).

Results

78

After transfecting siRNA coding for clathrin HC, no significant reduction in apoA-

I internalisation was observed (Fig. 36). LDL are taken up via clathrin coated

pits and are degraded after internalisation [144]. Therefore, LDL degradation

was evaluated after silencing clathrin HC and was found diminished by about

50%. These results suggest that most apoA-I is not internalised in a clathrin

dependent manner.

Figure 36: Role of clathrin heavy chain (HC) in apoA-I internalisation (A) and LDL

degradation (B). Clathrin HC specific siRNA were transfected in BAEC. 48 h after

transfection apoA-I internalisation (A) and LDL degradation (B) were assessed.

Discussion

79

DISCUSSION

1. ApoA-I Interaction with Aortic Endothelial Cells

Most anti-atherogenic properties of HDL are exerted in the arterial wall.

Therefore, HDL and their main protein constituent, apoA-I, must leave the

plasma compartment and cross the endothelium [13, 145, 146]. However, only

the transcytosis of intact HDL particles through endothelial cells isolated either

from fat tissue [127] or brain [126] but not the passage of apoA-I through

endothelial cells from large arteries was previously investigated. With respect to

the pathogenesis of atherosclerosis, we believe that endothelial cells from large

arteries rather than from capillaries are the mandatory model for two main

reasons. First, the lipoproteins invade the arterial wall from the luminal side and

form the initial fatty streaks in the intima rather than in the adventitia [147].

Second, endothelial cells of different vascular origin differ qualitatively and

quantitatively by the abundance of fenestrae, clefts, junctions and receptors

which all have a strong impact on the permeability of macromolecules [148-

150]. Furthermore, the transendothelial transport of lipid free apoA-I rather than

lipidated HDL particles was evaluated because in both the intimal fluid of

arteries and the lymph the relative concentration of lipid poor HDL precursors,

pre-β−HDL, is higher than that of mature and lipidated large HDL [17-19, 151].

These lipid free or lipid poor HDL precursors are continuously generated in the

plasma compartment during lipolysis of triglyceride-rich lipoproteins by

lipoprotein lipase and interconversion of HDL subclasses by lipid transfer

proteins, hepatic lipase and endothelial lipase [13, 146, 152]. They release

phospholipids and cholesterol from hepatic and non-hepatic cells including

macrophages and smooth muscle cells from the arterial wall for the reverse

transport to the liver [5, 13, 146, 152-154].

In this study, endothelial cells bound lipid free apoA-I at 4°C with high affinity

(Kd = 67 ± 20 nM) and in a saturable manner (Bmax = 1.5 ± 0.2 pmol / mg).

This result corresponds to the presence of 2.0 ± 0.3 105 binding sites per cell.

Besides, apoA-I binding was competable with excess unlabeled apoA-I but not

Discussion

80

with excess BSA, thus considered specific (Fig. 10). It is also important to note

that the equilibrium analysis allowed us to determine the presence of only one

kind of binding sites. However, we identified two proteins modulating apoA-I

binding, ABCA1 and β-ATPase. Two major explanations for this contradiction

can be envisaged. First, if both proteins are apoA-I receptors, they might have

very similar affinities for apoA-I. Second, it is still controversially discussed

whether ABCA1 binds directly apoA-I or modify the lipid distribution at the

plasma membrane facilitating apoA-I docking [155, 156].

Savion and Gamliel [157] previously showed that lipid free apoA-I specifically

associates with BAEC at 37°C. A proportion of the associated apoA-I was

resistant to trypsinisation and hence assumed to be internalised. We verified

this assumption directly in biotinylation experiments. About 20% of apoA-I

associated with endothelial cells was internalised within 2 hours (Fig. 13 B). In

addition, less than 3% of cell associated apoA-I (or less than 15% of

internalised apoA-I) was degraded during 4 hours incubations (Fig.15 A).

Furthermore, using a Transwell culture system, we found that presumably

polarised arterial endothelial cells transport apoA-I from the apical to the

basolateral compartment (Fig. 16). In the first 30 min about 50% of apoA-I

associated with endothelial cells is transported, which suggests that apoA-I

transcytosis is a major pathway. In order to further study the nature of apoA-I

transcytosis we used vesicular transport inhibitors such as dansylcadaverine,

filipin or N-ethylenimid. Unfortunately, due to the cytotoxixity of these inhibitors

no conclusive results were obtained from these experiments.

We believe that apoA-I transcytosis is not artifactual for four reasons. First, in

cells cultured in a Transwell system, apoA-I binding was threefold stronger on

the apical side as compared to the basolateral side (Fig. 11). Our results do not

allow to conclude whether the apoA-I binding sites on the apical and basolateral

cell membranes are of different nature and function. In addition, it cannot be

ruled out that the difference in binding capacity is due, at least in part, to steric

interference of the membrane. Second, the cell surface biotinylation

experiments clearly demonstrated that apoA-I is internalised in a specific and

saturable manner (Fig. 13). It was also verified that the majority of the

Discussion

81

internalised material remained intact (Fig. 15). In addition, apoA-I internalisation

was verified by fluorescence microscopy studies of BAEC incubated with alexa

488-conjugated apoA-I (Fig. 14). ApoA-I was visualised in vesicles which

colocalised in part with the early endosome marker EEA1 and with transferrin.

We also previously reported that gold-labelled apoA-I is internalised in

intracellular vesicles [158]. These results point to a transcellular trafficking of

apoA-I. However, the nature of the vesicles containing apoA-I needs further

investigation. Third, apoA-I added to the apical compartment of a two-

compartment system was transported to the basolateral compartment as an

intact protein (Fig. 17). This transport was competable and diminished at 16°C,

a temperature which prevents vesicle fusion with the plasma membrane (Fig.

16). One may argue that the fall in temperature reduces filtration in response to

increased fluid viscosity. However, we found a greater temperature dependent

reduction in specific transport than in total transport. This supports a cell

dependent transport. Fourth, the transport changed the originally pre-β-mobile

lipid free apoA-I into an α-mobile particle without changing the integrity to apoA-

I (Fig. 17). This indicates a non-covalent modification, such as addition of acidic

phospholipids of apoA-I. In addition the charge modification was abolished by

adding excess of cold apoA-I into the donor compartment and at reduced

temperature (Fig. 17). This clearly indicates that the modification step was cell

and energy dependent. However, our experimental set-up does not permit to

determine whether the modification took place at the cell surface or

intracellularly during transport.

In conclusion, endothelial cells from bovine aorta bind and internalise lipid-free

apoA-I in a specific and saturable manner. In addition, we provided the first

evidence that apoA-I undergoes transcytosis through arterial endothelial cells

giving rise to lipidated particles. This pathway may be an important rate limiting

factor for the antiatherogenicity of HDL because apoA-I and HDL mediate many

antiatherogenic functions within the arterial wall rather than in the plasma

compartment and apoA-I must therefore cross the endothelial barrier.

Discussion

82

2. Which Proteins mediate ApoA-I Transcytosis?

Next, we aimed to unravel receptor(s) and/or transporter(s) which modulate

apoA-I binding, uptake and transport in arterial endothelial cells. A candidate

based approach was choosen: known HDL/apoA-I binding proteins (ABCA1,

SR-BI and β-ATPase) were tested for their ability to bind, internalise and

transport apoA-I in endothelial cells.

2.1. Role of ABCA1 in ApoA-I Transport

Mutations in ABCA1 have been identified as the cause of Tangier disease, a

disease characterised by extremely low HDL plasma levels and the

accumulation of lipid loaded macrophages in several organs [40-44]. In the liver,

ABCA1 mediates a rate-limiting step in the formation of HDL [46, 47]. In

macrophages, ABCA1 prevents the excessive accumulation of lipids and

thereby protects the arteries from developing atherosclerotic lesions [31].

Besides, ABCA1 activity leads, via an unknown mechanism, to the efflux of

phospholipids and cholesterol onto apoA-I [44, 45].

At first, we verified that ABCA1 is expressed in bovine aortic endothelial cells by

RT-PCR and western blotting (Fig. 18). The expression of ABCA1 in human

umbilical vein endothelial cells and human aortic endothelial cells has already

been shown [159, 160]. ABCA1 is thought to mediate phospholipid and

cholesterol efflux onto apoA-I. Endothelial cells, however, do not efflux

phospholipids and cholesterol onto apoA-I [154], which leads to the question of

the function of ABCA1 in endothelial cells.

The role of ABCA1 in apoA-I binding (4°C) and cell association (37°C) was

assessed after pharmacological treatments and siRNA mediated silencing.

First, we verified that, as in macrophages [138, 139], the expression of ABCA1

is up regulated in endothelial cells incubated with a mixture of 22-R-

hydroxycholesterol (HC) and 9-cis retinoic acid (RA) (Fig. 18 B and D). ABCA1

was also trapped on the surface of endothelial cells treated with cyclosporin A

(CsA) (Fig. 18 E), as previously reported in macrophages [140]. After both

Discussion

83

treatments, apoA-I binding and cell association were increased (Fig. 19).

Because these treatments are not specifically modulating ABCA1, the previous

results provided evidence that an ABC transporter is involved in apoA-I binding

and cell association. Furthermore, when ABCA1 expression was specifically

reduced by RNA interference, apoA-I binding and cell association were lowered.

In other words, ABCA1 is very likely the ABC transporter which was modulated

by the two first treatments, ultimately leading to increased apoA-I binding and

cell association. The result that ABCA1 modulates apoA-I binding coincides with

a previous report. In deed, overexpression of ABCA1 in macrophages increases

apoA-I binding to the cell surface [155]. However, it is still controversially

discussed whether ABCA1 binds directly apoA-I or whether it modifies the lipid

distribution at the plasma membrane facilitating apoA-I docking [155, 156].

Hence, it is still unclear whether ABCA1 can be considered as a receptor for

apoA-I.

