In Copyright - Non-Commercial Use Permitted Rights ...30880/... · 9 CURRICULUM VITAE 127. ......

Research Collection

Doctoral Thesis

Host cell entry of vesicular stomatitis virus

Author(s): Jóhannsdóttir, Hrefna Kristín

Publication Date: 2008

Permanent Link: https://doi.org/10.3929/ethz-a-005692740

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

https://doi.org/10.3929/ethz-a-005692740

http://rightsstatements.org/page/InC-NC/1.0/

https://www.research-collection.ethz.ch

https://www.research-collection.ethz.ch/terms-of-use

DISS. ETH NO. 17866

Host cell entry of vesicular

stomatitis virus

A dissertation submitted to ETH ZURICH

for the degree of Doctor of Sciences

Presented by

Hrefna Kristín Jóhannsdóttir

M.Sc. Biomedical Science from the University of Iceland

Born on 12th of September 1974 Citizen of Iceland

Accepted on the recommendation of

Prof. Dr. Ari Helenius, examiner

Prof. Dr. Urs Greber, co-examiner Prof. Dr. Daniel Gerlich, co-examiner

2008

FYRIR AFA JÓN

6 Host cell entry of VSV

TABLE OF CONTENCE

1 SUMMARY 8

2 ZUSAMMENFASSUNG 10

3 INTRODUCTION 12

3.1 CLATHRIN-INDEPEN DEN T EN DOCYTOSIS 12

3.2 CLATHRIN-ME DIATE D EN DOCYTOSIS 16

3.2.1 MAJOR PROTEINS INVOLVED IN CME 16

3.2.2 NUCLEATION OF CCPS 27

3.2.3 MATURATION FROM CCP TO CCV 29

3.2.4 UNCOATING 31

3.2.5 ENDOSOMAL TRAFFICKING 33

3.3 ORGANIZATI ON AND DYNA MICS OF CCPS A T THE PLAS MA MEMBRANE 36

3.3.1 CLATHRIN DYNAMICS 36

3.3.2 CARGO SPECIFIC INTERACTION WITH THE CLATHRIN MACHINERY AT THE PLASMA MEMBRANE 38

3.4 VESICULAR S TOMA TITIS VIRUS 40

3.4.1 VSV STRUCTURE AND MORPHOLOGY 41

3.4.2 VSVG 41

3.4.3 ENDOCYTIC PATHWAY AND INFECTION 42

4 RESULTS 45

4.1 CHARA CTERIZA TION OF LABELE D VSV AND RE COMBIN ANT VSV 45

4.2 THE KINE TICS OF VSV EN DOCYTOSIS 47

4.2.1 KINETICS OF INTERNALIZATION AND ACID-ACTIVATION 47

4.2.2 VSV IN ENDOSOMES 51

4.3 THE EN DOCYTOSIS OF VSV IS CLATHRIN DE PEN DENT 52

4.3.1 VSV IN COATED AND UNCOATED PITS DURING HOST CELL ENTRY 52

4.3.2 VSV INFECTION IS BLOCKED BY THE CME INHIBITOR CHLORPROMAZINE 53

4.3.3 CLATHRIN HEAVY CHAIN KNOCKDOWN IMPAIRS VSV INFECTION. 54

4.3.4 TESTING OTHER PERTURBATIONS 56

4.4 ADAPTOR AN D ACCESS ORY FACTOR INVOLVE MEN T IN VSV INFECTION 58

4.4.1 DYNAMIN-2 IS REQUIRED FOR VSV INFECTION 58

4.4.2 THE CLASSICAL MULTIMERIC ADAPTOR PROTEIN COMPLEX AP2 IS NOT INVOLVED IN VSV INFECTION 60

4.4.3 THE ROLE OF OTHER ADAPTORS IN VSV INFECTION 62

4.5 VSV INTERACTION WI TH THE EN DOCYTIC MAS CHINE RY 66

4.5.1 TARGETING OF VSV TO CCPS 66

4.5.2 DYNAMICS OF VSV INTERACTION WITH DYNAMIN-2 AND AP2 AT THE PLASMA MEMBRANE 70

Host cell entry of VSV 7

4.6 THE ROLE OF PHOSPHOLI PIDS IN VSV INFECTION 72

4.6.1 PTDINS(3)P-KINASES AND MTMR2 PHOSPHATASE 73

4.7 FURTHE R CHARA CTE RIZATI ON OF THE EN TRY PATHWA Y OF VSV 75

4.7.1 VSV RECEPTOR 76

4.7.2 PHARMACOLOGICAL INHIBITORS 78

4.7.3 SIRNA SCREEN 82

5 DISCUSSION 87

5.1 THE KINE TICS OF VSV EN TRY, ACI D-ACTIVATI ON AND DEGRA DA TION 87

5.1.1 CLATHRIN 89

5.1.2 ADAPTORS 90

5.2 INTERACTION OF VSV WITH THE EN DOCYTIC MACHINERY 91

5.3 OTHER FACTORS INVOLVE D IN VSV ENTRY AN D INFECTION 94

5.3.1 HOST CELL RECEPTORS 95

5.4 MATE RIALS AND METHODS 98

5.4.1 CELLS AND VIRUSES 98

5.4.2 PURIFICATION AND LABELING OF WTVSV 99

5.4.3 SIRNA MEDIATED KNOCKDOWN OF CLATHRIN AND AP2 100

5.4.4 INFECTION AND INTERNALIZATION ANALYSIS 101

5.4.5 ENDOCYTOSIS ASSAY 102

5.4.6 FUSION ASSAY 102

5.4.7 VSVG DEGRADATION 103

5.4.8 ELECTRON MICROSCOPY 103

5.4.9 LIVE CELL MICROSCOPY ANALYSIS 104

5.4.10 PHARMACOLOGICAL INHIBITORS, CONSTRUCTS AND ANTIBODIES 105

5.4.11 SIRNA SCREENING 106

6 ABBREVIATIONS 108

7 REFERENCES 110

8 ACKNOWLEDGEMENTS 126

9 CURRICULUM VITAE 127


1 SUMMARY

VSV has for many years been considered to be an example of a classical cargo of

the clathrin-mediated endocytic pathway and both the virus itself as well as its

Transmembrane glycoprotein have been used extensively in various studies as

control cargo, virus or transmembrane protein. Clathrin-mediated endocytosis

is one of the most extensively investigated entry portals of the cell. Until

recently, it has been regarded as a uniform identity, strictly based on certain key

components for its maintenance, irrespective of cell-type or cargo involved.

Accumulating evidence however suggest that the defining core components of

clathrin-mediated pathways might be limited to the clathrin-coat itself and the

large GTPase, dynamin, which seem to be indispensable for clathrin-based

pathways while other factors such as adaptor proteins, accessory factors, actin

cytoskeleton, kinases, and phosphatases might be more cargo specific than

previously thought. It thus becomes important to investigate in a cargo

oriented way the requirements for CME to be able to define with more

specificity different subsets of the pathway.

Our aim in the current study was to have a closer look at the entry of VSV into

tissue culture cells in respect to morphology, kinetics, and cell factor

dependence. Using transmission electron microscopy we performed

morphological studies of the virus interaction with the plasma membrane and

in endocytic and endosomal compartments. Using live-cell imaging by TIRF-FM,

we visualized the interactions between the virus and components of the

clathrin-coated pits. Inhibitor studies, dominant negative proteins and siRNA-

mediated knockdown in combination with entry, infection and fusion assays

were used to define more closely the entry kinetics as well as cellular factors

involved in VSV infection.

Our results show that the virus associates with clathrin-coated pits, upon

binding to the plasma membrane. It is internalized very rapidly, primarily by

inducing the formation or stabilization of coated pits, and is subsequently seen


in clathrin-coated vesicles. The virus is targeted to endosomes where lowered

pH induces acid-activation of the viral envelope with membranes of the

endocytic compartments, eventually resulting in nucleocapsid release into the

cytosol where replication takes place. Acid-exposure and the acid-activated

change in the virus needed for penetration occurs with 2-10 min after

endocytosis. After that, the fraction of viruses that are able to penetrate

decreases, and 1h later, no infection can be detected, indicating that the virus is

no longer in a fusion/penetration compatible state and/or compartment.

Perturbation studies confirmed the clathrin-dependency of the virus but also

left open the possibility that VSV can use a subset of CCPs for productive entry

as well as non clathrin-mediated pathways.


2 ZUSAMMENFASSUNG

Der Transport von VSV durch die Zellmembran, wird seit mehreren Jahren als

Beispiel für die klassische Clathrin-vermittelten Endozytose verwendet und das

Virus als solches, wie auch seine Transmembranproteine wurden in vielen

Studien als Kontrollgut benutzt. Clathrin-vermittelte Endozytose ist der bis

heute am besten untersuchte Aufnahmeweg in die Zelle. Bis vor Kurzem wurde

dieser Weg als einheitlich betrachtet und durch Schlüsselkomponenten der

eigenen Aufrechterhaltung beschrieben, ungeachtet des Zelltyps in der die

Beobachtungen gemacht wurden oder des zu transportierenden Materials. Sich

ansammelnde Beweise deuten darauf hin, dass die Kernkomponenten der

Clathrin-vermittelten Endozytose die Clathrin Hülle selbst und die GTPase

Dynasore sind, beide unerlässlich für eine einwandfrei funktionierende

Aufnahme. Im Gegensatz dazu, könnte der Transport andere Güter wie

Adaptorenproteine, Proteine des Aktin-Zytoskeletts, Kinasen und Phosphatasen

spezifischer reguliert sein als bisher vermutet. Umso wichtiger wird es sein die

Clathrin-vermittelten Endozytose mit Hilfe der zu transportierenden Proteinen

zu durchleuchten, und dadurch spezifischere Unterteilungen des

Eintrittmechanismus zu definieren.

Das Ziel unserer Forschung bestand darin bezüglich der Morphologie, Kinetik

und der Abhängigkeit von verschiedenen Zellfaktoren näher zu untersuchen,

wie VSV in Zellen eindringt. Mit Hilfe eines Elektronenmikroskops haben wir

morphologische Studien durchgeführt über die Interaktion des Virus mit der

Plasmamembran und in endozytischen und endosomalen Kompartimenten.

Unter Verwendung von lebenden Gewebeskulturzellen und mit Hilfe von TIRF-

FM haben wir die Interaktionen zwischen dem Virus und den Komponenten der

Clathrin-markierten Vesikeln (CCPs) visualisiert. Inhibitor-Studien, dominant

negative Proteine und siRNA-vermitteltes ‚Knockdown’ in Kombination mit

Infektions- und Fusionsessays wurden benutzt, um sowohl die Eintrittskinetik

als auch die beteiligten zellulären Faktoren der VSV Infektion näher zu

definieren.


Gemäss unseren Resultaten bindet das Virus an die Plasmamembran und

assoziiert dadurch mit den CCPs. Es induziert eine sehr rasche Internalisierung,

vor allem, indem es die Bildung oder Stabilisierung von den CCPs bewirkt. Als

Folge wird es in Clathrin bedeckten Vesikeln internalisiert. Das Virus zielt auf

Endosome mit tiefem pH, die eine säure-aktivierte Fusion der viralen

Aussenhülle mit der Membrane des endozytischen Kompartiments auslösen die

schlussendlich in die Freisetzung des Nucleocapsids in das Zytosol resultiert, wo

schliesslich die Replikation stattfindet. Die säure-induzierte Freilegung und die

für die Penetration notwendigen Veränderungen im Virus finden 2-10 Minuten

nach Endozystose statt. Danach nimmt die penetrationsfähige Anzahl der Viren

ab; 1h später kann keine Infektion entdeckt werden, was zeigt, dass der Virus

sich nicht mehr in einem fusions-/penetrationskompatiblen Zustand und/oder

Kompartiment befindet. Induzierte Störungen, die gezielt während Studien

getestet wurden bestätigen die Clathrin-Abhängigkeit des Virus, lassen jedoch

auch die Möglichkeit bestehen, dass VSV eine Untergruppe von CCPs für das

produktive Eindringen sowie auch als non Clathrin-vermittelte Endocytosewege

verwenden kann.


3 INTRODUCTION

Endocytosis or the uptake of extra-cellular particles and solutes by plasma

membrane invaginations is a fundamental activity used by eukaryotic cells for

nutrition, intercellular communication, defense and maintenance of

homeostasis. The internalization of macromolecules into transport vesicles

derived from the plasma membrane is accomplished by several mechanisms,

which have been classically subdivided into two broad categories, phagocytosis

and pinocytosis. Phagocytosis is the uptake of large particles such as apoptotic

cells and bacteria and is restricted to specialized phagocytic cells (Fig.1A).

Pinocytosis or the uptake of smaller particles and solutes is performed by all

mammalian cells and is further divided into macropinocytosis, clathrin-

mediated endocytosis, caveolae-mediated endocytosis, and lipid-raft mediated

endocytosis (Fig. 1) (reviewed in (39, 167)).

3. 1 CLATHRIN-INDEPENDENT ENDOCYTOSIS

Macropinocytosis occurs when membrane ruffles or protrusions fuse back with

the plasma membrane, forming large, irregular vesicles called macropinosomes

(Fig.1B and C). The internalized cargo is targeted to lysosomes or recycled back

to the cell-surface. Alternatively, this pathway can be used as infectious route

for pathogens like vaccinia virus and adenovirus (4, 174). Macropinocytosis has

been show to be cholesterol-sensitive and dependent on rearrangements of the

actin cytoskeleton (86, 277). In some cases, dynamin-2 is required (Fig.1C) (4, 198,

272) while in others the process is dynamin-independent (Fig.1B) (86, 174),

indicating a possible cargo- and/or cell type specificity.

Some of the clathrin-independent endocytic pathways are referred to as lipid-

raft mediated. Several raft-dependent pathways have been described and

classified based on the involvement of cellular factors, morphology and cargo

(Fig.1E to K).


A number of lipid-raft mediated, caveolin-regulated pathways have been

described (reviewed in (136, 225)). Caveolin is a lipid-raft associated scaffold

protein, which is the main component of 50–80 nm flask-shaped lipid-raft

based plasma membrane invaginations called caveolae. It has been proposed to

be a negative regulator of raft-dependent endocytosis (46, 144, 200). Various

ligands, membrane components, viruses and toxins are internalized through a

caveolae-mediated pathway and are subsequently targeted to caveolin-1

positive compartments called caveosomes (Fig.1E) (117, 225, 227, 236).

Caveolin-1 independent pathways are defined as raft-mediated and can be

either dynamin-dependent or independent (Fig.1F to K). Considerably less is

known about these pathways than about the ones proceeding in the presence

of coat-proteins but ligand specific studies have been helpful for the

establishment of defined categories of raft-mediated endocytosis.

Ligands such as interleukin-2 (IL-2), choleratoxin B (ChxB) and autocrine motility

factor (AMF) are internalized in a raft- and dynamin-dependent manner (Fig.1H)

(138). Other cargo described to be raft-dependent however do not seem to

depend on dynamin for internalization. This is e.g. the case for SV40, originally

shown to be internalized in a caveolin-1 dependent manner but was later shown

to enter cells devoid of caveolin-1 using a pathway that is independent of

dynamin-2 (Fig.1F) (46). These uptake routes all have in common that they

depend on the small GTPase RhoA.

Glycosylphosphatidylinositol anchored proteins (GPI-APs) can be taken up by

the so-called GEEC pathway, which is also raft-mediated and dynamin-

independent (Fig.1K). This pathway is characterized by tubular endocytic

structures, which are targeted to so-called GEECs or GPI-AP enriched early

endosomal structures (113, 262, 263). Cholera toxin might be internalized in the

same manner (125, 134, 203, 263).

Another raft-dependent, dynamin-independet pathway has been described for

MHCI and GPI-AP. It is regulated by the small GTPase Arf6 and cargo is

transported to Arf6 positive endosomes (Fig.1I) (203, 204).


GPI-AP as well as ChxB can co-localize with the lipid-raft associated protein

flotillin-1, which seems to mediate the internalization of these ligands in a

dynamin-independent manner (Fig.1J) (80).

A novel clathrin- and caveolin-independent pathway has been recently

described as the infectious route taken by the lymphocytic choriomeningitis

virus (LCMV) (237, 258). Minority of viral particles enters cells in a clathrin-

dependent manner while the majority uses a dynamin and raft-independent

but cholesterol dependent route to late endosomes (Fig.1G).


3.2 CLATHRIN-MEDIATED ENDOCYTOSIS

Clathrin-mediated endocytosis (CME) is probably the best characterized

endocytic pathway in regard to cargo recognition, targeting to the endocytic

machinery, and the formation of endocytic vesicles. It occurs constitutively in all

mammalian cells and is involved in important cellular processes such as

intercellular communication during development (52, 281) serum homeostasis

and recycling of synaptic vesicle membrane proteins after neurotransmission

(49). In addition it mediates the uptake of essential nutrients such as low-

density lipoprotein (LDL) and transferrin (tfn) and growth factors such as

epidermal growth factor (EGF) (22, 39). It is also used by various pathogens as an

entry route to infect cells (reviewed in (161, 226, 299)).

The formation of a clathrin-coated pit (CCP) is initiated by the recruitment of

coat components to the cytoplasmic leaflet of the plasma membrane. These

include adaptors interacting with phospholipids, cargo, clathrin and other coat

components. Growth and maturation of the initially flat clathrin lattice is

achieved through the continuous recruitment of coat components and

accessory factors, eventually causing membrane curvature and the formation of

an invaginated coated pit. The neck of the fully formed, cargo loaded endocytic

vesicle eventually undergoes a constriction step, resulting in its release into the

cytosol (Fig.5). Subsequently the clathrin-coat is discharged prior to endosomal

targeting of the vesicle. In endosomes, a cargo dependent sorting occurs,

leading to recycling of cargo receptors to the plasma membrane, pH induced

release into the cytosol or degradation by lysosomal targeting (reviewed in (322,

346)).

3 .2 .1 Major proteins involved in CME

3.2.1 . 1 Clathrin

The clathrin triskelion is the basic unit of the clathrin lattice formed at CCPs

(Fig.2A). It consists of three heavy chains (180 kD) and three light ones (30-35


kD). The heavy chains (CHC) have a proximal (PD) and a distal domain (DD)

joined by a curved “knee” domain. The C-terminal part of the proximal domain

is called the hub domain, mediating trimerization and together with the hubs

of the other two CHC forming the vertex (V) of the triskelion (85, 121, 123, 274).

The clathrin light-chains (CLC), associate with the proximal part of the CHC. The

globular, N-terminal domain (NTD) mediates interactions with a number of

endocytic adaptor and accessory proteins. Both distal and proximal domains

contribute to inter-molecular contacts with other triskelions in the basket

structure. In vitro, clathrin triskelions can self-assemble into closed, polygonal

cages (Fig.2B) whereas in vivo, the assembly requires adaptor and accessory

proteins such as AP2 and AP180 / CALM (122).

Figure 2. Str uctur e of a clat hri n tri skelio n and t he clathri n ca ge.

A. Schematic representation of a clathrin triskelion with the three heavy chains (CHC) joined through their C-termini at the vortex (V). The three light-chains (CLC) associate with the proximal domains (PD) of the CHC, which are separated from the distal domain (DD) by the knee. NTD: N-terminal domain. Adapted from Fotin et al (70). B. Alignment of a triskelion (blue) into a hexagonal barrel formed upon assembly of clathrin coats in vitro. Adapted from Fotin et al (70).

3.2.1 .2 Adaptor proteins

An adaptor is a protein that promotes the assembly of clathrin on the cytosolic

leaflet of the plasma membrane and is thus responsible for the initial steps in


the formation of a coated pit. The interaction is mediated by lipid and protein

binding domains of the adaptor that associate with PtdIns(4,5)P2 in the plasma

membrane, with signal recognition sequences of the receptor to be internalized

and with clathrin. This multi-tasking function can be at least partly explained by

the design of adaptins; they are modular proteins with multiple, discretely

folded domains linked by unstructured flexible linker domains (114). Sequence

motifs found in these unstructured regions allow dynamic binding of the

adaptors to other components of the endocytic machinery relevant for vesicle

formation (reviewed in (218, 223)).

In addition to the classical multimeric adaptor protein complex AP2 (2), an

increasing number of monomeric adaptors involved in CME have been

identified in the last years (reviewed in (218, 252, 317)). They include amphiphysin

1 and 2 (48, 169)), autosomal recessive hypercholesterolemia (ARH) protein (190),

-arrestin 1 and 2 (82), AP180/clathrin assembly lymphoid myeloid leukemia

protein (CALM) (193, 199), Disabled-2 (Dab2) (189), epsin 1, 2, and 3 (32, 58), epsinR

(103, 330) and the Huntington-interacting proteins HIP1 and HIP1R (147).

3.2.1 .2.1 AP2

The adaptor protein complex AP2 (or assembly polypeptide 2 (347)) belongs to a

family of hetero-tetrameric adaptor proteins 1-4. Each of the four members have

their own specific function in intracellular trafficking of cargo proteins between

different organelles and interact with motifs present in the cytoplasmic tails of

their specific cargo at different intracellular locations. AP1 sorts cargo proteins

such as mannose 6-phosphate receptors (MPRs) in the trans-Golgi network

(TGN) and endosomes (55, 143, 180). AP2 is exclusively involved in CME at the

plasma membrane (251). AP3 is found at the TGN and endosomes and it thought

to play a role in the sorting of cargo to lysosomes (51, 73, 142). AP4 mediates

transport of lysosomal proteins to lysosomes (1). It has also been found

associated with clathrin-coated vesicles and endosomes and was suggested to

play a role in clathrin-mediated sorting from early endosomes to lysosomes (10).


AP2 was the first adaptor identified to be involved in CME (2). It is highly

enriched in purified clathrin-coated vesicle preparations and has therefore been

suggested to be an essential part of the clathrin-based endocytic machinery. It

is composed of two large ( 100 kD) subunits and 2, a medium subunit, μ2

(50 kD), and a small subunit, 2 (16 kD) (reviewed in (120)). The two large

subunits ( and 2) can be divided into two structural subunits, the N-terminal

“head” and the C-terminal appendages or “ears” connected to the head by

flexible regions called hinges (35, 101, 124) (Fig.3).

Targeting of the adaptor protein complex to the plasma membrane is mediated

by the ear domain of the subunit, as is the interaction of AP2 with the adaptor

proteins AP180/CALM and amphiphysin. The μ2 subunit has a role in targeting

the complex to the plasma membrane (257). In addition, it can bind to the

tyrosine-based internalization motifs in the cytoplasmic domains of receptors

to allow their concentration into coated pits. At least two distinct tyrosine-

binding sites within the subunit have been described, one recognizing the more

general YXX sequence ( is a bulky, hydrophobic amino acid and x represents

any amino acid) found e.g. in the tfn receptor (211), and the FDNPVY signal

sequence in the tail of LDL receptor (19). The interaction of the μ2 adaptin with

cargo-bound receptors is subjected to regulation through reversible

phosphorylation upon the action of the serine/threonine kinase, adaptor

associated kinase 1 (AAK1). Threonine-156 becomes phosphoryated, which leads

to increased affinity of the μ subunit towards sorting signals (247).

A clathrin-box motive (L x D/E) in the hinge of 2 subunit together with a

sequence in the 2-ear domain interacts with clathrin (50, 285) and can trigger

the assembly of clathrin lattices. The same hydrophobic sequence in the 2-ear

domain can also bind other adaptors such as Eps15, epsin and AP180 through

their D F/W motives. This binding is competitive and may serve as a recruiting

platform switch when a sequential order of events is needed (220, 221). The 2-

subunit has a structural role, stabilizing the core domain of AP2 (35).


Figure 3. T he str uctur e of AP 2. The multimeric adaptor-protein complex is composed of 4 different subunits. The large and subunits are composed of a N-terminal domain called the trunk and a C-terminalt domain called the ear. The ear and the trunk are connected by a flexible linker domain. In addition the complex is composed of the medium sized μ domain and a small domain.

3.2.1 .2.2 Eps15

The epidermal growth factor receptor pathway substrate clone number 15 or

Eps15 can has three distinct structural domains (65, 339). The Eps15 homology

domains (EH) are located in the N-terminus (340). They mediate protein-protein

interaction with NPF (Asn-Pro-Phe) motif-containing proteins including epsin

and AP180 / CALM (265). The central domain of Eps15 is arranged into a coiled-

coil that is involved in the homo-dimerization of the adaptor (313). The C-

terminal domain contains multiple copies of the DPF (Asp-Pro-Phe) motif,

mediating binding to the subunit of AP2 (14, 105), and two ubiquitin

interacting motives (UIMs).

The regulation of Eps15 function is based on two types of post-translational

modifications; mono-ubiquitination and phosphorylation. The role of mono-

ubiquitination is not as well understood as that of poly-ubiquitination, but a

sorting function is considered likely. In addition to their role in recognition of

ubiquitinated sequences, the UIMs of Eps15 are important for mono-

ubiquitination of the adaptor itself. This might promote an ubiquitin-based

sorting platform, where Eps15, together with other UIM-containing proteins


such as epsin, synchronize cargo recruitment and clathrin assembly. Through

their own ubiquitination they may contribute to the amplification of this

network in the endocytic pathway (232). While EGFR induced phosphorylation

of Eps15-Tyr85o is specifically required for EGFR internalization, it does not have

any role in tfn internalization. The alternative adaptor might thus provide a

possibility of a cargo regulated sorting (36).

3.2.1 .2.3 Dab2 and ARH

Dab2 (disabled-2) and ARH (autosomal recessive hypercholesterolemia) are

adaptors involved in the endocytosis of LDL-family member receptors (76, 112).

They have a PTB domain located in the N-terminus that binds to the tyrosine-

based internalization motive FYxNPxY. This motive is found in the cytoplasmic

tail of LDLRs. The affinity of the PTB-domain towards the sequence it is affected

by reversible phosphorylation, the binding affinity towards the un-

phosphorylated form being higher than towards the phosphorylated one (104,

195). The central region of Dab2 contains the PtdIns(4,5)P2, clathrin and AP2

appendage binding sites (189). A myosin VI interacting domain is located in the

C-terminus (194).

Both adaptors are involved in LDLR internalization but recent studies suggest a

delegation of roles in the process. Dab2 can interact with the actin motor-

protein myosin VI and has been suggested to mediate myosin-dependent

clustering of LDLR into pits where it subsequently induces AP2-independent

clathrin recruitment. ARH on the other hand is suggested to accelerate later

steps in LDLR endocytosis in co-operation with AP2 (166, 189, 194, 305).

3.2.1 .2.4 AP180/CALM

AP180 was originally reported to be required for efficient clathrin assembly and

the recycling of uniformly sized synaptic vesicles in neurons (94, 192, 307, 349).

Results from studies looking at the ubiquitously expressed mammalian isoform

of AP180, CALM (for clathrin-assembly lymphoid–myeloid leukemia) (312),


suggest a broader role for AP180/CALM in CME.

The monomeric AP180/CALM proteins fulfill three out of four of the adaptor

protein criteria’s, the ability to bind to the plasma membrane, to clathrin, and to

other adaptor/accessory proteins. Plasma membrane association depends on its

N-terminally located ANTH (AP180 N-terminal homology) domain, which binds

PtdIns(4,5)P2 (209, 345). The clathrin-binding site is located more C-terminally

and strongly promotes the assembly of clathrin into lattices (3, 153). Eps15, which

interacts with AP180 through a C-terminally located NPF motive, has been

suggested to influence this AP180-induced clathrin assembly (191). The D F/W

motive, interacting with the and subunits of AP2 is located in the C-terminus

of the protein (220, 221).

Besides the importance of AP180 in the assembly of clathrin lattices, it seems to

play a regulatory role in defining the size of endocytic vesicles. In its absence or

repression, unusually large and irregularly shaped vesicles are formed (208,

349). Although no sequence recognition motive has been identified within

AP180, the aberrant sorting of the v-SNARE synaptobrevin at the pre-synaptic

plasma membrane upon disruption in C. elegans has led to speculations

regarding a possible cargo specific role (208).

3.2.1 .2.5 Epsin

Four members of the epsin family (epsin1-3 and epsinR) have so far been

identified (reviewed in (149)). Epsin 1 and 2 are involved in clathrin-mediated

endocytosis (32, 107), whereas epsinR is important for TGN/endosome

trafficking (114, 187, 330). They all conform to the same overall architecture with

a PtdIns(4,5)P2 binding ENTH domain followed by a long stretch of unfolded

polypeptide chain containing clathrin-binding motifs and numerous DxFW

motives (enabling AP2 association), and EH-binding NPF motives (32). Following

the ENTH domain there are two UIMs for sorting of ubiquitinated signaling

receptors into CCVs (284). The epsins seem to have a role in driving membrane

curvature during CCV formation (69). Upon binding of the ENTH domain to

PtdIns(4,5)P2, a conformational change occurs, causing insertion of the N-

terminus of the protein into the membrane surface resulting in curvature of the


plasma membrane (107). Once formed, the curvature is stabilized by the

polymerizing clathrin.

3.2.1 .2.6 Hip1/R

Hip1 and its closely related Hip1R are enriched in CCVs. They possess an ANTH

domain and can interact with clathrin and AP2 (179, 188, 328, 147). HIP1 is

targeted to CCP by interacting with the clathrin assembly domain in CLC and it

promotes clathrin assembly through its central helical domain (148). In vitro,

Hip1R simultaneously binds to F-actin and clathrin lattices and promotes the

assembly of higher order clathrin/actin structures (61, 62). Recent findings

suggest a role in coordination of interaction between the endocytic machinery

and the actin cytoskeleton (63).

3.2.1 .2.7 -arrestin

The -arrestins, are cargo specific adaptors that specifically interact with the G-

protein-coupled receptors (GPCRs). By targeting active receptors to CCPs for

endocytosis, -arrestins have an important role in terminating signaling

cascades (82, 139). The N-terminal domain is mainly responsible for GPCR

binding (91, 235), whereas the clathrin-box motive, the AP2 interacting motive,

and PtdIns(4,5)P2 binding region are located within the C-terminus of the

protein (81) (74, 133, 139, 185, 315). The end of the C-termius is normally folded

back and associates with the N-terminus. This conformation plays an important

role in the -arrestin mediated targeting of GPCR to CCPs. Upon binding to

activated GPCRs, a conformational change of the adaptor occurs, resulting in

disassociation of the two termini from each other. The N-terminus associates

with the plasma membrane while the C-terminus interacts with clathrin and

AP2, allowing effective targeting of the complex to CCPs (reviewed in (218)).

Mono-ubiquitination of -arrestin has also been suggested to enhance

targeting and internalization of GPCRs (283).


3.2.1 .3 Accessory proteins

3.2.1 .3.1 Dynamin

Dynamin is a large GTPase that has been shown to play an important role in

many of the known endocytic pathways and is commonly used as one of the

markers to identify specific clathrin-dependent or independent entry portals.

Three mammalian forms of dynamins are known; the brain specific dynamin-1,

the ubiquitously expressed dynamin-2, and the testis specific dynamin-3. The

GTPase domain is located in the N-terminus of the protein. It has a rather low

affinity for GTP but a high basal hydrolytic activity (17, 300). C-terminally to the

GTPase domain is the PtdIns(4,5)P2 binding PH (plekstrin homology) domain,

needed for plasma membrane targeting. The GTPase effector domain (GED) in

the C-terminus is involved in dynamin oligo-merization and self-assembly (197,

282). The proline-rich domain (PRD) mediates interaction with SH3 (src

homology 3) domains in other accessory proteins, functioning as a scaffold

during the maturation from CCPs to CCVs (Fig.4).

Dynamin-2 is recruited in its GTP-bound form to deeply invaginated CCPs,

resulting in a constriction at the neck of the forming vesicle, membrane fission

and subsequent detachment of a fully formed endocytic vesicle from the

plasma membrane. Two main models have been put forward as a basis for the

action of dynamin. In the mechano-chemical model, the GTPase oligomerizes

through its GED-domain as a collar around the neck of a deeply invaginated pit.

Self-assembly of dynamin promotes GTPase-activating protein (GAP) stimulated

hydrolysis of GTP, which causes a conformational change resulting in neck

constriction and scission (170, 260). In the regulatory model, dynamin has a

regulatory and scaffolding role, recruiting downstream effector proteins that

subsequently drive fission (67, 282). An attempt to reconcile the two models has

been made by proposing a two-step model (202) in which a regulatory GTPase-

like mechanism operates during the rate-limiting step, recruiting necessary co-

factors to the forming vesicle and enabling the formation of constricted coated

pits. In a second step self-assembly and assembly-stimulated GTP hydrolysis

induces the final stages of vesicle formation.


