Impact of malaria pre -exposure on anti -parasite cellular...

1

Impact of malaria pre-exposure on anti-parasite cellular and humoral 1

immune responses after controlled human malaria infection 2

3

Joshua M. Obiero1,a, Seif Shekalaghe2, Cornelus C. Hermsen1, Maxmillian Mpina2, Else M. 4

Bijker1, Meta Roestenberg1,b, Karina Teelen1, Peter F. Billingsley3, B. Kim Lee Sim3, Eric R. 5

James3, Claudia A. Daubenberger4,5, Stephen L. Hoffman3, Salim Abdulla2, Robert W. 6

Sauerwein1,#, Anja Scholzen1,# 7

8

1. Radboud university medical center, Department of Medical Microbiology, Nijmegen, The 9

Netherlands 10

2. Ifakara Health Institute, Bagamoyo Research and Training Center, Bagamoyo, Tanzania 11

3. Sanaria Inc., Rockville, Maryland, USA 12

4. Swiss Tropical and Public Health Institute, Department of Medical Parasitology and 13

Infection Biology, Basel, Switzerland 14

5. University of Basel, Basel, Switzerland 15

16

Present affiliation: 17

(a) University of California Irvine, Department of Medicine, Division of Infectious Diseases, Irvine, 18

California, USA 19

(b) Leiden University Medical Center, Department of Infectious Diseases, Leiden, The 20

Netherlands 21

22

Correspondence (#): Anja Scholzen ([email protected]) and Robert W. Sauerwein, 23

([email protected]) 24

25

Running title: Immune responses after controlled malaria infection 26

27

IAI Accepted Manuscript Posted Online 16 March 2015Infect. Immun. doi:10.1128/IAI.03069-14Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on June 20, 2018 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

2

Abstract 28

To understand the effect of previous malaria exposure on anti-parasite immune responses is 29

important for developing successful immunization strategies. Controlled human malaria infections 30

(CHMI) using cryopreserved Plasmodium falciparum (Pf) sporozoites provide a unique 31

opportunity to study differences in acquisition or re-call of anti-malaria immune responses in 32

individuals from different transmission settings and genetic backgrounds. In this study, we 33

compared anti-parasite humoral and cellular immune responses in two cohorts of malaria-naïve 34

Dutch volunteers and Tanzanians from a low endemic area, which were subjected to the identical 35

CHMI protocol by intradermal injection of Pf sporozoites. Samples from both trials were analyzed 36

in parallel in a single center to ensure direct comparability of immunological outcomes. Within the 37

Tanzanian cohort we distinguished one group with moderate levels of pre-existing antibodies to 38

asexual Pf lysate, and another that based on Pf serology resembled the malaria-naïve Dutch 39

cohort. Positive Pf serology at baseline was associated with a lower parasite density at first 40

detection by qPCR after CHMI. Post-CHMI, both Tanzanian groups showed a stronger increase 41

in anti-Pf antibody titers than Dutch volunteers, indicating similar levels of B-cell memory 42

independent of serology. In contrast to the Dutch, Tanzanians failed to increase Pf-specific in 43

vitro re-call IFNγ-production after CHMI, and innate IFNγ-responses were lower in Pf lysate sero-44

positive individuals. In conclusion, positive Pf lysate serology can be used to identify individuals 45

with better parasite control, but weaker IFNγ-responses in circulating lymphocytes, which may 46

help to stratify volunteers in future CHMI trials in malaria endemic areas. 47

48


.org/D

ownloaded from

http://iai.asm.org/

3

Introduction 49

In 2012, Plasmodium falciparum (Pf) malaria caused an estimated 207 million cases and 627,000 50

deaths, of which 90% occurred in children under five years of age and in pregnant women in sub-51

Saharan Africa (1). Major control efforts have been implemented with some success (2, 3), but 52

malaria eradication will likely require a safe and highly protective vaccine. Subunit vaccines have 53

thus far shown moderate efficacy at best. RTS,S is the only vaccine candidate in phase 3 trials, 54

but despite averting substantial numbers of malaria cases (4), shows only 30-50 % reduction in 55

clinical disease after 12 months depending on both age and malaria endemicity and even less 56

after 18 months (5-7). These results stress the need for more effective second-generation 57

vaccines. Key requirements are not only the identification of novel immunogens, but also a better 58

understanding of protection-related immune responses. This includes the effect of previous 59

malaria exposure on immune responses upon re-exposure or vaccination (8, 9). 60

During the last three decades, Controlled Human Malaria Infection (CHMI) trials have 61

become an indispensable tool not only in assessing the efficacy of candidate vaccines (10, 11), 62

but also in evaluating immune responses induced by exposure to the malaria parasite (12-15). 63

CHMIs have so far been performed in non-endemic countries in previously unexposed individuals 64

(11, 16-19). A logical next step is to study potential differences in the acquisition, maintenance or 65

re-call of immune responses in individuals from different transmission settings and genetic 66

backgrounds (20, 21). The availability of aseptic, purified, cryopreserved live, Pf sporozoites 67

(PfSPZ Challenge) (22) opens up opportunities to carry out CHMI trials in malaria endemic 68

countries, since it bypasses the need for infecting local Anopheles mosquito with Pf or importing 69

Pf-infected mosquitoes to the trial site. The first PfSPZ Challenge trial in malaria-naïve Dutch 70

volunteers demonstrated an infectivity rate of 83% after intradermal injections, independent of the 71

dose given (23). Recently, PfSPZ Challenge was used for the first time during a CHMI trial in 72

healthy adult male Tanzanian volunteers, resulting in similar infection rates (24). As a follow up, 73

we here present results of the malaria-specific humoral and cellular immune responses in 74

Tanzanians and Dutch volunteers who were inoculated intradermally with the same number of 75

live PfSPZs during these CHMI studies. 76

77


.org/D

ownloaded from

http://iai.asm.org/

4

Methods 78

Human ethics statement 79

The Dutch trial (23) was approved by the Central Committee for Research Involving Human 80

Subjects of The Netherlands (NL31858.091.10) and registered at Clinicaltrials.gov, identifier: 81

NCT 01086917. The Tanzanian trial (24) was approved by institutional review boards of the 82

Ifakara Health Institute (IHI/IRB/No25), National Institute for Medical Research Tanzania 83

(NIMR/HQ/R.8a/Vol.IX/1217), the Ethikkommission beider Basel (EKBB), Basel, Switzerland 84

(EKBB 319/11) and the Tanzanian Food and Drug Administration (Ref. No. CE.57/180/04A/50) 85

and registered at Clinicaltrials.gov, identifier: NCT 01540903. All study teams complied with the 86

Declaration of Helsinki and Good Clinical Practice including monitoring of data, and all volunteers 87

gave written informed consent. 88

89

Clinical trial design 90

Samples for immunological analysis were obtained from two CHMI trials (23, 24). 91

The first trial performed at Radboud university medical center, Nijmegen, The Netherlands was 92

composed of 18 healthy Dutch subjects aged between 19-30 years with no history of malaria. 93

Any volunteer who was positive for Pf serology or had resided in a malaria endemic area within 94

previous six months was excluded from the trial. Three groups (n=6 per group) were infected by 95

intradermal injections of 2,500, 10,000 or 25,000 cryopreserved PfSPZ (NF54 strain). By day 21, 96

15/18 volunteers had developed parasites detectable by positive blood thick smear (TS), 5/6 in 97

each group (23). There were no differences in parasite densities at diagnosis between the three 98

dose groups (23). For immunological analysis, nine Pf positive volunteers of the 10,000 (n=4) and 99

25,000 (n=5) PfSPZ dose groups were selected based on availability of plasma and peripheral 100

blood mononuclear cells (PBMCs). 101

The second trial was carried out in Bagamoyo, Tanzania with volunteers residing in Dar es 102

Salaam (a malaria hypoendemic area). Twenty-four males between 20-35 years were enrolled 103

and confirmed to be free of parasites by real-time quantitative PCR (qPCR). Subjects with a self-104

reported history of clinical malaria in the previous five years were excluded. The volunteers were 105


.org/D

ownloaded from

http://iai.asm.org/

5

divided into two groups with 12 volunteers per group and infected by intradermal injections of 106

either 10,000 or 25,000 PfSPZ (NF54 strain). 21/24 became both qPCR and blood smear positive 107

by day 21 after infection (24). The three Pf negative volunteers were excluded from analysis in 108

the present study. 109

PBMCs, citrate anti-coagulated plasma samples from Dutch volunteers and serum samples from 110

Tanzanian volunteers were collected and cryopreserved one day before challenge (pre-CHMI) 111

and after treatment (post-CHMI, day 35 and 28 after infection, respectively). 112

113

DNA extraction and qPCR analysis 114

5µl Zap-Oglobin II Lytic Reagent (Beckman Coulter) was added to 500µl of EDTA blood, after 115

which the samples were mixed and stored at -80°C. 116

DNA extraction and quantification of parasitemia by qPCR in the Dutch CHMI trial was performed 117

in Nijmegen as described previously (25), with slight modifications. Briefly, after thawing, samples 118

were spiked with murine white blood cells as an extraction control and DNA was extracted with a 119

MagnaPure LC isolation station. For detection of the extraction control and Pf, primers for the 120

murine albumin gene and Pf 18sRNA were used as described previously (25). Additionally, the Pf 121

18sRNA TaqMan MGB probe AAC AAT TGG AGG GCA AG-FAM was used. 122

DNA extraction and qPCR in the Tanzanian trial was carried out at the Leiden University Medical 123

Center, Leiden, The Netherlands as described previously (26). Phocin herpes virus-1 (PhHV-1) 124

was added to the isolation lysis buffer to serve as an internal control. For quantification of PhHV 125

the primers GGGCGAATCACAGATTGAATC, GCGGTTCCAAACGTACCAA and the probe Cy5-126

TTTTTATGTGTCCGCCACCATCTGGATC were used. 127

Pf (NF54 strain) standard curves for both qPCR assays were prepared in Nijmegen by titration of 128

ring-stage infected red blood cells (RBC) in uninfected human blood. The two qPCR assays in 129

both sites were confirmed to yield the same results when quantifying the Pf content in sequential 130

samples from four CHMI volunteers. 131

132

Parasite material for immunological analysis 133


.org/D

ownloaded from

http://iai.asm.org/

6

The Pf NF54 strain used in both CHMI trials is the parental strain of the 3D7 clone (27). Pf (NF54 134

strain) blood-stage parasites were cultured in RPMI-1640 containing 10% human A+ serum and a 135

