IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3 …

IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3-DIOXYGENASE

DURING ACUTE INFLUENZA INFECTION

by

JULIE MARIE FOX

(Under the Direction of Ralph A. Tripp)

ABSTRACT

Influenza virus is a worldwide concern causing significant morbidity and

mortality. Although vaccines are available to prevent infection, the vaccine is targeted

toward homologous strains of influenza virus providing limited heterologous protection.

The majority of the cross-protection is derived from T cell immunity which is directed

primarily at the conserved internal proteins of influenza virus. Enhancing the T cell

response during vaccination could provide better cross-protection and perhaps reduce the

need for seasonal vaccines. We hypothesized that modulating the activity of indoleamine

2, 3-dioxygenase (IDO) during influenza virus infection could enhance the immune

response augmenting T cell memory to the vaccine. IDO has been shown to suppress the

immune response through depletion of tryptophan and production of kynurenine

metabolites. Pharmacological inhibition of IDO during acute influenza infections

resulted in enhanced Th1-type response and memory T cell responses. Assessment of

early immune time-points following infection revealed IDO inhibition enhanced cytokine

production, and IDO activity was induced in alveolar epithelial cells through IFN-λ

stimulation. 1MT treatment increased the pro-inflammatory response with increased

expression of TNF-α and IL-6 following influenza virus infection. The enhanced pro-

inflammatory response with IDO inhibited was modulated by the alveolar macrophage

population residing in the lung airways. Together, these finding show a role for IDO

during influenza virus infections and provide insight into the potential use of IDO

modulation for vaccine and therapeutic designs.

INDEX WORDS: Influenza, IDO, 1MT, T cells, IFNλ, epithelial cells, alveolar

macrophages



by

JULIE MARIE FOX

BS, University of Central Florida, 2008

A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial

Fulfillment of the Requirements for the Degree

DOCTOR OF PHILOSOPHY

ATHENS, GEORGIA

2013

© 2013

Julie Marie Fox

All Rights Reserved



by

JULIE MARIE FOX

Major Professor: Ralph A. Tripp

Committee: S. Mark Tompkins

Kimberly D. Klonowski

Wendy T. Watford

Donald A. Harn

Electronic Version Approved:

Maureen Grasso

Dean of the Graduate School

The University of Georgia

December 2013

iv

DEDICATION

This work is dedicated to my mom and dad, Donna and Tom Fox, for their

support and belief that I can achieve my dreams.

v

ACKNOWLEDGEMENTS

I would like to thank my advisor, Ralph Tripp, for providing excellent training

and resources to conduct this research and preparing me with the tools to be a successful

scientist. I want to thank my committee members, S. Mark Tompkins, Kim Klonowski,

Wendy Watford, and Don Harn for their support and insight into the project.

I need to thank everyone that was intimately involved in this project particularly

Leo Sage, Andrew Mellor, Lei Huang, and Phillip Chandler for their help and discussion,

and Elizabeth O’Connor for always being enthusiastic and optimistic. I am grateful for

the researchers at the Animal Health Research Center who have been critical in teaching

me the tools to complete this project, particularly Jackelyn Crabtree for training in cell

culture, Jamie Barber for patiently teaching me flow cytometry, Cheryl Jones for training

in all things influenza, Les Jones for his help with molecular techniques. Thank you to

Abjheet Bakre for listening to every problem and brainstorming solutions with me,

Patricia Jorquera, Olivia Perwitasari, Jason O’Donnell, Mary Hauser, Xiuzhen Yan, and

Josh Powell for their assistance and discussion. Thank you to Victoria Meliopoulos,

Tiffany Turner, Jon Gabbard, Jennifer Pickens, Dan Dlugolenski, Alaina Jones Mooney,

and Anthony Gresko for sharing their knowledge and providing laughter and friendship

through the good and bad days. An enormous thank you to Leslie Sitz for every crisis

she remedied and for going above and beyond what was ever asked of her to help me.

vi

Thank you to my family for always listening and being interested in what I was

doing even if they did not understand one word I said. Finally, thank you to Shamus

Keeler for his unconditional support and helpfulness through this endeavor.

vii

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS .................................................................................................v

LIST OF TABLES ...............................................................................................................x

LIST OF FIGURES ........................................................................................................... xi

CHAPTER

1 INTRODUCTION .............................................................................................1

References ....................................................................................................6

2 LITERATURE REVIEW ................................................................................13

Introduction to Influenza Virus ..................................................................13

Replication of Influenza Virus ...................................................................22

Pandemic Potential.....................................................................................23

Influenza Virus Vaccines and Therapeutics ..............................................26

Disease Pathogenesis .................................................................................28

Innate Immune Response ...........................................................................29

Adaptive Immune Response ......................................................................33

Overview of Indoleamine 2, 3-Dioxygenase (IDO) ..................................39

Mechanism of IDO Immune Suppression..................................................42

Kynurenine Pathway Metabolites ..............................................................44

IDO’s Role in Infectious Disease Pathogenesis.........................................45

Conclusions ................................................................................................52

viii

References ..................................................................................................53

3 INHIBITION OF INDOLEAMINE 2, 3-DIOXYGENASE (IDO)

ENHANCES THE T CELL RESPONSE TO INFLUENZA VIRUS

INFECTION ..................................................................................................106

Abstract ....................................................................................................107

Introduction ..............................................................................................108

Material and Methods ..............................................................................110

Results ......................................................................................................113

Discussion ................................................................................................119

Acknowledgements ..................................................................................123

References ................................................................................................123

4 INTERFERON LAMBDA UPREGULATES IDO1 EXPRESSION IN LUNG

EPITHELIAL CELLS FOLLOWING INFLUENZA VIRUS

INFECTION ..................................................................................................141

Abstract ....................................................................................................142

Introduction ..............................................................................................143


Results ......................................................................................................149

Discussion ................................................................................................154


References ................................................................................................157

ix

5 INHIBITION OF IDO DURING EARLY STAGES OF INFLUENZA VIRUS

INFECTION AUGMENTS PRO-INFLAMMATORY CYTOKINE

PRODUCTION ..............................................................................................169

Abstract ....................................................................................................170

Introduction ..............................................................................................171


Results ......................................................................................................177

Discussion ................................................................................................182


References ................................................................................................185

6 DEVELOPMENT OF A NOVEL METHOD TO INDUCIBLY SILENCE

IDO ACTIVITY.............................................................................................200

Abstract ....................................................................................................201

Introduction ..............................................................................................202


Results ......................................................................................................207

Discussion ................................................................................................208


References ................................................................................................210

7 CONCLUSIONS............................................................................................218

x

LIST OF TABLES

Page

Table 5.1: Genes differentially regulated post-X31 infection with 1MT treatment

compared to Con-treatment in mouse lungs ........................................................192

xi

LIST OF FIGURES

Page

Figure 3.1: Influenza infection increases IDO activity in the lungs and sera ..................132

Figure 3.2: 1MT treatment does not affect total frequency of T cells infiltrating the

lungs .....................................................................................................................133

Figure 3.3: IDO inhibition does not change viral titers ...................................................134

Figure 3.4: 1MT treatment enhances the Th1 response ...................................................135

Figure 3.5: IDO inhibition enhances the influenza specific response .............................137

Figure 3.6: IDO inhibition increases the frequency of functional PA-specific CD8+ T

cells ......................................................................................................................138

Figure 3.7: Inhibition of IDO activity increases the presence of CD8+ effector memory

cells ......................................................................................................................140

Figure 4.1: Influenza infection up-regulates IDO1 expression ........................................162

Figure 4.2: A/HK/X31 (X31) infection up-regulates IDO1 expression ..........................163

Figure 4.3: IDO and IFNλ expression is related to MOI of infection ..............................164

Figure 4.4: IDO expression correlates with IFNλ expression ..........................................165

Figure 4.5: rIFNλ directly up-regulates the expression of IDO .......................................166

Figure 4.6: IFNλ partially up-regulates IDO1 during influenza infection .......................167

Figure 4.7: Inhibition of IDO decreases viral titers and reduces cellular viability ..........168

Figure 5.1: 1MT treatment enhances pro-inflammatory cytokines in lungs following

influenza infection with modest increase in IDO1 expression ............................193

xii

Figure 5.2: Interaction of genes identified in TLR array .................................................194

Figure 5.3: Increased peli1 expression is mediated through macrophages ......................195

Figure 5.4: 1MT enhances pro-inflammatory cytokine expression .................................196

Figure 5.5: 1MT treatment enhances alveolar macrophage secretion of TNF-α and

IL-6 ......................................................................................................................198

Figure 6.1: Transduced MLE-15 cells sufficiently knock down the mRNA expression and

activity of IDO1 ...................................................................................................216

Figure 6.2: shRNA is gradually produced following doxycycline induction ..................217

Figure 7.1: Proposed model for IDO modulation of the acute immune response to

influenza ...............................................................................................................223

1

CHAPTER 1

INTRODUCTION

Influenza virus is a major health and economic concern causing significant

morbidity and mortality worldwide (13, 38). Despite the general availability of an

efficacious vaccine, influenza virus remains in seasonal circulation in part through subtle

mutations in a hemagglutinin (HA) and neuraminidase (NA), known as antigenic drift,

resulting in immunologically distinct viruses (20). Current influenza virus vaccines are

designed to generate a potent neutralizing antibody response against the HA protein and

live-attenuated vaccines having an added benefit of stimulating T cell memory responses

(8). While antibodies require the same or closely related HA epitopes for efficacy (1), T

cells provide a response directed at conserved internal proteins of influenza virus

potentially offering heterologous virus immunity (8). Also, influenza viruses periodically

undergo antigenic shift through genetic reassortment in mixing vessels such as swine

resulting in a novel virus having the potential of causing a global pandemic (7). The

antibodies produced to current influenza virus vaccines generally provide limited to no

protection against a pandemic virus. Studies have shown the importance of T cell

memory in protection from disease (31, 35, 37), and efforts have been focused on

producing a vaccine with enhanced memory T cell generation (16, 27).

2

Recent studies addressing the host response and metabolomics linked to immunity

have shown that inhibition of indoleamine 2, 3- dioxygenase (IDO) has the potential to

increase the T cell response upon vaccination and develop an increased memory response

(9, 24, 36). IDO is an intracellular enzyme that catabolizes tryptophan (trp) into

kynurenine (kyn) through the kynurenine pathway where it is the first and rate-limiting

step (15, 34). IDO activity is strongly upregulated by IFNγ stimulation (6), while other

molecules, such as type I interferons (39), LPS (42), CTLA-4 (26), can increase activity

to various degrees. IDO is expressed by a variety of cells including plasmacytoid and

myeloid-derived dendritic cells (10, 33), macrophages (28), and epithelial/endothelial

cells (5, 17, 40). The lack of trp and presence of kyn causes proliferation arrest and

apoptosis of immune cells (11, 12, 29). Furthermore, IDO activity has been associated

with inducing anergy in effector T cells and skewing naïve CD4+ T cells to a Treg

phenotype over a Th1 or Th17 response (2, 29). From these downstream events, IDO

activity creates an immunosuppressive environment. During an influenza virus infection,

IDO activity is increased in the mouse lung airways peaking at day 10 post-infection

(43). Although some research has shown IDO to be active during influenza virus

infection (43), little work has been done evaluating the modulatory effect of the immune

response following an influenza virus infection in a mouse model. Understanding the

effect of IDO during a primary infection will provide insight into using IDO

manipulation to enhance vaccine and therapeutic efficacy.

The long term goal of these studies is to examine the role of IDO during a primary

influenza infection to determine the mechanisms of IDO immune modulation. The

central hypothesis of these studies is that expression of IDO during influenza infection

3

suppresses the innate and adaptive immune response through reduction of pro-

inflammatory cytokine production and magnitude of the T cell response. The study

includes the following aims:

Specific aim 1. To determine the activity and role of IDO in the frequency and activation

of CD8+ and CD4+ T cells responding to acute influenza virus infection. The working

hypothesis is that inhibition of IDO during an influenza virus infection will enhance the

Th1 response and frequency of influenza virus-specific CD8+ T cells. IDO was inhibited

pharmacologically in C57BL/6 mice using 1-methyl-D, L-tryptophan (1MT) treatment in

drinking water. Viral load and IDO activity were determined from day 1 through day 14

post-infection and the T cell response was evaluated at day 10 post-infection.

Specific aim 2. To evaluate the induction and role of IDO expression by alveolar

epithelial cells during influenza virus infection. Since influenza virus primarily infects

respiratory epithelial cells and increases the expression of IDO in these cells (19, 32), the

induction and role of IDO is potentially unique to this cell type. The working hypothesis

is that IFNλ is up-regulated during influenza virus infections inducing the expression and

activity of IDO in alveolar epithelial cells. IDO expression and activity was assessed in

the mouse lung epithelial cell line, MLE-15, following influenza infection and IFNλ

stimulation.

Specific aim 3. To evaluate the effects of IDO on expression of pro-inflammatory

cytokines during influenza virus infection and determine the host cell types affected.

4

Since IDO inhibition modified the T cell response during influenza virus infections (Aim

1), the changes in the T cell response potentially are a result of early innate responses

affecting the cytokine milieu. The working hypothesis is that IDO inhibition through

1MT treatment increases the expression of pro-inflammatory cytokines in alveolar

macrophages. The effects of IDO suppression on cytokine response were initially

assessed in 1MT treated C57BL/6 mice through a TLR PCR array. The affected cell

type, i.e. type II alveolar epithelial cells and macrophages, was addressed in vitro using

mouse lung epithelial cells (MLE-15) and macrophage-like cells (Raw264.7) and

confirmed with primary murine alveolar macrophages.

An additional goal of this research was to utilize RNA interference (RNAi) to

conditionally silence IDO1 in vitro and in vivo. Two enzymes, IDO1 and IDO2, have

the same function and similar structures but are differentially expressed (4, 14). Recent

work is focused on delineating the roles of each enzyme, but this requires the ability to

preferentially inhibit one over the other (3). The primary method to transiently inhibit

IDO activity is pharmacologically through administration of 1MT, although there is some

debate about the 1MT isoform that preferentially inhibits IDO1 versus IDO2 (18, 25).

Recent studies have been focused on developing new methods and/or compounds to

block IDO1 or IDO2 expression and activity (3, 23). IDO1 knockout mice are available,

but the removal of IDO1 during early weeks of life may have an impact on the

development of the immune system which may result in a skewed immune response to

infection. We proposed using RNAi to transiently reduce IDO1 expression. A lentiviral

vector containing an inducible short hairpin RNA (shRNA) against IDO1 was used to

integrate the shRNA into the host genome. During induction, the specific shRNA is

5

processed through the microRNA (miRNA) pathway (30). It is transcribed by RNA

polymerase II or III and processed by Drosha (21, 30). Exportin 5 traffics the shRNA

from the nucleus to the cytoplasm (41) where it is further processed by Dicer to remove

the hairpin structure and produce 3’-overhangs (22). Finally, the guide strand is loaded

onto RNA-induced silencing complex (RISC) and can target the mRNA of the gene of

interest for degradation or translational repression (30). The use of RNA interference

(RNAi) to silencing IDO1 expression will provide the ability to conditionally silence

IDO1 at varying times to determine the essential time period of IDO1 activity during

infection.

Specific aim 4. To produce and evaluate the efficacy of a lentiviral vector expressing a

doxycycline-inducible shRNA against IDO1. The working hypothesis is that transduction

using a lentiviral vector containing a shRNA against IDO1 (shIDO1) will effectively

silence IDO1 expression and activity in vitro. MLE-15 cells were utilized as a model for

shRNA knock-down efficacy. These preliminary studies provide the basis for exploring

shRNA transduction in vivo and utilization of the transduced cell lines for current and

future studies.

These specific aims will provide a better understanding of the role and

modulatory effects of IDO in regard to influenza virus infections. IDO has a well-

established history of suppressing the immune response, particularly T cells, providing a

precedence to utilize IDO inhibition as a method to enhance immunity. Understanding

the immunological changes during an infection in the absence of IDO will potentially

benefit development of vaccines and augment heterologous influenza virus protection.

6

References:

1. 2009. Serum cross-reactive antibody response to a novel influenza A (H1N1)

virus after vaccination with seasonal influenza vaccine. MMWR Morb Mortal

Wkly Rep 58:521-524.

2. Baban, B., P. R. Chandler, M. D. Sharma, J. Pihkala, P. A. Koni, D. H.

Munn, and A. L. Mellor. 2009. IDO activates regulatory T cells and blocks their

conversion into Th17-like T cells. J Immunol 183:2475-2483.

3. Bakmiwewa, S. M., A. A. Fatokun, A. Tran, R. J. Payne, N. H. Hunt, and H.

J. Ball. 2012. Identification of selective inhibitors of indoleamine 2,3-

dioxygenase 2. Bioorg Med Chem Lett 22:7641-7646.

4. Ball, H. J., H. J. Yuasa, C. J. D. Austin, S. Weiser, and N. H. Hunt. 2009.

Indoleamine 2,3-dioxygenase-2; a new enzyme in the kynurenine pathway. The

International Journal of Biochemistry & Cell Biology 41:467-471.

5. Beutelspacher, S. C., P. H. Tan, M. O. McClure, D. F. Larkin, R. I. Lechler,

and A. J. George. 2006. Expression of indoleamine 2,3-dioxygenase (IDO) by

endothelial cells: implications for the control of alloresponses. Am J Transplant

6:1320-1330.

6. Bianchi, M., R. Bertini, and P. Ghezzi. 1988. Induction of indoleamine

dioxygenase by interferon in mice: a study with different recombinant interferons

and various cytokines. Biochem Biophys Res Commun 152:237-242.

7. Carrat, F., and A. Flahault. 2007. Influenza vaccine: the challenge of antigenic

drift. Vaccine 25:6852-6862.

7

8. Cox, R. J., K. A. Brokstad, and P. Ogra. 2004. Influenza virus: immunity and

vaccination strategies. Comparison of the immune response to inactivated and

live, attenuated influenza vaccines. Scand J Immunol 59:1-15.

9. Dai, H., and Z. Dai. 2008. The role of tryptophan catabolism in acquisition and

effector function of memory T cells. Curr Opin Organ Transplant 13:31-35.

10. Donovan, M. J., V. Tripathi, M. A. Favila, N. S. Geraci, M. C. Lange, W.

Ballhorn, and M. A. McDowell. 2012. Indoleamine 2,3-dioxygenase (IDO)

induced by Leishmania infection of human dendritic cells. Parasite Immunol

34:464-472.

11. Fallarino, F., U. Grohmann, C. Vacca, R. Bianchi, C. Orabona, A. Spreca, M.

C. Fioretti, and P. Puccetti. 2002. T cell apoptosis by tryptophan catabolism.

Cell Death Differ 9:1069-1077.

12. Fallarino, F., U. Grohmann, S. You, B. C. McGrath, D. R. Cavener, C.

Vacca, C. Orabona, R. Bianchi, M. L. Belladonna, C. Volpi, P. Santamaria,

M. C. Fioretti, and P. Puccetti. 2006. The combined effects of tryptophan

starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and

induce a regulatory phenotype in naive T cells. J Immunol 176:6752-6761.

13. Fiore, A. E., T. M. Uyeki, K. Broder, L. Finelli, G. L. Euler, J. A. Singleton,

J. K. Iskander, P. M. Wortley, D. K. Shay, J. S. Bresee, and N. J. Cox. 2010.

Prevention and control of influenza with vaccines: recommendations of the

Advisory Committee on Immunization Practices (ACIP), 2010. MMWR Recomm

Rep 59:1-62.

8

14. Fukunaga, M., Y. Yamamoto, M. Kawasoe, Y. Arioka, Y. Murakami, M.

Hoshi, and K. Saito. 2012. Studies on tissue and cellular distribution of

indoleamine 2,3-dioxygenase 2: the absence of IDO1 upregulates IDO2

expression in the epididymis. The journal of histochemistry and cytochemistry :

official journal of the Histochemistry Society 60:854-860.

15. Grohmann, U., F. Fallarino, and P. Puccetti. 2003. Tolerance, DCs and

tryptophan: much ado about IDO. Trends Immunol 24:242-248.

16. Guillonneau, C., J. D. Mintern, F. X. Hubert, A. C. Hurt, G. S. Besra, S.

Porcelli, I. G. Barr, P. C. Doherty, D. I. Godfrey, and S. J. Turner. 2009.

Combined NKT cell activation and influenza virus vaccination boosts memory

CTL generation and protective immunity. Proc Natl Acad Sci U S A 106:3330-

3335.

17. Jacoby, D. B., and A. M. Choi. 1994. Influenza virus induces expression of

antioxidant genes in human epithelial cells. Free Radic Biol Med 16:821-824.

18. Jia, L., K. Schweikart, J. Tomaszewski, J. G. Page, P. E. Noker, S. A.

Buhrow, J. M. Reid, M. M. Ames, and D. H. Munn. 2008. Toxicology and

pharmacokinetics of 1-methyl-d-tryptophan: absence of toxicity due to saturating

absorption. Food Chem Toxicol 46:203-211.

19. Knobil, K., A. M. Choi, G. W. Weigand, and D. B. Jacoby. 1998. Role of

oxidants in influenza virus-induced gene expression. The American journal of

physiology 274:L134-142.

20. Kreijtz, J. H., R. A. Fouchier, and G. F. Rimmelzwaan. 2011. Immune

responses to influenza virus infection. Virus Res 162:19-30.

9

21. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O.

Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates

microRNA processing. Nature 425:415-419.

22. Lee, Y. S., K. Nakahara, J. W. Pham, K. Kim, Z. He, E. J. Sontheimer, and

R. W. Carthew. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the

siRNA/miRNA silencing pathways. Cell 117:69-81.

23. Liu, X., N. Shin, H. K. Koblish, G. Yang, Q. Wang, K. Wang, L. Leffet, M. J.

Hansbury, B. Thomas, M. Rupar, P. Waeltz, K. J. Bowman, P. Polam, R. B.

Sparks, E. W. Yue, Y. Li, R. Wynn, J. S. Fridman, T. C. Burn, A. P. Combs,

R. C. Newton, and P. A. Scherle. 2010. Selective inhibition of IDO1 effectively

regulates mediators of antitumor immunity. Blood 115:3520-3530.

24. Liu, Z., H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai. 2007.

Suppression of memory CD8 T cell generation and function by tryptophan

catabolism. J Immunol 178:4260-4266.

25. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G.

Opelz, and P. Terness. 2009. IDO1 and IDO2 are expressed in human tumors:

levo- but not dextro-1-methyl tryptophan inhibits tryptophan catabolism. Cancer

Immunol Immunother 58:153-157.

26. Mellor, A. L., P. Chandler, B. Baban, A. M. Hansen, B. Marshall, J. Pihkala,

H. Waldmann, S. Cobbold, E. Adams, and D. H. Munn. 2004. Specific subsets

of murine dendritic cells acquire potent T cell regulatory functions following

CTLA4-mediated induction of indoleamine 2,3 dioxygenase. Int Immunol

16:1391-1401.

10

27. Mueller, S. N., W. A. Langley, E. Carnero, A. Garcia-Sastre, and R. Ahmed.

2010. Immunization with live attenuated influenza viruses that express altered

NS1 proteins results in potent and protective memory CD8+ T-cell responses. J

Virol 84:1847-1855.

28. Munn, D. H., E. Shafizadeh, J. T. Attwood, I. Bondarev, A. Pashine, and A.

L. Mellor. 1999. Inhibition of T cell proliferation by macrophage tryptophan

catabolism. J Exp Med 189:1363-1372.

29. Munn, D. H., M. D. Sharma, B. Baban, H. P. Harding, Y. Zhang, D. Ron, and

A. L. Mellor. 2005. GCN2 kinase in T cells mediates proliferative arrest and

anergy induction in response to indoleamine 2,3-dioxygenase. Immunity 22:633-

642.

30. Rao, D. D., J. S. Vorhies, N. Senzer, and J. Nemunaitis. 2009. siRNA vs.

shRNA: similarities and differences. Adv Drug Deliv Rev 61:746-759.

31. Roberts, A. D., K. H. Ely, and D. L. Woodland. 2005. Differential contributions

of central and effector memory T cells to recall responses. J Exp Med 202:123-

133.

32. Sanders, C. J., P. C. Doherty, and P. G. Thomas. 2010. Respiratory epithelial

cells in innate immunity to influenza virus infection. Cell Tissue Res.

33. Sharma, M. D., B. Baban, P. Chandler, D. Y. Hou, N. Singh, H. Yagita, M.

Azuma, B. R. Blazar, A. L. Mellor, and D. H. Munn. 2007. Plasmacytoid

dendritic cells from mouse tumor-draining lymph nodes directly activate mature

Tregs via indoleamine 2,3-dioxygenase. J Clin Invest 117:2570-2582.

11

34. Sugimoto, H., S. Oda, T. Otsuki, T. Hino, T. Yoshida, and Y. Shiro. 2006.

Crystal structure of human indoleamine 2,3-dioxygenase: catalytic mechanism of

O2 incorporation by a heme-containing dioxygenase. Proc Natl Acad Sci U S A

103:2611-2616.

35. Taylor, P. M., and B. A. Askonas. 1986. Influenza nucleoprotein-specific

cytotoxic T-cell clones are protective in vivo. Immunology 58:417-420.

36. Terness, P., T. M. Bauer, L. Rose, C. Dufter, A. Watzlik, H. Simon, and G.

Opelz. 2002. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-

dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan

metabolites. J Exp Med 196:447-457.

37. Thomas, P. G., R. Keating, D. J. Hulse-Post, and P. C. Doherty. 2006. Cell-

mediated protection in influenza infection. Emerg Infect Dis 12:48-54.

38. Thompson, W. W., D. K. Shay, E. Weintraub, L. Brammer, C. B. Bridges, N.

J. Cox, and K. Fukuda. 2004. Influenza-associated hospitalizations in the United

States. JAMA 292:1333-1340.

39. van der Marel, A. P., J. N. Samsom, M. Greuter, L. A. van Berkel, T.

O'Toole, G. Kraal, and R. E. Mebius. 2007. Blockade of IDO inhibits nasal

tolerance induction. J Immunol 179:894-900.

40. van Wissen, M., M. Snoek, B. Smids, H. M. Jansen, and R. Lutter. 2002. IFN-

gamma amplifies IL-6 and IL-8 responses by airway epithelial-like cells via

indoleamine 2,3-dioxygenase. J Immunol 169:7039-7044.

12

41. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the

nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development

17:3011-3016.

42. Yoshida, R., and O. Hayaishi. 1978. Induction of pulmonary indoleamine 2,3-

dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Proc Natl

Acad Sci U S A 75:3998-4000.

43. Yoshida, R., Y. Urade, M. Tokuda, and O. Hayaishi. 1979. Induction of

indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl

Acad Sci U S A 76:4084-4086.

13

CHAPTER 2

LITERATURE REVIEW

Introduction to Influenza Virus

Influenza viruses causes significant morbidity and mortality worldwide,

particularly the elderly and young (346). Influenza virus belongs to the family

Orthomyxoviridae where there are three genera: influenza virus A, B, and C (245).

Influenza A virus is the most common and mainly infects birds and mammals, while

influenza B and C viruses are primarily found in humans (346). The viruses are

differentiated based on their subtype named for the hemagglutinin (HA) and

neuraminidase (NA) proteins (289). Currently, there are 17 HA subtypes and 10 NA

subtypes, which can be combined in varying fashions. Waterfowl are the reservoir for

influenza A viruses and 16/17 HA and 9/10 NA can be isolated from this population

(289). The H17 has only been isolated from yellow-shouldered bats (318).

Robert Shope isolated the influenza virus in the early 1930s from an infected

swine and proved that the filterable agent produced influenza virus-like disease in

subsequent swine infections (282, 283, 329). Later, he also showed that serum from

individuals infected with the 1918 Spanish influenza virus were able to neutralize the

virus (281). Although this was the first isolation and characterization of influenza virus,

epidemics of influenza virus-like disease have been described for many centuries

14

potentially dating back to ancient Greece, with the first documented pandemic in the 16th

century (256). Since this time, numerous pandemics have impacted the human population

with a continued threat of pandemic potential of novel influenza viruses. This section

covers a description of influenza virus and its replication, recent pandemics, current

vaccines and therapeutics, and the host response to combat infection.

Influenza A viruses

Influenza virus is an enveloped virus containing a single stranded, negative sense,

segmented RNA genome (346). There are 8 segments encoding 10-11 proteins (346).

The genome encodes two glycoproteins, the hemagglutinin (HA) and neuraminidase

(NA), a RNA dependent RNA polymerase comprised of the polymerase basic 2 (PB2),

polymerase basic 1 (PB1), and polymerase acidic (PA) proteins, a nucleoprotein (NP),

two structural proteins, the matrix 1 and 2 (M1 and M2), and three nonstructural proteins,

NS1, NS2/Nuclear export protein (NEP), and PB1-F2 (346). The segments are ordered

based on length beginning with the longest PB2 segment, followed by the PB1 segment,

which also encodes the PB1-F2 protein from an alternative open reading frame. The

third segment is the PA and the fourth segment is the HA. The fifth segment encodes the

NP followed by the NA segment (sixth segment). The seventh and eighth segment

encode two proteins from splicing, which are the M segment, encoding the M1 and M2,

and NS segment, encoding the NS1 and NS2 proteins, respectively (346). Influenza virus

is pleomorphic in shape ranging from spherical to filamentous with a diameter of

between 100 and 300 nm (245, 264). The virion contains an envelope derived from the

15

host lipid membrane which possess the HA and NA glycoproteins along with the M2 ion

channel (264).

There are two major glycoproteins on the surface of the influenza virion, i.e. the

HA and NA proteins (346). There is more HA present on the surface of the virion with a

ratio of HA to NA of 4:1 (339). The HA is responsible for attachment and fusion of the

virion to the host cell through binding of sialic acid glycans (SA) (285). There are 17

different HA proteins; H1-H16 can be found in the avian population (71), H1-H3 have at

one time circulated in humans (346), and H17 was recently discovered from a yellow

shouldered bat (318). The HA protein is a homotrimer that is composed of a globular

head, which is heavy glycosylated, a conserved stalk region, and a transmembrane

domain (180). The HA is cleaved from HA0 to HA1 and HA2 to be functional (63).

This cleavage is mediated by host proteases (38). Seasonal viruses utilize trypsin-like

proteases, such as TMPRSS2 and HAT (38) predominantly found in the respiratory tract

while the HA from high pathogenic viruses are cleaved by PC6 and furin because of the

presence of a polybasic cleavage site (119, 294). The ability of the HA from high

pathogenic viruses to be cleaved by ubiquitously expressed proteases allows the virus to

infect cells systemically (168).

Host specificity of the virus is in part determined through the linkage of the

underlying galactose of the sialic acid receptor. Human-adapted viruses preferentially

bind to α-2, 6-SA, while avian adapted viruses more readily bind to α-2, 3-SA (262).

This preference is linked to the presence and availability of the respective sialic acid in

the target organs of infection in the host adapted virus (330). The human upper

respiratory tract predominantly contains α-2, 6-SA while the lower respiratory tract

16

contains α-2, 3-SA and α-2, 6-SA (204, 278). The gastrointestinal tract (GI) of wild

aquatic birds is lined mostly with α-2, 3-SA, although the GI and respiratory tract also

express low levels of α-2, 6-SA (104). Finally, the swine respiratory tract harbors α-2, 3-

SA and α-2, 6-SA, which lends to the hypothesis that swine are a mixing vessel for avian

and human viruses strains (153). Although sialic acid is the main receptor for influenza

virus, studies are emerging that influenza virus is able to infect cells in the absence of

sialic acids (243) utilizing DC-SIGN or L-SIGN (190). The HA protein is also the main

antigen targeted by neutralizing antibodies, which causes the protein to undergo mutation

to avoid immune pressure through antigenic drift and shift, as discussed below (285).

The other main glycoprotein is the NA protein which is responsible for release of

influenza virus through sialidase activity (245). The NA protein is a homotetramer and

consists of a glycosylated mushroom-like head with 4 catalytic domains, a stalk region,

which is also slightly glycosylated, and a conserved membrane anchor (120). There are

10 different NA proteins; N1-N9 can be found in avian species, N1-N2 are found in

humans, and N10 was described from yellowed shouldered bats (318). Although it was

recently determined that the N10 does not possess neuraminidase activity (356). The

main function of the NA is to cleave α-2, 3-SA and α-2, 6-SA residues from the surface

of the host cell and the HA protein to detach progeny virus and prevent aggregation of the

virions, respectively (244). An additional function of NA is its cleavage of glycan

structures found in mucus to provide increased ability of influenza virus to reach the host

cells (205). The NA protein also has a role in host restriction. Like the HA protein,

evidence suggests that the NA can provide host specificity through the preferentially

cleavage of α-2, 3-SA or α-2, 6-SA (349). Furthermore, the NA is an antigenic target for

17

antibodies, which would block the release of the virus from the host cell, which drives

mutation of the protein to evade the immune response (346).

The RNA dependent RNA polymerase (RdRp) is a heterotrimer comprised of the

PB2, PB1, and PA proteins (245). The polymerase is responsible for transcription and

replication of the RNA genome (245). It is also associated with virulence and host

tropism (37). The RdRp lacks proofreading capabilities resulting in a high error rate

(291). These mutations result in the virus undergoing antigenic drift, as described below,

and evading the immune response, i.e. HA and NA, in particular (17, 84). The PB2

protein functions in initiation of transcription through cap recognition of pre-mRNA 5’

cap, which will be cleaved and utilized as a RNA primer during replication, as described

below (124). PB2 also localizes the RdRp to the nucleus through interaction with

importin α (307). Mutations in the PB2 protein have been associated with host adaption,

including an E627K mutation which enhances replication in mammalian cells compared

to avian (297). Also, a D701N mutation increases PB2 binding to importin α in human

cells compared to avian species (37). The PB1 protein is involved in elongation of the

RdRp and provides endonuclease activity (229, 346). PB1 is the primary backbone of the

polymerase and is essential for the catalytic domain; studies have been done showing that

only variations of the polymerase which contained the PB1 protein were able to

synthesize RNA (174). Finally, the PA protein possesses endonuclease activity, which

cleaves the 5’ cap from pre-mRNA (76). Furthermore, recent work has shown the PA

protein to be involved in the shutdown of host protein synthesis with evidence of strain

variation between the efficiently of host protein inhibition of avian and human origin

viruses (74).

18

The fifth segment encodes the nucleoprotein (NP) which encapsidates the viral

RNA (vRNA) through a positively charged RNA-binding cleft (265, 346), although NP is

unable to directly bind to influenza virus mRNA (137). One hypothesis is that there is an

encapsidation signal located on the 5’ end of the vRNA which functions to initiation NP

binding (255, 317). From this interaction, the NP provides a role in regulation of

replication and transcription, although the exact mechanism of regulation is unclear. The

NP protein interacts with other viral and host proteins (31, 92, 236). First, NP binds to

the PB1 and PB2 protein, describing a potential role for NP in switching influenza virus

from transcription to replication (31). Binding of NP to the polymerase proteins may

modify the RdRp to favor an unprimed replication versus primed mRNA production

(233). Recent work has shown interaction between the NP, RdRp, and NS2/NES proteins

results in the synthesis of small viral RNA (svRNA) which assists in the production of

vRNA (249). Furthermore, blockade of the svRNA resulted in loss of only vRNA

production with no effect on cRNA or mRNA levels (249). The NP protein has also been

shown to interact with importin α as well as enhance binding of PB2 to importin α (109)

and CRM1 (92). These two proteins (importin α and CRM1) assist in the localization

and export of the vRNP (viral ribonucleoprotein; RdRp, NP, vRNA) from the nucleus,

respectively.

A frame shift in the PB1 gene produces an alternative +1 open reading frame that

codes for the PB1-F2 protein (56). This gene is found in influenza A viruses, while

absent in influenza B viruses, and is highly expressed during early hours after infection

(177). The PB1-F2 protein localizes to the mitochondria where it depolarizes the

membrane potential leading to apoptosis (56, 61). It has also been shown to form

19

oligomeric structures resulting in cellular permeabilization (45). Besides a role in the

induction of apoptosis, the PB1-F2 protein enhances the pathogenicity (354) and modifies

the innate immune response following influenza virus infection (207). Numerous works

have shown a N66S mutation to enhance replication of the virus (56, 271). The N66S

mutation enhances binding to mitochondrial antiviral-signaling protein (MAVS) which

antagonizes the production of type I interferons resulting in enhanced virulence (332).

The PB1-F2 protein can be expressed in varying lengths, from 11 to 101 amino acids

(54). The majority of the viruses that cause severe disease possess a functional PB1-F2,

such as the 1918 H1N1 Spanish flu and HPAI H5N1 (62). The functional protein is also

found in the majority of H3N2 viruses; however, the most recent 2009 H1N1 pandemic

virus contains a severely truncated and non-functional form of PB1-F2 (54).

The seventh segment produces two proteins: the matrix 1 (M1) protein is

transcribed from the whole segment while the M2 protein is produced from splicing

(346). This also occurs in the eighth segment which encodes the two non-structural

proteins (NS1 and NEP/NS2). The M1 protein is produced late after infection and serves

multiple roles in the final steps of virus replication (118). The M1 interacts with the

vRNPs and assists in the export of the vRNP from the nucleus (201). Removal of the

M1 protein synthesis results in the accumulation of vRNPs in the nucleus (201). Once

removed from the nucleus, the M1 interacts with the M2 cytoplasmic tail (55, 333, 355)

and evidences suggests interaction with the HA and NA cytoplasmic tails as well (124,

129) to bring the vRNP to the site of viral budding, the plasma membrane, as well as

cluster the glycoproteins to the budding site (230). Finally, in the virion, the M1 protein

20

lines the envelope where it remains partially associated with viral envelope and the vRNP

(135).

The M2 protein is a type III integral membrane protein which serves to transport

protons across the viral membrane (88). The M2 functions in the viral entry, maturation,

and assembly (293, 342). Once the virus is endocytosed during entry, the M2 protein

reduces the pH through the import of protons which causes release of the vRNPs from

M1 thus allowing the vRNPs to travel from the cytoplasm to the nucleus for replication

(245). Similar to the role of M2 in the entry of influenza virus, for highly pathogenic

influenza viruses (H5 and H7) the M2 protein increases the pH of the trans-golgi network

to prevent the premature cleavage of the HA protein (26). During the final stages of virus

replication, i.e. assembly and budding, the M2 assists in the recruitment of the M1 protein

to the site of budding through interactions with the M2 cytoplasmic tail (156, 208).

Mutations of these binding domains resulted in reduced viral titers and increased

production of filamentous shaped virions (156). Unlike the other surface proteins (HA

and NA), the M2 protein is highly conserved between different influenza viruses (73) and

although there is two times more M2 present on the surface of infected cells, very few

M2 proteins are present on the virion (100).

The NS1 is produced from the whole gene while the NEP/NS2 is produced from

splicing of the eighth segment (346). The NS1 has a role as a viral interferon antagonist

as well as enhancement of viral mRNA translation (129). The NS1 protein’s role in

combating innate immune pathways and interferon production is discussed later in the

innate immune response section. The main role of the NEP is to export vRNP from the

nucleus through interaction with Crm1 and the cofactor RanGTP to be trafficked to the

21

cell membrane for virion release (92, 246). Additional work is emerging providing a role

of NEP in the transition between mRNA, cRNA, and vRNA production (249, 260).

Influenza B and C viruses

Influenza B virus also contains a genome comprised of 8 segments which encode

one or more proteins. The proteins encoded are the polymerase genes (PB2, PB1, PA),

HA, NP, NA, NB, M1, BM2, NS1, and NEP/NS2 (346). Unlike influenza A viruses,

influenza B virus encodes the NB protein which is produced from a -1 shift in the open

reading frame of the NA segment (346). The NB protein is associated with the

membrane and potentially is an ion channel, although this protein is not necessary for in

vitro replication it provides an advantage in vivo (136, 292). Influenza B encodes the

BM2 protein which is encoded from the M1 segment and is transcribed from a stop-start

codon that stops the transcription of the M1 gene and starts the transcription of BM2

(346). BM2 is also a membrane protein and may function as an ion channel (221).

Influenza B viruses has the same structure as influenza A but primarily infects humans

(245).

Influenza C virus only has 7 segments in its genome and encodes 9 genes (346).

The largest segments encode the PB2, PB1, and P3 proteins which are a part of the

polymerase (348). The HEF protein, which is the main surface glycoprotein for influenza

C, is the fourth segment and is involved in binding, fusion, and release of the virion

(143). The remaining proteins are the NP, CM1, CM2, NS1, and NEP/NS2 (245). The

CM1 and CM2 proteins are encoded by the sixth segment. The CM1 protein is similar to

the matrix protein and interacts with the vRNPs (292). The CM2 protein is also a surface

22

glycoprotein and may function as an ion channel (27). The surface of influenza C virus

has hexagonal reticular structures which distinguish them from influenza A and B viruses

(245). Influenza C virus is also predominantly found in humans.