The role of ABCA1 in apoA-I internalisation was further evaluated. Similarly to

apoA-I binding and cell association, apoA-I internalisation was increased after

stimulating ABCA1 with HC and RA (Fig. 20). In contrast, CsA inhibited apoA-I

uptake. Finally, when ABCA1 expression was reduced by RNA interference,

apoA-I uptake was also diminished. These results are consistent with data

obtained previously in macrophages and fibroblasts. In macrophages, CsA

inhibits apoA-I uptake and resecretion by trapping ABCA1 on the cell surface

[140]. In fibroblasts, apoA-I colocalises with ABCA1 in endosomes [161, 162].

Thus, it seems that ABCA1 plays a critical role in apoA-I internalisation not only

in macrophages and fibroblasts but also in endothelial cells. In order to support

these data, the colocalisation of apoA-I and ABCA1 was analysed by

fluorescence microscopy. Unfortunately, all ABCA1 antibodies tested produced

unspecific patterns. In addition, the expression of an ABCA1-GFP fusion protein

resulted in such a high background in the endoplasmatic reticulum that no

conclusion could be drawn from the experiments.

Besides, ABCA1 also critically modulated apoA-I transcytosis. Indeed,

treatment with CsA and knock-down of ABCA1 expression reduced apoA-I

transport (Fig. 21). This might be due to the role of ABCA1 in apoA-I

Discussion

84

internalisation although we cannot exclude that ABCA1 might also play a role in

apoA-I trafficking and resecretion. In deed, when added into the basolateral

compartment CsA inhibited apoA-I transport from the apical to the basolateral

compartment (Fig. 21 A) but apoA-I cell association remained unchanged (Fig.

21 B). Therefore, CsA added in the basolateral compartment did not inhibit

ABCA1 on the apical cell surface. Nevertheless, it is possible that CsA was

internalised and inhibited ABCA1 intracellular trafficking without impairing the

function of ABCA1 on the apical surface. In other words, CsA at the basolateral

side or intracellularly might inhibit apoA-I transcytosis not only by reducing

apoA-I uptake but also by affecting apoA-I intracellular trafficking or even

resecretion. However, CsA is not only modulating ABCA1 activity but inhibits

also MDR1/ABCB1 [163] and calcineurin/protein phosphatase 2B (PP2B) [164].

In order to verify that the effect of CsA on apoA-I trafficking is not due to the

inhibition of PP2B, the experiment could be repeated in the presence of PP2B

specific inhibitors such as deltamethrin or FK506. In addition, deletion of the

cytoplasmic PEST sequence in ABCA1 inhibits ABCA1 trafficking but not

cholesterol efflux from the cell surface [165]. In order to assess whether ABCA1

is implicated in apoA-I trafficking, apoA-I internalisation and transcytosis could

be studied in cells expressing this deletion mutant (ABCA-dPEST).

ABCA1 is known to mediate phospholipid and cholesterol efflux onto apoA-I but

it is also modulating transferrin and dextran uptake [49], and apoptotic cells

engulfment [50]. We found that ABCA1 modulates apoA-I internalisation and

transcytosis in endothelial cells. Taken together, these results are raising the

major question of the intrinsic activity of ABCA1. It has been suggested that

ABCA1 would control the outward translocation of phosphadidylserine in a

calcium-induced manner [166]. Thereby, ABCA1 would induce an outward

bending of the membrane which would explain its inhibitory role in transferrin

and dextran uptake [52, 53]. On the contrary, our results indicate that the

caveolin-1-mediated internalisation of apoA-I would be facilitated by the putative

phosphadidylserine translocase function of ABCA1. However, it remains

challenging to understand how the phosphatidylserine export activity of ABCA1

may improve lipid efflux. Membrane domains, which preferentially bind apoA-I,

might be created upon translocation of phosphatidylserine to the outer leaflet.

Discussion

85

Alternatively, lipid efflux onto apoA-I has been suggested to occur through a

retroendocytosis process: apoA-I would in that case be internalised, interact

with intracellular lipid pools and be resecreted as lipidated particle [167, 168].

Thus, our finding that ABCA1 modulates apoA-I transport through endothelial

cells might help understanding the still unresolved mechanism by which ABCA1

mediate lipid efflux in macrophages.

Finally, according to the current opinion, ABCA1 helps protecting against the

development of atherosclerosis by two major mechanisms. It catalyses a

limiting step in the biogenesis of HDL in the liver and it mediates cholesterol

efflux from macrophages [28]. Many of the anti-atherogenic effects of apoA-I

and HDL are to be executed within the vascular wall. Therefore, by modulating

the transport of apoA-I through the endothelium into the arterial wall, ABCA1

may exert an additional atheroprotective activity. In this context, it is important

to note that several mutations in ABCA1 were associated with cardiovascular

risk independently of HDL cholesterol [169].

Discussion

86

2.2. Role of SR-BI in ApoA-I Transport

Initially, we verified that SR-BI is expressed in bovine aortic endothelial cells by

RT-PCR and western blotting (Fig. 22). It was already known that SR-BI is

expressed in endothelial cells, where it mediates the stimulation of endothelial

nitric oxid synthase (eNOS) by HDL [61]. SR-BI expression could be diminished

by RNA interference (Fig. 22). After reducing SR-BI expression, apoA-I binding

(4°C) and cell association (37°C) to endothelial cells did not changed (Fig. 23).

By contrast, HDL binding was reduced. SR-BI has already been reported to

bind lipidated apoA-I and HDL rather than lipid free apoA-I [170, 171]. Since our

data were consistent with the literature, we did not investigate further the

implication of SR-BI in apoA-I transcytosis.

Discussion

87

2.3. Role of F0F1 ATPase in ApoA-I Transport

F0F1 ATPase, which is essentially encoded by the nuclear genome, is the

principal ATP synthesis complex in mitochondria. It consists of a catalytic

domain F1 and a transmembrane domain F0. Surprisingly, F0F1 ATPase, like

other mitochondrial proteins, has been shown to be expressed on the surface of

diverse cells [69]. It has been found on the surface of endothelial cells and

hepatocytes, and has been shown to be active in this ectopic location [65, 67].

In hepatocytes, the beta chain of F0F1 ATPase (β-ATPase), which belongs to

the F1 domain, has been characterised as an apoA-I receptor, which triggers

the internalisation of HDL [67]. For these reasons, cell surface F0F1 ATPase

was considered as a candidate receptor, which might modulate apoA-I binding

and transcytosis in endothelial cells.

At first, the presence of β-ATPase at the plasma membrane of endothelial cells

was verified after cell surface biotinylation and streptavidin pull-down (Fig. 24).

Previously, components of F0F1 ATPase (subunits α, β, γ, b, d, e, F6 and

OSCP) have been observed by immunofluorescence or detected by

biotinylation and cell fractionation on the surface of tumor cell lines [64, 68],

adipocytes [66], hepatocytes [67], keratinocytes and endothelial cells [65].

However, whether all subunits of F0F1 ATPase are present on the cell surface

and whether the complex has the same structure as in mitochondria remains to

be addressed. Although the mechanism leading to ectopic expression is still

unknown other mitochondrial-matrix proteins, including fatty acid binding protein

(FABP), HSP60 and P32, are found at extramitochondrial sites [69].

Reducing β-ATPase expression diminished significantly apoA-I binding (Fig.

26), internalisation (Fig. 27) and transport (Fig. 28). However, silencing total β-

ATPase had no detectable consequences on intracellular ATP levels (Fig. 25).

Therefore, we estimated that the reduction in β-ATPase expression did not

induce an energetic stress that could explain the previous results. In addition,

the inhibitor IF1, which binds the F1 domain of F0F1 ATPase and inhibits ATP

hydrolysis [143], also reduced apoA-I internalisation (Fig. 27) and transport (Fig

Discussion

88

28). Besides, an antibody recognising the β−chain of F0F1 ATPase inhibited

apoA-I internalisation (Fig. 27). These results are supporting the concept that

ectopic β-ATPase acts as a receptor for apoA-I on the surface of endothelial

cells. In hepatocytes, comparable results were obtained. In these cells, apoA-I

binding to the β-chain of F0F1 ATPase was shown to trigger the internalisation of

HDL [67].

Mitochondrial F0F1 ATPase efficiently catalyses both ATP synthesis and ATP

hydrolysis. Several studies demonstrated that cell surface F0F1 ATPase is also

active in both ATP synthesis [66, 76] and ATP hydrolysis [67, 172].

Interestingly, we found that ADP rather than ATP stimulated the internalisation

of apoA-I in endothelial cells (Fig. 29). This suggested that F0F1 ATPase

hydrolyses ATP and that the ADP thus produced stimulates apoA-I

internalisation. To test this hypothesis, extracellular ATP concentrations were

measured in cells transfected with β-ATPase specific siRNA, in the absence

and in the presence of apoA-I. In not transfected cells, the extracellular ATP

concentrations were lower in the presence of apoA-I than in its absence (Fig.

30). Moreover, both in the presence and in the absence of apoA-I, ATP

accumulated extracellularly (Fig. 30) after reducing β-ATPase expression.

These results indicate that apoA-I stimulates the hydrolysis of ATP by F0F1

ATPase on the surface of endothelial cells. The ATP hydrolase activity is the

main feature of the F1 domain [75]. Therefore, our data suggest that a functional

F1 domain is present on the surface of endothelial cells.

In brief, our results indicate that β-ATPase is present on the surface of

endothelial cells where it catalyses the hydrolysis of ATP upon binding of apoA-

I. This process stimulates the internalisation and transcytosis of apoA-I. All our

data converge to the conclusion that on the cell surface F0F1 ATPase modulates

apoA-I transcytosis. However, this is a very surprising result as F0F1 ATPase is

considered as a strickly mitochondrial protein. Thus, it is critical to understand

the mechanism for ectopic expression of β-ATP in order to stregthen our

functional data. However, our findings are not unprecedented. In hepatocytes,

Discussion

89

the stimulation of cell surface F0F1 ATPase by apoA-I was shown to trigger HDL

endocytosis by a mechanism strictly related to the generation of ADP.