5% hematocrit erythrocyte suspension in a semi-automated culture system and regularly 136

screened for mycoplasma contamination. For in vitro stimulation assays, asynchronous parasites 137

harvested at a parasitemia of approximately 10-20% were purified by centrifugation on a 63% 138

Percoll density gradient to obtain mature asexual stages. This resulted in concentration of 139

parasitaemia levels to about 80-90% consisting of more than 95% schizonts/mature trophozoites. 140

Cryopreserved Pf infected RBC (PfRBC) were washed twice in RPMI and used in stimulation 141

assays. Mock-cultured uninfected erythrocytes (uRBC) were obtained similarly and served as 142

control. 143

Pf lysate for ELISA was prepared by extracting purified schizonts/mature trophozoites with 1% 144

sodium desoxycholate and 2.5µl phenylmethanesulfonyl fluoride protease inhibitor for 15 min at 145

room temperature (RT). 146

147

Recombinant and synthetic proteins 148

Recombinant proteins of CircumSporozoite Protein (CSP) and liver stage antigen (LSA)-1 were 149

used to probe humoral responses towards pre-erythrocytic stages, while crude Pf lysate were 150

used to assess antibody reactivity towards blood stages. Apical Membrane protein (AMA)-1 and 151

Exported protein (EXP)-1 are expressed in both pre-erythrocytic and asexual stages. 152

Full length P. falciparum NF54 CSP with repeats was produced in Escherichia coli by Gennova 153

Biopharmaceuticals Ltd, Pune, India. A recombinant LSA-1 construct, LSA-NRC, was expressed 154

in Escherichia coli, incorporating the N- and C-terminal regions of the protein and two of the 155

centrally placed 17-amino-acid repeats for the 3D7 LSA-1 sequence (PlasmoDB-156

PF3D7_1036400) (28). Both N- and C-terminal as well as the repeats are highly conserved 157

between NF54 and 3D7. The major difference is the greater number of repeats in the NF54 158

sequence (29), which are the primary target of anti-LSA-1 antibodies (30). Amino acids 25–545 of 159

codon-optimised AMA-1 of the Pf FVO-strain, were expressed in the methylotrophic yeast Pichia 160

pastoris (31, 32). A peptide covering the C-terminal amino acids 73-162 of the integral 161

parasitophorous vacuolar membrane protein EXP-1 (SWISS-PROT database primary accession 162


.org/D

ownloaded from

http://iai.asm.org/

7

number P04926) was chemically synthesized using solid phase F-moc chemistry, and differs only 163

by a single amino acid in position 160 from the 3D7 sequence (33). 164

165

ELISA to assess antibody reactivity 166

96-well Polystyrene flat-bottom plates (NUNC™ Maxisorp, Thermo Scientific) were coated with 167

2µg/ml of CSP, EXP-1 and AMA-1, 0.25µg/ml of LSA-1 or Pf lysate at the equivalent of 20,000 168

PfRBC/well in phosphate-buffered saline (PBS) and incubated overnight at 4ºC. Plates were 169

blocked with 5% milk in PBS. All following washing steps were carried out with PBS+0.05% 170

Tween (PBST). Using 1% milk in PBST, plasma or serum samples were serially diluted in 171

duplicate starting at 1:50 to 1:800 for protein antigen and 1:250 to 1:4000 for Pf lysate and 172

incubate for 3h at room temperature. Bound IgG was detected using horseradish peroxidase 173

(HRP) conjugated anti-human IgG) (Thermo Scientific, diluted 1:60000 in sample buffer). Plates 174

were developed using TMB peroxidase substrate (tebu-bio). The reaction was stopped using an 175

equal volume of 0.2M H2SO4 and absorbance measured with a spectro-photometer plate reader 176

at 450nm (Anthos 2001 ELISA plate reader). 177

A serial dilution of a pool of sera from 100 HyperImmune Tanzanian (HIT) (20) individuals living in 178

a highly malaria endemic area was used as a reference standard and was included on each 179

plate. Reactivity for each antigen in undiluted HIT serum was defined as 100 arbitrary units (AU). 180

OD values were converted into AUs by four-parameter logistic curve fit using Auditable Data 181

Analysis and Management System for ELISA (ADAMSEL-v1.1, 182

http://www.malariaresearch.eu/content/software). 183

For each antigen, all time points of an individual volunteer were assayed on the same plate. To 184

determine whether Tanzanians had a positive Pf serology (by recognition of Pf lysate), the mean 185

baseline antibody titer against Pf lysate plus 2SD of the Dutch volunteers was used as the cut-off 186

for positivity. 187

188

In vitro PBMC stimulation assay to assess cellular responses 189

Venous whole blood was collected into citrated vacutainer CPT-cell preparation tubes (Becton 190

and Dickinson). PBMCs were obtained by density gradient centrifugation, washed three times in 191


.org/D

ownloaded from

http://iai.asm.org/

8

cold PBS, counted and frozen at 107 cells/ml in fetal calf serum (FCS) with 10% dimethylsulfoxide 192

and stored in vapour-phase nitrogen. After thawing, PBMC were counted and cultured at a 193

concentration of 500,000 cells/well in a 96-well round-bottom plate and stimulated in duplicate at 194

a ratio of 1:2 with 106 Pf NF54-infected RBC or uRBC for either 24 hours or for 6 days in a total 195

volume of 200µl. 196

197

Flow cytometry 198

Cells were stained and analyzed by flow cytometry either directly ex vivo, or after 24 hours or 6 199

days of in vitro stimulation. Cells were stained first for viability with Live/Dead fixable Aqua dead 200

cell stain (Invitrogen) or Fixable viability dye eFluor 780 (eBioscience) and later with three 201

different staining panels for surface markers; For the 24hr stain CD3 PerCP (UCH1, Biolegend), 202

CD56-PE (HCD56, Biolegend), anti-TCR Pan γ/δ-PE (IMMU510, Beckman Coulter), CD4 Pacific 203

Blue (OKT4, Beckman Coulter), CD8 APC-H7 (SK1, BD Pharmigen), CD45RO ECD (UCH1, 204

Beckman Coulter), and CD62L PeCy7 (DREG56, eBioscience). For the ex vivo stain the only 205

changes from previous stain were CD3 V500 (clone SP342, BD Horizon) and CD8 PerCP (RPA-206

T8, Biolegend), and for the third panel 6 days stain CD3 PeCy7 (OKT3, Biolegend) and CD8 207

PerCP (RPA-T8, Biolegend). For intracellular staining, cells were incubated with different mAbs 208

depending on the staining panels. After 30 min of incubation at RT, cells were washed and 209

permeabilized with Foxp3 fix/perm buffer (eBioscience) for 30 min on ice and stained in 210

permeabilization buffer (eBioscience) with IFNγ FITC (4S.B3, eBioscience; 24hr stain), Foxp3 211

eF660 (PCH101, eBioscience; ex vivo stain) or Ki67 FITC (B56, BD Pharmigen) and Foxp3 212

eF660 (PCH101, eBioscience; 6 days stain). Cells were collected on a CyAn ADP 9-color flow 213

cytometer (DAKO/Beckman Coulter) and analyzed using FlowJo software (Tree Star, Inc.) 214

version 9.6. All assays were conducted with the same batches of PfRBC and uRBC, with all time 215

points of one volunteer assayed in one experiment to prevent inter assay variations. Natural killer 216

T-cells (NKT) and gamma delta T-cells (γδT) were analyzed in the same gate and henceforth are 217

referred to as NKT-γδT. 218

219

Statistical analysis 220


.org/D

ownloaded from

http://iai.asm.org/

9

Statistical analysis was performed in GraphPad Prism 5. Differences within the cohorts and 221

between time points were analyzed per volunteer by Wilcoxon matched-pairs signed rank test 222

and those between groups were analyzed by Mann Whitney U-test. Relationships between 223

baseline and increase in antibody titers were analyzed by Spearman correlation, P values <0.05 224

were considered statistically significant. Cellular responses were corrected for background by 225

subtracting responses to uRBC from responses to PfRBC for each sample; resulting negative 226

values were set to zero. 227

228


.org/D

ownloaded from

http://iai.asm.org/

10

Results 229

Tanzanian volunteers have higher baseline antibody titers than Dutch subjects 230

Pre-CHMI antibody titers were significantly higher in Tanzanian than in the malaria-naïve Dutch 231

volunteers for crude Pf lysate (p<0.03), with 12/21 Tanzanians having titers higher than the mean 232

+ 2SD of Dutch volunteers. This was also true for pre-CHMI antibodies to the individual parasite 233

antigens AMA-1 (p<0.015; 13/21), and CSP (p<0.04; 15/21), and the same trend was found for 234

EXP-1 (p<0.06; 8/21) (Figure 1A). Elevated LSA-1 antibody titers were found in 5/21 235

Tanzanians, but there was no significant difference between Dutch and Tanzanians on group 236

level (p<0.16). Within the Tanzania cohort, there was a wide range of pre-CHMI antibody 237

responses, with some volunteers showing only low responses comparable to the Dutch cohort. 238

To address whether there was a general division into high and low responders to malaria-239

antigens, we stratified Tanzanian individuals based on their reactivity to Pf lysate (containing a 240

large number of late-liver and blood-stage antigens, Figure 1B). Compared to their Pf lysate 241

sero-negative counterparts (n=9), sero-positive Tanzanians (n=12) had significantly higher 242

antibody titers against the cross-stage antigens AMA-1 (p=0.005, 7.6-fold higher median titer) 243

and EXP-1 (p=0.04, 5.4-fold higher). The same trend was found for the sporozoite antigen CSP 244

(p=0.09, 2.4-fold higher) and the liver-stage antigen LSA-1 (p=0.06, 1.7-fold) (Figure 1C). 245

246

Pf lysate sero-positivity prior to CHMI is associated with reduced initial blood-stage 247

parasitemia 248

We next assessed whether pre-existing humoral responses might be associated with control of 249

parasites in Tanzanian volunteers. In line with stronger humoral responses in the Tanzanian 250

cohort at baseline, Tanzanian volunteers became qPCR positive significantly later than the Dutch 251

volunteers (Figure 2A), with a median pre-patent period of 11.0 days [IQR: 11.0-13.5] in 252

Tanzanians and 10.0 days [9.5-11.0] in Dutch volunteers (p=0.009). Similarly, pre-patency by TS 253

was also longer in Tanzanians (median with IQR: 13.7 days [12.75-16.7]) compared to the Dutch 254