The Orthomyxoviridae family also includes the genera Thogotovirus, Isavirus,

and Quarjavirus, although these virus genera will not be discussed (245, 248).

Replication of Influenza Virus

Influenza virus enters the host cell by HA binding to SA present on the surface of

the cell, and is endocytosed primarily via clathrin-coated pits, although clathrin-

independent methods have been observed (266). The M2 ion channel acidifies the

endosome through an influx of protons inducing a conformational change in HA2

exposing the fusion peptide (346). The fusion peptide binds to the endosomal membrane

and creates a pore releasing the viral genome complex (vRNPs) into the cytoplasm (66).

The pH decrease in the endosome also releases the vRNPs from the M1 protein (251).

Once in the cytoplasm, the vRNA is transported to the nucleus through nuclear

localization signals on the NP proteins (65, 335). In the nucleus, the PB2 protein

initiates transcription through recognition of the 5’ cap on host pre-mRNA (124, 253).

The PA protein cleaves the pre-mRNA 5’ cap (76), which is then utilized as a primer for

transcription. The PB1 protein catalyzes the elongation of the primed transcript

producing the viral mRNA (112). The mRNA is trafficked as if it were host mRNA to

the cytoplasm and translated using host machinery. The HA, NA, and M2 proteins are

glycosylated and transported to the cellular membrane via the trans-Golgi network (245).

Although the exact mechanism is unknown, it is hypothesized that once adequate

23

amounts of NP are produced and trafficked back into the nucleus via importin α, the

RdRp switches to the synthesis of cRNA (255). The cRNA is a template for the

production of vRNA. The vRNA is encapsidated by the NP (255) and interacts with the

M1 protein (201). M1 associates with NS2/NEP to export the vRNP out of the nucleus

(150, 237). The M1 protein traffics the vRNPs to the plasma membrane through

interactions with the cytoplasmic tails of the M2, HA, and NA proteins for viral

packaging (55, 208, 333). The M1 protein, with the help of other viral proteins such as

HA, induces positive curvature of the plasma membrane and once the virion is budding,

the M2 protein induces negative curvature through the addition of a amphipathic helix

causing final budding of the virus (264). The NA protein cleaves the terminal sialic acid

residues on the surface of the cell and the HA protein to release the virion (346). Once

released from the cells, the HA0 protein is cleaved by host proteases to produce the

functional HA1 and HA2 (38). The virion is now able to infect neighboring cells and

repeat the replication process.

Pandemic Potential

The ability of influenza virus to evade the immune response is linked to antigenic

drift and shift (245). Mutations in the HA and NA, due to the high error rate of the

RdRp, result in the ability of the virus to evade the immune response, particularly

neutralizing antibodies (245). These mutations referred to as antigenic drift provide an

advantage to the virus and are the reason for yearly vaccination (310). Antigenic shift is

a result of reassortment of two distinct influenza viruses (245). Reassortment occurs

following infection of a single cell with two influenza viruses allowing the segmented

24

genome to be mixed between the two viruses resulting in a novel virus (346). Since these

viruses have not been seen in the population previously, the population is

immunologically naïve to the reassortant virus leading to the risk of pandemics.

Influenza virus pandemics have been described since early times where there has

typically been a pandemic occurring about every 36 years (310). Within the last two

centuries there have been four recognized influenza virus pandemics which had varying

degrees of morbidity and mortality (310). The most notorious pandemic is the 1918

Spanish Influenza virus. The 1918 pandemic caused 675,000 deaths in the United States

and estimated 50 million deaths worldwide (161, 309) mostly due to secondary infections

(218). The virus responsible for the 1918 pandemic was an avian derived H1N1 and it is

the ancestor to the current circulating strains (309). Infection with the 1918 H1N1 caused

W-shaped age mortality, with very young, very old, and ages 20-40 accounting for the

majority of the fatalities (310). The 1918 H1N1 was recently reconstructed and shown to

have high lethality in mice, high replication, and lack of trypsin requirements for

replication (323). Furthermore, work has shown that mutations in the HA (D190E and

D225G) reduced transmissibility of the virus (324) and shown the PB1-F2 protein to be a

virulence factor in enhanced bacterial pneumonia (207) and lung pathology (62).

The second pandemic of the 20th

century occurred in 1957 with the emergence of

the H2N2 Asian influenza virus (170). The H2N2 virus was a descendent of the 1918

virus; however, it contained three new gene segments, HA, NA, and PB1 (167, 272).

Unlike the 1918 H1N1, the large number of the fatalities had preexisting conditions and

died of viral pneumonia (193). The H2N2 circulated in the population during season

endemics and disappeared in 1968 (310). Replacing the H2N2 virus was the introduction

25

of the 1968 H3N2 Hong Kong influenza virus pandemic. The Hong Kong influenza

virus was derived from the 1957 virus but acquired two novel segments, HA and PB1

(272). This virus did not cause significant mortality most likely due to the presence of

pre-existing immunity to the NA of the 1957 virus (10) with the addition of a strong cell

mediated response. The H3N2 virus still remains in circulation in a seasonal manner

(310).

The most recent pandemic was the 2009 H1N1 swine-origin influenza virus

(pH1N1). The pH1N1 originated from a reassortment between a Eurasian H1N1 swine

lineage virus and a “triple reassortment” North American swine H1N2 lineage virus (115,

310). The PB1, PB2, PA, HA, NP, and NS were derived from the triple reassortment

North America virus, with the HA, NP, and NS being present in the classical swine

lineage (115). The NA and M originated from the Eurasian swine lineage virus (115).

During the first 12-months of the pandemic, there were between 43 and 89 million cases

(1) of pH1N1 infection and up to 570,000 individuals that died worldwide (72). The

majority of the severe cases were in the young population because of cross protection in

the older population from previous H1N1 exposure (198). The pH1N1, along with the

H3N2 virus, are still in current seasonal circulation (310).

Other influenza viruses have emerged causing epidemics and epizootics. These

epidemics include the highly pathogenic avian influenza (HPAI) viruses H5N1 and H7N7

and have occurred primarily in China and Southeast Asia, but also in Russia, Africa and

Europe (85, 169). An avian influenza virus is considered highly pathogenic if the HA

contains a polybasic cleavage site and kills at least 75% of chickens when administered

intravenously (296). The H5N1 and H7N7 viruses remain in a pre-pandemic level due to

26

the lack of efficient human to human transmission and require direct contact with

infected poultry or wild birds (6, 113). The HPAI H5N1 virus was isolated in 1997 from

Hong Kong where it infected individuals through direct contact with infected poultry

(284, 298). The H5N1 virus has been causing sporadic cases since 2003 with a fatality

rate up to a 60% (284). The HPAI H5N1 is found in migratory and aquatic fowl and can

be subsequently transmitted to the poultry population (169, 171). Although wild birds

are the main reservoir for influenza A viruses, infection normally does not cause clinical

disease, however infection with HPAI H5N1 usually results in high mortality in domestic

poultry (6). HPAI H5N1 contains multiple mutations which are thought to facilitate virus

fitness. The PB1 protein has an E627K mutation which enhances replication (279) and a

mutation in the NS1 protein (D92E) that increases resistance to IFNs (274). The HPAI

H7N7 virus isolated from the Netherlands in 2003 also caused infections in humans

through direct contact with infected poultry (175). Unlike the H5N1 outbreaks, the

majority of the individuals infected with the H7N7 virus developed conjunctivitis (175).

Most recently, in 2013, there was an epidemic of H7N9 low pathogenic avian influenza

virus in China and Taiwan (52). Currently, this virus has been unable to efficiently

transmit human to human (52).

Influenza Virus Vaccines and Therapeutics

Vaccination against influenza virus is generally an effective method to prevent

transmission and disease. Currently two types of vaccines are utilized, i.e. the

split/inactivated vaccine, and the live, attenuated vaccine (20, 40). The trivalent split

vaccine is mostly comprised of the HA and NA of three influenza virus strains, usually

27

two type A viruses including a H1N1, H3N2, and a type B virus (40). The trivalent

vaccine for the U.S. 2012-2013 season contains an A/California/7/2009 (H1N1) pdm09-

like virus, an A/Victoria/361/2011 (H3N2)-like virus, and a B/Wisconsin/1/2010-like

virus (50). These proteins are derived from whole grown virus that is inactivated and

disrupted to primarily contain the HA and NA (101). This is the most widely used

vaccine as it is safe for all ages, however young children generally require two doses to

provide protection, and it does not induce a robust response in the elderly (102). A

neutralizing antibody response provides the main mechanism of protection for this

vaccine as little to no cell-mediated response is produced (40). The live, attenuated

vaccine is a trivalent vaccine consisting of cold-adapted, temperature sensitive virus

mutants, meaning that the virus grows efficiently at 25°C but is unable to replicated at

37°C (20, 134). The nature of these viruses restrict the replication of the virus to the

nasopharynx not allowing replication in the lower respiratory tract or the lungs (134). A

benefit to the live, attenuated vaccine is the ability of the virus to replicate resulting in the

induction of a T cell response. While the main protection of the vaccine is still through

production of neutralizing antibodies targeting the HA, the live, attenuated influenza

virus vaccine induces a cell-mediated response (20); however, an increase in T cells is

more predominantly seen in children over adults (140). Recently, a quadrivalent vaccine

formulation of the yearly vaccine has been FDA approved for the 2013-2014 season

(238). This vaccine is comprised of 2 influenza A and 2 influenza B viruses and will be

available in the inactivated and live, attenuated versions of the vaccine (79). The vaccine

formulation for the U.S. 2013-2014 influenza virus vaccine will contain an

A/California/7/2009 (H1N1) pdm09-like virus, an A/Victoria/361/2011 (H3N2)-like

28

virus, and a B/Massachusetts/2/2012-like virus (51). The quadrivalent vaccine will also

include a B/Brisbane/60/2008-like virus (51).

Limited antiviral drugs are available that limit symptoms and reduce viral

shedding (295). The first drugs to become available against influenza A virus are

amantadine and rimantadine. These drugs target the M2 ion channel and ultimately affect

viral genome release during virus entry (25). As previously discussed, the M2 protein

acidifies the endosome releasing the vRNPs from the M1 protein and into the cytoplasm

(245). In the presence of amantadine or rimantadine this process is hindered (295).

Although initially effective, most circulating viruses since 2009 are resistant to these

drugs through a point mutation of the M2 protein (234). The second group of antivirals,

zanamivir and oseltamivir, bind to the active site of the NA protein and subsequently

blocks the neuraminidase activity (213). Unlike amantadine and rimantadine, zanamivir

and oseltamivir are effective against influenza A and B (213). Resistance to oseltamivir is

emerging in the circulating strains of influenza virus as of the 2011-2012 season (53).

This resistance has been associated with a H275Y mutation in the NA (345). However,

the 2009 H1N1 pandemic virus has also acquired an I223R mutation in the NA which

confers resistance to zanamivir and oseltamivir (328).

Disease Pathogenesis

Influenza virus infection causes an acute respiratory disease characterized by high

fever, upper respiratory tract inflammation, cough, headache, and malaise (311).

Symptoms normally subside in 7 to 10 days while general fatigue may last for additional

weeks (311). While most individuals develop these acute symptoms, those with pre-

29

existing conditions such as cardiac disease, COPD, immunocompromised state, diabetes

mellitus or elderly and very young individuals are at a higher risk for development of

viral or secondary bacterial pneumonia (64, 197, 311). Viral pneumonia is characterized

by pulmonary edema, dyspnea, and cyanosis and in severe cases can be fatal (311).

Streptococcus pneumoniae and Haemophilus influenzae are the most frequent

malefactors of secondary bacterial pneumonia (126), which is associated with massive

neutrophil infiltration into the airways (311).

Innate immune response

Influenza virus infection induces a robust immune response. During acute

infection, the initial defense is mediated through the innate immune response. Influenza

virus is recognized by multiple pattern recognition receptors (PRRs) which lead to the

production of pro-inflammatory cytokines and induction of the antiviral state mediated

through interferons (166). The three main mechanisms of influenza virus detection are

through Toll-like receptors (TLRs), RIG-I like receptor (RLR) family, and nucleotide

oligomerization domain-like receptors (NLR) (8, 209, 270). TLR3 and TLR7 are the

primary TLRs that respond to influenza virus infection (77, 184). TLR3 and TLR7 are

expressed by the majority of the homeostatic cell populations in the lungs including the

bronchial epithelial cells, macrophages, and dendritic cells (155, 179, 189) and recognize

double stranded RNA (dsRNA) and single stranded RNA, respectively (77, 305). Both

TLRs are present within the endosomal compartment, so they are triggered by influenza

virus during the entry stage of the virus replication (166). Following stimulation of the

receptor, TLR3 signals through the adaptor protein TRIF which subsequently leads to

30

downstream signaling resulting in the phosphorylation of IRF-3 and activation of NF-kB

(7). IRF-3 and NF-kB translocate to the nucleus where they initiate the production of

IFN-β and pro-inflammatory cytokines, respectively (305). Unlike TLR3, TLR7 utilizes

MyD88 as an adaptor protein. Downstream signaling from MyD88 results in the

phosphorylation of IRF-7 and activation of NF-kB and AP-1 resulting in the production

of IFN-α and pro-inflammatory cytokines, respectively, further discussed below (142,

305).

More recently, RIG-I, a member of the RLR family, has been shown to have an

important role in the induction of the antiviral immune response following influenza virus

infection (191). RIG-I localizes in the cytoplasm and recognizes ssRNA containing a 5’-

triphosophate (258, 306). Once the 5’-triphsophate is recognized, TRIM25 ubiquinates

RIG-I leading to activation of the downstream adaptor protein, MAVS (111). MAVS

initiates a cascade inducing the activation of Protein kinase R (PKR), IRF-3, IRF-7, and

NF-kB (149, 184). This pathway also leads to the production of interferons and pro-

inflammatory cytokines (240).

The NLR pathway is mediated through the activation of the NOD-like receptor

family, pyrin domain containing 3 (NLRP3) inflammasome (8). Two signals are required

to induce the activity of the inflammasome (183). The first being recognition by PRRs,

as listed above, which causes nuclear translocation of NF-kB. NF-kB initiates

transcription of NLRP3 and pro-IL-1β (183). NLRP3 is activated in response to the

second signal, in the case of influenza virus, this is produced by M2 activity (152). After

NLRP3 activation, the inflammasome is produced by incorporation of Apoptosis-

associated speck-like protein containing a CARD (ASC) and pro-caspase 1 resulting in an

31

active caspase 1, which cleaves pro-IL-1β into IL-1β (5, 8). Lack of NLRP3 expression

results in increased mortality in mice and reduced inflammatory response, suggesting an

important role of the NLRP3 inflammasome in influenza virus protection (8).

PRRs engagement result in the production of antiviral and pro-inflammatory

cytokines (163). The antiviral state is induced through type I and type III interferons

(IFNs) (314). IFN-α and IFN-β are the two main interferons in the type I IFN group of

proteins that are intimately involved in influenza virus infections; other type I IFNs

include IFN-κ, IFN-δ, IFN-ε, IFN-τ, IFN-ω, and IFN-ζ (314), although these will not be

discussed. Type I IFNs bind to the IFN-α receptor (IFNAR), which is comprised of the

IFNAR1 and IFNAR2 (314). The IFNAR is present on most cell types allowing almost

any cell to be effected by the stimulation of type I IFNs (321). Binding of IFN-α or IFN-

β to the IFNAR signals through the JAK-STAT pathway, where JAK1 and Tyk2

phosphorylate STAT1 and STAT2. STAT1-STAT2 binds to IRF9 and induces the

expression of interferon-stimulated genes (ISGs) by binding to interferon-sensitive

response elements (ISREs) (146). Type III IFNs (IFN-λ) also induce the production of

the antiviral state through ISG expression (176). There are 3 proteins in the IFN-λ

family, IL-29 (IFN-λ1), IL-28a (IFN-λ2), and IL-28b (IFN-λ3) (277). Humans have all

three IFN-λs; however, IFN-λ1 is a pseudogene in mice (133). IFN-λ has been shown to

be the predominant IFN produced following influenza virus infection in the mouse lung

(159). IFN-λ utilizes the IFN-λ receptor (IFNLR) which is a heterodimer of IL28Rα and

IL10Rβ (81). Although IFN-λ uses a distinct receptor, it still signals through the STAT1-

STAT2 pathway (176, 326). Mice lacking the IL28Rα have slightly increased mortality

and viral load, but the presence of type I interferons are able to overcome the lack of IFN-

32

λ signaling (217). Furthermore, IFNAR knock-out mice also only show slightly

increased mortality, which supports the idea that type I and type III IFNs provide similar

roles (159). However, in the absence of IFNAR1 and IL28Rα, STAT1, or STAT2, all

mice succumb to infection compared to complete protection in wild type mice (159, 217).

PKR, 2’5’-oligoadenylate synthetase (OAS)/ RNase L, and Mx1 (MxA in humans) are

important ISGs known to be up regulated by IFN signaling which help make cells

resistant to influenza virus infection (164).

Besides the induction of the antiviral state, infected epithelial and

macrophages/dendritic cells produce large amounts of chemokines and pro-inflammatory

cytokines to initiate cellular recruitment and activation/stimulation, respectively (163).

Following infection, epithelial cells secrete large amounts of MCP-1, RANTES, and IL-

8, whereas macrophages produce high levels of MIP-1α/β, MCP-1 and -3, IP-10, and

RANTES (164). These chemokines drive the recruitment of additional mononuclear cells

to the lung airways to combat the infection (163). The predominant pro-inflammatory

cytokines secreted are IL-1β, IL-6, TNF-α, IL-12 and IL-18 in addition to the IFNs and

these cytokines are produced by macrophages, dendritic cells, and epithelial cells (163,

268). Expression of these cytokines, as well as the chemokines, enhance activation and

maturation of antigen presenting cells (APCs), natural killer (NK) cells, and T cells

driving the Th1 response, discussed below (163, 273).

Although the innate immune response has multiple methods to reduce viral load,

influenza virus can also combat the induction of the innate response through the

expression of the NS1 protein (131). The influenza virus NS1 antagonizes the production

of IFNs, host mRNA synthesis, and induction of ISGs (270). First, the NS1 protein

33

blocks the IFNα/β response by binding and sequestering dsRNA, thus reducing the ability

of the cell to recognize viral replication through PKR and OAS (80). Furthermore, the

NS1 obstructs maturation of host mRNAs through binding of cleavage-polyadenylation

stimulating factor (CPSF) and blocking 3’ polyadenylation of host pre-mRNA halting

protein production of host genes (232). Finally, the NS1 protein binds to TRIM25

inhibiting the activation of RIG-I (110). Alternatively, NS1 blocks IFN induced proteins

to limit the antiviral state. The NS1 protein binds to PKR inhibiting its phosphorylation

of eIF2α, which renders eIF2α unable to block protein synthesis (24). Furthermore, NS1

binds to OAS and blocks activation of RNase L resulting in lack of RNA degradation

(216). In an alternative method to enhance virus replication, the NS1 protein activates

phosphatidylinositide 3-kinase (PI3K) potentially limiting apoptosis of the cell (130).

The lack of IFNα/β during the initial stages of the infection also reduces the ability of

DCs to mature which helps influenza virus initially evade the immune response (99).

Influenza viruses containing a mutated NS1 gene readily induce type I IFN secretion and

because of this, the virus is highly attenuated resulting in low virion output (337). The

innate immune response controls the infection until the adaptive immune response can

clear the remaining infected cells.

Adaptive immune response

The innate and adaptive immune system is bridged in part through the

presentation of antigens by professional APCs. The IFNs produced during the innate

response are also important for maturation of APCs, particularly DCs, to up-regulate

expression of MHC molecules, chemokines receptors, and co-stimulatory molecules

34

(314). Mature APCs home to the secondary lymphoid tissue for activation of the

adaptive immune cells (314). The adaptive immune system is separated into two arms,

i.e. the humoral and cell-mediated response. The humoral response is characterized by

the production of antibodies (172). Although antibodies are produced against most of the

influenza virus proteins, the antibodies against the HA protein provide viral neutralization

that can produce sterilizing immunity against homologous virus challenge, and mouse

studies suggest that this may occur without the need for a T cell response (40).

Furthermore, antibodies recognizing the NA and M2 proteins provide additional

assistance in viral clearance through blockade of virion budding and antibody dependent

cell-mediated cytotoxicity of infected cells by NK cells and complement-mediated

cytotoxicity, respectively (83, 158, 336). As previously discussed, antibodies against the

globular heads of HA and NA are only effective if the virus does not undergo antigenic

drift, but recent studies have shown the efficacy of cross-reactive antibodies directed to

the conserved stalk region of the HA protein and the conserved M2 protein (231, 290).

Another approach to provide heterologous protection is through the induction of the cell-

mediated immune response which is directed at conserved, internal viral proteins. In the

absence of antibody generation (e.g. μMT knockout mice), CD8+ T cells have been

shown to control the infection in mice, but in the absence of both antibody and CD8+ T

cells, few mice survive infection (319).

The cell-mediated immune response is characterized as the T cell-side of the

adaptive response. Peptides are presented to naïve CD8+ and CD4+ T cells through

major histocompatibility complex (MHC) class I and II, respectively (144, 261). Both

CD4+ and CD8+ T cells require initial activation from a professional APC (2). This

35

occurs through binding to MHC expressing a foreign antigen to the T cell receptor (TCR)

with co-stimulation by CD28 binding B7 on the APC (286). Activation up-regulates the

expression of the high affinity IL-2R, CD40L, and FasL (2). For influenza virus

infection, the CD8+ T cell response in the airways begins to establish between day 5-6,

peaking around 10 days post-infection, followed by contraction by day 14 post-infection

(203). This coincides with the elimination of virus by day 7 or 8 post-infection (203).

Generally, the CD4+ T cell response peaks in the lungs prior to the CD8 response (263).

During the contraction phase, a small population remains as memory cells, i.e. either

central or effector memory, that activate more rapidly upon re-exposure to antigen (39,

69, 78).

CD4+ T cells or T helper (Th) cells drive the immune response toward a Th1-,

Th2-, or Th17-based response through the elaboration of cytokines at the site of infection

(172). Influenza virus infection imitates a Th1-type response by the presence of IL-12

produced by APCs (49). The Th1 cells provide a role in the affinity maturation and class

switching of antibodies to a mucosal IgA and serum IgG2a subtype expression in mice in

germinal centers (referred to as TFH cells) (303). Interaction of CD40, present on B cells,

and CD40L, present on the TFH cells, maximize the humoral response and induce the

development of memory and plasma cells (185). Th1 cells also produce large amounts of

IL-2 enhancing the expansion of the CD4 and CD8 T cell populations (303), and more

evidence is showing cytotoxic abilities of the Th1 cells (43, 200). Cytotoxic CD4+ T

cells have the transcription factor eomesodermin, and provide effector functions through

granzyme B, FasL, and perforin, although the CD4+ T cells do not necessarily have to

derive from the Th1 lineage (303). Th1 cells are characterized by the presence of the

36

transcription faction T-bet (304) and produce IFNγ and TNF-α driving the CD8+ T cell

response (44) as well as enhancing memory CD8+ T cell generation (157). A large

amount of the CD4+ T cells in humans against the pandemic H1N1 is directed against the

M, PB1, NP, HA, and NA proteins (116). A recent study showed the importance of

CD4+ T cells in heterologous protection (343). CD4+ T cells were isolated from healthy

donors, with no pre-existing antibody response to the challenge virus, prior to and

following infection with a H3N2 or H1N1 viruses. Individuals with pre-existing CD4+ T

cells against internal proteins, rather than CD8+ T cells, had reduced disease severity and

virus shedding (343). These CD4+ T cells also showed cytotoxic effects against their

targets as well as recognized peptides derived from the pandemic H1N1 (343). This

study demonstrates the importance of the CD4 response in cross-protection.

CD8+ T cells or cytotoxic T lymphocytes (CTLs) have an important role in the

final clearance of influenza virus. CD8+ T cells use perforin/ granzymes, and Fas/FasL

interaction to kill infected cells through the recognition of MHC I: antigenic peptide

complexes (320). Another mechanism CD8+ T cells utilize to remove virally infected

cells is through TRAIL binding (41). CD8+ T cells also produced and enhance the

production of chemokines and cytokines, such as RANTES (48), TNF-α (347), and IFN-γ

(132). All these mechanisms used by CD8+ T cells overlap providing alternative

mechanisms of clearance in the absence of another (132). The CD8+ T cells are primed

in the lung-draining lymph nodes as well as in spleen resulting in the generation of

effector and memory cells, discussed below (325). These cells then traffic to the lungs to

remove virally infected cells (202). During infection, DCs are also recruited to the lungs

and provide an important role in the maintenance of CD8+ T cell effector functions

37

(210). Besides the CD8+ T cell effector functions, recent work is emerging providing a

regulatory role for CD8+ T cell through the production of IL-10 (302). Like the CD4+ T

cells, there are immunodominant epitopes for CD8+ cells during influenza virus

infection. In the C57BL/6 mouse model, the NP366-374 and PA224-233 specific CD8+ cells

dominate the acute infection whereas the NP366-374 is the dominant CD8+ T cell during a

challenge infection (22, 23, 67, 178). The immunodominant epitope found in the human

population is M158-66, which is presented by HLA-A*201 (270). This HLA is common

within humans and can be seen in over 50% of the population. It has been hypothesized

that the increase in the NP366-374 CD8+ T cell population may be due to the cells that

present this epitope. NP366-374 is commonly expressed by most cells including dendritic

cells and non-dendritic cells, while the PA224-233 peptide is almost exclusively expressed

on DCs (67). During the acute infection most naïve cells are activated by DCs allowing

the NP and PA epitopes to be co-dominant; however, memory cells can be activated by a

range of cells, thus allowing NP-specific cells to be activated more readily (67). Other

epitopes are subdominant to the NP and PA response including PB1703-711, PB1-F262-70,

NS2114-121, M1128-135, HA332-340, and HA211-225 (22, 222). However, these dominant and

subdominant epitopes change depending on the mouse model and varying between

human individuals with some epitopes being similar among similar alleles.

Activation of naïve T cells results in massive proliferation (228). The activated

cells lose the express of IL-7R in return for co-stimulatory molecules, such as CD40L, to

increase the activation of APCs and B cells, as well as FasL and high affinity IL-2R (2).

The effector cells also express high levels of killer cell lectin-like receptor G1 (KLRG1)

(187). Once terminally differentiated into an effector cell there is lowered proliferation

38

and a short life expectancy due to increases in pro-apoptotic factors, such as Bim1, at the

peak of activity (68). The pro-apoptotic factors and binding of FasL assist in the

contraction phase of an immune response following clearance of the pathogen (86, 247).

A small subset of T cells will differentiate into a memory phenotype through changes in

inflammation, cytokine milieu, and amount of antigen present, although the exact model

for differentiation preference is still debated (162, 165, 239). Two memory phenotypes

can be acquired: effector memory or central memory. These two populations are

classified based in part on the surface markers and localization following clearance of the

pathogen (165, 338). Effector memory cells are generally characterized as

CD44hi

CD62Llo

CCR7lo

and remain at the site of infection. These cells are the first

responders in the instance of reinfection, expressing high levels of cytokines but have

limited proliferation capabilities (68, 322). Central memory cells are generally

characterized as CD44hi

CD62Lhi

CCR7hi

and remain in secondary lymphoid organs.

Upon reinfection, these cells undergo massive proliferation and express multiple

cytokines (68, 165).

The CD4+ and CD8+ T cell response can recover from infection in the absence

of the other but with the consequence of delayed viral clearance (89, 315). This suggests

that both cell types are needed to establish a robust immune response and for the

development of immunological memory. In the absence of both CD8+ T cells and B

cells, CD4+ T cells alone are unable to control influenza virus infection (223).

Alternatively, MHC II knockout mice or CD4-depleted mice generate a similar CD8

response to wild type mice but lack the ability to produce a similar magnitude of CD8

39

influenza virus specific memory response, showing a role for CD4+ T cells in the

generation of memory CD8+ T cells (21, 259).

Overview of Indoleamine 2, 3- Dioxygenase (IDO)

IDO is a 45kDa intracellular enzyme that provides the first and rate limiting step

in the kynurenine pathway, where it catabolizes tryptophan (trp) into kynurenine (kyn)

(300). The structure of IDO contains 2 domains, mostly comprised of α-helixes, named

the small and large domains (300). The active site is located in a heme-containing pocket

at the intersection of the two domains. Key residues in the enzymatic function of IDO

are F226, F227, and R231 (300). Mutation of these residues results in severely decreased

enzymatic activity (300). The main function of IDO is to oxygenate the C-2 and C-3

double bond of the indole ring of trp through binding of O2 (300, 313). First, IDO

interacts with an O2 molecule through the ferrous ion of the heme group (313). The O2

molecule binds to trp producing a dixetane intermediate which is released from the

ferrous ion (300). Electron shifting produces N-formylkynurenine from the dixetane

intermediate (313). N-formylkynurenine is converted to kynurenine in the presence of

H2O with the release of formic acid (313).

IDO was first described in the mid-1970s as a new class of enzymes which utilize

superoxide anions as a substrate (145), with the first link to disease following detection of

pulmonary IDO activity in mice following intraperitoneal injection of lipopolysaccharide

(LPS) (138, 351). However, the impact of IDO activity was not fully appreciated until it

was shown to provide protection against T cell mediated allogeneic fetal rejection (226).

IDO is expressed by a variety of cells including plasmacytoid and monocyte-derived

40

dendritic cells (59, 275), macrophages and microglia cells (122, 224), epithelial and

endothelial cells (331), and astrocytes (301). IDO activity is found at high levels in

multiple tissues including the epididymis, uterus, spleen, small intestines, prostate, and

many types of cancerous cells with lower levels of expression in lung and brain tissue

(70); however, these sites can produce high levels following IDO induction (123, 352).

The promoter region of IDO contains interferon-sensitive response elements

(ISRE) that are stimulated in response to type I and type II interferons (254). IFN-γ is

considered one of the strongest inducers of IDO activity which lends to the potential role

IDO has on the immune response against infection (312). Other molecules have been

associated with increased IDO activity, albeit to varying levels of activity. The regulatory

molecule, CTLA-4, expressed by Treg cells increases the activity of IDO in APCs (121).

Treg cells induce a positive feedback loop of IDO expression through binding of CTLA-4

to APCs inducing the expression of IDO which in turn increases the number of Treg

resulting in increased IDO expression (182). Tregs are pivotal in the function of IDO

suppression, and their role is discussed below. Besides IFN-γ, other immune mediators

stimulate IDO activity including CpG motifs through TLR9 stimulation (344), type I

IFNs (340), LPS (30), and TNF-α (341). IFN-γ treated HeLa cells showed enhanced IDO

expression with the addition of TNF-α or IL-1 (12). The IDO expression synergy is

partially mediated by up-regulation of the IFNGR from TNF-α and IL-1 stimulation and

subsequent NF-κB activation (280). The activity of IDO can be suppressed with the

pharmacological competitive inhibitor, 1-methyl-D, L-tryptophan (1MT) (160). 1MT

induces little to no toxicity on the tissue or cells and can be used in vivo through oral

administration or in vitro (4, 46, 148, 160).

41

In recent years a similar enzyme to IDO1, Indoleamine 2, 3-dioxygenase-like 1

(INDOL1) or IDO2, has been discovered that has a similar structure (about 43%

similarity) and function; however it is differentially regulated (15). Both enzymes are

located on chromosome 8 as adjacent genes in both mice and humans suggesting that the

development of both enzymes was due to gene duplication (14, 214). Although IDO1

and IDO2 have a similar function, IDO1 has a lower Vm compared to IDO2 allowing

IDO1 to metabolize trp faster than IDO2 because of a higher substrate affinity (212).

Furthermore, the tissue expression and potential signaling pathways vary (214). While

both enzymes can be expressed by APCs and in tissues such as lungs, brain and the male

and female reproductive system, IDO2 has been shown to be more highly expressed and

distributed in the kidney, placenta, and liver (108, 214). A recent study showed that in

the absence of IDO1, using IDO1 -/- mice, IDO2 expression is increased apparently to

compensate for the lack of regulation in immune privileged sites, such as the epididymis

(108). Both enzymes can be transcribed using the full length sequence or as truncated

forms using an alternative 5’ exons leading to the possibility of various promoter sites

(15, 214). It has recently been reported that there is a difference in the isoform that 1-

methyl-tryptophan can block, with IDO1 being better inhibited by the L-isoform and

IDO2 utilizing the D-isoform more readily (15, 214). However, this preference is not

absolute as the opposite preference has also been reported (353). Furthermore, new

inhibitors, INCB024360 and Amg-1, are emerging to selectively inhibit IDO1 which will

aid in distinguishing the differences between the roles IDO1 and IDO2 (188, 212, 288).

42

Mechanism of IDO Immune Suppression

IDO activity results in an immunosuppressive environment through the

catabolism of trp and providing the first step in the production of kyn and its metabolites,

which are discussed in more detail below. The depletion of trp causes T cell arrest in the

G1 phase of the cell cycle (186). This mechanism is mediated through the general

controlled nonrepressed 2 (GCN2) kinase (225). GCN2 is activated by accumulation of

uncharged tRNA, in this case the depletion of trp (225). The activation of GCN2 leads to

the down regulation of the TCR zeta chains inhibiting TCR signaling (96). The trp-

deprived T cells are more susceptible to Fas-mediated apoptosis (186). In pDCs, GCN2

activation phosphorylates eIF2α which up-regulates NF-κB, IFNGR, and C/EBP

homology protein (CHOP) while reducing expression of IL-6 (276, 288). The kyn

produced from trp metabolism can bind and activate the aryl hydrocarbon receptor (AhR)

present on naïve T cells and, in combination with trp starvation, sways the T cells to a

Treg (CD4+Foxp3+CD25+) phenotype (215). Because IDO can be up-regulated from

binding of CTLA-4, it also has roles in Treg differentitation (121). As previously

described, binding of CTLA-4 to DCs increases the production of type I and II

interferons resulting in a positive feedback of increased IDO expression (97). There is a

fine line in the differentiation of naïve CD4+ cells to the Th17 or Treg phenotype. Th17

cells are distinguished by the production of IL-17, IL-23, and the expression of the

transcription factor RORγT (154), while Treg cells express high levels of CD25, GITR,

secrete IL-10 and TGF-β, and most express the transcription factor FoxP3 (13, 28). The

cytokine milieu drives the differentiation. In the presence of TGF-β, TCR activation

drives CD4+ cells to become Treg cells, while TGF-β and IL-6 provide the signals for

43

Th17 differentiation (172). These are the classical ways of Treg and Th17

differentiation; however, other mechanisms have been described (13, 60, 107, 334).

Activation of IDO suppresses the secretion of IL-6, thus creating an environment for Treg

production and suppression of the immune response (11). In the presence of 1MT, IL-6

production is increased producing an enhanced pro-inflammatory environment (98).

Interestingly, the reverse has also been demonstrated where IL-6 expression regulates the

degradation of the IDO protein (93). IDO1 contains two immunoreceptor tyrosine-

based inhibitory motifs (ITIMS) which are phosphorylated in the presence of

inflammation, in particular IL-6 (241). In pDCs, the phosphorylated ITIMS interact with

suppressor of cytokine signaling 3 (SOCS3) which mediates the proteasomal degradation

of IDO1 (242). Alternatively, in a TGF-β predominant environment, the ITIMS are

phosphorylated by Fyn rather than Src kinase and result in noncanonical NF-κB

activation which continues to produce TGF-β maintaining a regulatory environment (93,

206).

Studies are emerging showing the frequency and role of Tregs during a natural

influenza virus infection. The CD4+Foxp3+ Treg population peaks in number and

frequency prior to the peak CD8+ T cell response around day 7-8 post-infection, but peak

activation of the Treg cells is at the peak CD8 response, day 11 post-infection (29).

Furthermore, the induced Tregs proliferate in the presence of influenza virus infected

DCs, suggesting that these cells are influenza virus specific (29). Moreover, a recently

published study showed the dampening effect of Treg induction on the generation of

memory influenza-specific CD8+ T cell (42). There was an increased frequency of

NP366- and PA224-specific CD8+ T cells in the lungs of mice following memory challenge

44

when the Foxp3+ Treg were depleted prior to challenge compared to isotype-depleted

controls (42). But the Treg depleted mice produced enhanced pathology compared to

control mice (42). IDO activity is present in the lungs of influenza virus infected mice

peaking at day 10-11 post-infection which correlates with the time frame of Treg

development and activation during influenza virus infections (29, 351).

Kynurenine Pathway Metabolites

Kyn can be broken down further into other metabolites through additional

enzymes which are associated with neurological activities (16). Kynurenine

aminotransferase produces kynurenic acid (KA), which has been link to neuronal activity

and being a neuroprotectant (57, 220). High levels of this compound were associated

with sedation and provided protection during brain injuries (47). Alternatively, high

concentrations of KA have been associated with individuals suffering from schizophrenia

(235), suggesting a possible effect of long term exposure to KA on brain functioning. An

alternative pathway leads kyn toward the production of nicotinic acid dinucleotide

(NAD). This pathway utilizes kynurenine 3-hydroxylase or kynureninase to produce 3-

hydroxykynurenine (3-HK) or anthranilic acid (AA), respectively (57). Kynureninase

also hydrolyses 3-HK into 3-hydroxyanthranillic acid (3-HAA). AA is also oxidized to

3-HAA but mediated by anthranilic acid 3-hydrolase. 3-HAA is a neurotoxin and has

been shown to be both a free radical generator in the presence of copper as well as an

antioxidant, depending on the microenvironment (117, 219). 3-HAA has also been

implicated in blocking NF-κB signaling of macrophages. Furthermore, evidence suggests

that 3-HAA has a suppressive effect on T cell proliferation and activation through

45

inhibition of PDK1 activation (139). 3-HAA selectively targets Th1 cells to undergo

apoptosis through caspase-8 activation (94) and skewing toward a Th2-type response

(252). 3-hydroxyanthranilic acid oxygenase (3-HAO) produces quinolinic acid (QA)

from 3-HAA (57). QA has also been shown to have a negative effect on T cell activation

(95). Similar to 3-HAA, QA produced by pDCs induces apoptosis in Th1 cells (19) and

inhibits the activation of CD8+, CD4+ T cells, and NK cells (105). At high

concentrations (57), QA can be toxic which has associated it with neurodegenerative

diseases, such as Alzheimer’s disease (122) and Huntington’s disease (267). QA is

broken down by quinolinic acid phosphoribosyltransferase (QPRT) into nicotinic acid

mononuleotide (NaMN) (57). An additional adenylate is transferred to the NaMN which

is processed to NAD (57).

IDO’s Role in Infectious Disease Pathogenesis

While IDO has been shown to promote immune evasion of cancer, studies are

emerging now focused on pathogen regulation of IDO activity. Modulation of the

immune response has been seen with viruses, bacteria, parasites, and fungi. Although the

association of IDO activity varies between pathogens, ultimately IDO (1) helps dampen

the immune system, (2) produces a regulatory environment causing the pathogen to

remain stealth from the immune system, or (3) blocks essential trp availability to a

pathogen. Although only a handful of diseases have been studied in regard to IDO

activity, in the future, most likely more associations will be observed. Alternatively,

these studies show potential for IDO inhibition to counteract the immune suppression and

result in enhanced clearance or immune response to infections or vaccinations.

46

IDO activity has been associated with suppression of the immune response

following infection. IDO activity is strongly up-regulated in murine lungs, bronchiolar

and alveolar epithelial cells, and alveolar macrophages following infection with various

respiratory pathogens, including influenza virus, Histoplasma capsulatum (H.

capsulatum), Mycobacterium tuberculosis (TB), and Rhodococcus equi (R. equi) (33,

128, 141, 352). During influenza virus infections, inhibition of IDO using 1MT resulted

in an enhanced Th1 response but with no effect on viral load (103). IDO inhibition

following infection with H. capsulatum reduced fungal burden in the lungs and

inflammation in the lungs and spleen (128). Although work has emerged showing IDO

induction in the lungs during TB infections, the complete role of IDO in this system is

still unknown. In vitro studies of TB infection show an enhancement in T cell killing

ability following IDO inhibition in DCs, which was related to the production of picolinic

acid, a kynurenine metabolite (33). In vivo quinolinic acid (QA) is produced over

picolinic acid, resulting in no effect in mice (33). Besides DC expression of IDO,

epithelial cell expression of IFN-γ induced IDO provides a strong protection from TB

infection (75). Mice expressing mutant IFN-γ receptors only in nonhematopoietic cells

resulted in enhanced bacterial load, faster death, and increased inflammation (75).