In addition, using both a pharmacological approach and RNA interference,

P2Y13 was identified as the main partner in hepatic HDL endocytosis, in

cultured cells as well as in situ in perfused mouse liver [77]. Interestingly, P2Y

receptors on the surface of endothelial cells have been shown to regulate

vascular permeability [81-83]. Therefore, it might be that one of the endothelial

P2Y receptors is stimulated by the ADP produced by the F0F1 ATPase, leading

to the transcytosis of apoA-I via still unidentified pathways.

Finally, F0F1 ATPase subunits have been identified as cell surface receptors for

apparently unrelated ligands implicating the complex in biological events as

divers as angiogenesis, innate immunity and lipoprotein metabolism. In deed,

angiostatin, an endogenous angiogenesis inhibitor, has been shown to bind

F0F1 ATPase on the surface of endothelial cells, thus regultating cell migration

and proliferation [65]. β-ATPase has also been identified as a target for innate

cytotoxicity by natural killer and lymphokine-activated killer cells toward some

tumors [64, 68]. In hepatocytes, apoA-I is binding β-ATPase which triggers the

internalisation of HDL [67]. We found that F0F1 ATPase is modulating the

transcytosis of apoA-I. To sum up, the real function and biological significance

of ectopic F0F1 ATPase remains to be established. Besides, future work will

have to address several important issues before F0F1 ATPase can be accepted

as a cell surface apoA-I receptor: What is the structure of the complex on the

cell surface? What is the mechanism leading to cell surface expression? How

apoA-I binding to β-ATPase results in apoA-I transcytosis?

Discussion

90

3. Which Pathway is implicated in ApoA-I Transcytosis?

The role of caveolin-1 and clathrin heavy chain in apoA-I internalisation and

transport was assessed in endothelial cells. The expression of clathrin heavy

chain was reduced by RNA interference (Fig. 35). Knock-down of clathrin heavy

chain was reducing the degradation of LDL but had no effect on the uptake of

apoA-I (Fig. 36). On the contrary, reducing caveolin-1 expression diminished

apoA-I internalisation and transport but not LDL degradation (Fig. 31).

Moreover, we extracted the membrane fractions which are insoluble in TritonX-

100 at 4°C. These fractions were strongly stained by caveolin-1 antibodies and

apoA-I was preferentially binding these caveolin-1 enriched rafts transferred

onto nitrocellulose membrane (Fig. 33). Thus, it seems that most apoA-I is

internalised in a caveolin-1 dependent manner. Caveolae-internalisation

inhibitors (i.e. filipin, genistein) were used to confirm this result. Unfortunatelly,

they were cytotoxic and no specific effect could be observed. Besides, after 30

min incubation the vesicles containing apoA-I - such as the one observed by

fluorescence microscopy on Fig. 14 - were not stained with caveolin-1 (data not

shown). It is thus very likely that these vesicles were already uncoated at the

time of the observation. In addition, up to 20% of the vesicles colocalised with

the early endosomes markers transferrin and EEA1 (Fig. 14). These findings

seem to disagree with the role of caveolin-1 in apoA-I internalisation. In order to

further understand these contradictive results, it is critical to intensively

characterise the nature of the apoA-I vesicles and study apoA-I intracellular

trafficking.

Although we cannot exclude that a minor part of apoA-I might be taken up via

clathrin coated pits, most of apoA-I seems to be internalised in a caveolae-

mediated pathway. Interestingly, it is rather believed that HDL is internalised by

clathrin coated pits, at least in macrophages, CaCo2 cells and HepG2 cells,

which express low levels of caveolin-1 [168, 173-175]. On the contrary, in

endothelial cells HDL is known to interact with caveolae, thereby stimulating

endothelial nitric oxid synthase [61, 176]. Moreover, SR-BI the best known HDL

receptor is found essentially in caveolae [54]. Finally, caveolae were identified

as the major source of free cholesterol transferred onto apoA-I [177]. To

Discussion

91

conclude, it seems that HDL and apoA-I can undergo internalisation via both

clathrin-coated pits and caveolae, maybe depending on the cell type and on

their fate.

Both ABCA1 and β-ATPase were found in caveolin-1 enriched rafts (Fig. 34). It

has already been reported that F0F1 ATPase is expressed in these rafts [66, 73,

74, 178]. Moreover, in adipocytes the α and β subunits of F0F1 ATPase were

shown to colocalise with cholera toxin [66]. On the contrary, ABCA1 was shown

to be expressed in Lubrol WX insoluble rafts and not in Triton X-100 insoluble

rafts in macrophages and fibroblasts [179, 180]. We found that in endothelial

cells ABCA1 is expressed in Triton X-100 insoluble rafts. It would be neat to

confirm the localisation of ABCA1 and β-ATPase in caveolae using confocal

fluorescence microscopy. This result provides, however, the first hint that

ABCA1, F0F1 ATPase and caveolin-1 proteins might collaborate to mediate the

internalisation of apoA-I in endothelial cells.

Finally, not only HDL but also LDL [124, 181] were reported to be transcytosed

through the endothelium in a caveolae-dependent fashion. In the apoE deficient

mice, the ablation of caveolin-1 confers protection against atherosclerosis,

indicating that at least one early event involved in the development of

atherosclerosis is impaired in the caveolin-1 knockout mice [182]. Because

caveolin-1 seems to modulate the transport of both pro- and anti-atherogenic

lipoproteins, it might be a new critical target to interfere with the development of

atherosclerosis.

Outlook

93

OUTLOOK

The previous discussion revealed several issues that are to be addressed in the

future:

1. What is the intrinsic function of ABCA1? Notably, is ABCA1 directly

involved in apoA-I trafficking and resecretion?

2. Which subunits of F0F1 ATPase are present on the cell surface and how

is the complex organised?

3. Which mechanism leads to the ectopic expression of F0F1 ATPase?

4. What are the events, downstream from F0F1 ATPase, which are

modulating apoA-I transcytosis?

5. What is the nature of the vesicles containing apoA-I?

6. How are F0F1 ATPase, ABCA1 and caveolin-1 cooperating to apoA-I

transcytosis?

The last question will be now developed in more details. For this purpose, the

results discussed previously and data reported by other groups have been

integrated in a model that may be regarded as a working hypothesis (Fig. 37).

We provided evidence that, upon binding of apoA-I, F0F1 ATPase hydrolyses

ATP on the surface of endothelial cells, thus controlling apoA-I internalisation

and transcytosis. ABCA1 was also modulating the uptake and the transport of

apoA-I. Both F0F1 ATPase and ABCA1 were found in caveolae rafts, and

caveolin-1 was regulating apoA-I internalisation and transcytosis.

We propose that the ADP produced by F0F1 ATPase stimulates its cognate P2Y

receptor on the surface of endothelial cells. P2Y receptors are coupled to G-

proteins and regulate notably intracellular Ca2+ concentrations [183].

Interestingly, ABCA1 has been shown to promote Ca2+-induced exposure of

phosphatidylserine [166], which is thought to induce an outward bending of the

membrane [52, 53]. Therefore, we hypothesise that ABCA1 mediates efflux of

phosphatidylserine and creates a local change in the membrane bending, which

may promote the caveolin-1 mediated internalisation of apoA-I and ultimately

Outlook

94

apoA-I transcytosis. Besides, activation of the unidentified P2Y receptor by ADP

may also induce the Src-dependent phosphorylation of dynamin-2 and thereby

the caveolae-mediated internalisation and transport of apoA-I.

In order to validate this model (Fig. 37), several issues should be addressed.

First, simultaneous silencing of ABCA1 and β-ATPase should confirm that both

proteins contribute to the same pathway. Second, the P2Y receptor(s)

modulating apoA-I internalisation in endothelial cells must be identified and its

signalling should be studied, maybe initially focussing on PLC stimulated

release of IP3 and Ca2+ and adenyl cyclase regulation. Third, the

phosphatidylserine translocase activity of ABCA1 must be assessed and its

effect on caveolae mediated internalisation characterised.

Outlook

95

Figure 37: Model for the transcytosis of apoA-I in endothelial cells. F0F1 seems to

hydrolyse ATP upon binding of apoA-I. The ADP produced might bind one P2Y

receptor of endothelial cells, thereby stimulating the release of Ca2+ from

intracellular stores. ABCA1 was also found to modulate apoA-I internalisation and

transport. Interestingly, the phosphatidylserine transferase activity of ABCA1 is

dependent on the intracellular Ca2+ concentration. The translocation of

phosphatidylserine might induce an outward bending of the membrane which

promotes the internalisation and ultimately the transcytosis of apoA-I .

PS: phosphatidylserine, AC: adenyl cyclase, PLC: phospholipase C, cAMP: cyclic

AMP, IP3: inositol-3 phosphate

References

96

REFERENCES

[1] B. Rippe, B.I. Rosengren, O. Carlsson, D. Venturoli, Transendothelial transport: the vesicle controversy, J Vasc Res 39 (2002) 375-390.

[2] P.L. Tuma, A.L. Hubbard, Transcytosis: crossing cellular barriers, Physiol Rev 83 (2003) 871-932.

[3] J.E. Schnitzer, Caveolae: from basic trafficking mechanisms to targeting transcytosis for tissue-specific drug and gene delivery in vivo, Adv Drug Deliv Rev 49 (2001) 265-280.

[4] R. Ross, Atherosclerosis--an inflammatory disease, N Engl J Med 340 (1999) 115-126.

[5] J.F. Oram, J.W. Heinecke, ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease, Physiol Rev 85 (2005) 1343-1372.

[6] J.M. Tarbell, Mass transport in arteries and the localization of atherosclerosis, Annu Rev Biomed Eng 5 (2003) 79-118.

[7] M. Krieger, Charting the fate of the "good cholesterol": identification and characterization of the high-density lipoprotein receptor SR-BI, Annu Rev Biochem 68 (1999) 523-558.