Recent work with the newly described dynamin-specific inhibitor dynasore,

indicate that the GTPase might have an additional role at the point of

invagination of the CCP (157, 201). Dynasore is a non-competitive inhibitor of the

basal and stimulated GTP hydrolysis without affecting the affinity of the

GTPase towards its substrate. It mediates a reversible block on endocytosis of

ligands such as transferrin and low-density lipoprotein, which are internalized

in a dynamin dependent manner, by blocking the maturation of CCPs to CCVs

(157). Surprisingly, not only deeply invaginated pits (O-shaped) were seen in the

presence of dynasore as would be expected from studies with dominant

negative forms of dynamin, but also pits that were still in the process of

invaginating (U-shaped). This observation illustrates the multiple roles of

dynamin in the vesicle maturation process and could support the two-step

model suggested by Narayanan et al (202).

Figure 4. T he str uctur e dyna min- 2. Schematic representation of the structural domains of dynamin-2, their main functions and interaction partners. PH: plekstrin-homology domain, GED: GTPase effector domain, PRD: proline-rich domain.

3.2.1 .3.2 Sorting nexin 9

Sorting nexin 9 (SNX9) is a member of the sorting nexin protein family and has

recently been sown to have an important role in CME (156, 287, 288, 304). It has

an N-terminal SH3 domain, followed by a phox homology (PX) domain and a C-

terminal BAR-domain. The SH3 domain interacts with dynamin and has been

suggested to recruit the GTPase to CCPs and regulate its assembly at the vesicle

neck (155, 304). SNX9 can interact with the actin modulating proteins N-WASP


and Arp2/3 and bind to PtdIns(4)P-5-kinases via its PX domain (287, 288, 343). It

has thus been suggested to function in the coordination of membrane

remodelling and fission via interaction with actin-regulating proteins, endocytic

proteins and PtdIns(4,5)P2 metabolizing enzymes (287, 288, 343).

3.2.1 .3.3 Amphiphysin

The BAR-domain protein family of amphiphysin has two members, the brain

specific amphiphysin 1 and the ubiquitously expressed amphiphysin 2 (48, 152,

169). The BAR-domain, responsible for plasma membrane association, is located

in the N–terminus while the C-terminus contains a SH3 (src homology 3)

domain. Between the BAR- and SH3 domains, are two clathrin-interacting

motives as well as an AP2 appendage interactive motive.

Amphiphysins are primarily involved in the late steps of CCP invagination and

maturation. The two, clathrin binding motives confer a strong interaction with

free clathrin terminals and thus favor the recruitment of amphyphysin to the

periphery of CCPs. The elongated, concave form of the BAR-domain promotes

affinity of the protein towards curved membranes (231). Finally, through an

interaction with the SH3 domain, dynamin (for scission) and the PI-phosphatase

(for uncoating) are recruited to the neck of the forming CCV (29, 48, 183, 222).

3.2.1 .3.4 Endophilin 1

Endophilin 1 is a BAR-domain containing protein, and is thus recruited to the

curved membranes surrounding a forming CCV. Besides its N-terminally located

BAR-domain it has a C-terminal SH3 domain responsible for the dynamin-2

induced recruitment of endophilin to forming CCVs (248) as well as with the

accessory proteins amphiphysin (184) and synaptojanin (248). It exhibits a

lysophosphatidic acid acyl transferase (LPAAT) activity, resulting in conversion

of the unsaturated fatty acid arachidonate to lysophosphatidic acid. The change

from an inverted cone-shaped to a cone-shaped lipid in the cytoplasmic leaflet


of the bilayer induces negative membrane curvature. Endophilin 1 has thus been

suggested to co-operate with dynamin, mediating membrane invagination and

fission during vesicle formation (276). A second role of the N-BAR protein is in

the un-coating of endocytic vesicles (301). This is mediated by the SH3 domain of

endophilin, which recruits the PtdIns(5)-kinase synaptojanin (279).

3 .2 .2 Nucleation of CCPs

3.2.2.1 The role of phospholipids

As multi-valent binding factors and scaffolds, the adaptor proteins are

considered to have a co-ordinating role during CCP nucleation. Their common

ability to bind PtdIns(4,5)P2, internalization motives of receptors, clathrin and

other adaptors or accessory proteins, allow a temporal and spatial regulation of

multiple factors. Adaptors are cytosolic proteins that have to be recruited to the

plasma membrane for their involvement in CCP formation. Exactly what

regulates or trigger this recruitment is not know but local concentration of

phospholipids as well as affinity towards signal recognition sequences in

cytoplasmic domains of cargo, are thought to play a role.

The key regulatory phospholipid in endocytic processes from the plasma

membrane is PtdIns(4,5)P2. It is primarily found on the inner leaflet and

constitutes less than 10% of the total cellular phospholipids. PtdIns(4,5)P2

depletion using the PtdIns(4)P-5-kinases inhibitor 1-butanol results in rapid

disassembly of pre-existing CCPs and inhibits the nucleation of new ones (21).

The same effect has been reported using an inositol 5-phosphatase module for

the depletion of PtdIns(4,5)P2 (351). Consistent with these observations, the

uptake of tfn as well as EGF is perturbed in cells with low concentrations of

PtdIns(4,5)P2 (325). These results further support the role of plasma membrane

phospholipids for coat nucleation, growth and stability.

The level of PtdIns(4,5)P2 is partly regulated by the phosphatidylinositol-

phosphate kinase (PIPKI ) (56). The activation of organelle- and substrate

specific PI-kinases by small GTPases can contribute to local changes in PI-


content. ADP-ribosylation factor 6 (Arf6) is one of the small GTPases that

localize to the plasma membrane. Upon nucleotide exchange by the Arf6 GTP-

exchange factor (Arf6-GEF), Sec7, the GTPase activates PIPKI , resulting in

increased PtdIns(4,5)P2 levels (129).

3.2.2.2 Cargo recognition and sorting

The nature of endocytic cargo influences the endocytic pathway used for

uptake. This is at least to some extent regulated by the cargo specific

internalization motives found in the cytoplasmic tail of most plasma membrane

receptors. The type of adaptor protein associating with specific cargo depends

on the exact sequence of this internalization motive. Some adaptors recognize

more than one type of sorting signal while others are more specific. The affinity

of an adaptor towards a receptor-sorting signal can be regulated by

phosphorylation, conformational changes, or ubiquitination.

Internalization signals important for endocytosis from the plasma membrane

can be divided into three main categories: tyrosine, di-leucine, and

ubiquitination-based (reviewed in (20, 318)).

The first sorting motive identified was the tyrosine-based internalization signal

in the N-terminus of the transferrin receptor (211). It consists of the amino acid

sequence Yx where x is any amino acid, a bulky hydrophilic residue, and a

bulky hydrophobic residue. This sequence is recognized by the μ2 subunit of AP2

(211) and the interaction depends on two hydrophobic pockets on the μ subunit

that fit the tyrosine and the hydrophobic residue (219). Upon recruitment to the

plasma membrane, a phosphorylation-induced conformational change reveals

the binding site, enabling interaction with the receptor (38, 247).

Another well-known tyrosine-based internalization motive is FXNPXY, found in

members of the LDL receptor family (LDLR). This motive is recognized by the

adaptor protein Dab2 via an N-terminal phosphotyrosine-binding (PTB) domain

which in addition can bind phosphoinositides in the plasma membrane and to

clathrin and thus promote the assembly of triskelia into polyhedral coats (189).


In addition to Dab2, the classical adaptor AP2 as well as the alternative adaptor

ARH also recognize this motive.

Post-translational modification by the addition of ubiquitin to the cytosolic tail

of transmembrane receptors such as EGFR and 2-adrenergic receptor can also

serve as sorting signals. This is an important mechanism for the down-

regulation and termination of signaling cascades mediated by these receptors

(reviewed in (318)). The ubiquitinated sequences are recognized by ubiquitin

interaction motives (UIMs) in adaptor proteins such as epsin and Eps15 (232,

284). Upon ubiquitination, internalization of the active receptors is accelerated.

Instead of being recycled to the plasma membrane they are routed to the

degradation pathway by the ubiquitin-dependent endosomal sorting

machinery consisting of a network of ESCRT protein complexes (9, 118, 239, 284).

The di-leucine based sorting signals were originally identified in the T-cell

antigen receptor. They were shown to be responsible for the rapid

internalization and targeting of the receptor to lysosomes (151). This class of

sorting signals is composed of two distinct groups of motives, DEXXXLL and

DXXLL (reviewed in (20)) and are recognized by the classical adaptor protein

complexes (108) as well as Golgi-localized, gamma-ear-containing, ADP

ribosylation factor (ARF)-binding proteins (GGAs).

3 .2 .3 Maturation from CCP to CCV

A tightly regulated sequence of events results in the growing of the CCP by

recruitment of clathrin as well as adaptor and accessory factors necessary for

the formation of a CCV. Receptor-bound cargo can be targeted into plasma

membrane microdomains with an increased PtdIns(4,5)P2 level and might even

them selves induce a local rise in concentration of this phospholipd. Adaptor

proteins such as AP2, AP180, epsin, Eps15, Dab2 or ARH are then recruited to the

plasma membrane via PtdIns(4,5)P2 interaction (reviewed in (92)).

Simultaneously, they interact with endocytic cargo-sorting signals,

synchronizing receptor concentration on the plasma membrane with the

nucleation of the coated pit by interacting with clathrin. The concentration of


cargo stabilizes the forming pit to allow the assembly of the coat and the

recruitment of all necessary factors for the maturation of a CCP to CCV. Upon

interaction with adaptor proteins, clathrin polymerizes to form a lattice and

does itself induce the recruitment of additional triskelions to the growing cage,

which results in increased curvature of the membrane(221). At later stages of

CCP formation, accessory factors such as epsin, endophilin and amphiphysin are

recruited. They induce membrane curvature and through their direct

involvement in membrane fission or recruitment of dynamin to the vesicle neck,

they facilitate the next step in the CCV maturation, where the fully formed CCV

is released into the cytosol.

Upon PtdIns(4,5)P2 based recruitment of epsin, it undergoes a conformational

change resulting in increased membrane curvature (107). Amphiphysin is

recruited to the periphery of deeply invaginated pits through its BAR-domain

and interaction with free clathrin terminals where it recruits dynamin to the

neck of the forming vesicle. Endophilin I is also preferentially recruited to

membranes with curvature through its BAR-domain as well as SH3-domain

based interaction with dynamin. It has a lipid modifying activity, inducing

negative membrane curvature at the neck of the forming endocytic vesicle and

thereby facilitating the invagination and fission step (267, 275). The final

scission step is then regulated and at least partly mediated by dynamin, which

upon GPT-hydrolysis and conformational changes confer constriction to the

neck of the deeply invaginated pit.

An additional mechanical force might be accomplished through the interaction

of dynamin with the actin binding protein cortactin. Cortactin binds to dynamin

via its SH3-domain (171) and by interacting with the actin biding protein Arp2/3

it induces local actin branching and polymerization (323, 331, 332, 350). The

dynamin collar around the neck of the forming endocytic vesicle connected

through cortactin to branching actin filaments pointing towards the plasma

membrane could promote pit invagination and facilitate efficient scission (178,

342). Alternatively, the actin motor-proteins myosin VI and myosin 1E could act

as force generators in CCV formation. Myosin VI attaches to coated vesicles

through the alternative adaptor Dab2 (194, 305) and myosin 1E to dynamin


through its SH3 domain (130). A model where the plus-end motor myosin 1E

pulls the dynamin ring towards the plasma membrane while the minus-end

motor myosin VI pulls the vesicle into the cytoplasm has been suggested. This

would result in a severing force applied to the vesicle neck beneath the dynamin

ring, facilitating scission (reviewed in (322)). The endocytic vesicle is then

transported into the cytosol, possibly by the propelling force provided by

polymerizing actin (177, 178).

3 .2 .4 Uncoating

Upon release of the endocytic vesicle into the cytosol, the clathrin coat

disassembles within a few seconds (261). This is in part regulated by reversible

phosphorylation of subunits of the coat or plasma membrane phospholipids,

resulting in reduced affinity of the coat components towards each other as well

as the towards the vesicle membrane.

Local change in phospholipids concentration is probably the first step in the un-

coating process. This is accomplished by the endophilin-induced recruitment of

the inositol-5-phosphatase, synaptojanin (145, 163). Upon interaction with

endophilin, the enzymatic activity of the phosphatase is stimulated. The local

reduction in PtdIns(4,5)P2 has been shown to destabilize the membrane

association of adaptor proteins such as AP2 and AP180 (41). The local rise in

PtdIns(4)P elicited by the activity of synaptojanin on the other hand induces

PTEN-domain based recruitment of the chaperone co-factor G-associated kinase

GAK/auxilin. GAK/auxilin is a serine/threonine kinase that can bind to dynamin

(206), AP2, and clathrin (269, 270, 320). In addition it can phosphorylate , or

μ-subunits of AP2 and thereby interfering with the association of the adaptor

protein complex with clathrin or cargo (150, 320, 338). Finally, synaptojanin

recruits the chaperone Hsc70 to the coated vesicle via its DnaJ-domain. This

interaction stimulates the ATPase activity of the ATP-bound Hsc70 (11, 321).

Direct interaction of the Hsc70 with clathrin heavy chain then disrupts clathrin-

clathrin interactions, leading to disassembly of the coat (240).


3 .2 .5 Endosomal trafficking

The uncoated endocytic vesicle is subsequently targeted to early endosomes

(EE). EEs serve as sorting compartments for cargo to be routed on to recycling or

degradation. Some lipids and housekeeping proteins such as the transferrin

receptor are recycled back to the plasma membrane through recycling

endosomes or the trans-Golgi network (TGN). Other cargo such as signaling

receptors and their ligands are sorted to multi-vesicular, endosomal carrier

vesicles (ECV) and from there they are targeted to late endosomes and

lysosomes for degradation. Not all cargo that reaches the ECV is degraded.

Transmembrane proteins such as mannose-6-phosphate-receptor and MHC are

retrieved from the degradative pathway by back fusion of the internal vesicles

with the external membrane of the endosomes (reviewed in (89, 90).

Endosomal compartments differ in regard to pH, lipid and protein composition.

This is important for the functional integrity of the organelles. The mildly acidic

(pH 6-6.3) luminal environment of EEs (273, 298) serves to induce uncoupling a

cargo from their receptors (128). From EEs, receptors destined for the plasma

membrane are targeted to the recycling endosomes. Interestingly, no sorting

signals for this destination have so far been identified whereas sorting signals

for internal vesicles and lysosomal targeting are known. This could be an

indication for a default pathway back to the plasma membrane (88).

Important for the sorting function of endosomes are membrane micro-domains

with distinct composition and function (reviewed in (88, 348)). The basis for the

micro-domain formation is lipid composition. Early endosomal membranes as

well as the internal membranes of ECVs are enriched in PtdIns(3)P (79) and thus

recruit effectors containing PtdIns(3)P binding motives such as FYVE or PX

domains (26, 295, 296). A key factor in the formation of these lipid-based

microdomains is the small GTPase Rab5, which is characteristic for early

endosomal compartments. Rab GTPases belong to the Ras superfamily of small

GTPases. They can bind various effectors through their N-terminus, have a

characteristic phosphate/magnesium binding motif (230), and a guanine-

nucleotide binding domain. Sub-cellular membrane targeting of the Rab


GTPases is dependent on sequences in their C-terminus as well as post-

translational modifications with geranyl groups (30). The regulatory role of Rab

GTPases involves the switching between an active, GTP-bound form and an

inactive, GDP-bound form. The GTP-bound form recruits effectors to endosomal

micro-domains and form distinct sorting platforms.

Rab5 interacts directly with the PtdIns(3)P-kinase vacuolar protein sorting-34

(VPS34), which is responsible for PtdIns(3)P production on the early endosome

as well the recruitment of a set of PtdIns(3)P binding, Rab5 effectors such as

EEA1 (33, 286, 294). These Rab5-organized domains are responsible for

homotypic endosome fusion, the regulation of early endosomal trafficking as

well as sorting of incoming cargo (31, 24, 83).

Rab4 and Rab22 are also members of the Rab-GTPase family present on EEs and

have a postulated role in the recycling to Rab11 positive recycling endosomes,

which then target the cargo to the plasma membrane (159, 302, 319, 324, 348).

The biogenesis of endosomal carrier vesicles (ECV) and late endosomal

compartments is a complex process and not entirely understood. ECV are

thought to be intermediate transport vesicles between EEs and late endosomes

(LEs). The maturation from early endosomes to endosomal carrier vesicles

occurs by the invagination of the limiting membrane into the lumen of the

vesicle and subsequent formation of internal vesicles (89). This process is

regulated by the FYVE-domain containing protein Hrs, which recruits the

endosomal trafficking complex ESCRT (8). The internal vesicles increase in

number as the ECV is transported along microtubules towards LEs, and

specifically labeled cargo destined for degradation is then targeted in to these

vesicles.

The maturation from EEs to LEs is also regulated by Rab5 and Rab7 as shown by

live-cell imaging studies. Two models have been proposed for the progression of

cargo through the endocytic compartments and its concentration in perinuclear

late endosomes. One model suggests an active sorting of cargo from the EEs by

Rab7 (327). Together with the cargo, Rab7 forms micro-domains within the EE

membrane that then detache as a transport vesicle and are targeted to late


endosomes and lysosomes. The other model reports a sequential displacement

of Rab5 for Rab7 as the maturation proceeds (249).

Like early endosomes, ECV and LEs are also characterized by specific lipid

compositions. The limiting membrane of these compartments contain

increasing amounts of PtdIns(3,5)P2, which is synthesized from PtdIns(3)P by the

PtdIns(3)P 5-kinase PIKfyve (59, 182). Among PIKfyve effectors are members of

the ESCRT-complex (335). Internal vesicles of the ECV are characterized by their

high lysobisphosphatidic acid (LBPA) content (127). The LBPA is important for

sorting and trafficking of proteins and lipids that are in transit through late

endosomes (87, 127, 168).

The myotubularin and myotubularin related proteins (MTM/R) belong to a

family of enzymatically active or inactive, dual-specific lipid/tyrosine

phosphatases showing specificity towards PtdIns(3)P and PtdIns(3,5)P2. In

addition to the role in reversible phosphorylation of those phosphatidylinositols

(PIs), the MTM(R)s also show a binding affinity towards the same PIs through

their PH-GRAM (glucosyltransferase, Rab like GTPase activators and

Myotubularin) domain (16, 154, 250, 268). Due to their affinity towards these

two major phospholipids of endosomal compartments from early endosomes

and ECV to late endosomes, they are likely to be important for the regulation of

vesicle trafficking and cargo sorting (250).

Late endosomes have a more acidic pH ( 5.5) than early endosomes and are

enriched in internal vesicles. Late endosomes contain lysosomal hydrolases that

initiate the degradative process. Rab7 is the characteristic Rab-GTPase of late

endosomes and has been proposed to regulated trafficking between early and

late endosomes (66, 43, 233) and mediate fusion between late endosomes and

lysosomes (337, 25, 175). How, exactly this regulation is accomplished is not clear.

RILP is one of the few known effectors of Rab7 and has recently been suggested

to coordinate the biogenesis of multivesicluar endosomes through interaction

with the ESCRT-complex and a dynein-mediated trafficking of these endosomal

compartments towards lysosomes (234). The limiting membranes of late

endosomes and lysosomes contain high amounts of LAMP-1 and LAMP-2


(lysosomal-associated membrane protein) and the inner membranes contain

large amounts of LBPA which is not found in the limiting membrane. Lysosomes

are the end station of the degradative pathway with its highly acidic pH (4.8)

and hydrolases (128, 172).

3.3 ORGANIZATION AND DYNAMICS OF CCPs AT THE PLASMA MEMBRANE

3.3 .1 Clathrin dynamics

The generally accepted model for the initial steps of the endocytic pathway was

for a long time based on the theory that pit formation occurs more or less

randomly through the gradual association of individual coat subunits.

Receptors and other membrane components destined for internalization are

enriched in the growing pit, and this is synchronized with the progressive

invagination of the plasma membrane, resulting in the release of an endocytic

vesicle. Following uncoating the dissociated coat subunits become cytoplasmic

and are recycled to new sites of coated pit assembly, independent of previous

location.

3.3.1 . 1 The classical model

Using a GFP-tagged clathrin light-chain and live cell imaging, Gaidarov et al

were able to study clathrin-coated structures on the plasma membrane,

revealing new aspects of the early steps in CME in regard to spatial regulation,

nucleation and dynamics of CCPs (75). Consistent with the classical model of

CCP formation, the authors reported CCP “blinking” at the plasma membrane.

These events were seen as gradually increasing CLC-GFP signal for a short time

before abrupt disappearances, which would represent an accumulation of

clathrin in the pit, formation of CCV and a subsequent, rapid uncoating. Similar

observations have also been reported by other groups (60, 176, 253, 261). The

above-mentioned studies were not performed using total internal reflection

fluorescence microscopy (TIRFM), which allows imaging of plasma membrane

specific events. Another group, Merrifield et al however used a combination of


TIRFM and epi-fluorescence microscopy to show a gradual increase in clathrin

signal that was accompanied by a brief burst in dynamin signal shortly before

disappearance of both proteins upon internalization of the CCV (60, 176, 253,

261).

3.3.1 .2 The “catastrophic” and “non-catastrophic” CCPs

In addition to the above mentioned “classical” CCP-dynamics, different clathrin-

associated events have been reported. In a recent study, a large number of

short-lived pits that rapidly disappeared without any dynamin association were

seen. The lack of a dynamin burst suggested that the sudden loss of CLC signal

was not due to internalization. The authors then proposed a model where the

nucleating pit needs cargo for stabilization and in the absence of cargo, the

accumulation of necessary factors for completion of CCV formation cannot

proceed, resulting in a “catastrophic” collapse of the forming pit (60). A “non-

catastrophic” loss of clathrin from clathrin-coated pits has also been reported

where a gradual decrease in fluorescence of long-lived pits is observed (75). This

could represent an exchange of labeled triskelions from the coat with unlabled

cytosolic ones, indicating an active role of these otherwise rather static clathrin

structures in sorting or internalization (242). The active conversion of lattice

hexagons to pentagons is required to transform flat clathrin coats to budding

structures (99, 115). Supportive of this interpretation of the static clathrin spots

seen at the plasma membrane, is the notion that coated vesicles can emerge

from a static clathrin lattice. These types of static structures have thus been

suggested to serve as a lattice reservoirs and nucleating site for coated pits and

vesicles (75, 100, 109, 242).

3.3.1 .3 The “hot spots”

Several groups have reported preferential sites of CCP nucleation or so-called

“hot-spots”(18, 75, 261, 314). This kind of spatial control requires regulatory

factors that promote or favor CCP assembly in certain regions of the plasma

membrane while other regions are actively excluded. For the fast and highly


regulated exo- and endocytic cycles in nerve terminals, the high-level of

organization provided by such “hot spots” would be of importance. How this

spatial control would be accomplished is not clear but it has been suggested to

require the action of multi-domain scaffold proteins that are only present at

specific micro-domains. This would be in agreement with the spatial restriction

seen for the movements of CCPs and several cell-surface receptors, which are

typically limited to areas of about 0.5-0.8 mm in diameter (5, 135, 264). This

phenomenon has been explained by a mosaic membrane structure where

trans-membrane proteins that tether to the underlying cortical actin

cytoskeleton could act as fences, serving as scaffolds for endocytic structures

and limiting free diffusion within the membrane.

3 .3 .2 Cargo specific interaction with the clathrin machinery at the plasma membrane

For a long time, CME was considered to depend on a number of core-

components necessary and sufficient for the internalization all types of cargo. In

recent years it has become increasingly clear that despite the common clathrin

dependency, molecular requirements, targeting to endocytic machinery (60,

176, 261), intracellular sorting and transport is to some extent cargo specific

(137).

3.3.2.1 Targeting of cargo into CCP

Using fluorescently tagged cargo and endocytic proteins in combination with

live-cell imaging it its possible to specifically look at the initial interaction of

these factors at the plasma membrane. Different levels of receptor bound

cargo mobility as well as differences in the usage of pre-existing CCPs and

induction of de novo CCP formation has been reported. Originally, targeting was

thought to happen only through binding of cargo to receptors that were

laterally mobile within the plasma membrane before becoming confined to a

pre-formed CCP (266, 280). In recent years it has however become clear that

receptor bound cargo can trigger de novo formation of CCP. Smaller cargo such

as G-protein coupled receptors, tfn and LDL seem to be mainly targeted to pre-


formed CCPs (60, 266, 280) whereas viruses like influenza, Semliki Forest virus

and Reovirus (60, 261, 326) are at least partly seen to induce de novo formation

of CCPs.

The exact role of cargo in the induction of CCP formation however remains

unclear. In the case of clathrin assembly underneath a Reovirus particle, the

authors postulated that the clathrin recruitment was not cargo-induced but

rather a result of random CCP formation. This was based on calculations

showing that the likelihood of a CCP forming underneath the virus was the

same as in a random spot on the plasma membrane and therefore the binding

of the virus would not directly induce the formation of the pit but rather

stabilize the coat that was forming underneath it (60). In another study,

influenza virus was shown to exploit both mechanisms although de novo

formation was by far the more frequently seen event (261). The authors

suggested virus-induced clathrin recruitment based on the observation that pit

formation at the site of virus confinement was more frequent than in the

surrounding areas on the plasma membrane. The cargo induced de novo

formation of CCP has also been show to occur upon activation of EGFR (110). The

EGF-induced stimulation of EGFR resulted in the formation of new, EGFR- but

not tfn-containing pits, indicating a cargo specific induction of CCPs.

3.3.2.2 The role of adaptors

The requirement for adaptor proteins is maybe the most prominent difference

between different cargo using CME. The adaptor proteins are regarded as core

components of the clathrin-based endocytic machinery, making the initial

contact with the plasma membrane and endocytic signals in cargo receptors

and subsequently recruiting clathrin and accessory proteins to the forming CCP.

This function was previously thought to be restricted to AP2. Recently, it has

been shown that not all types of cargo depending on CME do also require AP2

for efficient internalization. While the endocytosis of tfn is effectively blocked in

cells lacking AP2 other cargo such as EGF, LDL, and influenza are still being

internalized (37, 137, 196, 205). In the case of EGF and influenza this could,

however, partly be due to an alternative, clathrin-independent pathway (102).


This differential adaptor protein requirement has been suggested to affect the

sorting process were cargo destined for late endosomes or lysosomes like LDL,

EGF and influenza are sorted into a highly mobile population of early

endosomes via alternative adaptors such as Dab2 while tfn is sorted into a more

static population of endosomes destined for recycling in a AP2 dependent

manner (137).

Depending on the adaptor involved, targeting mechanisms of cargo to CCPs

may vary. In the case of LDLR, it seems like the cargo specific adaptor Dab2 is

responsible for the initial recognition of the receptor at the plasma membrane

in an AP2-independent manner. Dab2 is thought to bind simultaneously to the

actin-based motor-protein, myosin VI and thereby actively mediate the

targeting of LDLR to CCPs (166).

Another cargo specific targeting mechanism could be accomplished by so-called

sorting platforms. The existence of sorting platforms has been suggested by

Rappoport et al in a study where they looked at the dynamics of clathrin, AP2

and epsin during endocytosis using TIRFM (242). AP2 was found to localize only

to a static population of clathrin spots and to be excluded from endocytic

vesicles (241, 242, 245). Eps15 has been reported to be restricted to the edges of

CCPs, and is not incorporated into the forming CCVs (42). The alternative

adaptor epsin was on the other hand found to be internalized together with the

majority ( 70%) of CCVs (242). The authors thus suggested a model where AP2

is restricted to the static population of clathrin lattices at the plasma

membrane, having a sorting function within these micro-domains. Upon

internalization, receptors would associate with more specific adaptors, which

would replace AP2 and be internalized in the CCV together with its cargo.

3.4 Vesicular stomatitis virus

Vesicular stomatitis virus or VSV belongs to the family of Rhabdoviridae, which

is composed of 6 genera. The most intensively studied genera are the Lyssa

viruses, commonly represented by the notorious Rabies virus and

Vesiculoviruses, with VSV as a prototype. VSV has a very broad host range,


infecting from insects to humans (259). It is however best know for causing

epidemics in cattle were the symptoms are vesiculation around hooves and

mouth, temporary lameness, and loss of milk production (259).

3 .4.1 VSV structure and morphology

VSV is an enveloped, bullet shaped virus with a size of 70-80 nm in diameter

and 170-180 nm in length. It is composed of two major structural components,

the helically coiled, cylindrical nucleocapsid and the host cell derived envelope

bearing an external fringe of spikes formed by trimers of the transmembrane

protein VSVG (Fig. 6A and B). In negatively stained electron micrographs, the

base of the bullet appears to be fragile, allowing stain to penetrate into the

envelope, revealing the internal helical nucleocapsid (Fig.6B). The genome of the

virus is a single, linear, negative-sense, ssRNA that is about 12 kb in size. It

encodes five major proteins: glycoprotein (G), matrix protein (M), nucleoprotein

(N), RNA-dependent RNA polymerase (L) and phosphoprotein (P) (Fig.6A). The

nucleocapsid is a tightly associated complex of RNA and nucleocapsid protein N.

Although present in fewer copies than the N protein, the phosphoprotein,

which is essential for the transcription complex, and the polymerase L, are also

components of the nucleocapsid. The polymerase L is a RNA-dependent RNA-

polymerase with an mRNA 5’-capping, 3’-poly(A) and protein-kinase activities.

The matrix protein is the most abundant protein of the virion and has a multi-

functional role in inhibition of host cell transcription as well as regulation of

viral transcription. In addition, it promotes viral budding by binding to

nucleocapsids and the cytoplasmic domain of VSVG.

3 .4.2 VSVG

VSVG plays a critical role during the initial steps of infection. It is responsible for

virus attachment to the host cell receptor as well as the acid-activation of the

viral envelope with target membranes (53, 78, 255, 259). Four distinct domains of

VSVG have been identified: a -sheet lateral domain (I) a central domain

involved in trimerization (II), PH domain (III) and a fusion domain (IV) (256).


VSVG can assume at least three different conformations: the native, pre-fusion

state detected at the virus surface above pH 7, the activated hydrophobic state,

which interacts with the target membrane and the post fusion conformation

(254-256). VSVG is an atypical fusion protein, showing a pH-dependent

equilibrium between its pre- and post-fusion conformations. This is in contrast

to other viruses fusing at low pH, were the acid-induced conformational change

is irreversible (77). The acid-activation is a result of low-pH induced

conformational changes in the fusion domain of the glycoprotein. Upon

exposure to low pH, protonation of histidines occurs, which causes the fusion

domain to move closer to the target membrane. The perturbation of the fusion

domain into the outer leaflet of the target bilayer leads to hemi-fusion and

subsequently to pore-formation (reviewed in (254)).

Figure 6. T he str uctur e of VSV. A. Structural components of VSV depicted on a negative staining of wtVSV and a schematic representation of the negative sensed RNA and its encoded proteins. B. A micrograph of negatively stained wild-type VSV. Due to rupture at the base of the virus, the stain has penetrated the envelope, revealing the internal helical nucleocapsid. Two of the viral particles (top left) are still intact and thus have a dense appearance. Micrographs were taken by Jürgen Kartenbeck. Scale bar represents 100 nm.

3 .4.3 Endocytic pathway and infection

Like many other pathogens, VSV must enter cells for survival, replication and

immune-system evasion. For this it makes use of existing cellular endocytic

pathways, which results in more efficient entry and delivery to sub-cellular

locations, optimal for viral replication (161). The initial contact of the virus with

A B


its host cell is through VSVG mediated interaction with attachment factors

and/or receptors. The nature of VSV receptor remains a matter of debate. For

some time, phosphatidylserine was thought to be the VSV receptor (271), but

more recent work suggests that this is not the case (34).