Increased inflammation in the absence of IDO expression was also observed during R.

equi infection (141). In this model, IDO knockout mice had no difference in bacterial

load, but had reduced numbers of TGF-β expressing cells and Treg cells, which

ultimately enhanced the inflammation present in the liver during infection (141). IDO

activity has also been shown to be up-regulated in bladder tissue, heart, and intestinal

goblet cells during uropathogenic E. coli (UPEC), acute viral myocarditis, and Trichuris

47

muris (T. muris) infections, respectively (18, 147, 192). In bladder tissue specific IDO -/-

mice, UPEC infections enhanced inflammation but in turn, reduced the bacterial survival

(192). Furthermore, acute viral myocarditis induced expression of IDO in the spleen and

heart and IDO inhibition with 1MT or with knockout mice, increased type I interferon

response and reduced the viral load enhancing survival of the animals (147). Finally,

IDO activity has been linked to the regulation of epithelial cell turnover during T. muris

infections of the intestines in SCID mice (18). Colonic epithelial cells and goblet

expressed IDO and blockade of IDO increased the sloughing of the T. muris infected

cells (18). These studies illustrate the benefit of immune dampening to suppress a T cell

response thus reducing pathology caused by a pathogen but at the cost of enhanced

clearance.

IDO produces a regulatory environment that certain pathogens exploit to maintain

a chronic infection. HIV infected individuals have increased IDO activity in lymphoid

tissues over uninfected individuals (9, 287) which correlated with the skewing of naïve

CD4+ T cells to a Treg phenotype from a protective Th17 response (98). In the SIV

model, IDO inhibition with 1MT in combination with antiretroviral therapy (ART)

reduced the viral load in the lymph nodes (36). Alternatively, a recent publication

showed no changes in T cell activation or viral rebound when 1MT was administered

following ART therapy, suggesting that 1MT may be more effective during ART therapy

rather than as a subsequent treatment (87). Furthermore, in a study using the mouse

equivalent of AIDS, IDO was active during infection, but IDO knockout mice did not

affect the disease progression or outcome as compared to wild type mice (194). The

increased IDO activity was also evident in isolated PBMCs from HIV-infected

48

individuals where CD4+ T cell proliferation were increased following ex vivo treatment

with 1MT to block IDO activity (35). It was determined that the IDO-mediated

suppression was derived from the HIV gp120 protein interacting with pDCs in the culture

(35). When pDCs were isolated from HIV-uninfected individuals and exposed to HIV,

the pDCs increased activation markers on CD4+ and CD8+ T cells in an interferon

dependent manner, but reduce the T cells proliferation through cell cycle arrest and up-

regulation of CHOP (34). So, evidence suggests that IDO may provide a pivotal role in T

cell activation and concurrent suppression during HIV infections. In the lymphoid

tissues, IL-32 production from immune cells, i.e. CD4+ T cells, macrophages, DCs, and

B cells, increased the activity of IDO and resulted in immune impairment and enhanced

virus replication (287). 1MT treatment during HIV induced encephalitis in SCID mice,

reconstituted with human PBMCs, and increased the number of HIV specific CD8+ T

cells and reduced the amount of infected macrophages (257).

Furthermore, IDO-mediated suppression also occurs during chronic hepatitis B

(HBV) and hepatitis C virus (HCV) infections. PBMCs collected from chronically HBV-

infected individuals showed increased IDO expression and activity with positive

correlation with viral load and T cell presence (58). Alternatively, in vitro, IDO

expression in human hepatocytes following HBV infection reduced the viral load (199).

Cells expressing an inactive IDO protein or supplemented with tryptophan restored HBV

replication (199). Similar results were observed during HCV infection of chimpanzees

where increased IDO expression in the liver correlated with a chronic infection (181).

The regulatory environment has also been observed with multiple protozoan and

bacterial infections leading to the development of a chronic infection state. Leishmania

49

species (L. major, L. infantum, L. donovani) infection shift the immune system to an

inadequate response through the up-regulation of IDO (195). The major source of IDO

activity is Leishmania infected DCs, which drive the stimulation and proliferation of Treg

cells located at the site of infection (299). Interestingly, the increased IDO activity is not

dependent on a live infection and can be induced by Leishmania lysate (82). A recent

study measured the ability of exogenous OVA-specific CD8 T cells to proliferate if

stimulated in a L. major infected mouse (196). The study showed that L. major infections

induced IDO expression in the draining lymph nodes and suppressed the proliferation of

the OVA-specific CD8 T cells (196). This suppression was reversed is the presence of

1MT and the Th17 cell population was increased with reduced parasite burden (196).

Alternative to IDO activity suppressing the immune response in favor of the

pathogen, IDO expression and the subsequent removal of trp from the microenvironment

is detrimental to the growth of some pathogens, including Toxoplasma gondii (T. gondii),

Trypanosoma cruzi (T. cruzi), and herpes simplex type 2 virus (3, 127, 173). T. gondii

infections induce the expression of IFN-γ which in turn up-regulates IDO activity (106).

The presence of IDO during infection reduces the growth of T. gondii through depletion

of trp (250). IDO mutant cells that were stimulated with IFN-γ were unable to suppress

the growth of the parasite (316). A recent study showed that in IDO knockout mice or

mice treated with 1MT had reduced levels of T. gondii surface antigen gene 2 mRNA

expression and inflammation during an intranasal infection with T. gondii as compared to

controls (227). Alternatively, IDO activity can be regulated by the oxygen supply in

tissues (269). IDO expression is reduced in hypoxic regions which reduced the

suppression of T. gondii growth (269). During T. cruzi infections, IDO activity is

50

systemically up-regulated and is a key player in the ability of T. cruzi to replicate in

macrophages (173). IDO inhibition with 1MT during infection increases the parasite

burden in mice and reduces the ability of the animal to fight the infection (173). Also,

herpes simplex type 2 virus induces IDO activity in an IFNγ dependent manner in human

cervical cells reducing the virus replication (3). The replication suppression can be

reversed through administration of L-tryptophan to the cells (3). Likewise, a limitation of

West Nile Virus (WNV) spread has been associated with IDO expression (350). WNV

infected human monocyte-derived macrophages induced the expression of IDO in

uninfected cells through the stimulation of TNF-α and signaling through the NF-kB

pathway (350). Overexpression of IDO reduced viral replication and this effect was

reversed with the addition of tryptophan (350).

Finally, work is emerging providing a role for IDO manipulation in the context of

enhanced vaccination as well as utilizing IDO expression as a biomarker of disease

progression. In a study testing the inflammatory response of the Bacillus Calmette–

Guérin (BCG) vaccine against subsequent TB infections showed that mock vaccinated

macaques had significant increases in IDO activity in TB lesions compared to BCG

vaccinated animals (211). BCG vaccination resulted in higher levels of chemokines and

reduced bacterial load following challenge (211). This study suggests the ability of a

vaccine to modulate IDO activity following challenge and since TB utilizes IDO to

provide a regulatory environment, reduction in IDO activity enhanced pathogen

clearance. IDO activity has also been associated with increased T cell memory

generation following vaccination with an inactivated influenza virus in the presence of α-

galactoceramide (α-GalCer) (125). IDO was induced following vaccination which

51

resulted in reduced initial T cell generation, but enhancing memory T cell generation

through up-regulation of Bcl-2 (125). In addition, decreased IDO activity was observed

following vaccination with a DNA-pox virus vaccine against SIV (327). After challenge,

the vaccinated macaques showed reduced levels of immune suppressive molecules, such

as Tregs, TGF-β, and IDO in mucosal sites which helped reduce the viral load in these

tissues, although there was no effect on the depletion of CD4+ T cell (327). Additionally,

a recent study evaluated the efficacy of a recombinant HBV vaccine in individuals

undergoing hemodialysis (90). The individuals receiving dialysis had increased IDO

activity prior to vaccination as compared to healthy individuals which resulted in a

dampened antibody response to vaccination, as determined by antibodies to the hepatitis

B surface antigen (90). Suppression of IDO in individuals with an impaired ability to

produce a robust adaptive immune response, like those seen undergoing hemodialysis,

may be a method to enhance vaccine efficacy. Alternatively, when this hypothesis was

tested in mice, albeit without the impaired immune response, IDO inhibition using 1MT

during vaccination with a hepatitis B surface protein resulted in reduced antibody

production (91). Modulation of IDO expression is also being examined against cancer.

Recently, a study showed systemic delivery of a Salmonella Typhimurium vector

containing a shRNA against IDO1 infiltrated the tumor and reduce the host IDO

expression (32). The reduction in IDO expression resulted in increased recruitment of

neutrophils to the tumor site with enhanced reactive oxygen species production (32).

Apart from modulating IDO activity during vaccination, the expression of IDO

has being linked to disease severity and could potentially be utilized as a biomarker. A

recent study examined the levels of IDO activity in individuals diagnosed with visceral

52

leishmaniasis. The study found that individuals that were treated for the infection had

IDO activity comparable to uninfected control, but there was enhanced IDO activity in

individuals still infected with leishmania (114). The expression of IDO is also being

examined as a biomarker for severity of sepsis (151, 308). Plasma samples derived from

individuals with varying severities of sepsis, including septic shock, severe sepsis, and

sepsis, showed increased IDO activity with increasing severity as compared healthy

controls (308). Individuals with a high kyn/trp ratio (greater than or equal to

120μmol/mmol) were associated with an increased risk of death compared to individuals

that survived the septic infection (151). These studies suggest the use of IDO activity to

improve diagnostics and prognosis of diseases and potentially lead to better treatment

regimens.

Conclusions

Influenza virus impacts humans worldwide and new approaches need to be

evaluated to enhance the efficacy of vaccination. The current vaccine provides a strong

humoral response against homologous challenges but flounders if the vaccine strain does

not match the circulating strain of influenza virus. There is a push to enhance the T cell

immunity following vaccination to provide increased cross-protection. Since IDO is

known for dampening T cell responses and has a history of immune modulation during

various infections, it is a logical approach to determine the effect of IDO inhibition on the

immune response, in particular to enhance the T cell response. Furthermore, the usage of

the IDO inhibitor, 1MT, is already in clinical trials which would accelerate the approval

for IDO inhibition during vaccination and disease intervention strategies.

53

References

1. Centers for Disease Control and Prevention. Updated CDC Estimates of 2009

H1N1 Influenza Cases, Hospitalizations and Deaths in the United States, April

2009 – April 10, 2010, http://www.cdc.gov/h1n1flu/estimates_2009_h1n1.htm.

2. Abbas, A. K., A. H. Lichtman, and S. Pillai. 2007. Cellular and molecular

immunology, 6th ed. Saunders Elsevier, Philadelphia.

3. Adams, O., K. Besken, C. Oberdorfer, C. R. MacKenzie, D. Russing, and W.

Daubener. 2004. Inhibition of human herpes simplex virus type 2 by interferon

gamma and tumor necrosis factor alpha is mediated by indoleamine 2,3-

dioxygenase. Microbes Infect 6:806-812.

4. Agaugue, S., L. Perrin-Cocon, F. Coutant, P. Andre, and V. Lotteau. 2006. 1-

Methyl-tryptophan can interfere with TLR signaling in dendritic cells

independently of IDO activity. J Immunol 177:2061-2071.

5. Agostini, L., F. Martinon, K. Burns, M. F. McDermott, P. N. Hawkins, and J.

Tschopp. 2004. NALP3 forms an IL-1beta-processing inflammasome with

increased activity in Muckle-Wells autoinflammatory disorder. Immunity 20:319-

325.

6. Alexander, D. J. 2000. A review of avian influenza in different bird species. Vet

Microbiol 74:3-13.

7. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001.

Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like

receptor 3. Nature 413:732-738.

http://www.cdc.gov/h1n1flu/estimates_2009_h1n1.htm

54

8. Allen, I. C., M. A. Scull, C. B. Moore, E. K. Holl, E. McElvania-TeKippe, D.

J. Taxman, E. H. Guthrie, R. J. Pickles, and J. P. Ting. 2009. The NLRP3

inflammasome mediates in vivo innate immunity to influenza A virus through

recognition of viral RNA. Immunity 30:556-565.

9. Andersson, J., A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G.

M. Shearer, and C. A. Chougnet. 2005. The prevalence of regulatory T cells in

lymphoid tissue is correlated with viral load in HIV-infected patients. J Immunol

174:3143-3147.

10. Anker, W. J., A. K. Bakker, and N. Masurel. 1978. Cross-protection in mice

after immunization with H2N2, H3N2, and Heq2Neq2 influenza virus strains.

Infect Immun 21:96-101.




12. Babcock, T. A., and J. M. Carlin. 2000. Transcriptional activation of

indoleamine dioxygenase by interleukin 1 and tumor necrosis factor alpha in

interferon-treated epithelial cells. Cytokine 12:588-594.

13. Bacchetta, R., S. Gregori, and M. G. Roncarolo. 2005. CD4+ regulatory T

cells: mechanisms of induction and effector function. Autoimmun Rev 4:491-496.

14. Ball, H. J., A. Sanchez-Perez, S. Weiser, C. J. Austin, F. Astelbauer, J. Miu,

J. A. McQuillan, R. Stocker, L. S. Jermiin, and N. H. Hunt. 2007.

Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans

and mice. Gene 396:203-213.

55




16. Baran, H., G. Amann, B. Lubec, and G. Lubec. 1997. Kynurenic acid and

kynurenine aminotransferase in heart. Pediatric research 41:404-410.

17. Barr, J. N., and R. Fearns. 2010. How RNA viruses maintain their genome

integrity. J Gen Virol 91:1373-1387.

18. Bell, L. V., and K. J. Else. 2011. Regulation of colonic epithelial cell turnover by

IDO contributes to the innate susceptibility of SCID mice to Trichuris muris

infection. Parasite Immunol 33:244-249.

19. Belladonna, M. L., U. Grohmann, P. Guidetti, C. Volpi, R. Bianchi, M. C.

Fioretti, R. Schwarcz, F. Fallarino, and P. Puccetti. 2006. Kynurenine pathway

enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO.

J Immunol 177:130-137.

20. Belshe, R. B., R. Walker, J. J. Stoddard, G. Kemble, H. F. Maassab, and P.

M. Mendelman. 2008. Influenza vaccine-live. In S. A. Potkin, W. A. Orenstein,

and P. A. Offit (ed.), Vaccines. Elsevier.

21. Belz, G. T., D. Wodarz, G. Diaz, M. A. Nowak, and P. C. Doherty. 2002.

Compromised influenza virus-specific CD8(+)-T-cell memory in CD4(+)-T-cell-

deficient mice. J Virol 76:12388-12393.

22. Belz, G. T., W. Xie, J. D. Altman, and P. C. Doherty. 2000. A previously

unrecognized H-2D(b)-restricted peptide prominent in the primary influenza A

56

virus-specific CD8(+) T-cell response is much less apparent following secondary

challenge. J Virol 74:3486-3493.

23. Belz, G. T., W. Xie, and P. C. Doherty. 2001. Diversity of epitope and cytokine

profiles for primary and secondary influenza a virus-specific CD8+ T cell

responses. J Immunol 166:4627-4633.

24. Bergmann, M., A. Garcia-Sastre, E. Carnero, H. Pehamberger, K. Wolff, P.

Palese, and T. Muster. 2000. Influenza virus NS1 protein counteracts PKR-

mediated inhibition of replication. J Virol 74:6203-6206.

25. Betakova, T. 2007. M2 protein-a proton channel of influenza A virus. Current

pharmaceutical design 13:3231-3235.

26. Betakova, T., F. Ciampor, and A. J. Hay. 2005. Influence of residue 44 on the

activity of the M2 proton channel of influenza A virus. J Gen Virol 86:181-184.

27. Betakova, T., and A. J. Hay. 2007. Evidence that the CM2 protein of influenza

C virus can modify the pH of the exocytic pathway of transfected cells. J Gen

Virol 88:2291-2296.

28. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L.

Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the

generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-

238.

29. Betts, R. J., N. Prabhu, A. W. Ho, F. C. Lew, P. E. Hutchinson, O. Rotzschke,

P. A. Macary, and D. M. Kemeny. 2012. Influenza A virus infection results in a

robust, antigen-responsive, and widely disseminated Foxp3+ regulatory T cell

response. J Virol 86:2817-2825.

57




31. Biswas, S. K., P. L. Boutz, and D. P. Nayak. 1998. Influenza virus

nucleoprotein interacts with influenza virus polymerase proteins. J Virol 72:5493-

5501.

32. Blache, C. A., E. R. Manuel, T. I. Kaltcheva, A. N. Wong, J. D. Ellenhorn, B.

R. Blazar, and D. J. Diamond. 2012. Systemic delivery of Salmonella

typhimurium transformed with IDO shRNA enhances intratumoral vector

colonization and suppresses tumor growth. Cancer Res 72:6447-6456.

33. Blumenthal, A., G. Nagalingam, J. H. Huch, L. Walker, G. J. Guillemin, G.

A. Smythe, S. Ehrt, W. J. Britton, and B. M. Saunders. 2012. M. tuberculosis

induces potent activation of IDO-1, but this is not essential for the immunological

control of infection. PLoS One 7:e37314.

34. Boasso, A., A. W. Hardy, S. A. Anderson, M. J. Dolan, and G. M. Shearer.

2008. HIV-induced type I interferon and tryptophan catabolism drive T cell

dysfunction despite phenotypic activation. PLoS One 3:e2961.

35. Boasso, A., J. P. Herbeuval, A. W. Hardy, S. A. Anderson, M. J. Dolan, D.

Fuchs, and G. M. Shearer. 2007. HIV inhibits CD4+ T-cell proliferation by

inducing indoleamine 2,3-dioxygenase in plasmacytoid dendritic cells. Blood

109:3351-3359.

36. Boasso, A., M. Vaccari, D. Fuchs, A. W. Hardy, W. P. Tsai, E. Tryniszewska,

G. M. Shearer, and G. Franchini. 2009. Combined effect of antiretroviral

58

therapy and blockade of IDO in SIV-infected rhesus macaques. J Immunol

182:4313-4320.

37. Boivin, S., S. Cusack, R. W. Ruigrok, and D. J. Hart. 2010. Influenza A virus

polymerase: structural insights into replication and host adaptation mechanisms. J

Biol Chem 285:28411-28417.

38. Bottcher, E., T. Matrosovich, M. Beyerle, H. D. Klenk, W. Garten, and M.

Matrosovich. 2006. Proteolytic activation of influenza viruses by serine proteases

TMPRSS2 and HAT from human airway epithelium. J Virol 80:9896-9898.

39. Boyman, O., S. Letourneau, C. Krieg, and J. Sprent. 2009. Homeostatic

proliferation and survival of naive and memory T cells. Eur J Immunol 39:2088-

2094.

40. Bridges, C. B., J. M. Katz, R. A. Levandowski, and N. J. Cox. 2008.

Inactivated influenza vaccines. In S. A. Potkin, W. A. Orenstein, and P. A. Offit

(ed.), Vaccines. Elsevier.

41. Brincks, E. L., A. Katewa, T. A. Kucaba, T. S. Griffith, and K. L. Legge.

2008. CD8 T cells utilize TRAIL to control influenza virus infection. J Immunol

181:4918-4925.

42. Brincks, E. L., A. D. Roberts, T. Cookenham, S. Sell, J. E. Kohlmeier, M. A.

Blackman, and D. L. Woodland. 2013. Antigen-specific memory regulatory

CD4+Foxp3+ T cells control memory responses to influenza virus infection. J

Immunol 190:3438-3446.

59

43. Brown, D. M., A. M. Dilzer, D. L. Meents, and S. L. Swain. 2006. CD4 T cell-

mediated protection from lethal influenza: perforin and antibody-mediated

mechanisms give a one-two punch. J Immunol 177:2888-2898.

44. Brown, D. M., E. Roman, and S. L. Swain. 2004. CD4 T cell responses to

influenza infection. Semin Immunol 16:171-177.

45. Bruns, K., N. Studtrucker, A. Sharma, T. Fossen, D. Mitzner, A. Eissmann,

U. Tessmer, R. Roder, P. Henklein, V. Wray, and U. Schubert. 2007.

Structural characterization and oligomerization of PB1-F2, a proapoptotic

influenza A virus protein. J Biol Chem 282:353-363.

46. Cady, S. G., and M. Sono. 1991. 1-Methyl-DL-tryptophan, beta-(3-

benzofuranyl)-DL-alanine (the oxygen analog of tryptophan), and beta-[3-

benzo(b)thienyl]-DL-alanine (the sulfur analog of tryptophan) are competitive

inhibitors for indoleamine 2,3-dioxygenase. Arch Biochem Biophys 291:326-333.

47. Carpenedo, R., A. Chiarugi, P. Russi, G. Lombardi, V. Carla, R. Pellicciari,

L. Mattoli, and F. Moroni. 1994. Inhibitors of kynurenine hydroxylase and

kynureninase increase cerebral formation of kynurenate and have sedative and

anticonvulsant activities. Neuroscience 61:237-243.

48. Catalfamo, M., T. Karpova, J. McNally, S. V. Costes, S. J. Lockett, E. Bos, P.

J. Peters, and P. A. Henkart. 2004. Human CD8+ T cells store RANTES in a

unique secretory compartment and release it rapidly after TcR stimulation.

Immunity 20:219-230.

60

49. Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid

dendritic cells activated by influenza virus and CD40L drive a potent TH1

polarization. Nat Immunol 1:305-310.

50. Centers for Disease, C. 2013. Vaccine Virus Selection for the 2012-2013

Influenza Season, Seasonal Influenza (Flu),

http://www.cdc.gov/flu/about/season/vaccine-selection.htm.

51. Centers for Disease, C. 2013. What You Should Know for the 2013-2014

Influenza Season, Seasonal Influenza (Flu),

http://www.cdc.gov/flu/about/season/flu-season-2013-2014.htm#strains.

52. Centers for Disease, C., and Prevention. 2013. Emergence of avian influenza

A(H7N9) virus causing severe human illness - China, February-April 2013.

MMWR Morb Mortal Wkly Rep 62:366-371.

53. Centers for Disease, C., and Prevention. 2012. Influenza Antiviral Drug

Resistance, http://www.cdc.gov/flu/about/qa/antiviralresistance.htm.

54. Chakrabarti, A. K., and G. Pasricha. 2013. An insight into the PB1F2 protein

and its multifunctional role in enhancing the pathogenicity of the influenza A

viruses. Virology 440:97-104.

55. Chen, B. J., G. P. Leser, D. Jackson, and R. A. Lamb. 2008. The influenza

virus M2 protein cytoplasmic tail interacts with the M1 protein and influences

virus assembly at the site of virus budding. J Virol 82:10059-10070.

56. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta,

R. O'Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W.

http://www.cdc.gov/flu/about/season/vaccine-selection.htm

http://www.cdc.gov/flu/about/season/flu-season-2013-2014.htm#strains

http://www.cdc.gov/flu/about/qa/antiviralresistance.htm

61

Yewdell. 2001. A novel influenza A virus mitochondrial protein that induces cell

death. Nat Med 7:1306-1312.

57. Chen, Y., and G. J. Guillemin. 2009. Kynurenine pathway metabolites in

humans: disease and healthy States. International journal of tryptophan research :

IJTR 2:1-19.

58. Chen, Y. B., S. D. Li, Y. P. He, X. J. Shi, Y. Chen, and J. P. Gong. 2009.

Immunosuppressive effect of IDO on T cells in patients with chronic hepatitis B*.

Hepatology research : the official journal of the Japan Society of Hepatology

39:463-468.

59. Chung, D. J., M. Rossi, E. Romano, J. Ghith, J. Yuan, D. H. Munn, and J. W.

Young. 2009. Indoleamine 2,3-dioxygenase-expressing mature human monocyte-

derived dendritic cells expand potent autologous regulatory T cells. Blood

114:555-563.

60. Collison, L. W., V. Chaturvedi, A. L. Henderson, P. R. Giacomin, C. Guy, J.

Bankoti, D. Finkelstein, K. Forbes, C. J. Workman, S. A. Brown, J. E. Rehg,

M. L. Jones, H. T. Ni, D. Artis, M. J. Turk, and D. A. Vignali. 2010. IL-35-

mediated induction of a potent regulatory T cell population. Nat Immunol

11:1093-1101.

61. Conenello, G. M., J. R. Tisoncik, E. Rosenzweig, Z. T. Varga, P. Palese, and

M. G. Katze. 2010. A Single N66S Mutation in the PB1-F2 Protein of Influenza

A Virus Increases Virulence by Inhibiting the Early Interferon Response In Vivo.

J Virol.

62

62. Conenello, G. M., D. Zamarin, L. A. Perrone, T. Tumpey, and P. Palese.

2007. A single mutation in the PB1-F2 of H5N1 (HK/97) and 1918 influenza A

viruses contributes to increased virulence. PLoS Pathog 3:1414-1421.

63. Copeland, C. S., R. W. Doms, E. M. Bolzau, R. G. Webster, and A. Helenius.

1986. Assembly of influenza hemagglutinin trimers and its role in intracellular

transport. J Cell Biol 103:1179-1191.

64. Cordero, E., T. Aydillo, M. C. Farinas, J. R. Pano-Pardo, J. Pachon, D.

Viasus, M. Riera, F. Lopez-Medrano, A. Payeras, A. Moreno, J. Rodriguez-

Bano, J. A. Oteo, J. Martinez-Montauti, J. Torre-Cisneros, F. Segura, J.

Carratala, and A. S. G. o. t. S. f. R. i. I. D. Novel Influenza. 2012.

Immunosuppressed patients with pandemic influenza A 2009 (H1N1) virus

infection. European journal of clinical microbiology & infectious diseases :

official publication of the European Society of Clinical Microbiology 31:547-556.

65. Cros, J. F., A. Garcia-Sastre, and P. Palese. 2005. An unconventional NLS is

critical for the nuclear import of the influenza A virus nucleoprotein and

ribonucleoprotein. Traffic 6:205-213.

66. Cross, K. J., W. A. Langley, R. J. Russell, J. J. Skehel, and D. A. Steinhauer.

2009. Composition and functions of the influenza fusion peptide. Protein and

peptide letters 16:766-778.

67. Crowe, S. R., S. J. Turner, S. C. Miller, A. D. Roberts, R. A. Rappolo, P. C.

Doherty, K. H. Ely, and D. L. Woodland. 2003. Differential antigen

presentation regulates the changing patterns of CD8+ T cell immunodominance in

primary and secondary influenza virus infections. J Exp Med 198:399-410.

63

68. Cui, W., and S. M. Kaech. 2010. Generation of effector CD8+ T cells and their

conversion to memory T cells. Immunol Rev 236:151-166.

69. D'Cruz, L. M., M. P. Rubinstein, and A. W. Goldrath. 2009. Surviving the

crash: transitioning from effector to memory CD8+ T cell. Semin Immunol

21:92-98.

70. Dai, X., and B. T. Zhu. 2010. Indoleamine 2,3-dioxygenase tissue distribution

and cellular localization in mice: implications for its biological functions. The

journal of histochemistry and cytochemistry : official journal of the

Histochemistry Society 58:17-28.

71. Davidson, B. L., and P. B. McCray, Jr. 2011. Current prospects for RNA

interference-based therapies. Nature reviews. Genetics 12:329-340.

72. Dawood, F. S., A. D. Iuliano, C. Reed, M. I. Meltzer, D. K. Shay, P. Y. Cheng,

D. Bandaranayake, R. F. Breiman, W. A. Brooks, P. Buchy, D. R. Feikin, K.

B. Fowler, A. Gordon, N. T. Hien, P. Horby, Q. S. Huang, M. A. Katz, A.

Krishnan, R. Lal, J. M. Montgomery, K. Molbak, R. Pebody, A. M. Presanis,

H. Razuri, A. Steens, Y. O. Tinoco, J. Wallinga, H. Yu, S. Vong, J. Bresee,

and M. A. Widdowson. 2012. Estimated global mortality associated with the first

12 months of 2009 pandemic influenza A H1N1 virus circulation: a modelling

study. Lancet Infect Dis 12:687-695.

73. De Filette, M., W. Min Jou, A. Birkett, K. Lyons, B. Schultz, A. Tonkyro, S.

Resch, and W. Fiers. 2005. Universal influenza A vaccine: optimization of M2-

based constructs. Virology 337:149-161.

64

74. Desmet, E. A., K. A. Bussey, R. Stone, and T. Takimoto. 2013. Identification

of the N-terminal domain of influenza PA responsible for the suppression of host

protein synthesis. J Virol.

75. Desvignes, L., and J. D. Ernst. 2009. Interferon-gamma-responsive

nonhematopoietic cells regulate the immune response to Mycobacterium

tuberculosis. Immunity 31:974-985.

76. Dias, A., D. Bouvier, T. Crepin, A. A. McCarthy, D. J. Hart, F. Baudin, S.

Cusack, and R. W. Ruigrok. 2009. The cap-snatching endonuclease of influenza

virus polymerase resides in the PA subunit. Nature 458:914-918.

77. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.

Innate antiviral responses by means of TLR7-mediated recognition of single-

stranded RNA. Science 303:1529-1531.

78. Doherty, P. C., D. J. Topham, and R. A. Tripp. 1996. Establishment and

persistence of virus-specific CD4+ and CD8+ T cell memory. Immunol Rev

150:23-44.

79. Domachowske, J. B., H. Pankow-Culot, M. Bautista, Y. Feng, C. Claeys, M.

Peeters, B. L. Innis, and V. Jain. 2013. A Randomized Trial of Candidate

Inactivated Quadrivalent Influenza Vaccine versus Trivalent Influenza Vaccines

in Children Aged 3-17 Years. J Infect Dis 207:1878-1887.

80. Donelan, N. R., C. F. Basler, and A. Garcia-Sastre. 2003. A recombinant

influenza A virus expressing an RNA-binding-defective NS1 protein induces high

levels of beta interferon and is attenuated in mice. J Virol 77:13257-13266.

65

81. Donnelly, R. P., F. Sheikh, S. V. Kotenko, and H. Dickensheets. 2004. The

expanded family of class II cytokines that share the IL-10 receptor-2 (IL-10R2)

chain. J Leukoc Biol 76:314-321.




34:464-472.

83. Dowdle, W. R., J. C. Downie, and W. G. Laver. 1974. Inhibition of virus

release by antibodies to surface antigens of influenza viruses. J Virol 13:269-275.

84. Drake, J. W. 1993. Rates of spontaneous mutation among RNA viruses. Proc

Natl Acad Sci U S A 90:4171-4175.

85. Ducatez, M. F., C. M. Olinger, A. A. Owoade, Z. Tarnagda, M. C. Tahita, A.

Sow, S. De Landtsheer, W. Ammerlaan, J. B. Ouedraogo, A. D. Osterhaus, R.

A. Fouchier, and C. P. Muller. 2007. Molecular and antigenic evolution and

geographical spread of H5N1 highly pathogenic avian influenza viruses in

western Africa. J Gen Virol 88:2297-2306.

86. Dudani, R., M. Russell, H. van Faassen, L. Krishnan, and S. Sad. 2008.

Mutation in the Fas pathway impairs CD8+ T cell memory. J Immunol 180:2933-

2941.

87. Dunham, R. M., S. N. Gordon, M. Vaccari, M. Piatak, Y. Huang, S. G.

Deeks, J. Lifson, G. Franchini, and J. M. McCune. 2013. Preclinical evaluation

of HIV eradication strategies in the simian immunodeficiency virus-infected

66

rhesus macaque: a pilot study testing inhibition of indoleamine 2,3-dioxygenase.

AIDS Res Hum Retroviruses 29:207-214.

88. Ebrahimi, S. M., and M. Tebianian. 2011. Influenza A viruses: why focusing

on M2e-based universal vaccines. Virus Genes 42:1-8.

89. Eichelberger, M., W. Allan, M. Zijlstra, R. Jaenisch, and P. C. Doherty.

1991. Clearance of influenza virus respiratory infection in mice lacking class I

major histocompatibility complex-restricted CD8+ T cells. J Exp Med 174:875-

880.

90. Eleftheriadis, T., V. Liakopoulos, G. Antoniadi, I. Stefanidis, and G.

Galaktidou. 2011. Indoleamine 2,3-dioxygenase is increased in hemodialysis

patients and affects immune response to hepatitis B vaccination. Vaccine

29:2242-2247.

91. Eleftheriadis, T., T. Sparopoulou, G. Antoniadi, V. Liakopoulos, I.

Stefanidis, and G. Galaktidou. 2011. Suppression of humoral immune response

to hepatitis B surface antigen vaccine in BALB/c mice by 1-methyl-tryptophan

co-administration. Daru : journal of Faculty of Pharmacy, Tehran University of

Medical Sciences 19:236-239.

92. Elton, D., M. Simpson-Holley, K. Archer, L. Medcalf, R. Hallam, J.

McCauley, and P. Digard. 2001. Interaction of the influenza virus nucleoprotein

with the cellular CRM1-mediated nuclear export pathway. J Virol 75:408-419.

93. Fallarino, F., U. Grohmann, and P. Puccetti. 2012. Indoleamine 2,3-

dioxygenase: from catalyst to signaling function. Eur J Immunol 42:1932-1937.

67




95. Fallarino, F., U. Grohmann, C. Vacca, C. Orabona, A. Spreca, M. C. Fioretti,

and P. Puccetti. 2003. T cell apoptosis by kynurenines. Adv Exp Med Biol

527:183-190.






97. Fallarino, F., C. Orabona, C. Vacca, R. Bianchi, S. Gizzi, C. Asselin-Paturel,

M. C. Fioretti, G. Trinchieri, U. Grohmann, and P. Puccetti. 2005. Ligand and

cytokine dependence of the immunosuppressive pathway of tryptophan

catabolism in plasmacytoid dendritic cells. Int Immunol 17:1429-1438.

98. Favre, D., J. Mold, P. W. Hunt, B. Kanwar, P. Loke, L. Seu, J. D. Barbour,

M. M. Lowe, A. Jayawardene, F. Aweeka, Y. Huang, D. C. Douek, J. M.

Brenchley, J. N. Martin, F. M. Hecht, S. G. Deeks, and J. M. McCune. 2010.

Tryptophan catabolism by indoleamine 2,3-dioxygenase 1 alters the balance of

TH17 to regulatory T cells in HIV disease. Sci Transl Med 2:32ra36.

99. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park,

T. Yuen, S. C. Sealfon, A. Garcia-Sastre, and T. M. Moran. 2006. Influenza

68

virus evades innate and adaptive immunity via the NS1 protein. J Virol 80:6295-

6304.

100. Fiers, W., M. De Filette, K. El Bakkouri, B. Schepens, K. Roose, M.

Schotsaert, A. Birkett, and X. Saelens. 2009. M2e-based universal influenza A

vaccine. Vaccine 27:6280-6283.

101. Fiore, A. E., C. B. Bridges, and N. J. Cox. 2009. Seasonal influenza vaccines.

Curr Top Microbiol Immunol 333:43-82.





Rep 59:1-62.

103. Fox, J. M., L. K. Sage, L. Huang, J. Barber, K. D. Klonowski, A. L. Mellor,

M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2, 3-

dioxygenase (IDO) enhances the T cell response to influenza virus infection. J

Gen Virol.

104. Franca, M., D. E. Stallknecht, and E. W. Howerth. 2013. Expression and

distribution of sialic acid influenza virus receptors in wild birds. Avian pathology

: journal of the W.V.P.A 42:60-71.

105. Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and G. B.

Ferrara. 2002. Tryptophan-derived catabolites are responsible for inhibition of T

and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J

Exp Med 196:459-468.

69

106. Fujigaki, S., M. Takemura, H. Hamakawa, M. Seishima, and K. Saito. 2003.

The mechanism of interferon-gamma induced anti Toxoplasma gondii by

indoleamine 2,3-dioxygenase and/or inducible nitric oxide synthase vary among

tissues. Adv Exp Med Biol 527:97-103.

107. Fujimoto, M., M. Nakano, F. Terabe, H. Kawahata, T. Ohkawara, Y. Han, B.

Ripley, S. Serada, T. Nishikawa, A. Kimura, S. Nomura, T. Kishimoto, and

T. Naka. 2011. The influence of excessive IL-6 production in vivo on the

development and function of Foxp3+ regulatory T cells. J Immunol 186:32-40.

108. Fukunaga, M., Y. Yamamoto, M. Kawasoe, Y. Arioka, Y. Murakami, M.

Hoshi, and K. Saito. 2012. Studies on tissue and cellular distribution of

indoleamine 2,3-dioxygenase 2: the absence of IDO1 upregulates IDO2

expression in the epididymis. The journal of histochemistry and cytochemistry :

official journal of the Histochemistry Society 60:854-860.

109. Gabriel, G., A. Herwig, and H. D. Klenk. 2008. Interaction of polymerase

subunit PB2 and NP with importin alpha1 is a determinant of host range of

influenza A virus. PLoS Pathog 4:e11.

110. Gack, M. U., R. A. Albrecht, T. Urano, K. S. Inn, I. C. Huang, E. Carnero,

M. Farzan, S. Inoue, J. U. Jung, and A. Garcia-Sastre. 2009. Influenza A virus

NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral

RNA sensor RIG-I. Cell Host Microbe 5:439-449.

111. Gack, M. U., Y. C. Shin, C. H. Joo, T. Urano, C. Liang, L. Sun, O. Takeuchi,

S. Akira, Z. Chen, S. Inoue, and J. U. Jung. 2007. TRIM25 RING-finger E3

70

ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446:916-

920.

112. Galarza, J. M., Q. Peng, L. Shi, and D. F. Summers. 1996. Influenza A virus

RNA-dependent RNA polymerase: analysis of RNA synthesis in vitro. J Virol

70:2360-2368.

113. Gambotto, A., S. M. Barratt-Boyes, M. D. de Jong, G. Neumann, and Y.

Kawaoka. 2008. Human infection with highly pathogenic H5N1 influenza virus.

Lancet 371:1464-1475.

114. Gangneux, J. P., Y. Poinsignon, L. Donaghy, L. Amiot, K. Tarte, C. Mary,

and F. Robert-Gangneux. 2013. Indoleamine 2,3-dioxygenase activity as a

potential biomarker of immune suppression during visceral leishmaniasis. Innate

immunity.

115. Garten, R. J., C. T. Davis, C. A. Russell, B. Shu, S. Lindstrom, A. Balish, W.

M. Sessions, X. Xu, E. Skepner, V. Deyde, M. Okomo-Adhiambo, L.

Gubareva, J. Barnes, C. B. Smith, S. L. Emery, M. J. Hillman, P. Rivailler, J.

Smagala, M. de Graaf, D. F. Burke, R. A. Fouchier, C. Pappas, C. M.

Alpuche-Aranda, H. Lopez-Gatell, H. Olivera, I. Lopez, C. A. Myers, D.

Faix, P. J. Blair, C. Yu, K. M. Keene, P. D. Dotson, Jr., D. Boxrud, A. R.

Sambol, S. H. Abid, K. St George, T. Bannerman, A. L. Moore, D. J.

Stringer, P. Blevins, G. J. Demmler-Harrison, M. Ginsberg, P. Kriner, S.

Waterman, S. Smole, H. F. Guevara, E. A. Belongia, P. A. Clark, S. T.

Beatrice, R. Donis, J. Katz, L. Finelli, C. B. Bridges, M. Shaw, D. B.

Jernigan, T. M. Uyeki, D. J. Smith, A. I. Klimov, and N. J. Cox. 2009.

71

Antigenic and genetic characteristics of swine-origin 2009 A(H1N1) influenza

viruses circulating in humans. Science 325:197-201.

116. Ge, X., V. Tan, P. L. Bollyky, N. E. Standifer, E. A. James, and W. W. Kwok.

2010. Assessment of seasonal influenza A virus-specific CD4 T-cell responses to

2009 pandemic H1N1 swine-origin influenza A virus. J Virol 84:3312-3319.

117. Goldstein, L. E., M. C. Leopold, X. Huang, C. S. Atwood, A. J. Saunders, M.

Hartshorn, J. T. Lim, K. Y. Faget, J. A. Muffat, R. C. Scarpa, L. T. Chylack,

Jr., E. F. Bowden, R. E. Tanzi, and A. I. Bush. 2000. 3-Hydroxykynurenine and

3-hydroxyanthranilic acid generate hydrogen peroxide and promote alpha-

crystallin cross-linking by metal ion reduction. Biochemistry 39:7266-7275.

118. Gomez-Puertas, P., C. Albo, E. Perez-Pastrana, A. Vivo, and A. Portela.

2000. Influenza virus matrix protein is the major driving force in virus budding. J

Virol 74:11538-11547.

119. Goto, H., and Y. Kawaoka. 1998. A novel mechanism for the acquisition of

virulence by a human influenza A virus. Proc Natl Acad Sci U S A 95:10224-

10228.

120. Grienke, U., M. Schmidtke, S. von Grafenstein, J. Kirchmair, K. R. Liedl,

and J. M. Rollinger. 2012. Influenza neuraminidase: a druggable target for

natural products. Nat Prod Rep 29:11-36.

121. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni,

P. Candeloro, M. L. Belladonna, R. Bianchi, M. C. Fioretti, and P. Puccetti.

2002. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat Immunol 3:1097-

1101.

72

122. Guillemin, G. J., B. J. Brew, C. E. Noonan, O. Takikawa, and K. M. Cullen.

2005. Indoleamine 2,3 dioxygenase and quinolinic acid immunoreactivity in

Alzheimer's disease hippocampus. Neuropathology and applied neurobiology

31:395-404.

