Immunogenetic factors in aetiology of pre-eclampsia/eclampsia ...
Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show...
-
Upload
milton-norton -
Category
Documents
-
view
228 -
download
0
Transcript of Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show...
![Page 1: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/1.jpg)
Immunogenetic
![Page 2: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/2.jpg)
![Page 4: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/4.jpg)
Tonegawa’s demonstration• 1976—used restriction enzymes and DNA probes to show that
germ cell DNA contained several smaller DNA segments compared to DNA taken from developed lymphocytes (myeloma cells)
![Page 5: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/5.jpg)
![Page 6: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/6.jpg)
Bone marrow stromal cells drive Pro-B cell proliferation and maturation.
Important molecules and interactions:SCF-cKitIL-7-IL-7R
![Page 7: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/7.jpg)
Antibody Diversity• How do we acquire so many
different types of antibodies?
– Somatic recombination
– Junctional diversity
– hypermutations
![Page 8: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/8.jpg)
![Page 9: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/9.jpg)
Summary of Splices
• Light chain– V-JC joining by DNA splice (lambda)– V-J joining by DNA splice (kappa)– VJ-C intron removal (RNA splice)
• Heavy chain• D-J joining by DNA splice• V-DJ joining by DNA splice• VDJ-C intron removal by RNA splice• IgM membrane bound 3rd C domain to soluble
3rd C domain by RNA splice• Class switching by DNA splice
![Page 10: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/10.jpg)
Genes for immunoglobulin proteins are found on different chromosomes
![Page 11: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/11.jpg)
Heavy chain rearrangement
![Page 12: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/12.jpg)
Kappa light chain rearrangement
![Page 13: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/13.jpg)
Lymphocyte-specific and ubiquitous enzymes are
required• RAG-1 and RAG-2 are
lymphocyte-specific– Fibroblasts transfected with
RAG-1 + RAG-2 undergo somatic recombination of Ig genes
– RAG-KO mice have no B or T cells
– RAG is active in G0 and G1 mitotic phase and is off in the proliferative status.
– RAG digest DNA in un-precise pattern.
![Page 14: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/14.jpg)
Recombination occurs at specific sites
• Recombination signal sequences (RSS) occur adjacent to coding sequences in V, D, and J segments– Heptamer-spacer-nonamer– 12/23 rule
![Page 15: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/15.jpg)
12/23 rule for gene recombination
![Page 16: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/16.jpg)
![Page 17: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/17.jpg)
• See gene recombination animation on CD
Marker of cells that have undergone V(D)J recombination
![Page 18: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/18.jpg)
![Page 19: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/19.jpg)
Recombination signal sequences (RSS)
12-23 RULE – A gene segment flanked by a 23mer RSS can only be linked to a segment flanked by a 12mer RSS
V 7 23 9
D7129 7 12 9
J7239
HEPTAMER - Always contiguous with coding sequence
NONAMER - Separated fromthe heptamer by a 12 or 23
nucleotide spacer
V 7 23 9
D7129 7 12 9
J7239
√ √
![Page 20: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/20.jpg)
23-mer
12-mer
Loop of interveningDNA is excised
• Heptamers and nonamers
align back-to-back
• The shape generated by the
RSS’s acts as a target for
recombinases
7
9
97
V1 V2 V3 V4
V8V7
V6V5
V9 D J
V1 DJ
V2
V3
V4
V8
V7
V6
V5
V9
• An appropriate shape can not be formed if two 23-mer flanked elements
attempted to join (i.e. the 12-23 rule)
Molecular explanation of the 12-23 rule
![Page 21: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/21.jpg)
V D J712
9
723
9
7 12 97239
V D J
Imprecise and random events that occur when the DNA breaks and rejoins allows new nucleotides to be inserted or lost from the sequence at and around the coding joint.
Junctional diversity
Mini-circle of DNA is permanently lost from the genome
Signal jointCoding joint
![Page 22: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/22.jpg)
![Page 23: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/23.jpg)
![Page 24: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/24.jpg)
Linkage of C gene to VDJ at the m-RNA level.
![Page 25: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/25.jpg)
![Page 26: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/26.jpg)
Allelic Exclusion• These diversity mechanisms
often generate non-functional Ig genes: genes that contain stop codons or don't stay in the proper reading frame. The developing B cells use a mechanism called "allelic exclusion", in which each B cell makes only 1 active L chain and 1 active H chain. The cell tries each copy of the L genes and each copy of the H genes in turn:
– If an active chain is made, no further DNA splicing occurs.
– However, if a non-functional Ig is made, the cell then tries the next L or H gene.
– This process continues until an active product is made from both H and L, or until all genes have been tried (in which case the cell dies).