Matlin et al originally showed the infectious route of VSV to be through

endosomal compartments due to the inhibitory effect of agents affecting the

endosomal pH and in the same study, using electron microscopy, the virus was

found in pits and vesicles with an electron-dense coat (164). More recent studies

have confirmed the clathrin dependence of the virus and in addition shown that

infection is reduced upon over-expression of a dominant negative form of Eps15

(310). Following entry, the virus containing endocytic vesicle fuses with early

endosomes (Fig.7). Rab5 and COPI-coatomer complex seem to play a role in this

process, most likely in targeting to the early endosome or in further sorting

within the endosomal compartments (47, 291). The late endosomal GTPase Rab7

is on the other hand not involved in VSV infection (291). Based on the pH

threshold of VSVG conformational change, which has been reported to be

below pH 6.2 (28, 334), the virus could undergo acid-activation in the early

endosomes (pH 6-6.3) (273, 298). Acid-activation would then result in fusion of

the viral envelope with the limiting membrane of the early endosome leading

to penetration of the nucleocapsid into the cytosol.

Le Blanc et al have suggested fusion and penetration to be two distinct steps,

separated in time and space. In their model, acid-activation is induced in ECV,

where the viral envelope fuses with internal vesicles rather than the limiting

membrane. The nucleocapsid would then be transported, in a microtubule

dependent manner within the internal vesicles of the ECV, towards late

endosomes. Penetration would then occur through a back-fusion of the internal

vesicles with the limiting membrane of the ECV or late endosome. This process

was found to be dependent on the endosomal lipid LBPA and its putative

effector Alix. The process was suggested to be regulated by PtdIns(3)P signaling

via the cellular fusion protein sorting nexin 16 (Snx16) (141).


4 RESULTS

4.1 CHARACTERIZATION OF LABELED VSV AND RECOMBINANT VSV

The viruses used in this study were grown in BHK-21 cells and purified from the

cell medium using isopycnic gradient centrifugation. The quality and purity of

the virus was tested by plaque assay, SDS-page and EM after negative staining.

The particles had the characteristic bullet shape of Rhabdoviruses and the

spikes in the viral envelope representing the VSVG trimers could be clearly

detected (Fig.1A, arrow). Only the five viral proteins (polymerase (L), glycoprotein

(G), nucleocapsid protein (N), phosphoprotein (NS) and matrix protein (M), were

visible on a coomassie stained SDS-PAGE gel (Fig. 1B, L (240 kD), G (63 kD), N (47

kD), NS (29 kD) and M (26 kD)).

For live-cell imaging, purified wtVSV was labeled with the fluorophores

AlexaFluor488 (VSV-AF488), AlexaFluor594 (VSV-AF594), or AlexaFluor647 (VSV-

AF647). SDS-PAGE and fluorography of the labeled viruses showed that the

fluorophores were coupled to the glycoprotein G (VSVG) (Fig. 1B). VSVG is the

only protein exposed on the outside of the envelope and thus the only protein

expected to be labeled if the viruses are intact. When viewed by a confocal

microscope, labeled viral particles could be seen as a homogenous population of

single spots with a diameter of 450±50 nm (Fig. 1C). Labeling reduced infectivity

from 1 x 1014 to 5 x 1013 plaque forming units/ml (pfu/ml).

The recombinant VSV (rVSV) that expresses GPF upon replication in infected

cells has been previously used and described (111, 131, 224, 278). The GFP

sequence was cloned between the gene coding for G and L proteins. This

allowed a direct fluorescent detection of infected cells 3-5h post-infection (pi)

without antibody staining (Fig. 2A). The infection index or the fraction of cells

infected at a given multiplicity of infection (MOI), was the same as for wtVSV,

and infection was inhibited by agents increasing the pH of endosomal

compartments (see Fig. 2B).


Figure 1. Pur if ied a nd la bel ed wt VSV. A. Analysis of purified wt VSV by negative staining using phosphotungstic acid (pH 7.3) in EM. Viral particles showed the characteristic bullet shape of Rhabdoviruses and a size of 80 x 180 nm. VSVG glycoprotein trimers were seen in the viral envelope (arrow). Majority of viral particles were intact when the pH of the phosphotingstic acid was buffered to pH 7.3. Micrograph taken by Jürgen Kartenbeck. Scale bar represents 100 nm. B. Analysis of wtVSV-AF488 by SDS-PAGE with coomassie blue staining in the right lanes, fluorography in the middle and western blotting by VSVG-8685 antibody in the right lane. In coomassie staining, all five viral proteins (polymerase (L), glycoprotein (G), nucleocapsid protein (N), phosphoprotein (NS) and matrix protein (M), were visible while the G protein (G (63 kD)) is the only protein that is fluorescently labeled. C. Confocal microscopy of the AF488 labeled VSV showing homogenously distributed, individual spots of uniform size (~ 0.5 μm). The relative fluorescence intensity distribution of one labeled virus (insert) is shown.


Figure 2 . Cha racterizatio n of rVSV. A. Infection of BHK cells with rVSV at a MOI of 1 showing 30% infection. Cells were counted by looking at hoechst nuclear staining (middle) while infection was scored by detection of GFP expressed upon viral replication (left). B. Dose dependent infection was seen for rVSV as scored by FACS and a complete inhibition of infection was seen in the presence of 20 mM NH4Cl.

4.2 THE KINETICS OF VSV ENDOCYTOSIS

4.2 .1 Kinetics of internalization and acid-activation

To analyze the kinetics of VSV uptake in HeLa cells, we followed the

internalization of [35S]-methionine-labeled virus. To allow synchronized entry,

the labeled virus was first allowed to bind to confluent cell monolayers at 4°C

for 1h at a MOI < 1. The cells were then washed to remove unbound virus leaving

2-10% of the added virus cell-associated. After rapidly raising the temperature to

37°C, dishes were placed on ice at different periods of time up to 45 min, and

cell-associated radioactivity was measured after treatment with proteinase K at

4˚C to remove surface-bound VSV (164). Control samples with virus bound to

the surface without shifting the cells to 37°C, showed that the proteinase K

treatment removed over 92±7% of surface-bound virus.


Figure 3. Entr y kinetics of VSV in HeLa cell s A. 35S labeled VSV was bound to cells at 4°C. Subsequently, unbound virus was removed before shifting cells to a 37°C water-bath for indicated times. Internalized virus was quantified using a scintillation counter. Error bars indicate standard deviation of the mean of 3 experiments. B. Kinetics of VSV acid-activation and VSVG degradation in HeLa cells. VSV was bound to cells at 4°C. Unbound virus was removed and samples were shifted to a 37°C water-bath in the presence (NH4Cl wash-out) or absence (NH4Cl add-in) of NH4Cl for indicated times. Subsequently the NH4Cl was either removed for 2 min and then re-added (NH4Cl wash-out) or added to the samples (NH4Cl add-in) at indicated time-points. Infection was scored by FACS 4h post infection and is represented as percentage of infected cells as compared to infection levels in the absence of NH4Cl. Error bars indicate standard deviation between 3 experiments. C. VSVG degradation. VSV was bound to cells at 4°C. Unbound virus was removed and samples were shifted to a 37°C water-bath in the presence of 1mM cycloheximide (CHX) for indicated times. Subsequently, the amount of internalized, un-degraded VSVG was quantified by western blot. Error bars indicate standard error of the mean of 3 experiments.

In samples incubated at 37°C, up to 30% of cell-associated radioactivity became

resistant to proteinase K treatment. As shown in Fig. 3A, internalization of VSV


was surprisingly rapid; the full cohort of viruses that was internalized was

already proteinase K resistant 5 min after warming, and half of it was resistant

within 2.5-3 min. The internalization of VSV thus occurred rapidly and

synchronously. Why only one third of the virus was internalized is not clear but

the inefficient internalization was consistent with previous observations in

MDCK and BHK cells (164, 186).

To determine the time course of the acid-induced activation of membrane

fusion and penetration following internalization, we developed a FACS-based

infection assay using a recombinant virus (rVSV is identical to wild-type virus in

regard to infection but modified so that it expresses GFP in the infected cell) (111,

131, 224, 278). To define the time of acid-exposure, we took advantage of the fact

that lipophilic weak bases such as ammonium chloride (NH4Cl) inhibit

endosomal acidification and thus prevents the pH-induced activation of the

VSVG (164). The elevation of endosomal pH is almost instantaneous upon

addition of the base to the extra-cellular medium (210). The virus is internalized

normally in the presence of 20 mM NH4Cl but if the medium pH is carefully

buffered to 7.2 or higher, penetration and infection is completely blocked (119)

(Table 1). As before, virus was bound to cells at 4°C for 1h. Unbound virus was

removed, and samples shifted rapidly to 37°C. NH4Cl was added at different

times, and the infection index determined 4 hours later using FACS analysis

after fixation. The percentage of cells infected in uninhibited controls ranged

between 20 and 70% depending on the experiment. It is important to note that

by using a multiplicity of infection below 1, we could score the average time of

acid-conversion; if more than one virus was added the kinetics of the fastest

viruses were scored.

The results showed that all viruses passed the acid-requiring step within 8-10

min post warming with no additional viruses being activated at later time

points (Fig. 3B, squares). The half time was about 3 min indicating that the

majority of viruses passed the acid-requiring step almost immediately after

internalization. Given the rapidity of the process, the critical acid-induced event

most likely occurred in early endosomes (173).


To determine whether later organelles in the endocytic pathway could also

could productive penetration, we allowed the virus to enter for different periods

in the presence of NH4Cl, then changed to inhibitor-free medium for 2 min,

followed by re-addition of NH4Cl, and infection was assayed 4h post-warming.

This protocol took advantage of the almost instantaneous drop in endosomal

pH after NH4Cl wash-out and the rapid pH increase after re-addition (210).

The results confirmed that viruses reached a compartment capable of

supporting productive entry as early as 2 min after warming (Fig.3B, circles).

Peak values of infection were observed 6-10 min after warming whereafter it

dropped to half within 30 min and to zero within 90 min. This confirmed that

the acid-activated step in VSV penetration occurred with highest efficiency in

early endocytic compartments, and demonstrated that movement into late

endosomes or lysosomes reduced and eventually prevented productive

penetration.

Next, we determined the time course of virus arrival in degradative

compartments by measuring the degradation of G-protein. Purified wild-type

VSV was again bound to cells for 1h at 4°C. After washing and a shift to 37°C for

different times, viruses that had failed to enter were removed by proteinase K

treatment in the cold. Cell lysates were analysed by SDS-PAGE and

immunoblotting using antibodies against the G-protein. As shown in Fig. 3B

(triangles) and quantified in Fig. 3C, about one third of cell-associated VSVG was

internalized, and its degradation started between 30 and 60 minutes after

warming and was complete by 120 min.

Taken together, the kinetic data were consistent with a model in which the

incoming virus passes through three compartments: 1) An early endosome that

supports acid-activation of the G-protein and efficient productive penetration;

2) A later endosomal compartment that is less effective in supporting infection,

and 3) A degradative, presumably lysosomal compartment incapable of

supporting penetration.


4.2 .2 VSV in endosomes

We also analyzed VSV entry into host cells using electron microscopy (EM). Due

to the inefficient binding of the virus to HeLa cells, we were able to detect a very

limited number of cell associated viruses. Syrian baby hamster kidney cells

(BHK-21) are about 100x more sensitive to VSV infection, and as the entry

kinetics were found to be the same as seen for HeLa (H.K.J. and A.H.) we decided

to use these for EM analysis of viruses in endosomal compartments. As our

above discussed results indicated a rapid internalization and acid-activation

that might result in penetration of the virus into the cytosol where it would not

be visible anymore, we tried to maximize the number of internalized viruses.

This we did by binding the virus to cells at 4°C for 1h and then, without

removing unbound virus, shifted the samples to a 37°C incubator. Our previous

results indicated that the temperature shift is slower when an incubator is used

in comparison to same experiment performed using a water-bath (H.K.J. and

A.H.). We therefore incubated our EM samples for 10 minutes at 37°C before

fixation and embedding.

Upon internalization, viruses were visible in vesicles with an electron dense coat

(Fig. 4B (open arrow), D, E and G). Viruses could also be seen in what appeared

to be intracellular membrane-bound structures with irregular shapes and

devoid of visible coat or internal vesicles (Fig. 4A, B (closed arrow), C, H and F)

suggesting newly formed endocytic vesicles or early endosomes with a

diameter of 195±7 x 271±7 nm. Only when NH4Cl was added to prevent

acidification, accumulation of VSV in endosomal compartments was observed

within larger vacuoles with diameter of 456±8 x 607±10 nm. These could

contain several viruses as well as some intra-vacuolar vesicles (Fig. 5A to F).


Figure 4. Electro n micro gra ph of VSV in endoc ytic/endoso mal vesicles. Virus was bound to cells at 4°C for 1h and subsequently shifted to a 37°C incubator to allow internalization for 10 min before fixation. Viruses were seen either in coated or partly coated endocytic vesicles (B (open arrow), D, E and G) or in relatively small, tight fitting endosomal vesicles (A, B (closed arrow), C, H and F), indicating their presence in early endosomal compartments. Micrographs taken by Roberta Mancini. Scale bar represents 100nm.

4.3 THE ENDOCYTOSIS OF VSV IS CLATHRIN DEPENDENT

4.3.1 VSV in coated and uncoated pits during host cell entry

By binding viral particles to cells at 4°C for 1h and subsequently fixing and

embedding the samples we were able to look at virus-cell interaction. Viral

particles that were attached to the cells (n=26) were in some cases associated

with (Fig.6F and G) or at the base of a microvilli (Fig. 6A and E) as has been

previously reported for Semliki Forest virus (162). The viruses were seen in two

types of surface invaginations; 60% of them were coated (Fig.6A, B, C and D),

and the rest similar invaginations but without a visible electron-dense coat


(Fig.6E, F and G). Upon warming, viruses started to be internalized and were in

some cases seen in coated vesicles (Fig.6H, arrows).

4.3 .2 VSV infection is blocked by the CME inhibitor chlorpromazine

Although it seems to be clear that VSV entry into host cells can occur via

clathrin-mediated endocytosis, its molecular mechanism has not been studied

in detail. Chlorpromazine is a pharmacological inhibitor reported to prevent

coated pit assembly on the plasma membrane and to cause clathrin lattices to

form on endosomal membranes (329). We applied this inhibitor to HeLa cells

and monitored its effect on VSV infection. The cells were pre-incubated with

different concentrations of the inhibitor for 10 min before virus was added. Due

to the cytopathic effect of the inhibitor, it was removed after 30 minutes

incubation with the virus and infection was the allowed to proceed in the

absence of the drug for additional 3.5h until infection was scored by FACS. At a

Figure 5 . Electro n micrographs of VSV in late endoso mal com partm ent s. Virus was bound to cells at 4°C for 1h and subsequently shifted to a 37°C incubator in the presence of NH4Cl to allow internalization but not acid-activation. Subsequently, NH4Cl was removed 30 sec before fixation. Accumulation of viruses was seen in larger endosomal structures some containing internal vesicles. No fusion events were seen. Micrographs taken by Jurgen Kartenbeck. Scale bar represents 100nm.


concentration of 17 μM, infection was reduced by about 40%, and at 280 μM by

90% (Fig.6I). This effect of chlorpromazine is an additional confirmation of the

importance of CME for productive VSV infection.

4.3 .3 Clathrin heavy chain knockdown impairs VSV infection.

To further confirm the importance of clathrin for VSV infection we performed

siRNA mediated silencing of clathrin heavy chain (CHC) in HeLa cells using four,

previously validated oligonucleotides, CHC1, CHC2, CHC3 and CHC4. To acquire

maximal knockdown, a double transfection protocol was deployed with a 48h

Figure 6. VSV endoc ytosi s is c lathrin dependent. A to G. Virus was bound to BHK-21 cells at 4°C for 1h and subsequently fixed and analyzed. Plasma membrane bound viruses with (A, B, C and D) or without (E, F and G) an electron dense coat. Viruses were in some cases seen close to or associated with microvilli (A, E F and G). Micrographs were taken by Roberta Mancini and Jurgen Kartenbeck. Scale bar represents 100 nm. I. A dose-dependent reduction of VSV infection was seen in the presence of the CME inhibitor chlorpromazine.


interval. To verify the efficiency of CHC knockdown, cell lysates were analyzed

using western blots and specific CHC antibodies; a loss of 30, 50, 85 and 95%

was observed for CHC1, CHC2, CHC3 and CHC4, respectively (Fig. 7A). Cells

transfected with AllStars Negative siRNA were used as a negative control and

actin as a loading control.

Figure 7. VSV i nfection is c lathrin dependent. HeLa cells were transfected with 4 siRNAs against clathrin heavy chain (CHC1 to 4). A. Quantification of CHC protein levels in siRNA treated cells by western blot. Results are presented as percentage of CHC normalized to CHC levels in control cells treated with AllStars Negative siRNA and the level of actin as a loading control. B. Cells treated with CHC1 to 4 were infected with rVSV. The infection was scored by FACS and normalized to infection levels of AllStars Negative treated cells. Error-bars represent standard deviation between 3 experiments. C. Cells treated with siRNA against CHC (CHC1, 2, 3 and 4) were infected with rVSV for 4h. AF594 labeled transferrin was added to the samples for 15 min, 25 min prior to fixation. Clathrin was detected using a mouse anti-clathrin antibody and a secondary antibody labeled with AF647 and infection was detected by GFP expression upon replication of the rVSV.

C


Cells were then infected with rVSV at a MOI of 0.5 for 4h. To determine if CME

was inhibited, AF594 labeled transferrin (tfn) was added for 15 min.

Subsequently, the transferrin was removed and the samples incubated for

additional 10 min. The remaining, un-internalized tfn was then removed by an

acid-wash using a glycine buffer with a pH of 3. Scoring the infection by FACS,

clathrin heavy chain knockdown using CHC1 resulted in 20% reduction of

infection while about 40% reduction was observed using CHC4 siRNA (Fig. 7B).

We confirmed our FACS results by immuno-fluorescence analysis using a

confocal microscope. The total amount of tfn internalized, which is exclusively

clathrin dependent and was therefore used as a positive control, was strongly

reduced in siRNA treated cells (Fig.7C, tfn). A very low level of tfn signal was

however seen in some of the cells. We analyzed the cells that were infected

with VSV and in some cases these were also still capable of internalizing some

tfn (Fig.7C, CHC2 and 4, arrows). In other cases, the virus was seen to infect cells

in which no uptake of transferrin could be detected (Fig.7C, CHC1, arrow). These

results indicate that despite lowered clathrin expression, it was still enough to

maintain low levels of clathrin-mediated endocytosis. Even in the absence of

any detectable tfn uptake, the cells could be infected. Clathrin thus seems to be

involved in the productive entry of VSV. However we could not exclude the

presence of an alternative clathrin-independent pathway.

4.3 .4 Testing other perturbations

To characterize the entry process further, we used a number of perturbations

known to affect different endocytic processes. To assess the importance of

cholesterol, we subjected CV-1 cells to cholesterol extraction over night using a

combination of the cholesterol-sequestering drug nystatin (25 μg/ml) and the

cholesterol synthesis inhibitor progesterone (10 μg/ml). Cells were subsequently

infected for 4h with rVSV and after fixation samples were analyzed by FACS. As

a positive control we infected an identical set of samples with SV40, which is

dependent on the presence cholesterol for its internalization through a clathrin-

independent pathway (228). The results showed that VSV infection was reduced

by 30% in the absence of cholesterol as compared to 80% reduction of SV40

infection (Fig. 8A). Similar results were obtained in HeLa cells using rVSV in the


presence of progesterone and nystatin. These results indicate that the majority

of VSV enter cells by a pathway, such as CME, that does not require lipid-rafts.

Figure 8. Lipi d rafts, Caveo lin- 1 a nd Arf 6 ar e not involv ed i n VSV i nfection. A. CV-1 cells were infected with rVSV in the presence of progesterone and nystatin and the lipid-raft dependent virus SV40 was used as a positive control. Infection was scored by FACS. Error bars indicate standard deviation between three samples. B. Caveolin-1 knockout cells were infected with different MOIs of rVSV and the infection index was compared to what was seen for the wild-type cells. Error bars indicate standard deviation between three samples. C. HeLa cells were transfected with Arf6-wt-GFP or Arf6-T27N-GFP constructs and 12 hours later infected with rVSV. Infection was scored by FACS. Error bars indicate standard deviation between three samples.

Caveolae and caveolin-1 are involved in the lipid raft mediated endocytic uptake

of SV40 in CV-1 cells (6, 116, 228, 306). It has however been shown that SV40 is

endocytosed just as efficiently in Caveolin-1 knockout cells as in the wild type

control cells and that the entry kinetics are even faster in the absence of

cavelolin-1, than in cells expressing caveolin-1 (46). We made use of mouse

embryonic fibroblasts lacking caveolin-1 (57) to look at the effect of caveolin-1

absence on VSV infection. We infected an identical set of samples of caveolin-1

knockout fibroblasts (KO MEFs) and wild-type MEFs (wt MEFs) with rVSV and

subjected to FACS infection analysis. The results showed that like for SV40,

infection was increased about 50-60% in the absence of caveolin-1 as compared

to what was seen in the wt MEFs (Fig. 8B). We conclude that caveolin-1 is not

required for VSV infection.

The small GTPase Arf6 is sometimes used as marker for one of the clathrin-

independent endocytic pathways (reviewed in (167)). To look at the effect of

Arf6 on VSV infection we made use of an Arf6 T27N mutant, which traps its

GDP/GTP exchange factor (GEF) in a stable complex, preventing the activation

of endogenous Arf6 (158). The wild-type Arf6-GFP construct as well as the GFP-

tagged, dominant negative form of Arf6 were transfected into HeLa cells and


subsequently the transfected cells were infected with wtVSV. There was no

significant difference between the infection of cells expressing the dominant

negative form as compared to those expressing wild-type Arf6 (Fig. 8C). VSV

does thus not seem to enter cells in an Arf6 dependent manner.

4.4 ADAPTOR AND ACCESSORY FACTOR INVOLVEMENT IN VSV INFECTION

4.4.1 Dynamin-2 is required for VSV infection

Since dynamin-2 is a key factor in several endocytic pathways including the

clathrin- and caveolar/lipid raft-mediated but dispensable in others such as

macropinocytosis and the non-clathrin/non-caveolar pathway recently

described for the entry of lymphocytic choriomeningitis virus (LCMV) (39, 136,

238, 322), it serves as a rather reliable first criterion for classifying endocytic

pathways. To test weather dynamin is involved in VSV infection we transfected

HeLa cells with dynamin-2-wt-EGFP and the dominant negative mutant

dynamin-2-K44A-EGFP (45). Transfected cells were then infected with rVSV for

4h prior to fixation and subsequently, infection was scored by eye using a

confocal microscope. As a positive control we used Semliki Forest virus (SFV),

which has been shown by our lab to enter cells in a clathrin and dynamin-2

dependent manner (326). Over 100 cells were counted for each construct. In

cells over-expressing the dynamin-K44A mutant, VSV infection was reduced

about 40% whereas SFV infection was reduced about 60% as compared to cells

over-expressing the dynamin-wt construct (Fig. 9A and B and Table 1).

Since over-expression of the dynamin-2-K44A is required for a clear inhibition of

CME, and this level of over-expression affects cell viability, we also applied

dynasore, an inhibitor that specifically inhibits the GTPase activity of dynamin

and thus blocks endocytosis of transferrin (157). It has no effect on vaccinia virus

(VV) infection of HeLa cells, which we have shown to enter through a dynamin-

2-independent macropinocytic pathway (174). We pre-incubated HeLa cells with

dynasore for 15 min and subsequently added rVSV or VV to the samples for 4h

before fixation and infection scoring by FACS. No cell toxicity was observed. The


inhibitor caused almost a 10-fold drop in infectivity indicating that the majority

of VSV particles depend on dynamin-2 for infectious entry (Fig. 9C). This is

consistent with what has been shown by our group for the clathrin-mediated

entry of SFV (T. Heger, unpublished data). Vaccinia virus was not affected by

dynasore (Fig. 9C and Table 1). We thus conclude that VSV infection of HeLa cell

is dynamin-2 dependent.

Figure 9. VSV inf ection is dynami n-2 dependent. A. HeLa cells were transfected with dynamin-2-wt-EGFP (black bars) or the dominant negative dynamin-2-K44A-EGFP (grey bars) and 12 hours post-transfection, cells were infected with wtVSV or SFV. Infection was scored by eye using a confocal microscope. Over 100 transfected cells were counted. B. Examples of dynamin-2 expressing cells and VSV or SFV infection. Quantification is shown in A. Experiments were performed by Lea Amato. C. HeLa cells were infected with VSV and vaccinia virus (VV) in the presence of indicated concentrations of dynasore. Infection was detected by FACS and normalized to infection of untreated cells. Error bars indicate standard deviation of 3 experiments.


4.4.2 The classical multimeric adaptor protein complex AP2 is not involved in VSV infection

As discussed above, the clathrin-mediated pathway makes use of a variety of

distinct adaptor proteins. The adaptor protein 2 (AP2), originally thought to be

essential for all types of clathrin-mediatated endocytosis, has been shown to be

important for the internalization of transferrin but it is not required for the

endocytosis of epidermal growth factor receptor (EGFR) or low-density

lipoprotein receptor (LDLR) (37, 196). Since nothing was known about the

adaptor requirements of VSV we analyzed the involvement of AP2 in VSV

infection by siRNA mediated knockdown of AP2 in HeLa cells using previously

validated oligo-nucleotides (102, 196). We used two siRNAs, here called AP2-1

and AP2-2) against the subunit of the multimeric adaptor protein complex as

well as a proven performance oligonucleotide against the μ subunit (AP2-3). As

in the case of CHC silencing, a double transfection was performed with a 48h

interval. Western blot analysis using actin as a loading control showed that

knockdown of the -subunit was 90% with AP2-1, 92% with AP2-2 and 70% with

AP2-3 (Fig. 10A, upper panel) as compared to AP2 levels in samples transfected

with AllStars Negative control siRNA. Analysis of the AP2μ levels sowed that

AP2-1 siRNA only resulted in 26% reduction of AP2μ levels while for the other

two oligonucleotides, the AP2μ level was only 10% of what was seen for the

control cells (Fig. 10A, lower panel). Our results are in accordance with previously

published observations that knockdown of one subunit of AP2 results in down-

regulation of other subunits of the complex (196). The transfected cells were

then infected with rVSV at a MOI of 0.5 for 4h, and as before, the cells were

pulsed with AF594 labeled transferrin for 15 min followed by a 10 min chase

before fixation. Infection was scored by FACS, and the results were confirmed

with immuno-fluorescence using a confocal microscope. Unlike CHC, AP2 was

clearly not required for VSV infection. FACS analysis of the samples showed no

reduction and rather an increase in the number of infected cells upon AP2 or μ

knockdown for all three oligonucleotides (Fig. 10B). This effect was confirmed by

looking at immuno-fluorescence samples (Fig. 10C). One explanation for the

increased infection could be that by inhibiting the formation of AP2 containing

CCPs we boosted the AP2-independent pathway(s) for internalization.


Figure 10. VSV infectio n i s AP 2 i ndependent. HeLa cells were transfected with siRNAs against AP2 (AP2-1 and AP2-2) or AP2μ (AP2-3). A. Quantification of AP2 (upper panel) and AP2μ (lower panel) protein levels in siRNA treated cells by western blot. Results are presented as percentage of AP2 levels normalized to AP2 levels in control cells treated with AllStars Negative siRNA and the level of actin as a loading control. B. Cells treated with AP2-1, and 3 were infected by rVSV, the infection was scored by FACS and normalized to infection levels of AllStars Negative treated cells. Error-bars represent standard deviation between 3 experiments. C. Cells treated with siRNA against AP2 (AP2-1, 2 and 3) were infected with rVSV for 4h. AF594 labeled transferrin was added to the samples for 15 min, 25 min prior to fixation. AP2 and AP2μ was detected using a mouse anti-AP2 or AP2μ antibody and a secondary antibody labeled with AF647. Infection was detected by GFP expression upon replication of the rVSV.


4.4.3 The role of other adaptors in VSV infection

Eps15 is an adaptor protein with a well-established role in clahtrin-mediated

endocytosis. It is important for the internalization of various types of cargo such

as tfn, EGF (13, 27, 316) and SFV (326). We transfected HeLa cells with a wild type

or a dominant negative (DN) form of GFP tagged Eps15. The transfected cells

were then infected at an MOI of 0.5 with rVSV or SFV as a positive control.

Infection was allowed to proceed for 4h before fixation and analysis. Infection

was scored using a confocal microscope, counting over 100 cells per construct.

For both viruses, significantly fewer cells expressing the dominant negative

form of Eps15 were infected as compared to cells expressing the wild-type form

of the adaptor protein (Fig. 11A and B and Table 1). Eps15 was clearly a cellular

factor required for infection by both viruses.

Another factor, adaptor protein 180 (AP180), has been shown to be important

for the endocytosis of tfn and EGF (312) as well as affecting the size of

endocytic vesicles (181, 307, 349). VSV is a relatively large virus ( 180x80 nm)

that theoretically would not fit into a typical clathrin-coated vesicle with a

diameter of 80-100nm. Using EM, we were however able to see two virus

particles entering the cell together in one clathrin-coated vesicle (Fig.6C and H).

It thus seems like the virus can modulate the size of the coated pit and vesicle.

We therefore found it interesting to see weather inhibition of AP180 function

would affect VSV infection of cells. We transfected HeLa cells with a full length,

GFP tagged construct of AP180, using a GFP vector as a negative control. The

transfected cells were then infected with an MOI of 0.5 for 4h and AF594

labeled tfn was added 30 minutes prior to fixation. Infection and tfn uptake was

monitored in fluorescent samples using a confocal microscope. Infection

increased (Fig. 12A and B), while tfn uptake was reduced (Fig. 12B).

As the classical adaptor protein complex AP2 does not seem to play a role in VSV

infection, we reasoned that the virus might make use of other adaptor

protein(s). Disabled 2 (Dab2) is an adaptor protein that, in addition to

PtdIns(4,5)P2 and clathrin binding domains, has a binding site for the


Figure 11. VSV inf ection is Eps15 dependent. A. HeLa cells were transfected with Eps15-wt-GFP (black bars) or a dominant negative GFP tagged Eps15 construct (grey bars) and 12h post-transfection, cells were infected with wtVSV or SFV. Infection was scored by eye using a confocal microscope. Over 100 transfected cells were counted. B. Examples of Eps15 expressing cells and VSV or SFV infection. Quantification is shown in A. Experiments were performed by Lea Amato.


Figure 12. AP180 i s involv ed i n VSV inf ection. A. HeLa cells were transfected with a GFP or AP180-GFP constructs and at 12h post-transfection, cells were infected with wtVSV. Infection was scored by eye using a confocal microscope. Over 100 transfected cells were counted. B. Examples of GFP or AP180-GFP expressing cells and VSV infection. Quantification is shown in A. Experiments were performed by Lea Amato.

internalization sequence FxNPxY of LDLR (189, 195). It has recently been shown

to support endocytosis of LDLR independently of AP2 (166). We used a Dab2 -/-

MEFs that were derived from a Dab2 fl/- cell line where the conditional allele (fl)

was excised by the cre recombinase. To verify the reduced ability of the Dab2 -/-

cells to internalize LDL, we compared DiI-labeled LDL uptake between the two

cell lines by immuno-fluorescence. After ligand binding to the cells on ice for

one hour, the temperature was shifted to 37°C for 8 minutes, allowing ligand

internalization before fixation. LDL uptake was clearly decreased in the Dab2 -/-

cells as compared to the control cells (Fig. 13A).


We then subjected the cells to rVSV at a MOI of 1, 10 and 100 for 4h and scored

for infection using FACS. There was no significant difference in infection index

between the two cell lines (Fig. 13B, infection). Infection is scored by detecting

replication of viral proteins and is thus an indicator of the productivity of the

whole pathway; binding, endocytosis, trafficking, escape from the endosomal

compartments, un-coating and replication. It was thus possible that e.g. an

endocytic time delay would not be detected at the level of viral protein

replication. We therefore looked more specifically at VSV endocytosis in regard

to Dab2 status. For that we used 35S labeled VSV that was bound to the cells at 4

°C for 1h. Samples were subsequently shifted to a 37 °C incubator to allow

internalization of the virus for 10 min. Following internalization, any bound,

non-internalized virus was removed by proteinase K treatment prior to analysis

with a scintillation counter. Again, we did not see a significant difference

between the cell lines although the trend indicated an accelerated virus uptake

in cells lacking Dab2 rather than a delay or inhibition (Fig. 13B, entry). We

concluded that VSV does not need Dab2 for entry or infection.