123. Guillemin, G. J., G. Smythe, O. Takikawa, and B. J. Brew. 2005. Expression

of indoleamine 2,3-dioxygenase and production of quinolinic acid by human

microglia, astrocytes, and neurons. Glia 49:15-23.

124. Guilligay, D., F. Tarendeau, P. Resa-Infante, R. Coloma, T. Crepin, P. Sehr,

J. Lewis, R. W. Ruigrok, J. Ortin, D. J. Hart, and S. Cusack. 2008. The

structural basis for cap binding by influenza virus polymerase subunit PB2.

Nature structural & molecular biology 15:500-506.





3335.

126. Gupta, R. K., R. George, and J. S. Nguyen-Van-Tam. 2008. Bacterial

pneumonia and pandemic influenza planning. Emerg Infect Dis 14:1187-1192.

127. Gupta, S. L., J. M. Carlin, P. Pyati, W. Dai, E. R. Pfefferkorn, and M. J.

Murphy, Jr. 1994. Antiparasitic and antiproliferative effects of indoleamine 2,3-

dioxygenase enzyme expression in human fibroblasts. Infect Immun 62:2277-

2284.

73

128. Hage, C. A., D. J. Horan, M. Durkin, P. Connolly, Z. Desta, T. C. Skaar, K.

S. Knox, and L. J. Wheat. 2013. Histoplasma capsulatum preferentially induces

IDO in the lung. Medical mycology : official publication of the International

Society for Human and Animal Mycology 51:270-279.

129. Hale, B. G., R. A. Albrecht, and A. Garcia-Sastre. 2010. Innate immune

evasion strategies of influenza viruses. Future Microbiol 5:23-41.

130. Hale, B. G., D. Jackson, Y. H. Chen, R. A. Lamb, and R. E. Randall. 2006.

Influenza A virus NS1 protein binds p85beta and activates phosphatidylinositol-3-

kinase signaling. Proc Natl Acad Sci U S A 103:14194-14199.

131. Hale, B. G., R. E. Randall, J. Ortin, and D. Jackson. 2008. The multifunctional

NS1 protein of influenza A viruses. J Gen Virol 89:2359-2376.

132. Hamada, H., E. Bassity, A. Flies, T. M. Strutt, L. Garcia-Hernandez Mde, K.

K. McKinstry, T. Zou, S. L. Swain, and R. W. Dutton. 2013. Multiple

redundant effector mechanisms of CD8+ T cells protect against influenza

infection. J Immunol 190:296-306.

133. Hamming, O. J., H. H. Gad, S. Paludan, and R. Hartmann. 2010. Lambda

Interferons: New cytokines with Old Functions. Pharmaceuticals 3:795-809.

134. Harper, S. A., K. Fukuda, N. J. Cox, and C. B. Bridges. 2003. Using live,

attenuated influenza vaccine for prevention and control of influenza:

supplemental recommendations of the Advisory Committee on Immunization

Practices (ACIP). MMWR Recomm Rep 52:1-8.

74

135. Harris, A., G. Cardone, D. C. Winkler, J. B. Heymann, M. Brecher, J. M.

White, and A. C. Steven. 2006. Influenza virus pleiomorphy characterized by

cryoelectron tomography. Proc Natl Acad Sci U S A 103:19123-19127.

136. Hatta, M., and Y. Kawaoka. 2003. The NB protein of influenza B virus is not

necessary for virus replication in vitro. J Virol 77:6050-6054.

137. Hay, A. J., B. Lomniczi, A. R. Bellamy, and J. J. Skehel. 1977. Transcription

of the influenza virus genome. Virology 83:337-355.

138. Hayaishi, O., and R. Yoshida. 1978. Specific induction of pulmonary

indoleamine 2,3-dioxygenase by bacterial lipopolysaccharide. Ciba Foundation

symposium:199-203.

139. Hayashi, T., J. H. Mo, X. Gong, C. Rossetto, A. Jang, L. Beck, G. I. Elliott, I.

Kufareva, R. Abagyan, D. H. Broide, J. Lee, and E. Raz. 2007. 3-

Hydroxyanthranilic acid inhibits PDK1 activation and suppresses experimental

asthma by inducing T cell apoptosis. Proc Natl Acad Sci U S A 104:18619-

18624.

140. He, X. S., T. H. Holmes, C. Zhang, K. Mahmood, G. W. Kemble, D. B. Lewis,

C. L. Dekker, H. B. Greenberg, and A. M. Arvin. 2006. Cellular immune

responses in children and adults receiving inactivated or live attenuated influenza

vaccines. J Virol 80:11756-11766.

141. Heller, M. C., C. P. Drew, K. A. Jackson, S. Griffey, and J. L. Watson. 2010.

A potential role for indoleamine 2,3-dioxygenase (IDO) in Rhodococcus equi

infection. Vet Immunol Immunopathol 138:174-182.

75

142. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T.

Horiuchi, H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral

compounds activate immune cells via the TLR7 MyD88-dependent signaling

pathway. Nat Immunol 3:196-200.

143. Herrler, G., I. Durkop, H. Becht, and H. D. Klenk. 1988. The glycoprotein of

influenza C virus is the haemagglutinin, esterase and fusion factor. J Gen Virol 69

( Pt 4):839-846.

144. Hewitt, E. W. 2003. The MHC class I antigen presentation pathway: strategies

for viral immune evasion. Immunology 110:163-169.

145. Hirata, F., and O. Hayaishi. 1975. Studies on indoleamine 2,3-dioxygenase. I.

Superoxide anion as substrate. J Biol Chem 250:5960-5966.

146. Horvath, C. M. 2004. The Jak-STAT pathway stimulated by interferon alpha or

interferon beta. Science's STKE : signal transduction knowledge environment

2004:tr10.

147. Hoshi, M., K. Matsumoto, H. Ito, H. Ohtaki, Y. Arioka, Y. Osawa, Y.

Yamamoto, H. Matsunami, A. Hara, M. Seishima, and K. Saito. 2012. L-

tryptophan-kynurenine pathway metabolites regulate type I IFNs of acute viral

myocarditis in mice. J Immunol 188:3980-3987.

148. Hou, D. Y., A. J. Muller, M. D. Sharma, J. DuHadaway, T. Banerjee, M.

Johnson, A. L. Mellor, G. C. Prendergast, and D. H. Munn. 2007. Inhibition

of indoleamine 2,3-dioxygenase in dendritic cells by stereoisomers of 1-methyl-

tryptophan correlates with antitumor responses. Cancer Res 67:792-801.

76

149. Hrincius, E. R., R. Dierkes, D. Anhlan, V. Wixler, S. Ludwig, and C.

Ehrhardt. 2011. Phosphatidylinositol-3-kinase (PI3K) is activated by influenza

virus vRNA via the pathogen pattern receptor Rig-I to promote efficient type I

interferon production. Cell Microbiol 13:1907-1919.

150. Huang, S., J. Chen, Q. Chen, H. Wang, Y. Yao, J. Chen, and Z. Chen. 2013.

A second CRM1-dependent nuclear export signal in the influenza A virus NS2

protein contributes to the nuclear export of viral ribonucleoproteins. J Virol

87:767-778.

151. Huttunen, R., J. Syrjanen, J. Aittoniemi, S. S. Oja, A. Raitala, J. Laine, M.

Pertovaara, R. Vuento, H. Huhtala, and M. Hurme. 2010. High activity of

indoleamine 2,3 dioxygenase enzyme predicts disease severity and case fatality in

bacteremic patients. Shock 33:149-154.

152. Ichinohe, T., I. K. Pang, and A. Iwasaki. 2010. Influenza virus activates

inflammasomes via its intracellular M2 ion channel. Nat Immunol 11:404-410.

153. Ito, T., J. N. Couceiro, S. Kelm, L. G. Baum, S. Krauss, M. R. Castrucci, I.

Donatelli, H. Kida, J. C. Paulson, R. G. Webster, and Y. Kawaoka. 1998.

Molecular basis for the generation in pigs of influenza A viruses with pandemic

potential. J Virol 72:7367-7373.

154. Ivanov, II, B. S. McKenzie, L. Zhou, C. E. Tadokoro, A. Lepelley, J. J.

Lafaille, D. J. Cua, and D. R. Littman. 2006. The orphan nuclear receptor

RORgammat directs the differentiation program of proinflammatory IL-17+ T

helper cells. Cell 126:1121-1133.

77

155. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive

immune responses. Nat Immunol 5:987-995.

156. Iwatsuki-Horimoto, K., T. Horimoto, T. Noda, M. Kiso, J. Maeda, S.

Watanabe, Y. Muramoto, K. Fujii, and Y. Kawaoka. 2006. The cytoplasmic

tail of the influenza A virus M2 protein plays a role in viral assembly. J Virol

80:5233-5240.

157. Janssen, E. M., E. E. Lemmens, T. Wolfe, U. Christen, M. G. von Herrath,

and S. P. Schoenberger. 2003. CD4+ T cells are required for secondary

expansion and memory in CD8+ T lymphocytes. Nature 421:852-856.

158. Jegerlehner, A., N. Schmitz, T. Storni, and M. F. Bachmann. 2004. Influenza

A vaccine based on the extracellular domain of M2: weak protection mediated via

antibody-dependent NK cell activity. J Immunol 172:5598-5605.

159. Jewell, N. A., T. Cline, S. E. Mertz, S. V. Smirnov, E. Flano, C. Schindler, J.

L. Grieves, R. K. Durbin, S. V. Kotenko, and J. E. Durbin. 2010. Lambda

interferon is the predominant interferon induced by influenza A virus infection in

vivo. J Virol 84:11515-11522.





161. Johnson, N. P., and J. Mueller. 2002. Updating the accounts: global mortality of

the 1918-1920 "Spanish" influenza pandemic. Bull Hist Med 76:105-115.

78

162. Joshi, N. S., W. Cui, A. Chandele, H. K. Lee, D. R. Urso, J. Hagman, L.

Gapin, and S. M. Kaech. 2007. Inflammation directs memory precursor and

short-lived effector CD8(+) T cell fates via the graded expression of T-bet

transcription factor. Immunity 27:281-295.

163. Julkunen, I., K. Melen, M. Nyqvist, J. Pirhonen, T. Sareneva, and S.

Matikainen. 2000. Inflammatory responses in influenza A virus infection.

Vaccine 19 Suppl 1:S32-37.

164. Julkunen, I., T. Sareneva, J. Pirhonen, T. Ronni, K. Melen, and S.

Matikainen. 2001. Molecular pathogenesis of influenza A virus infection and

virus-induced regulation of cytokine gene expression. Cytokine Growth Factor

Rev 12:171-180.

165. Kaech, S. M., and W. Cui. 2012. Transcriptional control of effector and memory

CD8+ T cell differentiation. Nat Rev Immunol 12:749-761.

166. Kawai, T., and S. Akira. 2006. Innate immune recognition of viral infection. Nat

Immunol 7:131-137.

167. Kawaoka, Y., S. Krauss, and R. G. Webster. 1989. Avian-to-human

transmission of the PB1 gene of influenza A viruses in the 1957 and 1968

pandemics. J Virol 63:4603-4608.

168. Kawaoka, Y., and R. G. Webster. 1988. Sequence requirements for cleavage

activation of influenza virus hemagglutinin expressed in mammalian cells. Proc


169. Keawcharoen, J., J. van den Broek, A. Bouma, T. Tiensin, A. D. Osterhaus,

and H. Heesterbeek. 2011. Wild birds and increased transmission of highly

79

pathogenic avian influenza (H5N1) among poultry, Thailand. Emerg Infect Dis

17:1016-1022.

170. Kilbourne, E. D. 2006. Influenza pandemics of the 20th century. Emerg Infect

Dis 12:9-14.

171. Kim, H. R., Y. J. Lee, C. K. Park, J. K. Oem, O. S. Lee, H. M. Kang, J. G.

Choi, and Y. C. Bae. 2012. Highly pathogenic avian influenza (H5N1) outbreaks

in wild birds and poultry, South Korea. Emerg Infect Dis 18:480-483.

172. Kindt, T. J., R. A. Goldsby, B. A. Osborne, and J. Kuby. 2007. Kuby

immunology, 6th ed. W.H. Freeman, New York.

173. Knubel, C. P., F. F. Martinez, R. E. Fretes, C. Diaz Lujan, M. G. Theumer,

L. Cervi, and C. C. Motran. 2010. Indoleamine 2,3-dioxigenase (IDO) is critical

for host resistance against Trypanosoma cruzi. FASEB J 24:2689-2701.

174. Kobayashi, M., T. Toyoda, and A. Ishihama. 1996. Influenza virus PB1 protein

is the minimal and essential subunit of RNA polymerase. Arch Virol 141:525-

539.

175. Koopmans, M., B. Wilbrink, M. Conyn, G. Natrop, H. van der Nat, H.

Vennema, A. Meijer, J. van Steenbergen, R. Fouchier, A. Osterhaus, and A.

Bosman. 2004. Transmission of H7N7 avian influenza A virus to human beings

during a large outbreak in commercial poultry farms in the Netherlands. Lancet

363:587-593.

176. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen, N. K.

Shah, J. A. Langer, F. Sheikh, H. Dickensheets, and R. P. Donnelly. 2003.

80

IFN-lambdas mediate antiviral protection through a distinct class II cytokine

receptor complex. Nat Immunol 4:69-77.

177. Krumbholz, A., A. Philipps, H. Oehring, K. Schwarzer, A. Eitner, P.

Wutzler, and R. Zell. 2011. Current knowledge on PB1-F2 of influenza A

viruses. Med Microbiol Immunol 200:69-75.

178. La Gruta, N. L., W. T. Rothwell, T. Cukalac, N. G. Swan, S. A. Valkenburg,

K. Kedzierska, P. G. Thomas, P. C. Doherty, and S. J. Turner. 2010. Primary

CTL response magnitude in mice is determined by the extent of naive T cell

recruitment and subsequent clonal expansion. J Clin Invest 120:1885-1894.

179. Lafferty, E. I., S. T. Qureshi, and M. Schnare. 2010. The role of toll-like

receptors in acute and chronic lung inflammation. Journal of inflammation 7:57.

180. Lamb, R. A., and P. W. Choppin. 1983. The gene structure and replication of

influenza virus. Annu Rev Biochem 52:467-506.

181. Larrea, E., J. I. Riezu-Boj, L. Gil-Guerrero, N. Casares, R. Aldabe, P.

Sarobe, M. P. Civeira, J. L. Heeney, C. Rollier, B. Verstrepen, T. Wakita, F.

Borras-Cuesta, J. J. Lasarte, and J. Prieto. 2007. Upregulation of indoleamine

2,3-dioxygenase in hepatitis C virus infection. J Virol 81:3662-3666.

182. Larsson, M., E. M. Shankar, K. F. Che, A. Saeidi, R. Ellegard, M. Barathan,

V. Velu, and A. Kamarulzaman. 2013. Molecular signatures of T-cell inhibition

in HIV-1 infection. Retrovirology 10:31.

183. Latz, E. 2010. The inflammasomes: mechanisms of activation and function. Curr

Opin Immunol 22:28-33.

81

184. Le Goffic, R., J. Pothlichet, D. Vitour, T. Fujita, E. Meurs, M. Chignard, and

M. Si-Tahar. 2007. Cutting Edge: Influenza A virus activates TLR3-dependent

inflammatory and RIG-I-dependent antiviral responses in human lung epithelial

cells. J Immunol 178:3368-3372.

185. Lee, B. O., J. Moyron-Quiroz, J. Rangel-Moreno, K. L. Kusser, L. Hartson,

F. Sprague, F. E. Lund, and T. D. Randall. 2003. CD40, but not CD154,

expression on B cells is necessary for optimal primary B cell responses. J

Immunol 171:5707-5717.

186. Lee, G. K., H. J. Park, M. Macleod, P. Chandler, D. H. Munn, and A. L.

Mellor. 2002. Tryptophan deprivation sensitizes activated T cells to apoptosis

prior to cell division. Immunology 107:452-460.

187. Lefrancois, L., and J. J. Obar. 2010. Once a killer, always a killer: from

cytotoxic T cell to memory cell. Immunol Rev 235:206-218.

188. Liu, X., N. Shin, H. K. Koblish, G. Yang, Q. Wang, K. Wang, L. Leffet, M. J.

Hansbury, B. Thomas, M. Rupar, P. Waeltz, K. J. Bowman, P. Polam, R. B.

Sparks, E. W. Yue, Y. Li, R. Wynn, J. S. Fridman, T. C. Burn, A. P. Combs,

R. C. Newton, and P. A. Scherle. 2010. Selective inhibition of IDO1 effectively

regulates mediators of antitumor immunity. Blood 115:3520-3530.

189. Londhe, V., N. McNamara, H. Lemjabbar, and C. Basbaum. 2003. Viral

dsRNA activates mucin transcription in airway epithelial cells. FEBS letters

553:33-38.

190. Londrigan, S. L., S. G. Turville, M. D. Tate, Y. M. Deng, A. G. Brooks, and

P. C. Reading. 2011. N-linked glycosylation facilitates sialic acid-independent

82

attachment and entry of influenza A viruses into cells expressing DC-SIGN or L-

SIGN. J Virol 85:2990-3000.

191. Loo, Y. M., J. Fornek, N. Crochet, G. Bajwa, O. Perwitasari, L. Martinez-

Sobrido, S. Akira, M. A. Gill, A. Garcia-Sastre, M. G. Katze, and M. Gale,

Jr. 2008. Distinct RIG-I and MDA5 signaling by RNA viruses in innate

immunity. J Virol 82:335-345.

192. Loughman, J. A., and D. A. Hunstad. 2012. Induction of indoleamine 2,3-

dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial

infection. J Infect Dis 205:1830-1839.

193. Louria, D. B., H. L. Blumenfeld, J. T. Ellis, E. D. Kilbourne, and D. E.

Rogers. 1959. Studies on influenza in the pandemic of 1957-1958. II. Pulmonary

complications of influenza. J Clin Invest 38:213-265.

194. MA, O. C., and W. R. Green. 2013. The role of indoleamine 2,3-dioxygenase in

LP-BPM5 murine retroviral disease progression. Virol J 10:154.

195. Makala, L. H. 2012. The Role of Indoleamine 2, 3 Dioxygenase in Regulating

Host Immunity to Leishmania Infection. J Biomed Sci 19:5.

196. Makala, L. H., B. Baban, H. Lemos, A. R. El-Awady, P. R. Chandler, D. Y.

Hou, D. H. Munn, and A. L. Mellor. 2011. Leishmania major attenuates host

immunity by stimulating local indoleamine 2,3-dioxygenase expression. J Infect

Dis 203:715-725.

197. Mallia, P., and S. L. Johnston. 2007. Influenza infection and COPD.

International journal of chronic obstructive pulmonary disease 2:55-64.

83

198. Manicassamy, B., R. A. Medina, R. Hai, T. Tsibane, S. Stertz, E. Nistal-

Villan, P. Palese, C. F. Basler, and A. Garcia-Sastre. 2010. Protection of mice

against lethal challenge with 2009 H1N1 influenza A virus by 1918-like and

classical swine H1N1 based vaccines. PLoS Pathog 6:e1000745.

199. Mao, R., J. Zhang, D. Jiang, D. Cai, J. M. Levy, A. Cuconati, T. M. Block, J.

T. Guo, and H. Guo. 2011. Indoleamine 2,3-dioxygenase mediates the antiviral

effect of gamma interferon against hepatitis B virus in human hepatocyte-derived

cells. J Virol 85:1048-1057.

200. Marshall, N. B., and S. L. Swain. 2011. Cytotoxic CD4 T cells in antiviral

immunity. J Biomed Biotechnol 2011:954602.

201. Martin, K., and A. Helenius. 1991. Nuclear transport of influenza virus

ribonucleoproteins: the viral matrix protein (M1) promotes export and inhibits

import. Cell 67:117-130.

202. Masopust, D., V. Vezys, E. J. Usherwood, L. S. Cauley, S. Olson, A. L.

Marzo, R. L. Ward, D. L. Woodland, and L. Lefrancois. 2004. Activated

primary and memory CD8 T cells migrate to nonlymphoid tissues regardless of

site of activation or tissue of origin. J Immunol 172:4875-4882.

203. Matheu, M. P., J. R. Teijaro, K. B. Walsh, M. L. Greenberg, D. Marsolais, I.

Parker, H. Rosen, M. B. Oldstone, and M. D. Cahalan. 2013. Three phases of

CD8 T cell response in the lung following H1N1 influenza infection and

sphingosine 1 phosphate agonist therapy. PLoS One 8:e58033.

84

204. Matrosovich, M. N., T. Y. Matrosovich, T. Gray, N. A. Roberts, and H. D.

Klenk. 2004. Human and avian influenza viruses target different cell types in

cultures of human airway epithelium. Proc Natl Acad Sci U S A 101:4620-4624.

205. Matrosovich, M. N., T. Y. Matrosovich, T. Gray, N. A. Roberts, and H. D.

Klenk. 2004. Neuraminidase is important for the initiation of influenza virus

infection in human airway epithelium. J Virol 78:12665-12667.

206. Matta, B. M., A. Castellaneta, and A. W. Thomson. 2010. Tolerogenic

plasmacytoid DC. Eur J Immunol 40:2667-2676.

207. McAuley, J. L., F. Hornung, K. L. Boyd, A. M. Smith, R. McKeon, J.

Bennink, J. W. Yewdell, and J. A. McCullers. 2007. Expression of the 1918

influenza A virus PB1-F2 enhances the pathogenesis of viral and secondary

bacterial pneumonia. Cell Host Microbe 2:240-249.

208. McCown, M. F., and A. Pekosz. 2006. Distinct domains of the influenza a virus

M2 protein cytoplasmic tail mediate binding to the M1 protein and facilitate

infectious virus production. J Virol 80:8178-8189.

209. McGill, J., J. W. Heusel, and K. L. Legge. 2009. Innate immune control and

regulation of influenza virus infections. J Leukoc Biol 86:803-812.

210. McGill, J., N. Van Rooijen, and K. L. Legge. 2008. Protective influenza-

specific CD8 T cell responses require interactions with dendritic cells in the

lungs. J Exp Med 205:1635-1646.

211. Mehra, S., X. Alvarez, P. J. Didier, L. A. Doyle, J. L. Blanchard, A. A.

Lackner, and D. Kaushal. 2013. Granuloma correlates of protection against

85

tuberculosis and mechanisms of immune modulation by Mycobacterium

tuberculosis. J Infect Dis 207:1115-1127.

212. Meininger, D., L. Zalameda, Y. Liu, L. P. Stepan, L. Borges, J. D. McCarter,

and C. L. Sutherland. 2011. Purification and kinetic characterization of human

indoleamine 2,3-dioxygenases 1 and 2 (IDO1 and IDO2) and discovery of

selective IDO1 inhibitors. Biochim Biophys Acta 1814:1947-1954.

213. Mendel, D. B., C. Y. Tai, P. A. Escarpe, W. Li, R. W. Sidwell, J. H. Huffman,

C. Sweet, K. J. Jakeman, J. Merson, S. A. Lacy, W. Lew, M. A. Williams, L.

Zhang, M. S. Chen, N. Bischofberger, and C. U. Kim. 1998. Oral

administration of a prodrug of the influenza virus neuraminidase inhibitor GS

4071 protects mice and ferrets against influenza infection. Antimicrob Agents

Chemother 42:640-646.

214. Metz, R., J. B. Duhadaway, U. Kamasani, L. Laury-Kleintop, A. J. Muller,

and G. C. Prendergast. 2007. Novel tryptophan catabolic enzyme IDO2 is the

preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase

inhibitory compound D-1-methyl-tryptophan. Cancer Res 67:7082-7087.

215. Mezrich, J. D., J. H. Fechner, X. Zhang, B. P. Johnson, W. J. Burlingham,

and C. A. Bradfield. 2010. An interaction between kynurenine and the aryl

hydrocarbon receptor can generate regulatory T cells. J Immunol 185:3190-3198.

216. Min, J. Y., and R. M. Krug. 2006. The primary function of RNA binding by the

influenza A virus NS1 protein in infected cells: Inhibiting the 2'-5' oligo (A)

synthetase/RNase L pathway. Proc Natl Acad Sci U S A 103:7100-7105.

86

217. Mordstein, M., G. Kochs, L. Dumoutier, J. C. Renauld, S. R. Paludan, K.

Klucher, and P. Staeheli. 2008. Interferon-lambda contributes to innate

immunity of mice against influenza A virus but not against hepatotropic viruses.

PLoS Pathog 4:e1000151.

218. Morens, D. M., J. K. Taubenberger, and A. S. Fauci. 2008. Predominant role

of bacterial pneumonia as a cause of death in pandemic influenza: implications for

pandemic influenza preparedness. J Infect Dis 198:962-970.

219. Morita, T., K. Saito, M. Takemura, N. Maekawa, S. Fujigaki, H. Fujii, H.

Wada, S. Takeuchi, A. Noma, and M. Seishima. 2001. 3-Hydroxyanthranilic

acid, an L-tryptophan metabolite, induces apoptosis in monocyte-derived cells

stimulated by interferon-gamma. Annals of clinical biochemistry 38:242-251.

220. Moroni, F., P. Russi, G. Lombardi, M. Beni, and V. Carla. 1988. Presence of

kynurenic acid in the mammalian brain. J Neurochem 51:177-180.

221. Mould, J. A., R. G. Paterson, M. Takeda, Y. Ohigashi, P. Venkataraman, R.

A. Lamb, and L. H. Pinto. 2003. Influenza B virus BM2 protein has ion channel

activity that conducts protons across membranes. Developmental cell 5:175-184.

222. Mount, A. M., and G. T. Belz. 2010. Mouse models of viral infection: influenza

infection in the lung. Methods Mol Biol 595:299-318.

223. Mozdzanowska, K., M. Furchner, K. Maiese, and W. Gerhard. 1997. CD4+ T

cells are ineffective in clearing a pulmonary infection with influenza type A virus

in the absence of B cells. Virology 239:217-225.

87







642.

226. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B.

Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal

rejection by tryptophan catabolism. Science 281:1191-1193.

227. Murakami, Y., M. Hoshi, A. Hara, M. Takemura, Y. Arioka, Y. Yamamoto,

H. Matsunami, T. Funato, M. Seishima, and K. Saito. 2012. Inhibition of

increased indoleamine 2,3-dioxygenase activity attenuates Toxoplasma gondii

replication in the lung during acute infection. Cytokine 59:245-251.

228. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. Sourdive, A. J. Zajac, J.

D. Miller, J. Slansky, and R. Ahmed. 1998. Counting antigen-specific CD8 T

cells: a reevaluation of bystander activation during viral infection. Immunity

8:177-187.

229. Nakagawa, Y., K. Oda, and S. Nakada. 1996. The PB1 subunit alone can

catalyze cRNA synthesis, and the PA subunit in addition to the PB1 subunit is

required for viral RNA synthesis in replication of the influenza virus genome. J

Virol 70:6390-6394.

88

230. Nayak, D. P., R. A. Balogun, H. Yamada, Z. H. Zhou, and S. Barman. 2009.

Influenza virus morphogenesis and budding. Virus Res 143:147-161.

231. Neirynck, S., T. Deroo, X. Saelens, P. Vanlandschoot, W. M. Jou, and W.

Fiers. 1999. A universal influenza A vaccine based on the extracellular domain of

the M2 protein. Nat Med 5:1157-1163.

232. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998.

Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF

and inhibits 3'end formation of cellular pre-mRNAs. Mol Cell 1:991-1000.

233. Newcomb, L. L., R. L. Kuo, Q. Ye, Y. Jiang, Y. J. Tao, and R. M. Krug. 2009.

Interaction of the influenza a virus nucleocapsid protein with the viral RNA

polymerase potentiates unprimed viral RNA replication. J Virol 83:29-36.

234. Nguyen, H. T., A. M. Fry, and L. V. Gubareva. 2012. Neuraminidase inhibitor

resistance in influenza viruses and laboratory testing methods. Antiviral therapy

17:159-173.

235. Nilsson, L. K., K. R. Linderholm, G. Engberg, L. Paulson, K. Blennow, L. H.

Lindstrom, C. Nordin, A. Karanti, P. Persson, and S. Erhardt. 2005. Elevated

levels of kynurenic acid in the cerebrospinal fluid of male patients with

schizophrenia. Schizophrenia research 80:315-322.

236. O'Neill, R. E., R. Jaskunas, G. Blobel, P. Palese, and J. Moroianu. 1995.

Nuclear import of influenza virus RNA can be mediated by viral nucleoprotein

and transport factors required for protein import. J Biol Chem 270:22701-22704.

89

237. O'Neill, R. E., J. Talon, and P. Palese. 1998. The influenza virus NEP (NS2

protein) mediates the nuclear export of viral ribonucleoproteins. EMBO J 17:288-

296.

238. O’Connell, P. M. 2013. FDA approves new quadrivalent influenza vaccine. AAP

News.

239. Obar, J. J., and L. Lefrancois. 2010. Early signals during CD8 T cell priming

regulate the generation of central memory cells. J Immunol 185:263-272.

240. Onoguchi, K., M. Yoneyama, A. Takemura, S. Akira, T. Taniguchi, H.

Namiki, and T. Fujita. 2007. Viral infections activate types I and III interferon

genes through a common mechanism. J Biol Chem 282:7576-7581.

241. Orabona, C., M. L. Belladonna, C. Vacca, R. Bianchi, F. Fallarino, C. Volpi,

S. Gizzi, M. C. Fioretti, U. Grohmann, and P. Puccetti. 2005. Cutting edge:

silencing suppressor of cytokine signaling 3 expression in dendritic cells turns

CD28-Ig from immune adjuvant to suppressant. J Immunol 174:6582-6586.

242. Orabona, C., M. T. Pallotta, C. Volpi, F. Fallarino, C. Vacca, R. Bianchi, M.

L. Belladonna, M. C. Fioretti, U. Grohmann, and P. Puccetti. 2008. SOCS3

drives proteasomal degradation of indoleamine 2,3-dioxygenase (IDO) and

antagonizes IDO-dependent tolerogenesis. Proc Natl Acad Sci U S A 105:20828-

20833.

243. Oshansky, C. M., J. A. Pickens, K. C. Bradley, L. P. Jones, G. M. Saavedra-

Ebner, J. P. Barber, J. M. Crabtree, D. A. Steinhauer, S. M. Tompkins, and

R. A. Tripp. 2011. Avian influenza viruses infect primary human bronchial

90

epithelial cells unconstrained by sialic acid alpha2,3 residues. PLoS One

6:e21183.

244. Palese, P., and R. W. Compans. 1976. Inhibition of influenza virus replication in

tissue culture by 2-deoxy-2,3-dehydro-N-trifluoroacetylneuraminic acid (FANA):

mechanism of action. J Gen Virol 33:159-163.

245. Palese, P., and M. L. Shaw. 2007. Orthomyxoviridae: The Viruses and Their

Replication, p. 1647-1689. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.),

Fields' virology, 5th ed, vol. 2. Wolters Kluwer Health/Lippincott Williams &

Wilkins, Philadelphia.

246. Paterson, D., and E. Fodor. 2012. Emerging roles for the influenza A virus

nuclear export protein (NEP). PLoS Pathog 8:e1003019.

247. Pellegrini, M., G. Belz, P. Bouillet, and A. Strasser. 2003. Shutdown of an

acute T cell immune response to viral infection is mediated by the proapoptotic

Bcl-2 homology 3-only protein Bim. Proc Natl Acad Sci U S A 100:14175-

14180.

248. Pello, S. J., and G. H. Olsen. 2013. Emerging and reemerging diseases of avian

wildlife. The veterinary clinics of North America. Exotic animal practice 16:357-

381.

249. Perez, J. T., A. Varble, R. Sachidanandam, I. Zlatev, M. Manoharan, A.

Garcia-Sastre, and B. R. tenOever. 2010. Influenza A virus-generated small

RNAs regulate the switch from transcription to replication. Proc Natl Acad Sci U

S A 107:11525-11530.

91

250. Pfefferkorn, E. R., M. Eckel, and S. Rebhun. 1986. Interferon-gamma

suppresses the growth of Toxoplasma gondii in human fibroblasts through

starvation for tryptophan. Mol Biochem Parasitol 20:215-224.

251. Pinto, L. H., L. J. Holsinger, and R. A. Lamb. 1992. Influenza virus M2 protein

has ion channel activity. Cell 69:517-528.

252. Platten, M., P. P. Ho, S. Youssef, P. Fontoura, H. Garren, E. M. Hur, R.

Gupta, L. Y. Lee, B. A. Kidd, W. H. Robinson, R. A. Sobel, M. L. Selley, and

L. Steinman. 2005. Treatment of autoimmune neuroinflammation with a

synthetic tryptophan metabolite. Science 310:850-855.

253. Plotch, S. J., M. Bouloy, I. Ulmanen, and R. M. Krug. 1981. A unique

cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs

to generate the primers that initiate viral RNA transcription. Cell 23:847-858.

254. Popov, A., and J. L. Schultze. 2008. IDO-expressing regulatory dendritic cells in

cancer and chronic infection. J Mol Med 86:145-160.

255. Portela, A., and P. Digard. 2002. The influenza virus nucleoprotein: a

multifunctional RNA-binding protein pivotal to virus replication. J Gen Virol

83:723-734.

256. Potter, C. W. 2001. A history of influenza. J Appl Microbiol 91:572-579.

257. Potula, R., L. Poluektova, B. Knipe, J. Chrastil, D. Heilman, H. Dou, O.

Takikawa, D. H. Munn, H. E. Gendelman, and Y. Persidsky. 2005. Inhibition

of indoleamine 2,3-dioxygenase (IDO) enhances elimination of virus-infected

macrophages in an animal model of HIV-1 encephalitis. Blood 106:2382-2390.

92

258. Rehwinkel, J., C. P. Tan, D. Goubau, O. Schulz, A. Pichlmair, K. Bier, N.

Robb, F. Vreede, W. Barclay, E. Fodor, and C. Reis e Sousa. 2010. RIG-I

detects viral genomic RNA during negative-strand RNA virus infection. Cell

140:397-408.

259. Riberdy, J. M., J. P. Christensen, K. Branum, and P. C. Doherty. 2000.

Diminished primary and secondary influenza virus-specific CD8(+) T-cell

responses in CD4-depleted Ig(-/-) mice. J Virol 74:9762-9765.

260. Robb, N. C., M. Smith, F. T. Vreede, and E. Fodor. 2009. NS2/NEP protein

regulates transcription and replication of the influenza virus RNA genome. J Gen

Virol 90:1398-1407.

261. Robinson, J. H., and A. A. Delvig. 2002. Diversity in MHC class II antigen

presentation. Immunology 105:252-262.

262. Rogers, G. N., and J. C. Paulson. 1983. Receptor determinants of human and

animal influenza virus isolates: differences in receptor specificity of the H3

hemagglutinin based on species of origin. Virology 127:361-373.

263. Roman, E., E. Miller, A. Harmsen, J. Wiley, U. H. Von Andrian, G. Huston,

and S. L. Swain. 2002. CD4 effector T cell subsets in the response to influenza:

heterogeneity, migration, and function. J Exp Med 196:957-968.

264. Rossman, J. S., and R. A. Lamb. 2011. Influenza virus assembly and budding.

Virology 411:229-236.

265. Ruigrok, R. W., T. Crepin, and D. Kolakofsky. 2011. Nucleoproteins and

nucleocapsids of negative-strand RNA viruses. Curr Opin Microbiol 14:504-510.

93

266. Rust, M. J., M. Lakadamyali, F. Zhang, and X. Zhuang. 2004. Assembly of

endocytic machinery around individual influenza viruses during viral entry.

Nature structural & molecular biology 11:567-573.

267. Sanberg, P. R., S. F. Calderon, M. Giordano, J. M. Tew, and A. B. Norman.

1989. The quinolinic acid model of Huntington's disease: locomotor

abnormalities. Exp Neurol 105:45-53.



269. Schmidt, S. K., S. Ebel, E. Keil, C. Woite, J. F. Ernst, A. E. Benzin, J. Rupp,

and W. Daubener. 2013. Regulation of IDO Activity by Oxygen Supply:

Inhibitory Effects on Antimicrobial and Immunoregulatory Functions. PLoS One

8:e63301.

270. Schmolke, M., and A. Garcia-Sastre. 2010. Evasion of innate and adaptive

immune responses by influenza A virus. Cell Microbiol 12:873-880.

271. Schmolke, M., B. Manicassamy, L. Pena, T. Sutton, R. Hai, Z. T. Varga, B.

G. Hale, J. Steel, D. R. Perez, and A. Garcia-Sastre. 2011. Differential

contribution of PB1-F2 to the virulence of highly pathogenic H5N1 influenza A

virus in mammalian and avian species. PLoS Pathog 7:e1002186.

272. Scholtissek, C., W. Rohde, V. Von Hoyningen, and R. Rott. 1978. On the

origin of the human influenza virus subtypes H2N2 and H3N2. Virology 87:13-

20.

273. Scott, P. 1993. IL-12: initiation cytokine for cell-mediated immunity. Science

260:496-497.

94

274. Seo, S. H., E. Hoffmann, and R. G. Webster. 2002. Lethal H5N1 influenza

viruses escape host anti-viral cytokine responses. Nat Med 8:950-954.





276. Sharma, M. D., D. Y. Hou, Y. Liu, P. A. Koni, R. Metz, P. Chandler, A. L.

Mellor, Y. He, and D. H. Munn. 2009. Indoleamine 2,3-dioxygenase controls

conversion of Foxp3+ Tregs to TH17-like cells in tumor-draining lymph nodes.

Blood 113:6102-6111.

277. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer, T. E.

Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, C. Ostrander,

D. Dong, J. Shin, S. Presnell, B. Fox, B. Haldeman, E. Cooper, D. Taft, T.

Gilbert, F. J. Grant, M. Tackett, W. Krivan, G. McKnight, C. Clegg, D.

Foster, and K. M. Klucher. 2003. IL-28, IL-29 and their class II cytokine

receptor IL-28R. Nat Immunol 4:63-68.

278. Shinya, K., M. Ebina, S. Yamada, M. Ono, N. Kasai, and Y. Kawaoka. 2006.

Avian flu: influenza virus receptors in the human airway. Nature 440:435-436.

279. Shinya, K., S. Hamm, M. Hatta, H. Ito, T. Ito, and Y. Kawaoka. 2004. PB2

amino acid at position 627 affects replicative efficiency, but not cell tropism, of

Hong Kong H5N1 influenza A viruses in mice. Virology 320:258-266.

95

280. Shirey, K. A., J. Y. Jung, G. S. Maeder, and J. M. Carlin. 2006. Upregulation

of IFN-gamma receptor expression by proinflammatory cytokines influences IDO

activation in epithelial cells. J Interferon Cytokine Res 26:53-62.

281. Shope, R. E. 1936. The Incidence of Neutralizing Antibodies for Swine Influenza

Virus in the Sera of Human Beings of Different Ages. J Exp Med 63:669-684.

282. Shope, R. E. 1931. Swine Influenza : I. Experimental Transmission and

Pathology. J Exp Med 54:349-359.

283. Shope, R. E. 1931. Swine Influenza : Iii. Filtration Experiments and Etiology. J

Exp Med 54:373-385.

284. Singh, N., A. Pandey, and S. K. Mittal. 2010. Avian influenza pandemic

preparedness: developing prepandemic and pandemic vaccines against a moving

target. Expert reviews in molecular medicine 12:e14.

285. Skehel, J. J., and D. C. Wiley. 2000. Receptor binding and membrane fusion in

virus entry: the influenza hemagglutinin. Annu Rev Biochem 69:531-569.

286. Smith-Garvin, J. E., G. A. Koretzky, and M. S. Jordan. 2009. T cell

activation. Annu Rev Immunol 27:591-619.

287. Smith, A. J., C. M. Toledo, S. W. Wietgrefe, L. Duan, T. W. Schacker, C. S.

Reilly, and A. T. Haase. 2011. The immunosuppressive role of IL-32 in

lymphatic tissue during HIV-1 infection. J Immunol 186:6576-6584.

288. Soliman, H., M. Mediavilla-Varela, and S. Antonia. 2010. Indoleamine 2,3-

dioxygenase: is it an immune suppressor? Cancer journal 16:354-359.

289. Spackman, E. 2008. A brief introduction to the avian influenza virus. Methods

Mol Biol 436:1-6.

96

290. Steel, J., A. C. Lowen, T. T. Wang, M. Yondola, Q. Gao, K. Haye, A. Garcia-

Sastre, and P. Palese. 2010. Influenza virus vaccine based on the conserved

hemagglutinin stalk domain. mBio 1.

291. Steinhauer, D. A., and J. J. Holland. 1987. Rapid evolution of RNA viruses.

Annu Rev Microbiol 41:409-433.

292. Steinhauer, D. A., and J. J. Skehel. 2002. Genetics of influenza viruses. Annu

Rev Genet 36:305-332.