[8] S.M. Clee, J.J. Kastelein, M. van Dam, M. Marcil, K. Roomp, K.Y. Zwarts, J.A. Collins, R. Roelants, N. Tamasawa, T. Stulc, T. Suda, R. Ceska, B. Boucher, C. Rondeau, C. DeSouich, A. Brooks-Wilson, H.O. Molhuizen, J. Frohlich, J. Genest, Jr., M.R. Hayden, Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes, J Clin Invest 106 (2000) 1263-1270.

[9] T. Elston, H. Wang, G. Oster, Energy transduction in ATP synthase, Nature 391 (1998) 510-513.

[10] A.J. Lusis, Atherosclerosis, Nature 407 (2000) 233-241.

[11] I. Tabas, Consequences of cellular cholesterol accumulation: basic concepts and physiological implications, J Clin Invest 110 (2002) 905-911.

[12] C.K. Glass, J.L. Witztum, Atherosclerosis. the road ahead, Cell 104 (2001) 503-516.

References

97

[13] M. Hersberger, A. von Eckardstein, Low high-density lipoprotein cholesterol: physiological background, clinical importance and drug treatment, Drugs 63 (2003) 1907-1945.

[14] C.J. Fielding, P.E. Fielding, Molecular physiology of reverse cholesterol transport, J Lipid Res 36 (1995) 211-228.

[15] A. Barrans, B. Jaspard, R. Barbaras, H. Chap, B. Perret, X. Collet, Pre-beta HDL: structure and metabolism, Biochim Biophys Acta 1300 (1996) 73-85.

[16] C. Wolfrum, M.N. Poy, M. Stoffel, Apolipoprotein M is required for prebeta-HDL formation and cholesterol efflux to HDL and protects against atherosclerosis, Nat Med 11 (2005) 418-422.

[17] B. Jaspard, N. Fournier, G. Vieitez, V. Atger, R. Barbaras, C. Vieu, J. Manent, H. Chap, B. Perret, X. Collet, Structural and functional comparison of HDL from homologous human plasma and follicular fluid. A model for extravascular fluid, Arterioscler Thromb Vasc Biol 17 (1997) 1605-1613.

[18] L. Lindstedt, M. Lee, G.R. Castro, J.C. Fruchart, P.T. Kovanen, Chymase in exocytosed rat mast cell granules effectively proteolyzes apolipoprotein AI-containing lipoproteins, so reducing the cholesterol efflux-inducing ability of serum and aortic intimal fluid, J Clin Invest 97 (1996) 2174-2182.

[19] M.N. Nanjee, C.J. Cooke, R. Garvin, F. Semeria, G. Lewis, W.L. Olszewski, N.E. Miller, Intravenous apoA-I/lecithin discs increase pre-beta-HDL concentration in tissue fluid and stimulate reverse cholesterol transport in humans, J Lipid Res 42 (2001) 1586-1593.

[20] A. van Tol, Phospholipid transfer protein, Curr Opin Lipidol 13 (2002) 135-139.

[21] S. Santamarina-Fojo, G. Lambert, J.M. Hoeg, H.B. Brewer, Jr., Lecithin-cholesterol acyltransferase: role in lipoprotein metabolism, reverse cholesterol transport and atherosclerosis, Curr Opin Lipidol 11 (2000) 267-275.

[22] P.J. Barter, H.B. Brewer, Jr., M.J. Chapman, C.H. Hennekens, D.J. Rader, A.R. Tall, Cholesteryl ester transfer protein: a novel target for raising HDL and inhibiting atherosclerosis, Arterioscler Thromb Vasc Biol 23 (2003) 160-167.

[23] D.L. Silver, N. Wang, X. Xiao, A.R. Tall, High density lipoprotein (HDL) particle uptake mediated by scavenger receptor class B type 1 results in

References

98

selective sorting of HDL cholesterol from protein and polarized cholesterol secretion, J Biol Chem 276 (2001) 25287-25293.

[24] D.J. Gordon, B.M. Rifkind, High-density lipoprotein--the clinical implications of recent studies, N Engl J Med 321 (1989) 1311-1316.

[25] M.E. Brousseau, J.M. Hoeg, Transgenic rabbits as models for atherosclerosis research, J Lipid Res 40 (1999) 365-375.

[26] C.A. Reardon, G.S. Getz, Mouse models of atherosclerosis, Curr Opin Lipidol 12 (2001) 167-173.

[27] A. von Eckardstein, M. Hersberger, L. Rohrer, Current understanding of the metabolism and biological actions of HDL, Curr Opin Clin Nutr Metab Care 8 (2005) 147-152.

[28] M. Van Eck, M. Pennings, M. Hoekstra, R. Out, T.J. Van Berkel, Scavenger receptor BI and ATP-binding cassette transporter A1 in reverse cholesterol transport and atherosclerosis, Curr Opin Lipidol 16 (2005) 307-315.

[29] M.A. Kennedy, G.C. Barrera, K. Nakamura, A. Baldan, P. Tarr, M.C. Fishbein, J. Frank, O.L. Francone, P.A. Edwards, ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation, Cell Metab 1 (2005) 121-131.

[30] J.F. Oram, Molecular basis of cholesterol homeostasis: lessons from Tangier disease and ABCA1, Trends Mol Med 8 (2002) 168-173.

[31] R.J. Aiello, D. Brees, P.A. Bourassa, L. Royer, S. Lindsey, T. Coskran, M. Haghpassand, O.L. Francone, Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages, Arterioscler Thromb Vasc Biol 22 (2002) 630-637.

[32] J.M. Timmins, J.Y. Lee, E. Boudyguina, K.D. Kluckman, L.R. Brunham, A. Mulya, A.K. Gebre, J.M. Coutinho, P.L. Colvin, T.L. Smith, M.R. Hayden, N. Maeda, J.S. Parks, Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I, J Clin Invest 115 (2005) 1333-1342.

[33] J. McNeish, R.J. Aiello, D. Guyot, T. Turi, C. Gabel, C. Aldinger, K.L. Hoppe, M.L. Roach, L.J. Royer, J. de Wet, C. Broccardo, G. Chimini, O.L. Francone, High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1, Proc Natl Acad Sci U S A 97 (2000) 4245-4250.

References

99

[34] K. Greenow, N.J. Pearce, D.P. Ramji, The key role of apolipoprotein E in atherosclerosis, J Mol Med 83 (2005) 329-342.

[35] I. Bjorkhem, U. Diczfalusy, D. Lutjohann, Removal of cholesterol from extrahepatic sources by oxidative mechanisms, Curr Opin Lipidol 10 (1999) 161-165.

[36] M. de La Llera-Moya, M.A. Connelly, D. Drazul, S.M. Klein, E. Favari, P.G. Yancey, D.L. Williams, G.H. Rothblat, Scavenger receptor class B type I affects cholesterol homeostasis by magnifying cholesterol flux between cells and HDL, J Lipid Res 42 (2001) 1969-1978.

[37] X. Gu, K. Kozarsky, M. Krieger, Scavenger receptor class B, type I-mediated [3H]cholesterol efflux to high and low density lipoproteins is dependent on lipoprotein binding to the receptor, J Biol Chem 275 (2000) 29993-30001.

[38] Y. Ji, B. Jian, N. Wang, Y. Sun, M.L. Moya, M.C. Phillips, G.H. Rothblat, J.B. Swaney, A.R. Tall, Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux, J Biol Chem 272 (1997) 20982-20985.

[39] C. Cavelier, I. Lorenzi, L. Rohrer, A. von Eckardstein, Lipid efflux by the ATP-binding cassette transporters ABCA1 and ABCG1, Biochim Biophys Acta 1761 (2006) 655-666.

[40] M. Bodzioch, E. Orso, J. Klucken, T. Langmann, A. Bottcher, W. Diederich, W. Drobnik, S. Barlage, C. Buchler, M. Porsch-Ozcurumez, W.E. Kaminski, H.W. Hahmann, K. Oette, G. Rothe, C. Aslanidis, K.J. Lackner, G. Schmitz, The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease, Nat Genet 22 (1999) 347-351.

[41] A.T. Remaley, S. Rust, M. Rosier, C. Knapper, L. Naudin, C. Broccardo, K.M. Peterson, C. Koch, I. Arnould, C. Prades, N. Duverger, H. Funke, G. Assman, M. Dinger, M. Dean, G. Chimini, S. Santamarina-Fojo, D.S. Fredrickson, P. Denefle, H.B. Brewer, Jr., Human ATP-binding cassette transporter 1 (ABC1): genomic organization and identification of the genetic defect in the original Tangier disease kindred, Proc Natl Acad Sci U S A 96 (1999) 12685-12690.

[42] S. Rust, M. Rosier, H. Funke, J. Real, Z. Amoura, J.C. Piette, J.F. Deleuze, H.B. Brewer, N. Duverger, P. Denefle, G. Assmann, Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1, Nat Genet 22 (1999) 352-355.

References

100

[43] A. Brooks-Wilson, M. Marcil, S.M. Clee, L.H. Zhang, K. Roomp, M. van Dam, L. Yu, C. Brewer, J.A. Collins, H.O. Molhuizen, O. Loubser, B.F. Ouelette, K. Fichter, K.J. Ashbourne-Excoffon, C.W. Sensen, S. Scherer, S. Mott, M. Denis, D. Martindale, J. Frohlich, K. Morgan, B. Koop, S. Pimstone, J.J. Kastelein, J. Genest, Jr., M.R. Hayden, Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency, Nat Genet 22 (1999) 336-345.

[44] G.A. Francis, R.H. Knopp, J.F. Oram, Defective removal of cellular cholesterol and phospholipids by apolipoprotein A-I in Tangier Disease, J Clin Invest 96 (1995) 78-87.