In summary, we could conclude that of the various clathrin adaptors tested,

only Eps15 was found to be essential for VSV infection.

Figure 13. Da b2 i s not i nvolved in VSV inf ection.

A. The uptake of DiI-LDL in Dab2 knockout cells (Dab2 -/-) was compared to the Dab2 wild-type cells (Dab2 fl/-). Labeled LDL was added to the two cell lines and let internalize for 10 min before fixation. The LDL uptake of Dab2 -/- cells was reduced as compared to the Dab2 fl/- cells. B. Dab2 fl/- (grey bars) and Dab2 -/- (black bars) were infected with rVSV for 3 or 5h and subsequently scored for infection by FACS (infection). Cells lacking Dab2 were just as well infected by VSV as their wild-type counterparts. Both cell lines were subjected to 35S labeled VSV and entry was scored by scintillation counter (entry). Like for infection, entry was not reduced in the absence of Dab2, rather increased.


4.5 VSV INTERACTION WITH THE ENDOCYTIC MASCHINERY

4.5.1 Targeting of VSV to CCPs

Two mechanisms have been described for the targeting of receptor-bound

cargo to CCPs; either the cargo moves along the plasma membrane and

accumulates in pre-existing pits (266, 280) or the clathrin coat is selectively

assembled where the cargo is localized. To investigate which of the two CCP

targeting mechanisms is used by VSV, we labeled purified wild-type virus with

fluorescent dyes as described above (AF488, AF594, or AF647). To be able to

visualize the clathrin-coat we either used HeLa, transiently transfected with

XFP-tagged clathrin light chain (CLC), or Vero cells stably expressing CLC-EGFP.

In our initial experiments, labeled virus suspended in buffer optimal for binding

and internalization was added to cells on a coverslip in a live-cell-imaging ring,

and video recordings were performed at 37°C. Total internal reflection

fluorescence microscopy (TIRFM) was used to observe the dynamics of VSV

particles and clathrin-mRFP in the plasma membrane facing the coverslip.

We could see a few viral particles entering the space between the cell and the

cover slip. Some of them bound to the cell and moved along the plasma

membrane laterally until trapped in fixed, pre-existing clusters of clathrin-mRFP

(Fig. 14A, B and C). We could also observe cases in which clathrin gradually

accumulated under immobile viruses. However, the small number of viruses

entering the space under the cell limited these studies. The reason was no

doubt the large size of VSV particles and the close apposition of the plasma

membrane to the coverslip.

To circumvent the problem, we prepared coverslips by growing cells to

confluency and then removing them using EDTA. This way, the extracellular

matrix (ECM) produced by the cells remained on the coverslip (see materials and

methods for details). Fluorescent viruses were then bound to the ECM-coated

cover slip. When clathrin-XFP expressing cells were added on top of the virus,


they could be seen to spread rapidly due to the ECM-coating, and in so doing

they covered the virus particles. This allowed us to efficiently use TIRFM to

record interactions between the virus and CLC-XFP. However, the majority of

virus particles was immobile under these conditions and could not undergo

normal endocytosis.

Using the ImageJ program to quantify co-localization of the two fluorescent

labels, we found that of 88 virus particle localized under spreading cells, 54

(61%) associated with CLC-XFP at some time-point during the 200 or 400 sec

recordings. Of these viruses, 15 (28%) were already associated with CLC-XFP

when the recordings started, 25 (46%) induced accumulation of clathrin, and 17

(31%) were associated with clathrin but lost their co-localization either because

they moved out of the clathrin containing region or the clathrin dissociated. In

some cases, the clathrin appeared and disappeared in cycles of coat assembly

and disassembly. Although the majority of observed VSV particles remained

fixed in place, a minority (6 in total) became mobile and disappeared from the

TIRF field together with the CLC-XFP suggesting that they were internalized in

clathrin-coated vesicles. Whether the viruses that failed to associate with

clathrin were associated with alternative structures could not be determined;

some of them may simply have failed to contact the plasma membrane of the

cell.


In figures 14 and 15, examples of these phenomena in the form of selected

digital images (A), kymographs (B), and intensity graphs in time-series (C) is

shown. In figure 15A, an AF647-labeled virus is stationary at an initial location

and accumulates CLC-EGFP on the cytoplasmic leaflet of the plasma membrane

(location 1, both virus and clathrin are indicated by a closed arrow). The virus

then moves away form the CCP but within the plane of the plasma membrane,

gets confined again, and induces a second wave of CLC-EGFP assembly (location

2, both virus and clathrin are indicated by an open arrow). Same events are

shown by kymographs in Fig. 15B. Closed arrows indicate appearance and

disappearance of both virus and clathrin at location 1 and open arrows at

location 2 (Fig. 15A and B). Between confinement at location 1 and 2 the virus is

moving in the plane of the plasma membrane without any visible clathrin

association (indicated by a horizontal bar in the VSV-AF647 kymograph).

The mean recruitment time of CLC at a forming CCP, from its initial appearance

until the fluorescence intensity had reached a stable plateau, was 112 sec ± 45

sec in the presence of a virus particle. In contrast, without any associated virus,

the mean rate of CCP formation (Fig. 15A (grey arrow)) was only 53 ± 17 sec

Figure 14. VSV ca n be targeted i nto pre-for med CCPs . AF488 labeled VSV was added to CLC-mRFP expressing HeLa cells and live cell imaging was performed by TIRFM. (A) Time-series (B) kymographs and (C) intensity graphs show how the labeled VSV appears in the TIRF-field from the surrounding medial and co-localizes with a stable CCP.


Figure 15. VSV ca n induc e t he formatio n of CCPs . AF647 labeled VSV and CLC-EGFP expressing HeLa cells were subjected to live cell imaging by TIRFM. (A) Time-series show a confined viral particle (closed arrow in VSV-AF647) and the recruitment of clathrin underneath it (closed arrow in CLC-EGFP w/VSV, 52nd sec). The virus then detaches and re-locates (open arrow in VSV-AF647, 131rst sec) and shortly thereafter, the pit collapses (CLC-EGFP w/VSV, 152nd-163rd sec). Upon re-confinement of the virus (open arrow in VSV-AF647, 131st sec) a new clathrin pit appears under the viral particle (open arrow CLC-EGFP w/VSV in 391rst sec). Bottom panel shows time-series of CCP without virus association (grey arrow in CLC-EGFP wo/VSV at 95th sec) (B) kymographs of the same events as in (A). Closed arrows indicate appearance and disappearance of virus and CLC signal at the initial location of confinement and open arrows parallel events at the second location. The bar between the closed arrow (indicating disappearance of the virus from the first location) and the open arrow (indicating its appearance at the second one) depicts the time-frame of viral movement within the plane of the plasma membrane (C) intensity graphs show the change in intensity over time for the virus particle (blue squares), its associated clathrin (green squares) and the virus independent CCP (grey triangles).

(example in Fig. 15A and B (bottom panels) and intensity graph in Fig. 15C), a

rate consistent with previously published data for dynamic CCPs (75) as well as

for recruitment of clathrin to small cargo such as LDL and Tfn (60). The longer

recruitment time may relate to a larger size of the CCP and a higher number of

clathrin triskelions required as previously suggested for other large cargo (60).


Alternatively, the prolonged association with clathrin could reflect the fact that

the virus is immobilized and the CCP cannot pinch off.

4.5.2 Dynamics of VSV interaction with dynamin-2 and AP2 at the plasma membrane

When dynamin-2-EGFP expressing HeLa cells were plated on top of AF594-

labeled virus, the majority (80%) of viral particles (n=59) associated with

dynamin-2, and of those, 36% were seen to recruit the GTPase during the

recordings. Again, viruses were sometimes seen to induce more than one cycle

of association (Fig. 8A, B and C). The time-series in Fig. 16A, show a confined

VSV-AF594 particle (closed arrow) recruiting dynamin-2 to the plasma

membrane (open arrow at 68 sec). Dynamin-2 dissociates from the plasma

membrane (open arrow at 114 sec) but is recruited a second time (open arrows

at 162 to 199). The average recruitment time of the GTPase was 55±17 sec (n=15),

hence shorter than the recruitment time of CLC. This was expected considering

the temporary role of dynamin-2 (at a rather late step) in vesicle formation. The

average recruitment time of randomly selected dynamin-2 spots at the plasma

membrane not associated with VSV was 25±9 sec (n=10), i.e. about half as long

as in the presence of the virus (Fig. 16A, grey arrow and B (bottom panels) and

intensity graph in C). Again, the difference could be due to the immobilized

state of the viral particles on the coverslip, or simply to the large size of vesicles

forming around the virus. Unfortunately we were limited to two fluorophores,

which prevented us form following VSV, clathrin, and dynamin-2 at the same

time.

We also visualized the association of AP-2 -EGFP with VSV using TIRFM.

Although this adaptor has no functional role in infection (see above), we could

see it associate with 38% of cell-associated, immobilized viruses (n=344). Most

of these viruses were associated with the adaptor protein complex already from

the start of the recordings with only 12% of them recruiting AP-2. In these cases,

recruitment occurred within 136 ± 66 sec, which was longer than for VSV-

induced recruitment of both CLC and dynamin-2. In many cases, AP-2

recruitment (Fig. 17A (open arrows)) to a confined virus particle (Fig. 17A (closed


arrows)) was characterized by a gradual increase in intensity over a long period

of time (Fig. 17A, B and C). Since AP-2 is not needed for infection, the observed

association with the VSV may reflect trapping of AP-2 in non-productive

clathrin-coat structures. Given the rapid internalization of VSV (Fig. 3A and B),

the association with AP-2 was too slow to be involved in endocytosis.

Figure 16. D ynami n i s r ecruit ed to plasma m em bra ne bo und VSV. AF594 labeled VSV and dynamin-2-EGFP expressing HeLa cells were subjected to live cell imaging by TIRFM. A. Time-series sow a confined viral particle (closed arrow in VSV-AF594) and the recruitment of dynamin underneath it (open arrow in dynamin-2-EGFP w/VSV, 68th sec). Over time, dynamin signal becomes weaker (dynamin-2-EGFP w/VSV, 114th sec) but then gains again in strength (open arrow in dynamin-2-EGFP w/VSV, 162nd sec). Bottom panel shows time-series of plasma-membrane recruitment of dynamin independent of VSV (grey arrow in dynamin-2-EGFP wo/VSV, 114th sec). B. Kymographs of the same events as described above. C. Intensity graphs show the change in intensity over time for the virus particle (red squares), its associated dynamin (green squares) and the virus independent plasma-membrane recruitment of dynamin (grey triangles).


F igure 17. AP 2 co-localizes wit h VSV at the plasma mem bra ne but is proba bl y not recruit ed by the vi rus. AF594 labeled VSV and AP2 -EGFP expressing HeLa cells were subjected to live cell imaging by TIRFM. A. Time-series of plasma membrane bound virus (closed arrow in VSV-AF594) and its co-localization with AP2 (open arrows in AP2 -EGFP w/VSV from 63rd sec). The lowest panel shows the recruitment of AP2 to the plasma membrane independent of VSV (grey arrow in AP2 -EGFP wo/VSV at 63rd sec). B. Kymographs of the same events as shown in the time-series. C. Intensity graphs show the change in intensity over time for the virus particle (red squares), the co-localizing AP2 (green squares) as well as the virus independent AP2 (grey triangles) at the plasma membrane.

4.6 THE ROLE OF PHOSPHOLIPIDS IN VSV INFECTION

Reversible phosphorylation of proteins as well as lipids plays an important

regulatory role in endocytosis (38-40, 68, 224). Phosphatidylinositol-4,5-di-


phosphate (PtdIns(4,5)P2) is needed at the plasma membrane and the level of

phosphatidylinositol-3-phosphate (PtdIns(3)P) is important for the function of

endosomes (250, 296, 308, 309). Since the infectious route of VSV into the cell

depends on endocytosis, correcte lipid composition of the plasma membrane

and the early endocytic compartments is important for efficient entry and

trafficking of the viral particles.

4.6.1 PtdIns(3)P-kinases and MTMR2 phosphatase

We applied the irreversible PtdIns(3)P-kinase inhibitor wortmannin to cells

during VSV infection and observed a moderate, dose-dependent reduction of

the infection index as scored by FACS. In the presence of 10 μM of the fungal

toxin, an inhibition of 40% was seen as compared to infection of untreated cells

(Table 1). This effect might at least in part result from reduced homotypic fusion

and trafficking through endosomal compartments.

The myotubularin and myotubularin related proteins (MTM/R) belong to a

family of enzymatically active or inactive, dual-specific lipid/tyrosine

phosphatases with specificity towards PtdIns(3)P and PtdIns(3,5)P2. In addition

to its role in reversible phosphorylation of those PtdIns, the MTM(R)s also show

binding affinity towards the same PtdIns through their PH-GRAM

(Glucosyltransferase, Rab like GTPase activators and myotubularin) domain (16,

154, 250, 268). The affinity of MTM(R)s towards these species of PtdIns, enriched

in early endosomes, endosomal carrier vesicles (ECV), late endosomes and

lysosomes may thus play a role in the regulation of endocytic vesicle trafficking

and cargo sorting. As VSV is dependent on the early endocytic compartments

and possibly also to some extent on the ECV (141) for trafficking and sorting, we

investigated the possible role of MTMR2 in VSV infection.


Figure 18 . The I nvolvement of MT MR2 i n VSV inf ection. A. HeLa cells were transfected with GFP tagged wild-type MTMR2 or GFP-vector and 12h later infected with rVSV. The level of expression was scored for and infection of all MTMR2 expressing cells or only strongly expressing cells was compared to what was seen for GFP expressing cells. Error bars indicate standard deviation of 3 experiments. B. HEK293 FlipIn cells, stably expressing MTMR2-wt or the phosphatase dead mutant, MTRM2 C417 were infected with rVSV with an MOI of 0.1, 5 and 10. Infection was scored by FACS and compared to infection rates in the HEK293 FlipIn control cells. Error bars indicate standard deviation of 3 experiments. C. Confocal microscopy of VSV-AF647 entering HeLa cells transfected with Rab5-GFP. HeLa cells were transfected with Rab5-GFP (green) 12h prior to experimental start. AF647 labeled VSV (blue) was bound to the cells for 1h on ice and subsequently shifted to a 37°C incubator for indicated time periods before fixation.

Immuno-staining was performed using a polyclonal anti-MTMR2 antibody and an AF594 labeled secondary antibody (red). Limited co-localization of MTMR2 with the virus containing Rab5 positive structures was seen at 2, 5 and 15 min post warming (arrows).


We first transfected HeLa cells with MTMR2-wt-GFP construct and infected

them with rVSV. Upon FACS analysis, no significant difference was seen

between infection of the control cells expressing a GFP-vector or the cells

expressing MTMR2-wt-GFP. However, when only strongly over-expressing cells

were considered, a reduction of 40% in infection was seen in comparison to

control cells (Fig. 18A).

We then made use of Hek293 cells, stably over-expressing either wt MTMR2 or

the phosphatase dead mutant MTMR2 S417C. We used rVSV at an MOI of 0.5 or

0.75 and a FlipIn cell line as a control. Less infection was seen for both MTMR2

over-expressing cell lines for all concentrations of virus as compared to the

FlipIn cells (Fig. 18B). Considering that the mutant enzyme also inhibited

infection to some extent, it seems likely that the phosphatase activity of

MTMR2 alone is not responsible for the effect but rather a combination of

altered PtdIns levels on endocytic compartments as well as partial masking of

the phospholipids resulting in reduced association effector proteins such as

EEA1, PIKfyve or Hrs.

We also looked at the localization of endogenous MTMR2 in HeLa cells upon

binding and internalization of VSV at different time points. A limited co-

localization between MTMR2, the early endosomal marker Rab5 and VSV was

seen upon 5 to 15 min internalization into HeLa cells (Fig. 18C).

From our results we concluded that MTMR2 might have an influence on VSV

trafficking in endosomal compartmens by affecting PtdIns levels, probably

through de-phosphorylation as well as masking.

4.7 FURTHER CHARACTERIZATION OF THE ENTRY PATHWAY OF VSV

To characterize the VSV entry pathway(s) further, we tested a variety of

recombinant cell lines as well as pharmacological inhibitors that have been

shown to affect virus entry and/or endocytic pathways.


4.7.1 VSV receptor

Cellular factors involved in the initial attachment and binding of VSV to the

plasma membrane are still unknown (34, 271). The host range of VSV is very

broad and thus it is likely that initial contact of the virus with the host cell is

mediated though ubiquitous molecules expressed by cells from variety of

species. Cell surface carbohydrates such as sialic acid-containing groups and

heparan sulfate are known to serve as attachment factors for some viruses (72,

126, 132, 207, 341). These molecules are also ubiquitously expressed and could

thus be candidates for VSV attachment to its host cell membrane.

Figure 19. T he effect of ganglios ides a nd hepar ane sul phates on VSV bindi ng and infection. A. CHO and 3T6 cells were infected with MOIs ranging from 10 to 500 and the infection rates were compared to what was seen in BHK cells as scored by FACS. Mock: treated, uninfected control cells. B. rVSV at a MOI of 500 (as calculated for BHK cells) was bound to GM95 cells and control cells, 3T6, at 4°C for 1h. Subsequently, unbound virus was removed at 4°C to prevent internalization of any loosely or unbound viruses, and samples shifted to 37°C for 4h. Comparison of infection in GM95 cells (grey bars) and 3T6 (black bars) as scored by FACS showed a reduced infection of the ganglioside deficient cells. C. rVSV at a MOI of 50, 100 and 500 (as calculated for BHK cells) was bound to Pgs A745 cells and their wild-type control, CHO cells at 4°C for 1h. Subsequently, unbound virus was removed at 4°C to prevent internalization of any loosely or unbound viruses and samples shifted to 37°C for 4h. No significant difference was seen for infection rates between Pgs A745 cells (grey bars) and CHO (black bars) at any given MOI as scored by FACS.

To assess whether gangliosides or heparan-sulfate could be the molecules

mediating VSV attachment to the host cell we made use of the commercially

available cell lines GM95 and Pgs A745. GM95 is a murine cell line deficient in

gangliosides and Pgs A745 is a hamster cell line deficient in xylosyltransferase,

which catalyzes the first sugar transfer step in GAG biosynthesis. The total

sulfated GAGs on Pgs A 745 is thus less than 6% of what is seen for the CHO

wild type cell line (64). As control cells for the experiments we used the murine

cell line 3T6 and wt CHO cells respectively.


As we had noticed a cell-specific difference in the infection capability of VSV in

previous experiment, we started out by looking at infection rates of the four

different cell lines in comparison with BHK cells. For this we added virus to the

cells at 37°C for 1h and then removed inoculum, and continued incubation for

additional 3h. We saw over ten fold less infection in the four cell lines tested

than in BHK cells (Fig. 19A).

Virus was then bound to confluent monolayers of all four cell lines for 1h at 4°C

and subsequently, unbound virus was removed. Samples were then washed and

shifted to 37°C for 4h prior to fixation and scoring of infection by FACS. Using

this approach, only the viruses that were able to bind the cells during this 1h in

the cold could be internalized and infect the cells while unbound or loosely

attached viruses were removed. We observed that after this procedure,

infection was decreased in GM95 cells as compared to the 3T6 cells (Fig. 19B)

indicating a possible involvement of gangliosides in VSV attachment to the cell

surface. However, it must be taken into account that infection rates were quite

low in our experiments using the murine cell lines. The binding of VSV to cells is

a relatively inefficient process, only a small part of the added virus binds to the

cells and the binding does not reach a plateau like shown for other viruses such

as SFV (164, 186). By allowing the virus to bind and internalize at 37°C in the

virus titration experiment (Fig. 19A) we maximized the number of viruses that

were able to bind and infect the cells. In subsequent experiments, where the

binding efficiency of the virus to the cell was of interest, we limited the number

of viruses that were able to infect the cells to the number of viruses that were

already bound after the 1h incubation on ice. For both murine and hamster cells

we thus saw a drop in infection index between the two approaches, from 60%

with a MOI of 500 for both cell lines to 3% and 15% respectively. The binding

capability of the virus to the murine cells is even lower that seen for the

hamster cells and thus in general very low.

As for the PGS A745 cells, no difference was seen in the affinity of the virus to

those as compared to the CHO cells (Fig. 19C) indicating an insignificant role of

heparan-sulphates in VSV binding or attachment to host cells.


4.7.2 Pharmacological inhibitors

4.7.2.1 COPI in VSV infection

It has been suggested that the vesicle coatomer protein (COPI) complex, that

has a well know role in the transport between the Golgi complex and

endoplasmic reticulum (ER) (212-215, 229), is also functionally associated with

endosomes and might play a role in endosomal sorting (47, 336). The membrane

association of COPI is regulated by the small GTPases known as ADP

ribosylation factors (ARFs) (311). Inhibition of ARF nucleotide exchange by the

fungal metabolite brefeldin A (BFA) prevents the binding of coatomer to

membranes and thus the normal sorting and transport functions of the ER and

the Golgi complex (54, 98). We infected cells in the presence of BFA and saw

about 40% drop in infection index as compared to untreated cells (Table 1)

indicating a possible role of COPI on early endosomes during VSV trafficking

and/or sorting. This is consistent with previously published results where cells

expressing defective COPI complexes were not able to support VSV infection

(47).

4.7.2.2 The role of actin cytoskeleton and reversible phoshporylation in VSV entry and infect ion

Actin cytoskeleton and numerous kinases have been implicated both in clathrin-

mediated endocytosis and in VSV infection (38-40, 68, 71, 84, 176, 224). We

applied inhibitors interfering with the actin cytoskeleton (jasplakinolide and

latrunculin A) as well as kinase and phosphatase inhibitors (staurosporin, BIM-1

and vanadate) to monitor their affect on VSV infection. The presence of all five

drugs inhibited VSV infection although to a different extent (Fig. 20A, grey

bars). As the readout in infection assays is the replication of viral proteins, it

means that reduced infection could be caused by inhibition of endocytosis,

trafficking, penetration, transcription or replication. To be able to distinguish

between the effect of an inhibitor on early endocytic steps versus effects on

later steps of the viral infection cycle, we performed an endocytosis assay using 35S labeled virus. In addition, we used an assay were we could by-pass the CME

and trafficking through endocytic compartments during VSV entry by inducing


acid-activated fusion of the viral envelope with the plasma membrane. Such

fusion results in the direct release of the viral capsid into the cytosol (333).

We applied the same inhibitors as used in the infection assay but measured

endocytosis instead of infection (Fig. 20A, black bars). Alternatively, we induced

fusion of the virus with the cell membrane, by-passed CME and scored for

infection 4h later (Fig. 20A, white bars and Table 1).

Latrunculin A is a toxin from the sponge Negombata magnifica, commonly used

to sequester actin monomers and thus inhibit actin polymerization (344). A very

moderate effect was seen on VSV infection in the presence of latrunculin A

(20% reduction) while a more prominent effect (40% reduction) was seen in the

endocytosis assay (Fig. 20A, grey and black bars). Interestingly, when the viruses

were fused at the plasma membrane, by-passing all steps of endocytosis, an

increase in infection was apparent in the presence of the drug (Fig. 20A, white

bar). This is consistent with reports showing that CME is dependent on the actin

cytoskeleton (38-40, 68, 71, 84, 176, 224). For a virus that enters directly through

the plasma membrane the cortical actin is a hinderness to reach deep into the

cytoplasm where replication takes place. Upon actin de-polymerization this

hinderness is reduced resulting in increased infection (160).

Similar results were seen for the F-actin stabilizing drug jasplakinolide (which

causes major changes in actin localization in cells (23)) although effects on

infection and endocytosis were more prominent than seen for latrunculin A and

the increase in infection upon endocytic by-pass was less prominent (Fig. 20A,

white bar). The tyrosine-phosphatase inhibitor vanadate was shown to inhibit

VSV entry strongly (Fig. 20A, black bar) while a less prominent effect was seen

on infection and almost no effect on post-endocytic steps (Fig.20, grey and

white bars respectively). It is apparent that the reversible tyrosine-

phosphorylation is required for early steps of VSV infection.


Figure 2o. The effect of phar macological i nhi bit ors o n VSV entr y a nd i nfection. A. Entry, infection and CME by-pass were assayed (described in materials and methods) in the presence of jasplakinolide, latrunculin A, vanadate, staurosporin and BIM-1 and the results are presented as normalized infection/entry compared to untreated controls. The effect of inhibitors on endocytosis is represented by the black bars, on infection by the grey bars and fusion at the plasma membrane, by-passing any endocytic steps, with white bars. B. Infection assay using rVSV in HeLa cells was performed in the presence of different concentrations of three, isoform specific PKC inhibitors; CPG, calphostin and rottlerin. Infection was scored by FACS and the results are shown as normalized percentage of cells infected as compared to cells infected in the absence of inhibitor. Error bar represent standard deviation between 3 experiments.

4.7.2.3 Protein kinase C in VSV entry and infect ion

Staurosporin is a broad-range serine/threonine kinase inhibitor affecting

protein kinase A, C, and G (PKA, PKC and PKG). When cells were subjected to


infection assay in the presence of staurosporin, infection dropped by 75% (Fig.

21, grey bar and Table 1). We however noted that the drug affected cell viability.

Cell viability was less compromised in the short period needed for the

endocytosis assay that resulted in a reduction of 35% in virus entry. However,

when viral fusion was induced at the plasma membrane in the presence of the

drug, a 60% reduction was seen in comparison to infection in untreated cells.

This difference indicates that although some of the target kinases of

staurosporin are involved in the early steps of VSV endocytosis, part of the

effect seen for the drug on infection may involve later steps of the infectious

cycle such as replication.

Table 1

Inhi bitor /domi nant negativ e co nstr ucts Concentration

used Decrease in

infection

Dynamin-2-wt-GFP / Dynamin-2-K44A-GFP constructs 40%

Eps15-wt-GFP / Eps15 95/295-GFP constructs 80%

Arf6-wt-GFP / Arf6-N27T constructs 00%

AP180-GFP construct 40% increase

MTMR2-his-wt / MTMR2-S417C constructs 40-80%

Ammonium chloride (NH4Cl) 10 and 20 mM >95%

Chlorpromazine 17, 70,140 and 280 μM 20-95%

Dynasore 20, 80 and 120 μM 25-90%

Progesteron/nystatin 25/10 μM/ml 30%

Brefeldin A 1 μM 40%

Nocodazole 1 μM 10-20%

Latrunculin 1 μM 15%

Jasplakinolide 1 μM 60%

Wortmannin 0.1, 1 and 100 μM 0-40%

Genistein 100 μM 40%

Vanadate 1 mM 50%

Staurosporin 1 μM 75%

BIM-1 1 μM 30%

PMA 1 μM 30%

Calphostin C 0.1 and 1 μM 40-90%

Rottlerin 0.1, 1 and 10μM 90-95%

CPG 2 and 20 μM 20-90%

That staurosporin has been reported to cause apoptosis as a secondary effect

raised the importance of testing more specific protein kinase inhibitors. PKC has

been reported to play a role in various endocytic pathways (7, 40, 290). We


therefore applied an inihibitor, bim-1 that is relatively specific for PKC isoform.

We found a similar effect of the drug with all three approaches (Fig. 20A and

Table 1) indicating both endocytosis specific as unspecific effects on infection.

To take a closer look at the possible involvement of more PKC isoforms we

applied CPG53353, a general PKC inhibitor, the PKC -specific inhibitor calphostin

and the PKC II-specific inhibitor rottlerin. We saw strong (up to 90%), dose-

dependent inhibition with all three drugs (Fig. 20B and Table 1). The results

suggested that, in addition to the previously suggested PKC (40), VSV infection

in addition depends on PKC and PKC isoforms.

4.7.3 siRNA screen

The siRNA library used was designed in our lab (T. Heger) to address 33 factors

involved in various endocytic pathways. Two independent runs siRNA scilencing

of were performed, scoring infection in the siRNA treated cells. Results were

generally consistent between runs regarding relative cell number, the

transfection efficiencies as judged by cell toxicity in the EG5 transfected cells

and no effect on AllStar Negative siRNA treated cells. In cases where two oligos

per gene were used, the effect seen upon silencing was in most cases

comparable (e.g. SNX9, PKCs, RhoA, AP1, Rab5c).

Using this approach, we were able to confirm the involvement of a number of

factors in the CME of VSV. Like in above-mentioned CHC knockdown

experiments, a reduced infection upon CHC silencing using CHC3 and CHC4 was

observed (Fig. 22). The difference in level of inhibition could be due to cell

toxicity shown by CHC9 but could also be result of different efficiencies of

knockdown. Upon validation, they however both showed over 80% knockdown.

Results for the adaptor proteins AP2 and Dab2 were also in agreement with

what we expected from our previous results were a boost of infection was seen

for AP2-μ (AP2 mu) (Fig. 21) and no effect was seen for one of the Dab2 oligos

(Dab2_1) (Fig.22). The other Dab2 directed oligo (Dab2_2) (Fig. 22) however did

show an intriguing negative effect on infection, which we cannot explain

except possibly through off target effects, as these two siRNAs were not


validated.

As previously mentioned, Rab5 is important for VSV infection whereas Rab7 is

not. The silencing of the GTPases confirmed this, showing a decreased infection

upon knockdown of Rab5 isoforms A and C (2 siRNAs each) (Fig. 21) while

knockdown of Rab7 (1 siRNA) (Fig. 21) did not have any effect. As expected,

knockdown of Rab4 did not have any effect on VSV infection (Fig. 21).

Another interesting observation was the effect seen upon silencing of various

isoforms of PKC (Fig. 21 and 22). Knockdown of all isoforms tested (PKC , , ,

and ) resulted in a reduced infection, although to a different extent. Cells

treated with siRNA against PKC were not so much affected (Fig. 21) whereas a

stronger inhibition was scored in cells treated with siRNA against PKC (Fig. 21

and 22). The effect seen upon PKC silencing is in agreement with our above-

mentioned results using the PKC inhibitor, BIM-1. Furthermore, an even

stronger effect was seen upon PKC (Fig. 22) and (Fig. 21 and 22) silencing,

which also confirms the results for the PKC -specific inhibitor calphostin and

the PKC -specific inhibitor rottlerin (Fig. 20B and Table 1).

An interesting new candidate for cellular factors involved in VSV infection is

sorting nexin 9 (SNX9). Upon silencing, infection was strongly and reproducibly

inhibited with both oligos used without any significant cell-toxicity (Fig. 22).

SNX9 has been shown to recruit dynamin to the plasma membrane and

regulate its assembly at the neck of the forming vesicle. It might also coordinate

actin remodeling with membrane fission (287, 288, 343). Regarding the

important role of dynamin-2 in VSV infection, it is plausible that SNX9 might

also be involved.

Some of the siRNAs showed cell-toxicity as judged from the relative cell

number, indicating a possible off target effect. The effect of these siRNAs on

infection was thus not considered to be reliable data. In some cases, as for the

siRNA against caveolin-2 (Fig. 22, Caveolin2_1) the cell number was very variable

between the 16 pictures taken pro well and thus giving misleading and


unreliable results.

Our results had shown that dynamin-2 is essential for VSV infection. Upon

silencing of dynamin-2 the infection however was considerably increased (Fig.

21). These intriguing results could be explained during the validation process

where the siRNA against the GTPase did not result in any detectable decrease in

protein level. The effect on VSV can thus most likely be explained by off-target

effect. Same explanation was found to be valid for both caveolin-2 (Caveolin2_1

and Caveolin2_2) as well as one of the two caveolin-1 (Caveolin1_2) siRNAs. The

other siRNA against caveolin-1 (Caveolin1_1) did however result in lowered

protein levels in the cells upon transfection without any significant cell-toxicity

and also did not have any effect on VSV infection as expected (Fig. 22).

The siRNA screening approach is of great value for confirming involvement of

cellular factors in VSV infection and identification of additional interesting

candidates. It is reproducible and allows a large-scale analysis and is thus an

interesting tool for further analysis of cellular factors involved in infection.