293. Steinhauer, D. A., S. A. Wharton, J. J. Skehel, D. C. Wiley, and A. J. Hay.

1991. Amantadine selection of a mutant influenza virus containing an acid-stable

hemagglutinin glycoprotein: evidence for virus-specific regulation of the pH of

glycoprotein transport vesicles. Proc Natl Acad Sci U S A 88:11525-11529.

294. Stieneke-Grober, A., M. Vey, H. Angliker, E. Shaw, G. Thomas, C. Roberts,

H. D. Klenk, and W. Garten. 1992. Influenza virus hemagglutinin with

multibasic cleavage site is activated by furin, a subtilisin-like endoprotease.

EMBO J 11:2407-2414.

295. Stiver, G. 2003. The treatment of influenza with antiviral drugs. CMAJ :

Canadian Medical Association journal = journal de l'Association medicale

canadienne 168:49-56.

296. Suarez, D. L. 2008. Influenza A Virus, p. 4-5. In D. Swayne (ed.), Avian

Influenza. Blackwell Publishing, Ames, IA.

297. Subbarao, E. K., W. London, and B. R. Murphy. 1993. A single amino acid in

the PB2 gene of influenza A virus is a determinant of host range. J Virol 67:1761-

1764.

97

298. Subbarao, K., A. Klimov, J. Katz, H. Regnery, W. Lim, H. Hall, M. Perdue,

D. Swayne, C. Bender, J. Huang, M. Hemphill, T. Rowe, M. Shaw, X. Xu, K.

Fukuda, and N. Cox. 1998. Characterization of an avian influenza A (H5N1)

virus isolated from a child with a fatal respiratory illness. Science 279:393-396.

299. Suffia, I. J., S. K. Reckling, C. A. Piccirillo, R. S. Goldszmid, and Y. Belkaid.

2006. Infected site-restricted Foxp3+ natural regulatory T cells are specific for

microbial antigens. J Exp Med 203:777-788.

300. Sugimoto, H., S. Oda, T. Otsuki, T. Hino, T. Yoshida, and Y. Shiro. 2006.

Crystal structure of human indoleamine 2,3-dioxygenase: catalytic mechanism of

O2 incorporation by a heme-containing dioxygenase. Proc Natl Acad Sci U S A

103:2611-2616.

301. Suh, H. S., M. L. Zhao, M. Rivieccio, S. Choi, E. Connolly, Y. Zhao, O.

Takikawa, C. F. Brosnan, and S. C. Lee. 2007. Astrocyte indoleamine 2,3-

dioxygenase is induced by the TLR3 ligand poly(I:C): mechanism of induction

and role in antiviral response. J Virol 81:9838-9850.

302. Sun, J., R. Madan, C. L. Karp, and T. J. Braciale. 2009. Effector T cells

control lung inflammation during acute influenza virus infection by producing IL-

10. Nat Med 15:277-284.

303. Swain, S. L., K. K. McKinstry, and T. M. Strutt. 2012. Expanding roles for

CD4(+) T cells in immunity to viruses. Nat Rev Immunol 12:136-148.

304. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, and L. H.

Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage

commitment. Cell 100:655-669.

98

305. Takeda, K., and S. Akira. 2005. Toll-like receptors in innate immunity. Int

Immunol 17:1-14.

306. Takeuchi, O., and S. Akira. 2009. Cytoplasmic Pattern Receptors (RIG-I and

MDA-5) and Signaling in Viral Infections, p. p.29-38. In A. R. Brasier, A.

García-Sastre, and S. M. Lemon (ed.), Cellular signaling and innate immune

responses to RNA virus infections. ASM Press, Washington, D.C.

307. Tarendeau, F., J. Boudet, D. Guilligay, P. J. Mas, C. M. Bougault, S. Boulo,

F. Baudin, R. W. Ruigrok, N. Daigle, J. Ellenberg, S. Cusack, J. P. Simorre,

and D. J. Hart. 2007. Structure and nuclear import function of the C-terminal

domain of influenza virus polymerase PB2 subunit. Nature structural & molecular

biology 14:229-233.

308. Tattevin, P., D. Monnier, O. Tribut, J. Dulong, N. Bescher, F. Mourcin, F.

Uhel, Y. Le Tulzo, and K. Tarte. 2010. Enhanced indoleamine 2,3-dioxygenase

activity in patients with severe sepsis and septic shock. J Infect Dis 201:956-966.

309. Taubenberger, J. K., and D. M. Morens. 2006. 1918 Influenza: the mother of

all pandemics. Emerg Infect Dis 12:15-22.

310. Taubenberger, J. K., and D. M. Morens. 2010. Influenza: the once and future

pandemic. Public Health Rep 125 Suppl 3:16-26.

311. Taubenberger, J. K., and D. M. Morens. 2008. The pathology of influenza

virus infections. Annual review of pathology 3:499-522.

312. Taylor, M. W., and G. S. Feng. 1991. Relationship between interferon-gamma,

indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J 5:2516-2522.

99

313. Terentis, A. C., S. R. Thomas, O. Takikawa, T. K. Littlejohn, R. J. Truscott,

R. S. Armstrong, S. R. Yeh, and R. Stocker. 2002. The heme environment of

recombinant human indoleamine 2,3-dioxygenase. Structural properties and

substrate-ligand interactions. J Biol Chem 277:15788-15794.

314. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I

interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol

23:307-336.



316. Thomas, S. M., L. F. Garrity, C. R. Brandt, C. S. Schobert, G. S. Feng, M. W.

Taylor, J. M. Carlin, and G. I. Byrne. 1993. IFN-gamma-mediated

antimicrobial response. Indoleamine 2,3-dioxygenase-deficient mutant host cells

no longer inhibit intracellular Chlamydia spp. or Toxoplasma growth. J Immunol

150:5529-5534.

317. Tiley, L. S., M. Hagen, J. T. Matthews, and M. Krystal. 1994. Sequence-

specific binding of the influenza virus RNA polymerase to sequences located at

the 5' ends of the viral RNAs. J Virol 68:5108-5116.

318. Tong, S., Y. Li, P. Rivailler, C. Conrardy, D. A. Castillo, L. M. Chen, S.

Recuenco, J. A. Ellison, C. T. Davis, I. A. York, A. S. Turmelle, D. Moran, S.

Rogers, M. Shi, Y. Tao, M. R. Weil, K. Tang, L. A. Rowe, S. Sammons, X.

Xu, M. Frace, K. A. Lindblade, N. J. Cox, L. J. Anderson, C. E. Rupprecht,

and R. O. Donis. 2012. A distinct lineage of influenza A virus from bats. Proc


100

319. Topham, D. J., and P. C. Doherty. 1998. Clearance of an influenza A virus by

CD4+ T cells is inefficient in the absence of B cells. J Virol 72:882-885.

320. Topham, D. J., R. A. Tripp, and P. C. Doherty. 1997. CD8+ T cells clear

influenza virus by perforin or Fas-dependent processes. J Immunol 159:5197-

5200.

321. Trinchieri, G. 2010. Type I interferon: friend or foe? J Exp Med 207:2053-2063.

322. Tripp, R. A., S. Hou, and P. C. Doherty. 1995. Temporal loss of the activated

L-selectin-low phenotype for virus-specific CD8+ memory T cells. J Immunol

154:5870-5875.

323. Tumpey, T. M., C. F. Basler, P. V. Aguilar, H. Zeng, A. Solorzano, D. E.

Swayne, N. J. Cox, J. M. Katz, J. K. Taubenberger, P. Palese, and A. Garcia-

Sastre. 2005. Characterization of the reconstructed 1918 Spanish influenza

pandemic virus. Science 310:77-80.

324. Tumpey, T. M., T. R. Maines, N. Van Hoeven, L. Glaser, A. Solorzano, C.

Pappas, N. J. Cox, D. E. Swayne, P. Palese, J. M. Katz, and A. Garcia-Sastre.

2007. A two-amino acid change in the hemagglutinin of the 1918 influenza virus

abolishes transmission. Science 315:655-659.

325. Turner, D. L., K. L. Bickham, D. L. Farber, and L. Lefrancois. 2013. Splenic

priming of virus-specific CD8 T cells following influenza virus infection. J Virol

87:4496-4506.

326. Uze, G., and D. Monneron. 2007. IL-28 and IL-29: newcomers to the interferon

family. Biochimie 89:729-734.

101

327. Vaccari, M., A. Boasso, Z. M. Ma, V. Cecchinato, D. Venzon, M. N. Doster,

W. P. Tsai, G. M. Shearer, D. Fuchs, B. K. Felber, G. N. Pavlakis, C. J.

Miller, and G. Franchini. 2008. CD4+ T-cell loss and delayed expression of

modulators of immune responses at mucosal sites of vaccinated macaques

following SIV(mac251) infection. Mucosal immunology 1:497-507.

328. van der Vries, E., P. J. Collins, S. G. Vachieri, X. Xiong, J. Liu, P. A. Walker,

L. F. Haire, A. J. Hay, M. Schutten, A. D. Osterhaus, S. R. Martin, C. A.

Boucher, J. J. Skehel, and S. J. Gamblin. 2012. H1N1 2009 pandemic influenza

virus: resistance of the I223R neuraminidase mutant explained by kinetic and

structural analysis. PLoS Pathog 8:e1002914.

329. Van Epps, H. L. 2006. Influenza: exposing the true killer. J Exp Med 203:803.

330. van Riel, D., V. J. Munster, E. de Wit, G. F. Rimmelzwaan, R. A. Fouchier,

A. D. Osterhaus, and T. Kuiken. 2007. Human and avian influenza viruses

target different cells in the lower respiratory tract of humans and other mammals.

The American journal of pathology 171:1215-1223.




332. Varga, Z. T., A. Grant, B. Manicassamy, and P. Palese. 2012. Influenza virus

protein PB1-F2 inhibits the induction of type I interferon by binding to MAVS

and decreasing mitochondrial membrane potential. J Virol 86:8359-8366.

333. Veit, M., and B. Thaa. 2011. Association of influenza virus proteins with

membrane rafts. Advances in virology 2011:370606.

102

334. Vignali, D. A., L. W. Collison, and C. J. Workman. 2008. How regulatory T

cells work. Nat Rev Immunol 8:523-532.

335. Wang, P., P. Palese, and R. E. O'Neill. 1997. The NPI-1/NPI-3 (karyopherin

alpha) binding site on the influenza a virus nucleoprotein NP is a nonconventional

nuclear localization signal. J Virol 71:1850-1856.

336. Wang, R., A. Song, J. Levin, D. Dennis, N. J. Zhang, H. Yoshida, L.

Koriazova, L. Madura, L. Shapiro, A. Matsumoto, H. Yoshida, T.

Mikayama, R. T. Kubo, S. Sarawar, H. Cheroutre, and S. Kato. 2008.

Therapeutic potential of a fully human monoclonal antibody against influenza A

virus M2 protein. Antiviral Res 80:168-177.

337. Wang, X., M. Li, H. Zheng, T. Muster, P. Palese, A. A. Beg, and A. Garcia-

Sastre. 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB

and induction of alpha/beta interferon. J Virol 74:11566-11573.

338. Wang, Y., H. X. Zhang, Y. P. Sun, Z. X. Liu, X. S. Liu, L. Wang, S. Y. Lu, H.

Kong, Q. L. Liu, X. H. Li, Z. Y. Lu, S. J. Chen, Z. Chen, S. S. Bao, W. Dai,

and Z. G. Wang. 2007. Rig-I-/- mice develop colitis associated with

downregulation of G alpha i2. Cell research 17:858-868.

339. Webster, R. G., W. G. Laver, and E. D. Kilbourne. 1968. Reactions of

antibodies with surface antigens of influenza virus. J Gen Virol 3:315-326.

340. Werner-Felmayer, G., E. R. Werner, D. Fuchs, A. Hausen, G. Reibnegger,

and H. Wachter. 1989. Characteristics of interferon induced tryptophan

metabolism in human cells in vitro. Biochim Biophys Acta 1012:140-147.

103

341. Werner-Felmayer, G., E. R. Werner, D. Fuchs, A. Hausen, G. Reibnegger,

and H. Wachter. 1989. Tumour necrosis factor-alpha and lipopolysaccharide

enhance interferon-induced tryptophan degradation and pteridine synthesis in

human cells. Biological chemistry Hoppe-Seyler 370:1063-1069.

342. Wharton, S. A., R. B. Belshe, J. J. Skehel, and A. J. Hay. 1994. Role of virion

M2 protein in influenza virus uncoating: specific reduction in the rate of

membrane fusion between virus and liposomes by amantadine. J Gen Virol 75 (

Pt 4):945-948.

343. Wilkinson, T. M., C. K. Li, C. S. Chui, A. K. Huang, M. Perkins, J. C.

Liebner, R. Lambkin-Williams, A. Gilbert, J. Oxford, B. Nicholas, K. J.

Staples, T. Dong, D. C. Douek, A. J. McMichael, and X. N. Xu. 2012.

Preexisting influenza-specific CD4(+) T cells correlate with disease protection

against influenza challenge in humans. Nat Med 18:274-280.

344. Wingender, G., N. Garbi, B. Schumak, F. Jungerkes, E. Endl, D. von

Bubnoff, J. Steitz, J. Striegler, G. Moldenhauer, T. Tuting, A. Heit, K. M.

Huster, O. Takikawa, S. Akira, D. H. Busch, H. Wagner, G. J. Hammerling,

P. A. Knolle, and A. Limmer. 2006. Systemic application of CpG-rich DNA

suppresses adaptive T cell immunity via induction of IDO. Eur J Immunol 36:12-

20.

345. Wong, D. D., K. T. Choy, R. W. Chan, S. F. Sia, H. P. Chiu, P. P. Cheung, M.

C. Chan, J. S. Peiris, and H. L. Yen. 2012. Comparable fitness and

transmissibility between oseltamivir-resistant pandemic 2009 and seasonal H1N1

104

influenza viruses with the H275Y neuraminidase mutation. J Virol 86:10558-

10570.

346. Wright, P. F., G. Neumann, and Y. Kawaoka. 2007. Orthomyxoviruses, p.

1691-1740. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields'

virology, 5th ed, vol. 2. Wolters Kluwer Health/Lippincott Williams & Wilkins,

Philadelphia :.

347. Xu, L., H. Yoon, M. Q. Zhao, J. Liu, C. V. Ramana, and R. I. Enelow. 2004.

Cutting edge: pulmonary immunopathology mediated by antigen-specific

expression of TNF-alpha by antiviral CD8+ T cells. J Immunol 173:721-725.

348. Yamashita, M., M. Krystal, and P. Palese. 1989. Comparison of the three large

polymerase proteins of influenza A, B, and C viruses. Virology 171:458-466.

349. Yassine, H. M., C. W. Lee, R. Gourapura, and Y. M. Saif. 2010. Interspecies

and intraspecies transmission of influenza A viruses: viral, host and

environmental factors. Animal health research reviews / Conference of Research

Workers in Animal Diseases 11:53-72.

350. Yeung, A. W., W. Wu, M. Freewan, R. Stocker, N. J. King, and S. R.

Thomas. 2012. Flavivirus infection induces indoleamine 2,3-dioxygenase in

human monocyte-derived macrophages via tumor necrosis factor and NF-kappaB.

J Leukoc Biol 91:657-666.

351. Yoshida, R., and O. Hayaishi. 1978. Induction of pulmonary indoleamine 2,3-

dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Proc Natl

Acad Sci U S A 75:3998-4000.

105



Acad Sci U S A 76:4084-4086.

353. Yuasa, H. J., H. J. Ball, C. J. Austin, and N. H. Hunt. 2010. 1-L-

methyltryptophan is a more effective inhibitor of vertebrate IDO2 enzymes than

1-D-methyltryptophan. Comp Biochem Physiol B Biochem Mol Biol 157:10-15.

354. Zamarin, D., M. B. Ortigoza, and P. Palese. 2006. Influenza A virus PB1-F2

protein contributes to viral pathogenesis in mice. J Virol 80:7976-7983.

355. Zhang, J., A. Pekosz, and R. A. Lamb. 2000. Influenza virus assembly and lipid

raft microdomains: a role for the cytoplasmic tails of the spike glycoproteins. J

Virol 74:4634-4644.

356. Zhu, X., W. Yu, R. McBride, Y. Li, L. M. Chen, R. O. Donis, S. Tong, J. C.

Paulson, and I. A. Wilson. 2013. Hemagglutinin homologue from H17N10 bat

influenza virus exhibits divergent receptor-binding and pH-dependent fusion

activities. Proc Natl Acad Sci U S A.

106

CHAPTER 3

INHIBITION OF INDOLEAMINE 2, 3-DIOXYGENASE (IDO) ENHANCES THE T

CELL RESPONSE TO INFLUENZA VIRUS INFECTION1

1Fox, J. M. , Sage, L. K., Huang, L., Barber, J., Klonowski, K. D., Mellor, A. L.,

Tompkins, S. M., Tripp, R. A. 2013. Journal of General Virology. 94:1441-1450

Reprinted here with permission of the publisher.

107

Abstract

Influenza infection induces an increase in the level of indoleamine 2, 3-

dioxygenase (IDO) activity in the lung parenchyma. IDO is the first and rate limiting

step in the kynurenine pathway where tryptophan is reduced to kynurenine and other

metabolites. The depletion of tryptophan, and production of associated metabolites,

attenuates the immune response to infection. The impact of IDO on the primary immune

response to influenza virus infection was determined using the IDO inhibitor 1-methyl-D,

L-tryptophan (1MT). C57BL/6 mice treated with 1MT and infected with A/HKx31

influenza virus had increased numbers of activated and functional CD4+, influenza-

specific CD8+ T cells, and effector memory cells in the lung. Inhibition of IDO increased

the Th1 response in CD4+ T cells as well as enhanced the Th17 response. These studies

show that inhibition of IDO engenders a more robust T cell response to influenza virus,

and suggests an approach for enhancing the immune response to influenza vaccination by

facilitating increased influenza-specific T cell response.

108

Introduction

Influenza virus is a worldwide health concern, particularly for persons at the extremes of

age, i.e. the young and elderly (20). While protection from influenza virus is mediated by

a neutralizing antibody response (6), a potent T cell response is required for elimination

of virally-infected cells, and for protection from heterologous virus infection as T cells

recognize conserved viral epitopes (15). Numerous studies have shown the importance

of T cell memory in protection from disease in mice (48, 50). Although the significance

of the T cell response is less understood for humans, there are studies showing influenza

infection is associated with increased frequencies of memory influenza specific CD8+ T

cells in the lungs compared to the circulating CD8+ T cells (14, 44), and evidence that

memory CD4+ T cells can reduce disease severity (53). Recently, several studies have

focused on developing vaccines to elicit potent T cell responses in an attempt to bypass

the need for yearly vaccination by providing cross-protective immunity (24, 39).

Several studies have addressed mechanisms that may facilitate the host response

to immunity, and have shown that inhibition of indoleamine 2, 3- dioxygenase (IDO) has

the potential to increase host responses (13, 36). IDO is an intracellular enzyme in the

kynurenine pathway that catabolizes tryptophan into kynurenine (23) and was initially

shown to provide protection from fetal rejection mediated through T cells (42). This

protection was attributed to reduction in tryptophan levels causing immune cells to arrest

in the cell cycle and T cells to become anergic (18, 41). Furthermore, IDO activity has

been shown to skew CD4 T cells toward a Treg phenotype over a pro-inflammatory

response (3). IDO activity is linked to immune attenuation and maintaining an

immunosuppressive environment, therefore inhibition of IDO has the potential to reverse

109

these effects as seen in the alloantigen memory T cell response (23, 49). Several studies

have focused on the role of IDO in the maintenance of cancerous cells and tumors and

resistance to T cell cytotoxicity (46, 52). In some studies, inhibition of IDO using 1-

methyl-tryptophan (1MT) was able to reduce the size and growth of tumors, but was

unable to provide complete tumor elimination alone (51, 54).

IDO expression is up-regulated through IFNγ signaling (4), suggesting IDO may

modulate the immune response to viral infection. During influenza virus infection in

mice, IDO activity has been shown to increase over time with peak activity coinciding

with the peak number of T cells within the respiratory tract (55). Thus, while coordinate

expression of IDO may serve to regulate the duration of immunity by modulating the T

cell response, it is also likely that IDO-mediated immune attenuation may also hinder the

quantity and/or quality of the T cell response. Recent studies have shown IDO to have an

attenuating role in the immune response to HIV (1), Leishmania major (37), and

Toxoplasma gondii (43).

IDO inhibition during combined NKT cell activation and influenza vaccination

has been shown to boost protective immunity (16, 24), however it remains unclear how

IDO impacts the immune response to influenza virus infection. To address this in this

study, 1MT was used to pharmacologically inhibit IDO activity in mice infected with

HKx31 (X31). The T cell response to infection was evaluated in lung airways. The

results show that IDO inhibition allows for an enhanced Th1 response, increased the

functional influenza virus-specific CD8+ T cell response, and produced higher quantities

of effector memory cells.

110

Material and Methods

Mice, virus propagation, and infection. Six-to-eight week old female C57BL/6 mice were

purchased from Charles River (Raleigh, NC) and all animal studies were approved by the

Animal Care and Use Committee of the University of Georgia. A/HKx31 (X31, H3N2)

influenza virus was propagated in the allantoic cavity of 9-day-old embroynated chicken

eggs at 37C for 72 hours. Titers were determined by an influenza plaque assay (38). All

mice were anesthetized by intraperitoneal (i.p.) injection of Avertin (2, 2, 2-

tribromoethanol) followed by intranasal (i.n.) infection with 103 PFU of X31 in 50 μl of

PBS at 8 to 10 weeks old.

Preparation and administration of 1-methyl-D, L-tryptophan (1MT). The D, L racemic

mixture of 1MT (Sigma-Aldrich, St. Louis, MO) was administered to the mice through

drinking water at a concentration of 2 mg/ml. The treated water was prepared by

dissolving the 1MT powder in water using NaOH. The pH was adjusted to 7. To coax

the mice to drink the water, aspartame was added to the water. The water was filter

sterilized and contained in autoclaved water bottles covered in aluminum foil. Control

animals received aspartame sweetened water only. 1MT-treated water was given to the

mice 3 days prior to infection and the animals remained on the treatment throughout the

course of the infection. Mice receiving the 1MT treatment were weighed during the three

days prior to infection to ensure consumption of the water. The water and water bottles

were changed every five-to-seven days.

111

Measuring IDO activity through the ratio of Kynurenine (kyn)-to-Tryptophan (trp) by

HPLC. Lungs and serum were collected from mice at 2, 4, 6, 8, 10, 12, and 14 days post-

infection (dpi). Lungs were harvested in PBS containing antibiotics and antimycotics and

homogenized using a tissue lyser (Qiagen, Valencia, CA). Clarified lung homogenate

and serum were aliquoted and frozen at -80C until processing. Concentration of kyn and

trp were determined by HPLC analysis using a standard curve (34). Briefly, proteins

were removed from the clarified lung homogenate and serum using trichloroacetic acid

and analyzed using a C18 reverse phase column (Restek, Bellefonte, PA).

Isolation and phenotyping of lymphocyte populations. At 10 dpi, mice were anesthetized

and bronchoalveolar leukocytes (BAL) were collected by instillation of 1 mL of PBS into

the lungs at three times for each mouse. Mediastinal lymph node (MLN) were removed

and placed into HBSS at 4C until processing. Single cells suspensions were prepared

from the MLN using a 100 micron cell strainer (BD Biosciences, San Jose, CA). Cells

were centrifuged and resuspended in complete tumor media (CTM). Cell numbers were

determined with a Coulter Counter (Beckman Coulter, Brea, CA). Single cell

suspensions were plated between 5x104 to 5x10

5 cells/well. The cells were resuspended

in staining wash buffer (SWB) (PBS + 1% BSA + 0.09% NaN3) followed by incubation

with Fc Block (BD Pharmingen, San Diego, CA) at 4C for 15 min. Cells were then

incubated with anti-CD3e (clone 145-2C11), anti-CD8 (clone 53-6.7), anti-CD4 (clone

RM4-5), anti-CD44 (clone IM7), and anti-CD62L (clone MEL-14) (BD Pharmingen) for

30 min at 4C. The cells were rinsed with SWB and fix with 1% paraformaldehyde in

PBS.

112

For intracellular cytokine staining, cells were stimulated with a cocktail of

influenza immunodominant peptides (NP366-374, PA224-233, PB1703-711) (1ug/ml), irrelevant

peptide (RSV M282-90) (1ug/ml), or DMSO for 4h in CTM at 37°C followed by surface

staining with anti-CD3, anti-CD8 , H2DbNP366-374 tetramer, H2D

bPA224-233 tetramer, or

H2KbPB1703-711 tetramer (NIH Tetramer Core Facility, Emory, Atlanta, GA) for 1 hour at

room temperature for the IFNγ response from CD8+ T cells. Cells were stimulated with

UV-inactivated X31 virus (1:100) or allantoic fluid for 6h in CTM at 37°C followed by

surface staining with anti-CD3 and anti-CD4 for intracellular staining of CD4 T cells for

IFNγ (clone XMG1.2), IL-6 (clone MP5-32C11), or IL-4 (clone 11B11) (BD

Pharmingen). Cultured cells were stained as described above, but were kept in the

presence of GolgiStop (BD Biosciences). Following surface staining, cells were rinsed

with SWB + GolgiStop and fix and permeabilized with the Foxp3

Fixation/Permeabilization solution (eBiosciences, San Diego, CA). The cells were rinsed

with Perm/Wash Buffer (BD Biosciences) and incubated with intracellular markers listed

above for 30 min at 4C. Cells were washed with Perm/Wash Buffer and resuspended in

PBS. All samples were run on a LSRII flow cytometer (BD Biosciences) and analyzed

using BD FACS Diva software (San Jose, CA) or FlowJo (Tree Star, Ashland, OR). All

populations were initially gated on CD3+ cells. Isotype control antibodies and mock

stimulation were used to set gates for analysis.

Determination of viral load from lung homogenate. At 1-10 days post-infection, mice

were anesthetized ip with Avertin and blood was collected from the brachial artery.

Lungs were harvested in PBS containing antibiotics and antimycotics and homogenized

113

using a tissue lyser (Qiagen, Valencia, CA). Lungs were centrifuged and supernatant was

aliquoted and frozen at -80C until assayed. Viral titers were determined using a TCID50

as previously described All TCID50s were done in quadruplicates. To determine M gene

copy number, lungs were harvested and processed as described above. RNA was isolated

using Trizol (Life Technologies, Grand Island, NY) followed by the addition of

chloroform. RNA was cleaned using the RNeasy kit following the manufacture’s

protocol (Qiagen). RNA concentrations were determined using the Nanodrop 1000

(Thermo Fisher). qRT-PCR was performed using the OneStep RT-PCR Kit (Qiagen)

using the CDC’s Universal Influenza Primer/Probe set. 1µg of RNA was added to each

reaction and ran in a MX3000P QPCR System (Stratagene). The samples were incubated

for 50°C for 30 min, 95°C for 15 min, then 45 cycles of 95°C for 15 sec and 55°C for 30

sec. M gene copy number was determined using a plasmid standard.

Statistical analysis. Statistics were performed using GraphPad Prism Version 5.01 (La

Jolla, CA). The data was analyzed using a two-tailed student’s t-test comparing 1MT

treatment to control treated mice at each time point. Significance was assigned when the

p value < 0.05.

Results

Influenza infection increases IDO activity in the lungs.

The presence of IDO is associated with attenuated T cell responses to infectious agents

(5, 37). As these pathogens drive expression of IFNγ, IDO activity is upregulated in

dendritic cells, macrophages, and epithelial cells (4, 28, 40). IDO activity has been

114

previously shown to be upregulated in the lungs of influenza infected mice (55);

however, the effect IDO has on the quantity and quality of the anti-influenza T cell

response has not been examined. In this study, we address the hypothesis that inhibition

of IDO activity during T cell priming will augment the magnitude and duration of the

pulmonary T cell response to influenza virus infection. To test this, IDO expression was

inhibited using 1MT, a competitive inhibitor of IDO (8). 1MT was administered via

drinking water three days prior to infection, and the mice remained on 1MT throughout

the course of the study. IDO activity was measured in mice receiving 1MT or vehicle

(sweetened water) by evaluating the ratio of kynurenine (kyn) to tryptophan (trp) in lung

homogenates and serum of influenza-infected mice at days 0, 2, 4, 6, 8, 10, 12 and 14 dpi

(Fig 1). The kyn/trp ratio directly measures IDO activity by comparing the concentrations

of metabolite to substrate produced. The serum kyn/trp ratios in mice receiving 1MT or

vehicle control were similar to day 10 pi, however there was a significant (p<0.05)

difference in kyn/trp ratios in the serum of control vs 1MT treated mice on day 12pi (Fig.

3.1a). Although the kyn/trp ratios were similar to day 10 pi, there was a trend towards

increased kyn/trp ratios in control compared to 1MT treated mice. In comparison, the

kyn/trp ratios were substantially higher in the lungs following influenza infection

compared to control treated mice, suggesting that infection modulates IDO activity (Fig.

3.1b), and at day 4 post- infection, there was a small but significant (p<0.05) difference in

IDO activity in the lungs (Fig. 3.1b). Notably, at day 10 pi, a significant (p<0.01)

increase in the kyn/trp ratios was evident in the lungs of control compared to 1MT-treated

mice (Fig. 3.1b). These findings are consistent with a previous report showing that IDO

activity peaks between day 10 and 11pi in the lungs after influenza infection (55), and

115

also demonstrates a temporal pharmacological inhibition of influenza induced IDO

activity through the administration of 1MT. Since IDO activity peaked at day 10, we

evaluated the cellular response at this time-point for the remainder of the study.

IDO inhibition does not affect leukocyte infiltration or viral clearance.

Since IDO has been shown to increase apoptosis and reduce cell proliferation (35, 40),

we sought to determine if IDO affected pulmonary leukocyte numbers. To examine the

effects of IDO inhibition on the overall frequency of cells responding to virus infection,

the number of leukocytes in the bronchoalveolar lavage (BAL) and draining mediastinal

lymph node (MLN) were determined at 10 dpi. It is known that following influenza virus

infection in mice, NK cells can be detected in the airways at day 3 post-influenza

infection, peaking by day 5 pi, whereby influenza-specific T cells begin to accumulate at

detectable frequencies in the lung airways at day 5 pi with their overall numbers peaking

at day 10 pi (12, 21, 31). In this study, 1MT treatment did not have any substantial effect

on the overall level or kinetics of pulmonary leukocyte recruitment (Fig. 3.2a). Similarly,

1MT treatment did not have any substantial effect on MLN cell numbers (Fig. 3.2b).

It was important to determine if IDO was selectively affecting the frequency

and/or function of specific pools of respondent leukocytes, as modulation of local

tryptophan levels has been shown to affect the survival and function of T cells (17).

Examination of the CD4+ and CD8+ T cell subpopulations isolated from the BAL of

1MT treated mice showed no significant difference as compared to vehicle treated mice

(Fig. 3.1c), while there was an increase in the CD4+ T cell population in the MLN in the

control treated mice (Fig. 3.1d).

116

Previous studies have shown that inhibition of IDO reduces the pathogen load

during Leishmania infections (37). Thus, we wanted to determine if 1MT treatment had

any effect on lung virus clearance. No differences in virus were evident between 1MT

and control treated mice by TCID50 (Fig. 3.3a) or M gene expression (Fig. 3.3b). As

differences in IDO activity were not detected until day 10 pi in lung homogenate (Fig.

3.1a), and there was no substantial difference in pulmonary CD8+ T cell numbers (Fig.

3.2c), it is not surprising that 1MT had no detectable effect on virus clearance.

Inhibition of IDO activity enhances the Th1 cytokine response.

The CD4+ T cell response to influenza infection in mice has been characterized as a Th1-

type response (9, 15), however IDO has been shown to activate regulatory T cells and

block their conversion into Th17-like cells (3). Thus, the effects of IDO on the

differentiation of Th1- or Th2-type CD4+ T cells were determined in the BAL. Cytokines

representative of Th1-, Th2-, and Th17-type responses were determined, i.e. IFNγ, IL-4,

and IL-6, respectively. The proportion and frequency of CD4+ T cells expressing IFNγ,

IL-6, or IL-4 was determined at day 10 pi (Fig. 3.4). There was a significant increase (p

< 0.05) in the percentage (Fig. 3.4b) and number (Fig. 3.4c) of CD4+ T cells expressing

IFNγ. There was also a significant increase in the percentage of CD4+ T cells expressing

IL-6 (Fig. 3.2d), although there was only a slight increase in the number of CD4+ T cells

expressing IL-6 (Fig. 3.2e). There was no change in the CD4+ IL-4 expressing

population, showing a specific role of IDO in the suppression of a Th1/Th17 response.

Together, these findings indicate that IDO inhibition through 1MT treatment enhances

117

the Th1-type response indicated by higher numbers of BAL CD4+ T cells expressing

IFNγ following infection with influenza virus.

IDO inhibition is associated with increased numbers of influenza-specific CD8+ T cells.

Total numbers of CD8+ T cells in the BAL of 1MT treated mice were not affected (Fig.

3.2c), thus virus-specific CD8+ T cell frequencies were determined following 1MT or

vehicle treatment. CD8+ T cells from the BAL were collected at day 10 post-infection

and stained with tetramers detecting reactivity to the influenza nucleoprotein (NP) (H-

2DbNP366-374 tetramer), acid polymerase (PA) (H-2D

bPA224-233), or basic polymerase 1

(H-2KbPB1703-711) (Fig. 3.5). NP and PA have been shown to be the dominate CD8+ T

cell epitopes in response to influenza with PB1 being subdominant to NP and PA (10, 11,

56). While there was no difference in the percent of influenza-specific CD8+ T cells

between 1MT and control treated mice (Fig. 3.5a), treatment with 1MT had increased

numbers of CD8+ T cells for each immune dominant influenza-specific epitope (Fig.

3.5b). There was a significant (p<0.05) increase in PA specific CD8+ T cells (Fig. 3.5b),

and a trend toward higher numbers of NP and PB1-specific CD8+ T cells (Fig. 3.5b).

There were no substantial differences in the frequency of influenza-specific CD8+ T cells

in the MLN in the 1MT and control treated groups (data not shown), suggesting that this

increase occurs at the site of infection.

Since IDO has a role in dampening the T cell response, and there were increases

in the number of influenza-specific CD8+ T cells in the BAL, the TCR Vβ diversity was

examined in 1 MT-treated and control mice at days 0, 6, 8, 10, 12, and 14 pi. Splenocytes

were stained for TCR Vβ 2, 6, 7, 8, and 8.1/8.2. No substantial variation was detected in

118

TCR Vβ usage among influenza specific CD8+ T cells from that previously shown (32)

(data not shown). These results support the finding that IDO inhibition increased the

numbers of pulmonary CD8+ T cells that are influenza virus-specific.

IDO affects influenza-specific CD8+ T cell functionality and the effector memory

population.

As IDO treatment was associated with an enhanced Th1-type response determined by

increased numbers of CD4+ T cells expressing IFNγ (Fig. 3.4b), and there were increases

in the number of PA-specific CD8+ T cells in the BAL (Fig. 3.5b), the effect of IDO

treatment on CD8+ T cell activation was evaluated. To determine if IDO inhibition was

linked to a concomitant increase in virus-specific CD8+ T cells, the percentage and

number of CD8+ T cells and influenza specific CD8+ T cells expressing IFNγ collected

from the BAL was analyzed 10 dpi (Fig. 3.6a, c-d). In contrast to the increased numbers

of CD4+ T cells expressing IFNγ in the BAL of 1MT treated mice (Fig. 3.4), inhibition

of IDO did not change the percentage of CD8+ T cells expressing IFNγ (Fig. 3.6c-d).

There were slightly higher numbers of BAL CD8+ T cells expressing IFNγ of 1MT

treated mice compared to control mice (Fig. 3.6d). CD8+ T cells were stained with H-

2DbNP366-374, H-2D

bPA224-233, and H-2K

bPB1703-711 tetramers and for intracellular IFNγ to

evaluate activation (Fig. 3.6b, e-f). Of the CD8+ T cells expressing IFNγ, there was a

significant (p<0.05) increase in the number of PA-specific T cells, while NP and PB1

CD8+ T cells showed no difference between the treatments (Fig. 3.6f). These findings

indicate that in the absence of IDO, the activated PA-specific CD8+ T cells are increased

over the NP and PB1. These results suggest that IDO modifies the CD8+ T cell

119

frequency, and IDO inhibition increases the number of functional influenza virus specific

CD8+ T cells, in particular a co-dominant epitope, at the site of infection.

Given the increase in CD4+ and CD8+ T cell activity with IDO inhibition, the

level of effector and central memory T cell populations were evaluated. To evaluate the

effector and central memory populations, CD4+ and CD8+ T cells were phenotyped for

expression of CD44 and CD62L, with CD44hi

CD62Llo

expression being indicative of

effector memory cells and CD44hi

CD62Lhi

expression representing central memory cells

(45). Ten days post-infection there was an increased frequency of CD8+ effector

memory cells in the absence of IDO activity (Fig. 3.7a-b). While there was no difference

between the CD4+ T cell effector memory populations (Fig. 3.7c-d), there was a

significant increase in the central memory population in control compared to 1MT treated

mice (Fig. 3.7d). These results support a role of IDO in the reduction of the production

of the effector memory population, particularly the CD8+ T cell population.

Discussion

The findings from this study show that IDO has an immune dampening role in the

response to influenza virus infection where IDO inhibition resulted in an overall

enhancement in the number of activated T cells in the lungs. IDO dampening of the IFNγ

response appeared greatest for the CD4+ T cell compartment with an enhanced Th1 and

Th17 response, although IFNγ expression by CD8+ T cells was also affected. In the

BAL, the most abundant functional CD8+ T cell response in the absence of IDO was

directed to the PA epitope (PA224-233) compared to the control treated mice. These

findings suggest that IDO might alter CD8+ T cell frequency while there is no detectable

120

shift in the TCR Vβ usage of the CD8+ T cells. This could possibly be attributed to

enhance trafficking of PA-specific T cells to the lungs related to a survival advantage.

Changes in the frequency have implications on the diversity of the T cell

population directed at influenza. There are multiple possibilities on how IDO affects the

influenza specific CD8+ T cell population. One potential mechanism is through changes

in antigen expression in antigen presenting cells (APCs). NP is commonly expressed by

most cells including dendritic cells and non-dendritic cells, while the PA peptide is

almost exclusively expressed on dendritic cells and this has been shown to affect the

peptide dominance between acute and secondary influenza infection (11). The

expression pattern for PB1, however, has not been established. Since both macrophages

and dendritic cells can express IDO through stimulation with IFN-γ (28), there is

potential for a differential expression pattern of influenza epitopes. This could be driven

through the immunoproteasome, which is also up-regulated through IFN-γ (47). The

immunoproteasome is responsible for the cleavage of proteins during infection for

peptide presentation through the MHC class I pathway (30) and IDO may be influencing

the expression of epitopes. Furthermore, it has been shown that immunodominance is

affected by the recruitment and expansion of CD8+ T cells (33). With reduced IDO

activity, there was increased activation of the influenza specific CD8+ T cells, suggesting

prolonged exposure to antigen or continued activation of T cell arriving “late” to the

immune response. The continued activation can be due in part to the reduced production

of Treg cells as a result of IDO inhibition (3).

Although inhibition of IDO increased the amount of virus-specific cells

expressing IFNγ, surprisingly 1MT treatment did not affect lung viral titers as noted for

121

other pathogens (37). One explanation may relate to the tempo of IDO expression.

Accordingly, there are likely two phases of IDO activity in response to influenza virus

infection, the first during initial infection of respiratory epithelial cells, followed by a

larger induction related to IFNγ produced by CD4+ and CD8+ T cells. IFNγ is an

extremely potent activator of IDO (4), and the second wave of IDO activity is more

robust and can be easily detected by examination of kyn levels or the ratio of kyn/trp. As

the first induction of IDO likely occurs during infection of respiratory epithelial cells, this

lower level of IDO activity has limited effects on the early response to infection, thus no

immediate impact on virus clearance. Another possibility may be linked to the location of

T cell activation. Findings from our lab show IDO to be active in the MLNs of influenza-

infected mice. It is possible that the T cell response is affected by the expression of IDO

in the lymph node, rather than in the lungs, which would help explain the lack of

differences in viral titers. Furthermore, influenza infection of epithelial cells induces

IDO (29); however, the role IDO has in lung epithelial cells has not been thoroughly

examined. IDO may be involved in cell survival, as it does have antioxidant properties,

which could reduce the damage caused by superoxides produced during infection (27).

In addition, increased tryptophan availability has been shown to aid in pathogen

proliferation (25), and this may also facilitate influenza replication.

Interestingly, there was no difference in the level of serum IgG titers between

1MT treated and control mice (data not shown), and the immunoglobulin isotype was the

same between the two groups (data not shown). These findings suggest that IDO has no

detectable effect on the B cell response to infection. This is consistent with an earlier

study that showed IDO treatment of peripheral blood derived B cells had no effect on B

122

cells or their proliferation (22). Furthermore, treatment with 1MT did not change the

expression of IFNγ from splenocytes 21 dpi by ELISPOT detection following influenza

peptide stimulation compared to control treated mice (data not shown). Since there was

an increase in the CD8+ T cell effector memory population, the effect in the memory

population may be more evident in the resident lung cells (not evaluated in this study).