(12.6 [12.3-14]) (p=0.035). The time between detection by qPCR and TS was comparable 255

between both cohorts (median with IQR: Tanzanians 2.6 days [2.2-3.15] vs Dutch 3.0 [2.0-3.15], 256


.org/D

ownloaded from

http://iai.asm.org/

11

respectively; p=0.88), but Dutch volunteers had a significantly higher peak parasite density 257

(parasites/ml, median with IQR: Tanzanians 12,000 [6,800-15,000] vs Dutch 74,000 [26,000-258

190,000], respectively; p=0.02), possibly due to slight differences in the thick smear protocol 259

between the two sites. Within the Tanzanian cohort, there was no significant difference in time to 260

qPCR-detectable parasitemia between volunteers that were either Pf lysate sero-positive or -261

negative at baseline (p=0.16; Figure 2B), nor was there a difference in pre-patency by TS 262

(p=0.41), or time between detection by qPCR and TS (p=0.15). However, sero-positive 263

Tanzanian volunteers had a significantly lower parasite load at the time of first qPCR-detectable 264

parasitemia than their sero-negative counterparts (p=0.033; Figure 2C). This difference remained 265

evident, but became smaller, by the time when the first peak in parasite load was reached 266

(p=0.05; Figure 2D). Across all Tanzanian volunteers, pre-CHMI antibody titers for CSP (Pearson 267

r=0.45, p=0.04), but no other antigens, correlated significantly with prepatancy by qPCR (Figure 268

S1). 269

270

Pf-specific antibody responses are more efficiently increased in Tanzanians after CHMI 271

Post-CHMI, antibody responses increased significantly in the Tanzanian volunteers for Pf lysate 272

(p<0.001; 15/21 with >3-fold increase in titers), AMA-1 (p=0.002, 6/21), EXP-1 (p<0.0001, 14/21), 273

LSA-1 (p=0.001, 5/21) and CSP (p<0.001, 11/21; Figure 3A). In contrast, the Dutch volunteers 274

showed significant increased titers only against EXP-1 (p=0.004, 7/9), CSP (p=0.008, 6/9) and Pf 275

lysate (3/9) (p=0.008), while responses to LSA-1 and AMA-1 remained low and unaltered (Figure 276

3B). Compared to the Dutch, Tanzanians showed a trend for stronger induction or boosting of 277

responses based on overall fold increase in titers to Pf lysate, AMA-1 and LSA-1 (Figure 3C), 278

and significant higher absolute increases in titers for these antigens (Figure 3D). Volunteers in 279

both cohorts were subjected to CHMI with either 10,000 or 25,000 PfSPZ. However, the only 280

significant differences in antibody responses between the two dose groups was a slightly higher 281

response in the 25,000 versus 10,000 dose group for Pf lysate in Dutch volunteers (p=0.04), and 282

a similar trend for the Tanzanians for CSP (p=0.07; Figure S2). Post-CHMI, Pf lysate sero-283

negative Tanzanians had a significantly stronger fold increase in antibody titers against AMA-1 284

(p=0.02) and EXP-1 (p=0.04) than sero-positive individuals, with a similar trend for Pf lysate 285


.org/D

ownloaded from

http://iai.asm.org/

12

(p=0.082) and CSP (p=0.095), but no difference in LSA-1 responses (p=0.80; Figure 3E). For the 286

entire cohort, the fold increase of Pf lysate (p=0.01) and AMA-1 (p=0.001) responses upon CHMI 287

correlated negatively with the baseline response. The absolute increase in titers, however, was 288

not different for any of the antigens between the two groups (Figure 3F). Notably, Pf lysate sero-289

negative Tanzanians showed thereby also a greater absolute increase in antibody titers than 290

malaria-naïve Dutch volunteers. 291

292

Dutch, but not Tanzanian volunteers show cellular re-call responses induced by CHMI 293

To analyze the acquisition of cellular responses after CHMI, we investigated in vitro IFNγ-294

responses upon incubation with PfRBC for 24 hours (Figure 4A, B). At baseline, Pf-specific 295

IFNγ-responses was comparable between Dutch and Tanzanians for all cell subsets except for 296

NKT-γδT cells, which showed slightly higher responses in the Dutch (p=0.077; Figure 4C). Post-297

CHMI, previously malaria-naïve Dutch volunteers showed significant increases in Pf-specific IFNγ 298

production by all lymphocyte subsets analyzed (CD4+ p=0.004; CD8+ p=0.009; CD56dim 299

p=0.004; CD56bright NK p=0.008; NKT-γδT p=0.004; Figure 4E-I). In contrast, Tanzanian 300

volunteers showed little or no increase in IFNγ-producing cells (CD4+ p=0.74; CD8+ p=0.065; 301

CD56dim p=0.49; CD56bright NK p=0.75; NKT-γδT p=0.92). In both cohorts and at both time 302

points, CD56bright NK cells showed significantly higher IFNγ-responses than CD56dim NK cells 303

(Dutch pre/post-CHMI p=0.004; Tanzanian pre/post-CHMI p≤0.0001). Significantly increased 304

IFNγ-responses were found both in both the effector (CD4+ p=0.004, CD8+ p=0.008) and central 305

memory T-cell compartment (CD4+ p=0.004, CD8+ p=0.012) in the Dutch cohort, while the 306

Tanzanians showed no such increase (Figure S3). As a result, post-CHMI IFNγ-responses in the 307

Dutch were significantly higher for all cell subsets than in the Tanzanian cohort (Figure 4D). 308

Within the Tanzanian cohort, there was an overall trend for higher Pf-specific pre-CHMI IFNγ-309

responses in those volunteers that had particularly short pre-patency by qPCR (Figure S1). 310

CD8+ T-cells from Dutch (p=0.04), but not Tanzanian volunteers (p=0.47), showed increased 311

proliferative responses post-CHMI (Figure S4A). Proliferation of CD4+ T-cells in response to 312

PfRBC was not significantly altered post-CHMI in either cohort (p=0.25 in Dutch and p=0.11 in 313

Tanzanians, respectively; Figure S4B). 314


.org/D

ownloaded from

http://iai.asm.org/

13

Analyzing the lymphocyte subset composition in both cohorts, we found that those were largely 315

stable between pre- and post-CHMI time points, with the exception of a prominent and significant 316

post-CHMI increase of NKT-γδT proportion in the Dutch volunteers and a clear decrease of 317

CD56dim NK proportions in both cohorts. There was further no significant difference in the 318

proportion of CD4+CD45RO+Foxp3+ T-cells between the two cohorts, which could have 319

explained differences in responsiveness (Table S1). For the Tanzanian cohort, we observed a 320

significant reduction of Foxp3+ T-cells post-CHMI (p=0.008), while for the Dutch volunteers there 321

was no change (p=0.44). Stimulation with the mitogens PMA/ionomycin showed that lymphocytes 322

of both Dutch and Tanzanian volunteers were fully functional and able to produce IFNγ at 323

comparable levels both pre- and post-CHMI (Figure S4C). 324

325

Reduced innate IFNγ responses in Tanzanian volunteers are associated with pre-existing 326

humoral immunity and thus potential pre-exposure 327

Finally, we analyzed whether the degree of pre-exposure reflected by differences in malaria-328

specific humoral immunity might affect cellular re-call responses to PfRBCs. Cells from Pf lysate 329

sero-negative Tanzanian volunteers had significantly higher responses to PfRBC (pre-CHMI) 330

than those from sero-positive Tanzanian volunteers (NKT-γδT p=0.05; CD56dim p=0.01 and 331

CD56bright NK p=0.04;), and were of comparable magnitude as those observed in the Dutch 332

volunteers (Figure 5). CD4+ and CD8+ T-cells showed a similar pattern, although the difference 333

between sero-positive and -negative Tanzanians did not reach statistical significance (Figure 334

5A,B). Post-CHMI, these differences remained, and there was no increase in these responses in 335

either of the two groups. 336

337

338


.org/D

ownloaded from

http://iai.asm.org/

14

Discussion 339

In the present study we performed a side-by-side comparison of anti-malarial immune responses 340

initiated or re-called by CHMI in two cohorts of young adults with different malaria exposure 341

histories and genetic background, in the Netherlands and Tanzania. Recruitment of Tanzanian 342

volunteers took place in the hypo-endemic urban area of Dar es Salaam. Inclusion criteria into 343

this CHMI trial were tailored to ensure minimal recent exposure to Pf: Tanzanian volunteers had 344

not experienced a clinical episode of malaria for five years, as self-reported, and were confirmed 345

free of parasites by qPCR before CHMI took place. Nevertheless, more than 50% of the 21 346

Tanzanian volunteers had a positive Pf lysate serology before CHMI based on Pf lysate ELISA, 347

which is a standard exclusion criterion in Dutch CHMI trials. In line with this, increased baseline 348

antibody titers for the Pf antigens CSP, LSA-1, EXP-1 and AMA-1 were found in the Tanzania 349

cohort and particularly in those with positive serology for Pf lysate. This clearly indicates previous 350

exposure to the malaria parasite in this cohort. Asymptomatic infections, which can often occur in 351

people living in low endemic areas (34), also in the 5 years of no self-reported clinical malaria 352

preceding CHMI, might have led to a maintenance of higher antibody responses. 353

354

As might be expected, pre-existing antibodies to Pf antigens appeared to have an effect on the 355

outcome of CHMI. Tanzanians had a significantly longer pre-patency based on qPCR detection 356

than the previously malaria-naïve Dutch. Furthermore, Pf lysate sero-positive Tanzanians had a 357

lower parasite load at time of first detection by qPCR and first peak of parasite load. The first 358

peak of blood-stage parasitemia can be used as a proxy for parasite liver-load (16, 35). Our 359

results might therefore indicate emergence of fewer parasites from the liver and hence better 360

control of either initiation or progression of liver-stage infection in the Tanzanian cohort. In line 361

with such an effect of pre-existing anti-sporozoite immunity would be the observation that those 362

Tanzanian volunteers with a longer prepatancy by qPCR also had higher baseline antibody titers 363

against the sporozoite antigen CSP. However, first detection by qPCR in both the Dutch and 364

Tanzanians after intradermal PfSPZ injection was uncharacteristically late compared to infection 365

by mosquito bite routinely conducted in the Netherlands and elsewhere (11, 16, 18, 19, 23, 24, 366