5 DISCUSSION

In current study we investigated the initial interactions of VSV with host cells

(HeLa ATCC and BHK-21) and characterized its entry in regard to kinetics and

cellular factors required. We found that VSV is rapidly endocytosed, and that the

acid-activation of VSVG occurs within minutes of internalization. While we

cannot exclude the possibility that the virus can also use alternative pathways

the main endocytic pathway taken was clathrin-mediated and dependent on

dynamin-2. The classical adaptor protein complex AP2 was not required but

Eps15 was. The virus uses two mechanisms of entering clathrin-coated pits; it

can either become confined to preformed clathrin-coated membrane domains

or it recruits clathrin to its location of confinement. That clathrin recruitment

was slower than previously reported for small cargo such as transferrin or LDL,

is probably due to the large size of the coated pit required. Dynamin was

recruited to plasma membrane bound virus, but AP2, although in some cases

seen to co-localize with the virus, was recruited less frequently and more slowly

than both clathrin and dynamin.

5 .1 THE KINETICS OF VSV ENTRY, ACID-ACTIVATION AND DEGRADATION

VSV binding to the cell surface was quite inefficient and sensitive to external

factors such as pH (164, 186). Internalization of surface-bound virus was also

relatively inefficient with only 1/3 of virus particles internalizing. However, the

endocytic event was fast with the majority of the entering viral particles being

internalized within 6-7 min and half of them within the first 3 min. This was

faster that what has been described for both Semliki Forest and influenza virus

(97, 162), and is in line with what has been published for transferrin with a T of

2.5 min (234, 324). The acid-activation occurred immediately after

internalization, the first viral particles were found to be insensitive to NH4Cl-

induced fusion block already 2 min post-warming. This is consistent with the

EM observations that viruses were seldom found in endosomal compartments

as compared to the plasma membrane. When observed, internalized viral

particles were mainly in coated, partially coated, or small, relatively tight fitting


smooth vesicles, indicating their presence in primary endocytic vesicles and

early endosomes. At later time-points, fusion had most likely already taken

place and the bullet shaped capsid disassembled. This is in agreement with

what has been previously published for VSV where the G-protein and viral lipid

markers do move into late endosomes within 30-60 min (141). In addition no

accumulation of virus has been seen in endocytic compartments by EM (164).

Only upon internalization in the presence of NH4Cl were we able to see

accumulation of the virus in endocytic compartments due to the inability of the

viruses to fuse and penetrate into the cytosol. We find it likely that the viruses

are not only activated for fusion in early endosomes but that they also undergo

fusion with the limiting membrane, which leads to penetration into the cytosol.

The most efficient time-point for acid-activation was around 3 min post-

warming, which was faster than previously seen for Semliki Forest virus (96,

326). If the time-window between internalization and acid-activation was

artificially extended to 20 min or more, the fraction of viruses able to infect cells

was reduced, and if acid-activation was delayed for more than 1 hour, the

internalized virus lost almost all infectivity. This indicated that until about 10

min post-internalization, the majority of viruses were still fusion competent and

in fusion supportive compartments. Later they moved into endocytic

compartments where it was no longer able to penetrate into the cytosol upon

acidification and eventually ending up in lysosomes. This agreed with the

steady increase in VSVG degradation starting at 30-60 min post-infection.

Le Blanc et al have proposed that the acid-activation of VSV and its penetration

into the cytosol in BHK-21 cells occurs in two steps (141). They suggest that the

acid-activation takes place in early multi-vesicular endosomes at a pH above 5.5,

where the viral envelope fuses with internal vesicles. Once the multi-vesicular

endosome has matured into a late endosome, transfer of the capsid to the

cytosol involves back-fusion of the internal vesicles through the action of

cellular fusion machinery. Our results indicated that the acid-induced step

occurs 2-3 min after internalization in early endosomes, which do not have

internal vesicles. Such early fusion is consistent with the pH dependence of G-

protein activation, which occurs already at pH 6.2 (28, 334). Fusion in early


endosome is also in line with the Rab5 dependence and Rab7 independence of

VSV infection seen in current study and reported by Sieczkarski et al (291).

Although our data in HeLa ATCC cells is more consistent with direct fusion of

the VSV with the limiting membrane of an early endosome, we cannot exclude

that some of them use the two-step pathway proposed b Le Blanc et al.

5 .1 .1 Clathrin

That VSV has for many years been considered a prototypic cargo of clathrin-

mediated endocytosis is mainly based on EM-images such as those shown in

Fig. 6A to D (44, 164). More recent studies have confirmed the presence of VSV in

clathrin-coated structures, and a number of studies have focused on more

detailed analysis of molecular factors involved in various stages of VSV

endocytosis and infection, all consistent with CME (47, 141, 291, 310). However,

many aspects are still unclear regarding the mechanisms involved. Studies with

other viruses and bacterial toxins indicate that a ligand can be endocytosed by

more that a single pathway. Lymphocytic choriomenignitis mouse virus (LCMV)

and influenza both use clathrin-coated pits and clathrin- and caveolin-

independent pathways (165, 238, 292). In addition, it is becoming increasingly

clear that depending on the cargo the clathrin-mediated pathway varies in

respect to adaptor and accessory factor requirements.

In the present study, we addressed the cellular factors and activities involved in

early steps of VSV entry. Our results support the uptake of VSV via clathrin-

coated pits and vesicles. Numerous virus particles are seen associated with

electron dense coats by EM, and with CLC-XFP by light microscopy. The infection

process was efficiently inhibited by chlorpromazine, by silencing of Eps15, and

by the action of dynasore. Silencing of CHC using siRNA showed a partial

decrease in infectivity but was unfortunately inconclusive because the level of

CHC could not be reduced to the level that would efficiently inhibit the uptake

of transferrin. While there is no question about a major role of CME, we cannot

exclude alternative, parallel pathways. However, if such pathways exist they

would have to be similar to CME in being Eps15 and dynamin-2 dependent, lipid-

raft and Arf6 independent, rapid and targeted to acidic compartments. The


distinct comparison with SV40, which enters via caveolin/lipid-raft mediated

pathways and vaccinia virus, which enters via macropinocytosis showed that

VSV uses neither of these two pathways. In a direct comparison with SFV, which

is CME dependent, the VSV results were comparable.

5 .1 .2 Adaptors

Until recently, the adaptor-protein complex AP2 was considered to be one of the

core components of clathrin-based endocytic machinery (reviewed in (39, 252,

318)). It was therefore unexpected that cells depleted of AP2 would support VSV

infection as well as control cells. This result could of course be interpreted as

another piece of evidence that VSV is not entirely dependent on CME for

infection, but based on results from recent studies focusing on the role of AP2 in

the CME of other cargo this is not necessarily the case. AP2 was for some time

the only known and therefore the best studied adaptor protein involved in CME.

However, in last years an increasing number of other proteins that can

simultaneously bind to plasma membrane phospholipids, clathrin, and cargo

and based on that been classified as alternative adaptors (reviewed in (195, 217,

218, 252, 303, 317, 318)). Some of them interact with cargo together with AP2 (82,

93, 140), while others seem to be able to support endocytosis in the absence of

AP2 (189). Classical clathrin dependent cargo such as transferrin, LDL and EGF

have been shown to differ in their requirements for the classical adaptor

protein complex (37, 102, 196). While tfn internalization strictly depends on AP2,

LDL and EGF endocytosis occurs in the absence of the adaptor. The reason for

continued uptake of EGF could of course be based on a shift to its clathrin-

independent pathway (216, 293), but the CME of LDL is maintained by the

alternative adaptor Dab2 (166). It is thus clear that there are cargo-dependent

variations in the requirements for the basic clathrin-associated machinery.

From our results, it seems like VSV is not dependent upon the classical adaptor

protein complex in HeLa cells. We found that the alternative adaptors Eps15 as

well as AP180 are at least partly involved in VSV infection while the LDLR-

adaptor Dab2 is not. Ap180 has previously shown to be a size-regulating factor

of endocytic vesicles and in its absence, large and irregular vesicles are formed


(181, 307, 349). VSV is a large virus (80 x 180 nm) that theoretically would not fit

into a CCV. In addition, two viral particles can sometimes been seen enterin cells

in a single CCV, exceeding by far the normal size of clathrin-coated vesicles (80-

100nm). It is plausible that as we over-expressed a full length AP180 protein,

which has been shown to have a dominant negative effect over the

endogenous protein (312), the size control is compromised which facilitates VSV

endocytosis.

5 .2 Interaction of VSV with the endocytic machinery

By monitoring interaction of VSV with the endocytic machinery by TIRFM we

were able to see two different mechanisms used by the virus to interact with

clathrin-coats. The fist mechanism was illustrated by virus particles that came

into the TIRF-field from the surrounding medium, bound to the plasma

membrane and moved laterally until confined within a pre-existing clatrhin-

coated membrane domain. In other cases, the appearing of a clathrin-coat

underneath immobile virus particles was seen. Similar observations have been

made previously in the lab for Semliki Forest virus (326), and both mechanisms

have been reported for other cargo (60, 261, 266, 280). In some cases, the

targeting of specific cargo is restricted to one of the two mechanisms while in

other cases both can be observed. In a study by Ehrlich et al, were live-cell

imaging was used to monitor cargo targeting and endocytosis by clathrin-

coated pits it was reported that small cargo with high surface mobility such as

transferrin and low-density lipoprotein were mainly sorted to newly preformed

pits on the plasma membrane (60). Similar results have been shown for

activated G-protein coupled receptors (266, 280) where agonist activation

resulted in the accumulation of arrestin-3 in pre-formed pits.

Cargo-induced formation of clathrin-coated pits has only been reported for

larger cargo such as viruses. Ehrlich et al reported that following a lag-phase of

280-1500 sec, clathrin appeared underneath surface bound reovirus particles.

The authors however postulated that the clathrin recruitment was not cargo-

induced but due to coat stabilization by the virus after a random CCP formation.

This was based on calculations showing that the likelihood of a CCP formation


underneath the virus was the same as in a random spot on the plasma

membrane. Binding of the virus would thus not directly induce the formation of

the pit but rather serve to stabilize it (60). In another study, influenza virus was

shown to be able to exploit both mechanisms although de novo formation was

by far the more frequently seen event (261). Authors suggested virus-induced

clathrin recruitment based on the observation that pit formation at the sites of

virus confinement was more frequent than in the surrounding areas on the

plasma membrane. The results of current study indicate that VSV can use pre-

existing coated pits but also induce or stabilize new ones. However, based on

our results, we cannot say weather the clathrin recruitment to VSV is a result of

virus induced signaling or weather it serves to stabilize a randomly formed pit.

By counting viruses that were associated with coated pits during imaging,

either stably or recruited ones, we found that about 40% were not seen to co-

localize with clathrin at any time. Only 20% were not seen to associate with

dynamin-2, which is in agreement with the prominent reduction of VSV

infection in the presence of dynasore. On the other hand, only 38% of the

viruses were seen to co-localize with AP2. The percentage of recruitment events

for clathrin and dynamin was much higher than what was seen for AP2 (46% vs.

12% respectively) and the recruitment time of AP2 to a viral particle was longer

than what was seen for clathrin (136 ± 66 sec vs. 112 sec ± 45 respectively).

The time required for the formation of a clathrin-coated pit/vesicle with an

outer diameter of 90-100 nm has been calculated to be about 32 sec (60). The

formation of larger coated structures takes proportionally longer time. Clathrin

recruitment has been shown to range from 25-50 sec for small (5 nm) cargo like

transferrin to 400 sec for larger cargo such as reovirus (60). As the VSV is

relatively large ( 80x180 nm) the prolonged time needed for vesicle formation

around virus particles is consistent with previous observations. The prolonged

recruitment time of AP2 as compared to clathrin could indicate that the adaptor

needs to be plasma membrane associated to initiate coat recruitment, which

would be in agreement with the role of AP2 as an adaptor between the plasma

membrane, cargo and clathrin but not in accordance with observations made by

Ehrlich et al where AP2 was recruited even faster than clathrin (60).


Given that the adaptor protein complex seems to have no role in VSV entry or

infection, it was intriguing that it associated at all with virus particles. A

possible explanation for this could be provided by reports from Rappoport et al,

who have used live-cell imaging to analyze the dynamics of clathrin-coated

structures together with adaptor proteins and cargo (241-246). According to

their results and others, clathrin on the cell surface can be divided into distinct

populations of clathrin structures, static spots residing for a longer time on the

plasma membrane and dynamic spots moving either peripherally or

perpendicularly to the cell surface (75, 176, 243, 246). Using transferrin as a

cargo, the perpendicularly moving clathrin spots were defined as clathrin-

coated vesicles being endocytosed. In many cases, the internalized vesicles

originated from a static clathrin structure. The adaptor protein complex AP2

was only found in static clathrin-coated pits and absent in the laterally and

perpendicularly mobile spots. Shortly before internalization, AP2 was seen to

separate from the clathrin-containing vesicles while the alternate adaptor epsin

was endocytosed. The authors suggested that AP2 has a temporary and

localized cargo-sorting function at clathrin nucleation sites whereas alternate

adaptors link the cargo to the clathrin-coat and are endocytosed (242).

Considering the results from current study, the rather low percentage of VSV

particles recruiting or co-localizing with AP2, the long recruitment time as well

as unperturbed VSV infection in AP2 depleted cells, it could be postulated that

the adaptor protein complex only plays a minor role in VSV entry and that its

plasma membrane recruitment is not virus induced but rather incidental co-

localization of the virus with an AP2 and clathrin- containing sorting platform.

Dynamin recruitment to the virus was faster than what was seen for clathrin

and in the absence of virus, the recruitment time was even shorter (25 sec). This

agrees with what has been previously reported for dynamin (60, 176). The

prolonged recruitment time of the VSV associated dynamin (55 sec) might, like

in the case of clathrin, reflect the size of the vesicle that needs to be formed

around the virus. This is in agreement with data from Rappoport et al, where

they suggest a linear relation between the amount of clathrin and its associated

dynamin in CCPs (243). This could also be affected by the experimental setup, as


the virus is likely to be partly immobilized on the extra-cellular matrix and thus

not so easily endocytosed.

5 .3 Other factors involved in VSV entry and infection

By applying various pharmacological inhibitors, we were able to look at factors

such as the actin cytoskeleton and reversible phosphorylation, that have

previously been shown to be important for some of the clathrin-based

endocytic pathways, and evaluate their role in VSV entry and infection. Our

results supported the notion that actin rearrangements are important for at

least some of the steps required in the maturation from CCPs to CCVs, and the

transport of the newly formed endocytic vesicle into the cytosol. In the presence

of the actin stabilizing drug jasplakinolide as well as the actin monomer

sequestering drug latrunculin A, VSV infection was inhibited (although to a

different extent) and the effect was at least partly due to inhibition of the

endocytic steps. In contrast, when fusion was induced between the viral

envelope and the plasma membrane, releasing the viral nucleocapsid directly

into the cytosol, the infection index increased significantly, indicating a

fundamental difference in the role of actin cytoskeleton during VSV entry

through the endocytic compartments versus endocytic by-pass.

The infectious route of the virus via endocytosis is in general much more

efficient than fusion at the plasma membrane. When fused at the plasma

membrane (our results as well as (160)), only 20% of the viruses that would be

able to infect the cell though endocytosis are able to enter the cell, reach a

correct location in the cytosol and replicate. It has also been reported that only

some cell lines are at all infectable through fusion at the plasma membrane and

this correlates with the thickness of the cortical actin cytoskeleton (160). During

endocytosis of the virus, the endocytic machinery most likely acts in cohort with

the actin cytoskeleton, accomplishing the rearrangements necessary for the

formation of the endocytic vesicle (342). Lack of a dynamic actin cytoskeleton

would thus inhibit the process. Upon fusion at the plasma membrane on the

other hand, the viral capsid is deposited directly into the cortical actin

cytoskeleton, which most likely act as a barrier for the virus to reach the


replication machinery of the cell. Upon elimination of this barrier by actin-

interfering drugs, the proportion of viruses reaching a proper location in the

cytosol is increased.

Our inhibitor studies also illustrated the importance of reversible

phosphorylation for VSV entry and infection. The dual-specificity lipid/tyrosine

phosphatase MTMR2 plays an important role in regulating the levels of

PtdIns(3)P and PtdIns(3,5)P2 in membranes of endocytic compartments (16, 154,

250, 268). Since over-expression of the phosphatase inhibited VSV infection, our

results indicated that MTMR might play a role in VSV entry. As MTMR2 not only

has an enzymatic affinity towards the endosomal PtdIns but also a binding

affinity, we also looked at the effect of a phosphatase dead mutant of MTMR2

on VSV infection. Our results showed that over-expression of a functional and

non-functional phosphatase domain had a similar inhibitory effect on VSV,

indicating that the phosphatase activity of MTMR2 alone is not entirely

responsible for the effect seen but rather a combination of altered PtdIns levels

on endocytic compartments as well as partial masking of the phospholipids

resulting in reduced association of other PtdIns binding domain containing

effector proteins. Co-localization studies revealed limited co-localization of

endogenous MTMR2 with Rab5 and VSV upon endocytosis. It thus seems that

MTMR2 may have some role in VSV sorting or trafficking, which based upon

postulated roles and structure of the phosphatase does not seem unlikely. The

rather un-conclusive results presented here regarding the exact mechanisms of

this involvement could however be partly due to the double effect the

phoshpatase might have on the phospholipids composition of the endosomal

compartments required for VSV infection as well as the multi-level regulation of

the phosphatase regarding enzymatic activity as well as membrane association

(15).

5 .3 .1 Host cell receptors

The cell-surface factors involved in initial attachment and binding of VSV to the

plasma membrane are still unknown (34, 271). Due to the broad host range of

the virus, it is likely that its initial contact with the host cell is mediated though


a ubiquitous molecule expressed by cells from variety of species or by many

different surface components. Cell surface carbohydrates such as sialic acid-

containing groups and heparan-sulphate are known to serve as attachment

factors for some viruses (72, 126, 132, 207, 341). They are also ubiquitously

expressed and could thus be candidates for VSV attachment to its host cell

membrane. Our results showed that the lack of plasma membrane heparan-

sulphates does not affect the ability of the virus to bind to the cell. This is in

accordance with data from Basu et al (12). The lack of gangliosides however

seemed to compromise the binding ability of the virus. These glycosphingolipids

could thus serve as cell-attachment factors although most likely not a major

host-cell receptor for VSV.

In summary, we found the entry of VSV into host cells is a fast process where

the release of viral capsid into the cytosol enabling replication, can occur very

soon after entry. The major endocytic pathway taken by the virus seems to be

clathrin-mediated and dependent on dynamin-2. VSV does not belong to the

CME dependent cargo that is sorted to the endocytic machinery by the classical

adaptor protein complex AP2 or Dab2 while the targeting seem to involve the

alternative adaptors Eps15 and AP180. Thus, although the EM shows VSV

particles entering cells by clathrin-coated pits and vesicles, the perturbation

analysis using pharmacological inhibitors, clathrin heavy chain silencing,

dominant/negative clathrin adaptor protein constructs gave a somewhat mixed

picture. It left open the possibility that VSV can use a subset of CCPs as well as

non clathrin-mediated pathways for productive entry.

The number of factors know to be involved in VSV entry and infection is slowly

increasing and our knowledge about the pathway as well. However, many

aspects still have to be addressed for a more complete perspective of CME in

general as well as its subsets of more or less cargo specific pathways. Our

small-scale screen of selected components of endocytic pathways provided

promising results and will be of great value as a tool for classification of

endocytic pathways through direct comparison of ligand-specific requirements

for cellular factors. The results of such a screen would be a good starting point

for further, more detailed analysis.


5 .4 MATERIALS AND METHODS

5.4.1 Cells and viruses

Human cervix carcinoma HeLa ATCC cells were maintained in D-MEM

supplemented with 10% FCS (Gibco, Life Tech), baby hamster kidney (BHK-21)

cells in Glasgow medium supplemented with 10% FCS and 10% Tryptose

phosphate broth (Gibco, Life Tech) and African green monkey kidney cells (Vero)

stably expressing CLC-mRFP in MEM (10% FCS, 1% glutamin, 1% NEAA, 1 μg/ml

G418) (Gibco, Life Tech). Stably expressing human embryonic kidney (HEK293)

FlipIn (Invitrogen) cells (15) were kindly provided by Prof. U.Suter, (Institute of

Cell biology, ETH, Zürich) and maintained on D-MEM supplemented with 10%

FCS and 400 μg/ml penicillin-streptomycin (Gibco, Life Tech). Cells without an

expression vector were selected and cultured in the presence 400 μg/ml zeocin

and cells expressing His tagged MTMR2 or MTMR2 C417 in the presence of 100

μg/ml hygromycin (Invitrogen). Cav-1KO and cav-1WT cells are lung mouse

fibroblasts described previously (57) and were grown in D-MEM containing 10%

serum, penicillin-streptomycin /(100 μg/ml and 1000 units/ml) and 1% (4 mM)

glutamax (Gibco, Life Tech). Dab2 fl/- and Dab2 -/- are mouse embryonic

fibroblasts (kindly provided by J. Cooper, Fred Hutchinson Cancer Research

Centre, Seattle). Dab2 fl/- cells express a conditional allele of Dab2 and Dab2 -/-

cells were produced by expression of Cre in the Dab2 fl/- cells to excise the

conditional Dab2 allele. Both cell lines were grown in D-MEM supplemented

with 10% FCS. The Swiss albino-mouse fibroblasts (ATCC) and the mouse

melanoma cell line, GM95 deficient in sialyl-lactosylceramide (previously

described in (106) were grown in D-MEM with 10% FCS and 1% glutamax. The

Chinese hamster ovary cells CHO and the CHO mutant cell line PGS A745 (kindly

provided by J. DD. Esko, Department of Biochemistry, University of Birmingham).

These cells are deficient in xylosyltransferase, which catalyzes the first sugar

transfer step in GAG biosynthesis (64). Both cell lines were maintained in D-

MEM, 10% FCS and 1% glutamax. All cell lines were grown at 37°C under 5% CO2.


Wild-type vesicular stomatitis virus (wtVSV) was kindly provided by Prof. H.

Hengartner (Institute of Experimental Immunology, Zürich). Stocks were

prepared as previously described (289). Recombinant vesicular stomatitis virus

(rVSV) was kindly provided by Prof. L. Pelkmans (Molecular Systems Biology, ETH

Zürich) and was prepared as previously described (278). Stocks were prepared by

infecting slightly sub-confluent BHK-21 cells for 24h at 0.1 PFU/cell in 10 ml

serum free MEM (10 mM Hepes pH 6.5). Cells were incubated at 37°C and 5%

CO2 for 1h on a rocker before adding 20 ml of MEM (30 mM Hepes pH 7.3, 10%

Tryptose phosphate broth, 1% FCS) for the rest of the incubation time.

Supernatant was harvested when 90% of cells were rounded up and cell debris

was removed by centrifugation at 8000g for 15 min at 4°C. The stock was

buffered with 10 mM Hepes at pH 7.4 and stored at -80°C. Wild type Semliki

Forest virus (SFV) was kindly provided by Thomas Heger who prepared stocks as

previously described (95). Vaccinia virus was kindly provided by Jason Mercer.

5 .4.2 Purification and labeling of wtVSV

The wtVSV was purified to enable labeling with fluorophores. This was done by

pelleting the virus at 25 000 rpm for 2.5h at in a Beckman ultracentrifuge using

a SW41 rotor. The pellet was eluted over night on ice at 4°C in TN buffer (50 mM

Tris pH 7.4, 100 mM NaCl). Subsequently the eluted pellet was purified on a

Pfeffercorn gradient (10-50% w/v sucrose gradient with an 0.5 ml 50% w/v

sucrose cushion), at 30 000 rpm for 1h at 4°C in Beckman ultracentrifuge using

a SW41 rotor. The banded virus was re-pelleted at 25 000 rpm for 1h and eluted

in TN buffer as described above. The purified virus was dialyzed in 0.1 M NaHCO3

pH 8.3 over night at 4°C. The protein concentration was measured and the

fluorescent dye (AlexaFluor 488, 594 or 647) was added in a 1:4 molarity ratio

while vortexing. The labeled virus was then rotated head-over-tail at room

temperature for 2h and subsequently banded on a pfeffercorn gradient as

described above. Labeled virus was aliquoted and stored at -80°C until time of

use.


35S methionine labeled VSV was prepared as previously described (164). Briefly,

BHK-21 cells were infected with 20 pfu/cell of wtVSV in 10 ml Earle`s MEM (pH

6.3) without bicarbonate (10 mM Tris, 10 mM PIPES, 10 mM MOPS, 10 mM

NaH2PO4, 0.2% BSA) at 37°C on a rocker for 1h. Inoculum was replaced with 5 ml

Dulbecco`s modified Eagle’s medium (20 mM Hepes pH 7.3, without

methionine, cystine or L-glutamine) and incubate for 1.5h at 37°C before adding

35S methionine (1 mCi) to each 175 cm3 flask and incubate for additional 7.5h.

Subsequently, the radioactively labeled virus was purified as described for the

wtVSV above. Verification of the labeling both with fluorescent dyes and 35S

methionine was done by running an SDS/page, the infectivity was monitored

with plaque assays and activity counting was done using a multipurpose

scintillation counter (LS 650, Beckmann Coulter).

5 .4.3 siRNA mediated knockdown of clathr in and AP2

For the depletion of clathrin heavy chain, two previously published

oligonucleotides were used, CHC1 (AAC CUG CGG UCU GGA GUC AAC) (102) and

CHC2 (AUC CAA UUC GAA GAC CAA UdTdT) (196). In addition, two proven

performance siRNAs, CHC3 (AAGGAGAGTCTCAGCCAGTGA) and CHC4

(TAATCCAATTCGAAGACCAAT) were used. For the depletion of the subunit of

AP2, two previously published siRNAs were used, AP2-1

(GAGCAUGUGCACGCUGGCCAGCU) (102) and AP2-2

(AAGAGCAUGUGCACGCUGGCCA) (196). In addition the proven performance

siRNA AP2-3 (ACGTGTGACTTCGTCCAGTTA) directed against AP2 μ subunit was

used. All previously published oligonucleotides were synthesized by Dharmacon

and the proven performance siRNAs and AllStars Negative control siRNA were

obtained from Qiagen. Transfections for siRNA silencing were performed using

HiPerFect Transfection Reagent (Qiagen) according to manufacture’s fast

forward protocol. Briefly, HeLa cells were seeded 1h prior to transfection. AllStars

Negative siRNA (5 nM), CHC1 (20nM), CHC2 (5 nM), CHC3 (5 nM), CHC4 (5 nM),

AP2-1 (5 nM), AP2-2 (100 nM) and AP2-3 (5 nM) were together with the HiPerfect

diluted Opti-MEM (Gibco Life Tech) and added to the cells. About 48h post-

transfection, cells were re-transfected and incubated for additional 40h before


being counted and seeded for experiment, which was started 8-10h post

plating. Knockdown was verified by western blot using mouse-anti-Adaptin-

(1:100), mouse-anti-Adaptin-μ (1:100) and -actin (1:1000) for normalization. All

antibodies were purchased from BD Biosciences.

5 .4.4 Infection and internalization analysis

For infection assays, wtVSV, rVSV or SFV at a MOI of 1 were added to HeLa cells.

Virus stocks were diluted in RPMI medium (30 mM Hepes pH 6.8, 1% BSA) (Gibco

Life Tech) and before adding the virus, cells were washed once with RPMI

medium. Infection was done on a rocker at 37ºC for 1h before replacing the

inoculum by MEM (10% FCS, 1% Glutamax) for additional 3h. For analysis of

transferrin uptake, samples were pulsed with 20 μg/ml labeled (AF594 or

AF647) transferrin (Invitrogen) for 15 min and then a chase was performed for 10

min. Subsequently, samples were washed with PBS and stripped of any bound,

un-internalized tfn using a glycine buffer, pH3 (0.1M glycine, 0.1M NaCl).

Samples were fixed with 4% formaldehyde in PBS for 20 min at room

temperature. For infection detection samples were either subjected to a FACS

based infection assay or infection was scored by eye using a confocal

microscope.

Samples subjected to FACS analysis were permeabilized (0.1% saponin (w/v), 2 %

FCS, 20 mM EDTA, 0.02% NaN3 in PBS) and stained with primary antibodies for

2h at room temperature (I-14 mouse-anti-VSVG (1:2000) (146), rabbit-anti-SFV

E1/E2 antibody (1:100) (297), followed by the secondary antibodies (AlexaFluor

488, AlexaFluor 647 or AlexaFluor 594 labeled goat anti rabbit or mouse IgG

(Invitrogen) for 45 min at RT. Detection of infection with rVSV was based on GFP

expression. Cells were analyzed on a FACS Calibur cytometer using CellQuest 3.1

software (Becton Dickinson Immunocytometry Systems). At least 10 000 cells

were analyzed for each sample. At least two independent experiments, each in

triplicates, were performed. Samples subjected to microscopic analysis were

permeabilized (1% BSA (w/v), 0.05% (w/v) saponin in PBS) and stained with

primary antibodies (I-14 mouse-anti-VSVG (1:2000) (146), rabbit-anti-SFV E1/E2

antibody (1:500) (297), mouse-anti-Adaptin- (AP2- ) (1:500) (BD Biosciences)


mouse-anti-Clathrin Heavy Chain antibody (1:1000) (BD Biosciences) followed by

the secondary antibodies (AlexaFluor 488, AlexaFluor 647 or AlexaFluor594

labeled goat anti rabbit or mouse IgG (Invitrogen) for 45 min at RT. Samples

were mounted using ImmuMount (Thermo Shandon). Subsequent analysis was

performed using an inverted confocal microscope, Zeiss510Meta (Carl Zeiss

MicroImaging, Inc.) with a 63x/1.4NA oil immersion objective. For excitation, an

Argon (488 nm), a Helium-Neon 1 (543 nm) and a Helium-Neon 2 (633 nm) laser

supported by dichroic mirrors HFT 488/543/633, NFT 545 and NFT 635 VIS and

emission filters BP 505-530, LP 560 and 634-720. Images were acquired using

LSM510 software package (Carl Zeiss MicroImaging, Inc.) and processed using

Image J (National Institutes of Health) and Adobe Illustrator (Adobe Systems).

5 .4.5 Endocytosis assay

Endocytosis assay was performed as previously described (164). Briefly, 50 000

cpm of 35S labeled virus, which corresponds to a PFU of 0.1/cell was diluted in

RPMI-medium and added to HeLa cells plated on a 35 mm dish. To acquire a

synchronized entry, virus was allowed to bind to cells at 4°C before shifting to

37°C for internalization for various time-points. Subsequently, samples were

shifted again to 4°C and treated with 1 mg/ml proteinase K (Roche), which

cleaves VSVG and thus efficiently removes surface bound, un-internalized virus

(164). As a negative control, bound virus was removed from the cell surface

using proteinase K at 4°C without shifting the cells to 37°C. Cells were pelleted

and washed 3x in PBS containing 0.2% BSA, 1 mM PMSF and protease inhibitor

cocktail (Sigma) and subsequently re-suspended in 300 μl medium and 2 ml

Ready Safe scintillation cocktail (Beckman Coulter) and analyzed using a

multipurpose scintillation counter (LS 650, Beckmann Coulter) counting 5 min

for each sample.

5 .4.6 Fusion assay

rVSV was diluted in RPMI medium buffered to a pH of 6.6 and bound to

confluent HeLa cells at 4°C for 1h. Inoculum was then removed and cells washed


1x with cold RPMI medium on ice. Subsequently, warm, serum free medium

with a pH of 5.5 or medium with a pH of 7.4 was added to the samples at the

same time as they were placed on a 37ºC warm waterbath for 1 minute. With a

pH of 5.5, bound viruses were able to fuse with the plasma membrane and thus

releasing their nucleocapsid into the cytosol without going through the

endocytic compartments. Medium was then replaced by complete medium,

containing the inhibitors (vanadate (1mM), staurosporine (1μM), jasplakinolide

(1μM), latrunculin A (1μM) or BIM-I (1μM) as well as 20mM NH4Cl to prevent any

endocytosis of un-fused viruses. Samples were then incubated for 4h before

fixation and analysis by FACS. Control cells were either shifted to the water bath

with medium pH 7.4 or pH5.5 containing no drug and complete medium

without drug and with or without NH4Cl were added.

5 .4.7 VSVG degradation

VSVG degradation assay was performed by binding purified wild-type VSV

diluted in RPMI-medium, to confluent HeLa cells at 4°C for 1h before removing

unbound virus and shifting samples to 37°C for internalization for various time-

points. Cycloheximide (1 mM) was added to the samples to prevent viral

replication. Subsequently, samples were shifted again to 4°C and treated with 1

mg/ml proteinase K (Roche). As a negative control, bound virus was removed

from the cell surface using proteinase K at 4°C without a 37°C shift. Cells were

pelleted and washed 3x in PBS (0.2% BSA, 1 mM PMSF, protease inhibitor cocktail

(Sigma)) and subsequently re-suspended in SDS-Lämmli lysis buffer prior to

SDS-page and blotting. VSVG was detected using the rabbit polyclonal antibody

8685, produced in the lab of A. Helenius.