In this study, increased IDO activity was induced following influenza virus

infection, a feature that had a dampening effect on the immune response. Specifically,

1MT-treated mice had higher numbers Th1-CD4+ T cells and effector memory CD8+ T

cells. IDO activity peaked in the lungs at day 10 post-infection, a finding consistent with

an earlier study (55). Early leukocyte recruitment to the lungs was not substantially

affected by IDO inhibition (data not shown). There are several possibilities for this that

relate to trp catabolism, particularly in the MLN. IDO metabolites have been shown to

induce apoptosis of T cells (26) and to sway the CD4+ T cells to a regulatory phenotype

(19). The production of regulatory T cells in the MLN could suppress the pulmonary T

cell recruitment. Preliminary work in our lab shows that 1MT treatment decreases the

number of cytotoxic Treg cells in the BAL. The lack of Treg suppression and production

of Trp metabolites may contribute to altered leukocyte trafficking, proliferation, and

increased survival of cells in the airways. Another possibility that is related to Treg

production is the inability of inhibitory molecules to produce an effect on the system.

The PD-1/PD-L pathway has been linked to IDO expression and activity (2). Tregs

activated by IDO up-regulate the expression of PD-L1/PD-L2 on dendritic cells (46).

The lack of PD-L expression will increase the activation and survival of the effector T

cell population (7).

123

The results from this study show that regulating IDO can enhance aspects of the

adaptive immune response to influenza infection. This is attractive as regulating IDO

activity during vaccination may facilitate vaccine efficacy. These observations support

the concept that controlling IDO activity during vaccination with the live, attenuated

influenza virus may be a means to augment vaccine efficacy and the robustness of the T

cell response, an attribute that could potentially facilitate heterosubtypic immunity.

Acknowledgements

We thank Dr. Phillip Chandler for his technical assistance with 1MT preparation and

administration, Spencer Poore and Scott Johnson for assistance with animal work, and the

NIH Tetramer Core Facility for generating the tetramers. This work was supported by

the National Institutes of Health U01 grant AI083005-01.

References

1. Andersson, J., A. Boasso, J. Nilsson, R. Zhang, N. J. Shire, S. Lindback, G.

M. Shearer, and C. A. Chougnet. 2005. The prevalence of regulatory T cells in

lymphoid tissue is correlated with viral load in HIV-infected patients. J Immunol

174:3143-3147.

2. Baban, B., P. R. Chandler, B. A. Johnson, 3rd, L. Huang, M. Li, M. L.

Sharpe, L. M. Francisco, A. H. Sharpe, B. R. Blazar, D. H. Munn, and A. L.

Mellor. 2011. Physiologic control of IDO competence in splenic dendritic cells. J

Immunol 187:2329-2335.

124







5. Boasso, A., J. P. Herbeuval, A. W. Hardy, S. A. Anderson, M. J. Dolan, D.

Fuchs, and G. M. Shearer. 2007. HIV inhibits CD4+ T-cell proliferation by

inducing indoleamine 2,3-dioxygenase in plasmacytoid dendritic cells. Blood

109:3351-3359.

6. Bridges, C. B., J. M. Katz, R. A. Levandowski, and N. J. Cox. 2008.

Inactivated influenza vaccines. In S. A. Potkin, W. A. Orenstein, and P. A. Offit

(ed.), Vaccines. Elsevier.

7. Brown, J. A., D. M. Dorfman, F. R. Ma, E. L. Sullivan, O. Munoz, C. R.

Wood, E. A. Greenfield, and G. J. Freeman. 2003. Blockade of programmed

death-1 ligands on dendritic cells enhances T cell activation and cytokine

production. J Immunol 170:1257-1266.





125

9. Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid

dendritic cells activated by influenza virus and CD40L drive a potent TH1

polarization. Nat Immunol 1:305-310.

10. Crowe, S. R., S. C. Miller, and D. L. Woodland. 2006. Identification of

protective and non-protective T cell epitopes in influenza. Vaccine 24:452-456.

11. Crowe, S. R., S. J. Turner, S. C. Miller, A. D. Roberts, R. A. Rappolo, P. C.

Doherty, K. H. Ely, and D. L. Woodland. 2003. Differential antigen

presentation regulates the changing patterns of CD8+ T cell immunodominance in

primary and secondary influenza virus infections. J Exp Med 198:399-410.

12. Culley, F. J. 2009. Natural killer cells in infection and inflammation of the lung.

Immunology 128:151-163.

13. Dai, H., and Z. Dai. 2008. The role of tryptophan catabolism in acquisition and

effector function of memory T cells. Curr Opin Organ Transplant 13:31-35.

14. de Bree, G. J., E. M. van Leeuwen, T. A. Out, H. M. Jansen, R. E. Jonkers,

and R. A. van Lier. 2005. Selective accumulation of differentiated CD8+ T cells

specific for respiratory viruses in the human lung. J Exp Med 202:1433-1442.

15. Doherty, P. C., D. J. Topham, R. A. Tripp, R. D. Cardin, J. W. Brooks, and

P. G. Stevenson. 1997. Effector CD4+ and CD8+ T-cell mechanisms in the

control of respiratory virus infections. Immunol Rev 159:105-117.

16. Fallarini, S., T. Paoletti, L. Panza, and G. Lombardi. 2008. Alpha-

galactosylceramide modulates the induction of indoleamine 2,3-dioxygenase in

antigen presenting cells. Biochem Pharmacol 76:738-750.

126


















Rep 59:1-62.

21. Flynn, K. J., G. T. Belz, J. D. Altman, R. Ahmed, D. L. Woodland, and P. C.

Doherty. 1998. Virus-specific CD8+ T cells in primary and secondary influenza

pneumonia. Immunity 8:683-691.

22. Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and G. B.

Ferrara. 2002. Tryptophan-derived catabolites are responsible for inhibition of T

127

and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J

Exp Med 196:459-468.

23. Grohmann, U., F. Fallarino, and P. Puccetti. 2003. Tolerance, DCs and

tryptophan: much ado about IDO. Trends Immunol 24:242-248.





3335.

25. Gupta, S. L., J. M. Carlin, P. Pyati, W. Dai, E. R. Pfefferkorn, and M. J.

Murphy, Jr. 1994. Antiparasitic and antiproliferative effects of indoleamine 2,3-

dioxygenase enzyme expression in human fibroblasts. Infect Immun 62:2277-

2284.

26. Hayashi, T., J. H. Mo, X. Gong, C. Rossetto, A. Jang, L. Beck, G. I. Elliott, I.

Kufareva, R. Abagyan, D. H. Broide, J. Lee, and E. Raz. 2007. 3-

Hydroxyanthranilic acid inhibits PDK1 activation and suppresses experimental

asthma by inducing T cell apoptosis. Proc Natl Acad Sci U S A 104:18619-

18624.



28. Hwu, P., M. X. Du, R. Lapointe, M. Do, M. W. Taylor, and H. A. Young.

2000. Indoleamine 2,3-dioxygenase production by human dendritic cells results in

the inhibition of T cell proliferation. J Immunol 164:3596-3599.

128



30. Kloetzel, P. M. 2001. Antigen processing by the proteasome. Nat Rev Mol Cell

Biol 2:179-187.

31. Kreijtz, J. H., R. A. Fouchier, and G. F. Rimmelzwaan. 2011. Immune

responses to influenza virus infection. Virus Res 162:19-30.

32. La Gruta, N. L., K. Kedzierska, K. Pang, R. Webby, M. Davenport, W.

Chen, S. J. Turner, and P. C. Doherty. 2006. A virus-specific CD8+ T cell

immunodominance hierarchy determined by antigen dose and precursor

frequencies. Proc Natl Acad Sci U S A 103:994-999.

33. La Gruta, N. L., W. T. Rothwell, T. Cukalac, N. G. Swan, S. A. Valkenburg,

K. Kedzierska, P. G. Thomas, P. C. Doherty, and S. J. Turner. 2010. Primary

CTL response magnitude in mice is determined by the extent of naive T cell

recruitment and subsequent clonal expansion. J Clin Invest 120:1885-1894.

34. Laich, A., G. Neurauter, B. Widner, and D. Fuchs. 2002. More rapid method

for simultaneous measurement of tryptophan and kynurenine by HPLC. Clin

Chem 48:579-581.

35. Lee, G. K., H. J. Park, M. Macleod, P. Chandler, D. H. Munn, and A. L.

Mellor. 2002. Tryptophan deprivation sensitizes activated T cells to apoptosis

prior to cell division. Immunology 107:452-460.

36. Liu, Z., H. Dai, N. Wan, T. Wang, S. Bertera, M. Trucco, and Z. Dai. 2007.

Suppression of memory CD8 T cell generation and function by tryptophan

catabolism. J Immunol 178:4260-4266.

129




Dis 203:715-725.

38. Matrosovich, M., T. Matrosovich, W. Garten, and H. D. Klenk. 2006. New

low-viscosity overlay medium for viral plaque assays. Virol J 3:63.

39. Mueller, S. N., W. A. Langley, E. Carnero, A. Garcia-Sastre, and R. Ahmed.

2010. Immunization with live attenuated influenza viruses that express altered

NS1 proteins results in potent and protective memory CD8+ T-cell responses. J

Virol 84:1847-1855.







642.






130


replication in the lung during acute infection. Cytokine.

44. Oshansky, C. M., and P. G. Thomas. 2012. The human side of influenza. J

Leukoc Biol 92:83-96.

45. Roberts, A. D., K. H. Ely, and D. L. Woodland. 2005. Differential contributions

of central and effector memory T cells to recall responses. J Exp Med 202:123-

133.





47. Tanaka, K., and M. Kasahara. 1998. The MHC class I ligand-generating

system: roles of immunoproteasomes and the interferon-gamma-inducible

proteasome activator PA28. Immunol Rev 163:161-176.

48. Taylor, P. M., and B. A. Askonas. 1986. Influenza nucleoprotein-specific

cytotoxic T-cell clones are protective in vivo. Immunology 58:417-420.

49. Terness, P., T. M. Bauer, L. Rose, C. Dufter, A. Watzlik, H. Simon, and G.

Opelz. 2002. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-

dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan

metabolites. J Exp Med 196:447-457.



131

51. Uyttenhove, C., L. Pilotte, I. Theate, V. Stroobant, D. Colau, N. Parmentier,

T. Boon, and B. J. Van den Eynde. 2003. Evidence for a tumoral immune

resistance mechanism based on tryptophan degradation by indoleamine 2,3-

dioxygenase. Nat Med 9:1269-1274.

52. Wainwright, D. A., I. V. Balyasnikova, A. L. Chang, A. U. Ahmed, K. S.

Moon, B. Auffinger, A. L. Tobias, Y. Han, and M. S. Lesniak. 2012. IDO

expression in brain tumors increases the recruitment of regulatory T cells and

negatively impacts survival. Clin Cancer Res.

53. Wilkinson, T. M., C. K. Li, C. S. Chui, A. K. Huang, M. Perkins, J. C.

Liebner, R. Lambkin-Williams, A. Gilbert, J. Oxford, B. Nicholas, K. J.

Staples, T. Dong, D. C. Douek, A. J. McMichael, and X. N. Xu. 2012.

Preexisting influenza-specific CD4(+) T cells correlate with disease protection

against influenza challenge in humans. Nat Med 18:274-280.

54. Yang, H. J., M. C. Yen, C. C. Lin, C. M. Lin, Y. L. Chen, T. Y. Weng, T. T.

Huang, C. L. Wu, and M. D. Lai. 2010. A combination of the metabolic enzyme

inhibitor APO866 and the immune adjuvant L-1-methyl tryptophan induces

additive antitumor activity. Exp Biol Med (Maywood) 235:869-876.



Acad Sci U S A 76:4084-4086.

56. Zhong, W., P. A. Reche, C. C. Lai, B. Reinhold, and E. L. Reinherz. 2003.

Genome-wide characterization of a viral cytotoxic T lymphocyte epitope

repertoire. J Biol Chem 278:45135-45144.

132

Figure 3.1. Influenza infection increases IDO activity in the lungs and sera. Mice were

treated with 1MT or control three days prior to infection. On day 0, i.e. 3 days after

treatment, mice were i.n. infected with 103 PFU X31 in PBS. (a) Serum, and (b) lung

homogenate were collected every other day from day 0 (uninfected animals) until day 14

pi. Each time point represents the mean and SEM of 3-5 mice/group and shows two

independent experiments. (**p value <0.01 and *p value < 0.05)

133

Figure 3.2. 1MT treatment does not affect total frequency of T cells infiltrating the

lungs. Mice were treated with 1MT or control three days prior to infection and

subsequently infected with 103 PFU of X31 i.n. (a) BAL and (b) MLN cells numbers

from day 10 pi. Number of CD8+ and CD4+ T cells in the (c) BAL and (d) MLN.

Representative data from one experiment is shown from 3 independent experiments. (*p

value < 0.05)

134

Figure 3.3. IDO inhibition does not change viral titers. Mice were treated with 1MT or

control three days prior to infection. On day 0, mice were anesthetized and intranasally

infected with 103 PFU X31 in PBS. Lungs were harvested and homogenized in PBS

containing antibiotic and antimycotic. (a) Clarified homogenate was titered by TCID50

on MDCK in the presence of trypsin as previously described. (b) Viral antigen was

determined by qRT-PCR on the M gene and quantified using a standard curve. The limit

of detection (LD) of the assay is denoted with a dashed line.

135

Figure 3.4. 1MT treatment enhances the Th1 response. Mice were treated with 1MT or

control, as described, and infected with 103 PFU X31 i.n. Ten days post-infection, BAL

cells were stimulated for 6h with UV-inactivated influenza virus and subsequently

stained for intracellular expression of IFNγ, IL-6, and IL-4. (a) Representative dot plots

of CD4+ T cells expressing IFNγ, IL-6, and IL-4. (b, d ,f) Proportion and (c, e, g)

frequency of CD4+ T cells expressing (b, c) IFNγ, (d, e) IL-6, and (f, g) IL-4.

136

Representative data from one experiment is shown from 3 independent experiments. (**p

value <0.01 and *p value < 0.05)

137

Figure 3.5. IDO inhibition enhances the influenza specific response. Mice were treated

with 1MT or control, as described, and infected with 103 PFU X31 i.n. On day 10 pi,

BAL cells were analyzed for virus-specific CD8+ T cell numbers as determined by

tetramers specific to NP366-374, PA224-233, or PB1703-711. (a) Proportion and (b) frequency

of CD8+ T cells are shown Representative data from one experiment is shown from 3

independent experiments. (*p value < 0.05)

138

Figure 3.6. IDO inhibition increases the frequency of functional PA-specific CD8+ T

cells. Mice were treated with 1MT or control, as described, and infected with 103 PFU

139

X31 i.n. Ten days post-infection, single cells from the BAL were stimulated for 4h with

influenza immunodominant peptides and subsequently stained for intracellular expression

of IFNγ. (a, b) Representative dot plots of (a) CD8+ T cells and (b) influenza-specific

CD8+ T cells expressing IFNγ. (c) Percentage and (d) frequency of CD8+ T cells

expressing IFNγ. (e) Percentage and (f) frequency of influenza-specific CD8+ T cells

expressing IFNγ. Representative data from one experiment is shown from 3 independent

experiments. (*p value < 0.05)

140

Figure 3.7. Inhibition of IDO activity increases the presence of CD8+ effector memory

cells. Mice were treated with 1MT or control three days prior to infection. On day 0,

mice were i.n. infected with 103 PFU X3. (a, b) CD8+ and (c, d) CD4+ T cells collected

10 dpi from the BAL were stained for the presence of CD44 and CD62L. Representative

data from one experiment is shown from 2 independent experiments. (*p value < 0.05)

141

CHAPTER 4

INTERFERON LAMBDA UPREGULATES IDO1 EXPRESSION IN RESPIRATORY

EPITHELIAL CELLS FOLLOWING INFLUENZA VIRUS INFECTION2

2Fox, J. M., Crabtree, J. M., Sage, L. K., Tompkins, S. M., Tripp, R.A. To be resubmitted

to Journal of Immunology

142

Abstract

Influenza infection causes an increase in indoleamine 2, 3-dioxygenase (IDO)

activity in the lung parenchyma. IDO catabolizes tryptophan into kynurenine leading to

immune dampening. Multiple cell types express IDO, and while IFNγ up-regulates IDO

in dendritic cells and macrophages, it is unclear how IDO is affected in respiratory

epithelial cells during influenza infection. In this study, the role of IFNλ in IDO

regulation was investigated following influenza infection of respiratory epithelial cells.

IDO1 expression increased concurrently with IFNλ expression. Recombinant IFNλ up-

regulated IDO1 activity, IFNλ neutralizing antibodies decreased IDO1 expression during

influenza infection, and IDO1 inhibition was associated with decreased lung viral titers.

Furthermore, kynurenine was released from the cells basal-laterally. These studies show

a role for IDO in the host response to influenza infection, and provide insight into novel

approaches for enhancing vaccine responses and therapeutic approaches.

143

Introduction

Influenza is a significant worldwide health concern. During respiratory infection,

influenza mainly infects the respiratory epithelium which supports virus replication as

well as initiates the antiviral state in response to infection (23). Virus infection of the

epithelium stimulates the production of type I and type III IFNs (IFNλ) with IFNλ being

the main IFN expressed in response to influenza infection in mice (12).

Interferon lambda consists of three subtypes, IFNλ-1, IFNλ-2, IFNλ-3 (7).

Although IFNλ and type I IFNs have similar activities, a primary difference is the

receptor utilization (27). IFNλ binds to the IFNλR, which consists of the IFNLR1 (IL-

28Rα) and IL-10R2 (7). The IL-10R2 is ubiquitously expressed on the surface of most

cells, while IFNLR1 is mainly expressed on epithelial cell lining the respiratory and

gastrointestinal tract (25), as well as by plasmacytoid dendritic cells (pDCs) in mice (17).

In contrast, type I IFNs utilizes IFN-αR1 and IFN-αR2 which are present on most cell

types (8). Since the complete IFNλ receptor is found on epithelial cells, its role in

antiviral immunity is unique to these cell types. After binding to their receptors, type I

and type III IFNs have similar signaling pathways through dimerization of Stat1 and

Stat2 which can in turn recognize IFNγ activation site sequence and IFN-stimulated

response elements (7).

Indoleamine 2, 3-dioxygenase (IDO) is an intracellular enzyme in the kynurenine

pathway that catabolizes tryptophan (trp) into kynurenine (kyn3) which leads to immune

suppression and attenuation (18). IDO is expressed by dendritic cells, macrophages (9),

and epithelial cells (26). Since respiratory epithelial cells are a primary target for

influenza replication, it is critical to understand the role IDO has during influenza

144

infections. The IDO gene contains an IFN-stimulated response element in its promoter

(20), is highly up-regulated by stimulation with IFNγ, and modestly up-regulated by type

I IFNs (5); however, the effect of type III IFNs has not been evaluated.

To understand the relationship between IFN and IDO during the early stages of

the host response to influenza infection, mouse and human respiratory epithelial cell

models were investigated. The findings indicated that IDO1 was up-regulated following

influenza virus infection and by concomitant IFNλ expression. Inhibition of IDO activity

using 1-methyl-D, L- tryptophan (1MT) resulted in decreased viral burden and viability

in the epithelial cells. Furthermore, kyn, metabolite of IDO, was secreted basally from

influenza infected cells. These results define a role for IFNλ during influenza infection,

and show that IFNλ directly stimulates IDO activity.


Cell culture and viruses. MLE-15 cells were cultured in HITES media [RMPI 1640

media (Cellgro, Manassas, VA) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis,

MO), 10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1%

ITS (insulin-transferring-selenium; Gibco)] with 4% FBS (culture media). Madin Darby

Canine Kidney (MDCK) cells were cultured in DMEM (HyClone, Logan, UT) with 5%

FBS. Human lung epithelial (Beas2B) cells were cultured in BronchialLife Basal media

supplemented with B/T LifeFactors (LifeLine Cell Technology, Frederick, MD). Normal

human bronchial epithelial (NHBE) cells (LifeLine Cell Technology) were cultured and

maintained as previously described (13, 19). NHBE cells were maintained at an air-

liquid-interface at 37°C with 5% CO2 until fully differentiated. Basal media was

145

changed every 2 days and apical surface was rinsed with PBS after two weeks at air.

A/WSN/33 (H1N1; WSN) and A/HK/X31 (H3N2; X31) influenza viruses were

propagated in the allantoic cavity of 9-day-old embryonated chicken eggs. Titers were

determined by a standard plaque assay on MDCK cells in the presence of 5% FBS or

trypsin at 37C for WSN and X31, respectively (15).

WSN infection of epithelial cells and stimulation with rIFNλ. MLE-15 and Beas2B cells

were cultured on 24-well plates at 6 x 105 cells/well or 2 x 10

5 cells/well, respectively.

Cells were rinsed once with PBS followed by infection with WSN in infection media

(HITES media + 4% FBS for MLE-15 cells and BronchialLife Basal media with

supplements + 2% FBS for Beas2B cells) for 1 hour at 37C. Cells were rinsed 3 times

with PBS and fresh infection media was added to the cells. The cells were incubated at

37C for the indicated amount of time. Differentiated NHBE cells were cultured on a

transwell plate, as described above. Cells were rinsed 3 times with PBS followed by

infection with WSN apically in BronchialLife Basal media without supplements for 1

hour at 37°C. After infection, cells were rinsed 3 times with PBS, the final rinse was

removed and the cells were incubated at 37°C for indicated times. RNA was harvested as

described below and supernatant was collected and stored at -80C. IFNλ activity was

blocked during infection on MLE-15 cells using an IFNλ2/3 neutralizing antibody (nAb)

(R&D Systems, Minneapolis, MN) at 9μg/ml. IFNλ expression was silenced in MLE-15

cells with a siRNA targeting IL28b (IFNλ3; siIL28b) (ON-TARGETplus Il28b siRNA

SMARTpool; Thermo Scientific, Pittsburgh, PA). Briefly, MLE-15 cells were transfected

16h prior to infection with WSN using Dharmafect 1 following manufacturer’s protocol

146

with the siRNA at a concentration of 100nM. A non-targeting control (siNEG; Thermo

Scientific) was included at the same concentration. IDO activity was blocked during

infection using 1-methyl-D, L-tryptophan (1MT; Sigma-Aldrich) at 750uM. Viral titers

were determined from cell culture supernatant at times indicated using a TCID50 method

as previously described (24), with dilutions prepared in DMEM (Hyclone) with 5% FBS.

The TCID50 was calculated using the Reed and Meunch method (22). MLE-15 cells

were stimulated with recombinant IFNλ3 (rIFNλ; eBiosciences, San Diego, CA) prepared

in culture media with an unstimulated control. Differentiated NHBE cells were apically

stimulated with recombinant IFNλ1 (rIFNλ1; eBiosciences) or IFNλ2 (rIFNλ2;

eBiosciences) in BronchialLife Basal media without supplements for 1 hour at 37°C.

After stimulation, cells were rinsed 3 times with PBS, the final rinse was removed and

the cells were incubated at 37°C for indicated times.

qPCR for detection of mRNA. RNA was isolated at respective time-points from samples

using the RNeasy mini kit (Qiagen, Valencia, CA) following the manufacture’s protocol

and stored at -20C. Isolated RNA was DNase treated using DNase I recombinant

(Roche, Indianapolis, IN) following manufacture’s protocol. DNase treated RNA was

quantified using the Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was

synthesized using Verso cDNA kits (Thermo Scientific, Lafayette, CO) following the

manufacture’s protocol using equivalent concentrations of RNA for each experiment.

qPCR was used to detect murine (Mm) IDO1 (Forward-

GCACGACATAGCTACCAGTCT, Reverse- CCACAAAGTCACGCATCCTCTTAA,

Probe-5’-6FAM-AAAGCCAAGGAAATTT-MGBNFQ-3’), Mm IDO2 (Forward-

147

CTTCATCCTAGTGACAGTCTTGGT, Reverse-GCCTCCATTCCCTGAACCA, Probe-

5’-6FAM-CACTGCTGCCTTCTC-MGBNFQ-3’), Mm IFNλ2/3 (Forward-

CAGTGGAAGCAAAGGATTGCCACA, Reverse-

AACTGCACCTCAGGTCCTTCTCAA, Probe-5’-6FAM-

AAAGGCCAAGGATGCCATCGAGAAGA-MGBNFQ-3’). The cycling times were

95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 52°C for 1 min, and 68°C for

1 min. All samples were normalized to a housekeeping gene, HPRT (Applied

Biosystems, Foster City, CA) or GAPDH. mRNA expression was determined using 2^(-

ΔΔCt).

Evaluating IDO activity by measuring kyn concentrations. The cells were either infected

with WSN as previously described or stimulated with rIFNλ in phenol red free culture

media. Exogenous trp (50M; Sigma-Aldrich) was added to each well 24 h prior to

collection of supernatant. At 24 h post addition of trp, cellular supernatant was collected

and stored at -80C. For NHBE cells, exogenous trp (50M; Sigma-Aldrich) was added

to the basal media 24h prior to collection. At time of collection, the apical surface was

rinsed with PBS and the basal media was obtained and stored at -80°. Concentration of

kyn was determined using a kyn colorimetric assay with a standard curve of kyn

concentrations in PBS (Sigma-Aldrich). Briefly, proteins were removed by addition of

30% tricholoracetic acid (TCA; VWR, Radnor, PA) and incubated at 50°C for 30 min to

hydrolyze n-formylkynurenine to kyn. Samples were then centrifuged at 2400 rpm for 10

min at 4°C. Supernatants were incubated with Erlich’s reagent for 10 min. Absorbance

was read at 490nm using an Epoch microplate reader (BioTek, Winooski, VT).

148

Quantification of IFNλ and IFNα. IFNλ was quantified from infected cell supernatant

using a VeriKine-DIY Mouse interferon lambda 2/3 ELISA (PBL Interferon Source,

Piscataway, NJ) following the manufacture’s protocol. IFNα was quantified using the

Mouse IFN-alpha FlowCytomix Simplex Kit (eBiosciences, San Diego, CA) following

the manufacture’s protocol. Samples were run on a LSRII (BD Biosciences, San Jose,

CA) and analyzed using the provided software. IFNλ and IFNα was quantified from

human cells (Beas2B and NHBE) using the VeriKine-DIY Human Interleukin-

29/Interferon Lambda ELISA and VeriKine Human Interferon Alpha ELISA Kit (PBL

Interferon Source) following the manufacture’s protocol.

Evaluation of cell death following infection. MLE-15 cells were infected with WSN, as

described above, and cell supernatant collected at the indicated time points. Adenylate

kinase release was detected using the ToxiLight kit (Lonza, Allendale, NJ) following

manufacturer’s instructions. Complete lysis controls were treated with 1% triton-x 100

(Sigma-Aldrich) in PBS for 10 min. Percent cell death was calculated using the equation

[(I- UI)/(C-UI)]*100, where I= infected sample, UI= uninfected samples of the same

treatment as infected sample, C= complete lysis control.

Statistical Analysis. Statistics were performed using GraphPad Prism Version 5.04 (La

Jolla, CA). Significance was assigned when the *p < 0.05, **p<0.01, ***p<0.001,

****p<0.0001 using either a student’s t-test or ANOVA with a Bonferroni post-hoc test,

as listed in the figure legends.

https://www.interferonsource.com/content/verikine-diy-human-interleukin-29interferon-lambda-elisa

https://www.interferonsource.com/content/verikine-diy-human-interleukin-29interferon-lambda-elisa

https://www.interferonsource.com/content/verikine-human-interferon-alpha-elisa-kit

149

Results

Influenza infection up-regulates expression of IDO1 over IDO2.

A paucity of information is available regarding IDO expression during influenza

infection. To address this, MLE-15 cells were infected with WSN, and IDO1 and IDO2

mRNA evaluated over the course of infection (Fig. 4.1A). At 48h post-infection (hpi),

IDO1 and IDO2 were significantly up-regulated compared to uninfected controls;

however, IDO1 was preferentially expressed over IDO2 (Fig. 4.1A). To corroborate this

finding, a different influenza virus, X31, was used (Fig. 4.2A). MLE-15 cells infected

with X31 were examined at 24 and 48 hpi for IDO1 and IDO2 expression. Similar to the

WSN infection, IDO1 was more highly expressed than IDO2; however, the kinetics of

IDO1 expression was shifted where IDO1 peaked at 24 hpi rather than 48 hpi (Fig. 4.2A).

These findings likely reflect differences in virus replication between WSN and X31.

To determine if the level of IDO up-regulation correlated with virus replication,

MLE-15 cells were infected at varying MOI of WSN, and mRNA expression and IDO

activity was evaluated. IDO activity was determined by the level of the IDO metabolite,

kynurenine (kyn), produced from IDO-mediated trp catabolism. The results showed

IDO1 mRNA expression increased with increasing MOI (Fig. 4.3A). At an MOI of 0.1,

IDO1 mRNA expression was reduced and this may be linked to loss of cell viability due

to higher infectious dose (data not shown). Importantly, as the MOI increased there was

also an increase in IDO activity which was significant at 48 hpi and 72 hpi (Fig 4.1B).

These findings indicate that influenza infection induces increased IDO1 expression and

activity in MLE-15 cells.

150

Since the IDO1 mRNA expression and activity were initially determined in a

mouse cell line, we want to validate the increase in IDO activity following influenza

infection utilizing a more relevant human bronchial epithelial cell line, Beas2B cells and

fully differentiated normal human bronchial epithelial (NHBE) cells. Similar to the

MLE-15 cells, there was an increase in IDO activity in the Beas2B cells with increasing

MOI at 48 hpi and 72 hpi, which was significant for the highest MOI compared to

uninfected controls (Fig. 4.1C). Furthermore, WSN infection of the NHBE cells

increased the concentration of kyn present in the basal media (Fig. 4.1D). There was no

detectable kyn present in the NHBE apical washes (data not shown), suggesting that the

effect of IDO induction following influenza infection is reducing the trp concentration on

the basal-lateral side of the lung airways. These results indicate that IDO1 mRNA

expression and activity are increased across mouse and human lung epithelial cells

following influenza infection.

Peak IDO1 and IFNλ expression coincide.

During influenza virus infection antiviral IFNs are expressed. To determine the

pattern of IFN expression, MLE-15 cells were infected with WSN and IFNλ and IFNα

levels were determined at 24, 48, and 72 hpi (Fig. 4.4A). At 24 hpi, IFNλ was primarily

detected in the MLE-15 cell supernatant; however, at 48 hpi, the concentration of IFNλ

peaked and was significantly higher than IFNα. Interestingly, peak IDO1 mRNA

expression also occurred at 48 hpi (Fig. 4.1A), a feature consistent with the hypothesis

that IFNλ drives IDO1 expression. No IFNγ mRNA was present in the cells at any time

point post-infection (data not shown), indicating that IDO1 was not up-regulated by

151

IFNγ. To correlate increased IDO activity with increasing MOI (Fig. 4.3B), the amount

of IFNλ produced in cell supernatant was analyzed. Increased MOI resulted in increased

IFNλ in the supernatant (Fig. 4.3B). The significant increase in IFNλ production over

IFNα was also seen during WSN infection in Beas2B and NHBE cells at each time point

(Fig. 4.4B & C). Peak IFNλ expression also occurred at 48 hpi (Fig. 4.4B), which is

consistent with increased IDO activity (Fig. 4.1C & D). These results suggest that IFNλ

produced during influenza infection upregulates the expression and activity of IDO.

To confirm that IFNλ expression drives IDO expression, the level of IFNλ mRNA

expression in MLE-15 cells was assessed following infection with X31. IFNλ mRNA

expression peaked at 24 hpi (Fig. 4.2B), a finding consistent with peak IDO1 expression

(Fig. 4.2A). These results suggest that IFNλ from infected MLE-15 cells may be

signaling neighboring cells through their IFNλR to express IDO1.

IFNλ up-regulates IDO1.

It is established that type I and type II IFNs can induce IDO activity (5).

However, as IFNλ was predominantly expressed following WSN infection, recombinant

IFNλ (rIFNλ) was evaluated for its ability to stimulate IDO expression. Since the

Beas2B cells had similar results as the NHBE cells (Fig. 4.1 & 4.4), we evaluated IFNλ

stimulation of IDO in the MLE-15 and NHBE cells. Stimulation of the MLE-15 cells for

24h with rIFNλ3 had a significant increase in IDO1 mRNA expression compared to

unstimulated cells (Fig. 4.5A). The IDO1 increase was dose-dependent (Fig. 4.5A). IFNλ

mediated up-regulation of IDO1 had minimal effect on IDO2, a finding that is consistent

with influenza results (Fig. 4.1A). Notably, there was also a dose-response effect in IDO

152

activity following IFNλ stimulation (Fig. 4.5B) where increasing concentrations of IFNλ

were associated with increased IDO activity. Similar results were observed in the NHBE

cells. rIFNλ1 (IL-29) or rIFNλ2 (IL-28a) stimulation was able to significantly increase

IDO activity as compared to unstimulated cells (Fig. 4.5C). As previously seen during

WSN infection (Fig. 4.1D), IFNλ stimulation also increased the kyn levels in the basal

media with limited concentrations present in the apical washes (Fig. 4.5C). These

findings show that IFNλ can directly stimulate IDO activity primarily through IDO1.

Since the recombinant IFNλ stimulated IDO1 expression, it was important to

confirm that IFNλ is a source of IDO1 stimulation during influenza infection. Since IFNλ

induced IDO activity in the mouse and human cells, only the MLE-15 cells were used for

the remainder of the study. MLE-15 cells were infected with WSN in the presence or

absence of an IFNλ2/3 neutralizing antibody (nAb). The presence of nAb decreased

IDO1 expression (Fig 4.6A), however there was still IDO1 mRNA compared to

uninfected cells suggesting there is likely another factor affecting IDO1 expression. We

validated the role of IFNλ in IDO induction by silencing IFNλ3 using small interfering

RNA (siRNA). Treatment with the siRNA targeting IFNλ3 (siIFNλ3) significantly

reduced the relative gene expression of IFNλ compared to non-targeting control (siNEG)

(Fig. 4.6B). When the MLE-15 cells were infected with WSN after transfection with

siIFNλ3, there was a significant reduction in IDO1 mRNA expression compared to

siNEG treated cells (Fig. 4.6C). These results show that IFNλ is partly responsible for

the up-regulation of IDO during an influenza infection. Other factors may be involved in

IDO up-regulation, such as type I IFNs. Also it is possible that when both type I and type

III IFNs are present, they may act synergistically to increase IDO1 expression.

153

Inhibition of IDO decreases viral load and increases cell death.

Since IDO is upregulated during influenza infection of MLE-15 cells, a feature

linked to IFNλ expression, it was important to evaluate the consequence of IDO

expression on virus clearance. To test this, MLE-15 cells were infected with WSN in the

presence or absence of 1-methyl-D, L-tryptophan (1MT). 1MT blocks IDO activity

through competitive inhibition and the racemic mixture will inhibit both IDO1 and IDO2

activity (14, 21). The concentration of 1MT used was able to inhibit IDO during

influenza infection based on IDO activity and caused minimal cellular cytotoxicity (2-3%

increase in cell death compared to untreated uninfected controls; data not shown). When

IDO was inhibited during influenza infection, there was decreased viral load at 24 hpi

and a significant decrease in viral titers at 48 hpi compared to untreated controls (Fig.

4.7A). To confirm that the decrease in viral titers was not associated with increased cell

death, cellular supernatants were tested for the presence of adenylate kinase and

compared to uninfected and completely lysed cells. At 24 and 48 hpi, there were no

significant differences between cells receiving 1MT versus control media (Fig. 4.7B).

However, at 72 hpi, there was a significant increase in the amount of cell death with cells

receiving 1MT (Fig. 4.7B). To confirm that inhibition of IDO reduced viral load and it

was not an effect of 1MT treatment, transduced MLE-15 cells expressing a short hairpin

RNA (shRNA) targeting either IDO1 (shIDO1) or a non-silencing control (shNEG) were

infected with WSN and viral load was determined. MLE-15 cells expressing shIDO1 had

significantly reduced viral loads at 48 hpi, which continued to be reduced compared to

shNEG cells through 72 hpi (Fig. 4.7C). These results show that the absence of IDO

154

decreases viral burden early during infection and reduces cellular viability at later time

points post-infection.

Discussion

Respiratory epithelial cells respond to influenza infection to limit virus replication

through elaboration of antiviral IFNs (2). The results from this study show that influenza

infection of epithelial cells upregulates IDO activity, specifically IDO1, which is partially

driven by IFNλ. This finding is important as IDO attenuates the immune response to

virus infection and because this is the first demonstration that IFNλ is an inducer of IDO1

in the context of influenza infection. Notably, upregulation of IDO following influenza

infection was shown to be linked to increased viral load. Recently, a second IDO enzyme,

IDO2, was recognized and findings are emerging on the differential regulation between

IDO1 and IDO2. IDO1 has been shown to be highly up-regulated in response to IFN

stimulation (3), while IDO2 appears more involved in tumor immunology (4). The

findings reported here that influenza preferentially upregulates IDO1 over IDO2 is

important when considering features driving the antiviral state.

Another interesting result from these studies was the basal secretion of kyn from

influenza and IFN stimulated differentiated NHBE cells (Fig 4.1D and 4.5C). NHBE

cells mimic the lung airways through their ability to differentiate and be maintained at the

air-liquid interface. These cells provide the opportunity to evaluate molecules secreted

from the apical and basal surfaces of the cells. Kyn was only detected in the basal media

suggesting that the effects of IDO activity are directed toward the recruited cell

populations rather than the virus. Furthermore, there was high concentration of kyn

155

present in the basal media of uninfected and unstimulated NHBE cells. Preliminary

results show that as the NHBE cells are being differentiated at the air-liquid interface

there is a steady increase in the concentration of kyn that reaches the levels observed in

these studies by 2 weeks at air (data not shown). This suggests that the bronchial

epithelial cells present in the lungs constitutively have a low level of IDO activity.

Importantly, in the presence of influenza infection or IFN stimulation there was an

increase in the concentration of kyn over the control cells.

Although IFNλ is involved in mediating an antiviral state, IFNλ-mediated IDO

induction was linked to higher viral titers compared to cells with IDO inhibited (Fig

4.7A). There are several possibilities for the decreased viral titers when IDO activity is

blocked. One is reduced cell viability. Although there was not a significant difference

between 1MT administration cell death at 48 hpi (Fig 4.7B), it is possible that changes in

cellular functions may reduce the capacity of the cell to produce virus. IDO has been

shown to impart antioxidant properties following influenza infection by using superoxide

anion as a substrate, thus protecting the cell from oxidative damage (10, 11). These

cellular changes would occur at early stages of cell death, and perhaps be more

distinguishable at later time-points, thus providing a pro-survival response for the

epithelial cells. Another possibility may involve the 1MT treatment. A study showed that

1MT can work independently of IDO to enhance or change the response to TLR

stimulation in dendritic cells (1). We addressed this hypothesis by using shRNA

transduced MLE-15 to silence IDO1 expression. While there was still reduced WSN viral

load in the shIDO1 MLE-15 cells compared to shNEG cells, the pattern was altered (Fig

4.7C). Treatment with 1MT showed reduced viral titers at 24 and 48 hpi, but by 72 hpi,

156

1MT treatment had no effect compared to control treated cells (Fig 4.7A). While shIDO1

transduced cells showed reduced viral load 48 and 72 hpi (Fig 4.7C), suggesting that

1MT may potentially be playing an additional role in enhancing TLR signaling following

influenza infection at early time points.

In addition to sharing downstream signaling pathways with type I and II IFNs for

IDO induction, IFNλ has also been shown to dampen the immune response through Treg

stimulation. One report showed that dendritic cells stimulated with IFNλ triggered the

proliferation of Foxp3-expressing Treg cells (16). Also, IFNλ in conjunction with IFNα

expression during respiratory syncytial virus infection has been shown to suppress CD4+

T cell proliferation, where the suppression could be blocked by addition of neutralizing

antibodies to the IFN receptors (6). These studies support a mechanism by which IFNλ is

inducing IDO expression and inducing a regulatory phenotype.

In summary, the results from this study show a mechanism of IDO up-regulation

through IFNλ signaling. This finding is of significance as IFNλ can only act on a limited

number of cells, so this response is unique to epithelial cells and pDCs. These studies

also show a role of IDO in increasing viral titers in epithelial cells which could be

associated with reduced cellular death. Thus, this study enhances the link between IDO

activity and regulation during infection and support the need for continued studies on

IDO’s role in vaccine development.

157

Acknowledgements

We thank Elizabeth O’Connor for her help and Dr. Wendy Watford for providing and

assisting with reagents. This work was supported by the National Institutes of Health

U01 grant AI083005-01 and the Georgia Research Alliance.