[45] A.T. Remaley, U.K. Schumacher, J.A. Stonik, B.D. Farsi, H. Nazih, H.B. Brewer, Jr., Decreased reverse cholesterol transport from Tangier disease fibroblasts. Acceptor specificity and effect of brefeldin on lipid efflux, Arterioscler Thromb Vasc Biol 17 (1997) 1813-1821.

[46] B.L. Vaisman, G. Lambert, M. Amar, C. Joyce, T. Ito, R.D. Shamburek, W.J. Cain, J. Fruchart-Najib, E.D. Neufeld, A.T. Remaley, H.B. Brewer, Jr., S. Santamarina-Fojo, ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice, J Clin Invest 108 (2001) 303-309.

[47] R.R. Singaraja, C. Fievet, G. Castro, E.R. James, N. Hennuyer, S.M. Clee, N. Bissada, J.C. Choy, J.C. Fruchart, B.M. McManus, B. Staels, M.R. Hayden, Increased ABCA1 activity protects against atherosclerosis, J Clin Invest 110 (2002) 35-42.

[48] M. Haghpassand, P.A. Bourassa, O.L. Francone, R.J. Aiello, Monocyte/macrophage expression of ABCA1 has minimal contribution to plasma HDL levels, J Clin Invest 108 (2001) 1315-1320.

[49] X. Zha, J. Genest, Jr., R. McPherson, Endocytosis is enhanced in Tangier fibroblasts: possible role of ATP-binding cassette protein A1 in endosomal vesicular transport, J Biol Chem 276 (2001) 39476-39483.

[50] Y. Hamon, C. Broccardo, O. Chambenoit, M.F. Luciani, F. Toti, S. Chaslin, J.M. Freyssinet, P.F. Devaux, J. McNeish, D. Marguet, G. Chimini, ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine, Nat Cell Biol 2 (2000) 399-406.

[51] N. Alder-Baerens, P. Muller, A. Pohl, T. Korte, Y. Hamon, G. Chimini, T. Pomorski, A. Herrmann, Headgroup-specific exposure of phospholipids in ABCA1-expressing cells, J Biol Chem 280 (2005) 26321-26329.

[52] T. Pomorski, R. Lombardi, H. Riezman, P.F. Devaux, G. van Meer, J.C. Holthuis, Drs2p-related P-type ATPases Dnf1p and Dnf2p are required

References

101

for phospholipid translocation across the yeast plasma membrane and serve a role in endocytosis, Mol Biol Cell 14 (2003) 1240-1254.

[53] P.F. Devaux, Static and dynamic lipid asymmetry in cell membranes, Biochemistry 30 (1991) 1163-1173.

[54] J. Babitt, B. Trigatti, A. Rigotti, E.J. Smart, R.G. Anderson, S. Xu, M. Krieger, Murine SR-BI, a high density lipoprotein receptor that mediates selective lipid uptake, is N-glycosylated and fatty acylated and colocalizes with plasma membrane caveolae, J Biol Chem 272 (1997) 13242-13249.

[55] K.T. Landschulz, R.K. Pathak, A. Rigotti, M. Krieger, H.H. Hobbs, Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat, J Clin Invest 98 (1996) 984-995.

[56] M.A. Connelly, D.L. Williams, Scavenger receptor BI: a scavenger receptor with a mission to transport high density lipoprotein lipids, Curr Opin Lipidol 15 (2004) 287-295.

[57] A. Rigotti, B. Trigatti, J. Babitt, M. Penman, S. Xu, M. Krieger, Scavenger receptor BI--a cell surface receptor for high density lipoprotein, Curr Opin Lipidol 8 (1997) 181-188.

[58] B. Liu, M. Krieger, Highly purified scavenger receptor class B, type I reconstituted into phosphatidylcholine/cholesterol liposomes mediates high affinity high density lipoprotein binding and selective lipid uptake, J Biol Chem 277 (2002) 34125-34135.

[59] D. Rhainds, P. Bourgeois, G. Bourret, K. Huard, L. Falstrault, L. Brissette, Localization and regulation of SR-BI in membrane rafts of HepG2 cells, J Cell Sci 117 (2004) 3095-3105.

[60] P.G. Yancey, M. de la Llera-Moya, S. Swarnakar, P. Monzo, S.M. Klein, M.A. Connelly, W.J. Johnson, D.L. Williams, G.H. Rothblat, High density lipoprotein phospholipid composition is a major determinant of the bi-directional flux and net movement of cellular free cholesterol mediated by scavenger receptor BI, J Biol Chem 275 (2000) 36596-36604.

[61] I.S. Yuhanna, Y. Zhu, B.E. Cox, L.D. Hahner, S. Osborne-Lawrence, P. Lu, Y.L. Marcel, R.G. Anderson, M.E. Mendelsohn, H.H. Hobbs, P.W. Shaul, High-density lipoprotein binding to scavenger receptor-BI activates endothelial nitric oxide synthase, Nat Med 7 (2001) 853-857.

[62] M. Van Eck, J. Twisk, M. Hoekstra, B.T. Van Rij, C.A. Van der Lans, I.S. Bos, J.K. Kruijt, F. Kuipers, T.J. Van Berkel, Differential effects of

References

102

scavenger receptor BI deficiency on lipid metabolism in cells of the arterial wall and in the liver, J Biol Chem 278 (2003) 23699-23705.

[63] S.D. Covey, M. Krieger, W. Wang, M. Penman, B.L. Trigatti, Scavenger receptor class B type I-mediated protection against atherosclerosis in LDL receptor-negative mice involves its expression in bone marrow-derived cells, Arterioscler Thromb Vasc Biol 23 (2003) 1589-1594.

[64] B. Das, M.O. Mondragon, M. Sadeghian, V.B. Hatcher, A.J. Norin, A novel ligand in lymphocyte-mediated cytotoxicity: expression of the beta subunit of H+ transporting ATP synthase on the surface of tumor cell lines, J Exp Med 180 (1994) 273-281.

[65] T.L. Moser, M.S. Stack, I. Asplin, J.J. Enghild, P. Hojrup, L. Everitt, S. Hubchak, H.W. Schnaper, S.V. Pizzo, Angiostatin binds ATP synthase on the surface of human endothelial cells, Proc Natl Acad Sci U S A 96 (1999) 2811-2816.

[66] B.W. Kim, H.J. Choo, J.W. Lee, J.H. Kim, Y.G. Ko, Extracellular ATP is generated by ATP synthase complex in adipocyte lipid rafts, Exp Mol Med 36 (2004) 476-485.

[67] L.O. Martinez, S. Jacquet, J.P. Esteve, C. Rolland, E. Cabezon, E. Champagne, T. Pineau, V. Georgeaud, J.E. Walker, F. Terce, X. Collet, B. Perret, R. Barbaras, Ectopic beta-chain of ATP synthase is an apolipoprotein A-I receptor in hepatic HDL endocytosis, Nature 421 (2003) 75-79.

[68] E. Scotet, L.O. Martinez, E. Grant, R. Barbaras, P. Jeno, M. Guiraud, B. Monsarrat, X. Saulquin, S. Maillet, J.P. Esteve, F. Lopez, B. Perret, X. Collet, M. Bonneville, E. Champagne, Tumor recognition following Vgamma9Vdelta2 T cell receptor interactions with a surface F1-ATPase-related structure and apolipoprotein A-I, Immunity 22 (2005) 71-80.

[69] B.J. Soltys, R.S. Gupta, Mitochondrial-matrix proteins at unexpected locations: are they exported?, Trends Biochem Sci 24 (1999) 174-177.

[70] M.L. Wahl, D.J. Kenan, M. Gonzalez-Gronow, S.V. Pizzo, Angiostatin's molecular mechanism: aspects of specificity and regulation elucidated, J Cell Biochem 96 (2005) 242-261.

[71] D.D. Stump, S.L. Zhou, P.D. Berk, Comparison of plasma membrane FABP and mitochondrial isoform of aspartate aminotransferase from rat liver, Am J Physiol 265 (1993) G894-902.

[72] L.M. Isola, S.L. Zhou, C.L. Kiang, D.D. Stump, M.W. Bradbury, P.D. Berk, 3T3 fibroblasts transfected with a cDNA for mitochondrial aspartate

References

103

aminotransferase express plasma membrane fatty acid-binding protein and saturable fatty acid uptake, Proc Natl Acad Sci U S A 92 (1995) 9866-9870.

[73] R.R. Sprenger, D. Speijer, J.W. Back, C.G. De Koster, H. Pannekoek, A.J. Horrevoets, Comparative proteomics of human endothelial cell caveolae and rafts using two-dimensional gel electrophoresis and mass spectrometry, Electrophoresis 25 (2004) 156-172.

[74] T.J. Bae, M.S. Kim, J.W. Kim, B.W. Kim, H.J. Choo, J.W. Lee, K.B. Kim, C.S. Lee, J.H. Kim, S.Y. Chang, C.Y. Kang, S.W. Lee, Y.G. Ko, Lipid raft proteome reveals ATP synthase complex in the cell surface, Proteomics 4 (2004) 3536-3548.

[75] P.D. Boyer, The ATP synthase--a splendid molecular machine, Annu Rev Biochem 66 (1997) 717-749.

[76] T.L. Moser, D.J. Kenan, T.A. Ashley, J.A. Roy, M.D. Goodman, U.K. Misra, D.J. Cheek, S.V. Pizzo, Endothelial cell surface F1-F0 ATP synthase is active in ATP synthesis and is inhibited by angiostatin, Proc Natl Acad Sci U S A 98 (2001) 6656-6661.

[77] S. Jacquet, C. Malaval, L.O. Martinez, K. Sak, C. Rolland, C. Perez, M. Nauze, E. Champagne, F. Terce, C. Gachet, B. Perret, X. Collet, J.M. Boeynaems, R. Barbaras, The nucleotide receptor P2Y13 is a key regulator of hepatic high-density lipoprotein (HDL) endocytosis, Cell Mol Life Sci 62 (2005) 2508-2515.