![Page 27: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/27.jpg)
Multiple gene segments increase Ig diversity
Combinatorial diversity:
Heavy chains40 x 25 x 6 = 6000
Light chains40 x 5 = 200 30 x 4 = 120
Total possible:320 x 6000 = 1.9x106
![Page 28: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/28.jpg)
Junctional diversity•Nucleotide deletion can also occur
•Occurs in HV3 (CDR3) region
•What problem could these events cause??
![Page 29: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/29.jpg)
N nucleotide addition at joining segments: the addition of random bases
![Page 30: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/30.jpg)
Randomness in joining process helps generate diversity by creating hypervariable of antigen binding site
![Page 31: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/31.jpg)
V TCAG U D JAT
TA
U Endonuclease cleaves single strand at random sites in V and D segment
V TC~GAAG D JAT
TA~TAThe nucleotides that flip out, become part of the complementary DNA strand
Generation of the palindromic sequence
In terms of G to C and T to A pairing, the ‘new’ nucleotides are palindromic.The nucleotides GA and TA were not in the genomic sequence and introduce diversity of sequence at the V to D join.
V TCAG U D JAT
TA
U
Regions to be joined are juxtaposed
The nicked strand ‘flips’ out
![Page 32: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/32.jpg)
Junctional Diversity – N nucleotide additions
V TC~GAAG D JAT
TA~TA
Terminal deoxynucleotidyl transferase (TdT) adds nucleotides randomly to the P nucleotide ends of the single-stranded V and D segment DNA
CACTCCTTA
TTCTTGCAA
V TC~GAAG D JAT
TA~TA
CACACCTTA
TTCTTGCAA Complementary bases anneal
V D JDNA polymerases fill in the gaps with complementary nucleotides and DNA ligase IV joins the strands
TC~GAAG
ATTA~TA
CACACCTTA
TTCTTGCAA
D JTA~TAExonucleases nibble back free endsV TC~GACACACCTTA
TTCTTGCAA
V TCDTA
GTT AT AT
AG C
![Page 33: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/33.jpg)
Imprecise joining generates diversity
![Page 34: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/34.jpg)
V D JTCGACGTTATATAGCTGCAATATA
Junctional Diversity
TTTTTTTTTTTTTTT
Germline-encoded nucleotides
Palindromic (P) nucleotides - not in the germline
Non-template (N) encoded nucleotides - not in the germline
Creates an essentially random sequence between the V region, D region and J region in beta chains and the V region and J region in alpha chains.
![Page 35: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/35.jpg)
Additional Diversity Mechanisms• In addition to the DNA splicing,
other variants in the antibody molecules are generated by two mechanisms:
• First, the DNA splices do not occur at a precise point: they can vary by several bases, which can lead to the addition or deletion of 1 or 2 amino acids at each splice point. – These variations can lead to
different specificities of the antibodies.
– The enzymes that do the DNA splicing (RAG1 and RAG2) produce double stranded breaks in the DNA, which is repaired imprecisely.
![Page 36: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/36.jpg)
P and N region nucleotide alteration adds to diversity of V region
• During recombination some nucleotide bases are cut from or add to the coding regions (p nucleotides)
• Up to 15 or so randomly inserted nucleotide bases are added at the cut sites of the V, D and J regions (n nucleotides).
• TdT (terminal deoxynucleotidyl transferase) a unique enzyme found only in lymphocytes (20 N added)
• Since these bases are random, the amino acid sequence generated by these bases will also be random
![Page 37: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/37.jpg)
![Page 38: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/38.jpg)
B lymphocyte development
![Page 39: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/39.jpg)
IgM and IgD are coexpressed in mature
naïve B cells
![Page 40: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/40.jpg)
Alternative RNA processing generates transmembrane or
secreted Ig
![Page 41: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/41.jpg)
Synthesis, assembly and secretion of
immunoglobulins
![Page 42: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/42.jpg)
Combination of heavy and light chains adds final diversity of variable region
• 8262 possible heavy chain combinations
• 320 light chain combinations
• Over 2 million combinations
• P and N nucleotide additions and subtractions multiply this by 104
• Possible combinations over 1010
![Page 43: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/43.jpg)
IL-7 has critical role in the proliferative activity of B and T lymphocytes precursor.
![Page 44: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/44.jpg)
![Page 45: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/45.jpg)
Somatic hypermutation adds even more variability
• B cell multiplication introduces additional opportunities for alterations to rearranged VJ or VDJ segments
• These regions are extremely susceptible to mutation compared to “regular” DNA, about one base in 600 is altered per two generations of dividing (expanding) lymphocyte population
![Page 46: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/46.jpg)
Further Ig diversity arises through affinity maturation
![Page 47: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/47.jpg)
Affinity maturation is due to somatic hypermutation
SilentNeutralDeleteriousPositive
![Page 48: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/48.jpg)
Somatic Hypermutation• Second, there is a “somatic
hypermutation” mechanism by which random base change mutations occur in the V regions in B cells.