.org/D

ownloaded from

http://iai.asm.org/

15

35). This is likely due to less efficient liver-stage infection by this route, and hence a lower initial 367

blood-stage load that only reaches the qPCR-detection limit later. A lower first detectable 368

parasitemia in sero-positive Tanzanians might therefore additionally be attributed to control of 369

blood-stage replication prior to qPCR-detection. Antibodies directed against AMA-1, for instance, 370

are known to interfere with blood-stage multiplication (36), but can also confer protection against 371

liver-stage infection (37). Since recognition of both cross-stage and liver-stage antigens was 372

stronger in the Tanzanian cohort, and particularly the sero-positive individuals, both possibilities 373

remain open. Our data would, however, only support antibody control of blood-stage replication 374

during the initial phase of sub-qPCR detectable parasitemia: While parasite multiplication based 375

on PCR data could not be directly compared due to the high variability of the amplification 376

dynamics (24), there was no difference between pre-patency by TS or qPCR between the two 377

Tanzanian groups. 378

379

Upon CHMI, Dutch volunteers showed a slight but significant induction of humoral responses 380

against CSP, Pf lysate and EXP-1, while Tanzanians boosted responses to all antigens 381

examined. Reactivity to the sporozoite antigen CSP is expected after PfSPZ inoculation, and 382

consistent with previous findings (38, 39). Increased antibody responses against Pf lysate and 383

EXP-1 likely reflect cross-stage reactivity between late liver-stage and blood-stage merozoites, 384

while exposure to developing liver-stages (LSA-1) in naïve volunteers appears insufficient to 385

induce a detectable antibody response. Similarly, limited exposure to blood-stage expressed 386

AMA-1, due to early curative treatment, appears to prevent induction of detectable titers in naïve 387

volunteers, which is consistent with results even after multiple CHMIs (39). Consistent with pre-388

exposure, Tanzanians showed on group level a greater increase in titers for Pf lysate, AMA-1 and 389

LSA-1 compared to the previously malaria-naive Dutch. Within the Tanzanian cohort, Pf lysate 390

sero-negative Tanzanians showed a similar absolute and accordingly much greater fold increase 391

in antibody titers compared to their sero-positive counterparts. At baseline, these volunteers had 392

significantly lower responses to most parasite antigens and largely resembled the malaria-naïve 393

Dutch cohort. The fact that this group showed a greater increase in antibody titers than the Dutch 394

strongly suggests that despite largely negative Pf serology, these individuals have a stable Pf-395


.org/D

ownloaded from

http://iai.asm.org/

16

specific memory B-cell repertoire (40, 41). Given the same increase in absolute antibody titers, 396

their memory B-cell repertoire appears to be of a similar magnitude as that of the Pf lysate sero-397

positive Tanzanians, despite lower circulating plasma antibody levels. 398

399

Of note, humoral responses were assessed using a number of recombinant or synthetic proteins, 400

which are not fully identical to the sequences of these proteins expressed by the NF54 strain 401

used in both CHMI trials. While most antigens used in this study were of 3D7 sequence and thus 402

closely resemble the NF54 sequence, AMA-1 responses were assessed using the FVO strain 403

sequence. AMA-1 is known to for its extensive antigenic polymorphism and to cause strain-404

specific immunity (42, 43). Nevertheless, there is a significant antigenic overlap between AMA-1 405

alleles allowing for cross-reactivity across different strains, both in terms of functional activity and 406

recognition, which mainly affects the magnitude of the response (42, 44-46). Based on these 407

data, we consider it unlikely that assessment of AMA-1 responses using the NF54 or 3D7 408

sequence would have yielded different qualitative results. However, absolute titers would likely 409

have been higher when using the AMA-1 sequence homologous to the CHMI strain. 410

Another potential confounder is the fact that the Pf strains, which Tanzanian volunteers were 411

exposed to prior to CHMI with Pf NF54, are naturally unknown. As any study examining pre-412

exposed individuals, analysis of antigen-specific responses against polymorphic antigens has 413

therefore the additional limitation that it is difficult to match this unknown exposure history. This 414

has to especially be taken into account when investigating CHMI-induced boosting of potential 415

pre-existing responses in this cohort, which might be masked by using antigens of different strain 416

origin. However, despite the fact that Tanzanians likely experienced exposure to a variety of Pf 417

strains prior to CHMI, there was (i) a clear division into sero-positive and negative individuals not 418

just by total Pf NF54 lysate, but also reflected by all individual antigens analyzed and (ii) a clearly 419

stronger increase in antibody titers in Tanzanians compared to malaria-naïve Dutch volunteers to 420

several antigens including AMA-1. We cannot exclude, however, that this might have even been 421

more pronounced when using antigens of different strain origin for analysis. 422

423


.org/D

ownloaded from

http://iai.asm.org/

17

Although the Tanzanian volunteers in the present study showed evidence for humoral immune 424

memory, parasite-specific IFNγ-production by adaptive T-cell subsets was not higher than in 425

malaria-naïve Dutch volunteers at baseline and remained unchanged after CHMI. In contrast, 426

previously naïve Dutch volunteers showed a significant increase in IFNγ-production by CD4 and 427

CD8 T-cell subsets after a primary infection, consistent with what has been shown previously (47, 428

48). The lack of increased proliferative and Th1 responses one month after CHMI in Tanzanian 429

volunteers could be partially due to immunosuppression following exposure to blood-stage 430

parasites during CHMI. Such T-cell immunosuppression is well described for malaria (49-58), and 431

although usually resolved within two weeks (52, 53) can persist for more than 4 weeks (50). That 432

Dutch volunteers are not equally affected by this might be due to the fact that such 433

immunosuppressive effects appear to be more pronounced in immune than non-immune donors, 434

as shown elsewhere (59). One potential mediator of suppressed IFNγ-production by adaptive 435

cells are T regulatory cells (Tregs). Increased Treg numbers during or after malaria are a well 436

reported phenomenon (60), and malaria parasites can enhance the suppressive activity of Tregs 437

(61). While Dutch and Tanzanian volunteers had similar Treg proportions, we cannot exclude that 438

Tregs in Tanzanian volunteers might be functionally more active, potentially due to past priming 439

in malaria infections. That this apparent lack of a Th1 immune response in the Tanzanian cohort 440

is malaria-specific is supported by the fact Dutch and Tanzanian volunteers showed similar Th1 441

responses to mitogen stimulation both pre- and post-CHMI. Nevertheless, an additional influence 442

of genetic background, which may explain differential Pf-specific responses as described in 443

endemic settings, cannot be excluded (62, 63). 444

445

NK cells are rapidly activated by malaria parasites, contribute to the early IFNγ-response during 446

blood-stage infection (64) and can eliminate infected erythrocytes in vivo in a contact-dependent 447

manner (65). Importantly, there seems is a functional dichotomy: the rarer CD56bright cells are 448

more prominent in lymphatic tissues and are superior cytokine producers, while the CD56dim 449

subset harbors a stronger cytotoxic potential (66-68). However, NK cells have usually been 450

examined as one population and the exact contribution of CD56dim and CD56bright NK cell 451

subsets to malaria immunity thus remains to be established. An in vitro study on PBMCs from 452


.org/D

ownloaded from

http://iai.asm.org/

18

malaria-naïve donors found greater IFNγ-production by CD56bright compared to CD56dim NK 453

cells only in response to cytokines, but not upon PfRBC stimulation (69). However, consistent 454

with their generally reported greater cytotoxic potential, only CD56dim cells showed de-455

granulation upon PfRBC stimulation (69). Our findings that CD56bright NK cells show a greater 456

IFNγ-response than CD56dim NK cells to PfRBC both before and after a primary malaria 457

infection, as well as a memory-like effect of this response is in line with findings from a previous 458

CHMI trial (70). Tanzanian volunteers showed the same functional difference between the two 459

NK cell subsets, but no memory-effect in either subset after CHMI. It was previously shown that 460

depletion of αβ T-cells abrogates memory-like IFNγ responses of innate cells otherwise observed 461

after CHMI (47, 70). Therefore, the absence of increased PfRBC-specific αβ T-cell responses 462

post-CHMI in Tanzania volunteers might be one reason why Pf-specific IFNγ-production by NK 463

cells and other innate lymphocytes (NKT and γδ T-cells) was also not increased post-CHMI. The 464

fact that Pf lysate sero-negative Tanzanians had higher innate IFNγ-responses already at 465

baseline is a further indication that reduced Th1 responses are likely linked to the degree of 466

previous malaria-exposure. Of note, the proportion of CD56bright cells remained unaltered after 467

CHMI, while the CD56dim subset had a smaller contribution to the PBMC compartment post-468

CHMI in both cohorts. Whether this means that in contrast to memory-like IFNγ-production, other 469

NK cell functions such as migration out of the circulation and engagement in anti-malaria immune 470

responses at other sites such as the spleen is unaffected and fully functional in pre-exposed 471

individuals remains to be established. 472

473

Within the Tanzanian cohort, there was no association of pre-existing Pf-specific IFNγ-responses 474

by T-cell subsets or innate lymphocytes with the parasiological outcome of CHMI, i.e. pre-patency 475

or parasite load at first detection by qPCR. If at all, those with higher IFNγ-responses to blood-476

stage PfRBC had a shorter pre-patency. This does not, however, exclude that cellular responses 477

play a role in the prolonged pre-patency of Tanzanian volunteers and specifically those with 478

positive Pf-serology. One possible reason for the lack of such an association is that PfRBC were 479

chosen as a stimulus for Pf-specific responses. This was done due to the relatively large 480

antigenic overlap between blood-stage and (late) liver-stage parasites (71, 72). However, 481


.org/D

ownloaded from

http://iai.asm.org/

19

responses to sporozoite and early liver-stage antigens, which may be more relevant when 482

assessing responses responsible for reducing the parasite load by targeting the earlier stages of 483

infection, are likely to be missed using PfRBC as a stimulus. Moreover, our analysis was 484

restricted to Pf-specific IFNγ-production, and it is likely that other responses, for instance de-485

granulation as a proxy for cytotoxicity may be more relevant readouts (71). Finally, the only 486

accessible compartment for analysis of cellular responses in these human trials was peripheral 487

blood. Pf-specific responses and particularly those responsible for reducing liver-infection, might, 488

however, be enriched or primarily located in other sites, for instance as tissue-resident memory 489

cells in the liver (73, 74). This might be even more pronounced in pre-exposed individuals, where 490

such a tissue-resident memory population might have already been established. 491