References

1. Agaugue, S., L. Perrin-Cocon, F. Coutant, P. Andre, and V. Lotteau. 2006. 1-

Methyl-tryptophan can interfere with TLR signaling in dendritic cells

independently of IDO activity. J Immunol 177:2061-2071.

2. Ank, N., and S. R. Paludan. 2009. Type III IFNs: new layers of complexity in

innate antiviral immunity. Biofactors 35:82-87.

3. Ball, H. J., A. Sanchez-Perez, S. Weiser, C. J. Austin, F. Astelbauer, J. Miu,

J. A. McQuillan, R. Stocker, L. S. Jermiin, and N. H. Hunt. 2007.

Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans

and mice. Gene 396:203-213.







6. Chi, B., H. L. Dickensheets, K. M. Spann, M. A. Alston, C. Luongo, L.

Dumoutier, J. Huang, J. C. Renauld, S. V. Kotenko, M. Roederer, J. A.

158

Beeler, R. P. Donnelly, P. L. Collins, and R. L. Rabin. 2006. Alpha and lambda

interferon together mediate suppression of CD4 T cells induced by respiratory

syncytial virus. J Virol 80:5032-5040.

7. Commins, S., J. W. Steinke, and L. Borish. 2008. The extended IL-10

superfamily: IL-10, IL-19, IL-20, IL-22, IL-24, IL-26, IL-28, and IL-29. J Allergy

Clin Immunol 121:1108-1111.

8. de Weerd, N. A., S. A. Samarajiwa, and P. J. Hertzog. 2007. Type I interferon

receptors: biochemistry and biological functions. J Biol Chem 282:20053-20057.

9. Fallarino, F., C. Vacca, C. Orabona, M. L. Belladonna, R. Bianchi, B.

Marshall, D. B. Keskin, A. L. Mellor, M. C. Fioretti, U. Grohmann, and P.

Puccetti. 2002. Functional expression of indoleamine 2,3-dioxygenase by murine

CD8 alpha(+) dendritic cells. Int Immunol 14:65-68.








vivo. J Virol 84:11515-11522.

13. Krunkosky, T. M., B. M. Fischer, L. D. Martin, N. Jones, N. J. Akley, and K.

B. Adler. 2000. Effects of TNF-alpha on expression of ICAM-1 in human airway

159

epithelial cells in vitro. Signaling pathways controlling surface and gene

expression. Am J Respir Cell Mol Biol 22:685-692.

14. Lob, S., A. Konigsrainer, D. Zieker, B. L. Brucher, H. G. Rammensee, G.

Opelz, and P. Terness. 2009. IDO1 and IDO2 are expressed in human tumors:

levo- but not dextro-1-methyl tryptophan inhibits tryptophan catabolism. Cancer

Immunol Immunother 58:153-157.



16. Mennechet, F. J., and G. Uze. 2006. Interferon-lambda-treated dendritic cells

specifically induce proliferation of FOXP3-expressing suppressor T cells. Blood

107:4417-4423.

17. Mordstein, M., E. Neugebauer, V. Ditt, B. Jessen, T. Rieger, V. Falcone, F.

Sorgeloos, S. Ehl, D. Mayer, G. Kochs, M. Schwemmle, S. Gunther, C.

Drosten, T. Michiels, and P. Staeheli. 2010. Lambda interferon renders

epithelial cells of the respiratory and gastrointestinal tracts resistant to viral

infections. J Virol 84:5670-5677.




642.

19. Oshansky, C. M., J. P. Barber, J. Crabtree, and R. A. Tripp. 2010.

Respiratory syncytial virus F and G proteins induce interleukin 1alpha, CC, and

160

CXC chemokine responses by normal human bronchoepithelial cells. J Infect Dis

201:1201-1207.

20. Popov, A., Z. Abdullah, C. Wickenhauser, T. Saric, J. Driesen, F. G.

Hanisch, E. Domann, E. L. Raven, O. Dehus, C. Hermann, D. Eggle, S.

Debey, T. Chakraborty, M. Kronke, O. Utermohlen, and J. L. Schultze. 2006.

Indoleamine 2,3-dioxygenase-expressing dendritic cells form suppurative

granulomas following Listeria monocytogenes infection. J Clin Invest 116:3160-

3170.

21. Qian, F., J. Liao, J. Villella, R. Edwards, P. Kalinski, S. Lele, P. Shrikant,

and K. Odunsi. 2012. Effects of 1-methyltryptophan stereoisomers on IDO2

enzyme activity and IDO2-mediated arrest of human T cell proliferation. Cancer

Immunol Immunother.

22. Reed, L. J., and H. Meunch. 1938. A simple method for estimating fifty

160160rcent endpoints. American Journal of Hygiene 27:493-497.



24. Smith, J. H., P. Brooks, S. Johnson, S. M. Tompkins, K. M. Custer, D. L.

Haas, R. Mair, M. Papania, and R. A. Tripp. 2011. Aerosol vaccination

induces robust protective immunity to homologous and heterologous influenza

infection in mice. Vaccine 29:2568-2575.

25. Sommereyns, C., S. Paul, P. Staeheli, and T. Michiels. 2008. IFN-lambda

(IFN-lambda) is expressed in a tissue-dependent fashion and primarily acts on

epithelial cells in vivo. PLoS Pathog 4:e1000017.

161




27. Wang, J., R. Oberley-Deegan, S. Wang, M. Nikrad, C. J. Funk, K. L.

Hartshorn, and R. J. Mason. 2009. Differentiated human alveolar type II cells

secrete antiviral IL-29 (IFN-lambda 1) in response to influenza A infection. J

Immunol 182:1296-1304.

162

Hours Post-Infection

Fo

ld C

han

ge

24 48

0

2

4

6IDO1

IDO2

****

*

****


Kyn

co

ncen

trati

on

(u

g/m

l)

48 72

0

1

2

3UI

0.001

0.01

*

**


Kyn

co

ncen

trati

on

(u

g/m

l)

48 72

0.0

0.1

0.2

0.3

0.4

0.5

0.1

0.01

UI

**

***


Kyn

co

ncen

trati

on

(u

g/m

l)

UI

48 72

0

5

10

15

20

**** ****

A. B.

C. D.

Figure 4.1. Influenza infection up-regulates IDO1 expression. (A) MLE-15 cells were

infected with WSN at an MOI of 0.001. At 24 or 48 hours post-infection (hpi), RNA was

harvested. IDO1 and IDO2 mRNA expression was determined by qRT-PCR.

Significance is indicated when compared to uninfected cells (UI) using a one-way

ANOVA for each panel. (B) MLE-15 cells and (C) Beas2B cells were infected with

varying MOIs of WSN. Cell supernatant was collected at 48 and 72 hpi and the

concentration of kyn was determined. Significance is indicated using a one-way ANOVA

for each time point. (D) Differentiated NHBE cells were infected with WSN at an MOI of

0.5 and IDO activity was determined in the basal media. Each graph is representative of

the mean and standard deviation (SD) of at least 2 independent experiments. Significance

is indicated using a one-way ANOVA with increase compared to UI controls.

163

24 48

0

2

4

6

8

10 IDO1

IDO2

*


Fo

ld C

han

ge

24 48

0

500

1000

1500


Fo

ld C

han

ge

**

A.

B.

Figure 4.2. A/HK/X31 (X31) infection up-regulates IDO1 expression. MLE-15 cells

were infected with X31 at an MOI of 0.1 in the presence of 2 ug/ml TPCK-treated trypsin

and 0.3% BSA. At 24 or 48 hpi, RNA was harvested. (A) IDO1 and IDO2 mRNA

expression was determined by qRT-PCR. Significance assigned when compared to IDO2

using a one-way ANOVA. (B) IFNλ mRNA expression was determined by qRT-PCR.

All samples were normalized to a housekeeping gene. Each graph represents the mean

and SD of at least 2 independent experiments. Significance assigned when compared to

48hpi using a student’s t-test.

164

UI

0.00

10.

01

0

5

10

15UI0.001

0.01* *

WSN MOI

Fo

ld C

han

ge

24 48 72

0

500

1000

1500

2000

0.01

0.001

*

****

*


IFN

Co

ncen

trati

on

(p

g/m

l)

A.

B.

Figure 4.3. IDO and IFNλ expression are related to MOI of infection. MLE-15 cells were

infected at varying MOI with WSN. (A) RNA was collected 48hpi and IDO1 expression

was determined by qRT-PCR. All samples were normalized to a housekeeping gene.

Significance was assigned when compared to uninfected control (UI) using a one-way

ANOVA. (B) Cellular supernantant was collected at indicated time points and the

concentration of IFNλ was determined using an ELISA. Each graph represents the mean

and SD of at least 2 independent experiments. Significance assigned when compared to

MOI 0.001 at same time point using a student’s t-test.

165


IFN

Co

ncen

trati

on

(p

g/m

l)

24 48 72

0

50

100

500

1000

1500IFN

IFN

**

********

***

*


IFN

Co

ncen

trati

on

(p

g/m

l)

24 48 72

010203040

500

1000

1500

2000IFN

IFN

***

****

********


IFN

Co

ncen

trati

on

(p

g/m

l)

48 72 48 72

0

50

100

1500

3000

4500

6000

7500IFN

IFN

Apical Basal

**

**** ****

A. B.

C.

Figure 4.4. IDO expression correlates with IFNλ expression. (A) MLE-15 cells and (B)

Beas2B cells were infected with WSN at a MOI of 0.01 and 0.1, respectively. Cell

supernatant was collected at 24, 48, and 72 hpi and IFNλ and IFNα concentrations were

determined through ELISA. (C) Differentiated NHBE cells were infected with WSN at

an MOI of 0.5 and IFNλ and IFNα concentrations were determined from apical and basal

supernatant at indicated times points via ELISA. Each graph is representative of the mean

and SD of at least 2 independent experiments. Significance was determined by a one-way

ANOVA.

166

0

0.03

9

0.07

8

0.15

6

0.31

2

0.62

51.

25 2.5

0

2

4

6

8

10IDO1IDO2

******

******

** *

rIFN concentration (nM)

No

rmalized

Fo

ld C

han

ge

0

0.03

9

0.07

8

0.15

6

0.31

2

0.62

51.

25 2.5

0

2

4

6

8

*************

*

rIFN concentration (nM)

Kyn

co

ncen

trati

on

(u

g/m

l)

Kyn

co

ncen

trati

on

(u

g/m

l)

Apical Basal0

5

10

15US

IFN2

IFN1****

*

A. B.

C.

Figure 4.5. rIFNλ directly up-regulates the expression of IDO. (A, B) MLE-15 cells were

stimulated with varying concentrations of rIFNλ3. (A) RNA was collected at 24 h post-

stimulation and IDO1 and IDO2 expression was determined by qRT-PCR. (B)

Supernatants were collected 48 h post-stimulation and the concentration of kyn was

determined. (C) Differentiated NHBE cells were stimulated with rIFNλ2 or rIFNλ1 at

25nM. Supernatants were collected 48 h post-stimulation and IDO activity was

determined by kyn expression. Each graph is representative of the mean and SD of at

least 2 independent experiments. Significance is indicated when compared to

unstimulated expression using a one-way ANOVA.

167

nAb none0.0

0.5

1.0

1.5

**

Treatment

Rela

tive ID

O1 F

old

Ch

an

ge

Treatment

% R

ela

tive g

en

e e

xp

ressio

n

siIFN3 siNEG0

20

40

60

80

100

120

140

**

Treatment

Rela

tive ID

O1 F

old

Ch

an

ge

siIFN3 siNEG0.0

0.5

1.0

1.5

*

A. B.

C.

Figure 4.6. IFNλ partially up-regulates IDO1 during influenza infection. (A) MLE-15

cells were infected with WSN at an MOI of 0.01 with or without IFNλ nAb. RNA was

collected 48 hpi and IDO1 mRNA expression was determined through qRT-PCR. (B, C)

MLE-15 cells were transfected for 16 h with siIFNλ3 or siNEG followed by infection

with WSN at an MOI of 0.01. RNA was harvested 48 hpi. (B) IFNλ3 or (C) IDO1 gene

expression was determined through qRT-PCR. Each graph is representative of the mean

and SD of at least 2 independent experiments. Significance was assigned by student’s t-

test compared to negative control.

168

24 48 72

103

104

105

106

107

1MT

Con*


TC

ID50

/ml


TC

ID5

0/m

l

24 48 72

102

103

104

105

106

shIDO1

shNEG*

24 48 72

0

20

40

60

80

1001MT

Con

*


% C

ell D

ea

th

A.

B.

C.

Figure 4.7. Inhibition of IDO decreases viral titers and reduces cellular viability. (A, B)

MLE-15 cells were infected with WSN at an MOI of 0.01 with or without 1-methyl-D, L-

tryptophan (1MT) present. Cellular supernatant was collected at indicated time points.

(A) Viral titers were determined from supernatant using a TCID50. (B) Cell death was

evaluated by adenylate kinase release. (C, D) MLE-15 cells were transduced using a

lentiviral vector containing a shRNA targeting IDO1 (shIDO1) or non-targeting control

(shNEG). The transduced cells were infected with WSN at an MOI of 0.001 and cellular

supernatants were collected at indicated time points. (C) Viral titers were determined by

TCID50. Each graph is representative of the mean and SD of at least 2 independent

experiments. Significance is indicated when compared to control treated cells using a t-

test at each time point.

169

CHAPTER 5

INHIBITION OF IDO DURING EARLY STAGES OF INFLUENZA VIRUS

INFECTION AUGMENTS PRO-INFLAMMATORY CYTOKINE PRODUCTION3

3Fox, J.M., Sage, L.K., Poore, S., Johnson, S., Tompkins, S.M., and Tripp, R.A. To be

submitted to Journal of Virology.

170

Abstract

Indoleamine 2, 3-dioxygenase (IDO) activity is increased in the lung parenchyma of mice

following influenza virus infection. The presence of IDO has been shown to mediate

immune suppression through depletion of tryptophan. Influenza virus is recognized by

pattern recognition receptors which are critical in the early response to virus infection.

To determine IDO’s role in the innate response, IDO activity was inhibited using the

synthetic analog, 1-methyl-D, L-tryptophan (1MT). The results show that IDO inhibition

at early times post-infection enhanced innate signaling and increased pro-inflammatory

cytokine gene and protein expression at 24 and 48 h post-infection, respectively,

compared to control treated mice. The enhanced pro-inflammatory response in the

presence of 1MT is attributed to the macrophage population present in the airways as

RAW264.7 and primary alveolar macrophages have enhanced production of IL-6 and

TNF-α in the presence of 1MT. These studies will provide knowledge into the role of

IDO during early stages of influenza infection and how this may enhance vaccine and

therapeutic approaches.

171

Introduction

Influenza virus belongs to the family Orthomyxoviridae and causes significant

morbidity and mortality worldwide each year (7). Influenza virus primarily infects and

replicates in the airway epithelium where infection and replication induces a robust innate

immune response through recognition of pattern associated molecular patterns (PAMPs)

(34). Influenza virus is primarily recognized by TLR7, TLR3, and RIG-I, which detect

ssRNA, dsRNA, and 5’ triphosphate on ssRNA, respectively (8, 30). Stimulation of

these pattern recognition receptors (PRRs) on epithelial cells, alveolar macrophages

(AMs), and dendritic cells (DCs) induce the secretion of pro-inflammatory cytokines (IL-

6, TNF-α, IL-1β), chemokines (MCP-1, RANTES, MIP-1α/β), and type I and III

interferons (5, 18, 25, 26, 32). The expression of these molecules induces an acute phase

response, enhanced recruitment of immune cells, and induces an antiviral state resulting

in clearance and immunity (6, 22, 25, 39).

Indoleamine 2, 3-dioxygenase (IDO) is the first and rate-limiting step in the

kynurenine pathway where it catabolizes tryptophan into kynurenine (38). Kynurenine

can be further degraded into metabolites that include 3-HAA and QA (42). IDO-

mediated depletion of tryptophan and production of metabolites induces an

immunosuppressive environment in part through T cell anergy and immune cell death

(12, 13). IDO activity can be blocked using the pharmacological inhibitor 1-methyl- D,

L- tryptophan (1MT) (23). We have previously shown that in the absence of IDO activity

there is an enhanced Th1-type immune response and robust influenza-specific CD8+ T

cell response to influenza virus infection (15). To better understand the innate features

that may have contributed to an enhanced adaptive response in the absence of IDO

172

activity, it is important to evaluate how IDO activity affects very early time points post-

influenza infection.

IDO can be induced in a variety of cells types including DCs (14), macrophages

(44), and respiratory epithelial cells (41). These cell types are important for viral

replication as well as initial viral control and are known to facilitate adaptive immunity

(2, 36, 40, 43). Thus, the pro-inflammatory cytokine response throughout influenza virus

infection, and in the absence of IDO activity, was evaluated following 1MT treatment.

The results show that IDO inhibition during influenza virus infection boosts the pro-

inflammatory cytokine response, in particular the expression of IL-6 and TNF-α.

Raw264.7 macrophage cells and primary murine AMs showed increased cytokine

production in the presence of 1MT following influenza infection. These findings show a

role of AMs in modulation of the immune response to influenza through IDO inhibition.

Material and Methods:

Mice, cell culture, and virus. Six-to-eight week old female C57BL/6 mice were received

from the Charles River NCI program (Raleigh, NC). Madin Darby canine kidney

(MDCK) cells and RAW264.7 cells were maintained in DMEM (Hyclone, Logan, UT)

with 5% FBS. Mouse Lung Epithelial (MLE-15) cells were cultured in HITES media

[RMPI 1640 media (Hyclone) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis,

MO), 10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1%

ITS (insulin-transferring-selenium; Gibco)] with 4% FBS. A/HK/x31 (X31; H3N2) was

propagated in the allantoic cavity of 9 day old embryonated chicken eggs for 72h at 37°C.

Viral titer was determined through a standard avicel plaque assay on Madin Darby canine

173

kidney cells (MDCKs) in the presence of TPCK-treated trypsin, as previously described

(31).

Preparation and administration of 1-methyl-D, L-tryptophan (1MT). D, L-1MT (Sigma-

Aldrich) was administered to the mice through drinking water at a concentration of 2

mg/ml. The treated water was prepared by dissolving the 1MT powder in water using

NaOH. The pH was then adjusted to 7. To ensure the mice would drink the water, 2

sleeves of aspartame per 1L were added to the water. The water was filter sterilized and

contained in autoclaved water bottles covered in aluminum foil. Control animals

received sweetened water. 1MT-treated water was given to the mice 3 days prior to

infection and the animals remained on the treatment throughout the course of the

infection. Mice receiving the 1MT treatment were weighed during the three days prior to

infection to ensure consumption of the water. The water and water bottles were checked

every day and changed if needed. For in vitro studies, a concentrated stock solution of

1MT (7.5 mM) was prepared in molecular grade water and dissolved using NaOH. The

pH was then adjusted to 7. The solution was filtered sterilized and frozen at -80°C in

aliquots.

Evaluating TLR associated genes using a TLR PCR Array. Mice were treated 3 days

prior to infection with either 1MT or control (Con) water. On day 0, mice were infected

with 103 PFU of X31 in PBS. At 24 h post-infection, lungs were harvested and

homogenized in TRIZOL (Invitrogen, Carlsbad, CA) using a tissuelyser. Homogenate

was frozen at -80°C until processed. RNA was isolated by addition of chloroform,

174

centrifugation, and collection of the aqueous phase. RNA was precipitated with

isopropanol and washed twice with 75% ethanol. Finally, the RNA was dried and

resuspended in RNase-free water. RNA concentration was determined using the

Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was prepared using the

RT2 First Strand cDNA kit (SABiosciences; Qiagen, Valencia, CA) following the

manufacturer’s protocol with 1 ug of RNA for each sample. The RT2 Profiler PCR Array

Mouse Toll-Like Receptor Signaling Pathway (PAMM-018A) was purchased from

SABiosciences (Qiagen) and the samples were run following manufacturer’s protocol on

the Mx3005P or Mx3000P real-time machines (Stratagene, La Jolla, CA). All Ct values

were determined using a manual baseline and equivalent threshold values. Data was

analyzed using the software provided, which utilizes the 2^(-ΔΔCt) method with HPRT

has the housekeeping gene. Mice receiving 1MT-X31 were compared to Con-X31.

Influenza infection of MLE-15 and RAW264.7 cells. MLE-15 and RAW264.7 cells were

seeded onto a 24-well plate at 4.5x105 and 5x10

5 cells per well, respectively. The MLE-

15 cells were infected for one hour with the indicated MOI in MEM (Hyclone) with 0.3%

BSA Fraction V and 1 ug/ml TPCK-treated trypsin (Worthington, Lakewood, NJ). The

RAW264.7 cells were infected for one hour with indicated MOI in MEM with 1 ug/ml

TPCK-treated trypsin. Following infection, both cell types were rinsed three times with

PBS and appropriate infection media was added to the cells. RNA and supernatant was

collected at indicated time points.

175

qRT-PCR for peli1 and IDO1 gene expression. RNA was isolated at respective time-

points from samples using the RNeasy mini kit (Qiagen) following the manufacture’s

protocol and stored at -20C. Isolated RNA was DNase treated using DNase I

recombinant (Roche, Indianapolis, IN) following manufacture’s protocol. DNase treated

RNA was quantified using the Nanodrop 1000. cDNA was synthesized using Verso

cDNA kits (Thermo Scientific, Lafayette, CO) following the manufacture’s protocol

using equivalent concentrations of RNA for each experiment. The reaction was done at

42C for 30 min. qPCR was used to detect peli1 (Applied Biosystems, Foster City, CA).

The cycling times were 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 55°C

for 1 min, and 72°C for 1 min. qPCR was used to detect IDO1 (primers and probes:

Forward-GCACGACATAGCTACCAGTCT, Reverse-

CCACAAAGTCACGCATCCTCTTAA, Probe-5’-6FAM-AAAGCCAAGGAAATTT-

MGBNFQ-3’) and the cycling times were 95°C for 10 min, followed by 40 cycles of

95°C for 30 sec, 52°C for 1 min, and 68°C for 1 min. All samples were normalized to a

housekeeping gene, HPRT (Applied Biosystems). mRNA expression was determined

using the 2^(-ΔΔCt) method.

Isolation of murine alveolar macrophages (AM). Mice were treated 3 days prior to

infection with either 1MT or vehicle (control) water. On day 0, mice were infected with

103 PFU of X31 in PBS. Bronchoalveolar lavage (BAL) was collected 24 h post-

infection from uninfected or X31-infected mice by instillation of 1ml of PBS three times

in the lungs. Lung washes were maintained on ice or 4°C until processing. BAL cells

were centrifuged at 1500 x rpm for 8 min and resuspended in RPMI (Hyclone) with 10%

176

FBS and 1x antibiotics/antimycotics (Hyclone) (growth media). Adherent cells were

isolated by plastic adherence on a petri dish and incubated at 37°C with 5% CO2 for 3h.

Following incubation, the media was removed carefully and replaced with 2.5mM EDTA

in PBS for 5 min at 37°C to release the cells. Remaining adherent cells were released

using a cell lifter. Cells were centrifuged for 1500 x rpm for 8 min at 4°C and

resuspended in growth media. Cells were counted using a hemocytometer with trypan

blue exclusion. The same number of cells was plated for each group in growth media in a

48-well dish or used to phenotype the cellular population, as described below.

Supernatants were collected 48 h post-plating for pro-inflammatory cytokine response

analysis. Cells collected from 1MT treated mice were maintained in the presence of 1MT

(750uM; Sigma Aldrich) during the 3h incubation and for the 48h culture. Control cells

received molecular grade water in place of 1MT.

Quantification of pro-inflammatory cytokines. Protein concentrations were determined

from cell supernatant or BAL fluid (BALF). IL-6, IL-1β, and TNF-α concentrations were

determined using Ready-Set-Go ELISA kits (eBiosciences, San Diego, CA) following

manufacture’s protocol compared to a standard curve. Concentration of IFNβ was

determined using the VeriKine IFNβ ELISA kit (PBL Interferon Source, Piscataway, NJ)

following manufacture’s protocol compared to a standard curve.

Staining for AMs. Single cell suspensions from BAL were plated at the same number.

The cells were resuspended in staining wash buffer (SWB) (PBS + 1% BSA + 0.09%

NaN3) followed by incubation with Fc Block (BD Pharmingen, San Diego, CA) at 4C

177

for 15 min. Cells were then incubated with anti-CD45 (clone 30-F11), anti-CD11c (clone

HL3), and anti-Siglec-F (clone E50-2440) (BD Pharmingen) for 30 min at 4C. Cells

were rinsed with SWB and fix and permeabilized with the Foxp3

Fixation/Permeabilization solution (eBiosciences). The cells were rinsed with

Perm/Wash Buffer (BD Biosciences) and incubated with anti-CD68 (clone FA-11) (AbD

Serotec, Raleigh, NC) for 30 min at 4C. All samples were run on a LSRII flow

cytometer (BD Biosciences, San Jose, CA) and analyzed using FlowJo (Tree Star,

Ashland, OR). Isotype control antibodies were used to set gates for analysis.

Statistical analysis. Statistics were performed using GraphPad Prism Version 5.04 (La

Jolla, CA). Significance was assigned when the *p < 0.05, **p<0.01, ***p<0.001,

****p<0.0001 using either a student’s t-test or ANOVA with a Bonferroni post-hoc test,

as listed in the figure legends.

Results

1MT treatment augments pro-inflammatory cytokine expression during influenza

infection.

IDO inhibition during an acute influenza infection resulted in an enhanced Th1-

type and influenza virus-specific CD8 T cell response (16, 20). To better understand the

features that may have affected the adaptive immune response, the role of IDO activity

and modulation of the pro-inflammatory cytokine response was addressed, particularly

the inhibition of IDO activity during very early time points post- influenza infection.

Thus, mice were orally-treated with 1MT, a competitive inhibitor of IDO, or vehicle

178

water (control) for three days prior to intranasal infection with 103 PFU of X31. At 12

and 24 hours post-infection (hpi), RNA was isolated from lungs to evaluate the

expression of IDO1. There was no increase in the mRNA expression of IDO1 at 12 hpi

compared to uninfected controls; however, there was significant (p<0.05) increase of

IDO1 mRNA expression at 24 hpi compared to 12 hpi (Fig. 5.1A). IDO2 mRNA levels

were not altered in any of the lung samples (data not shown). There was also no

difference in IDO1 gene expression between 1MT and control treated mice (data not

shown).

IDO1 expression was increased at 24 hpi, thus the expression of pro-inflammatory

genes from the lungs of 1MT or control treated mice was determined at 24 hpi using a

Toll-like Receptor (TLR) array. In this assay, a substantial increase in gene expression

was assigned if the fold-change from 1MT treated mice compared to control treatment

was greater than 2. Mice treated with 1MT had significantly increased IL-6 (p<0.05) and

CD80 (p<0.001) gene expression compared to control treated mice (Table 1). Other

genes were up-regulated in 1MT treated mice including colony stimulating factor 3

(CSF3), interleukin-1β (IL-1β), interferon beta (IFNβ), prostaglandin-endoperoxide

synthase 2 (PTGS2; also known as COX-2), pellino1 (peli1), TNF-α induced protein 3

(TNFAIP3), Lymphotoxin A (LTA), TNF receptor-associated factor 6 (TRAF6), Toll-

like receptor 6 (TLR6), and Myeloid differentiation primary response gene 88 (MyD88)

(Table 1). Since 1MT treatment enhanced multiple pro-inflammatory cytokines as well as

TNF-α induced pathways compared to control treated mice, the concentration of the

cytokines (IL-6, TNF-α, IFNβ, and IL-1β) in the bronchoalveolar lavage (BAL) fluid

(BALF) of 1MT or control treated mice was determined at 48 hpi. 1MT treatment

179

significantly (p<0.01) increased the levels of IL-6, TNF-α, and IFNβ present in the BALF

compared to control treatment (Fig. 5.1B), a finding consistent with the PCR array data

(Table 1). There was no significant difference in the levels of IL-1β expression (Fig.

5.1B). These results show that 1MT treatment enhances the pro-inflammatory response

in the lung airways following influenza virus infection in mice.

1MT treatment and enhanced pro-inflammatory cytokine expression is mediated through

macrophages.

Since 1MT treatment during an influenza infection increased the cytokine

response, the cell types likely linked to enhanced cytokine expression were evaluated.

The immune cell types present in the lungs of naïve mice primarily consists of alveolar

macrophages (AMs) with a low percentage of pulmonary DCs and lymphocytes (28).

Influenza virus primarily replicates in alveolar epithelial cells stimulating an antiviral

response, but has been shown to minimally replicate in AMs, where infection in epithelial

or macrophage cell type induces a robust pro-inflammatory response (19, 33, 36).

Consequently, murine lung epithelial cells (MLE-15) and a mouse macrophage cell line

(Raw264.7) were evaluated for their cytokine responses following influenza virus

infection. Recent studies by others have shown the E3 ubiquitin ligase Pellino-1 (peli1)

to be an important adaptor molecule in TLR3 signaling (4) as well as mediating

interaction between IRAK4 and TRAF6 following IL-1β stimulation (24). Since the TLR

screen showed an increase in peli1 gene expression in 1MT treated mice compared to

control treatment and peli1 is associated with the other genes identified in the array

(Figure 5.2), peli1 expression was used as a marker for indicating a potential enhanced

180

cytokine response. MLE-15 cells or Raw264.7 cells were infected with X31 at varying

multiplicities of infection (MOI), and peli1 expression was assessed at 12 and 24 hpi.

There was no increase in peli1 expression in the MLE-15 cells following influenza virus

infection (Fig. 5.3A), suggesting that the epithelial cells are not likely the key cell types

mediating the enhanced pro-inflammatory response. However, there was a significant

increase in the expression of peli1 at 12 and 24 hpi in the Raw264.7 cells, peaking at 12

hpi (Fig. 5.3B) and the increase in gene expression was virus dependent as increased

MOIs increased the expression of peli1 (Fig. 5.3B).

As peli1 was up-regulated in Raw264.7 cells, the effect of 1MT treatment on the

cytokine response was determined. Raw264.7 cells were pretreated for 24h with 1MT,

followed by infection (MOI = 1) with X31. RNA was collected at 12 hpi to assess peli1

gene expression. There was no difference in the expression of peli1 with 1MT treatment

compared to control treated cells (Fig. 5.4A). Interesting, there was a significant increase

in the expression of peli1 in Raw264.7 cells that were treated with 1MT and not infected

(Fig. 5.4A) suggesting that peli1 gene expression may be linked to IDO1 expression. To

determine if increased levels of peli1 correlated with an enhanced pro-inflammatory

cytokine response, Raw 264.7 were pretreated with 1MT for 24h, and subsequently

infected (MOI = 1) with X31 to be compared with a mock-infected control. Cell

supernatants were collected 12 and 24 hpi and cytokine concentrations were evaluated

using ELISA. Consistent with the level of peli1 expression, there was a significant

(p<0.01) increase in the levels of IL-6 and TNF-α following 1MT treatment compared to

control treatment in mock infected cells (Fig. 5.4B). There was no detectable level of IL-

1β or IFNβ in mock infected supernatants (data not shown). At 12 hpi, 1MT treatment

181

was significantly associated with increased concentrations of IL-6 (p<0.01), TNF-α

(p<0.001), IFNβ (p< 0.01), and IL-1β (p<0.0001) compared to control treated cells (Fig.

5.4C). The significant increase in IL-6 (p<0.01), TNF-α (p<0.01), IFNβ (p<0.05), and

IL-1β (p<0.01) in 1MT treated compared to control treated Raw264.7 cells was also

observed at 24 hpi, although the overall levels of cytokine expression were lower (Fig.

5.4D). At 12 and 24 hpi there was no detectable level of IL-1β in control treated cells

(Fig. 5.4C and D), while the addition of 1MT induced high levels of IL-1β from influenza

virus infected cells at 12 and 24 hpi (Fig. 5.4C and D). The level of IDO1 mRNA

expression was evaluated by qRT-PCR. There was minimal IDO1 mRNA detected in

uninfected cells that gradually increased through the course of infection (Fig. 5.4E).

There were no significant differences in IDO1 expression between 1MT and control

treated cells at either time point. These results indicate that 1MT modulation of the pro-

inflammatory cytokine response is likely linked to the macrophage population.

Alveolar macrophages are responsible for enhanced TNF-α and IL-6 expression

Since the Raw264.7 cells showed increased cytokine expression with 1MT

treatment, it was important to confirm these results using primary mouse AMs. Mice

were treated with 1MT or control for 3 days prior to X31 infection. Twenty-four hours

post-infection, AM macrophages were harvested from the BAL by plastic adherence.

These adherent cells were phenotyped to determine the cell populations present where

AMs were phenotyped as CD45+CD68

hiCD11c

+ Siglec-F

+ as previously described (37,

45). Representative dot plots show that greater than 90% of the cells collected following

plastic adherence were CD45+ and of that population, almost 99% were of the alveolar

182

macrophage phenotype (Fig. 5.5A). Almost 100% of the adherent cells collected from

each group (1MT or control treatment and X31 infected or mock infected) were AMs

(Fig. 5.5B). There was no difference in the number of AMs between 1MT and control

treatment following plastic adherence with or without X31 infection (Fig. 5.5C).

Interestingly, AMs harvested from mice treated with 1MT and infected with X31 had

significantly increased levels of IL-6 and TNF-α in the supernatant compared to control

treated-X31 infected mice (Fig. 5.5D and E). There were no detectable levels of IFNβ or

IL-1β present with either treatment group (data not shown). These results help to confirm

that the AMs are in part linked to the enhanced pro-inflammatory cytokine response

following 1MT treatment.

Discussion

IDO has been associated with attenuating the immune response to infectious

diseases, including influenza virus infection, and modulation of IDO activity through

1MT administration has been shown to reverse the inhibitory effects of IDO and IDO

metabolites (10, 16, 29). This study shows an enhanced pro-inflammatory cytokine

response occurs in the presence of 1MT which appears to be partially mediated through

AMs. An interesting result was the minimal expression of IDO1 in uninfected cells and

small increase in expression following influenza infection (Fig. 5.1A and 5.4E). This

suggests that the increase in cytokine expression could be caused by an IDO1-

independent mechanism, i.e. a 1MT non-specific enhancement. Also of interest is the

finding that the IDO1-independent cytokine increase was only seen for IL-6 and TNF-α

expression. This may be the reason the levels of IL-1β and IFNβ were undetectable in

183

the ex vivo culture of the AMs, while dramatic increases in IL-6 and TNF-α were

observed with 1MT treatment (Fig. 5.5D and E). The time point evaluated following ex

vivo culture may have resulted in degradation of IL-1β and IFNβ in the absence of

stimuli, while IL-6 and TNF-α were maintained without stimuli.

The 1MT mediated modulation of the macrophage response over the epithelial

cell response correlated with the cytokines observed during the PCR array screen (Table

1). AMs are known to secrete high levels of TNF-α (36) and IL-1β (21) following

influenza virus infection, although somewhat lower levels of IL-1β were detected in this

study. An unexpected result was the lack of change in peli1 gene expression in the 1MT-

treated and influenza virus infected Raw264.7 cells compared to increased peli1 gene

expression in uninfected cell treated with 1MT treatment (Fig. 5.4A). The peli1 gene

encodes for Pellino 1, an E3 ubiquitin ligase, which is emerging as a critical effector

molecule during viral infections, including TLR3 stimulation (11) and during rhinovirus

infections (3). Pellino 1 is important for IL-1β signaling (24) and cytokine production,

including TNF-α and IFNβ, following TLR3 or TLR4 stimulation (Fig. 5.2) (4). The lack

of change in peli1 gene expression may be related to the kinetics of its induction.

Uninfected cells showed increase in peli1 expression suggesting that influenza virus

infection may down-regulate peli1, and because there was increased expression of peli1

gene expression with 1MT treatment, this effect is likely linked to IDO1 gene activity.

Inhibition of IDO through 1MT administration increased the secretion of IL-6 in

the BALF (Fig. 5.1B) and isolated AMs (Fig. 5.5B) from influenza infected mice, and in

influenza infected macrophage cell line (Fig. 5.4B-D). Besides being prominently

expressed in inflammatory environments and increasing recruit of neutrophils and

184

monocytes (35), IL-6 is a key mediator in the differentiation of CD4+ toward a Th17-

type pro-inflammatory response over a Treg response (27). IDO activity has been shown

to skew the immune response to a Treg phenotype and inhibition of IDO activity drives a

Th17 response through enhanced secretion of IL-6 (1). Although enhanced IL-6

secretion may be seen as potentially detrimental to the host, studies have shown that

increased IL-6 expression only has an effect on inducible Treg cells development with

little effect on natural Tregs (17). Furthermore, IL-6 is known to be important for the

resolution of influenza infection (9). These results show that AMs provide a role in the

modulation of the regulatory phenotype particularly in the lungs.

The results from this study identify a novel mechanism to enhance the pro-

inflammatory cytokine response using a pharmacological inhibitor of IDO, i.e. 1MT. The

addition of 1MT could be useful to boost vaccines with poor immune activation as the

presence of 1MT would improve cytokine induction. This study demonstrates the

connection between IDO activity and modulation of the immune response early following

influenza virus infections and shows potential usage of 1MT as a method to augment the

immune response for influenza vaccines.

Acknowledgements

We thank Elizabeth O’Connor for her help. This work was supported by the National

Institutes of Health U01 grant AI083005-01 and the Georgia Research Alliance.

185

References




2. Bender, B. S., and P. A. Small, Jr. 1992. Influenza: pathogenesis and host

defense. Seminars in respiratory infections 7:38-45.

3. Bennett, J. A., L. R. Prince, L. C. Parker, C. A. Stokes, H. G. de Bruin, M.

van den Berge, I. H. Heijink, M. K. Whyte, and I. Sabroe. 2012. Pellino-1

selectively regulates epithelial cell responses to rhinovirus. J Virol 86:6595-6604.

4. Chang, M., W. Jin, and S. C. Sun. 2009. Peli1 facilitates TRIF-dependent Toll-

like receptor signaling and proinflammatory cytokine production. Nat Immunol

10:1089-1095.

5. Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I.

Julkunen, M. Cella, R. Lande, and G. Uze. 2004. Viral infection and Toll-like

receptor agonists induce a differential expression of type I and lambda interferons

in human plasmacytoid and monocyte-derived dendritic cells. Eur J Immunol

34:796-805.

6. Conn, C. A., J. L. McClellan, H. F. Maassab, C. W. Smitka, J. A. Majde, and

M. J. Kluger. 1995. Cytokines and the acute phase response to influenza virus in

mice. The American journal of physiology 268:R78-84.

7. Cox, R. J., K. A. Brokstad, and P. Ogra. 2004. Influenza virus: immunity and

vaccination strategies. Comparison of the immune response to inactivated and

live, attenuated influenza vaccines. Scand J Immunol 59:1-15.

186

8. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.

Innate antiviral responses by means of TLR7-mediated recognition of single-

stranded RNA. Science 303:1529-1531.

9. Dienz, O., J. G. Rud, S. M. Eaton, P. A. Lanthier, E. Burg, A. Drew, J. Bunn,

B. T. Suratt, L. Haynes, and M. Rincon. 2012. Essential role of IL-6 in

protection against H1N1 influenza virus by promoting neutrophil survival in the

lung. Mucosal immunology 5:258-266.




34:464-472.

11. Enesa, K., A. Ordureau, H. Smith, D. Barford, P. C. Cheung, J. Patterson-

Kane, J. S. Arthur, and P. Cohen. 2012. Pellino1 is required for interferon

production by viral double-stranded RNA. J Biol Chem 287:34825-34835.




13. Fallarino, F., U. Grohmann, C. Vacca, C. Orabona, A. Spreca, M. C. Fioretti,

and P. Puccetti. 2003. T cell apoptosis by kynurenines. Adv Exp Med Biol

527:183-190.

14. Fallarino, F., C. Vacca, C. Orabona, M. L. Belladonna, R. Bianchi, B.

Marshall, D. B. Keskin, A. L. Mellor, M. C. Fioretti, U. Grohmann, and P.

187

Puccetti. 2002. Functional expression of indoleamine 2,3-dioxygenase by murine

CD8 alpha(+) dendritic cells. Int Immunol 14:65-68.


M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2, 3-

dioxygenase (IDO) enhances the T cell response to influenza virus infection. J

Gen Virol.


S. M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2,3-

dioxygenase enhances the T-cell response to influenza virus infection. J Gen Virol

94:1451-1461.

17. Fujimoto, M., M. Nakano, F. Terabe, H. Kawahata, T. Ohkawara, Y. Han, B.

Ripley, S. Serada, T. Nishikawa, A. Kimura, S. Nomura, T. Kishimoto, and

T. Naka. 2011. The influence of excessive IL-6 production in vivo on the

development and function of Foxp3+ regulatory T cells. J Immunol 186:32-40.