– This mechanism doesn't work in other cells and doesn't affect other genes: only a region of about 1.5 kb is affected.
– It only occurs as the B cell is maturing: after it has been stimulated to divide by an antigen, somatic hypermutation occurs to modify the antigen binding region.
– Those cells that bind the antigen most tightly survive and divide more than the others. This process is called “affinity maturation”.
– It is triggered by the enzyme “activation-induced cytidine deaminase” (AID), which deaminates cytidine to uracil. This base mismatch can be incorrectly repaired by several different mechanisms to generate mutations.
![Page 49: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/49.jpg)
Isotype switching
• Irreversible
• Only occurs after a given B cell has encountered antigen
• Mechanism not fully understood– Requires AID– Requires DNA repair enzymes– Requires external signals (helper T cells)
![Page 50: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/50.jpg)
Isotype switching occurs in activated B cells
![Page 51: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/51.jpg)
Class Switching• Heavy chains fall into 5 classes,
based on their C regions. • Each H gene has C regions for
all 5 classes arranged on the chromosome, with the IgM C region nearest to the V regions.
• There are several different C regions for some of the classes.
• IgM is the initial Ab made by each B cell.
• However, after a while the B cell switches to a different class.
• This is done using a third DNA splice, in which the DNA between the VDJ and the constant region for the new class is spliced out.
![Page 52: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/52.jpg)
![Page 53: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/53.jpg)
Class switching among constant regions: generation of IgG, IgA and IgE with same antigenic determinants—idiotypes
![Page 54: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/54.jpg)
7 means of generating antibody diversity
![Page 55: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/55.jpg)
![Page 56: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/56.jpg)
Location of variability occurs within CDR regions of V domains (antigen binding sites)
![Page 57: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/57.jpg)
Mature B cells undergo Positive and negative selection in the bone marrow and then migrate to the peripheral blood. Negative selection carried out with membrane bound self antigen for immature expressing IgM+ B cells and resulted in apoptosis. In some cases receptor editing (mainly for k gene) resulted in changes in the specificity of B cells.
![Page 58: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/58.jpg)
Stages in B-cell maturation in the bone marrow
![Page 59: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/59.jpg)
From Pro- to Pre-B cell transition events
![Page 60: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/60.jpg)
B cell development
![Page 61: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/61.jpg)
T cell development
![Page 62: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/62.jpg)
T Cells These are some of the General characteristics of the TCell receptor for antigen recognition.
![Page 63: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/63.jpg)
The Thymus: What is it?
2-lobed organ, divided into lobules, in thechest, just above the heart
Approximately 2-3 hundred millionthymocytes (in the mouse)
Consists of stromal components andthymocytes at various stages of maturation
![Page 64: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/64.jpg)
T cell development occurs in the thymus
Lack of thymus in mice and human resulted to nude mice and digeorge syndrome in human.
![Page 65: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/65.jpg)
![Page 66: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/66.jpg)
66
Progression through development correlates with rearrangement
![Page 67: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/67.jpg)
67
TCR locus has two D-J clustersAllows a 2nd rearrangement if 1st is nonproductive
![Page 68: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/68.jpg)
Diversity in the TCR gene locus
![Page 69: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/69.jpg)
69
Pre-T cell receptor
How do you test for successful TCRbeta chain rearrangements if you have not rearranged TCRalpha?
Pre-Talpha
![Page 70: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/70.jpg)
The TCR and BCR gene is most variable in the CDR3 region
CDR3
![Page 71: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/71.jpg)
Allelic exclusion occurred in B-TCR but not in a-TCR, So 30% of Ln T has TWO types TCR and co-expressed both allele of a-TCR.
![Page 72: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/72.jpg)
72
![Page 73: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/73.jpg)
73
Thymocytes at different developmental stages are found in distinct parts of the thymus
Maturation
![Page 74: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/74.jpg)
Development of T cells in a mouse.
RAG rearrangement
![Page 75: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/75.jpg)
![Page 76: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/76.jpg)
Tolerance to self antigens encountered in the thymus is achieved by eliminating T cells that are reactive to these antigens.
![Page 77: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/77.jpg)
![Page 78: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/78.jpg)
Major Thymocyte Subsets: (cont.)