[78] L. Wang, L. Karlsson, S. Moses, A. Hultgardh-Nilsson, M. Andersson, C. Borna, T. Gudbjartsson, S. Jern, D. Erlinge, P2 receptor expression profiles in human vascular smooth muscle and endothelial cells, J Cardiovasc Pharmacol 40 (2002) 841-853.

[79] E.M. Schwiebert, A. Zsembery, Extracellular ATP as a signaling molecule for epithelial cells, Biochim Biophys Acta 1615 (2003) 7-32.

[80] M.R. Boarder, S.M. Hourani, The regulation of vascular function by P2 receptors: multiple sites and multiple receptors, Trends Pharmacol Sci 19 (1998) 99-107.

[81] C.I. Seye, N. Yu, F.A. Gonzalez, L. Erb, G.A. Weisman, The P2Y2 nucleotide receptor mediates vascular cell adhesion molecule-1 expression through interaction with VEGF receptor-2 (KDR/Flk-1), J Biol Chem 279 (2004) 35679-35686.

[82] N. Tanaka, N. Nejime, S. Kagota, Y. Kubota, K. Yudo, K. Nakamura, M. Kunitomo, K. Takahashi, M. Hashimoto, K. Shinozuka, ATP participates

References

104

in the regulation of microvessel permeability, J Pharm Pharmacol 58 (2006) 481-487.

[83] N. Tanaka, K. Kawasaki, N. Nejime, Y. Kubota, K. Nakamura, M. Kunitomo, K. Takahashi, M. Hashimoto, K. Shinozuka, P2Y receptor-mediated Ca(2+) signaling increases human vascular endothelial cell permeability, J Pharmacol Sci 95 (2004) 174-180.

[84] J.R. Pappenheimer, E.M. Renkin, L.M. Borrero, Filtration, diffusion and molecular sieving through peripheral capillary membranes; a contribution to the pore theory of capillary permeability, Am J Physiol 167 (1951) 13-46.

[85] G. Grotte, Passage of dextran molecules across the blood-lymph barrier, Acta Chir Scand Suppl 211 (1956) 1-84.

[86] F.E. Curry, C.C. Michel, A fiber matrix model of capillary permeability, Microvasc Res 20 (1980) 96-99.

[87] A.J. Milici, N.E. Watrous, H. Stukenbrok, G.E. Palade, Transcytosis of albumin in capillary endothelium, J Cell Biol 105 (1987) 2603-2612.

[88] G.E. Palade, M. Simionescu, N. Simionescu, Structural aspects of the permeability of the microvascular endothelium, Acta Physiol Scand Suppl 463 (1979) 11-32.

[89] L. Ghitescu, M. Bendayan, Transendothelial transport of serum albumin: a quantitative immunocytochemical study, J Cell Biol 117 (1992) 745-755.

[90] B.D. Angst, C. Marcozzi, A.I. Magee, The cadherin superfamily: diversity in form and function, J Cell Sci 114 (2001) 629-641.

[91] H. Aberle, H. Schwartz, R. Kemler, Cadherin-catenin complex: protein interactions and their implications for cadherin function, J Cell Biochem 61 (1996) 514-523.

[92] A. Ben-Ze'ev, B. Geiger, Differential molecular interactions of beta-catenin and plakoglobin in adhesion, signaling and cancer, Curr Opin Cell Biol 10 (1998) 629-639.

[93] G.J. Feldman, J.M. Mullin, M.P. Ryan, Occludin: structure, function and regulation, Adv Drug Deliv Rev 57 (2005) 883-917.

[94] G. Bazzoni, E. Dejana, Endothelial cell-to-cell junctions: molecular organization and role in vascular homeostasis, Physiol Rev 84 (2004) 869-901.

References

105

[95] T. Hirase, J.M. Staddon, M. Saitou, Y. Ando-Akatsuka, M. Itoh, M. Furuse, K. Fujimoto, S. Tsukita, L.L. Rubin, Occludin as a possible determinant of tight junction permeability in endothelial cells, J Cell Sci 110 ( Pt 14) (1997) 1603-1613.

[96] A. Youakim, M. Ahdieh, Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin, Am J Physiol 276 (1999) G1279-1288.

[97] L. DeMaio, Y.S. Chang, T.W. Gardner, J.M. Tarbell, D.A. Antonetti, Shear stress regulates occludin content and phosphorylation, Am J Physiol Heart Circ Physiol 281 (2001) H105-113.

[98] L. DeMaio, D.A. Antonetti, R.C. Scaduto, Jr., T.W. Gardner, J.M. Tarbell, VEGF increases paracellular transport without altering the solvent-drag reflection coefficient, Microvasc Res 68 (2004) 295-302.

[99] D. Predescu, G.E. Palade, Plasmalemmal vesicles represent the large pore system of continuous microvascular endothelium, Am J Physiol 265 (1993) H725-733.

[100] D. Predescu, R. Horvat, S. Predescu, G.E. Palade, Transcytosis in the continuous endothelium of the myocardial microvasculature is inhibited by N-ethylmaleimide, Proc Natl Acad Sci U S A 91 (1994) 3014-3018.

[101] J.E. Schnitzer, J. Liu, P. Oh, Endothelial caveolae have the molecular transport machinery for vesicle budding, docking, and fusion including VAMP, NSF, SNAP, annexins, and GTPases, J Biol Chem 270 (1995) 14399-14404.

[102] S.A. Predescu, D.N. Predescu, G.E. Palade, Endothelial transcytotic machinery involves supramolecular protein-lipid complexes, Mol Biol Cell 12 (2001) 1019-1033.

[103] D. Feng, R. Flaumenhaft, C. Bandeira-Melo, P. Weller, A. Dvorak, Ultrastructural localization of vesicle-associated membrane protein(s) to specialized membrane structures in human pericytes, vascular smooth muscle cells, endothelial cells, neutrophils, and eosinophils, J Histochem Cytochem 49 (2001) 293-304.

[104] D.P. McIntosh, J.E. Schnitzer, Caveolae require intact VAMP for targeted transport in vascular endothelium, Am J Physiol 277 (1999) H2222-2232.

[105] J.E. Schnitzer, P. Oh, E. Pinney, J. Allard, Filipin-sensitive caveolae-mediated transport in endothelium: reduced transcytosis, scavenger endocytosis, and capillary permeability of select macromolecules, J Cell Biol 127 (1994) 1217-1232.

References

106

[106] T.A. John, S.M. Vogel, C. Tiruppathi, A.B. Malik, R.D. Minshall, Quantitative analysis of albumin uptake and transport in the rat microvessel endothelial monolayer, Am J Physiol Lung Cell Mol Physiol 284 (2003) L187-196.

[107] S.A. Predescu, D.N. Predescu, B.K. Timblin, R.V. Stan, A.B. Malik, Intersectin regulates fission and internalization of caveolae in endothelial cells, Mol Biol Cell 14 (2003) 4997-5010.

[108] L. Pelkmans, M. Zerial, Kinase-regulated quantal assemblies and kiss-and-run recycling of caveolae, Nature 436 (2005) 128-133.

[109] B. Razani, J.A. Engelman, X.B. Wang, W. Schubert, X.L. Zhang, C.B. Marks, F. Macaluso, R.G. Russell, M. Li, R.G. Pestell, D. Di Vizio, H. Hou, Jr., B. Kneitz, G. Lagaud, G.J. Christ, W. Edelmann, M.P. Lisanti, Caveolin-1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities, J Biol Chem 276 (2001) 38121-38138.

[110] M. Drab, P. Verkade, M. Elger, M. Kasper, M. Lohn, B. Lauterbach, J. Menne, C. Lindschau, F. Mende, F.C. Luft, A. Schedl, H. Haller, T.V. Kurzchalia, Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice, Science 293 (2001) 2449-2452.

[111] R.V. Stan, Structure of caveolae, Biochim Biophys Acta 1746 (2005) 334-348.

[112] J.E. Hinshaw, S.L. Schmid, Dynamin self-assembles into rings suggesting a mechanism for coated vesicle budding, Nature 374 (1995) 190-192.

[113] S.M. Sweitzer, J.E. Hinshaw, Dynamin undergoes a GTP-dependent conformational change causing vesiculation, Cell 93 (1998) 1021-1029.

[114] P. Oh, D.P. McIntosh, J.E. Schnitzer, Dynamin at the neck of caveolae mediates their budding to form transport vesicles by GTP-driven fission from the plasma membrane of endothelium, J Cell Biol 141 (1998) 101-114.

[115] A.N. Shajahan, B.K. Timblin, R. Sandoval, C. Tiruppathi, A.B. Malik, R.D. Minshall, Role of Src-induced dynamin-2 phosphorylation in caveolae-mediated endocytosis in endothelial cells, J Biol Chem 279 (2004) 20392-20400.

[116] M. Okamoto, S. Schoch, T.C. Sudhof, EHSH1/intersectin, a protein that contains EH and SH3 domains and binds to dynamin and SNAP-25. A

References

107

protein connection between exocytosis and endocytosis?, J Biol Chem 274 (1999) 18446-18454.

[117] S.A. Predescu, D.N. Predescu, K. Shimizu, I.K. Klein, A.B. Malik, Cholesterol-dependent syntaxin-4 and SNAP-23 clustering regulates caveolar fusion with the endothelial plasma membrane, J Biol Chem 280 (2005) 37130-37138.

[118] G. Assmann, J.R. Nofer, Atheroprotective effects of high-density lipoproteins, Annu Rev Med 54 (2003) 321-341.

[119] B.G. Nordestgaard, R. Wootton, B. Lewis, Selective retention of VLDL, IDL, and LDL in the arterial intima of genetically hyperlipidemic rabbits in vivo. Molecular size as a determinant of fractional loss from the intima-inner media, Arterioscler Thromb Vasc Biol 15 (1995) 534-542.

[120] B.G. Nordestgaard, L.B. Nielsen, Atherosclerosis and arterial influx of lipoproteins, Curr Opin Lipidol 5 (1994) 252-257.