492

Noteworthy, the differential immune responses described herein may explain why Tanzanian 493

volunteers reported fewer clinical symptoms such as fever compared to their Dutch counterparts 494

during CHMI after PfSPZ injection (24). On the one hand, pre-existing antibody responses may 495

reduce the initial parasite load and mediate anti-disease immunity. Additionally, the relatively 496

lower Pf-specific cellular Th1 responses observed in the Tanzanian cohort might also be 497

beneficial. Dutch volunteers pre-exposed to infected mosquito-bites under chloroquine 498

prophylaxis exhibited stronger IFNγ-production and earlier clinical symptoms when re-exposed to 499

blood-stage parasites than malaria-naïve volunteers during their first infection (15). Thus, a shift 500

away from Th1 responses in pre-exposed volunteers may make them less vulnerable to fever 501

and other inflammation-induced symptoms. 502

503

In conclusion, our data show that previous malaria exposure is associated with some degree of 504

parasite control during liver or early blood-stage infection after CHMI, humoral immune memory, 505

and reduced anti-parasite Th1 responses in the circulating lymphocyte compartment. Positive Pf 506

lysate serology can be used to identify individuals with better parasite control but weaker 507

peripheral blood Th1 responses, which may help to stratify volunteers in future CHMI trials in 508

endemic areas. However, assessment of memory B-cell responses might be explored as a 509

potentially better tool than serology to define pre-exposure per se. Important questions to be 510


.org/D

ownloaded from

http://iai.asm.org/

20

addressed in future studies include (i) which readouts other than Th1 responses should be used 511

to determine immunization-induced cellular immunity, and (ii) how differences in pre-existing 512

malaria-specific immune responses affect the outcome of whole parasite immunization and 513

vaccination approaches in malaria-endemic areas. 514

515

516


.org/D

ownloaded from

http://iai.asm.org/

21

Acknowledgements 517

We thank all the trial volunteers and the staff from the Radboud university medical center, the 518

Ifakara Health Institute/Bagamoyo Research and Training Centre, Sanaria Inc. and the Swiss 519

Tropical and Public Health Institute, all of whom made this study possible. We thank S. Singh 520

(Gennova Biopharmaceuticals), D. Lanar and G. Corradin, for providing recombinant and 521

synthetic CSP, LSA-1 and EXP-1 proteins, respectively. We thank M. van de Vegte-Bolmer, R. 522

Siebelink-Stoter and W. Graumans for culture and isolation of PfRBCs. 523

524

S.L.H. is Chief Executive and Scientific Officer at Sanaria Inc., B.K.L.S., P.F.B. and E.R.J. are 525

employees of Sanaria Inc. which manufactured and provided PfSPZ Challenge, and do thus have 526

a potential conflict of interest. There are no other conflicts of interest for all other authors. 527

528

This work was supported by Top Institute (TI) Pharma (grant number T4-102),the FP7-founded 529

European Virtual Institute of Malaria Research (EVIMalaR, grant agreement number 242095), the 530

Tanzanian Commission on Science and Technology (COSTECH), the Ifakara Health Institute, 531

and the Swiss Tropical Public Health Institute. A.S. received a long-term post-doctoral fellowship 532

from the European Molecular Biology Organization (EMBO). The development and manufacturing 533

of cryopreserved Pf sporozoites PfSPZ Challenge was further supported by Small Business 534

Innovation Research (SBIR) (grants R44AI058375-03, 04, 05, 05S1) from the National Institute of 535

Allergy and Infectious Diseases at the National Institute of Health (NIAID/NIH), USA and through 536

agreement 07984 from the Program for Appropriate Technology in health (PATH) Malaria 537

Vaccine Initiative (with funds from the Bill and Melinda Gates Foundation). The funders had no 538

role in study design, data collection and analysis, decision to publish, or preparation of the 539

manuscript. 540

541

Author contributions 542

J.M.O., S.S., C.C.H., E.M.B., M.R, C.D.A., S.L.H., S.A., R.S. and A.S. designed the studies and 543

experiments. S.S., E.M.B. and M.R. performed the clinical studies and collected clinical data. 544


.org/D

ownloaded from

http://iai.asm.org/

22

J.M.O., C.C.H., K.T. and A.S. conducted experiments. J.M.O., C.C.H. and A.S. analyzed the 545

data. M.M., P.F.B., B.K.L.S., E.R.J., S.L.H. and A.S. collected/prepared/contributed vital 546

reagents. J.M.O., C.C.H., R.W.S. and A.S. interpreted the data. J.M.O., C.C.H., R.W.S. and A.S. 547

wrote the manuscript. All authors read and approved the final manuscript. 548

549


.org/D

ownloaded from

http://iai.asm.org/

23

Figures 550

Figure 1: Baseline malaria-specific antibody titers indicate previous exposure in Tanzanian 551

volunteers. Antibody reactivity against crude Pf lysate and the Pf antigens AMA-1, EXP-1, LSA-1 552

and CSP was tested prior to malaria infection. A pool of sera from 100 hyperimmune Tanzanians 553

(HIT) was used as a reference. Reactivity for each antigen in undiluted HIT serum was set at 100 554

arbitrary units (AU). (A) Responses between Dutch (D; circles; n=9) and Tanzanian (T; squares; 555

n=21) cohorts were compared using Mann-Whitney U-test. (B) Tanzanian volunteers were 556

stratified based on Pf lysate recognition at baseline as Sero+ (n=12; black box plots) or Sero- 557

(n=9; white box plots), using the mean +2SD of Dutch volunteers (grey circles) as a cut-off for 558

positivity. (C) Pre-CHMI responses of sero+ and sero- Tanzanians were analyzed by ELISA for 559

individual Pf antigens and compared by Mann Whitney U-test. Scatter plots show individual data 560

points, horizontal lines indicate the median of the group and error bars the interquartile range 561

(IQR). Dashed lines indicate the mean + 2SD of antibody titers in Dutch volunteers for each 562

respective antigen. 563

564

Figure 2: Pre-exposure to malaria is associated with difference in pre-patency and 565

parasitemia after CHMI. Parasitemia after CHMI was determined by qPCR. The day of first 566

parasite detection by qPCR after PfSPZ injection is shown for (A) Dutch (D, grey circles; n=9) 567

versus Tanzanians (T, grey squares; n=21) and (B) for Pf sero-positive (n=12; black squares) 568

and sero-negative (n=9; white squares) Tanzanian volunteers. The parasite load (number of Pf 569

parasites per ml blood) at (C) the first day of qPCR-detectable parasitemia and (D) the time of 570

first peak parasite density is shown for Pf sero-positive (n=12; black squares) and sero-negative 571

(n=9; white squares) Tanzanian volunteers. Data are shown as median ± IQR. Groups were 572

compared by Mann Whitney U-test. 573

574

Figure 3: Increased humoral responses in Dutch and Tanzanians after CHMI. Antibody titers 575

were measured (A) four weeks (Tanzanians; squares, n=21) and (B) five weeks (Dutch; circles, 576

n=9) after intradermal infection with PfSPZ. Graphs show the antibody reactivity (AU) pre-CHMI 577


.org/D

ownloaded from

http://iai.asm.org/

24

(black) versus post-CHMI (white) against crude Pf lysate, AMA-1, EXP-1, LSA-1 and CSP. Plots 578

show individual data points, with lines connecting the two time points for each volunteer. 579

Responses in the two cohorts pre-versus post-CHMI were compared using Wilcoxon matched-580

pairs signed rank test. The (C, E) fold increase (ratio AU post-CHMI/AU pre-CHMI) and (D, F) 581

absolute increase in antibody reactivity ( AU post-CHMI minus AU pre-CHMI) was calculated for 582

(C, D) Dutch versus Tanzanian volunteers, and (E, F) in Tanzanian volunteers classified as Pf 583

lysate sero-positive or sero-negative at baseline. Data are shown as whisker plots with boxes 584

indicating the median and IQR, and whiskers the min/max values. Responses were compared 585

using Mann-Whitney U-test. 586

587

Figure 4: Dutch, but not Tanzanian volunteers show increased Pf-specific in vitro IFNγ-588

production after CHMI. PBMCs collected pre- and post-CHMI from Dutch (D; circles; n=9; 589

post=35 days after CHMI) and Tanzanian (T; squares; n=21; post=28 days after CHMI) 590

volunteers were stimulated with PfRBC for 24h. After stimulation cells were stained for (A) 591

surface expression of CD3, CD4, γδTCR, CD8 and CD56 to gate lymphocyte subsets. NKT and 592

γδT were gated as a combined population. (B) Intracellular IFNγ is shown for total lymphocytes 593

after 24h uRBC or PfRBC stimulation. Graphs show the proportions of cells with Pf-specific IFNγ-594

production, comparing Dutch and Tanzanian volunteers (C) pre- and (D) post-CHMI, and 595

comparing pre- and post-CHMI responses within each cohort for (E) CD4+ T-cells, (F) CD8+ T-596

cells, (G) CD56dim NK cells, (H) CD56bright NK cells and (I) NKT-γδT-cells. For each volunteer 597

all time points were measured in a single experiment. Data are shown as (C, D) whisker plots 598

with boxes indicating the median with IQR and whiskers the min/max values or (E-I) individual 599

data points with lines connecting the two time points for each volunteer. All responses were 600

corrected for background by subtracting responses to uRBC. Responses pre- versus post-CHMI 601

were compared using Wilcoxon matched-pairs signed rank test. 602

603

Figure 5: Pf-specific in vitro IFNγ-production by innate lymphocytes from Tanzanian 604

volunteers is dependent on baseline serological status. PBMC collected from Tanzanian 605

volunteers who either had a positive Pf (Sero+; n=12; black squares) or negative Pf serology 606


.org/D

ownloaded from

http://iai.asm.org/

25

(Sero-; n=9; white squares) prior to challenge (baseline) were stimulated with PfRBC for 24h and 607

stained for intracellular IFNγ. Panels show IFNγ-production by lymphocyte subsets; (A) CD4+ T-608

cells, (B) CD8+ T-cells, (C) NKT-γδT-cells, (D) CD56dim and (E) CD56bright NK cells. Data are 609

shown as median ± IQR of responses corrected for background by subtracting responses to 610

uRBC. Differences in responses between the sero+ and sero-groups were analyzed by Mann 611

Whitney U-test. Pf-specific IFNγ-responses of pre-CHMI PBMCs from malaria-naïve Dutch 612

volunteers (D; n=9; grey circles), who had negative Pf serology, are shown as a comparator. 613