18. Hennet, T., H. J. Ziltener, K. Frei, and E. Peterhans. 1992. A kinetic study of

immune mediators in the lungs of mice infected with influenza A virus. J

Immunol 149:932-939.

19. Hofmann, P., H. Sprenger, A. Kaufmann, A. Bender, C. Hasse, M. Nain, and

D. Gemsa. 1997. Susceptibility of mononuclear phagocytes to influenza A virus

infection and possible role in the antiviral response. J Leukoc Biol 61:408-414.

20. Huang, L., L. Li, K. D. Klonowski, S. M. Tompkins, R. A. Tripp, and A. L.

Mellor. 2013. Induction and role of indoleamine 2,3 dioxygenase in mouse

models of influenza a virus infection. PLoS One 8:e66546.

188

21. Ichinohe, T., H. K. Lee, Y. Ogura, R. Flavell, and A. Iwasaki. 2009.

Inflammasome recognition of influenza virus is essential for adaptive immune

responses. J Exp Med 206:79-87.




vivo. J Virol 84:11515-11522.





24. Jiang, Z., H. J. Johnson, H. Nie, J. Qin, T. A. Bird, and X. Li. 2003. Pellino 1

is required for interleukin-1 (IL-1)-mediated signaling through its interaction with

the IL-1 receptor-associated kinase 4 (IRAK4)-IRAK-tumor necrosis factor

receptor-associated factor 6 (TRAF6) complex. J Biol Chem 278:10952-10956.

25. Julkunen, I., K. Melen, M. Nyqvist, J. Pirhonen, T. Sareneva, and S.

Matikainen. 2000. Inflammatory responses in influenza A virus infection.

Vaccine 19 Suppl 1:S32-37.

26. Julkunen, I., T. Sareneva, J. Pirhonen, T. Ronni, K. Melen, and S.

Matikainen. 2001. Molecular pathogenesis of influenza A virus infection and

virus-induced regulation of cytokine gene expression. Cytokine Growth Factor

Rev 12:171-180.

189

27. Kimura, A., and T. Kishimoto. 2010. IL-6: regulator of Treg/Th17 balance. Eur

J Immunol 40:1830-1835.

28. Kirby, A. C., J. G. Raynes, and P. M. Kaye. 2006. CD11b regulates recruitment

of alveolar macrophages but not pulmonary dendritic cells after pneumococcal

challenge. J Infect Dis 193:205-213.





30. Le Goffic, R., J. Pothlichet, D. Vitour, T. Fujita, E. Meurs, M. Chignard, and

M. Si-Tahar. 2007. Cutting Edge: Influenza A virus activates TLR3-dependent

inflammatory and RIG-I-dependent antiviral responses in human lung epithelial

cells. J Immunol 178:3368-3372.



32. Onoguchi, K., M. Yoneyama, A. Takemura, S. Akira, T. Taniguchi, H.

Namiki, and T. Fujita. 2007. Viral infections activate types I and III interferon

genes through a common mechanism. J Biol Chem 282:7576-7581.

33. Rodgers, B. C., and C. A. Mims. 1982. Influenza virus replication in human

alveolar macrophages. Journal of medical virology 9:177-184.



190

35. Scheller, J., A. Chalaris, D. Schmidt-Arras, and S. Rose-John. 2011. The pro-

and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys

Acta 1813:878-888.

36. Seo, S. H., R. Webby, and R. G. Webster. 2004. No apoptotic deaths and

different levels of inductions of inflammatory cytokines in alveolar macrophages

infected with influenza viruses. Virology 329:270-279.

37. Stevens, W. W., T. S. Kim, L. M. Pujanauski, X. Hao, and T. J. Braciale.

2007. Detection and quantitation of eosinophils in the murine respiratory tract by

flow cytometry. J Immunol Methods 327:63-74.

38. Taylor, M. W., and G. S. Feng. 1991. Relationship between interferon-gamma,

indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J 5:2516-2522.

39. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I

interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol

23:307-336.

40. Tumpey, T. M., A. Garcia-Sastre, J. K. Taubenberger, P. Palese, D. E.

Swayne, M. J. Pantin-Jackwood, S. Schultz-Cherry, A. Solorzano, N. Van

Rooijen, J. M. Katz, and C. F. Basler. 2005. Pathogenicity of influenza viruses

with genes from the 1918 pandemic virus: functional roles of alveolar

macrophages and neutrophils in limiting virus replication and mortality in mice. J

Virol 79:14933-14944.




191

42. Wichers, M. C., G. H. Koek, G. Robaeys, R. Verkerk, S. Scharpe, and M.

Maes. 2005. IDO and interferon-alpha-induced depressive symptoms: a shift in

hypothesis from tryptophan depletion to neurotoxicity. Molecular psychiatry

10:538-544.

43. Wijburg, O. L., S. DiNatale, J. Vadolas, N. van Rooijen, and R. A. Strugnell.

1997. Alveolar macrophages regulate the induction of primary cytotoxic T-

lymphocyte responses during influenza virus infection. J Virol 71:9450-9457.

44. Yeung, A. W., W. Wu, M. Freewan, R. Stocker, N. J. King, and S. R.

Thomas. 2012. Flavivirus infection induces indoleamine 2,3-dioxygenase in

human monocyte-derived macrophages via tumor necrosis factor and NF-kappaB.

J Leukoc Biol 91:657-666.

45. Zaynagetdinov, R., T. P. Sherrill, P. L. Kendall, B. H. Segal, K. P. Weller, R.

M. Tighe, and T. S. Blackwell. 2013. Identification of myeloid cell subsets in

murine lungs using flow cytometry. Am J Respir Cell Mol Biol 49:180-189.

192

Table 5.1. Genes differentially regulated post-X31 infection in 1MT-treatment compared

to Con-treatment in mouse lungs.

193

Figure 5.1. 1MT treatment enhances pro-inflammatory cytokines in lungs following

influenza infection with modest increase in IDO1 expression. Mice were pretreated with

1MT (2 mg/ml) or vehicle (con) water for 3 days prior to intranasal infection with 103

PFU of X31. (A) RNA was harvested from lungs at indicated time points and analyzed

for IDO1 mRNA expression by qRT-PCR. Samples were normalized to HPRT and

compared to control treated uninfected controls at respective time points. (B)

Concentration of indicated cytokines in the BALF at 48 hpi. Significance was assigned

using a student’s t-test. Graphs show the mean and standard deviation of representative

data from at least 2 independent experiments.

194

Figure 5.2. Interaction of genes identified in TLR array. VisANT was used to

determined protein interactions for genes up-regulated with 1MT treatment (red diamond)

with peli1 (blue diamond). Connections shown are representative of known protein

interactions of Homo sapiens since more data exists as compared to Mus musculus.

195


Rela

tive p

eli1 F

old

Ch

an

ge

12 24

0

2

4

6

8

10

MOI 0.5

MOI 0.1


Rela

tive p

eli1 F

old

Ch

an

ge

12 24

0

2

4

6

8

10MOI 0.5

MOI 1

**

****

****

*

***

A. B.

Figure 5.3. Increased peli1 expression is mediated through macrophages. (A) MLE-15

or (B) Raw264.7 cells were infected with X31 at indicated MOI. RNA was harvested at

12 and 24 hpi. Expression of peli1 was determined by qRT-PCR. Significance was

assigned using a one-way ANOVA. Samples were normalized to HPRT and compared to

control treated uninfected controls at respective time points. Graphs show the mean and

standard deviation of representative data from at least 2 independent experiments.

196

A. B.

C. D.

E.

Co

ncen

trati

on

(p

g/m

l)

IL-6

TNF-

IFN

IL-1

05

10100

200

300

400

500

2000400060008000

1MT

Con

**

***

**

****

Co

ncen

trati

on

(p

g/m

l)

IL-6

TNF-

IFN

IL-1

0

50

100

150

200

250

1500

3000

45001MT

Con

**

**

***

Co

ncen

trati

on

(p

g/m

l)

IL-6 TNF-0

5

10

1550

100

150

200

1000

2000

30001MT

Con

**

**


Rela

tive ID

O1 F

old

Ch

an

ge

UI 12 240

5

10

15

20

251MT

Con

Rela

tive p

eli1 F

old

Ch

an

ge

UI X31

0

2

4

6

8

101MT

Con

***

Figure 5.4. 1MT enhances pro-inflammatory cytokine expression. Raw264.7 cells were

pretreated with 1MT or control for 24h followed by infection with X31 (MOI = 1). (A)

RNA was collected 12 hpi and expression of peli1 was assessed by qRT-PCR. (B-E)

Cytokine levels were determined using an ELISA for (B) uninfected cells, (C) 12 hpi, or

(D) 24 hpi. Significance was assigned using a student’s t-test. (E) RNA was harvested at

indicated time points and expression of IDO1 was evaluated using qRT-PCR. Samples

were normalized to HPRT and compared to control treated uninfected controls at

197

respective time points. Graphs show the mean and standard deviation of representative

data from at least 2 independent experiments.

198

Mock X310

50

100

1501MT

Con

% A

lveo

lar

macro

ph

ag

es

of

CD

45+

cells

Mock X310

2100 4

4100 4

6100 4

8100 4

1MT

Con

Cell

Nu

mb

er

of

CD

45+

cells

A.

B. C.

D. E.

TN

F-

co

ncen

trati

on

(p

g/m

l)

Mock X31

0

50

100

150

200

2501MT

Con

*

IL-6

co

ncen

trati

on

(p

g/m

l)

Mock X31

0

20

40

601MT

Con

*

Figure 5.5. 1MT treatment enhances alveolar macrophage secretion of TNF-α and IL-6.

Mice were pretreated with 1MT (2 mg/ml) or vehicle (con) water for 3 days prior to

intranasal infection with 103 PFU of X31 or mock infected. Alveolar macrophages were

isolated from BAL collected 24h post-infection. (A) Representative dot plots of the

isolated cell population from BAL. (B) Percentage and (C) frequency of the alveolar

199

macrophage population isolated from the BAL. (D-E) Isolated alveolar macrophages

were cultured for an additional 48h and levels of (D) IL-6 or (E) TNF-α were evaluated

in the supernatant through ELISA. Graphs show the mean and standard error mean from

results of 2 independent experiments.

200

CHAPTER 6

DEVELOPMENT OF A NOVEL METHOD TO INDUCIBLY SILENCE IDO1

ACTIVITY4

4Fox, J.M., E.R. O’Connor, S.M. Tompkins, R.A. Tripp. To be submitted to Virology.

201

Abstract

Indoleamine 2, 3-dioxygenase (IDO) is rapidly emerging as a key player in

dampening the immune response to pathogens. Two models are accepted to study the

effects of IDO abolition in vitro and in vivo: IDO1 -/- mice and administration of

pharmacological inhibitors, e.g. 1-methyl-tryptophan (1MT). Both methods have

advantages and disadvantages in the efficacy related to the temporal inhibition of IDO

activity; however, a method that has the gene silencing efficacy of IDO -/- mice with

conditional expression would be advantageous to studying the impact of IDO on the

immune response. In this study, a lentiviral vector expressing an inducible short hairpin

RNA (shRNA) targeting IDO1 (shIDO1) was developed and transduced into MLE-15

cells. Following IDO induction through recombinant IFNγ stimulation, IDO1 mRNA

expression and activity was reduced to un-stimulated levels. These results provide the

framework for applying the lentiviral vector to a mouse model and producing a shIDO1

inducible in vivo system.

202

Introduction

Indoleamine 2, 3-dioxygenase (IDO) is an immunosuppressive enzyme in the

kynurenine pathway that catabolizes tryptophan (trp) into kynurenine (kyn) (8). Testing

the effects of IDO requires the blockade of IDO activity either genetically or

pharmacologically (1, 7, 10). Correspondingly, two IDO proteins, IDO1 and IDO2, can

metabolize trp making it difficult to determine the particular enzyme having the great

catabolic effect on trp (17, 21, 22). One method to inhibit IDO activity is through

administration of 1-methyl-tryptophan (1MT), a competitive inhibitor of IDO (5, 23, 24).

1MT is typically provided to animals via drinking water or by pellet implantation, and is

efficacious for IDO inhibition in cell culture (2, 10, 19). Another option to

pharmacological inhibition in vivo is the use of IDO1 -/- mice (28). 1MT, although

effective, has drawbacks because water consumption may decrease during infectious

disease studies, thus affecting the uptake of the compound as well. Alternatively, IDO -/-

mice may have irregularities in the development of their immune system, and these mice

lack the ability to inducibly silence IDO.

In this study, a lentiviral vector containing a tetracycline-controlled expression

system encoding a short hairpin RNA (shRNA) targeting the IDO1 gene was produced

and evaluated. IDO1 was targeted based on earlier findings that showed IDO1 to be

predominantly expressed over IDO2 during influenza virus infections (specific aim 2).

The lentiviral system involves transfecting HEK293T cells with a plasmid encoding the

shRNA of interest in addition to a mix of 5 plasmids to produce the lentivirus (25). The

lentivirus can then be used to transduce cell lines or administered in vivo. The lentiviral

vector has broad tropism and can infect and replicate in dividing and non-dividing cells

203

and integrates the shRNA construct into the host genome (27). As the packaging

plasmids that are transfected are reliant on each other for expression, and the structural

genes are not included in the viral genome, there is reduced risk of recombination

between plasmids and thus a replication incompetent virus (13). The lentiviral particles

were used to transduce mouse lung epithelial cells (MLE-15) to evaluate efficacy of

IDO1 gene silencing. In vitro experiments using doxycycline-induced lentivirus

transduced MLE-15 cells showed almost complete reduction in IDO activity. This

reduction in activity was able to be reversed and showed rapid expression following

doxycycline administration. This work provides the basis to test the shRNA targeting

IDO1 (shIDO1) construct for IDO silencing in mice to eventually producing an inducible

shIDO1 knock-in mouse or in vivo cell specific IDO1 silencing.


Cell culture. MLE-15 cells were maintained in HITES media [RMPI 1640 media

(Cellgro, Manassas, VA) with 10nM hydrocortisone (Sigma-Aldrich, St. Louis, MO),

10nM β-estradiol (Sigma-Aldrich), 2mM L-glutamine (Gibco, Carlsbad, CA), 1% ITS

(insulin-transferring-selenium; Gibco)] with 4% FBS. HEK293T were maintained in

DMEM with 5% FBS.

Transfer for shIDO1 construct to inducible vector and lentivirus propagation. shIDO1

construct (hairpin sequence:

TGCTGTTGACAGTGAGCGATCCGTGAGTTTGTCATTTCAATAGTGAAGCCACA

GATGTATTGAAATGACAAACTCACGGACTGCCTACTGCCTCGGA; mature

204

sense: CCGTGAGTTTGTCATTTCA; mature antisense:

TGAAATGACAAACTCACGG) was obtained in the pGIPZ backbone (constitutive

expression of construct) (Open Biosystems; Thermo Scientific, Pittsburgh, PA) in E.coli

and grown on LB-Lennox agar plates supplemented with ampicillin (100ug/ml) (Fisher

BioReagents, Pittsburgh, PA) and zeocin (25ug/ml) (Invivogen, San Diego, CA).

Isolated colonies were grown in 2x-Lennox Broth (VWR, Radnor, PA) supplemented

with ampicillin. The plasmids were purified and size verified on a 1% agarose gel

following digestion with SalI [New England BioLabs (NEB), Ipswich, MA]. The

shIDO1 construct and empty pTRIPZ (doxycycline-inducible plasmid) vector were

digested using MluI and XhoI and gel purified. The 345 bp shRNA insert was ligated to

the digested pTRIPZ using T4 DNA ligase (NEB) following the manufacturer’s protocol.

The ligated construct was transformed into PrimePlus E. coli (Open Biosystems)

following manufacturer’s protocol and plated on Lennox agar plates supplemented with

amplicillin and zeocin. Colonies were isolated and grown in 2x Lennox broth with

ampicillin, purified, and shRNA insert was sequence verified. shNEG construct (non-

targeting control; Open Biosystems) was obtained in the pTRIPZ backbone. The shNEG

and shIDO1 lentiviruses were produced according to manufacturer’s protocol using

arrest-in on HEK293T cells. Supernatant was collected 72 h post-transfection,

concentrated using the Fast-Trap Lentivirus Purification and Concentration Kit

(Millipore, Billerica, MA). Viral titers were determined on HEK293T cells in the

presence of doxycycline hydrochloride (doxycycline; 1ug/ml; Fisher BioReagents) as

described by the manufacturer.

205

Transduction of MLE-15 cells with shRNA constructs. MLE-15 cells were plated in a 24-

well dish at 2x105 cells/well and infected with the shIDO1 or shNEG lentivirus for 6 h

followed by addition of normal growth media. The following day, doxycycline (1ug/ml)

was added to cells to induce shRNA insert. Two days later, media was changed to

growth media containing doxycycline (1ug/ml) and puromycin (7.5ug/ml; Invitrogen,

Pittsburgh, PA) for selection of transduced cells. The appropriate concentration of

puromycin was determined by a dose kill curve on MLE-15 cells (data not shown).

Media was changed every 2-3 days and passaged into larger flasks when confluent.

Transduced cells were sorted using FACSAria (BD Biosciences, San Jose, CA) collecting

the top 10% of RFP fluorescencing cells. Clonal cell populations were used for in vitro

studies. Transduced cells were maintained in growth media containing doxycycline and

puromycin. Fluorescent images were taken using the EVOS Fluorescent Cell Imaging

System (Life Technologies, Carlsbad, CA).

Validation of IDO1 knock-down in transduced cells. Transduced and parental MLE-15

cells were plated in a 24-well dish at 4.5x105 cells/well. Cells were stimulated with

recombinant mouse IFNγ (rIFNγ; Pierce, Rockford, IL) at 10ng/ml in growth media

without phenol red. Transduced cells are stimulated in the same media with the addition

of doxycycline and puromycin. Twenty-four hours post stimulation, L-trp (50uM)

(Sigma Aldrich) was added to each well. The following day supernatant was collected

and stored at -20°C. RNA was harvested using the RNeasy mini kit (Qiagen, Valencia,

CA) and stored at -20°C. The supernatant was used to determine IDO activity using the

kynurenine (kyn) colorimetric assay. Briefly, proteins were removed by addition of 30%

206

tricholoracetic acid (TCA; VWR) and incubated at 50°C for 30 min to hydrolyze n-

formylkynurenine to kyn. Samples were then centrifuged at 2400 rpm for 10 min at 4°C.

Supernatants were incubated with Erlich’s reagent for 10 min. Absorbance was read at

490nm using an Epoch microplate reader (BioTek, Winooski, VT). Concentration of kyn

was determined using a kyn colorimetric assay with a standard curve of kyn (Sigma-

Aldrich). IDO1 mRNA expression was determined by qRT-PCR, as described below.

To determine the amount of time needed for shIDO1 induction following doxycycline

treatment, transduced cells were cultured in the absence of doxycycline until IDO activity

assay was not significant between the groups (data not shown). Doxycycline (1ug/ml)

was added to the cells at varying times prior to rIFNγ stimulation.

qPCR for detection of IDO1 mRNA. RNA was isolated at respective time-points from

samples using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol and

stored at -20C. Isolated RNA was DNase treated using DNase I recombinant (Roche,

Indianapolis, IN) following manufacturer’s protocol. DNase treated RNA was quantified

using the Nanodrop 1000 (Thermo Scientific, Wilmington, DE). cDNA was synthesized

using the Verso cDNA kits (Thermo Scientific, Lafayette, CO) following the

manufacturer’s protocol using equivalent concentrations of RNA for each experiment.

The reaction was done at 42C for 30 min. qPCR was used to detect IDO1 (Forward-

GCACGACATAGCTACCAGTCT, Reverse- CCACAAAGTCACGCATCCTCTTAA,

Probe-5’-6FAM-AAAGCCAAGGAAATTT-MGBNFQ-3’). The cycling time was 95°C

for 10 min, followed by 40 cycles of 95°C for 30 sec, 52°C for 1 min, and 68°C for 1

207

min. All samples were normalized to a housekeeping gene, HPRT (Applied Biosystems,

Foster City, CA). mRNA expression was determined using the 2^(-ΔΔCt) method.

Results

MLE-15 cells transduced with shIDO1 effectively silence IDO1 expression and activity.

MLE-15 cells were transduced with either shIDO1 or shNEG constructs using a

lentiviral vector and sorted based on the intensity of RFP expression (data not shown).

MLE-15 cells containing the shIDO1 or shNEG construct showed RFP expression

compared to the parental cells, which is indicative of induction of the construct (Fig.

6.1A). IFNγ is a strong stimulator of IDO activity and is an appropriate measure of the

shRNA efficacy (3, 11). To validate the effectiveness of the shRNA targeting IDO1

expression, transduced and parental MLE-15 cells were stimulated with recombinant

IFNγ (rIFNγ) and the expression and activity of IDO was analyzed. IDO activity is

determined by quantifying the concentration of kyn, i.e. IDO metabolite present in the

cell culture supernatant. Following stimulation, the shIDO1 transduced cells had

significantly reduced IDO1 mRNA expression compared to shNEG cells and parental

cells (Fig. 6.1B). More importantly, there was a significant reduction in the amount of

kyn present in the supernatant of stimulated shIDO1 transduced cells compared to

stimulated control cells (Fig. 6.1C). There was no significant difference between

stimulated shIDO1 transduced cells and unstimulated MLE-15 showing that the IDO1

shRNA is able to reduce IDO activity to background levels (Fig. 6.1C). These results

demonstrate that the shIDO1 construct can efficiently silence IDO1 gene expression and

activity following stimulation with a potent activator.

208

Doxycycline induction of shIDO1.

Since the shRNA constructs are inducible through doxycycline, it was important

to evaluate the time-course following doxycycline induction that was required for

efficient IDO1 silencing. The transduced cells were removed from doxycycline and

puromycin for multiple passages until there was no significant difference of IDO activity

between the two groups following rIFNγ stimulation (data not shown). Doxycycline was

added to transduced cells at 4, 3, 2, 1, or 0 days prior to rIFNγ stimulation (Fig. 6.2).

RFP expression was observed 1 day following doxycycline induction, but achieved

maximal fluorescence by 3 days post induction (Fig. 6.2A). On Day 0 (D0), transduced

cells were stimulated with rIFNγ and IDO activity was evaluated 48 h post-stimulation.

As expected for RNAi-mediated processes, there was not complete knock-down of IDO

activity, although induction of shIDO1 at least 2 days prior to stimulation (D-2)

significantly reduced the amount of kyn present in the cell culture supernatant as

compared to no doxycycline treated controls (none) (Fig 6.2B). These results show that

the shIDO1 and shNEG constructs are inducible but require extended culturing in

doxycycline to achieve a high level of gene silencing.

Discussion

IDO is emerging as an important player in immunity during infection (1, 9, 14,

18). Although several methods are available to inhibit IDO activity, these approaches

lack the ability to induce silencing and lack and often lack substantial efficacy (6, 24).

The use of a doxycycline-inducible shRNA method to silence IDO1 expression provides

efficient gene silencing allowing for evaluation of the effects of temporal IDO

209

expression. Furthermore, these results provide proof-of-concept that lentiviral vectors

may be used to proceed with in vivo IDO1 silencing essentially generating IDO1 -/- mice.

Although the shIDO1 construct reduced IDO mRNA expression and activity to

unstimulated levels, transduction with the shNEG construct also reduced the expression

and activity of IDO1 (Fig. 6.1B & C). This reduction is likely due to excessive amounts

of non-specific siRNA present from prolonged induction because removal of doxycycline

and short-term induction showed no reduction in IDO activity following stimulation as

compared to shIDO1 induced cells (Fig. 6.2B). Following lentiviral infection, the

shRNA construct is integrated into the genome and is synthesized and processed

following the same pathway as microRNAs (miRNA) (20). The shRNA is initially

cleaved by Drosha producing a precursor-shRNA (pre-RNA) that contains a 3’ nucleotide

overhang (15). The pre-RNA is exported from the nucleus via exportin-5 and processed

by Dicer to cleave the hairpin structure producing a siRNA duplex (16, 29). The guide

strand is incorporate into the RNA-induced silencing complex (RISC) to achieve mRNA

silencing (12). The shRNA constructs used for these studies mirror the hairpin structure

of miR-30 to enhance shRNA processing and contain a destabilized 5’ end of the

passenger strand in the final siRNA duplex to better direct the guide strand into RISC,

which should reduce the amount of off-target effects (4, 26). However, the construct

might be overwhelming the RNAi machinery and have indirect off-target effects through

reduced cellular regulation via normal miRNA expression (20).

Finally, there was a gradual reduction in IDO activity when initially inducing the

shRNA construct (Fig. 6.2B). These results suggest that either the induction of shRNA is

not rapid or that the method of IDO1 stimulation (i.e. rIFNγ) was too robust to

210

dramatically reduce IDO activity after only a limited doxycycline induction time. While

this lag is apparent in vitro, this does not necessarily translate to induction times in vivo.

These experiments would need to be tested and optimized for in vivo analysis.

Overall these studies provide the initial results for shRNA lentiviral production

and construct validation. This is the first step to proceed with in vivo delivery

optimization and verification of IDO1 silencing. The in vivo model will be useful not

only in infectious disease research but also in cancer and autoimmune studies in

determining the effects and timing of IDO activity in a mouse model system.

Acknowledgements

We thank Elizabeth O’Connor and Nisarg Patel for their help. This work was supported

by the National Institutes of Health U01 grant AI083005-01.

References

1. Bennett, J. A., L. R. Prince, L. C. Parker, C. A. Stokes, H. G. de Bruin, M.

van den Berge, I. H. Heijink, M. K. Whyte, and I. Sabroe. 2012. Pellino-1

selectively regulates epithelial cell responses to rhinovirus. J Virol 86:6595-6604.

2. Beutelspacher, S. C., P. H. Tan, M. O. McClure, D. F. Larkin, R. I. Lechler,

and A. J. George. 2006. Expression of indoleamine 2,3-dioxygenase (IDO) by

endothelial cells: implications for the control of alloresponses. Am J Transplant

6:1320-1330.

211




4. Boden, D., O. Pusch, R. Silbermann, F. Lee, L. Tucker, and B. Ramratnam.

2004. Enhanced gene silencing of HIV-1 specific siRNA using microRNA

designed hairpins. Nucleic Acids Res 32:1154-1158.





6. Dunham, R. M., S. N. Gordon, M. Vaccari, M. Piatak, Y. Huang, S. G.

Deeks, J. Lifson, G. Franchini, and J. M. McCune. 2013. Preclinical evaluation

of HIV eradication strategies in the simian immunodeficiency virus-infected

rhesus macaque: a pilot study testing inhibition of indoleamine 2,3-dioxygenase.

AIDS Res Hum Retroviruses 29:207-214.

7. Eleftheriadis, T., G. Pissas, A. Karioti, G. Antoniadi, V. Liakopoulos, K.

Dafopoulou, S. Pournaras, G. Koukoulis, and I. Stefanidis. 2012. The

Indoleamine 2,3-dioxygenase Inhibitor 1-methyl-tryptophan Suppresses

Mitochondrial Function, Induces Aerobic Glycolysis and Decreases Interleukin-

10 Production in Human Lymphocytes. Immunol Invest.




212







S. M. Tompkins, and R. A. Tripp. 2013. Inhibition of indoleamine 2,3-

dioxygenase enhances the T-cell response to influenza virus infection. J Gen Virol

94:1451-1461.

11. Fujigaki, S., M. Takemura, H. Hamakawa, M. Seishima, and K. Saito. 2003.

The mechanism of interferon-gamma induced anti Toxoplasma gondii by

indoleamine 2,3-dioxygenase and/or inducible nitric oxide synthase vary among

tissues. Adv Exp Med Biol 527:97-103.

12. Gregory, R. I., T. P. Chendrimada, N. Cooch, and R. Shiekhattar. 2005.

Human RISC couples microRNA biogenesis and posttranscriptional gene

silencing. Cell 123:631-640.

13. Kappes, J. C., X. Wu, and J. K. Wakefield. 2003. Production of trans-lentiviral

vector with predictable safety. Methods in molecular medicine 76:449-465.





213

15. Lee, Y., C. Ahn, J. Han, H. Choi, J. Kim, J. Yim, J. Lee, P. Provost, O.

Radmark, S. Kim, and V. N. Kim. 2003. The nuclear RNase III Drosha initiates

microRNA processing. Nature 425:415-419.

16. Lee, Y. S., K. Nakahara, J. W. Pham, K. Kim, Z. He, E. J. Sontheimer, and

R. W. Carthew. 2004. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the

siRNA/miRNA silencing pathways. Cell 117:69-81.

17. Maiwald, S., R. Wehner, M. Schmitz, M. Bornhauser, S. Loeb, and R.

Wassmuth. 2011. IDO1 and IDO2 gene expression analysis by quantitative

polymerase chain reaction. Tissue Antigens 77:136-142.




Dis 203:715-725.

19. Maneglier, B., C. Rogez-Kreuz, O. Spreux-Varoquaux, B. Malleret, P.

Therond, B. Samah, I. Drouet, D. Dormont, C. Advenier, and P. Clayette.

2007. Comparative effects of two type I interferons, human IFN-alpha and ovine

IFN-tau on indoleamine-2,3-dioxygenase in primary cultures of human

macrophages. Fundamental & clinical pharmacology 21:29-34.

20. Manjunath, N., H. Wu, S. Subramanya, and P. Shankar. 2009. Lentiviral

delivery of short hairpin RNAs. Adv Drug Deliv Rev 61:732-745.

21. Meininger, D., L. Zalameda, Y. Liu, L. P. Stepan, L. Borges, J. D. McCarter,

and C. L. Sutherland. 2011. Purification and kinetic characterization of human

214

indoleamine 2,3-dioxygenases 1 and 2 (IDO1 and IDO2) and discovery of

selective IDO1 inhibitors. Biochim Biophys Acta 1814:1947-1954.

22. Metz, R., J. B. Duhadaway, U. Kamasani, L. Laury-Kleintop, A. J. Muller,

and G. C. Prendergast. 2007. Novel tryptophan catabolic enzyme IDO2 is the

preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase

inhibitory compound D-1-methyl-tryptophan. Cancer Res 67:7082-7087.







replication in the lung during acute infection. Cytokine 59:245-251.

25. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M.

Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of

nondividing cells by a lentiviral vector. Science 272:263-267.

26. Silva, J. M., M. Z. Li, K. Chang, W. Ge, M. C. Golding, R. J. Rickles, D.

Siolas, G. Hu, P. J. Paddison, M. R. Schlabach, N. Sheth, J. Bradshaw, J.

Burchard, A. Kulkarni, G. Cavet, R. Sachidanandam, W. R. McCombie, M.

A. Cleary, S. J. Elledge, and G. J. Hannon. 2005. Second-generation shRNA

libraries covering the mouse and human genomes. Nat Genet 37:1281-1288.

215

27. Wu, X., J. K. Wakefield, H. Liu, H. Xiao, R. Kralovics, J. T. Prchal, and J. C.

Kappes. 2000. Development of a novel trans-lentiviral vector that affords

predictable safety. Mol Ther 2:47-55.

28. Xu, H., T. B. Oriss, M. Fei, A. C. Henry, B. N. Melgert, L. Chen, A. L.

Mellor, D. H. Munn, C. G. Irvin, P. Ray, and A. Ray. 2008. Indoleamine 2,3-

dioxygenase in lung dendritic cells promotes Th2 responses and allergic

inflammation. Proc Natl Acad Sci U S A 105:6690-6695.

29. Yi, R., Y. Qin, I. G. Macara, and B. R. Cullen. 2003. Exportin-5 mediates the

nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development

17:3011-3016.

216

Figure 6.1. Transduced MLE-15 cells sufficiently knock down the mRNA expression

and activity of IDO1. (A) RFP expression of parental and transduced cells (10x). (B)

Cells were stimulated with recombinant IFNγ (rIFNγ) for 24h. IDO1 expression was

determined by qRT-PCR. All samples were normalized to HPRT and compared to MLE-

15 unstimuated (US). (C) Cells were stimulated with rIFNγ for 48h. IDO activity was

determined using the kyn colorimetric assay. A one-way ANOVA was used to assign

significance (***p < 0.001); no significance (ns).

217

Figure 6.2. shRNA is gradually produced following doxycycline induction. (A) RFP

expression at indicated time points following addition of doxycycline at D-4 pre-

stimulation for each transduced cell line (10x). (B) Cells were induced with doxycycline

at indicated time prior to stimulation. At D0, cells were stimulated with recombinant

IFNγ (rIFNγ) for 48h. IDO activity was determined using the kyn colorimetric assay. A

one-way ANOVA was used to assign significance (*p < 0.05).

218

CHAPTER 7

CONCLUSIONS

Influenza virus remains a worldwide concern and a threat for pandemics.

Vaccines are available but rely primarily on production of neutralizing antibodies against

the HA protein with no consideration of the memory T cell response. Since influenza

virus is constantly undergoing antigenic drift, the current vaccine provides limited

heterologous virus protection which necessitates yearly vaccination for newly circulating

strains. T cells recognize conserved internal proteins of influenza virus rather than the

highly variable surface glycoproteins; therefore, enhancement of the T cell response

during vaccination could increase protection from heterologous virus challenge.

Indoleamine 2, 3-dioxygenase (IDO) has been associated with suppression of the immune

response, particularly the T cell response, through depletion of tryptophan (trp) and

production of kynurenine (kyn) metabolites. Modulation of IDO activity may be an

approach to enhance the T cell response to influenza virus vaccination. The experiments

in these studies examine the various roles of IDO during primary influenza virus

infection to determine the mechanisms of IDO immune modulation and the potential for

enhancing the immune response to vaccination. The central hypothesis of these studies is

that IDO activity during influenza infection results in suppressed innate and adaptive

immune responses in part through the reduction of pro-inflammatory cytokine

219

expression, a feature that negatively affects the magnitude of the T cell response. The

specific aims addressed were:

Specific aim 1. To determine the activity and role of IDO in the frequency and activation

of CD8+ and CD4+ T cells responding to acute influenza virus infection. The working

hypothesis is that inhibition of IDO during an influenza virus infection will enhance the

Th1 response and frequency of influenza virus-specific CD8+ T cells. The results in

Chapter 3 show that IDO is responsible for dampening the influenza specific CD8+ T cell

and CD4+ T cell response during influenza virus infection. In these studies, IDO activity

was blocked in vivo through oral administration of 1-methyl-D, L-tryptophan (1MT) and

mice were infected intranasally with influenza virus. IDO activity was assessed by

HPLC analysis for detection of trp and kyn. Cell populations and their activation status

were analyzed by flow cytometry. IDO activity peaked at day 10 post-infection during

an influenza virus infection. Inhibition of IDO during infection enhanced the proportion

of IL-6 and IFNγ expressing CD4+ T cells and the number of activated influenza specific

CD8+ T cells compared to control treated mice in the lung airways. Further, in the

absence of IDO activity, there was an increase in the frequency of CD8+ effector

memory cells. This study shows IDO mediated T cell modulation during an influenza

virus infection and a mechanism to enhance the T cell response.

Specific aim 2. To evaluate the induction and role of IDO expression by alveolar

epithelial cells during influenza virus infection. The working hypothesis is that IFNλ is

up-regulated during influenza virus infection inducing the expression and activity of IDO

220

in alveolar epithelial cells. The data from Chapter 4 show that IDO is induced by

influenza virus in airway epithelial cells and this induction is partially mediated by IFNλ

stimulation. In this study, mouse lung epithelial (MLE-15) cells, human bronchial

epithelial cells (Beas2B), and fully differentiated normal human bronchial epithelial

(NHBE) cells were used to examine IDO activity and its role during infection. IDO

activity was evaluated through detection of kyn in the cell culture supernatant using a kyn

colorimetric assay, and IDO1/2 gene expression was assessed through qRT-PCR.

Influenza virus infection preferentially up-regulates IDO1 over IDO2, and increases IDO

activity in a virus-dependent manner. Furthermore, kynurenine was found to be secreted

basolaterally from influenza infected NHBE cells. Following infection, IFNλ was

increased with low expression of IFNα which correlated with IDO1 expression. IDO

activity was directly induced following IFNλ stimulation in a dose-dependent manner.

Silencing IFNλ expression with siRNA or neutralizing antibodies reduced the expression

of IDO1 compared to untreated cells. Finally inhibition or silencing of IDO activity

following influenza infection resulted in reduced viral titers. This study shows a novel

role for IFNλ in the induction of IDO1 and basal secretion of kyn following influenza

virus infection.

Specific aim 3. To evaluate the effects of IDO on expression of pro-inflammatory

cytokines during influenza virus infection and determine the host cell types affected. The

working hypothesis is that IDO inhibition through 1MT treatment increases the

expression of pro-inflammatory cytokines in alveolar macrophages. The results from

Chapter 5 show that 1MT treatment enhances the pro-inflammatory cytokine response

221

prior and during influenza virus infection by macrophages. The initial screen using a

TLR PCR array to evaluate modulation of genes associated with TLR signaling pathways

showed that 1MT treatment enhanced IL-6, IL-1β, and IFNβ gene expression as well as

TNF-α, IL-1β, and TLR3 associated signaling pathways. The increase in gene expression

correlated with enhanced protein levels of IL-6, IFNβ, and TNF-α in the BAL fluid of

1MT treated mice. Further evaluation using immortalized cell lines and primary murine

alveolar macrophages revealed that 1MT modulated pro-inflammatory cytokine

expression by macrophages. This increase in the presence of 1MT occurred with or

without infection, suggesting a level of IDO independent modulation of the pro-

inflammatory response. These studies show a role of 1MT-mediated enhancement of

inflammatory cytokines particularly through macrophage stimulation.

Specific aim 4. To produce and evaluate the efficacy of a lentiviral vector expressing a

doxycycline-inducible shRNA against IDO1. The working hypothesis is that transduction

using a lentiviral vector containing a shRNA against IDO1 (shIDO1) will effectively

silence IDO1 expression and activity in vitro. The results from Chapter 6 show that a

lentiviral vector expressing a shRNA targeting IDO1 can effectively silence IDO1

expression and activity following stimulation of the cells with a potent IDO1 inducer,

IFNγ. These studies were performed using a mouse lung epithelial (MLE-15) cell line to

translate the approach to in vivo studies. mRNA expression and activity were assessed

by qRT-PCR and kyn colorimetric assay, respectively. The shIDO1 construct efficiently

silenced mRNA expression and activity following IFNγ stimulation suggesting this

construct would withstand IDO induction in vivo. Furthermore, shRNA expression was

222

induced via doxycycline treatment and was significantly expressed, based on suppression

of IDO1 activity, by 2 days following doxycycline treatment. These studies confirm

silencing and induction of the shIDO1 construct and provide a foundation for

administration of a lentiviral vector containing a shRNA in a mouse model for inducible

IDO1 silencing.

Taken together, this research shows a role for IDO in modulation of the innate

and adaptive immune response to influenza virus infection. The effect of IDO expression

most likely occurs in various locations depending on the cell type. During initial

infection, IDO activity is increased in the respiratory epithelial cells through IFN-λ

stimulation resulting in modulation of cellular viability (Fig. 7.1A). IDO activity in the

epithelial cells potentially effects the activation and cytokine expression from antigen

presenting cells. In line with epithelial cell IDO expression, IDO expression in lung

resident alveolar macrophages decreases inflammatory cytokine production, particularly

IL-6 and TNF-α, and possibly various chemokines enhancing cellular recruitment and

CD4+ T cell differentiation and expansion (Fig. 7.1B). Modulation of the T cell response

would primarily occur in the mediastinal lymph node (MLN) where IDO activity is

derived from hematopoietic cells. Increased IFN-γ production in the MLN would

increase IDO activity thus modifying the cellular expression of epitopes as well as the

cytokine milieu for influenza specific T cell activation and differentiation (Fig. 7.1C).

This model suggests that the effect of IDO may be more global in the overall immune

response following influenza infection rather than isolated to the lung tissue. These

studies provide insight into the role of IDO during influenza infection and a potential to

utilize IDO inhibition to enhance vaccine efficacy.

223

Figure 7.1. Proposed model for IDO modulation of the acute immune response to

influenza. (A) Influenza infects and replicates in respiratory epithelial cells (EC)

increasing the secretion of type III interferons (IFN-λ). IFN- λ stimulates neighboring

cells resulting in enhanced IDO1 expression. (A-C) IDO inhibition using 1MT results in

(A) decreased viral load and increased cell death in respiratory epithelial cells. (B) 1MT

treatment increases the secretion of IL-6, TNF-α, IL-1β, and IFN-β from alveolar

macrophages (AMΦ) following stimulation with influenza virus. The increased

expression of these pro-inflammatory cytokines potentially increases inflammation and

recruitment of leukocytes. (C) Increased levels of IL-6 enhance the production of Th17

cells with decreases in the Treg response. Increased secretion of TNF-α and IFN-β

224

augments the Th1 response and influenza specific CD8+ T cell (Flu-CD8) expansion

resulting in augmented IFNγ production.

IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3 …

Documents

Transcript of IMMUNOMODULATORY ROLE OF INDOLEAMINE 2, 3 …