[121] B.I. Rosengren, O. Carlsson, D. Venturoli, O. al Rayyes, B. Rippe, Transvascular passage of macromolecules into the peritoneal cavity of normo- and hypothermic rats in vivo: active or passive transport?, J Vasc Res 41 (2004) 123-130.

[122] B.I. Rosengren, O. Al Rayyes, B. Rippe, Transendothelial transport of low-density lipoprotein and albumin across the rat peritoneum in vivo: effects of the transcytosis inhibitors NEM and filipin, J Vasc Res 39 (2002) 230-237.

[123] J.C. Rutledge, F.E. Curry, P. Blanche, R.M. Krauss, Solvent drag of LDL across mammalian endothelial barriers with increased permeability, Am J Physiol 268 (1995) H1982-1991.

[124] E. Vasile, M. Simionescu, N. Simionescu, Visualization of the binding, endocytosis, and transcytosis of low-density lipoprotein in the arterial endothelium in situ, J Cell Biol 96 (1983) 1677-1689.

[125] E.S. Kuzmenko, S. Djafarzadeh, Z.P. Cakar, K. Fiedler, LDL transcytosis by protein membrane diffusion, Int J Biochem Cell Biol 36 (2004) 519-534.

[126] Z. Balazs, U. Panzenboeck, A. Hammer, A. Sovic, O. Quehenberger, E. Malle, W. Sattler, Uptake and transport of high-density lipoprotein (HDL) and HDL-associated alpha-tocopherol by an in vitro blood-brain barrier model, J Neurochem 89 (2004) 939-950.

References

108

[127] C.S. Robinson, R.C. Wagner, Differential endocytosis of lipoproteins by capillary endothelial vesicles, Microcirc Endothelium Lymphatics 2 (1985) 313-329.

[128] H.E. de Vries, B. Breedveld, J. Kuiper, A.G. de Boer, T.J. Van Berkel, D.D. Breimer, High-density lipoprotein and cerebral endothelial cells in vitro: interactions and transport, Biochem Pharmacol 50 (1995) 271-273.

[129] R.J. Havel, H.A. Eder, J.H. Bragdon, The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum, J Clin Invest 34 (1955) 1345-1353.

[130] A. von Eckardstein, H. Funke, M. Walter, K. Altland, A. Benninghoven, G. Assmann, Structural analysis of human apolipoprotein A-I variants. Amino acid substitutions are nonrandomly distributed throughout the apolipoprotein A-I primary structure, J Biol Chem 265 (1990) 8610-8617.

[131] J.R. Nofer, B. Levkau, I. Wolinska, R. Junker, M. Fobker, A. von Eckardstein, U. Seedorf, G. Assmann, Suppression of endothelial cell apoptosis by high density lipoproteins (HDL) and HDL-associated lysosphingolipids, J Biol Chem 276 (2001) 34480-34485.

[132] C.M. Gajdusek, S.M. Schwartz, Technique for cloning bovine aortic endothelial cells, In Vitro 19 (1983) 394-402.

[133] M. Freeman, Y. Ekkel, L. Rohrer, M. Penman, N.J. Freedman, G.M. Chisolm, M. Krieger, Expression of type I and type II bovine scavenger receptors in Chinese hamster ovary cells: lipid droplet accumulation and nonreciprocal cross competition by acetylated and oxidized low density lipoprotein, Proc Natl Acad Sci U S A 88 (1991) 4931-4935.

[134] K.A. Youdim, A. Avdeef, N.J. Abbott, In vitro trans-monolayer permeability calculations: often forgotten assumptions, Drug Discov Today 8 (2003) 997-1003.

[135] M. Sargiacomo, M. Sudol, Z. Tang, M.P. Lisanti, Signal transducing molecules and glycosyl-phosphatidylinositol-linked proteins form a caveolin-rich insoluble complex in MDCK cells, J Cell Biol 122 (1993) 789-807.

[136] B.G. Drew, N.H. Fidge, G. Gallon-Beaumier, B.E. Kemp, B.A. Kingwell, High-density lipoprotein and apolipoprotein AI increase endothelial NO synthase activity by protein association and multisite phosphorylation, Proc Natl Acad Sci U S A 101 (2004) 6999-7004.

[137] S.G. Milton, V.P. Knutson, Comparison of the function of the tight junctions of endothelial cells and epithelial cells in regulating the

References

109

movement of electrolytes and macromolecules across the cell monolayer, J Cell Physiol 144 (1990) 498-504.

[138] S. Murthy, E. Born, S.N. Mathur, F.J. Field, LXR/RXR activation enhances basolateral efflux of cholesterol in CaCo-2 cells, J Lipid Res 43 (2002) 1054-1064.

[139] R.P. Koldamova, I.M. Lefterov, M.D. Ikonomovic, J. Skoko, P.I. Lefterov, B.A. Isanski, S.T. DeKosky, J.S. Lazo, 22R-hydroxycholesterol and 9-cis-retinoic acid induce ATP-binding cassette transporter A1 expression and cholesterol efflux in brain cells and decrease amyloid beta secretion, J Biol Chem 278 (2003) 13244-13256.

[140] W. Le Goff, D.Q. Peng, M. Settle, G. Brubaker, R.E. Morton, J.D. Smith, Cyclosporin A traps ABCA1 at the plasma membrane and inhibits ABCA1-mediated lipid efflux to apolipoprotein A-I, Arterioscler Thromb Vasc Biol 24 (2004) 2155-2161.

[141] D.L. Williams, R.E. Temel, M.A. Connelly, Roles of scavenger receptor BI and APO A-I in selective uptake of HDL cholesterol by adrenal cells, Endocr Res 26 (2000) 639-651.

[142] M.E. Pullman, G.C. Monroy, A Naturally Occurring Inhibitor of Mitochondrial Adenosine Triphosphatase, J Biol Chem 238 (1963) 3762-3769.

[143] W. Rouslin, Regulation of the mitochondrial ATPase in situ in cardiac muscle: role of the inhibitor subunit, J Bioenerg Biomembr 23 (1991) 873-888.

[144] M.S. Brown, J.L. Goldstein, A receptor-mediated pathway for cholesterol homeostasis, Science 232 (1986) 34-47.

[145] A.C. Li, C.K. Glass, The macrophage foam cell as a target for therapeutic intervention, Nat Med 8 (2002) 1235-1242.

[146] A. von Eckardstein, J.R. Nofer, G. Assmann, High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport, Arterioscler Thromb Vasc Biol 21 (2001) 13-27.

[147] P. Libby, Inflammation in atherosclerosis, Nature 420 (2002) 868-874.

[148] W. Risau, Differentiation of endothelium, Faseb J 9 (1995) 926-933.

[149] M. Simionescu, A. Gafencu, F. Antohe, Transcytosis of plasma macromolecules in endothelial cells: a cell biological survey, Microsc Res Tech 57 (2002) 269-288.

References

110

[150] M. Bendayan, Morphological and cytochemical aspects of capillary permeability, Microsc Res Tech 57 (2002) 327-349.

[151] M.N. Nanjee, C.J. Cooke, J.S. Wong, R.L. Hamilton, W.L. Olszewski, N.E. Miller, Composition and ultrastructure of size subclasses of normal human peripheral lymph lipoproteins: quantification of cholesterol uptake by HDL in tissue fluids, J Lipid Res 42 (2001) 639-648.

[152] K.A. Rye, P.J. Barter, Formation and metabolism of prebeta-migrating, lipid-poor apolipoprotein A-I, Arterioscler Thromb Vasc Biol 24 (2004) 421-428.

[153] M. Denis, B. Haidar, M. Marcil, M. Bouvier, L. Krimbou, J. Genest, Jr., Molecular and cellular physiology of apolipoprotein A-I lipidation by the ATP-binding cassette transporter A1 (ABCA1), J Biol Chem 279 (2004) 7384-7394.

[154] P.E. Fielding, K. Nagao, H. Hakamata, G. Chimini, C.J. Fielding, A two-step mechanism for free cholesterol and phospholipid efflux from human vascular cells to apolipoprotein A-1, Biochemistry 39 (2000) 14113-14120.

[155] O. Chambenoit, Y. Hamon, D. Marguet, H. Rigneault, M. Rosseneu, G. Chimini, Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter, J Biol Chem 276 (2001) 9955-9960.

[156] A. Chroni, T. Liu, M.L. Fitzgerald, M.W. Freeman, V.I. Zannis, Cross-linking and lipid efflux properties of apoA-I mutants suggest direct association between apoA-I helices and ABCA1, Biochemistry 43 (2004) 2126-2139.

[157] N. Savion, A. Gamliel, Binding of apolipoprotein A-I and apolipoprotein A-IV to cultured bovine aortic endothelial cells, Arteriosclerosis 8 (1988) 178-186.

[158] L. Rohrer, C. Cavelier, S. Fuchs, M.A. Schluter, W. Volker, A. von Eckardstein, Binding, internalization and transport of apolipoprotein A-I by vascular endothelial cells, Biochim Biophys Acta 1761 (2006) 186-194.

[159] B.J. O'Connell, M. Denis, J. Genest, Cellular physiology of cholesterol efflux in vascular endothelial cells, Circulation 110 (2004) 2881-2888.

[160] H. Liao, T. Langmann, G. Schmitz, Y. Zhu, Native LDL upregulation of ATP-binding cassette transporter-1 in human vascular endothelial cells, Arterioscler Thromb Vasc Biol 22 (2002) 127-132.

References

111

[161] E.B. Neufeld, J.A. Stonik, S.J. Demosky, Jr., C.L. Knapper, C.A. Combs, A. Cooney, M. Comly, N. Dwyer, J. Blanchette-Mackie, A.T. Remaley, S. Santamarina-Fojo, H.B. Brewer, Jr., The ABCA1 transporter modulates late endocytic trafficking: insights from the correction of the genetic defect in Tangier disease, J Biol Chem 279 (2004) 15571-15578.