5 .4.8 Electron microscopy

For thin section electron microscopy, wtVSV diluted in RPMI-medium was either

bound to HeLa cells plated on 12 mm converslips on ice for 1h and subsequently

fixed or alternatively shifted to 37°C for 10 min before fixation. In the presece of


20 mM NH4Cl, cells were infected at 37°C for 1h. Cells were fixed with 2.5%

glutaraldehyde (0.05 M sodium cacodylate pH 7.2, 50 mM KCl, 1.25 mM MgCl2,

and 1.25 mM CaCl2) for 30 min at RT followed by 1.5 h in 2% OsO4. Dehydration,

embedding and thin sectioning were performed as previously described (116).

Examination of samples and micrographs were done by Jürgen Kartenbeck and

Roberta Mancini.

5 .4.9 Live cel l microscopy analysis

HeLa cells for live cell microscopy were transfected using AMAXA according to

manufacturers protocol 12-24h prior to experimental start. Constructs used

were CLC-GFP or RFP (kindly provided by J.H. Keen, Kimmel Cancer Center, PA),

Dynamin-2-GFP (kindly provided by M. Mc.Niven, Mayo Clinic, Rochester, MN)

and AP-2-GFP (kindly provided by L. Greene, NIH, Bethesda, MD). For coating of

coverslips with extra-cellular matrix (ECM), cells of the same type as used for

the subsequent experiment were seeded on 18 mm coverslips (Greiner) two

days before imaging was performed and grown to confluency. On the day of

imaging, cells were removed from the coverslip using 20 mM EDTA to prevent

protein digestion and removal of the ECM produced by the cells. For live

microscopy, coverslips were whased in cold PBS and mounted in custom-built

stainless-steel chambers (Workshop Biochemistry). Labeled virus, diluted in cold

RPMI medium (30 mM Hepes pH 6.6, 1% BSA) was then added to the coated

coverslip for 30 min on ice. Transfected cells intended for the imaging were

then detached using EDTA (20 mM) and after 3x washing with PBS, they were

suspended in 300 μl RPMI medium (30 mM Hepes pH 6.6, 1% BSA), added to the

coverslip and allowed to attach for 30 min on ice. Subsequently, the samples

were subjected to live cell imaging using custom modified Olympus IX71

inverted microscope with a heating chamber (37°C) and an objective-type total

internal reflection fluorescence microscopy setup (TILL Photonics). Image

acquisition was done using TILL Image QE charge-coupled device camera and

TILLVISION software (TILL Photonics). The total-internal-reflection angle was

manually adjusted for every experiment. Images were processed using Image J

(National Institutes of Health) and Adobe Illustrator (Adobe Systems).


5 .4.10 Pharmacological inhibitors, constructs and antibodies

Cells were pre-incubated for 30 min at 37°C in D-MEM (10% FCS) containing 20

mM NH4Cl (Baker), 17, 70,140 or 280 μM chlorpromazine (Sigma-Aldrich), 20, 80

or 120 μM dynasore (ASINEX), 10 μg/ml progesteron (Sigma-Aldrich) and 25

ug/ml nystatin (Sigma-Aldrich), 1 μM brefeldin A (Sigma-Aldrich), 1 μM

nocodazole (Sigma-Aldrich), 1 μM latrunculin (Molecular Probes), 1 μM

jasplakinolide (Molecular Probes), 0.1, 1 or 10 μM wortmannin (Sigma-Aldrich),

100 μM genistein (Sigma-Aldrich), 1 mM vanadate (Merck), 1 μM staurosporin

(Sigma-Aldrich), 1 μM BIM-1 (Sigma-Aldrich), 1 μM PMA (Sigma-Aldrich), 0.1 or 1

μM calphostin C (Sigma-Aldrich), 0.1, 1 or 10μM Rottlerin (VWR) and 2 or 20 μM

CPG53353 (VWR). Due to high cell toxicity, cells were only pre-incubated with

chlorpromazine for 10 min before adding the virus and the drug containing

inoculum was left on the cells for 30 min before replacement with complete

medium. Pre-incubation with progesteron and nystatin was performed over

night in the absence of serum and the virus was not incubated with the drugs.

Otherwise, drugs were present throughout the experiment and the treatment

did not result in loss of cell viability.

Transfection of cells with dynamin-2-wt-GFP and dynamin-2-K44A-GFP (kindly

provided by M. Mc.Niven, Mayo Clinic, Rochester), Eps15-wt-GFP and

Eps15 95/295-GFP (kindly provided by A. Benmerah and A. Dautry-Varsat,

Institut Pasteur, Paris), Arf6-wt-GFP and Arf6-Q67L-GFP (kindly provided by J.

Donaldson NIH, Bethesda), AP180-GFP (kindly provided by H.T.McMahon,

Laboratory of Molecular Biology, Cambridge), MTMR2-his-wt and MTMR2-his-

S417C (kindly provided by U.Suter, Institute of Cell Biology, ETH Zürich), Rab5-

GFP (kindly provided by A. Vonderheit, Institute of Biochemistry, ETH Zürich) and

CLC-wt-XFP (kindly provided by J.H. Keen, Kimmel Cancer Centre, PA), was

performed by AMAXA 10-12 hours prior to experimental start. Cells were allowed

to express the AP2 -wt-GFP construct (kindly provided by L. Greene, NIH,

Bethesda) for 24-48h before experimental start. The prolonged expression time

is required for efficient incorporation of the GFP labeled alpha subunit into the


endogenous adaptor protein complex (68).

Monoclonal antibodies against clathrin heavy chain, AP2 and AP2μ were

purchased from BD Biosciences and secondary antibodies coupled to

AlexaFluor488, 594 or 647 were from Invitrogen. The monoclonal antibody I-14

against VSVG has been previously described (146) and the polyclonal antibody

8685 against VSVG was raised in rabbit in the group of A. Helenius. Polyclonal

antiserum against E1 and E2 were raised in rabbit (297). The monoclonal

antibody against MRMR2 was kindly provided by U. Suter (Institute of Cell

Biology, ETH Zürich) and has been previously described (15).

5 .4.11 siRNA screening

The siRNA library used was designed in our lab (T. Heger) to address 33 factors

involved in various endocytic pathways. If available two so-called “proven-

performance” siRNA per gene were used, which have been tested to knock-

down their target mRNA by 70% or more (Qiagen). Titration of cell number,

amount of transfection reagent, and virus was performed prior to screening to

reach the optimal cell density, transfection efficiency, and infection rates. A

selection of siRNAs was validated in regard to silencing efficiency by western

blotting. Reverse transfections were performed in black optical bottom 96-well

plates (nunc). For each transfection, 0.2 μl of Lipofectamine RNAiMAX

(Invitrogen) in 15μl OPTI-MEM was mixed with 15μl OPTI-MEM containing

33.3nM siRNA, and incubated for 15min to allow lipid complex formation.

Approximately 3000 HeLa cells in 70 μl complete DMEM (10% FCS) were added

to the wells and cells were transfected for 3 days. As a transfection control,

apoptosis induction by siRNA against KIF11/EG5 was monitored. On the third

day, 90% of EG5-siRNA transfected cells were dead. As controls, three wells of a

non-targeting control siRNA (AllStarsNegative, Qiagen) were included on each

plate. For analysis, the ratio, infected to all cells was determined using

immunofluorescence, automated microscopy, and a MATLAB-based image

analysis software that was developed in the lab (K.Quirin, S.Moese, T.Heger).

The infection ratio for all siRNA was normalized to the average ratio of the

negative control siRNA wells for each plate. Cells were infected with rVSV in

RPMI-medium for 4h to acquire 15-30% infection. Each siRNA was tested twice


for its effect on infection. For microscopy, nuclei were stained with Hoechst

33258 (1:10’000 in PBS, 0.5% Triton X-100). Infection as well as cell number was

scored with an automated widefield microscope (BD Pathway 855, Beckton

Dickinson) equipped with an Olympus 10x 0.4NA UPlanSApo objective,

DAPI/GFP filters, Hamamatsu Orca ER camera and Attovision software (Beckton

Dickinson). For each well, 4 x4 montages of both the nucleus and GFP channel

were acquired. The impact of each siRNA on virus infection was determined by

counting the number of cell showing hoechst nuclear staining and of cells

expressing GFP. Pictures were analysed using MATLAB-based (The MathWorks)

in-house programs (K. Quirin, T. Heger, and S. Moese). Results were presented as

relative infection indices (RII) as well as relative cell numbers (RCN). RII is the

ratio of the number of infected, siRNA-treated cells to the average number of

infected control-treated cells on a logarithmic scale. Accordingly, RCN

represents the logarithmic ratio of the cell numbers of siRNA-treated to the

average cell number of the control siRNA-treated cells.


6 Abbreviations

ANTH AP180 N-terminal homology AP Adaptor/assembly protein Arf1 ADP-ribosylation factor 1 CALM Clathrin assembly lymphoid myeloid leukaemia Cav-1 Caveolin 1 CCP Clathrin-coated pit CCV Clathrin-coated vesicles CHC Clathrin heavy chain Chx Cholera toxin CI-MPR Cation independent mannose-6-phosphate receptor CLC Clathrin light-chain CME Clatrhin-mediated endocytosis CPM Counts per minute Dab2 Disabled 2 DN Dominant negative ECV Endosomal carrier vesicles EE Early endosome EEA1 Early endosomal antigen 1 EGF Epidermal growth factor EGFR Epidermal growth factor receptor EM Electron microscopy ENTH Epsin N-terminal homology Eps15 EGF receptor pathway substrate clone number 15 Epsin Eps15-interacting protein ER Endoplasmic reticulum ESCRT Endosomal sorting complexes required for transport FACS Fluorescent-activated cell sorter FCS Fetal calf serum GAP GTPase-activating protein GDF GDI displacement factor GDI GDP dissociation inhibitor GDP Guanosin diphosphate GED GTPase effector domain GEEC Enriched early endosomal comprtments GEF GDP/GTP exchange factor GFP green fluorescent protein GPI-AP Glycosylphosphatidylinositol anchored proteins GTP guanosine triphosphate HIP1/Hip1R Huntingtin-interacting protein 1 Hrs Hepatocyte growth factor-related tyrosine kinase substrate Hsp Heat shock protein ICAM-1 Intercellular adhesion molecule IF Immunofluorescence kD Kilo Dalton kd knock-down LAMP Lysosomal-associated membrane protein


LBPA l Lysobisphosphatidic acid LCMV Lymphocytic choriomeningitis virus LDL Low-density lipoprotein LDLR Low-density lipoprotein receptor LE Late endosome MEFs Mouse embryonic fibroblasts MHC I Major histocompatibility complex class I MOI Multiplicity of infection MTMR2 Myotubularin related protein 2 PI Phosphatidylinositol PIPKI Phosphatidylinositol phosphate kinase type PtdIns Phosphatidylinositol PtdIns(3)P Phosphatidylinositol-3-phosphate PtdIns(4)P Phosphatidylinositol-4-phosphate PdtIns(3,5)P 2 Phosphatidylinositol-3,5-bisphosphate PdtIns(4,5)P 2 Phosphatidylinositol-4,5-bisphosphate PECAM-1 Platelet-endothelial cell adhestion molecule PFU Plaque forming units PH Pleckstrin homology PI(3)K Phosphoinositol-3-OH kinase PRD Prolin-rich domain PX Phox homology RFP Red fluorescent protein RILP Rab-interacting lysosomal protein rVSV Recombinant VSV expressing GFP SFV Semliki Forest virus SH3 Src homology3 siRNA Small interfering ribonucleic acid SNARE Soluble NSF attachment protein receptor SV40 Simian virus 40 TIRF Total internal reflection fluorescence Tfn Transferrin TfnR Transferrin receptor UIMs Ubiquitin-interacting motifs VV Vaccinia virus wtVSV Wild-type VSV XFP Any fluorescent protein


7 REFERENCES

1. AAguilar , R. C. , M. Bo ehm, I . Gorshko va, R. J . Crouch, K. Tomita, T. Saito, H. Ohno, a nd J . S. Bo nifacino. 2001. Signal-binding specificity of the mu4 subunit of the adaptor protein complex AP-4. J Biol Chem 2276:13145-52.

2. AAhl e, S. , and E. Ungewick ell . 1989. Identification of a clathrin binding subunit in the HA2 adaptor protein complex. J Biol Chem 2264:20089-93.

3. AAhl e, S. , a nd E. Ungewic kell . 1986. Purification and properties of a new clathrin assembly protein. Embo J 55:3143-9.

4. AAm stutz, B. , M. Ga staldell i , S. Ka lin, N. I melli , K. Bo ucke, E. Wandel er, J . Merc er, S. Hemmi, and U. F . G reber. 2008. Subversion of CtBP1-controlled macropinocytosis by human adenovirus serotype 3. Embo J 227:956-69.

5. AAnderso n, C. M., G. N. Geor gio u, I . E. Morri son, G. V. Stev enson, a nd R. J . Cher ry . 1992. Tracking of cell surface receptors by fluorescence digital imaging microscopy using a charge-coupled device camera. Low-density lipoprotein and influenza virus receptor mobility at 4 degrees C. J Cell Sci 1101 ( Pt 2) :415-25.

6. AAnderso n, H. A . , Y . C hen, a nd L . C. Nork in. 1996. Bound simian virus 40 translocates to caveolin-enriched membrane domains, and its entry is inhibited by drugs that selectively disrupt caveolae. Mol Biol Cell 77 :1825-34.

7. AAqui no, A. , A. Li si , D. Pozzi , G. Rava gna n, a nd S . Grimal di. 1993. EBV membrane receptor (CR2) is phosphorylated by protein kinase C (PKC) in the early stages of virus entry into lymphoblastoid cells line (Raji). Biochemical & Biophysical Research Communications 1196:794-802.

8. BBache, K. G. , A. Br ech, A. Mehlum, and H. St enm ark. 2003. Hrs regulates multivesicular body formation via ESCRT recruitment to endosomes. J Cell Biol 1162:435-42.

9. BBache, K. G . , C. Rai bor g, A. Mehl um, and H. St enmark. 2003. STAM and Hrs are subunits of a multivalent ubiquitin-binding complex on early endosomes. J Biol Chem 278 :12513-21.

10. BBaroi s, N. , and O. Bakke. 2005. The adaptor protein AP-4 as a component of the clathrin coat machinery: a morphological study. Biochem J 3385:503-10.

11. BBaro uch, W., K. Pra sad, L . Gr eene, and E. Eisenber g. 1997. Auxilin-induced interaction of the molecular chaperone Hsc70 with clathrin baskets. Biochemistry 36:4303-8.

12. BBasu, A. , T . Ka nda, A. Beyene, K . Saito, K. Meyer, and R. Ra y. 2007. Sulfated homologues of heparin inhibit hepatitis C virus entry into mammalian cells. J Virol 81:3933-41.

13. BBenm era h, A. , M. Ba yrou, N . Cerf- Bensussan, and A. Dautr y- Var sat. 1999. Inhibition of clathrin-coated pit assembly by an Eps15 mutant. J Cell Sci 1112:1303-11.

14. BBenm era h, A. , B. Begue, A. Da utr y- Varsat, and N. Cerf- Bensussa n. 1996. The ear of alpha-adaptin interacts with the COOH-terminal domain of the Eps 15 protein. J Biol Chem 2271:12111-6.

15. BBerger, P . , I . Ber ger , C. Schaffitze l , K. Ter sar, B. Volkm er, and U. Sut er. 2006. Multi-level regulation of myotubularin-related protein-2 phosphatase activity by myotubularin-related protein-13/set-binding factor-2. Hum Mol Genet 115 :569-79.

16. BBerger, P . , C. Sc haffitzel , I . Ber ger, N. Ba n, a nd U. Suter. 2003. Membrane association of myotubularin-related protein 2 is mediated by a pleckstrin homology-GRAM domain and a coiled-coil dimerization module. Proc Natl Acad Sci U S A 100:12177-82.

17. BBi nns, D. D. , B. Bar ylko, N. Gric hi ne, M. A. Atk inso n, M. K . Helm s, D. M. Jameso n, J . F . Ecclesto n, and J . P . Al ba nesi . 1999. Correlation between self-association modes and GTPase activation of dynamin. J Protein Chem 118 :277-90.

18. BBla npi ed, T. A. , D . B. Scott , a nd M. D. Ehl ers . 2002. Dynamics and regulation of clathrin coats at specialized endocytic zones of dendrites and spines. Neuron 336:435-49.

19. BBoll , W., I . Rapo port , C. Brunner, Y . Mo dis, S. P rehn, and T. Kirchhausen. 2002. The mu2 subunit of the clathrin adaptor AP-2 binds to FDNPVY and YppO sorting signals at distinct sites. Traffic 33:590-600.

20. BBonifacino, J . S. , and L. M. Tra ub. 2003. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu Rev Biochem 772:395-447.


21. BBouc rot, E. , S. Saffaria n, R. Ma ssol, T . Kirc hha usen, and M. Ehrlic h. 2006. Role of lipids and actin in the formation of clathrin-coated pits. Exp Cell Res 3312:4036-48.

22. BBro dsk y, F . M., C. Y . C hen, C. Knuehl, M. C. To wler, and D . E. Wa keham. 2001. BIOLOGICAL BASKET WEAVING: Formation and Function of Clathrin-Coated Vesicles. Annu Rev Cell Dev Biol 117 :517-68.

23. BBubb, M. R. , I . Spector, B. B. Beyer, a nd K . M. Fosen. 2000. Effects of jasplakinolide on the kinetics of actin polymerization. An explanation for certain in vivo observations. J Biol Chem 2275 :5163-70.

24. BBucci , C. , R . G. Parton, I . H. Mat her, H. St unnenber g, K. Simo ns, B. Hoflack, and M. Zer ial . 1992. The small GTPase rab5 functions as a regulatory factor in the early endocytic pathway. Cell 770 :715-28.

25. BBucci , C. , P . Thom sen, P. Nicoziani, J . McCarthy, and B. van Deurs. 2000. Rab7: a key to lysosome biogenesis. Mol Biol Cell 111 :467-80.

26. BBurd, C. G. , a nd S. D. Emr . 1998. Phosphatidylinositol(3)-phosphate signaling mediated by specific binding to RING FYVE domains. Mol Cell 22:157-62.

27. CCarbo ne, R. , S. Fre, G. Ia nnolo, F . Belleudi, P . Manci ni , P . G. Pe licci , M. R. Torrisi , and P. P . Di Fiore . 1997. eps15 and eps15R are essential components of the endocytic pathway. Cancer Res 557:5498-504.

28. CCarneiro, F . A. , A. S. Ferra dosa, a nd A. T. Da Poian. 2001. Low pH-induced conformational changes in vesicular stomatitis virus glycoprotein involve dramatic structure reorganization. J Biol Chem 2276:62-7.

29. CCestra, G. , L . Ca stagnoli , L . D ente , O. Mi nenkov a, A. Petr ell i , N. Mi gone, U. Hoffm uller, J . Schnei der-Mer gener, and G. C esa reni. 1999. The SH3 domains of endophilin and amphiphysin bind to the proline-rich region of synaptojanin 1 at distinct sites that display an unconventional binding specificity. J Biol Chem 2274:32001-7.

30. CChavri er, P . , J . P . Gorvel , E. Stelzer, K. Simo ns, J . Gruenberg, a nd M. Zerial . 1991. Hypervariable C-terminal domain of rab proteins acts as a targeting signal. Nature 35 3:769-72.

31. CChavri er, P . , R . G. Parto n, H. P. Ha uri , K. S i mons, and M. Zer ial . 1990. Localization of low molecular weight GTP binding proteins to exocytic and endocytic compartments. Cell 662:317-29.

32. CChen, H. , S. Fre, V. I . Sl epnev , M. R. Ca pua , K. T akei, M. H. Butl er, P . P . Di Fiore, and P. De Camill i . 1998. Epsin is an EH-domain-binding protein implicated in clathrin-mediated endocytosis. Nature 3394:793-7.

33. CChri stoforidi s, S. , M. Miacz ynska, K . Ashm an, M. Wilm, L . Z hao, S. C. Yi p, M. D. Wat erfiel d, J . M. Back er, a nd M. Z erial . 1999. Phosphatidylinositol-3-OH kinases are Rab5 effectors. Nat Cell Biol 11:249-52.

34. CCoil , D. A. , and A. D. Mill er. 2004. Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. J Virol 778 :10920-6.

35. CCollins , B. M., A. J . McCoy, H. M. Kent, P . R . Ev ans, and D . J . Owen. 2002. Molecular architecture and functional model of the endocytic AP2 complex. Cell 109:523-35.

36. CConfaloni eri , S. , A. E. Salci ni , C . P uri , C. T acchet ti , and P. P . Di Fior e. 2000. Tyrosine phosphorylation of Eps15 is required for ligand-regulated, but not constitutive, endocytosis. J Cell Biol 1150 :905-12.

37. CConner, S. D. , a nd S. L . Schm id. 2003. Differential requirements for AP-2 in clathrin-mediated endocytosis. J Cell Biol 1162:773-9.

38. CConner, S . D. , and S. L . Schmid. 2002. Identification of an adaptor-associated kinase, AAK1, as a regulator of clathrin-mediated endocytosis. J Cell Biol 115 6:921-9.

39. CConner, S. D. , and S. L . Sc hmi d. 2003. Regulated portals of entry into the cell. Nature 4422:37-44.

40. CConsta ntinescu, S. N. , C. D. Cer nescu, and L. M. Po pescu. 1991. Effects of protein kinase C inhibitors on viral entry and infectivity. Febs Letters 2292:31-33.

41. CCremo na, O. , G. Di Paolo, M. R. Wenk, A. Lut hi, W. T. Kim, K. Ta kei, L . Daniell , Y . N emoto, S. B. Shea rs, R. A. Flavel l , D. A. McCo rmick, a nd P. De Camill i . 1999. Essential role of phosphoinositide metabolism in synaptic vesicle recycling. Cell 999:179-88.

42. CCuper s, P . , A. P . Jadhav, and T. Kirc hha usen. 1998. Assembly of clathrin coats disrupts the association between Eps15 and AP-2 adaptors. J Biol Chem 2273:1847-50.


43. DDale, L . B. , J . L . Seac hrist , A. V. Ba bwa h, and S. S. Ferguso n. 2004. Regulation of angiotensin II type 1A receptor intracellular retention, degradation, and recycling by Rab5, Rab7, and Rab11 GTPases. J Biol Chem 2279:13110-8.

44. DDales, S. 1980. Penetration of Animal Viruses into Cells. 45. DDamke, H. , D. D. Binns, H. Ueda, S. L . Schmid, and T. Ba ba. 2001. Dynamin

GTPase domain mutants block endocytic vesicle formation at morphologically distinct stages. Mol Biol Cell 112:2578-89.

46. DDamm, E. M. , L . Pelk mans, J . Ka rtenbec k, A. Mezzacasa, T. Kurzchal ia, a nd A. Heleni us. 2005. Clathrin- and caveolin-1-independent endocytosis: entry of simian virus 40 into cells devoid of caveolae. J Cell Biol 1168 :477-88. Epub 2005 Jan 24.

47. DDaro, E. , D. Sheff , M. Gom ez, T. Krei s, and I . Mell man. 1997. Inhibition of endosome function in CHO cells bearing a temperature-sensitive defect in the coatomer (COPI) component epsilon-COP. J Cell Biol 1139:1747-59.

48. DDavid, C. , P . S. McP her son, O. Mundi gl, and P . de Cam ill i . 1996. A role of amphiphysin in synaptic vesicle endocytosis suggested by its binding to dynamin in nerve terminals. Proc Natl Acad Sci U S A 993:331-5.

49. DDe Cam ill i , P . , and K. Ta kei. 1996. Molecular mechanisms in synaptic vesicle endocytosis and recycling. Neuron 116:481-6.

50. DDell 'Angelica , E. C. , J . Kl um per ma n, W. Stoorv ogel, a nd J . S. Bonifaci no. 1998. Association of the AP-3 adaptor complex with clathrin. Science 2280 :431-4.

51. DDell 'Angelica , E. C . , V. Shotelersuk, R. C. Agui lar, W. A. Gahl , and J . S. Bonifacino. 1999. Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor. Mol Cell 33:11-21.

52. DDi Fiore, P . P . , a nd P. De Camill i . 2001. Endocytosis and signaling. an inseparable partnership. Cell 110 6:1-4.

53. DDoms, R. W., D. S. Kell er, A. Helenius, a nd W. E. Balc h. 1987. Role for adenosine triphosphate in regulating the assembly and transport of vesicular stomatitis virus G protein trimers. J. Cell Biol. 1105:1957-1969.

54. DDonaldson, J . G. , D. Finazzi , and R. D. Kla usner. 1992. Brefeldin A inhibits Golgi membrane-catalysed exchange of guanine nucleotide onto ARF protein. Nature 360:350-2.

55. DDoray, B. , P . G hosh, J . Griff ith, H. J . Geuz e, and S. Kor nfel d. 2002. Cooperation of GGAs and AP-1 in packaging MPRs at the trans-Golgi network. Science 297:1700-3.

56. DDoughma n, R . L . , A. J . Fi resto ne, and R. A. Anderso n. 2003. Phosphatidylinositol phosphate kinases put PI4,5P(2) in its place. J Membr Biol 1194:77-89.

57. DDrab, M., P . Ver kade, M. Elger, M. Kasper, M. Lo hn, B. La uter bach, J . Menne, C . Li ndscha u, F . Mende, F . C. Luft , A. Schedl, H. Hal ler, and T. V. Kurzc halia. 2001. Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science 2293:2449-52.

58. DDrake, M. T. , M. A. Dow ns, and L. M. T raub. 2000. Epsin binds to clathrin by associating directly with the clathrin-terminal domain. Evidence for cooperative binding through two discrete sites. J Biol Chem 2275 :6479-89.

59. EEfe, J . A . , R . J . Botel ho, and S. D. Emr. 2005. The Fab1 phosphatidylinositol kinase pathway in the regulation of vacuole morphology. Curr Opin Cell Biol 117:402-8.

60. EEhrl ich, M., W. Boll , A. Va n Oi jen, R. Hari hara n, K. Chandra n, M. L . Nibert , and T. Kirc hha usen. 2004. Endocytosis by random initiation and stabilization of clathrin-coated pits. Cell 1118:591-605.

61. EEngqvist-Gol dstei n, A. E. , M. M. Kessels , V. S . C hopra, M. R. Ha yden, and D. G. Drubi n. 1999. An actin-binding protein of the Sla2/Huntingtin interacting protein 1 family is a novel component of clathrin-coated pits and vesicles. J Cell Biol 1147:1503-18.

62. EEngqvist-Gol dstei n, A. E. , R . A. War ren, M. M. Kessel s, J . H. Keen, J . Heuser, and D. G. Drubi n. 2001. The actin-binding protein Hip1R associates with clathrin during early stages of endocytosis and promotes clathrin assembly in vitro. J Cell Biol 154:1209-23.

63. EEngqvist-Gol dstei n, A. E. , C. X. Zhang, S. Ca rreno, C. Barro so, J . E. Heuser, and D. G. Dr ubi n. 2004. RNAi-mediated Hip1R silencing results in stable association between the endocytic machinery and the actin assembly machinery. Mol Biol Cell 15:1666-79.


64. EEsko, J . D . 1991. Genetic analysis of proteoglycan structure, function and metabolism. Curr Opin Cell Biol 33:805-16.

65. FFazioli , F . , L . Mi nichiello, B. Mato skova, W. T. Wong, and P. P . Di Fior e. 1993. eps15, a novel tyrosine kinase substrate, exhibits transforming activity. Mol Cell Biol 13 :5814-28.

66. FFeng, Y. , B. Pr ess , a nd A. Wandi nger-N ess . 1995. Rab 7: an important regulator of late endocytic membrane traffic. J Cell Biol 1131 :1435-52.

67. FFish, K. N. , S. L . Sc hmi d, and H. Damk e. 2000. Evidence that dynamin-2 functions as a signal-transducing GTPase. J Cell Biol 1150 :145-54.

68. FFlett , A. , S. Semer dji eva, A . P . Jackso n, a nd E. Smyt he. 2005. Regulation of the clathrin-coated vesicle cycle by reversible phosphorylation. Biochem Soc Symp::65-70.

69. FFord, M. G. , I . G. Mill s, B . J . Peter, Y . Vall i s, G. J . Praefcke, P. R. Evans, and H. T. Mc Maho n. 2002. Curvature of clathrin-coated pits driven by epsin. Nature 419:361-6.

70. FFotin, A. , Y . C heng, P. Sl iz , N. Gri gori eff , S. C. Ha rrison, T. Kirchha usen, a nd T. Walz. 2004. Molecular model for a complete clathrin lattice from electron cryomicroscopy. Nature 4432:573-9.

71. FFuji moto, L . M., R. Rot h, J . E. Heuser, and S. L . Schmi d. 2000. Actin assembly plays a variable, but not obligatory role in receptor- mediated endocytosis in mammalian cells. Traffic 11 :161-71.

72. FFuji naga, Y. , A. A. Wolf , C. Ro di ghi ero, H. Wheeler, B. Tsai , L . All en, M. G. Jobling, T. Ra po port , R. K. Hol mes, and W. I . L encer. 2003. Gangliosides that associate with lipid rafts mediate transport of cholera and related toxins from the plasma membrane to endoplasmic reticulm. Mol Biol Cell 114:4783-93.

73. FFutter, C. E. , A. Gi bso n, E. H. Allc hin , S. Ma xw ell , L . J . Ruddock , G. Odo rizzi , D. Domi ngo, I . S. Trow bri dge, a nd C. R. Ho pki ns . 1998. In polarized MDCK cells basolateral vesicles arise from clathrin-gamma-adaptin-coated domains on endosomal tubules. J Cell Biol 1141:611-23.

74. GGaidarov, I . , J . G. Kr upnick, J . R . Falck, J . L . Benovic , and J . H. Keen. 1999. Arrestin function in G protein-coupled receptor endocytosis requires phosphoinositide binding. Embo J 118 :871-81.

75. GGaidarov, I . , F . Sa ntini , R. A. Warren, a nd J . H. Keen. 1999. Spatial control of coated-pit dynamics in living cells. Nat Cell Biol 11 :1-7.

76. GGarcia, C. K. , K. Wil und, M. Arca , G. Z uliani , R. Fell i n, M. Maioli , S. Calandra, S . Bertoli ni , F . Cossu, N. Gri shi n, R. Ba rnes, J . C. Co hen, and H. H. Ho bbs. 2001. Autosomal recessive hypercholesterolemia caused by mutations in a putative LDL receptor adaptor protein. Science 2292:1394-8.

77. GGaudi n, Y. 2000. Reversibility in fusion protein conformational changes. The intriguing case of rhabdovirus-induced membrane fusion. Subcell Biochem 334:379-408.

78. GGaudi n, Y. , C . Tufferea u, D. Segr etain, M. Knossow, and A. Flam and. 1991. Reversible conformational changes and fusion activity of rabies virus glycoprotein. J Virol 665:4853-9.

79. GGillooly, D . J . , I . C. Morrow, M. Lindsay, R. Gould, N. J . Br ya nt, J . M. Gaullier, R. G. Parto n, and H. St enma rk. 2000. Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. Embo J 119:4577-88.

80. GGlebov, O. O. , N . A. Bri ght, and B. J . Nic hols. 2006. Flotillin-1 defines a clathrin-independent endocytic pathway in mammalian cells. Nat Cell Biol 88 :46-54.

81. GGoodma n, O. B . , Jr . , J . G . Krupnick, V. V. Gurevi ch, J . L . Benovic , and J . H. Keen. 1997. Arrestin/clathrin interaction. Localization of the arrestin binding locus to the clathrin terminal domain. J Biol Chem 2272:15017-22.

82. GGoodma n, O. B. , Jr . , J . G. Krupnick, F . Santi ni , V . V. Gurev ich, R. B . Penn, A. W. Gagnon, J . H. Keen, a nd J . L . Benov ic . 1996. Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 3383:447-50.