CD4-CD8- (Double Negative, DN) cells: 3-5% of total thymocytes Contain least mature cells, considerable cell division 2/3rds are triple negative (TN) based on TCR expression Can be further divided based on CD44 and CD25 (discussed later) TCR and rearrangements occur at this stage 1/3rd are TCR +
CD4+CD8+ (Double Positive, DP) cells: 80-85% of total thymocytes TCR rearrangement occurs at this stageMost have rearranged TCR genes and express low levels (1/10th mature level) of TCR Small subset has high levels of TCR (most mature, positively selected cells) Small subset is actively dividing (earliest DPs) Most apoptosis occurs here, very sensitive to apoptosis inducing agents, especially sensitive to glucocorticoids
CD4+CD8- and CD4-CD8+ (Single positive, SP) cells: 10-15% of total thymocytes Most are mature cells with high levels of CD3 and TCR CD4:CD8 approx 2:1 ratio Most SP cells are functionally mature and are destined to leave the thymus Small subset of SP are immature (ISP) (CD8 in mouse, CD4 in human) and have low CD3 and no TCR - transitional cells that are on the way from DN -> DP
![Page 79: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/79.jpg)
How do DP Cells Become SP?
• Instructive Model– Fitting
• Stochastic Model– Random
![Page 80: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/80.jpg)
![Page 81: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/81.jpg)
Mechanism of Selection
• Avidity– Differences in signal strength is dictated by
TcR:MHC avidity– “Quantitative” Model
• Differential Signaling– Selection outcomes are dictated by different
signals– Qualitative
![Page 82: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/82.jpg)
82
TCR locus has 50 J segments
![Page 83: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/83.jpg)
T Cell Receptors• The TCR protein has 2 subunits
and one antigen binding site.• The alpha subunit has V and J
segments (similar to Ig light chains)
• The beta subunit has V, D and J regions, like the Ig heavy chain.
• Both segments undergo DNA splicing rearrangements like the Ig genes. The joining is not precise and short additions or deletions of bases can occur, as in the Ig genes. However, affinity maturation and somatic hypermutation do not occur.
• The TCR protein is membrane bound. It is only found on T cells.
![Page 84: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/84.jpg)
![Page 85: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/85.jpg)
Sequentially making and expressinga pre-TCR and TCR
![Page 86: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/86.jpg)
Abbas & Lichtman. Cellular and Molecular Immunology, 5th ed. W. B. Saunders 2003
![Page 87: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/87.jpg)
Summary of Thymic Development
![Page 88: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/88.jpg)
Lineage Commitment Models
DeFranco, Locksley, & Robertson, Immunity, NSP, 2007)
![Page 89: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/89.jpg)
Newer Lineage Commitment Models
DeFranco, Locksley, & Robertson, Immunity, NSP, 2007)
![Page 90: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/90.jpg)
Positive Selection
• Results in MHC restriction
• Mechanism:– Immature thymocytes cluster with MHC
molecules on the cortical cells of the thymus• If TCR interacts with MHC protective signal
results that prevents apoptosis.• If TCR does not interact with MHC no protective
signal and apoptosis occurs.
• Result? Only reactive thymocytes survive.
![Page 91: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/91.jpg)
Negative Selection
• Ensures self-tolerance• Weeds out High affinity thymocytes• Mechanism:
– APC’s bearing MHC’s interact with thymocytes• If avidity is too strong thymocyte undergoes
apoptosis.• Details unknown…
• Result? Only self-tolerant thymocytes survive.
![Page 92: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/92.jpg)
Generation of diversity in the TcR
COMBINATORIAL DIVERSITYMultiple germline segments
In the human TcR
Variable (V) segments: ~70, 52Diversity (D) segments: 0, 2Joining (J) segments: 61, 13The need to pair and chains to form a binding sitedoubles the potential for diversity
JUNCTIONAL DIVERSITYAddition of non-template encoded (N) and palindromic (P) nucleotides atimprecise joints made between V-D-J elements
SOMATIC MUTATION IS NOT USED TO GENERATE DIVERSITY IN TcR
![Page 93: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/93.jpg)
ElementImmunoglobulin TcR
Variable segments
Diversity segments
D segments inall 3 frames
Joining segments
Joints with N & Pnucleotides
No. of V gene pairs
Junctional diversity
Total diversity
H
40
27
Yes
6
22360 3640
~1013 ~1013
~1016** ~1016
59
0
-
9
(1)*
52 ~70
2 0
Yes -
13 61
2 1
* Only half of human chains have N & P regions**No of distinct receptors increased further by somatic hypermutation
Estimate of the number of human TcR and IgExcluding somatic hypermutation
![Page 94: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/94.jpg)
Summary: Ig vs TCR
![Page 95: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/95.jpg)
Summary: mechanisms that generate diversity in lymphocyte
receptors
![Page 96: Immunogenetic. Tonegawa’s demonstration 1976—used restriction enzymes and DNA probes to show that germ cell DNA contained several smaller DNA segments.](https://reader033.fdocuments.net/reader033/viewer/2022050819/56649f165503460f94c2b880/html5/thumbnails/96.jpg)
Thanks