[162] J.D. Smith, C. Waelde, A. Horwitz, P. Zheng, Evaluation of the role of phosphatidylserine translocase activity in ABCA1-mediated lipid efflux, J Biol Chem 277 (2002) 17797-17803.

[163] M. Qadir, K.L. O'Loughlin, S.M. Fricke, N.A. Williamson, W.R. Greco, H. Minderman, M.R. Baer, Cyclosporin A is a broad-spectrum multidrug resistance modulator, Clin Cancer Res 11 (2005) 2320-2326.

[164] A. Kheirollah, J.I. Ito, Y. Nagayasu, R. Lu, S. Yokoyama, Cyclosporin A inhibits apolipoprotein A-I-induced early events in cellular cholesterol homeostasis in rat astrocytes, Neuropharmacology (2006).

[165] W. Chen, N. Wang, A.R. Tall, A PEST deletion mutant of ABCA1 shows impaired internalization and defective cholesterol efflux from late endosomes, J Biol Chem 280 (2005) 29277-29281.

[166] Y. Hamon, O. Chambenoit, G. Chimini, ABCA1 and the engulfment of apoptotic cells, Biochim Biophys Acta 1585 (2002) 64-71.

[167] Y. Takahashi, J.D. Smith, Cholesterol efflux to apolipoprotein AI involves endocytosis and resecretion in a calcium-dependent pathway, Proc Natl Acad Sci U S A 96 (1999) 11358-11363.

[168] G. Schmitz, H. Robenek, U. Lohmann, G. Assmann, Interaction of high density lipoproteins with cholesteryl ester-laden macrophages: biochemical and morphological characterization of cell surface receptor binding, endocytosis and resecretion of high density lipoproteins by macrophages, Embo J 4 (1985) 613-622.

[169] R. Frikke-Schmidt, B.G. Nordestgaard, P. Schnohr, R. Steffensen, A. Tybjaerg-Hansen, Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population, J Am Coll Cardiol 46 (2005) 1516-1520.

[170] K.N. Liadaki, T. Liu, S. Xu, B.Y. Ishida, P.N. Duchateaux, J.P. Krieger, J. Kane, M. Krieger, V.I. Zannis, Binding of high density lipoprotein (HDL) and discoidal reconstituted HDL to the HDL receptor scavenger receptor class B type I. Effect of lipid association and APOA-I mutations on receptor binding, J Biol Chem 275 (2000) 21262-21271.

References

112

[171] S. Xu, M. Laccotripe, X. Huang, A. Rigotti, V.I. Zannis, M. Krieger, Apolipoproteins of HDL can directly mediate binding to the scavenger receptor SR-BI, an HDL receptor that mediates selective lipid uptake, J Lipid Res 38 (1997) 1289-1298.

[172] T. Osanai, K. Magota, M. Tanaka, M. Shimada, R. Murakami, S. Sasaki, H. Tomita, N. Maeda, K. Okumura, Intracellular signaling for vasoconstrictor coupling factor 6: novel function of beta-subunit of ATP synthase as receptor, Hypertension 46 (2005) 1140-1146.

[173] A. Klinger, F.M. Reimann, M.H. Klinger, E.F. Stange, Clathrin-mediated endocytosis of high density lipoprotein3 in human intestinal Caco-2 cells. A post-embedding immunocytochemical study, Biochim Biophys Acta 1345 (1997) 65-70.

[174] A. Garcia, R. Barbaras, X. Collet, A. Bogyo, H. Chap, B. Perret, High-density lipoprotein 3 receptor-dependent endocytosis pathway in a human hepatoma cell line (HepG2), Biochemistry 35 (1996) 13064-13071.

[175] E.R. Eckhardt, L. Cai, S. Shetty, Z. Zhao, A. Szanto, N.R. Webb, D.R. Van der Westhuyzen, High density lipoprotein endocytosis by scavenger receptor SR-BII is clathrin-dependent and requires a carboxyl-terminal dileucine motif, J Biol Chem 281 (2006) 4348-4353.

[176] W.T. Chao, S.H. Tsai, Y.C. Lin, W.W. Lin, V.C. Yang, Cellular localization and interaction of ABCA1 and caveolin-1 in aortic endothelial cells after HDL incubation, Biochem Biophys Res Commun 332 (2005) 743-749.

[177] P.E. Fielding, J.S. Russel, T.A. Spencer, H. Hakamata, K. Nagao, C.J. Fielding, Sterol efflux to apolipoprotein A-I originates from caveolin-rich microdomains and potentiates PDGF-dependent protein kinase activity, Biochemistry 41 (2002) 4929-4937.

[178] C. Chatenay-Rivauday, Z.P. Cakar, P. Jeno, E.S. Kuzmenko, K. Fiedler, Caveolae: biochemical analysis, Mol Biol Rep 31 (2004) 67-84.

[179] W. Drobnik, H. Borsukova, A. Bottcher, A. Pfeiffer, G. Liebisch, G.J. Schutz, H. Schindler, G. Schmitz, Apo AI/ABCA1-dependent and HDL3-mediated lipid efflux from compositionally distinct cholesterol-based microdomains, Traffic 3 (2002) 268-278.

[180] A.J. Mendez, G. Lin, D.P. Wade, R.M. Lawn, J.F. Oram, Membrane lipid domains distinct from cholesterol/sphingomyelin-rich rafts are involved in the ABCA1-mediated lipid secretory pathway, J Biol Chem 276 (2001) 3158-3166.

References

113

[181] M.J. Kim, J. Dawes, W. Jessup, Transendothelial transport of modified low-density lipoproteins, Atherosclerosis 108 (1994) 5-17.

[182] P.G. Frank, H. Lee, D.S. Park, N.N. Tandon, P.E. Scherer, M.P. Lisanti, Genetic ablation of caveolin-1 confers protection against atherosclerosis, Arterioscler Thromb Vasc Biol 24 (2004) 98-105.

[183] J.M. Boeynaems, D. Communi, N.S. Gonzalez, B. Robaye, Overview of the P2 receptors, Semin Thromb Hemost 31 (2005) 139-149.

Acknowledgements

115

ACKNOWLEDGEMENTS

First of all, I would like to thank my PhD father, Matthias Peter, for following up

the development of this project over the three last years and reviewing my

thesis.

I am grateful to Ari Helenius for his constructive feedback on my project and for

agreeing to be co-examiner of this thesis.

I would also like to express my gratitude to Arnold von Eckardstein for his

continuous support and interest in my work.

I am indebted to my direct supervisor, Lucia Rohrer. She always had time to

answer my questions and to discuss work-related as well as work-unrelated

matters. Her critical feedback stimulated me to do always better.

Many thanks to Martin Hersberger for reviewing my thesis and to Thorsten

Hornemann for his always good advice.

I would like to acknowledge Jonathan D. Smith for the kind gift of the ABCA1-

GFP construct as well as the co-workers of the emz

(Elektronenmikroskopisches Zentrallabor der Universität Zürich). I would like to

thank Silvija and Yú for preparing the precious lipoproteins. I also recognise the

contribution of the technicians from the IKC routine for the many samples they

analysed for me.

Many thanks are given to the members of the lab DOPS4 for the nice working

atmosphere that developed over the years. Special thanks to Iris for her help,

her understanding and her support.

Last but not least, many thanks to my family and friends, who have been a great

source of strength all through this work.

Curriculum Vitae

117

CURRICULUM VITAE

Clara CAVELIER 21/10/1979 2003-2006 University Hospital Zurich (Switzerland) - Clinical Chemistry

Understand one critical atheroprotective property of apoA-I Study apoA-I transcytosis through aortic endothelial cells

ETH Zurich – Biochemistry Department PhD Student, 3rd year

ACADEMIC QUALIFICATIONS 2002 INA P-G (Institut National Agronomique de Paris-Grignon),

France's leading engineering school for life sciences Master’s degree, specialisation Biotechnology and Biochemistry

1997 Baccalauréat in Sciences with honours (equivalent to A-Level) WORK EXPERIENCE 2002 Feb-Sep

Aventis Pharma (France), Process Development - Biotechnology Purify, identify and characterise the unusual coenzyme of an oxidoreductase

2001 Jun-Aug

Hospital of the University of Washington (USA), Pediatrics Investigate the bridging function of hepatic lipase (a critical enzyme in the metabolism of circulating lipoproteins)

2001 Apr-Jun

Objectif Maths (France) part-time teacher Teaching of Mathematics, Physics, Chemistry and Biology

2000 Apr-Mai

French mixed family farm (France) Farm work and economic analysis of the farm

Curriculum Vitae

118

SCIENTIFIC COMMUNICATIONS 2006 Presentation at the 20th Jahrestagung der Deutschen

Gesellschaft für Arterioskleroseforschung, Germany 2005 Presentation at the 28th Annual Meeting of the European

Lipoprotein Club, Germany 2005 Presentation at the 4th Day of Clinical Research, Switzerland L. Rohrer, C. Cavelier, S. Fuchs, M.A. Schluter, W. Volker, A. von Eckardstein, Binding, internalization and transport of apolipoprotein A-I by vascular endothelial cells, Biochim Biophys Acta 1761 (2006) 186-194. C.Cavelier, I. Lorenzi, L. Rohrer, A. von Eckardstein. Lipid Efflux by the ATP Binding Cassette Transporters ABCA1 and ABCG1, Biochim Biophys Acta. 1761 (2006) 655-666. C.Cavelier, L. Rohrer, A. von Eckardstein, ABCA1 modulates apoA-I transcytosis through aortic endothelial cells, Cric Res (in press). C.Cavelier, L. Rohrer, A. von Eckardstein, Caveolin-1 modulates apoA-I transcytosis through aortic endothelial cells (submitted).

C.Cavelier, L. Rohrer, A. von Eckardstein, The β-chain of cell surface F0F1 ATPase modulates apoA-I transcytosis through aortic endothelial cells (submitted).