83. GGorvel, J . P . , P . C havrier, M. Z erial , a nd J . Gr uenber g. 1991. rab5 controls early endosome fusion in vitro. Cell 664:915-25.

84. GGottlieb, T. A. , I . E. Iva nov, M. Adesnik , and D. D. Sabati ni . 1993. Actin microfilaments play a critical role in endocytosis at the apical but not the basolateral surface of polarized epithelial cells. J Cell Biol 1120:695-710.

85. GGreene, B. , S. H. Li u, A. Wil de, and F . M. Brodsk y. 2000. Complete reconstitution of clathrin basket formation with recombinant protein fragments: adaptor control of clathrin self-assembly. Traffic 11 :69-75.


86. GGrimm er, S. , B. van Deurs , a nd K. Sa ndvi g. 2002. Membrane ruffling and macropinocytosis in A431 cells require cholesterol. J Cell Sci 1115 :2953-62.

87. GGruenber g, J . 2003. Lipids in endocytic membrane transport and sorting. Curr Opin Cell Biol 115:382-8.

88. GGruenber g, J . 2001. The endocytic pathway: a mosaic of domains. Nat Rev Mol Cell Biol 22 :721-30.

89. GGruenber g, J . , a nd H. Stenmark . 2004. The biogenesis of multivesicular endosomes. Nat Rev Mol Cell Biol 55 :317-23.

90. GGruenber g, J . , a nd F. G. va n der Goot. 2006. Mechanisms of pathogen entry through the endosomal compartments. Nat Rev Mol Cell Biol 77 :495-504.

91. HHa n, M., V. V. Gur evic h, S. A . Vi shnivet ski y, P . B. Si gler, and C. Sc hubert . 2001. Crystal structure of beta-arrestin at 1.9 A: possible mechanism of receptor binding and membrane Translocation. Structure 99:869-80.

92. HHa ucke, V. 2005. Phosphoinositide regulation of clathrin-mediated endocytosis. Biochem Soc Trans 333:1285-9.

93. HHe, G. , S. G upta, M. Yi , P . Michael y, H. H. Hobbs , and J . C. Co hen. 2002. ARH is a modular adaptor protein that interacts with the LDL receptor, clathrin, and AP-2. J Biol Chem 2277:44044-9.

94. HHebert , D. N . , J .- X. Z hang, a nd A. Hel eni us. 1998. Protein folding and maturation in a cell-free system. Biochem. Cell Biol.::In press.

95. HHel eni us , A. 1980. Entry of Semliki forest virus into the host cell. Proceedings of the International Conference on Biological Membranes, Eds. Bloch, K., L. Bolis, and D. C. Tosteson.

96. HHel eni us , A. , J . Kart enbeck, K. Si mons, a nd E. Fries . 1980. On the entry of semliki forest virus into BHK-21 cells. J. Cell Biol. 88 4:404 - 420.

97. HHel eni us , A. , M. Marsh, and J . White. 1980. The entry of viruses into animal cells. Trends in Biochemical Sciences 55:104 - 106.

98. HHel ms, J . B. , a nd J . E. Rothman. 1992. Inhibition by brefeldin A of a Golgi membrane enzyme that catalyses exchange of guanine nucleotide bound to ARF. Nature 3360 :352-4.

99. HHeuser, J . 1980. Three-dimensional visualization of coated vesicle formation in fibroblasts. J Cell Biol 88 4:560-83.

100. HHeuser, J . E. , a nd R. G. Ander son. 1989. Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J Cell Biol 1108:389-400.

101. HHeuser, J . E. , a nd J . Keen. 1988. Deep-etch visualization of proteins involved in clathrin assembly. J Cell Biol 1107:877-86.

102. HHi nrichsen, L . , J . Ha rbort h, L . Andr ees , K. Weber, a nd E. J . Ungewick ell . 2003. Effect of clathrin heavy chain- and alpha-adaptin-specific small inhibitory RNAs on endocytic accessory proteins and receptor trafficking in HeLa cells. J Biol Chem 278 :45160-70.

103. HHir st , J . , A. Motley, K. Harasak i , S. Y . Peak Chew , and M. S. Ro bi nso n. 2003. EpsinR: an ENTH domain-containing protein that interacts with AP-1. Mol Biol Cell 14:625-41.

104. HHow ell , B. W., L . M. La ni er, R. Fra nk, F . B. G ertler , and J . A. Coo per. 1999. The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol Cell Biol 119:5179-88.

105. IIannolo, G. , A. E . Salci ni , I . Gai darov , O. B. G oodma n, Jr . , J . Ba uli da, G. Carpenter, P . G. Pelicci , P . P . Di Fiore, a nd J . H. Keen. 1997. Mapping of the molecular determinants involved in the interaction between eps15 and AP-2. Cancer Res 57:240-5.

106. IIchikawa , S. , N. Nakajo, H. Saki yama, a nd Y. Hi raba yashi. 1994. A mouse B16 melanoma mutant deficient in glycolipids. Proc Natl Acad Sci U S A 991 :2703-7.

107. IItoh, T. , S. Koshiba, T. Ki gawa , A. Kik uchi, S . Yokoyam a, and T. Tak ena wa. 2001. Role of the ENTH domain in phosphatidylinositol-4,5-bisphosphate binding and endocytosis. Science 2291 :1047-51.

108. JJanvier , K. , Y . Kato, M. Boehm, J . R. Ro se, J . A. Ma rtina, B. Y . Kim, S. Venkatesan, and J . S. Bonifaci no. 2003. Recognition of dileucine-based sorting signals from HIV-1 Nef and LIMP-II by the AP-1 gamma-sigma1 and AP-3 delta-sigma3 hemicomplexes. J Cell Biol 1163:1281-90.


109. JJ in, A. J . , and R. Nossal. 1993. Topological mechanisms involved in the formation of clathrin-coated vesicles. Biophys J 665 :1523-37.

110. JJohannessen, L . E . , N. M. P edersen, K. W. Peder sen, I . H. Ma dshus, a nd E. Stang. 2006. Activation of the epidermal growth factor (EGF) receptor induces formation of EGF receptor- and Grb2-containing clathrin-coated pits. Mol Cell Biol 26:389-401.

111. JJohnson, J . E. , M. J . Schnell , L . Buonocor e, and J . K. Rose. 1997. Specific targeting to CD4+ cells of recombinant vesicular stomatitis viruses encoding human immunodeficiency virus envelope proteins. J Virol 771:5060-8.

112. JJones, C. , R . E . Ham mer, W. P. Li , J . C. Co hen, H. H. Ho bbs, a nd J . Herz . 2003. Normal sorting but defective endocytosis of the low density lipoprotein receptor in mice with autosomal recessive hypercholesterolemia. J Biol Chem 2278 :29024-30.

113. KKalia, M., S. Kumari , R . Cha dda, M. M. Hil l , R . G. Parton, a nd S. Mayor . 2006. Arf6-independent GPI-anchored protein-enriched early endosomal compartments fuse with sorting endosomes via a Rab5/phosphatidylinositol-3'-kinase-dependent machinery. Mol Biol Cell 117:3689-704.

114. KKalthoff , C. , J . Alv es, C. Ur ba nke, R. Knor r, a nd E. J . Ungewickell . 2002. Unusual structural organization of the endocytic proteins AP180 and epsin 1. J Biol Chem 2277:8209-16.

115. KKana seki, T . , and K. Kadota. 1969. The "vesicle in a basket". A morphological study of the coated vesicle isolated from the nerve endings of the guinea pig brain, with special reference to the mechanism of membrane movements. J Cell Biol 442:202-20.

116. KKartenbeck, J . , H. St ukenbrok, a nd A. Helenius. 1989. Endocytosis of simian virus 40 into the endoplasmic reticulum. J Cell Biol 110 9:2721-9.

117. KKasam atsu, H. , and A. Naka nishi. 1998. How do animal DNA viruses get to the nucleus? Annu Rev Microbiol 552:627-86.

118. KKatzmann, D. J . , M. Babst, and S. D. Emr. 2001. Ubiquitin-dependent sorting into the multivesicular body pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I. Cell 110 6:145-55.

119. KKielia n, M. C. , S. Ker anen, L . Kaariai nen, and A. Helenius. 1984. Membrane fusion mutants of Semliki Forest virus. J Cell Biol 998 :139-45.

120. KKirchhausen, T. 1999. Adaptors for clathrin-mediated traffic. Annu Rev Cell Dev Biol 15:705-32.

121. KKirchhausen, T. 2000. Clathrin. Annu Rev Biochem 669:699-727. 122. KKirchhausen, T . , J . S. Bonifaci no, a nd H. R iezma n. 1997. Linking cargo to vesicle

formation: receptor tail interactions with coat proteins. Curr Opin Cell Biol 99:488-95. 123. KKirchhausen, T. , a nd S. C. Harri son. 1984. Structural domains of clathrin heavy

chains. J Cell Biol 999:1725-34. 124. KKirchhausen, T. , K. L . Nat hanson, W. Matsui, A. Vaisberg, E. P . C how, C.

Burne, J . H. Keen, a nd A. E. Davis . 1989. Structural and functional division into two domains of the large (100- to 115-kDa) chains of the clathrin-associated protein complex AP-2. Proc Natl Acad Sci U S A 88 6:2612-6.

125. KKirkham, M., A. F uj ita, R. C ha dda, S. J . Ni xo n, T. V. Kurzchalia, D. K. Shar ma, R . E . Pa gano, J . F . Hancock, S. Ma yo r, and R. G. Pa rton. 2005. Ultrastructural identification of uncoated caveolin-independent early endocytic vehicles. J Cell Biol 1168 :465-76.

126. KKlimstr a, W. B. , E. M. Nangl e, M. S . Smit h, A . D. Yurochko , and K. D. Ryma n. 2003. DC-SIGN and L-SIGN can act as attachment receptors for alphaviruses and distinguish between mosquito cell- and mammalian cell-derived viruses. J Virol 77 :12022-32.

127. KKoba yashi, T . , E. Stang, K. S. Fang, P. de Moer loose, R. G. Parton, and J . Gruenber g. 1998. A lipid associated with the antiphospholipid syndrome regulates endosome structure and function. Nature 3392:193-7.

128. KKornfeld, S. , a nd I . Mellm an. 1989. The biogenesis of lysosomes. Annu Rev Cell Biol 5:483-525.

129. KKrauss, M., M. Ki nuta, M. R. Wenk , P. D e Ca mill i , K. Ta kei, a nd V. Ha ucke. 2003. ARF6 stimulates clathrin/AP-2 recruitment to synaptic membranes by activating phosphatidylinositol phosphate kinase type Igamma. J Cell Biol 1162:113-24.

130. KKrendel, M., E. K. Osterw eil , a nd M. S. Mooseker. 2007. Myosin 1E interacts with synaptojanin-1 and dynamin and is involved in endocytosis. FEBS Lett 558 1:644-50.


131. KKretzsc hmar , E. , L . Buo nocore, M. J . Schnell , and J . K . Rose. 1997. High-efficiency incorporation of functional influenza virus glycoproteins into recombinant vesicular stomatitis viruses. J Virol 771:5982-9.

132. KKrishna n, H. H. , P . P . Naranatt , M. S. Smit h, L . Zeng, C. Bloomer, and B. Chandra n. 2004. Concurrent expression of latent and a limited number of lytic genes with immune modulation and antiapoptotic function by Kaposi's sarcoma-associated herpesvirus early during infection of primary endothelial and fibroblast cells and subsequent decline of lytic gene expression. J Virol 778 :3601-20.

133. KKrupnick, J . G. , O. B . Goo dma n, Jr . , J . H. Keen, a nd J . L . Benovic . 1997. Arrestin/clathrin interaction. Localization of the clathrin binding domain of nonvisual arrestins to the carboxy terminus. J Biol Chem 2272:15011-6.

134. KKum ari, S. , and S. Ma yor. 2008. ARF1 is directly involved in dynamin-independent endocytosis. Nat Cell Biol 110 :30-41.

135. KKusum i, A. , Y . Sako, a nd M. Yama moto. 1993. Confined lateral diffusion of membrane receptors as studied by single particle tracking (nanovid microscopy). Effects of calcium-induced differentiation in cultured epithelial cells. Biophys J 665 :2021-40.

136. LLajoie, P . , a nd I . R . Nabi . 2007. Regulation of raft-dependent endocytosis. J Cell Mol Med 111 :644-53.

137. LLakada mya li , M., M. J . R ust , a nd X. Z hua ng. 2006. Ligands for clathrin-mediated endocytosis are differentially sorted into distinct populations of early endosomes. Cell 124:997-1009.

138. LLamaze, C . , A. D ujeanco urt , T. Ba ba, C. G. Lo, A. Benm erah, and A. Dautr y-Var sat. 2001. Interleukin 2 receptors and detergent-resistant membrane domains define a clathrin-independent endocytic pathway. Mol Cell 77 :661-71.

139. LLaporte, S. A. , R . H. Oakley, J . A. Holt , L . S. Barak, and M. G. Caron. 2000. The interaction of beta-arrestin with the AP-2 adaptor is required for the clustering of beta 2-adrenergic receptor into clathrin-coated pits. J Biol Chem 2275 :23120-6.

140. LLaporte, S . A. , R . H. Oakl ey, J . Zhang, J . A. Holt , S . S. Ferguso n, M. G. Caro n, and L. S. Barak. 1999. The beta2-adrenergic receptor/betaarrestin complex recruits the clathrin adaptor AP-2 during endocytosis. Proc Natl Acad Sci U S A 996:3712-7.

141. LLe Bla nc, I . , P . P . Luyet, V. Pons, C. Fer guso n, N. Emans, A. Petiot , N. Ma yran, N. Demaurex, J . Fa ure, R. Sa doul , R. G. Parton, and J . Gr uenber g. 2005. Endosome-to-cytosol transport of viral nucleocapsids. Nat Cell Biol 77:653-64.

142. LLe Bor gne, R. , A. Alconada, U. Bauer, and B. Hoflack. 1998. The mammalian AP-3 adaptor-like complex mediates the intracellular transport of lysosomal membrane glycoproteins. J Biol Chem 2273:29451-61.

143. LLe Bor gne, R. , and B. Hoflack. 1997. Mannose 6-phosphate receptors regulate the formation of clathrin-coated vesicles in the TGN. J Cell Biol 1137 :335-45.

144. LLe, P . U. , G. G ua y, Y. Altschul er, a nd I . R . Na bi. 2002. Caveolin-1 is a negative regulator of caveolae-mediated endocytosis to the endoplasmic reticulum. J Biol Chem 277:3371-9.

145. LLee, D. W., X. Wu, E. Ei senberg, and L. E. Greene. 2006. Recruitment dynamics of GAK and auxilin to clathrin-coated pits during endocytosis. J Cell Sci 11 19:3502-12.

146. LLefrancoi s, L . , a nd D. S. L yles . 1982. The interaction of antibody with the major surface glycoprotein of vesicular stomatitis virus. I. Analysis of neutralizing epitopes with monoclonal antibodies. 1121:157-166.

147. LLegendre-Guill emi n, V. , M. Metzl er, M. C harbo nnea u, L . Ga n, V. Cho pra, J . Phil ie, M. R. Ha yden, a nd P. S . McP herson. 2002. HIP1 and HIP12 display differential binding to F-actin, AP2, and clathrin. Identification of a novel interaction with clathrin light chain. J Biol Chem 2277:19897-904.

148. LLegendre-Guill emi n, V. , M. Metzl er, J . F . Lemai re, J . P hil ie, L . Ga n, M. R. Ha yden, a nd P. S. McPherso n. 2005. Huntingtin interacting protein 1 (HIP1) regulates clathrin assembly through direct binding to the regulatory region of the clathrin light chain. J Biol Chem 2280 :6101-8.

149. LLegendre-Guill emi n, V. , S . Wasiak , N. K. Hussain, A. Anger s, and P. S . McPherso n. 2004. ENTH/ANTH proteins and clathrin-mediated membrane budding. J Cell Sci 1117:9-18.

150. LLemmo n, S. K. 2001. Clathrin uncoating: Auxilin comes to life. Curr Biol 111 :R49-52. 151. LLetour neur, F . , a nd R. D. Kla usner . 1992. A novel di-leucine motif and a tyrosine-

based motif independently mediate lysosomal targeting and endocytosis of CD3 chains. Cell 669:1143-57.


152. LLichte, B. , R . W. Veh, H. E . Meyer, a nd M. W. Ki l imann. 1992. Amphiphysin, a novel protein associated with synaptic vesicles. Embo J 11 1:2521-30.

153. LLindner, R. , and E. Ungewickell . 1992. Clathrin-associated proteins of bovine brain coated vesicles. An analysis of their number and assembly-promoting activity. J Biol Chem 2267:16567-73.

154. LLorenzo, O. , S. Ur be, and M. J . Clague. 2006. Systematic analysis of myotubularins: heteromeric interactions, subcellular localisation and endosome related functions. J Cell Sci 1119:2953-9.

155. LLundma rk, R. , and S. R. Ca rlsson. 2004. Regulated membrane recruitment of dynamin-2 mediated by sorting nexin 9. J Biol Chem 2279:42694-702.

156. LLundma rk, R. , and S. R. Carl sso n. 2003. Sorting nexin 9 participates in clathrin-mediated endocytosis through interactions with the core components. J Biol Chem 278 :46772-81.

157. MMacia, E. , M. Ehrlic h, R. Ma ssol, E. Bo uc rot, C. Brunner, a nd T. Kirchhausen. 2006. Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell 110 :839-50.

158. MMacia, E. , F . Luto n, M. Partisani, J . Cherfi ls , P . Chardi n, and M. Fra nco. 2004. The GDP-bound form of Arf6 is located at the plasma membrane. J Cell Sci 117 :2389-98.

159. MMagada n, J . G. , M. A. Ba rbi eri , R. Mesa, P. D . Sta hl, a nd L. S. Ma yorga. 2006. Rab22a regulates the sorting of transferrin to recycling endosomes. Mol Cell Biol 26:2595-614.

160. MMarsh, M., and R. Bro n. 1997. SFV infection in CHO cells: cell-type specific restrictions to productive virus entry at the cell surface. J Cell Sci 1110 ( Pt 1) :95-103.

161. MMarsh, M., a nd A. Helenius. 2006. Virus entry: open sesame. Cell 1124:729-40. 162. MMarsh, M., M.C. Ki elia n, and A. Heleni us. 1985. Semliki Forest virus entry and the

endocytic pathway. Trans. Biochem. Soc. 112 :981-983. 163. MMassol, R . H. , W. Boll , A. M. Griff i n, a nd T. Ki rchha usen. 2006. A burst of

auxilin recruitment determines the onset of clathrin-coated vesicle uncoating. Proc Natl Acad Sci U S A 110 3:10265-70.

164. MMatlin , K. S. , H. Reggio, A. Heleni us and K. Simons. 1982. The pathway of Vesicular Stomatitis virus entry leading to infection. J. Mol. Biol. 115 6:609-631.

165. MMatlin , K. S. , H. Reggio, A. Heleni us, a nd K. Simo ns. 1981. Infectiuos entry pathway of Influenza virus in a Canine kidney cell line. J. Cell. Biol. 991:601-613.

166. MMaurer, M. E. , a nd J . A. Coo per. 2006. The adaptor protein Dab2 sorts LDL receptors into coated pits independently of AP-2 and ARH. J Cell Sci 11 19:4235-46.

167. MMa yor, S. , and R. E . Pa gano . 2007. Pathways of clathrin-independent endocytosis. Nat Rev Mol Cell Biol.

168. MMa yran, N. , R. G . Parton, a nd J . Gr uenber g. 2003. Annexin II regulates multivesicular endosome biogenesis in the degradation pathway of animal cells. Embo J 222:3242-53.

169. MMcMa ho n, H. T. , P . Wi gge, and C. Smit h. 1997. Clathrin interacts specifically with amphiphysin and is displaced by dynamin. FEBS Lett 4413:319-22.

170. MMcNiven, M. A. 1998. Dynamin: a molecular motor with pinchase action. Cell 994:151-4.

171. MMcNiven, M. A. , L . K im, E . W. Krueger, J . D. Orth, H. Cao, a nd T. W. Wo ng. 2000. Regulated interactions between dynamin and the actin-binding protein cortactin modulate cell shape. J Cell Biol 115 1:187-98.

172. MMell man, I . 1996. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol 112:575-625.

173. MMell man, I . , R . F uchs, and A. Hel eni us. 1985. Acidification of endocytic and exocytic pathways. Ann. Rev. Biochem. 555 :663 - 700.

174. MMerc er, J . , and A. Helenius. 2008. Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells. Science 3320:531-5.

175. MMer esse, S. , J . P . Gor vel , a nd P. C havrier. 1995. The rab7 GTPase resides on a vesicular compartment connected to lysosomes. J Cell Sci 110 8 ( Pt 1 1) :3349-58.

176. MMer rif iel d, C. J . , M. E. F eldman, L . Wa n, a nd W. Al mer s. 2002. Imaging actin and dynamin recruitment during invagination of single clathrin-coated pits. Nat Cell Biol 44:691-8.


177. MMer rif iel d, C. J . , S. E. Moss , C. Ba llestr em, B. A. Im hof, G. Gi ese, I . Wunderlich, and W. Al mer s. 1999. Endocytic vesicles move at the tips of actin tails in cultured mast cells. Nat Cell Biol 11 :72-4.

178. MMer rif iel d, C. J . , D. Per rais, and D. Zenisek. 2005. Coupling between clathrin-coated-pit invagination, cortactin recruitment, and membrane scission observed in live cells. Cell 1121:593-606.

179. MMetzler, M., V. Legendre-G uillemin, L . Gan, V. Cho pra, A. Kwok , P. S. McPherso n, a nd M. R. Ha yden. 2001. HIP1 functions in clathrin-mediated endocytosis through binding to clathrin and adaptor protein 2. J Biol Chem 2276:39271-6.

180. MMeyer, C. , D. Zizioli , S. Lausma nn, E . L . Eskeli nen, J . Hama nn, P. Saftig , K. von Figura, and P. Schu. 2000. mu1A-adaptin-deficient mice: lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. Embo J 119:2193-203.

181. MMeyerholz, A. , L . Hi nric hsen, S. G roos, P . C. Esk, G. Bra ndes, and E. J . Ungewickell . 2005. Effect of clathrin assembly lymphoid myeloid leukemia protein depletion on clathrin coat formation. Traffic 66:1225-34.

182. MMichell , R . H. , V. L . Heath, M. A. Lemmo n, and S. K . Dove. 2006. Phosphatidylinositol 3,5-bisphosphate: metabolism and cellular functions. Trends Biochem Sci 331 :52-63.

183. MMicheva, K. D. , B. K. Ka y, and P. S. McP her son. 1997. Synaptojanin forms two separate complexes in the nerve terminal. Interactions with endophilin and amphiphysin. J Biol Chem 2272:27239-45.

184. MMicheva, K. D. , A. R . Ra mja un, B. K. Kay, a nd P. S. McP her son. 1997. SH3 domain-dependent interactions of endophilin with amphiphysin. FEBS Lett 4414:308-12.

185. MMila no, S. K. , H. C. P ace, Y. M. Ki m, C. Brenner, a nd J . L . Benovic . 2002. Scaffolding functions of arrestin-2 revealed by crystal structure and mutagenesis. Biochemistry 441 :3321-8.

186. MMiller, D. K. , a nd J . L ena rd. 1980. Inhibition of vesicular stomatitis virus infection by spike glycoprotein. Evidence for an intracellular, G protein-requiring step. J Cell Biol 84:430-7.

187. MMills , I . G. , G. J . Pra efcke, Y. Vall i s, B. J . Pet er, L . E. Olesen, J . L . Gallo p, P. J . Butl er, P . R. Evans, a nd H. T . Mc Ma hon. 2003. EpsinR: an AP1/clathrin interacting protein involved in vesicle trafficking. J Cell Biol 1160 :213-22.

188. MMishra, S. K. , N . R. Agosti nell i , T . J . Brett , I . Miz ukami, T. S. Ro ss, a nd L. M. Traub. 2001. Clathrin- and AP-2-binding sites in HIP1 uncover a general assembly role for endocytic accessory proteins. J Biol Chem 2276:46230-6.

189. MMishra, S. K. , P . A. Keyel , M. J . Ha wr yluk , N. R. Ago stinell i , S. C. Watki ns, and L. M. Tra ub. 2002. Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor. Embo J 221 :4915-26.

190. MMishra, S. K. , S. C. Watkins, a nd L. M. T raub. 2002. The autosomal recessive hypercholesterolemia (ARH) protein interfaces directly with the clathrin-coat machinery. Proc Natl Acad Sci U S A 999:16099-104.

191. MMor gan, J . R . , K. Prasa d, S. J i n, G. J . Augusti ne, and E. M. Lafer . 2003. Eps15 homology domain-NPF motif interactions regulate clathrin coat assembly during synaptic vesicle recycling. J Biol Chem 2278:33583-92.

192. MMor gan, J . R . , X. Z hao, M. Womack, K. Prasad, G. J . Augusti ne, and E. M. Lafer. 1999. A role for the clathrin assembly domain of AP180 in synaptic vesicle endocytosis. J Neurosci 119:10201-12.

193. MMorri s, S. A. , S. Sc hroder, U. Plessmann, K . Weber, and E. Ungewickell . 1993. Clathrin assembly protein AP180: primary structure, domain organization and identification of a clathrin binding site. Embo J 112:667-75.

194. MMorri s, S . M., S. D. Arden, R. C . Ro bert s, J . Kendr ick-Jones, J . A. Coo per, J . P . Luzio, a nd F. Buss. 2002. Myosin VI binds to and localises with Dab2, potentially linking receptor-mediated endocytosis and the actin cytoskeleton. Traffic 33:331-41.

195. MMorri s, S. M., a nd J . A. Coo per . 2001. Disabled-2 colocalizes with the LDLR in clathrin-coated pits and interacts with AP-2. Traffic 22 :111-23.

196. MMotley, A . , N. A. Bri ght, M. N. Seama n, and M. S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J Cell Biol 1162:909-18.

197. MMuhl ber g, A. B. , D. E. Wa rnock, a nd S. L . Sc hmi d. 1997. Domain structure and intramolecular regulation of dynamin GTPase. Embo J 116:6676-83.


198. MMuro, S. , R . Wiewro dt, A. T homa s, L . Ko nia ris, S. M. Al belda, V. R. Muz yka ntov, a nd M. Koval. 2003. A novel endocytic pathway induced by clustering endothelial ICAM-1 or PECAM-1. J Cell Sci 1116:1599-609.

199. MMurphy, J . E. , I . T . Pleasure, S. P uszki n, K. Pr asad, a nd J . H. Keen. 1991. Clathrin assembly protein AP-3. The identity of the 155K protein, AP 180, and NP185 and demonstration of a clathrin binding domain. J Biol Chem 2266:4401-8.

200. NNabi, I . R . , a nd P. U. L e. 2003. Caveolae/raft-dependent endocytosis. J Cell Biol 161:673-7.

201. NNankoe, S. R. , a nd S. Sever. 2006. Dynasore puts a new spin on dynamin: a surprising dual role during vesicle formation. Trends Cell Biol 116:607-9.

202. NNaraya na n, R. , M. Leonard, B. D. So ng, S. L . Sc hmi d, a nd M. R amaswami . 2005. An internal GAP domain negatively regulates presynaptic dynamin in vivo: a two-step model for dynamin function. J Cell Biol 1169:117-26.

203. NNaslavsky, N. , R. Weigert , a nd J . G. Donal dso n. 2004. Characterization of a nonclathrin endocytic pathway: membrane cargo and lipid requirements. Mol Biol Cell 15:3542-52.

204. NNaslavsky, N. , R. Wei gert , and J . G. Donaldso n. 2003. Convergence of non-clathrin- and clathrin-derived endosomes involves Arf6 inactivation and changes in phosphoinositides. Mol Biol Cell 114:417-31.

205. NNestero v, A. , R. E. Cart er, T . Sorki na, G. N. Gil l , and A. Sorki n. 1999. Inhibition of the receptor-binding function of clathrin adaptor protein AP-2 by dominant-negative mutant mu2 subunit and its effects on endocytosis. Embo J 118 :2489-99.

206. NNewm yer, S . L . , A. C hrist ensen, and S. Sev er. 2003. Auxilin-dynamin interactions link the uncoating ATPase chaperone machinery with vesicle formation. Dev Cell 44:929-40.

207. NNg, D. T. , E. D. Spear, and P. Walter. 2000. The unfolded protein response regulates multiple aspects of secretory and membrane protein biogenesis and endoplasmic reticulum quality control. J Cell Biol 1150 :77-88.

208. NNonet, M. L . , A . M. Hol ga do, F . Br ew er, C. J . Ser pe, B. A. Nor beck, J . Holleran, L . Wei , E. Ha rtwieg, E. M. Jor gensen, and A. Alfo nso. 1999. UNC-11, a Caenorhabditis elegans AP180 homologue, regulates the size and protein composition of synaptic vesicles. Mol Biol Cell 110 :2343-60.

209. NNorris, F . A. , E. Ungewickell , a nd P. W. Majerus. 1995. Inositol hexakisphosphate binds to clathrin assembly protein 3 (AP-3/AP180) and inhibits clathrin cage assembly in vitro. J Biol Chem 2270:214-7.

210. OOhkuma, S. , a nd B. Poole. 1978. Fluorescence probe measurement of the intralysosomal pH in living cells and the perturbation of pH by various agents. Proc Natl Acad Sci U S A 775 :3327-31.

211. OOhno, H. , J . Stewart , M. C. Fourni er, H. Bossha rt , I . R hee, S. Mi yatak e, T . Saito, A. Gall usser, T. Ki rchhausen, and J . S. Bonifacino. 1995. Interaction of tyrosine-based sorting signals with clathrin-associated proteins. Science 2269:1872-5.

212. OOrci , L . , B. S. Glick, a nd J . E. Rothma n. 1986. A new type of coated vesicular carrier that appears not to contain clathrin: its possible role in protein transport within the Golgi stack. Cell 446:171 - 184.

213. OOrci , L . , D. J . Pal mer, M. Ravazzola, A. Perrel et , M. Amherdt, a nd J . E . Rothma n. 1993. Budding from Golgi membranes requires the coatomer complex of non-clathrin coat proteins. Nature 3362:648-52.

214. OOrci , L . , A. Perrel et , M. Rav azzola, F . T . Wiela nd, R. Schekma n, and J . E. Rothma n. 1993. "BFA bodies": a subcompartment of the endoplasmic reticulum. Proc Natl Acad Sci U S A 990 :11089-93.

215. OOrci , L . , M. Taga ya, M. Am herdt, A. Perr elet , J . G . Donaldso n, J . Lippi ncott-Schwa rtz, R. D. Klausner, a nd J . E. Rothman. 1991. Brefeldin A, a drug that blocks secretion, blocks the formation of non-clathrin coated buds on Golgi cisternae. Cell 64:1183-1195.

216. OOrth, J . D. , E. W. Krueger, S. G. Well er, and M. A. McNiv en. 2006. A novel endocytic mechanism of epidermal growth factor receptor sequestration and internalization. Cancer Res 666:3603-10.

217. OOw en, D. J . 2004. Linking endocytic cargo to clathrin: structural and functional insights into coated vesicle formation. Biochem Soc Trans 332:1-14.

218. OOw en, D. J . , B. M. Coll i ns , and P. R. Evans. 2004. Adaptors for clathrin coats: structure and function. Annu Rev Cell Dev Biol 220:153-91.


219. OOw en, D. J . , a nd P. R. Eva ns. 1998. A structural explanation for the recognition of tyrosine-based endocytotic signals. Science 228 2:1327-32.

220. OOw en, D. J . , Y . Vall i s, M. E. No ble, J . B. Hunt er, T. R. Daffor n, P. R. Evans, and H. T. Mc Ma hon. 1999. A structural explanation for the binding of multiple ligands by the alpha-adaptin appendage domain. Cell 997:805-15.

221. OOw en, D . J . , Y . Vall i s, B. M. Pea rse , H. T. McMa hon, a nd P. R. Evans. 2000. The structure and function of the beta 2-adaptin appendage domain. Embo J 119:4216-27.

222. OOw en, D. J . , P . Wigge, Y. Vall i s, J . D. Moo r e, P. R. Eva ns, a nd H. T. McMa ho n. 1998. Crystal structure of the amphiphysin-2 SH3 domain and its role in the prevention of dynamin ring formation. Embo J 117 :5273-85.