614


.org/D

ownloaded from

http://iai.asm.org/

26

References 615

616

1. WHO. 2013. World Malaria report. 617

2. Feachem, R. G., A. A. Phillips, J. Hwang, C. Cotter, B. Wielgosz, B. M. Greenwood, 618

O. Sabot, M. H. Rodriguez, R. R. Abeyasinghe, T. A. Ghebreyesus, and R. W. Snow. 619

2010. Shrinking the malaria map: progress and prospects. Lancet 376:1566-1578. 620

3. Mendis, K., A. Rietveld, M. Warsame, A. Bosman, B. Greenwood, and W. H. 621

Wernsdorfer. 2009. From malaria control to eradication: The WHO perspective. Tropical 622

medicine & international health : TM & IH 14:802-809. 623

4. Rts, S. C. T. P. 2014. Efficacy and safety of the RTS,S/AS01 malaria vaccine during 18 624

months after vaccination: a phase 3 randomized, controlled trial in children and young 625

infants at 11 African sites. PLoS medicine 11:e1001685. 626

5. Rts, S. C. T. P., S. T. Agnandji, B. Lell, J. F. Fernandes, B. P. Abossolo, B. G. 627

Methogo, A. L. Kabwende, A. A. Adegnika, B. Mordmuller, S. Issifou, P. G. 628

Kremsner, J. Sacarlal, P. Aide, M. Lanaspa, J. J. Aponte, S. Machevo, S. Acacio, H. 629

Bulo, B. Sigauque, E. Macete, P. Alonso, S. Abdulla, N. Salim, R. Minja, M. Mpina, S. 630

Ahmed, A. M. Ali, A. T. Mtoro, A. S. Hamad, P. Mutani, M. Tanner, H. Tinto, U. 631

D'Alessandro, H. Sorgho, I. Valea, B. Bihoun, I. Guiraud, B. Kabore, O. Sombie, R. T. 632

Guiguemde, J. B. Ouedraogo, M. J. Hamel, S. Kariuki, M. Oneko, C. Odero, K. 633

Otieno, N. Awino, M. McMorrow, V. Muturi-Kioi, K. F. Laserson, L. Slutsker, W. 634

Otieno, L. Otieno, N. Otsyula, S. Gondi, A. Otieno, V. Owira, E. Oguk, G. Odongo, J. 635

B. Woods, B. Ogutu, P. Njuguna, R. Chilengi, P. Akoo, C. Kerubo, C. Maingi, T. 636

Lang, A. Olotu, P. Bejon, K. Marsh, G. Mwambingu, S. Owusu-Agyei, K. P. Asante, 637

K. Osei-Kwakye, O. Boahen, D. Dosoo, I. Asante, G. Adjei, E. Kwara, D. 638

Chandramohan, B. Greenwood, J. Lusingu, S. Gesase, A. Malabeja, O. Abdul, C. 639

Mahende, E. Liheluka, L. Malle, M. Lemnge, T. G. Theander, C. Drakeley, D. Ansong, 640

T. Agbenyega, S. Adjei, H. O. Boateng, T. Rettig, J. Bawa, J. Sylverken, D. Sambian, 641

A. Sarfo, A. Agyekum, F. Martinson, I. Hoffman, T. Mvalo, P. Kamthunzi, R. Nkomo, 642


.org/D

ownloaded from

http://iai.asm.org/

27

T. Tembo, G. Tegha, M. Tsidya, J. Kilembe, C. Chawinga, W. R. Ballou, J. Cohen, Y. 643

Guerra, E. Jongert, D. Lapierre, A. Leach, M. Lievens, O. Ofori-Anyinam, A. Olivier, 644

J. Vekemans, T. Carter, D. Kaslow, D. Leboulleux, C. Loucq, A. Radford, B. 645

Savarese, D. Schellenberg, M. Sillman, and P. Vansadia. 2012. A phase 3 trial of 646

RTS,S/AS01 malaria vaccine in African infants. The New England journal of medicine 647

367:2284-2295. 648

6. Bejon, P., M. T. White, A. Olotu, K. Bojang, J. P. A. Lusingu, N. Salim, N. N. Otsyula, 649

S. T. Agnandji, K. P. Asante, S. Owusu-Agyei, S. Abdulla, and A. C. Ghani. 2013. 650

Efficacy of RTS,S malaria vaccines: individual-participant pooled analysis of phase 2 data. 651

The Lancet Infectious Diseases 13:319-327. 652

7. Bojang, K. A., P. J. M. Milligan, M. Pinder, L. Vigneron, A. Alloueche, K. E. Kester, W. 653

R. Ballou, D. J. Conway, W. H. H. Reece, P. Gothard, L. Yamuah, M. Delchambre, G. 654

Voss, B. M. Greenwood, A. Hill, K. P. W. J. McAdam, N. Tornieporth, J. D. Cohen, 655

and T. Doherty. 2001. Efficacy of RTS,S/AS02 malaria vaccine against Plasmodium 656

falciparum infection in semi-immune adult men in The Gambia: a randomised trial. The 657

Lancet 358:1927-1934. 658

8. Struik, S. S., and E. M. Riley. 2004. Does malaria suffer from lack of memory? Immunol 659

Rev 201:268-290. 660

9. Doolan, D., C. Dobaño, and J. Baird. 2009. Acquired immunity to malaria. Clinical 661

microbiology reviews 22:13. 662

10. Sauerwein, R., M. Roestenberg, and V. Moorthy. 2011. Experimental human challenge 663

infections can accelerate clinical malaria vaccine development. Nat Rev Immunol 11:57-664

64. 665

11. Stoute, J. A., M. Slaoui, D. G. Heppner, P. Momin, K. E. Kester, P. Desmons, B. T. 666

Wellde, N. Garcon, U. Krzych, and M. Marchand. 1997. A preliminary evaluation of a 667

recombinant circumsporozoite protein vaccine against Plasmodium falciparum malaria. 668

RTS,S Malaria Vaccine Evaluation Group. The New England journal of medicine 336:86-669

91. 670


.org/D

ownloaded from

http://iai.asm.org/

28

12. Clyde, D. 1975. Immunization of man against falciparum and vivax malaria by use of 671

attenuated sporozoites. The American journal of tropical medicine and hygiene 24:397-672

401. 673

13. Hoffman, S., L. Goh, T. Luke, I. Schneider, T. Le, D. Doolan, J. Sacci, P. de la Vega, 674

M. Dowler, C. Paul, D. Gordon, J. Stoute, L. Church, M. Sedegah, D. Heppner, W. 675

Ballou, and T. Richie. 2002. Protection of humans against malaria by immunization with 676

radiation-attenuated Plasmodium falciparum sporozoites. The Journal of infectious 677

diseases 185:1155-1164. 678

14. Kester, K., D. McKinney, N. Tornieporth, C. Ockenhouse, D. Heppner, T. Hall, U. 679

Krzych, M. Delchambre, G. Voss, M. Dowler, J. Palensky, J. Wittes, J. Cohen, W. 680

Ballou, and S. M. V. E. G. Rts. 2001. Efficacy of recombinant circumsporozoite protein 681

vaccine regimens against experimental Plasmodium falciparum malaria. The Journal of 682

infectious diseases 183:640-647. 683

15. Bijker, E., G. Bastiaens, A. Teirlinck, G.-J. van Gemert, W. Graumans, M. van de 684

Vegte-Bolmer, R. Siebelink-Stoter, T. Arens, K. Teelen, W. Nahrendorf, E. 685

Remarque, W. Roeffen, A. Jansens, D. Zimmerman, M. Vos, B. van Schaijk, J. 686

Wiersma, A. van der Ven, Q. de Mast, L. van Lieshout, J. Verweij, C. Hermsen, A. 687

Scholzen, and R. Sauerwein. 2013. Protection against malaria after immunization by 688

chloroquine prophylaxis and sporozoites is mediated by preerythrocytic immunity. 689

Proceedings of the National Academy of Sciences of the United States of America 690

110:7862-7867. 691

16. Roestenberg, M., G. A. O'Hara, C. J. A. Duncan, J. E. Epstein, N. J. Edwards, A. 692

Scholzen, A. J. A. M. van der Ven, C. C. Hermsen, A. V. S. Hill, and R. W. Sauerwein. 693

2012. Comparison of Clinical and Parasitological Data from Controlled Human Malaria 694

Infection Trials. PloS one 7:e38434. 695

17. Engwerda, C. R., G. Minigo, F. H. Amante, and J. S. McCarthy. 2012. Experimentally 696

induced blood stage malaria infection as a tool for clinical research. Trends in parasitology 697

28:515-521. 698


.org/D

ownloaded from

http://iai.asm.org/

29

18. Lyke, K. E., M. Laurens, M. Adams, P. F. Billingsley, A. Richman, M. Loyevsky, S. 699

Chakravarty, C. V. Plowe, B. K. Sim, R. Edelman, and S. L. Hoffman. 2010. 700

Plasmodium falciparum malaria challenge by the bite of aseptic Anopheles stephensi 701

mosquitoes: results of a randomized infectivity trial. PloS one 5:e13490. 702

19. Hodgson, S. H., K. J. Ewer, C. M. Bliss, N. J. Edwards, T. Rampling, N. A. 703

Anagnostou, E. de Barra, T. Havelock, G. Bowyer, I. D. Poulton, S. de Cassan, J. J. 704

Illingworth, A. D. Douglas, P. B. Mange, K. A. Collins, R. Roberts, S. Gerry, E. Berrie, 705

S. Moyle, S. Colloca, R. Cortese, R. E. Sinden, S. C. Gilbert, P. Bejon, A. M. Lawrie, 706

A. Nicosia, S. N. Faust, and A. V. Hill. 2014. Evaluation of the Efficacy of ChAd63-MVA 707

Vectored Vaccines Expressing CS & ME-TRAP Against Controlled Human Malaria 708

Infection in Malaria Naive Individuals. The Journal of infectious diseases. 709

20. Roestenberg, M., M. McCall, J. Hopman, J. Wiersma, A. Luty, G. van Gemert, M. van 710

de Vegte-Bolmer, B. van Schaijk, K. Teelen, T. Arens, L. Spaarman, Q. de Mast, W. 711

Roeffen, G. Snounou, L. Rénia, A. van der Ven, C. Hermsen, and R. Sauerwein. 712

2009. Protection against a malaria challenge by sporozoite inoculation. The New England 713

journal of medicine 361:468-477. 714

21. Seder, R. A., L. J. Chang, M. E. Enama, K. L. Zephir, U. N. Sarwar, I. J. Gordon, L. A. 715

Holman, E. R. James, P. F. Billingsley, A. Gunasekera, A. Richman, S. Chakravarty, 716

A. Manoj, S. Velmurugan, M. Li, A. J. Ruben, T. Li, A. G. Eappen, R. E. Stafford, S. H. 717

Plummer, C. S. Hendel, L. Novik, P. J. Costner, F. H. Mendoza, J. G. Saunders, M. C. 718

Nason, J. H. Richardson, J. Murphy, S. A. Davidson, T. L. Richie, M. Sedegah, A. 719

Sutamihardja, G. A. Fahle, K. E. Lyke, M. B. Laurens, M. Roederer, K. Tewari, J. E. 720

Epstein, B. K. Sim, J. E. Ledgerwood, B. S. Graham, S. L. Hoffman, and V. R. C. S. 721

Team. 2013. Protection against malaria by intravenous immunization with a nonreplicating 722

sporozoite vaccine. Science 341:1359-1365. 723

22. Hoffman, S. L., P. F. Billingsley, E. James, A. Richman, M. Loyevsky, T. Li, S. 724

Chakravarty, A. Gunasekera, R. Chattopadhyay, M. Li, R. Stafford, A. Ahumada, J. 725

E. Epstein, M. Sedegah, S. Reyes, T. L. Richie, K. E. Lyke, R. Edelman, M. B. 726

Laurens, C. V. Plowe, and B. K. Sim. 2010. Development of a metabolically active, non-727


.org/D

ownloaded from

http://iai.asm.org/

30

replicating sporozoite vaccine to prevent Plasmodium falciparum malaria. Hum Vaccin 728

6:97-106. 729

23. Roestenberg, M., E. Bijker, B. Sim, P. Billingsley, E. James, G. Bastiaens, A. 730

Teirlinck, A. Scholzen, K. Teelen, T. Arens, A. van der Ven, A. Gunasekera, S. 731

Chakravarty, S. Velmurugan, C. Hermsen, R. Sauerwein, and S. Hoffman. 2013. 732

Controlled human malaria infections by intradermal injection of cryopreserved 733

Plasmodium falciparum sporozoites. The American journal of tropical medicine and 734

hygiene 88:5-13. 735

24. Shekalaghe, S., M. Rutaihwa, P. F. Billingsley, M. Chemba, C. A. Daubenberger, E. 736

James, M. Mpina, O. Ali Juma, T. Schindler, E. Huber, A. Gunasekera, A. Manoj, B. 737

Simon, E. Savarino, L. W. Church, C. C. Hermsen, R. W. Sauerwein, C. V. Plowe, M. 738

Venkatesan, P. Sasi, O. Lweno, P. Mutani, A. Hamad, A. Mohammed, A. Urassa, T. 739

Mzee, D. Padilla, A. Ruben, B. K. Lee Sim, M. Tanner, S. Abdullah, and S. L. 740

Hoffman. 2014. Controlled Human Malaria Infection of Tanzanians by Intradermal 741

Injection of Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites. The 742

American journal of tropical medicine and hygiene. 743

25. Hermsen, C. C., D. S. Telgt, E. H. Linders, L. A. van de Locht, W. M. Eling, E. J. 744

Mensink, and R. W. Sauerwein. 2001. Detection of Plasmodium falciparum malaria 745

parasites in vivo by real-time quantitative PCR. Molecular and biochemical parasitology 746

118:247-251. 747

26. Adegnika, A. A., J. J. Verweij, S. T. Agnandji, S. K. Chai, L. P. Breitling, M. 748

Ramharter, M. Frolich, S. Issifou, P. G. Kremsner, and M. Yazdanbakhsh. 2006. 749

Microscopic and sub-microscopic Plasmodium falciparum infection, but not inflammation 750

caused by infection, is associated with low birth weight. The American journal of tropical 751

medicine and hygiene 75:798-803. 752

27. Walliker, D., I. A. Quakyi, T. E. Wellems, T. F. McCutchan, A. Szarfman, W. T. 753

London, L. M. Corcoran, T. R. Burkot, and R. Carter. 1987. Genetic analysis of the 754

human malaria parasite Plasmodium falciparum. Science 236:1661-1666. 755


.org/D

ownloaded from

http://iai.asm.org/

31

28. Hillier, C. J., L. A. Ware, A. Barbosa, E. Angov, J. A. Lyon, D. G. Heppner, and D. E. 756

Lanar. 2005. Process Development and Analysis of Liver-Stage Antigen 1, a 757

Preerythrocyte-Stage Protein-Based Vaccine for Plasmodium falciparum. Infection and 758

immunity 73:2109-2115. 759

29. Zhu, J., and M. R. Hollingdale. 1991. Structure of Plasmodium falciparum liver stage 760

antigen-1. Molecular and biochemical parasitology 48:223-226. 761

30. Fidock, D. A., H. Gras-Masse, J. P. Lepers, K. Brahimi, L. Benmohamed, S. Mellouk, 762

C. Guerin-Marchand, A. Londono, L. Raharimalala, J. F. Meis, G. Langsley, C. 763

Roussilhon, A. Tartar, and P. Druilhe. 1994. Plasmodium falciparum liver stage antigen-764

1 is well conserved and contains potent B and T cell determinants. Journal of immunology 765

153:190-204. 766

31. Kocken, C., C. Withers-Martinez, M. Dubbeld, A. van der Wel, F. Hackett, A. 767

Valderrama, M. Blackman, and A. Thomas. 2002. High-level expression of the malaria 768

blood-stage vaccine candidate Plasmodium falciparum apical membrane antigen 1 and 769

induction of antibodies that inhibit erythrocyte invasion. Infection and immunity 70:4471-770

4476. 771

32. Faber, B., E. Remarque, C. Kocken, P. Cheront, D. Cingolani, F. Xhonneux, M. 772

Jurado, M. Haumont, S. Jepsen, O. Leroy, and A. Thomas. 2008. Production, quality 773

control, stability and pharmacotoxicity of cGMP-produced Plasmodium falciparum AMA1 774

FVO strain ectodomain expressed in Pichia pastoris. Vaccine 26:6143-6150. 775

33. Meraldi, V., I. Nebié, R. Moret, N. Cuzin-Ouattara, A. Thiocone, O. Doumbo, F. 776

Esposito, A. Traoré, G. Corradin, and S. Terenzi. 2002. Recognition of synthetic 777

polypeptides corresponding to the N- and C-terminal fragments of Plasmodium falciparum 778

Exp-1 by T-cells and plasma from human donors from African endemic areas. Parasite 779

immunology 24:141-150. 780

34. Bottius, E., A. Guanzirolli, J.-F. Trape, C. Rogier, L. Konate, and P. Druilhe. 1996. 781

Malaria: even more chronic in nature than previously thought; evidence for subpatent 782

parasitaemia detectable by the polymerase chain reaction. Transactions of the Royal 783

Society of Tropical Medicine and Hygiene 90:15-19. 784


.org/D

ownloaded from

http://iai.asm.org/

32

35. Roestenberg, M., S. J. de Vlas, A. E. Nieman, R. W. Sauerwein, and C. C. Hermsen. 785

2012. Efficacy of preerythrocytic and blood-stage malaria vaccines can be assessed in 786

small sporozoite challenge trials in human volunteers. The Journal of infectious diseases 787

206:319-323. 788

36. Arnot, D. E., D. R. Cavanagh, E. J. Remarque, A. M. Creasey, M. P. Sowa, W. D. 789

Morgan, A. A. Holder, S. Longacre, and A. W. Thomas. 2008. Comparative testing of 790

six antigen-based malaria vaccine candidates directed toward merozoite-stage 791

Plasmodium falciparum. Clinical and vaccine immunology : CVI 15:1345-1355. 792

37. Schussek, S., A. Trieu, S. H. Apte, J. Sidney, A. Sette, and D. L. Doolan. 2013. 793

Immunization with apical membrane antigen 1 confers sterile infection-blocking immunity 794

against Plasmodium sporozoite challenge in a rodent model. Infection and immunity 795

81:3586-3599. 796

38. Felgner, P. L., M. Roestenberg, L. Liang, C. Hung, A. Jain, J. Pablo, R. Nakajima-797

Sasaki, D. Molina, K. Teelen, C. C. Hermsen, and R. Sauerwein. 2013. Pre-erythrocytic 798

antibody profiles induced by controlled human malaria infections in healthy volunteers 799

under chloroquine prophylaxis. Scientific reports 3:3549. 800

39. Nahrendorf, W., A. Scholzen, E. M. Bijker, A. C. Teirlinck, G. J. Bastiaens, R. Schats, 801

C. C. Hermsen, L. G. Visser, J. Langhorne, and R. W. Sauerwein. 2014. Memory B-cell 802

and antibody responses induced by Plasmodium falciparum sporozoite immunization. The 803

Journal of infectious diseases. 804

40. Ndungu, F. M., K. Lundblom, J. Rono, J. Illingworth, S. Eriksson, and A. Farnert. 805

2013. Long-lived Plasmodium falciparum specific memory B cells in naturally exposed 806

Swedish travelers. European journal of immunology 43:2919-2929. 807

41. Ndungu, F. M., A. Olotu, J. Mwacharo, M. Nyonda, J. Apfeld, L. K. Mramba, G. W. 808

Fegan, P. Bejon, and K. Marsh. 2012. Memory B cells are a more reliable archive for 809

historical antimalarial responses than plasma antibodies in no-longer exposed children. 810


109:8247-8252. 812


.org/D

ownloaded from

http://iai.asm.org/

33

42. Kennedy, M. C., J. Wang, Y. Zhang, A. P. Miles, F. Chitsaz, A. Saul, C. A. Long, L. H. 813

Miller, and A. W. Stowers. 2002. In vitro studies with recombinant Plasmodium 814

falciparum apical membrane antigen 1 (AMA1): production and activity of an AMA1 815

vaccine and generation of a multiallelic response. Infection and immunity 70:6948-6960. 816

43. Remarque, E. J., B. W. Faber, C. H. Kocken, and A. W. Thomas. 2008. Apical 817

membrane antigen 1: a malaria vaccine candidate in review. Trends in parasitology 818

24:74-84. 819

44. Drew, D. R., A. N. Hodder, D. W. Wilson, M. Foley, I. Mueller, P. M. Siba, A. E. Dent, 820

A. F. Cowman, and J. G. Beeson. 2012. Defining the antigenic diversity of Plasmodium 821

falciparum apical membrane antigen 1 and the requirements for a multi-allele vaccine 822

against malaria. PloS one 7:e51023. 823

45. Terheggen, U., D. R. Drew, A. N. Hodder, N. J. Cross, C. K. Mugyenyi, A. E. Barry, R. 824

F. Anders, S. Dutta, F. Osier, S. R. Elliott, N. Senn, D. I. Stanisic, K. Marsh, P. M. 825

Siba, I. Mueller, J. S. Richards, and J. G. Beeson. 2014. Limited antigenic diversity of 826