223. PPawso n, T. 2007. Dynamic control of signaling by modular adaptor proteins. Curr Opin Cell Biol 119:112-6.

224. PPelkma ns, L . , E. Fava, H. Gra bner, M. Hannus, B. Haberma nn, E. Krausz, and M. Z erial . 2005. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature.

225. PPelkma ns, L . , a nd A. Hel enius. 2002. Endocytosis via caveolae. Traffic 33:311-20. 226. PPelkma ns, L . , and A. Hel eni us . 2003. Insider information: what viruses tell us about

endocytosis. Curr Opin Cell Biol 115 :414-22. 227. PPelkma ns, L . , J . Kart enbeck, a nd A. Helenius. 2001. Caveolar endocytosis of

simian virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nat Cell Biol 33:473-83.

228. PPelkma ns, L . , D. P untener, a nd A. Hel eni us. 2002. Local Actin Polymerization and Dynamin Recruitment in SV40-Induced Internalization of Caveolae. Science 2296:535-9.

229. PPepperkok, R. , J . Sc heel , H. Horstma nn, H. P. Hauri , G. G riff iths , and T. E. Krei s. 1993. Beta-COP is essential for biosynthetic membrane transport from the endoplasmic reticulum to the Golgi complex in vivo. Cell 774:71-82.

230. PPereira -Leal, J . B . , and M. C. Sea bra. 2000. The mammalian Rab family of small GTPases: definition of family and subfamily sequence motifs suggests a mechanism for functional specificity in the Ras superfamily. J Mol Biol 3301:1077-87.

231. PPeter, B. J . , H. M. Kent, I . G . Mi lls, Y . Va ll is, P . J . Butler, P . R. Evans, a nd H. T. Mc Ma hon. 2004. BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science 3303:495-9.

232. PPolo, S. , S. Sigism und, M. Faretta, M. Guidi , M. R . Capua , G. Bossi , H. C hen, P. De Camil l i , a nd P. P. Di Fiore. 2002. A single motif responsible for ubiquitin recognition and monoubiquitination in endocytic proteins. Nature 4416:451-5.

233. PPress, B. , Y . Feng, B. Hoflack, and A. Wandi nger- Ness. 1998. Mutant Rab7 causes the accumulation of cathepsin D and cation-independent mannose 6-phosphate receptor in an early endocytic compartment. J Cell Biol 1140:1075-89.

234. PProgi da, C. , L . Malero d, S. Stuffer s, A. Brech, C. Bucci , and H. Stenmark . 2007. RILP is required for the proper morphology and function of late endosomes. J Cell Sci 1120 :3729-37.

235. PPulver muller, A. , K. Sc hroder, T. Fischer, a nd K. P. Hof mann. 2000. Interactions of metarhodopsin II. Arrestin peptides compete with arrestin and transducin. J Biol Chem 2275 :37679-85.

236. PPuri , V. , R . Watana be, R. D. Singh, M. Domi nguez, J . C. Brow n, C . L . Wheatl ey, D . L . Mark s, and R. E. Pa gano. 2001. Clathrin-dependent and -independent internalization of plasma membrane sphingolipids initiates two Golgi targeting pathways. J Cell Biol 1154:535-47.

237. QQui rin, K. , B. Eschl i , I . Scheu, L . Poort , J . Ka rtenbeck, and A. Heleni us. 2008. Lymphocytic choriomeningitis virus uses a novel endocytic pathway for infectious entry via late endosomes. Virology 3378 :21-33.

238. QQui rin, K. , Esc hli , B. , Sc heu, I . , Poort , L . , Ka rtenbeck, J . , Heleni us, A. 2008. Lymphocytic choriomeningitis virus uses a novel endocytic pathway for infectious entry via late endosomes. Virology ii n press.

239. RRaibor g, C. , and H. Stenm ark. 2002. Hrs and endocytic sorting of ubiquitinated membrane proteins. Cell Struct Funct 227:403-8.

240. RRapo port , I . , W. Boll , A . Yu, T. Bocking, a nd T. K irchha usen. 2008. A motif in the clathrin heavy chain required for the hsc70/auxilin uncoating reaction. Mol Biol Cell 19:405-13.


241. RRappoport , J . Z . , A. Benmera h, a nd S . M. Sim on. 2005. Analysis of the AP-2 adaptor complex and cargo during clathrin-mediated endocytosis. Traffic 66:539-47.

242. RRappoport , J . Z . , S. Kemal , A. Benm erah, and S. M. Simo n. 2006. Dynamics of clathrin and adaptor proteins during endocytosis. Am J Physiol Cell Physiol 2291:C1072-81.

243. RRappoport , J . Z . , a nd S. M. Si mon. 2003. Real-time analysis of clathrin-mediated endocytosis during cell migration. J Cell Sci 1116:847-55.

244. RRappoport , J . Z . , S. M. Simo n, a nd A. Benm era h. 2004. Understanding living clathrin-coated pits. Traffic 55 :327-37.

245. RRappoport , J . Z . , B. W. Ta ha, S. L em eer, A. Benm erah, and S. M. Si mon. 2003. The AP-2 complex is excluded from the dynamic population of plasma membrane-associated clathrin. J Biol Chem 2278 :47357-60.

246. RRappoport , J . Z . , B. W. Ta ha, and S. M. Si mon. 2003. Movement of plasma-membrane-associated clathrin spots along the microtubule cytoskeleton. Traffic 44:460-7.

247. RRicotta, D. , S. D. Conner, S. L . Sc hmi d, K. vo n Fi gura , and S. Honi ng. 2002. Phosphorylation of the AP2 mu subunit by AAK1 mediates high affinity binding to membrane protein sorting signals. J Cell Biol 115 6:791-5.

248. RRingstad, N. , Y . Nemoto, and P. De Camil l i . 1997. The SH3p4/Sh3p8/SH3p13 protein family: binding partners for synaptojanin and dynamin via a Grb2-like Src homology 3 domain. Proc Natl Acad Sci U S A 994:8569-74.

249. RRink, J . , E. Ghigo, Y. Kalai dzi dis, a nd M. Zeri al . 2005. Rab conversion as a mechanism of progression from early to late endosomes. Cell 1122:735-49.

250. RRobinson, F . L . , and J . E. Dixo n. 2006. Myotubularin phosphatases: policing 3-phosphoinositides. Trends Cell Biol 116:403-12.

251. RRobinson, M. S. 1987. 100-kD coated vesicle proteins: molecular heterogeneity and intracellular distribution studied with monoclonal antibodies. J Cell Biol 110 4:887-95.

252. RRobinson, M. S. 2004. Adaptable adaptors for coated vesicles. Trends Cell Biol 114:167-74.

253. RRobinson, M. S. 1994. The role of clathrin, adaptors and dynamin in endocytosis. Curr Opin Cell Biol 66:538-44.

254. RRoche, S . , A . A. Al berti ni , J . L epa ult , S. Br essa nell i , a nd Y. Gaudi n. 2008. Structures of vesicular stomatitis virus glycoprotein: membrane fusion revisited. Cell Mol Life Sci.

255. RRoche, S . , S. Bressa nell i , F . A. R ey, and Y. Gaudi n. 2006. Crystal structure of the low-pH form of the vesicular stomatitis virus glycoprotein G. Science 3313:187-91.

256. RRoche, S. , F . A. Rey, Y. Ga udi n, a nd S . Bressa nell i . 2007. Structure of the prefusion form of the vesicular stomatitis virus glycoprotein G. Science 3315 :843-8.

257. RRohde, G. , D. Wenz el, and V. Hauck e. 2002. A phosphatidylinositol (4,5)-bisphosphate binding site within mu2-adaptin regulates clathrin-mediated endocytosis. J Cell Biol 1158 :209-14.

258. RRojek, J . M., M. P er ez, and S . Kunz. 2008. Cellular entry of lymphocytic choriomeningitis virus. J Virol 88 2:1505-17.

259. RRose, J . K. , and M. A. Whitt . 2001. Rhabdoviridae: the viruses and their replication. Fields, 4th ed.::1221-1224.

260. RRoux, A. , K. Uyhazi, A. F rost , a nd P. D e Ca mill i . 2006. GTP-dependent twisting of dynamin implicates constriction and tension in membrane fission. Nature 4441 :528-31.

261. RRust, M. J . , M. Laka dam yali , F . Z hang, a nd X. Zhua ng. 2004. Assembly of endocytic machinery around individual influenza viruses during viral entry. Nat Struct Mol Biol 11 1:567-73.

262. SSabhara njak , S. , a nd S. Ma yor. 2004. Folate receptor endocytosis and trafficking. Adv Drug Deliv Rev 556:1099-109.

263. SSabhara njak , S. , P . Sha rma, R. G. P arton, and S. Mayo r. 2002. GPI-anchored proteins are delivered to recycling endosomes via a distinct cdc42-regulated, clathrin-independent pinocytic pathway. Dev Cell 22:411-23.

264. SSako, Y. , and A. Kusumi. 1994. Compartmentalized structure of the plasma membrane for receptor movements as revealed by a nanometer-level motion analysis. J Cell Biol 1125 :1251-64.

265. SSalcini , A. E. , S. Confalo nieri , M. Doria, E. Sa ntol ini , E. Ta ssi , O. Mi nenkova, G. Cesareni, P . G. Pelicci , and P. P . Di Fior e. 1997. Binding specificity and in vivo


targets of the EH domain, a novel protein-protein interaction module. Genes Dev 11:2239-49.

266. SSanti ni , F . , I . Gaidarov , and J . H. Keen. 2002. G protein-coupled receptor/arrestin3 modulation of the endocytic machinery. J Cell Biol 115 6:665-76.

267. SScales, S . J . , a nd R. H. Sc hel ler. 1999. Lipid membranes shape up. Nature 4401 :123-4. 268. SSchal etzky, J . , S. K. Dov e, B. Short , O. Lorenzo, M. J . Cla gue, and F. A. Barr.

2003. Phosphatidylinositol-5-phosphate activation and conserved substrate specificity of the myotubularin phosphatidylinositol 3-phosphatases. Curr Biol 113:504-9.

269. SScheele, U. , J . Alves, R. Fra nk, M. Duw el, C. Kal thoff , and E. Ungewic kell . 2003. Molecular and functional characterization of clathrin- and AP-2-binding determinants within a disordered domain of auxilin. J Biol Chem 2278:25357-68.

270. SScheele, U. , C. Kalt hoff , and E. Ungewickell . 2001. Multiple interactions of auxilin 1 with clathrin and the AP-2 adaptor complex. J Biol Chem 2276:36131-8.

271. SSchlegel, R. , T . S. Tral ka, M. C. Wi ll ingham, a nd I . Pastan. 1983. Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV-binding site? Cell 332:639-46.

272. SSchl unck, G. , H. Da mke, W. B. Kiosses , N. R usk, M. H. Symo ns, C . M. Waterma n-Stor er, S. L . Sc hmi d, and M. A. Sc hw artz. 2004. Modulation of Rac localization and function by dynamin. Mol Biol Cell 115:256-67.

273. SSchmi d, S. , R . F uchs, M. Ki elian, A. Heleni us, and I . Mell man. 1989. Acidification pf endosome subpopulations in wild-type chinese hamster ovary cells and temperature-sensitive acification-defective mutants. J.Cell Biol. 1108 :1291-1300.

274. SSchmi d, S. L . 1997. Clathrin-coated vesicle formation and protein sorting: an integrated process. Annu Rev Biochem 666:511-48.

275. SSchmi dt, A . , M. Wol de, C. Thiele , W. F est , H. Kratzin, A. V. Podt elejnikov, W. Witke, W. B. Huttner, a nd H. D. Soling. 1999. Endophilin I mediates synaptic vesicle formation by transfer of arachidonate to lysophosphatidic acid. Nature 440 1:133-41.

276. SSchmi dt, A . , M. Wol de, C. Thiele , W. F est , H. Kratzin, A. V. Podt elejnikov, W. Witke, W. B. Huttner, a nd H. D. Soling. 1999. Endophilin I mediates synaptic vesicle formation by transfer of arachidonate to lysophosphatidic acid. Nature 440 1:133-41.

277. SSchnei der, B. , C. Sc huell er, O. Uter moehlen, and A. Haa s. 2007. Lipid microdomain-dependent macropinocytosis determines compartmentation of Afipia felis. Traffic 88:226-40.

278. SSchnell , M. J . , L . Buo nocore, M. A. Whitt , and J . K. Rose. 1996. The minimal conserved transcription stop-start signal promotes stable expression of a foreign gene in vesicular stomatitis virus. J Virol 770 :2318-23.

279. SSchusk e, K. R. , J . E. Richmo nd, D. S. Matt hies, W. S. Davi s, S. Runz, D. A. Rube, A. M. van der Bliek, and E. M. Jor gensen. 2003. Endophilin is required for synaptic vesicle endocytosis by localizing synaptojanin. Neuron 440 :749-62.

280. SScott , M. G. , A. Benmera h, O. Muntaner, a nd S. Mar ullo. 2002. Recruitment of activated G protein-coupled receptors to pre-existing clathrin-coated pits in living cells. J Biol Chem 2277:3552-9.

281. SSeto, E. S. , H. J . Bellen, a nd T. E. Llo yd. 2002. When cell biology meets development: endocytic regulation of signaling pathways. Genes Dev 116:1314-36.

282. SSever, S. , A. B. Muhl ber g, a nd S. L . Sc hm id. 1999. Impairment of dynamin's GAP domain stimulates receptor-mediated endocytosis. Nature 3398:481-6.

283. SSheno y, S. K. , P . H. McDo nal d, T. A. Ko hout, and R. J . Lefkowitz. 2001. Regulation of receptor fate by ubiquitination of activated beta 2-adrenergic receptor and beta-arrestin. Science 2294:1307-13.

284. SShi h, S. C. , D. J . Katzmann, J . D. Schnell , M. Suta nto, S. D. Emr, and L. Hicke . 2002. Epsins and Vps27p/Hrs contain ubiquitin-binding domains that function in receptor endocytosis. Nat Cell Biol 44:389-93.

285. SShi h, W., A. Gall usser, a nd T. Kirc hha usen. 1995. A clathrin-binding site in the hinge of the beta 2 chain of mammalian AP-2 complexes. J Biol Chem 2270 :31083-90.

286. SShi n, H. W., M. Haya shi, S . C hri stoforidi s, S . Lac as-Gerva is, S. Ho epf ner , M. R. Wenk, J . Mo dr egger , S. Utt enw eiler-Joseph, M. Wil m, A. N ystuen, W. N. Frank el, M. Sol imena, P. De Ca mill i , a nd M. Zeri al . 2005. An enzymatic cascade of Rab5 effectors regulates phosphoinositide turnover in the endocytic pathway. J Cell Biol 1170 :607-18.


287. SShi n, N. , N. Ahn, B. C hang-Il eto, J . Park, K. Tak ei , S. G. Ahn, S. A . Ki m, G. Di Paolo, and S. C hang. 2008. SNX9 regulates tubular invagination of the plasma membrane through interaction with actin cytoskeleton and dynamin 2. J Cell Sci 121 :1252-63.

288. SShi n, N. , S. Lee, N. Ahn, S. A. Kim, S . G. Ahn, Z . YongPark , and S . Cha ng. 2007. Sorting nexin 9 interacts with dynamin 1 and N-WASP and coordinates synaptic vesicle endocytosis. J Biol Chem 2282:28939-50.

289. SSidman, C. 1981. B lymphocyte differentiation and the control of IgM mu chain expression. Cell 223:379-89.

290. SSieczkar ski , S. B. , H. A. Brow n, a nd G . R. Whittak er. 2003. Role of protein kinase C betaII in influenza virus entry via late endosomes. J Virol 777:460-9.

291. SSieczkar ski , S. B. , a nd G. R. Whittak er. 2003. Differential requirements of Rab5 and Rab7 for endocytosis of influenza and other enveloped viruses. Traffic 44:333-43.

292. SSieczkar ski , S . B . , and G. R. Whittaker. 2002. Influenza virus can enter and infect cells in the absence of clathrin-mediated endocytosis. J Virol 776:10455-64.

293. SSigi sm und, S. , T . Wo elk, C. P uri , E. Ma spero, C. Tacchetti , P . Tra nsi dico, P. P . Di Fiore, and S . Polo. 2005. Clathrin-independent endocytosis of ubiquitinated cargos. Proc Natl Acad Sci U S A 110 2:2760-5.

294. SSimo nsen, A. , R. Li ppe, S. C hristofori dis , J . M. Gaul lier, A. Brec h, J . Callaghan, B. H. Toh, C. Mur phy, M. Zerial , and H. Stenma rk. 1998. EEA1 links PI(3)K function to Rab5 regulation of endosome fusion. Nature 3394:494-8.

295. SSimo nsen, A. , and H. Stenm ark. 2001. PX domains: attracted by phosphoinositides. Nat Cell Biol 33:E179-82.

296. SSimo nsen, A. , A. E. Wur mser, S. D. Emr, a nd H. Stenmar k. 2001. The role of phosphoinositides in membrane transport. Curr Opin Cell Biol 113 :485-92.

297. SSingh, I . , a nd A. Helenius. 1992. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating. J. Virol. 666:7049-7058.

298. SSipe, D. M., a nd R. F . Mur phy. 1987. High-resolution kinetics of transferrin acidification in BALB/c 3T3 cells: exposure to pH 6 followed by temperature-sensitive alkalinization during recycling. Proc Natl Acad Sci U S A 88 4:7119-23.

299. SSmith, A. E. , a nd A. Heleni us. 2004. How viruses enter animal cells. Science 30 4:237-42.

300. SSong, B. D. , D. Ya rar, a nd S. L . Sc hmi d. 2004. An assembly-incompetent mutant establishes a requirement for dynamin self-assembly in clathrin-mediated endocytosis in vivo. Mol Biol Cell 115 :2243-52.

301. SSong, W., and K. E. Zi nsmaier. 2003. Endophilin and synaptojanin hook up to promote synaptic vesicle endocytosis. Neuron 440 :665-7.

302. SSonnichsen, B. , S. De Renzis, E. Niel sen, J . R ietdorf , and M. Z erial . 2000. Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5, and Rab11. J Cell Biol 1149:901-14.

303. SSorkin , A. 2004. Cargo recognition during clathrin-mediated endocytosis: a team effort. Curr Opin Cell Biol 116:392-9.

304. SSoulet , F . , D. Yara r, M. Leo nar d, and S. L . Sc hmi d. 2005. SNX9 regulates dynamin assembly and is required for efficient clathrin-mediated endocytosis. Mol Biol Cell 116:2058-67.

305. SSpudic h, G. , M. V. C hiba lina, J . S. Au, S. D. Ar den, F . Buss , and J . Kendrick-Jones. 2007. Myosin VI targeting to clathrin-coated structures and dimerization is mediated by binding to Disabled-2 and PtdIns(4,5)P2. Nat Cell Biol 99:176-83.

306. SStang, E. , J . Kartenbeck, and R. G. Parton. 1997. Major histocompatibility complex class I molecules mediate association of SV40 with caveolae. Mol Biol Cell 8:47-57.

307. SStavrou, I . , a nd T . J . O'Hallo ran. 2006. The monomeric clathrin assembly protein, AP180, regulates contractile vacuole size in Dictyostelium discoideum. Mol Biol Cell 17 :5381-9.

308. SStenmark, H. 2001. Introduction. Trafficking of lipids. Semin Cell Dev Biol 112 :135-7. 309. SStenmark, H. , and D. J . Gil lool y. 2001. Intracellular trafficking and turnover of

phosphatidylinositol 3-phosphate. Semin Cell Dev Biol 112 :193-9. 310. SSun, X. , V. K. Ya u, B . J . Bri ggs, and G. R. Whittaker. 2005. Role of clathrin-

mediated endocytosis during vesicular stomatitis virus entry into host cells. Virology 338:53-60.


311. TTakizawa, P. A. , and V. Mal hotra. 1993. Coatomers and SNAREs in promoting membrane traffic. Cell 775:593-6.

312. TTeba r, F . , S. K. Bo hla nder, a nd A. So rkin. 1999. Clathrin assembly lymphoid myeloid leukemia (CALM) protein: localization in endocytic-coated pits, interactions with clathrin, and the impact of overexpression on clathrin-mediated traffic. Mol Biol Cell 110:2687-702.

313. TTeba r, F . , S. Co nfaloni eri , R. E. Carter , P . P . Di Fiore, and A. Sorki n. 1997. Eps15 is constitutively oligomerized due to homophilic interaction of its coiled-coil region. J Biol Chem 2272:15413-8.

314. TTeng, H. , J . C. Col e, R. L . Ro berts , a nd R. S. Wil kinso n. 1999. Endocytic active zones: hot spots for endocytosis in vertebrate neuromuscular terminals. J Neurosci 19:4855-66.

315. tter Ha ar, E. , S . C. Harr ison, and T. Kirc hha usen. 2000. Peptide-in-groove interactions link target proteins to the beta-propeller of clathrin. Proc Natl Acad Sci U S A 997:1096-100.

316. TTorrisi , M. R. , L . V. Lotti , F . Bel leudi, R. Gradi ni , A. E. Salci ni , S. Confaloni eri , P . G. P elicci , a nd P . P . Di Fiore. 1999. Eps15 is recruited to the plasma membrane upon epidermal growth factor receptor activation and localizes to components of the endocytic pathway during receptor internalization. Mol Biol Cell 10:417-34.

317. TTraub, L . M. 2003. Sorting it out: AP-2 and alternate clathrin adaptors in endocytic cargo selection. J Cell Biol 1163:203-8.

318. TTraub, L . M., a nd G. L . Lukacs. 2007. Decoding ubiquitin sorting signals for clathrin-dependent endocytosis by CLASPs. J Cell Sci 1120 :543-53.

319. UUllric h, O. , S . Reinsch, S. Ur be, M. Zerial , and R. G. Parton. 1996. Rab11 regulates recycling through the pericentriolar recycling endosome. J Cell Biol 1135 :913-24.

320. UUm eda, A. , A. Meyer holz, a nd E. Ungewick el l . 2000. Identification of the universal cofactor (auxilin 2) in clathrin coat dissociation. Eur J Cell Biol 779:336-42.

321. UUngewickell , E. , H. Ungewickel l , S. E. Holstei n, R. Lindner, K. Pr asa d, W. Baro uch, B. Marti n, L . E. Gr eene, a nd E. Ei senber g. 1995. Role of auxilin in uncoating clathrin-coated vesicles. Nature 3378:632-5.

322. UUngewickell , E. J . , and L. Hinrichsen. 2007. Endocytosis: clathrin-mediated membrane budding. Curr Opin Cell Biol 119:417-25.

323. UUruno, T . , J . Liu, P . Z hang, Y. Fan, C. Egile, R. Li , S. C. Muell er, a nd X . Zha n. 2001. Activation of Arp2/3 complex-mediated actin polymerization by cortactin. Nat Cell Biol 33:259-66.

324. vvan der Sl uijs , P . , M. Hull , P . Webster, P . Male, B. Goud, a nd I . Mell ma n. 1992. The small GTP-binding protein rab4 controls an early sorting event on the endocytic pathway. Cell 770 :729-40.

325. VVar nai, P . , B. Thya garaja n, T. Rohac s, and T. Balla. 2006. Rapidly inducible changes in phosphatidylinositol 4,5-bisphosphate levels influence multiple regulatory functions of the lipid in intact living cells. J Cell Biol 1175 :377-82.

326. VVonderheit , A. 2004. Visualization of the Endocytosis Pathway of Semliki Forest Virus. dissertation.

327. VVonderheit , A. , and A. Helenius. 2005. Rab7 associates with early endosomes to mediate sorting and transport of Semliki forest virus to late endosomes. PLoS Biol 3:e233. Epub 2005 Jun 21.

328. WWa elter, S . , E. Sc herzinger , R. Ha senba nk, E. No rdhoff , R. L urz, H. Goehler, C. Ga uss , K . Sat hasi vam, G. P . Bates, H. Lehrac h, and E. E. Wanker. 2001. The huntingtin interacting protein HIP1 is a clathrin and alpha-adaptin-binding protein involved in receptor-mediated endocytosis. Hum Mol Genet 110 :1807-17.

329. WWa ng, L . H. , K. G . Rothberg, a nd R. G . Anderso n. 1993. Mis-assembly of clathrin lattices on endosomes reveals a regulatory switch for coated pit formation. J Cell Biol 123:1107-17.

330. WWa siak, S . , V . Legendr e-G uillemin, R. Puertolla no, F . Blondea u, M. Girar d, E. de Heuvel, D. Boismenu, A. W. Bell , J . S. Bo nifacino, and P. S. McP her son. 2002. Enthoprotin: a novel clathrin-associated protein identified through subcellular proteomics. J Cell Biol 1158:855-62.

331. WWeaver, A. M., J . E. Heuser, A. V. Kar gi nov, W. L . Lee, J . T . Parsons, and J . A. Cooper . 2002. Interaction of cortactin and N-WASp with Arp2/3 complex. Curr Biol 12 :1270-8.


332. WWeaver, A. M., A. V. Karginov, A . W. Ki nley, S. A . Weed, Y. Li , J . T . Par sons, and J . A . Coo per. 2001. Cortactin promotes and stabilizes Arp2/3-induced actin filament network formation. Curr Biol 111 :370-4.

333. WWhite, J . , J . Ka rtenbeck, and A. Helenius. 1980. Fusion of Semliki forest virus with the plasma membrane can be induced by low ph. J. Cell Biol. 887:264 - 272.

334. WWhite, J . , K. Matli n, and A. Hel eni us. 1981. Cell fusion by Semliki Forest, influenza, and vesicular stomatitis viruses. J Cell Biol 88 9:674-9.

335. WWhitley, P . , B. J . Reav es, M. Hashimoto, A . M. Ri ley, B. V. Potter, and G. D. Holma n. 2003. Identification of mammalian Vps24p as an effector of phosphatidylinositol 3,5-bisphosphate-dependent endosome compartmentalization. J Biol Chem 2278:38786-95.

336. WWhitney, J . A. , M. Gom ez, D. Sheff , T . E. Kr eis, and I . Mell ma n. 1995. Cytoplasmic coat proteins involved in endosome function. Cell 88 3:703-13.

337. WWic hma nn, H., L . Hengst, and D. Gall witz. 1992. Endocytosis in yeast: evidence for the involvement of a small GTP-binding protein (Ypt7p). Cell 771:1131-42.

338. WWil de, A. , and F. M. Bro dsky. 1996. In vivo phosphorylation of adaptors regulates their interaction with clathrin. J Cell Biol 1135 :635-45.

339. WWo ng, W. T. , M. H. Kra us , F . Ca rloma gno, A. Zel ano, T. D ruck, C. M. Croc e, K. Huebner, a nd P . P . Di Fiore. 1994. The human eps15 gene, encoding a tyrosine kinase substrate, is conserved in evolution and maps to 1p31-p32. Oncogene 99:1591-7.

340. WWo ng, W. T. , C. Schumac her , A. E. Salci ni , A. Ro mano, P. Casta gni no, P . G. Pelicci , a nd P. P . Di Fio re. 1995. A protein-binding domain, EH, identified in the receptor tyrosine kinase substrate Eps15 and conserved in evolution. Proc Natl Acad Sci U S A 992:9530-4.

341. WWuDunn, D. , and P. G. Spear. 1989. Initial interaction of herpes simplex virus with cells is binding to heparan sulfate. Journal of Virology 663:52-8.

342. YYarar, D. , C. M. Wat erma n-Stor er, a nd S. L . Schmi d. 2005. A dynamic actin cytoskeleton functions at multiple stages of clathrin-mediated endocytosis. Mol Biol Cell 116:964-75.

343. YYarar, D. , C. M. Wat erma n-Stor er, a nd S. L . Schmid. 2007. SNX9 couples actin assembly to phosphoinositide signals and is required for membrane remodeling during endocytosis. Dev Cell 113 :43-56.

344. YYarmola, E. G. , T . So masundar am, T. A . Bori ng, I . Spector , and M. R. Bubb. 2000. Actin-latrunculin A structure and function. Differential modulation of actin-binding protein function by latrunculin A. J Biol Chem 2275:28120-7.

345. YYe, W., N. Ali , M. E. Bem benek, S. B. Shear s, and E. M. L afer. 1995. Inhibition of clathrin assembly by high affinity binding of specific inositol polyphosphates to the synapse-specific clathrin assembly protein AP-3. J Biol Chem 2270 :1564-8.

346. YYoung, A. 2007. Structural insights into the clathrin coat. Semin Cell Dev Biol 118:448-58.

347. ZZarem ba, S. , a nd J . H. Keen. 1983. Assembly polypeptides from coated vesicles mediate reassembly of unique clathrin coats. J Cell Biol 997:1339-47.

348. ZZerial , M., and H. Mc Br ide. 2001. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol 22 :107-17.

349. ZZhang, B. , Y . H. Ko h, R. B. Beckst ead, V. Budnik, B. Ga netzk y, a nd H. J . Bell en. 1998. Synaptic vesicle size and number are regulated by a clathrin adaptor protein required for endocytosis. Neuron 221 :1465-75.

350. ZZhu, J . , K. Zho u, J . J . Hao, J . Li u, N. Smit h, and X. Zha n. 2005. Regulation of cortactin/dynamin interaction by actin polymerization during the fission of clathrin-coated pits. J Cell Sci 11 18 :807-17.

351. ZZoncu, R. , R . M. Perera, R. Sebastia n, F . Nakatsu, H. Chen, T. Balla, G. Aya la, D. Toomre, and P. V. De Camill i . 2007. Loss of endocytic clathrin-coated pits upon acute depletion of phosphatidylinositol 4,5-bisphosphate. Proc Natl Acad Sci U S A 104:3793-8.


8 ACKNOWLEDGEMENTS

I would like to thank Ari Helenius for allowing me to do my PhD in his lab, his

guidance and support and for being a great example of a scientist for his group.

I would like to thank Daniel Gerlich and Urs Greber for being willing to be a part

of my thesis committee and for helpful and interesting discussions. I thank Lea

Amato for good collaboration during her master project and her contributions

to this project. I thank Jürgen Kartenbeck and Roberta Mancini for all their help

with the EM. I thank Eva-Maria Damm and Katharina Quirin for introducing me

into the “world of virus preps” and other very helpful things and for always

being willing to answer questions of any kind. I thank Anna Mezzacasa for her

great help in my struggle with the German language as well as other struggles.

I thank Thomas Heger for all his effort and help in establishing the siRNA

screening as well as various computer issues and Arnold Hayer for his help with

the microscopes. Friederike Thor and Sabrina Engel and Andreas Vonderheit I

thank for scientific and supportive discussion throughout my PhD. I thank Lea

Amato for letting my use her IF picture for the cover of this thesis and Mario

Schelhaas for his help with the final steps. I would like to thank the staff of IBC,

Anton Lehmann and Sonja Muggler for always being willing to help to solve

problems and for the IT support from Rolf Moser, Roland Stuber and Nicolas

Graf. Marianne Chiesi I would like to thank for all the help with administrative

things.

All former and present members of the Helenius as well as the Ellgaard groups I

thank for an excellent atmosphere and good times in as well as outside the lab.

I thank Hilda, Kristinn, Hrafnhildur and Jóhann for constant support and

understanding throughout my studies and beyond.


9 CURRICULUM VITAE

Surname Jóhannsdóttir

First Name Hrefna Kristín

Date of Birth September 12th, 1974

Place of Birth Uppsala, Sweden

Nationality Icelandic

Address Pfaffenmattweg 37b

4132 Muttenz

Switzerland

Education

1980-1990 Primary school, Akureyri/Reykjavík, Iceland

1990-1994 Menntaskólinn v/Sund, Reykjavík, Iceland

1996-1999 Háskóli Islands, B.Sc. studies

1998 Leopold-Franzens Universität, B.Sc.studies

1999 B.Sc. in Micro- and Molecular Biology

2000-2003 Háskóli Islands, M.Sc. studies

2003 M.Sc. in Biomedical Sciences

2004-2008 Graduate studies at the Institute of Biochemistry, ETH

Zürich under the supervision of Prof. Dr. Ari Helenius.

In Copyright - Non-Commercial Use Permitted Rights ...30880/... · 9 CURRICULUM VITAE 127. ......

Documents

Transcript of In Copyright - Non-Commercial Use Permitted Rights ...30880/... · 9 CURRICULUM VITAE 127. ......