Plasmodium falciparum apical membrane antigen 1 supports the development of effective 827

multi-allele vaccines. BMC medicine 12:183. 828

46. Remarque, E. J., B. W. Faber, C. H. Kocken, and A. W. Thomas. 2008. A diversity-829

covering approach to immunization with Plasmodium falciparum apical membrane antigen 830

1 induces broader allelic recognition and growth inhibition responses in rabbits. Infection 831

and immunity 76:2660-2670. 832

47. Teirlinck, A., M. B. McCall, M. Roestenberg, A. Scholzen, R. Woestenenk, Q. de 833

Mast, A. van der Ven, C. Hermsen, A. Luty, and R. Sauerwein. 2011. Longevity and 834

composition of cellular immune responses following experimental Plasmodium falciparum 835

malaria infection in humans. PLoS pathogens 7. 836

48. Teirlinck, A., M. Roestenberg, M. van de Vegte-Bolmer, A. Scholzen, M. Heinrichs, 837

R. Siebelink-Stoter, W. Graumans, G.-J. van Gemert, K. Teelen, M. Vos, K. Nganou-838

Makamdop, S. Borrmann, Y. Rozier, M. A. Erkens, A. Luty, C. Hermsen, B. Sim, L. 839

van Lieshout, S. Hoffman, L. Visser, and R. Sauerwein. 2013. NF135.C10: a new 840


.org/D

ownloaded from

http://iai.asm.org/

34

Plasmodium falciparum clone for controlled human malaria infections. The Journal of 841

infectious diseases 207:656-660. 842

49. Riley, E. M., G. Andersson, L. N. Otoo, S. Jepsen, and B. M. Greenwood. 1988. 843

Cellular immune responses to Plasmodium falciparum antigens in Gambian children 844

during and after an acute attack of falciparum malaria. Clin Exp Immunol 73:17-22. 845

50. Ho, M., H. K. Webster, S. Looareesuwan, W. Supanaranond, R. E. Phillips, P. 846

Chanthavanich, and D. A. Warrell. 1986. Antigen-specific immunosuppression in human 847

malaria due to Plasmodium falciparum. The Journal of infectious diseases 153:763-771. 848

51. Chemtai, A. K., and G. B. Okelo. 1989. Suppression of T-cell proliferative response in 849

Plasmodium falciparum malaria patients--preliminary results. East Afr Med J 66:787-791. 850

52. Bygbjerg, I. C., S. Jepsen, and T. G. Theander. 1986. Lymphocyte response to purified 851

Plasmodium falciparum antigens during and after malaria. Acta Trop 43:55-62. 852

53. Theander, T. G., I. C. Bygbjerg, B. J. Andersen, S. Jepsen, A. Kharazmi, and N. 853

Odum. 1986. Suppression of parasite-specific response in Plasmodium falciparum 854

malaria. A longitudinal study of blood mononuclear cell proliferation and subset 855

composition. Scand J Immunol 24:73-81. 856

54. Williamson, W. A., and B. M. Greenwood. 1978. Impairment of the immune response to 857

vaccination after acute malaria. Lancet 1:1328-1329. 858

55. Mabey, D. C., A. Brown, and B. M. Greenwood. 1987. Plasmodium falciparum malaria 859

and Salmonella infections in Gambian children. The Journal of infectious diseases 860

155:1319-1321. 861

56. Gunapala, D. E., C. A. Facer, R. Davidson, and W. R. Weir. 1990. In vitro analysis of 862

Epstein-Barr virus: host balance in patients with acute Plasmodium falciparum malaria. I. 863

Defective T-cell control. Parasitol Res 76:531-535. 864

57. Greenwood, B. M., A. M. Bradley-Moore, A. D. Bryceson, and A. Palit. 1972. 865

Immunosuppression in children with malaria. Lancet 1:169-172. 866

58. Cook, I. F. 1985. Herpes zoster in children following malaria. J Trop Med Hyg 88:261-867

264. 868


.org/D

ownloaded from

http://iai.asm.org/

35

59. Riley, E. M., O. Jobe, M. Blackman, H. C. Whittle, and B. M. Greenwood. 1989. 869

Plasmodium falciparum schizont sonic extracts suppress lymphoproliferative responses to 870

mitogens and antigens in malaria-immune adults. Infection and immunity 57:3181-3188. 871

60. Scholzen, A., G. Minigo, and M. Plebanski. 2010. Heroes or villains? T regulatory cells 872

in malaria infection. Trends in parasitology 26:16-25. 873

61. Minigo, G., T. Woodberry, K. A. Piera, E. Salwati, E. Tjitra, E. Kenangalem, R. N. 874

Price, C. R. Engwerda, N. M. Anstey, and M. Plebanski. 2009. Parasite-dependent 875

expansion of TNF receptor II-positive regulatory T cells with enhanced suppressive 876

activity in adults with severe malaria. PLoS pathogens 5:e1000402. 877

62. McCall, M. B., J. Hopman, M. Daou, B. Maiga, V. Dara, I. Ploemen, K. Nganou-878

Makamdop, A. Niangaly, Y. Tolo, C. Arama, J. T. Bousema, J. W. van der Meer, A. J. 879

van der Ven, M. Troye-Blomberg, A. Dolo, O. K. Doumbo, and R. W. Sauerwein. 880

2010. Early interferon-gamma response against Plasmodium falciparum correlates with 881

interethnic differences in susceptibility to parasitemia between sympatric Fulani and 882

Dogon in Mali. The Journal of infectious diseases 201:142-152. 883

63. Torcia, M. G., V. Santarlasci, L. Cosmi, A. Clemente, L. Maggi, V. D. Mangano, F. 884

Verra, G. Bancone, I. Nebie, B. S. Sirima, F. Liotta, F. Frosali, R. Angeli, C. Severini, 885

A. R. Sannella, P. Bonini, M. Lucibello, E. Maggi, E. Garaci, M. Coluzzi, F. Cozzolino, 886

F. Annunziato, S. Romagnani, and D. Modiano. 2008. Functional deficit of T regulatory 887

cells in Fulani, an ethnic group with low susceptibility to Plasmodium falciparum malaria. 888


105:646-651. 890

64. Inoue, S., M. Niikura, S. Mineo, and F. Kobayashi. 2013. Roles of IFN-gamma and 891

gammadelta T Cells in Protective Immunity Against Blood-Stage Malaria. Frontiers in 892

immunology 4:258. 893

65. Chen, Q., A. Amaladoss, W. Ye, M. Liu, S. Dummler, F. Kong, L. H. Wong, H. L. Loo, 894

E. Loh, S. Q. Tan, T. C. Tan, K. T. Chang, M. Dao, S. Suresh, P. R. Preiser, and J. 895

Chen. 2014. Human natural killer cells control Plasmodium falciparum infection by 896


.org/D

ownloaded from

http://iai.asm.org/

36

eliminating infected red blood cells. Proceedings of the National Academy of Sciences of 897

the United States of America 111:1479-1484. 898

66. Jacobs, R., G. Hintzen, A. Kemper, K. Beul, S. Kempf, G. Behrens, K. W. Sykora, and 899

R. E. Schmidt. 2001. CD56bright cells differ in their KIR repertoire and cytotoxic features 900

from CD56dim NK cells. European journal of immunology 31:3121-3127. 901

67. Cooper, M. A., T. A. Fehniger, and M. A. Caligiuri. 2001. The biology of human natural 902

killer-cell subsets. Trends in immunology 22:633-640. 903

68. Poli, A., T. Michel, M. Theresine, E. Andres, F. Hentges, and J. Zimmer. 2009. 904

CD56bright natural killer (NK) cells: an important NK cell subset. Immunology 126:458-905

465. 906

69. Korbel, D. S., K. C. Newman, C. R. Almeida, D. M. Davis, and E. M. Riley. 2005. 907

Heterogeneous human NK cell responses to Plasmodium falciparum-infected 908

erythrocytes. Journal of immunology 175:7466-7473. 909

70. McCall, M. B., M. Roestenberg, I. Ploemen, A. Teirlinck, J. Hopman, Q. de Mast, A. 910

Dolo, O. Doumbo, A. Luty, A. van der Ven, C. Hermsen, and R. Sauerwein. 2010. 911

Memory-like IFN-γ response by NK cells following malaria infection reveals the crucial role 912

of T cells in NK cell activation by P. falciparum. European journal of immunology 40:3472-913

3477. 914

71. Bijker, E. M., A. C. Teirlinck, R. Schats, G. J. van Gemert, M. van de Vegte-Bolmer, L. 915

van Lieshout, J. IntHout, C. C. Hermsen, A. Scholzen, L. G. Visser, and R. W. 916

Sauerwein. 2014. Cytotoxic Markers Associate With Protection Against Malaria in Human 917

Volunteers Immunized With Plasmodium falciparum Sporozoites. The Journal of 918

infectious diseases. 919

72. Tarun, A. S., X. Peng, R. F. Dumpit, Y. Ogata, H. Silva-Rivera, N. Camargo, T. M. 920

Daly, L. W. Bergman, and S. H. Kappe. 2008. A combined transcriptome and proteome 921

survey of malaria parasite liver stages. Proceedings of the National Academy of Sciences 922

of the United States of America 105:305-310. 923

73. Nganou-Makamdop, K., G. J. van Gemert, T. Arens, C. C. Hermsen, and R. W. 924

Sauerwein. 2012. Long term protection after immunization with P. berghei sporozoites 925


.org/D

ownloaded from

http://iai.asm.org/

37

correlates with sustained IFNgamma responses of hepatic CD8+ memory T cells. PloS 926

one 7:e36508. 927

74. Tse, S. W., I. A. Cockburn, H. Zhang, A. L. Scott, and F. Zavala. 2013. Unique 928

transcriptional profile of liver-resident memory CD8+ T cells induced by immunization with 929

malaria sporozoites. Genes and immunity 14:302-309. 930

931

932


.org/D

ownloaded from

http://iai.asm.org/


.org/D

ownloaded from

http://iai.asm.org/

Impact of malaria pre -exposure on anti -parasite cellular...

Documents

Transcript of Impact of malaria pre -exposure on anti -parasite cellular...